Induction of Recombinant Proteins in Wheat Seed and Vegetative Tissues 

Von der Fakultät für Mathematik, Informatik und Naturwissenschaften

der RWTH Aachen University zur Erlangung des akademischen

Grades eines Doktors der Naturwissenschaften

genehmigte Dissertation

 

vorgelegt von

 

Mag. Phil. in Biotechnologie und Genetechnik

Imran Khan

aus Peshawar, Pakistan

Berichter: Universitätsprofessor Dr. rer. nat. Rainer Fischer

Universitätsprofessor Dr. rer. nat. Eva Stoger

Tag der mündlichen Prüfung: 20.02.2013

 

Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar

Dedication

I feel it a great honour to dedicate my PhD thesis to my

beloved parents for their significant contribution in

achieving this goal of academic excellence.

Acknowledgements

I am, first of all, extremely thankful to Almighty Allah whose blessing have always

followed me regardless of the fact weather I deserved or not. It always seems to me a

miracle of very convoluted nature to see ordinary people like me, doing unordinary things.

I express my deepest gratitude for whatever I have been bestowed with by the gracious.

I am in grateful to Prof. Dr. Rainer Fischer for supervising my PhD and to provide me

every possible help and opportunity to work at Institute of Molecular Biotechnology,

RWTH Aachen. I am thankful to him for giving me opportunity to join his group and

commence research in the area that captured my interest and imagination at first glance.

I‟m greatly honoured to pay my deep gratitude to Prof. Dr. Eva Stöger under whose

stimulating guidance, valuable suggestions, sympathetic attitude and encouragements this

research work was carried out. Eva is someone you will instantly love and never forget

once you meet her. Although I was supposed to stay at RWTH Aachen for the entire

duration of my PhD but when Eva moved to Vienna, I couldn‟t resist the temptation to

move there as well despite all the troubles of moving from one country to another. I wish

that I could be as lively, kind, enthusiastic, and energetic as Eva.

I am indebted to Dr. Elsa Arcalis for her discussions, support, editorial judgement and

insightful contribution to lend finesse to every aspect of my draft. Dear Elsa, thank you so

much, with your constant care and motivation, I was able to finish this PhD which

otherwise would have taken I don‟t know how many years. When I was writing my thesis,

your input was of the greatest value and I am so thankful to you for helping out in the labs

and experiments. Fewer people have I seen having a friendlier nature than you have got.

God bless you with a very happy life ahead.

How can I forget to mention Dr. Thomas Rademacher and Markus Sack for being the

person who fed me with the knowledge and skills required to do the experimental and

empirical work in the labs in Aachen. Sincerest gratitude to for their dynamic and

purposeful support, literally skill, distinguished and enthusiastic guidance in a very

friendly environment provided me a confidence to pursuit this valuable research work.

It wouldn‟t be fair to miss out on appreciating certain other people‟s help. Uli and Verena

provided not only help but an amazing company during the time I was working in Vienna.

Certain colleagues became some of my deepest friends. I convey my heartiest and

sincerest acknowledgements to Helene, Stanislov, Jenny, Tuba, Sneha, Hue, Gabi, Julian,

Valerie, Ester and Anna were the people whose presence around me was so monumental

both for my research as well as my social life. I can‟t forget the amazing time we had. Life

was so colourful because of your presence. You guys are the coolest friend one can ever

find! Thanks for bearing with me when I called you „Hell‟ dear Helene and “everybody‟s

LOVE” dear Stanislov.

Donatella, David, Kristina, Eva, Kasia are the ever best friends at Vienna Institute for

Biotechnology. Thank you so much for providing me an amazing social circle to enjoy my

free time. I never loved going to the kitchen for cooking but it was your company that

made me staying longer there and eventually a good cook too.

During my stay at Aachen, Germany, some of my compatriots in Aachen were a great

company. Noor, Aamer, Wasif, Mubasher, Usman, Falak, Adnan, Abid, Arham and

Rizwan all of you were amazing. I never thought I would meet the coolest countrymen in

a foreign country. Thank you all for being such a great family.

Some friends from Bremen, Geremany were great whenever I visited them. Abu Nasar,

Asim, Sadiq, Wakeel, Nawab, Noor Shad and Amna. I will miss the great time we spent

together.

Some people in Vienna, Austria that I wouldn‟t miss out on mentioning here are Fakh-e-

alam, Saeed gul, Imran, Hafeez, Waqas, Rehan, Hammad, Tahir, GM, Usman, Hameed,

Shaghif, Elazibath, Ana, Eva and Gosia. What a memorable time we spent together. Thank

you all for your love and time.

Finally but immensely, I owe major debts to “The backbone of my life” my loving parents

and caring brothers and sisters, whose immeasurable support and eminent understanding

has helped me through thick and thin. With their inexplicable contributions only, I have

reached this stage. My father, who had this dream that his son becomes a PhD doctor, will

be so proud seeing this effort. It was indeed his love and the hard work he always did in

his life so to give us a better living and a future that I have today. My mother, whose love

is unmatchable and whose heart beats but with mine always. Thank you so much to m

brothers, who never let me do the chores so that I could focus on my studies, and to my

sisters who are the most loving and adorable sisters in the world.

Finally, I wish to thank Higher Education Commission (HEC), Islamabad Pakistan for

their financial support and Germany Academic Exchange Service (DAAD) Germany for

organizational help in the entire duration of doctoral studies. Thanks to Institute for

Molecular Biotechnology, RWTH Aachen, Germany and Vienna Institute for

Biotechnology (VIBT), BOKU Vienna, Austria for hosting me.

Imran Khan

29th

October, 2012

Aachen, Germany

i

Contents

Dedication ............................................................................................................ ii

List of Figures ................................................................................................... iv

List of Tables ........................................................................................................ v

Abstract .............................................................................................................. vi

I. Introduction .............................................................................................. 1

I.1. Molecular farming .................................................................................................. 1

I.2. The seed .................................................................................................................. 2

I.2.1. Seed storage proteins ......................................................................................... 3

I.3. Seed as bioreactor ................................................................................................... 4

I.3.1. Wheat ................................................................................................................. 5

I.4. Subcellular protein targeting................................................................................... 5

I.4.1. Endoplasmic reticulum ...................................................................................... 6

I.4.2. Protein bodies and protein storage vacuoles ...................................................... 8

I.4.3. Oil bodies ........................................................................................................... 8

I.4.4. Starch binding domains...................................................................................... 9

I.5. Seed storage protein trafficking ............................................................................ 10

I.6. Fluorescent protein markers ................................................................................. 14

I.6.1. Discosoma red fluorescent protein................................................................... 15

I.7. Encapsulation of recombinant proteins ................................................................ 16

I.7.1. Zein .................................................................................................................. 17

I.7.2. Elastin-like polypeptide ................................................................................... 18

I.7.3. Hydrophobins ................................................................................................... 20

Objectives of the study............................................................................22

II. Materials and methods ........................................................................... 24

II.1. Materials ............................................................................................................... 24

II.1.1. Chemicals and consumables ............................................................................ 24

II.1.2. Buffers, media and solutions............................................................................ 24

II.1.3. Plants ................................................................................................................ 28

II.1.4. Vectors ............................................................................................................. 28

ii

II.1.5. Resin and membranes ...................................................................................... 28

II.1.6. Equipment ........................................................................................................ 28

II.2. Methods ................................................................................................................ 29

II.2.1. Transformation, selection and characterisation of recombinant bacteria ........ 29

