VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015

6

TAGS:

Transcript of VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015

Page 1: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015
Page 2: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015
Page 3: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015
Page 4: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015
Page 5: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015
Page 6: VVTA BOARD OF DIRECTORS: Meeting Agenda Supplemental Item – May 18, 2015

VVTA BOARD OF DIRECTORS: Meeting Agenda Item Correction – May 18, 2015

VVTA BOARD OF DIRECTORS: Meeting Agenda Item Correction – May 18, 2015

Supplemental Guide for Psychiatry Supplemental Guide ...

Supplemental Guide for Psychiatry Supplemental Guide ...

VVTA Board Of Directors Meeting Agenda - May 19, 2014

VVTA Board Of Directors Meeting Agenda - May 19, 2014

SUPPLEMENTAL MATERIAL Supplemental Table 1: …circ.ahajournals.org/.../CIR201937-Supplemental_Material.pdf · SUPPLEMENTAL MATERIAL Supplemental Table 1: Genetic Polymorphisms Evaluated

SUPPLEMENTAL MATERIAL Supplemental Table 1: …circ.ahajournals.org/.../CIR201937-Supplemental_Material.pdf · SUPPLEMENTAL MATERIAL Supplemental Table 1: Genetic Polymorphisms Evaluated

VVTA Board Of Directors Meeting Agenda - October 20, 2014

VVTA Board Of Directors Meeting Agenda - October 20, 2014

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig.

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig.

VVTA RFP 2015-06: ADA Complementary Paratransit Eligibility Certification Services

VVTA RFP 2015-06: ADA Complementary Paratransit Eligibility Certification Services

Supplemental Figures Supplemental Figure 1€¦ · Supplemental Figures . Supplemental Figure 1 . Supplemental Figure 1. AdipoChaser mouse models used for cold and thermoneutral exposures.

Supplemental Figures Supplemental Figure 1€¦ · Supplemental Figures . Supplemental Figure 1 . Supplemental Figure 1. AdipoChaser mouse models used for cold and thermoneutral exposures.

VVTA: RFP 2015-03: CNG Fuel Cylinder Replacement

VVTA: RFP 2015-03: CNG Fuel Cylinder Replacement

VVTA Board Of Directors Meeting Agenda - November 17, 2014

VVTA Board Of Directors Meeting Agenda - November 17, 2014

BOARD OF DIRECTORS MARCH 4, 2020 SUPPLEMENTAL …omnitrans.org/wp-content/uploads/2020/02/Contract-Supplemental-Information...Mar 04, 2020  · Produce daily, weekly and monthly ridership

BOARD OF DIRECTORS MARCH 4, 2020 SUPPLEMENTAL …omnitrans.org/wp-content/uploads/2020/02/Contract-Supplemental-Information...Mar 04, 2020  · Produce daily, weekly and monthly ridership

FINANCIAL STATEMENTS WITH SUPPLEMENTAL INFORMATION …€¦ · Board of Directors Association of Graduates of the United States Air Force Academy USAF Academy, Colorado INDEPENDENT

FINANCIAL STATEMENTS WITH SUPPLEMENTAL INFORMATION …€¦ · Board of Directors Association of Graduates of the United States Air Force Academy USAF Academy, Colorado INDEPENDENT

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

Neuropathology Supplemental Guide Supplemental Guide ... · Neuropathology Supplemental Guide . 1 . Supplemental Guide: Neuropathology ... Modifies personal snap freezing technique

Neuropathology Supplemental Guide Supplemental Guide ... · Neuropathology Supplemental Guide . 1 . Supplemental Guide: Neuropathology ... Modifies personal snap freezing technique

SUPPLEMENTARY MATERIAL Supplemental Table S1. · PDF fileSUPPLEMENTARY MATERIAL Supplemental Table S1. Supplemental Table S2. Supplemental Table S3. Supplemental Table S4. References.

SUPPLEMENTARY MATERIAL Supplemental Table S1. · PDF fileSUPPLEMENTARY MATERIAL Supplemental Table S1. Supplemental Table S2. Supplemental Table S3. Supplemental Table S4. References.

Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

VVTA Board Of Directors Meeting Agenda - September 15, 2014

VVTA Board Of Directors Meeting Agenda - September 15, 2014

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B.