II.2.2. Preparation of competent E. coli cells for heat-shock transformation ............. 29

II.2.3. Transformation of E. coli by heat-shock .......................................................... 30

II.2.4. Preparation of competent E. coli cells for electroporation .............................. 30

II.2.5. Transformation of E. coli by electroporation ................................................... 30

II.3. Recombinant DNA techniques ............................................................................. 31

II.3.1. Isolation of plasmid DNA ................................................................................ 31

II.3.2. Restriction enzyme digestion ........................................................................... 31

II.3.3. Agarose gel electrophoresis ............................................................................. 31

II.3.4. Ligation of DNA .............................................................................................. 32

II.3.5. DNA isolation .................................................................................................. 32

II.3.6. Polymerase chain reaction ............................................................................... 33

II.3.7. Purification of DNA from agarose gel ............................................................. 33

II.3.8. Determination of the DNA concentration ........................................................ 34

II.3.9. DNA sequencing .............................................................................................. 34

II.4. Wheat transformation ........................................................................................... 34

II.4.1. Isolation and pre-culture of immature embryo ................................................ 35

II.4.2. Preparation of DNA coated gold particles ....................................................... 35

II.4.3. Micro-projectile bombardment ........................................................................ 36

II.4.4. Tissue culture and selection of transformants .................................................. 36

II.4.5. Selection and propagation of transgenics ........................................................ 40

II.5. Protein analysis ..................................................................................................... 40

II.5.1. Isolation of total soluble proteins from wheat tissues ...................................... 40

II.5.2. SDS-polyacrylamide gel electrophoresis of proteins ....................................... 41

II.5.3. Coomassie brilliant blue staining ..................................................................... 41

II.5.4. Western blot ..................................................................................................... 41

II.6. Immunolocalization studies .................................................................................. 42

II.6.1. Fixation and embedding ................................................................................... 42

II.6.2. Fixation for immunocytochemistry.................................................................. 42

II.6.3. Fixation for ultra-structure ............................................................................... 42

iii

II.6.4. Light and electron microscopy ......................................................................... 44

II.6.5. Immunofluorescent labeling ............................................................................ 44

II.6.6. Fluorescence microscopy ................................................................................. 45

II.6.7. Confocal microscopy ....................................................................................... 45

III. Results ..................................................................................................... 46

III.1. Fusion protein expression construct ..................................................................... 46

III.2. Transformation of wheat plants ............................................................................ 48

III.3. Selection of wheat plants using PPT .................................................................... 51

III.4. Molecular verification of transgenic wheat lines.................................................. 54

III.5. DsRed as a marker for selection and protein trafficking ...................................... 55

III.6. Model fusion protein in wheat tissues .................................................................. 61

III.6.1. Presence and stability of the recombinant protein ........................................... 61

III.6.2. Model fusion protein expression and accumulation in transgenic wheat

leaves................................................................................................................ 63

III.6.3. DsRed mobility in wheat leaf tissues ............................................................... 65

III.6.4. Model fusion protein expression and accumulation in transgenic wheat

endosperm ........................................................................................................ 65

III.6.5. Model fusion protein expression and accumulation in transgenic wheat

embryo ............................................................................................................. 68

IV. Discussion .................................................................................................. 71

V. Conclusion ................................................................................................. 84

VI. References ................................................................................................. 85

Appendix ....................................................................................................... 107

Curriculum Vitae ........................................................................................... 111

iv

List of Figures

Figure I.1 Illustration of the seed anatomy of three plant models. 2

Figure I.2 ER-targeted Green fluorescent protein (GFP). 7

Figure I.3 Wheat A-type and B-type granule structure. 10

Figure I.4 Conceptual diagram of the ontogeny of PBs and PSVs . 13

Figure I.5 Deposition of wheat protein bodies. 13

Figure I.6 Protein bodies deposition in maize and rice. 14

Figure I.7 Red Fluorescent protein as selection marker. 15

Figure I.8 Using storage organelles for the accumulation and encapsulation of recombinant

proteins 17

Figure I.9 Localization of storage proteins in maize endosperm. 18

Figure I.10 Fluorescence microscopic image of Tobacco leaf. 19

Figure I.11 ER-targeted GFP Hydrophobin fusion (GFP-HFBI) promotes the formation of

PBs in Nicotiana benthamiana. 20

Figure III.1 Vector map of pTRAbux-DsRed.zen-H (DsRedzenH). 47

Figure III.2 Structure of the pTRAbux-DsRed-zenH (DsRedzenH) expression vector. 48

Figure III.3 Wheat plant transformation procedure. 49

Figure III.4 Bio-Rad PDS1000/He particle bombardment apparatus. 50

Figure III.5 Wheat tissue culture: from immature embryos to shoot development.. 50

Figure III.6 Wheats plant after PPT application. 52

Figure III.7 Segregation of transgenic wheat lines. 53

Figure III.8 Confirmation of transgene integration by PCR. 54

Figure III.9 Protein pellets extracted from wheat leaves under green light. 56

Figure III.10 DsRed expression during transgenic callus development. 57

Figure III.11. DsRed as a visual selection marker in transgenic wheat lines. 58

Figure III.12 Expression of induced protein bodies in wheat endosperm cells. 59

v

List of Tables

Table I.1 Fusion sequences for the creation of artificial storage organelles. 17

Table I.2 Examples of recombinant proteins produced in cereal seeds 21

Table II.1 Sequence of primers used for DsRed detection. 33

Table II.2 Media ingredients used for wheat tissue culture. 38

Table II.3 List of ingredients and suppliers. 39

Table II.4 MS vitamin ingredients. 39

Table II.5 Series of acetone dehydration for ultra structure fixation. 43

Table II.6 Mixture of resin/ethanol used for ultra structure fixation of the tissues. 43

vi

Abstract

Cereals offer advantages for molecular farming because seeds have naturally evolved for

protein storage. In seeds, the recombinant proteins can be targeted to storage organelles,

such as Protein Bodies (PBs) derived from the endoplasmic reticulum (ER) and Protein

Storage Vacuoles (PSVs) for stable accumulation and storage. γ-Zein, the maize prolamin

storage protein, and partial sequences thereof can be fused to proteins of interest to induce

the formation of novel PB-like organelles not only in its native environment (maize

endosperm) but also in other plant cells and in eukaryotic cells generally. We report the

constitutive expression of recombinant fusion protein i.e. repeated and Pro-X domain of γ-

Zein and red fluorescent protein (DsRed) in transgenic wheat plants. The red fluorescent

protein (DsRed) was used as tool for tracking subcellular localization of recombinant

proteins and also as fluorescent selection marker to monitor transgene expression during

wheat transformation. In the present study we explored endogenous and ectopically

induced protein storage organelles as preferred intracellular destination for recombinant

protein in wheat different tissues i.e. leaf, endosperm and embryo. Our finding has

confirmed that the model fusion protein has induced the formation of an additional

population of protein bodies containing the recombinant protein in seed and vegetative

tissues. To better understand the trafficking of recombinant proteins in ectopic tissues, the

subcellular localization of recombinant proteins in seed and green tissues were examined.

We confirmed the feasibility of using γ-Zein for targeting recombinant protein into

artificial protein bodies those were preferably retained in the protein storage vacuoles

(PSV) in seed tissues. In vegetative tissues, the induced protein bodies were found highly

mobile organelles, exhibiting different pattern of movement with no specific direction.

The presence of the model fusion protein was validated in all three transgenic wheat plant

tissues tested. Also, no degradation products were detected in transgenic wheat seeds after

five months storage. The expression of recombinant fusion proteins had no harmful effect

on the viability and development of transgenic wheat plants.

1

I. INTRODUCTION

I.1. Molecular farming

The concept of molecular farming describes the production of valuable recombinant

proteins at agricultural scale in transgenic plants (Schillberg et al., 2003). In the last two

decades, humans have started exploring different production systems by using plants for

the production of many recombinant proteins. Plants provide an alternative expression

system to microbes or mammalian cells grown in fermentors, which have limited capacity,

higher production costs and in case of bacteria, lack post translational modifications.

Molecular farming has an edge over other production systems for recombinant proteins in

terms of eukaryotic post translational modifications, low risk of human and animal

pathogen contaminations, microbial toxins or oncogenic sequences, relatively high protein

yield and scalability. In 1990‟s, the widely acknowledge advantages of plant based

molecular farming were not sufficient to displace the conventional fermentor based

plantforms. The early technical limitations in terms of low yield, low recovery during

processing and lack of regulatory framework for plant based pharmaceuticals (Ma et al.,

2003) were the major hurdles. The recent development by several research groups and

industry-led consortia has eliminated these obstacles by different approaches for higher

accumulation and efficient downstream processes. Good manufacturing practices (GMP)

are now available for plant based system and the first products are entering clinical trials

(Fischer et al., 2012).

Different plant species and tissues have now been used as production system for a variety

of recombinant proteins including cereals, legumes, leafy crops, oilseeds, higher plant

tissue and cell culture, fruits, vegetables, algae, moss and higher aquatic plants (Stoger et

al., 2005). All of these production hosts have their own merits and demerits for protein

production in terms of time required, cost of end product, safety, scalability, ease of

transformation, downstream processing, protein folding and transportation.

2

I.2. The seed

Seeds are the dispersal and propagation units that allow plants to spread out and grow in

new territories, and help plants to survive under unfavourable conditions in a dormant

stage. A seed is a small embryogenic plant emerged from an ovule after fertilization and it

is composed of three main parts: a seed coat, an endosperm and an embryo with one or

two cotyledons (Fig. I.1D). Structural division of plant seed include: monocotyledonous

seeds (cereals), endospermic dicotyledonous seeds (tobacco) and non-endospermic

dicotyledonous seeds (beans). In seed, the embryo is surrounded by endosperm cells

which supply nutrient to embryonic tissues. The entire seed tissues are provided by seed

coat that acts as a mechanical barrier to protect the seed and to remain dormant for a

longer time (Khan et al., 2012).

The endosperm is well recognized for its importance as food and feed. Cereal seed

endosperm contains 70% starch in terms of dry weight. Starch is made of glucan

polymers, amylose and amylopectin, that are packed into semi-crystalline granules in

amyloplasts (James et al., 2003). Cereals are the main protein provider in certain regions

where rice or maize is the main staple food (Shewry, 2002). In cereals, endosperm

provides major space for for storage proteins, which are responsible for the visco-elastic

properties of the dough. Hence in the case of wheat the seed protein content is a major

quality determinant for bread, pasta and other backed goods.

Figure I.1 Illustration of the seed anatomy of three plant models. A. Cross section of Nicotiana

tabacum.sc. seed coat, cot. cotyledon, en. endosperm (Tomlinson et al. 2004). B. Light microscopy with

toluidine blue of Medicago truncatula mature seed (non-endospermic dicotyledonous) rad. Radical, mes.

Mesophyll, col. cotyledon, en. endosperm (Figure from Prof. Eva Stoger Lab at Vienna, Austria) C. Cross

section of wheat seed (monocotyledonous) sc. Seed coat, en. endosperm, cot. cotyledon (Figure from Prof.

Eva Stoger Lab at Vienna, Austria) D. Longitudinal section of wheat grain (Figure adapted from Wikipedia;

Wugo).

3

I.2.1. Seed storage proteins

Seeds are rich reservoirs of storage proteins (seed storage proteins, SSPs), which

constitute up to 90% of the total protein fraction in developing seeds and are crucial for

germinating seedlings providing them with carbon, nitrogen and sulphur (Kumamaru et

al., 2007). The total mass of seed proteins varies from 10-15% of grain dry weight in

cereals to up to 45% (dry weight) in legumes.

Seed proteins are classified into three types i.e. storage protiens, structural and metabolic

proteins and protective proteins. SSPs occur in three different tissues of the grain (embryo,

aleurone layer and endosperm) and can be divided into different classes (Galili 2004). A

range of criteria have been used to define and classify seed proteins. T. B. Osborne

(Shewry 2002) developed a classification based on solubility of plant proteins known as

“Osborne fractionation” which is still used today, especially by cereal scientists. Thus,

four groups are defined: water soluble albumins (found mainly in dicots), salt soluble

globulins (found both in dicots and monocots), alcohol soluble prolamins (found

exclusively in cereals) and glutelins (soluble in dilute acids, found also in cereals). Cereal

seed proteins can also be classified on the basis of their metabolic properties, deposition

sites and allergenic properties, but the latter is not so often in use (Breiteneder et al. 2005).

I.2.1.1. Prolamins

Prolamins are the major endosperm storage proteins in cereals with the exception of oats

and rice. They were originally classified as soluble in alcohol/water mixtures but some

occur in alcohol-insoluble polymers. All individual prolamins are soluble in alcohol in the

reduced state. However, variations in their structure are the clue of distinct evolutionary

origins of the Triticeae (wheat, barley and rye) and the Panicoideae (maize, sorghum,

millets). The prolamin superfamily has been reorganised in subgroups according to

structural and evolutionary relationships. On the broad spectrum, sequence similarities can

be found among different cereal prolamins. Based on sequence repetition, the S-rich and

S-poor groups are relatively similar as they both contain proline and glutamine rich

sequences. However, similar motifs can also be found in non-repetitive domains. These

similarities suggest the common evolutionary origin of S-rich and HMW prolamins

(Shewry et al., 1995). The cereal prolamin super-family has been defined on the bases of

4

wider comparison of evolutionary and structural similarities of several groups of maize,

oats and rice prolamins, 2S albumin storage proteins and other seed proteins (Kreis et al.,

1985).

The prolamins of maize (called zeins) constitute more than half of total seed proteins

synthesized within endosperm tissue. Alpha-zeins have a relative molecular mass of 19

and 22 kDa and constitute the most important class of zeins, comprising 70% of the total

prolamins. Alpha-zeins do not appear to be related to any other prolamins except the

alpha-type of the other panicoid cereals. The remaining three classes (beta, gamma and

delta) are sulphur rich and contrary to alpha-zeins they have higher cysteine content and

form polymers (Kumamaru et al 2007; Shewry and Halford 2002; Woo et al. 2001,).

I.3. Seed as bioreactor

Plant seed is an attractive host for molecular farming because recombinant protein can be

targeted to naturally available storage organelles allowing the stable accumulation of

recombinant proteins in endosperm and embryo tissues. Seed tissues are gifted with

molecular chaperones and disulfide isomerases to facilitate folding and assembly of

proteins. As well, the endosperm and embryo tissues are desiccated to prevent proteolytic

degradation and can therefore remain stable for years (Ramessar et al., 2008). Seed from

various plants has been considered as production host for large number of heterologous

proteins. Seed crops such as: wheat (Arcalis et al., 2004; Stoger et al., 2000), rice (He et

al., 2011), barley (Schunman et al., 2002), arabidopsis (Downing et al., 2006), maize

(Ramessar et al., 2008; Rademacher et al., 2008) brassica (Parmenter et al., 1995), pea

(Perrin et al., 2000), safflower (Nykiforuk et al., 2010), tobacco (Floss et al., 2008) and

soybean (Cunha et al., 2010) have been used as bioreactor for different recombinant

proteins. Cereal crops such as maize, rice, barley and wheat have been used as hosts for

recombinant proteins (Table 2) and the former three of these are being developed

commercially (Stoger et al., 2002a). The structure of seeds provides advantages in terms of

post-harvest processing because the small and homogenous size of seeds is beneficial for

the concentration and downstream processing of recombinant proteins. Protein targeting is

one of the crucial factors influencing protein yield and stability in seeds which also

determine posttranslational modification and accumulation levels (Ramessar et al., 2008).

5

I.3.1. Wheat

Wheat is the major crop grown all over the world. It is the most widely consumed food

crop because of its adaptability and high yield in a wide range of environments. Wheat was

the first Triticeae species to be stably transformed (Vasil et al. 1992). Among cereals,

wheat has been used rarely as a production host for recombinant proteins because the gene

transfer in wheat is less efficient and requires more specialized skills for stable

transformation (Stoger et al. 2000). Wheat is an attractive candidate for molecular farming

because of its higher protein content (>12%) and lower production cost. Different

ecombinant proteins have been expressed in wheat plant (Arcalis et al, 2004, Stoger et al.,

2000). This is important to mention that the antibodies expressed in wheat seed have

remain stable for several years at room temperature without any detectable loss of activity

(Stoger et al., 2000). Wheat is a self-pollinating crop, which implies that the chances of

out-crossing to non-transgenic crops and wild relatives are minimized. To make wheat

more feasible for molecular farming, more efficient gene transfer and regeneration

technology is needed. This may be accomplished through the development of routine

methods for high-frequency stable transformation i.e by Agrobacterium-mediated gene

transfer. Attempts to express different proteins in wheat seeds have so far produced lower

yields of recombinant proteins compared to other cereal species.

I.4. Subcellular protein targeting

The stability and accumulation of the recombinant proteins can be achieved by targeting to

appropriate subcellular compartment (Streatfield et al., 2007). The targeting organelle is

not the same for all the recombinant proteins because of their diverse structures and

properties. Literature provides evidences in terms of appropriate targeting approaches for

particular types of proteins, e.g. a range of recombinant antibodies expressed in plants.

Proper folding, assembly, the formation of disulfide bonds and glycosylation influence the

stability and functionality of antibodies, therefore targeting of such polypeptides to the

secretory pathway is recommended. Secretion of proteins to the apoplast is achieved by

the addition of N-terminal signal peptide to each antibody chain. An additional C-terminal

KDEL or HDEL tag can also reclaim secreted proteins to the endoplasmic reticulum

(Conrad et al., 1998).

6

Plant seed storage tissues contain more complex endomembrane system than non-seed

cells where more complex protein can travel through storage proteins as their final

destination. The plant endomembrane system involves a series of functionally-specialized

membrane-bound compartments and organelles including an abundant ER reminiscent of

mammalian secretory cells, ER-derived protein bodies, endosomes, the Golgi apparatus

and different types of vacuoles. Storage proteins in cereal endosperm accumulate in

different compartments, and their abundance and distribution varies according to the

species (Arcalis et al., 2004). Proteins with N-terminal signal peptides are translocated

into the ER and are normally secreted to the apoplast if there are no further targeting

signals, or retrieved to the ER if a C-terminal H/KDEL tetrapeptide is present. In addition

to ER lumen, seed tissues evolve storage organelles such as ER derived protein bodies

(PB), protein storage vacuoles (PSVs), starch granules and oil bodies. In different studies,

these naturally available organelles have been utilized as final destination for recombinant

proteins to achieve higher accumulation, stability, and facilitate recovery (Khan et al.,

2012). Targeting recombinant proteins to protein bodies provide additional benefits such

as increasing the efficacy of oral vaccine delivery (Takagi et al., 2010).

I.4.1. Endoplasmic reticulum

The endoplasmic reticulum (ER) is considered as the “gateway to the secretory pathway”

(Ibl and Stoger 2011). The endoplasmic reticulum (ER) is a part of the plant

endomembrane system with highly conserved functions in lower and higher plants. The

endoplasmic reticulum is crucial for secretory proteins as they are synthesized on the

rough ER and are subjected to the machinery for their processing including glycosylation,

disulfide bond formation, proper folding and oligomerization (Hadlington and Denecke

2000). For accumulation in the ER and in ER-derived storage organelles, the constructs

are designed to contain a targeting sequence for ER retention such as the C-terminal

tetrapeptide H/KDEL, which prevents protein secretion (Takaiwa et al., 2007).

Recombinant proteins have shown higher accumulation and stability when targeted to ER

in various plant species. Interestingly, heterologous proteins which contain a KDEL signal

and accumulate in the ER of tobacco leaves, tend to secreted or accumulated in protein

storage vacuoles in seeds (Petruccelli et al., 2006). In tobacco leaves, the single-chain

7

variable fragment (scFv)-KDEL antibody is expressed with accumulation levels of 1.65%

TSP (Fischer et al., 1999). The fusion of hydrophobins HFBI sequence from Trichoderma

reesei with Green fluorescent (GFP-HFBI) has successfully induced the formation of

protein bodies with higher concentration to 51% (TSP) of fusion proteins in tobacco leaves

(Fig. I.2; Joensuu et al., 2010). In another study, the expression and proper accumulation of

two protein components of KDEL-tagged spider dragline silk in tobacco leaves has also

been described (Menassa et al., 2004). In seeds, an antibody scFv-Fc construct fused to

KDEL was produced up to 12% TSP in Arabidopsis where the heterologous protein was

detected in the periplasmic space but absent from the ER. In this case the presence of

heterologous protein apparently disturbed the ER retention and leading partial secretion of

the recombinant protein and endogenous storage proteins in seeds (Van Droogenbroeck et

al., 2007). Similarly, an unexpected deposition of KDEL-tagged human serum albumin

protein was observed in wheat endosperm, where the recombinant protein was deposited

together with prolamin aggregates within the storage vacuole (Arcalis et al., 2004). This

mistargeting of KDEL-tagged proteins may be a result of the unique storage properties of

seed tissues. Strong over-expression of GFP without fusion partner in transient N.

benthamiana leaves induced the formation of necrotic lesions, In contrast, when GFP is

expressed as a fusion with HFBI, an increase in the expression up to 2 fold was observed

and infiltrated leaves remained healthy up to 10 dpi (Joensuu et al., 2010).

Figure I.2 ER-targeted Green fluorescent protein (GFP). Confocal image of the ER targeted recombinant

protein (GFP) expression shows the ER network indicated by the flourecent protein (Joenssu et al., 2010).

8

I.4.2. Protein bodies and protein storage vacuoles

Cereal endosperm includes two types of protein storage organelles: protein bodies, which

are derived from the ER, and protein storage vacuoles (PSVs), which are formed de novo

(Jiang et al., 2001). In cereals, all storage proteins are synthesized on the surface of the

ER. After synthesis, they are translocated from the cytoplasmic side of the rER to the ER

lumen. The newly formed polypeptides are then assembled into protein bodies accretions.

Protein bodies either remain in ER or they may deposit through endomembrane system to

protein storage vacuoles (PSVs; Vitale and Denecke, 1999). The protein bodies in cereals

are surrounded by a membrane of ER origin. In cereals, seed storage proteins are

transported to PSVs in three different pathways. These include the transport through

Golgi-derived dense vesicles, precursor-accumulating (PAC) vesicles and via an

autophagy-like process (Tosi et al., 2009).

As shown in wheat and barley, protein bodies containing prolamins are deposited into

central large PSV by an autophagy-like process (Levanony et al., 1992; Herman et al,

1999). In other cereals, such as maize and rice, the protein bodies are synthesized within

ER lumen and they remain in these organelles. Rice storage proteins are deposited into

two different populations of protein bodies, the regular shape and ER origin protein bodies

(PB-I) and irregular vacuolar PB-II. In cereals, the origin and exact mechanism of protein

bodies synthesis is still unclear. The synthesis and trafficking of storage proteins in

different cereals has been discussed further in section I.5.

In molecular farming, both these compartments i.e protein storage vacuoles (Frigerio et al.

2008; Vitale and Hinz 2005) and protein bodies (Coleman et al. 1996; Conley et al., 2009)

have been used to accumulate variety of recombinant proteins (Takaiwa et al., 2007). The

targeting of recombinant proteins to ER derived protein bodies and PSVs have resulted in

stable and higher accumulation (Arcalis et al., 2004; Galili 2004; Herman and Larkins

1999; Levanony et al., 1992).

I.4.3. Oil bodies

Lipid particles are found in seeds such as sunflower, safflower, rapeseed and mustard. Oil

seeds save lipids in subcellular particles as food reserves in form of triacylglycerol (TAG)

9

used to supply energy for germination and post-germinative growth. The TAGs are present

in small subcellular spherical oil bodies, being approximately 0.5-1 µm in diameter.

Recombinant proteins targeted to oil bodies are relatively stable, do not aggregate or

coalesce and are surrounded by a protected layer of unique proteins called oleosins (Huang

1996). The recognition signals are provided by oleosins for lipase binding during oil

mobilization in seedlings (Huang, 1996; Murphy, 1993).

Oil bodies are used as storage organelles in plant biotechnology because of their presence

in various plant tissues. Oilseeds in particular are exploited for protein expression. Oil

body targeting has its own advantages in terms of purification of fused proteins due to a

high ratio of triacylglycerides. Using the oleosin-fusion system, the pharmaceutical protein

hirudin has been successfully expressed in Brassica species i.e. Brassica napus (Boothe et

al., 1997) and Brassica carinata (Chaudhary et al., 1998). Recently, recombinant protein

Apoliprotein Al Milano was expressed as a fusion protein in transgenic safflower seed

with high levels of expression corresponding to 7g of ApoAlmilano per kilogram of seed

in the transgenic line selected for commercialization (Nykiforuk et al., 2011). One of the

molecular farming product is recombinant human insulin expressed in safflower seeds is in

phase III clinical trials and closest to the market (Fischer et al., 2011).

I.4.4. Starch binding domains

Starch is the primary energy storage polysaccharide in all plants, a main source of calories

in the human diet (James et al., 2003) and widely used for food and industrial purposes.

Starch is composed of α-1,4-linked glucose residues organised into the essentially linear

amylose and the branched amylopectin containing α-1,6-linkages. Starches are deposited

as semi-crystalline granules in chloroplasts of leaves (transitory starch) and in amyloplasts

of storage organs. Starch consists usually of 20-30% amylase and 70-80% amylopectin (Ji

et al., 2003). Starch granule size varies from less than 1 μm to over 100 μm with spherical

or elongated shapes (Smith 2001). Cereals such as wheat and barley contain a mixture of

small and large granules known as A and B granules (Fig. I.3), which differ in their

morphology and chemical composition (Ao and Jane 2007 and Geera et al., 2006). In

wheat, A-granules are between 10 and 38 μm in size and disc- or lenticular-shaped, while

B-granules are smaller than 10 μm and possess a spherical or polygonal morphology

(Wilson et al., 2006).

10

Starch-binding domains (SBD) derived from bacterial enzymes that catabolise starches

have the capability to bind two helices of starch and thus potentially useful for targeting

recombinant proteins to starches. SBDs independently retain their function even if fused to

another protein and can therefore be used to target recombinant proteins to existing starch

granules (Janecek 1999).

Figure I.3 Wheat A-type and B-type granule structure. (Buléon et al., 1998)

I.5. Seed storage protein trafficking

In the seed, storage proteins move along specific routes within the endomembrane system.

Seed cells produce vast amounts of SSPs with different subcellular destinations, including

complex protein storage vacuoles and protein bodies derived from the ER (Ibl and Stoger,

2011). Storage proteins, such as albumin and globulins, start the journey from ER lumen

and are then transported to PSVs, passing through the Golgi apparatus via dense vesicles

(Hohl et al., 1996). In contrast to this pathway, 2S albumins and 11S globulins in pumpkin

seed accumulate in PSVs, bypassing the Golgi apparatus via precursor-accumulating

(PAC) vesicles (Hara-Nishirama et al., 1998).

Storage protein trafficking has been extensively studied because of the nutritional value of

such proteins. In cereals, globulins follow the same routes as described above: they

accumulate in the cell‟s PSVs passing through the Golgi apparatus. The deposition of

prolamins in cereal endosperm is specific to the species. In cereals such as rice, maize and

sorghum, prolamins aggregate into dense protein bodies within the rough-ER lumen (Fig.

1.4) and remain attached to this organelle (Muench et al., 2000). The protein bodies are

encapsulated by a membrane protecting them from proteases and desiccation during seed

development, until they are used up as an energy source for germinating seedlings (Muntz

1998). Thus, protein bodies are particularly favoured for deposition and storage of large

11

amounts of recombinant proteins which are poorly secreted or toxic to the host (Torrent et

al., 2009). Prolamins are exclusively found in cereal endosperm. In wheat and oat, the

prolamins accumulate to form aggregates and bud off the ER as in other cereals. But later

they are incorporated into PSVs by an autophagy-like process bypassing the conserved

mechanism of the Golgi mediated targeting (Arcalis et al., 2004; Galili et al., 1993;

Levanony et al., 1992). The role of the Golgi apparatus has been controversial but

generally, the Golgi independent pathway is more widely accepted, although a Golgi-

dependent pathway has also been proven for small amounts of prolamins (Miflin et al.,

1981).

Wheat endosperm contains two types of PBs: the low density type protein bodies (light

PBs) where gliadins are present, and the high density type of protein bodies (dense PB),

where high molecular weight glutenins are located. Both the high molecular weight

glutenins and gliadins are transported and deposited to the PSV by two separate processes,

the Golgi-dependent and the Golgi-independent pathway (Kumamaru 2007). Wheat

protein bodies do not remain as separate cytosolic structures but are sequestered into

provacuoles (Rubin et al., 1992), predominantly in the cells of the subaleurone layer (Fig.

I.5A). Surprisingly, cereal prolamins do not contain any known ER or vacuolar targeting

signals. Wheat protein bodies are sequestered within a large, central vacuole. In wheat,

gliadine and glutenins are the major classes of prolamins in the endosperm, but also

contains an 11S globulin homolg and triticin as minor storage proteins, which account for

5% of total seed proteins (Singh et al., 1991). Gliadins accumulate in protein bodies as

monomers, while glutenins assemble via non-covalent interactions and intermolecular

disulfide bonds. Unlike prolamins, gliadins contain N-terminal signal sequences that

determine their passage into lumen of the ER. However, it is not known why some gluten

proteins pass and others bypass the Golgi apparatus (Tosi et al., 2009).

Zein constitutes more than half of the total seed proteins in maize endosperm (Fig I.3B).

Different classes of zeins can be found in endosperm 10-40 days after pollination (DAP)

and constitute approximately 50% of the total proteins in mature seed (Lending and

Larkins 1989). Maize γ-zein is able to induce protein body formation in dicot tissues

regardless of the presence of other zein subunits (Coleman et al., 1996). -Zein is

composed of four domains: eight repetitions of the PPPVHL motif, a hydrophobic cystein

12

rich C-terminal sequence, Pro-X enclosing proline residues and a 19 amino acid signal

peptide (Prat et al., 1985). In maize endosperm tissues, zeins located in 2 µm spherical

protein bodies within the ER lumen where γ-zeins are located at the periphery of the dense

bodies. N-terminal proline rich sequences contribute to protein body formation and its

retention within the ER lumen. Three types of zein (β, γ, δ) have been successfully

produced in leaves of transgenic arabidopsis, where they are deposited to ER derived

protein bodies (Bagga et al., 1995, 1997).

Alpha zeins are composed of two major subclasses (19 and 22 kDa zeins), and constitute

the most important class of zeins, accounting for 70% of the total prolamins. The

remaining minor group of three zein classes include delta, beta and gamma (δ, β and γ)

having molecular masses of 10, 15 and 27 kDa respectively, when separated on SDS-

PAGE. -zeins are rich in cystein while both δ and β are rich in methionine residues. Beta

zeins share some features with γ-zein, such as both being sulphur rich, carrying conserved

N and C terminal peptides and requiring a reducing agent for their solubility in alcohol.

Rice endosperm accumulates three types of storage proteins, the glutelins, prolamins and

α-globulins (Muench et al., 1999), where globulins (known as glutelins) and prolamins are

in majorityand make up 60-80% and 20-30% of total seed proteins, respectively

(Kawakatsu et al., 2010). These storage proteins are transported to different sites of the

endomembrane system (Krishnan et al., 1986, Tanaka et al., 1980). In rice seeds, more

than 80% of the total seed proteins are deposited as storage proteins in protein bodies as

protein storage organelles. There are two distinct protein bodies found in the rice

endosperm known as PB-I, which originates from the ER and contains prolamins, and

vacuolar PB-II, accumulating globulins and glutelins (Fig. I.6; Krishnan et al., 1986;

Yamagata and Tanaka 1986). In rice, the chaperone BiP is closely associated with

prolamins and is located at the periphery of rice prolamin bodies, which aids the deposition

of prolamins on the surface of protein bodies (Li et al., 1993; Muench et al., 1997). BiP is

known to be present in cereal PBs, where it is considered to play a role in storage, protein

folding and assembly (Li et al., 1993). Okita and co-workers could show that prolamin

mRNA plays a crucial role in the deposition of prolamins within the rice endosperm.

Evidence has been found that rice prolamins and globulins/glutelins are translated on two

separate sub-domains of ER. Prolamin mRNAs are targeted to ER membrane surrounding

13

the protein bodies by a mRNA signal recognition process (Hamada et al., 2003a; Hamada

2003b), whereas mRNA localization on the cisternal ER membrane results in

globulin/glutelin transport to the PSV (Li et al., 1993a). The specific mRNA trafficking to

protein bodies appears to involve the cytoskeleton (Hamada et al., 2003b).

Figure I.4 Conceptual diagram of the ontogeny of PBs and PSVs. In cereals, protein bodies are form

within the rER. After synthesis, they can either bud off the ER, remain in the cytoplasm or be sequestered

into protein storage vacuoles. PSVs are formed as the result of ER-synthesized storage proteins progressing

through the endomembrane secretory system to the vacuole for accumulation (Hermans and Larkins 1999).

Figure I.5 Deposition of wheat protein bodies. Light microscopy. Cross section of a wild type wheat seed

stained with methylene blue. The protein bodies are deposited within the large central vacuole (arrow) in the

wheat endosperm cells. Figure adapted from Prof. Stoger‟s Lab at Vienna, Austria.

14

Figure I.6 Protein bodies deposition in maize and rice. Light microscopy. Semi-thin cross section of wild

type maize seed treated with methylene blue. Protein bodies (arrow) are distributed in first few cell layers of

maize endosperm tissues. Rice. Light microscopy. Methylene blue stained semi-thin section. Protein bodies

Type I and II (arrow) are visible within rice endosperm. Figure adapted from Prof. Stoger‟s Lab at Vienna,

Austria.

I.6. Fluorescent protein markers

Transgenic plants are generally developed through co-insertion of selectable marker genes

together with the transgenes. Selection with antibiotics or herbicides is then used to enrich

for plants with successful integration of the transgenes in the host cells. In contrast to

selectable marker genes, fluorescent reporter genes (GUS; GFP, dsRed) can be easily

detected by phenotypic analysis (Miki and McHugh 2004). For the identification of

transformed cells, which are very few within a large background of non-transformed cells,

reporter genes (cat, uidA, luc, gfp, dsRed) are favoured for plant transformation constructs.

To monitor the gene expression, protein localization and intracellular protein trafficking

may be visualized with protein markers in situ, without harming the plants (Ziemienowicz

2001). GFP and DsRED are favoured because of their high quantum yields and stability in

living cells.

Fluorescence is a phenomenon in which a material absorbs light of one colour

(wavelength) and emits light of a different colour (wavelength). Fluorescent reporter

proteins, such as green fluorescent protein (GFP) and red fluorescent protein (DsRED), in

plant cell biology are essential to track, visualise and quantify gene expression in the host

cells. Monitoring of CAT, GUS and LUC activity requires the sample preparation (Jach et

al., 2001). Due to intrinsic fluorescence detection, the fluorescent protein offers an

advantage over GUS and luciferase marker proteins with respect to being used without any

15

additional specific substrates to monitor gene expression and analysis of transformants in

the first generation.

I.6.1. Discosoma red fluorescent protein

Red fluorescent protein (DsRed) has been isolated from coral of the genus Discosoma

(Matz et al., 1999) and is used as natural red chromophore. DsRED has the maximum

excitation and emission shifted to the red when compared to GFP (excitation/emission

maximum of GFPs 488–495 nm/507–510 nm versus 558 nm/583 nm for DsRED).

Discrimination of DsRED and GFP fluorescence can be easily done by using appropriate

filter settings; allowing simultaneous multicolour imaging of different genes (Jach et al.,

2001). DsRed is commonly utilized to examine developmental and spatial gene expression

in transgenic plants. Like GFP, it does not require the preparation of protein extracts,

additional substrates or enzymes. DsRed allows non-invasive, non-destructive detection at

very early stages of plant transformation. DsRed was first expressed in tobacco BY2

protoplast cells by Mas et al. (2000). The DsRed is visualized by the red phenotype of

seeds, seedlings and plant lines, which express the protein in the cytosol, ER or

chloroplast. The expression of red fluorescent proteins does not affect the fertility and

germination of seeds (Jach et al., 2001). Red fluorescent marker proteins are traceable

markers and can be easily detected by simple microscopic analysis. The fused protein can

be easily detected at very early stages of its development using low tech equipment.

Figure I.7 Red Fluorescent protein as selection marker. Detection of transgenic seeds on a segregating

ear of maize using red fluorescent protein (DsRed) as a visible marker (Rademacher et al., 2009)

16

I.7. Encapsulation of recombinant proteins

Several strategies have been exploited in an attempt to maximize heterologous protein

accumulation in plant cells. Despite successful alternative expression systems, foreign

protein expression levels are relatively lower in the plant expression system due to major

challenges, which include insufficient accumulation levels and lack of efficient purification

methods for recovery (Joennsu et al., 2010). Expressing recombinant proteins as fusions to

protein - stabilizing partners has a positive impact on the protein accumulation and

purification, and efficient and cost-effective purification of recombinant proteins from

plants (Witte et al., 2004). To enhance recombinant protein accumulation, a variety of

fusion proteins has been used in plants such as cholera toxin B subunit (Molina et al.,

2004), viral coat proteins (Canizares et al., 2005), ubiquitin (Mishra et al., 2006), β-

glucuronidase (Dus Santos et al., 2002), human immunoglobulin (IgG) α-chains (Obregon

et al., 2006). To enhance the purification process, recombinant proteins are fused affinity

tags such as His-tag, glutathione S-transferase-tag, FLAG-tag, c-myc-tag, Arg-tag,

calmodulin-binding peptide, maltose-binding protein, the cellulose-binding domain (Lichty

et al., 2005) and eight-amino acid StrepII epitope tag (Skerra and Schmidt 2000).

However, these tags include costly chromatography techniques for protein purification that

is difficult to scale up for industrial use (Menkhaus et al., 2004; Waugh 2005).

Large-scale partitioning of different biological components, including recombinant

proteins, is often a bottleneck in modern biotechnology. To increase the accumulation of

valuable recombinant proteins in seeds, and to facilitate protein purification, the properties

of seed storage proteins and/or the trafficking pathways that lead to storage protein

deposition in seeds have been exploited (Table I.1). Therefore, different fusion based

strategies have been developed to deal with these issues (Terpe 2003) including, zeins,

ELPs and Hydrophobins.

17

Figure I.8 Using storage organelles for the accumulation and encapsulation of recombinant proteins

(Khan et al., 2012).

Table I.1 Fusion partners for creation of artificial storage organelles.

I.7.1. Zein

In the cereal endosperm, zeins are accumulating in the endoplasmic reticulum-derived

protein bodies and can accumulate up to 15% of total endospermic proteins (Marzbal

1998). Zeins are among well studied seed storage proteins in maize. Endospermic cells of

maize, together with other zein classes (α, β, γ, δ) form large complexes known as protein

bodies in endoplasmic reticulum lumen (Fig. I.9). No specific canonical HDEL/KDEL

retention/retrieval signals responsible for retaining proteins in the ER have been found in

Origin Purification Method Increased yield PB-Formation

Zein Plant Isopycnic sucrose density

centrifugation

15-100 fold Protein repeat domain,

Pro-X domain,

Cystein domain

Elastin-like

polypeptides

Animal

Inverse transition cycling

(ITC)

2-100 fold

VPGXG

Hydrophobin Fungus Surfactant-based aqueous

two phase system (ATPS)

Unknown Hydrophobic

interation.

8 cysteines

18

γ-zeins. This phenomenon of protein retention and localization within the ER of

endosperm of maize is still to be discovered.

Protein fused to N-terminal proline–rich domain of γ-zein, known as Zera has capability to

stably express recombinant proteins in plants and have induced an increase in overall

yields (Mainieri et al., 2004; Torrent et al., 2009;). Zera fusions with other protein are able

to self-assemble and accumulate the recombinant proteins inside protein bodies. The exact

synthesis of protein bodies is still undetermined, but it has been proven in earlier studies

that proline rich domains made of hexapeptide PPPVHL are responsible for retention of

proteins in the ER. There is evidence that β-zein sharing conserved N- and C-terminals

with γ-zeins, which are then capable of inducing protein body formations (Colemann and

Larkins 1999). However, expression of only α-zeins fails to induce protein body structures

when expressed into different hosts.

Figure I.9 Localization of storage proteins in maize endosperm. Fluorescence microscopy. Two classes

of Zein (α, γ) expressed in maize leaves. Figure adapted from Prof. Stoger‟s Lab at Vienna, Austria.

I.7.2. Elastin-like polypeptide

Elastin like polypeptides (ELP) are synthetic biopolymers made of repeats of amino acid

`Val-Pro-Gly-Xaa-Gly` sequences, where residue Xaa is any amino acid except proline

(Urry, 1988). Elastin-like polypeptides (ELP) are found in all mammalian elastin proteins

and can be purified with temperature based non chromatographic methods. Elastin-like

polypeptide (ELP) tags upon expression with particular proteins induce protein body

formation of the same size and morphology to natural protein bodies found in maize

endosperm. This has been demonstrated by ELP-GFP fusion in tobacco leave which

19

positively affected the stability and resulted in higher accumulation of recombinant

proteins (Fig. I.10; Conley et al., 2009).

ELP fused protein can be purified with inverse transition cycling (ITC) which is a fast,

simple, easily scalable and cheap non-chromatographic method for protein purification.

This method is used for purification of antibodies, cytokins and spider milk proteins from

transgenic plants. When heated above transition temperature, ELP are converted to

hydrophobic aggregates and form β-spiral structures. This thermal response property has

also been transferred when ELPs are fused with recombinant proteins, enabling the

purification through ITC (Conley et al., 2009). This heat sensitivity is directly connected to

the size of the proteins in plants, such as that the transition temperature could be 30-39 C

for proteins ranging from 30-65 kD in mass (Stibora et al., 2003). However, the heat

sensitivity is inversely proportional to the size in E.coli (Meyer and Chilkoti 1999). ELP

fusion has found 40 times more abundant (compared to control) when expressed in tobacco

seeds (Scheller et al., 2006).

The proteins, once fused with the ELP tags, exhibit an increase in accumulation in plants,

but this procedure still needs to be optimized in order to maximize the accumulation levels

of these fused proteins in plants. ELP fusion proteins have significantly accelerated protein

accumulation and purification in plants, but the impact of ELP fusion proteins on overall

factors defining protein quality still needs to be determined.

Figure I.10 Fluorescence microscopic image of tobacco leaf. In the presence of an ELP fusion tag, the

ER-targeted GFP was detected in brightly fluorescing spherical-shaped particles distributed throughout the

cells of the leaf (Colney et al., 2009)

20

I.7.3. Hydrophobins

Hydrophobin fusions are originally developed for the purpose of purifying proteins from

fungal cultures supernatant (Conley et al., 2011). It has already been demonstrated that

hydrophobin fusion can induce higher accumulation of target proteins in plants and fungi

(Linder et al., 2004). Endoplasmic reticulum-targeted hydrophobins induce the formation

of novel protein bodies (Table.I.1; PBs; Conley et al., 2009b; Torrent et al., 2009).

Purification of macromolecules is the key factor in alteration of the fusion protein partners,

through surfactant-based aqueous two-phase system (ATPS; Linder et al., 2004). ATPS is

a simple, rapid, and inexpensive procedure that can result fast separations (Persson et al.,

1999). At industrial points of view, hydrophobins are attractive because they require a one-

step purification procedure and can be easily scaled up for industrially valuable proteins

(Linder et al., 2004; Selber et al., 2004).

Figure I.11 ER-targeted GFP Hydrophobin fusion (GFP-HFBI) promotes the formation of PBs in

Nicotiana benthamiana. Leaf epidermal cell accumulation GFP-HFBI fusion protein in protein bodies

(Joensuu et al., 2010).

21

Table I.2 Examples of recombinant proteins produced in cereal seeds.

TSP: Total Seed Protein; RSP: Rice Seed Powder

Crop Recombinant protein Plant Tissue/ Subcellular

Localization

Expression

Level/Yield

Promoter Reference

Maize

Barley

HIV 2G12

HIV 2G12SEKDEL

Avidin

Escherichia coli heat

labile enterotoxin (LT-B)

HIV Diagnostic Reagent

(HIVDR)

Endosperm/embryo

ER-derived Protein Bodies

Endoplasmic Reticulum (ER)

Starch granules

Endoplasmic reticulum

38-75 µg per gram

30μg/g dry weight

5.7% TSP

1.3g/kg

150 µg of reagent g-1

Endosperm-specific rice glutelin-1

glutelin-1 (gt-1) promoter

Maize ubiquitin promoter

27-kDa γ-zein promoter

B×17 promoter

Ramessar et al., 2008

Rademacher et al., 2008

Kusnadi et al., 1998

Chikwamba et al., 2003

Schünmann et al., 2002

Rice

Wheat

Human serum albumin

(HSA)

7Crp peptide

Human interleukin

Cholera toxin B subunit

Human Serum Albumin

Single-chain Fv antibody

(ScFvT84.66)

Endosperm

ER-derived Protein Bodies

Endoplasmic reticulum

Protein bodies (PB) I & II

ER-derived Protein Bodies

Endosperm

2.75g/kg of Rice

60 µg/ grain

4.5mg/100g RSP

30 µg/g CBT per Seed

0.5% TSP

30μg/g

Endosperm-specific promoter,

Gt13a promoter,

Glutelin GluB-1

Glutelin GluB-1

Ubiquitin-1 promoter

Maize ubiquitin promoter

He et al., 2011

Takaiwa et al., 2009

Fujiwara et al., 2010

Nochi et al., 2007

Arcalis et al., 2004

Stoger et al., 2000

22

Objectives of the study

In the context of molecular farming, plant seeds are ideal vehicles for the production of

recombinant proteins because they contain specialized compartments for the stable

accumulation of storage proteins. Recombinant proteins and endogenous storage proteins

in dry seeds each benefit from the same stable environment, allowing long-term storage

and batch processing. Seeds contain several unique types of storage organelles to which

recombinant proteins can be directed and in which they accumulate. These include protein

bodies derived from the endoplasmic reticulum (ER) and protein storage vacuoles. The

maize seed storage protein γ-zein is an endogenous prolamin that can trigger the formation

of protein bodies both in the seed and non-seed tissues of dicotyledonous plant species. In

this project, the repetitive (PPPVHL)8 and PX domains from γ-zein protein were

expressed as a fusion with the red fluorescent marker protein DsRed to allow the behavior

of the fusion protein to be characterized visually in different wheat tissues.

The main objective of this thesis was to study the expression of recombinant wheat plant

and to study trafficking and deposition of the model fusion protein in different wheat

tissues, such as the endosperm, embryo and leaves, to investigate its ability to form protein

bodies for the storage of recombinant fusion proteins in diverse environments. Our

hypothesis was that in wheat cells the model γ-zein-DsRed fusion protein would form a

unique and separate population of protein bodies budding from the ER into the cytoplasm,

but because endogenous prolamins would be present in the endosperm it would not be

possible to predict the behavior of the model protein in this setting. We therefore

investigated the precise localization of the fusion protein to find out whether it would form

a separate population of ER-derived protein bodies or mix with endogenous prolamins in

endogenous glutelin bodies. Autophagy-like processes are well-documented in wheat

endosperm cells, so we also set out determine whether the model protein was ultimately

incorporated in the protein storage vacuole like wheat glutenins.

One of the bottlenecks in molecular farming is the low yields of recombinant proteins in

transgenic plants, often reflecting a combination of low-level accumulation and inefficient

extraction and downstream processing. We used the model fusion protein γ-zein-DsRed to

investigate strategies for the improvement of recombinant protein accumulation in wheat,

23

based on preventing exposure to proteolytic enzymes in the cytosol. This thesis

contributes to the body of knowledge on recombinant protein expression in plants by

studying the expression and deposition of γ-zein-DsRed and by extrapolating this

knowledge to develop strategies that can be applied to pharmaceutical proteins in

commercial processes.

Figure I.12 Schematic overview of the PhD project.

Construction of Model

Fusion Protein (Recombinant DNA techniques)

Generation of Stable

Transgenic plants

(Tissue culture, particle

bombardment, regeneration)

Characterization of

Transgenic Wheat Plants (Fluorescent microscopy, PCR, PAT

analysis)

Protein Analysis

(Isolation of total soluble proteins,

SDS-PAGE analysis, commassie-blue

staining, western blot analysis)

Immunolocalization Studies

(Fixation and embedding, ultra thin

sectioning, fixation for

immunochemistry, fixation for ultra

structure, light microscopy, fluorescent

microscopy and confocal microscopy)

24

II. MATERIALS AND METHODS

II.1. Materials

II.1.1. Chemicals and consumables

All the chemicals used through-out the research work were purchased from the following

companies: Alfa Aesar (Karlsruhe, D), Amersham Bioscience (Freiburg, D), Bio-Rad

(München, D), Boehringer Mannheim (Mannheim, D), Duchefa (Haarlem, NL), Fluka

(Neu-Ulm, D), Gibco BRL Eggenstein, D), Invitrogen (Karlsruhe, D), London Resin

Company Ltd (London, UK), Merck (Darmstadt, D), Molecular Probes (Leiden, NL),

MWG (Ebersberg, D), New England Biolabs (Frankfurt, D), Plano (Wetzlar, D), Roche

(Mannheim, D), Roth (Karlsruhe, D), Serva (Heidelberg, D) and Sigma-Aldrich

(Taufkirchen, D).

The consumables were purchased from: Eppendorf (Hamburg, D), SPI supplies (Adi

Hassel, München, D), Bio-Rad (München, D), MilliPore (Schwalbach, D), Qiagen

(Hilden, D), and Whatman (Bruchsal, D).

II.1.2. Buffers, media and solutions

All the required buffers, media and solutions used in this study were prepared according to

standard protocols as described in Sambrook and Russell (2000). The other optimized

media and solutions are listed here. Heat-sensitive additives such as antibiotic were

prepared in stocks and were filter sterilised by passing through 0.2μm filter (Millipore)

and added to the autoclaved media or buffer after they were cooled down to 55-60°C. The

pH was adjusted with 1M, 5M and 10M NaOH, 1M and 5M KOH or 37 % (v/v) and 10 %

(v/v) HCl.

AP buffer 100 mM Tris-HCl pH 8.9

100 mM NaCl

5 mM MgCl2 , pH 9.6

Coomassie staining solution 0.25 % (w/v) Coomassie blue G-250

50 % (v/v) Methanol

9 % (v/v) Glacial acetic acid

25

Blotting buffer 25 mM Tris-HCl pH 8.3

192 mM Glycine

20 % (v/v) Methanol

Coomassie de-staining solution 20 % (v/v) Methanol

10% (v/v) Glacial acetic acid

DNA extraction buffer 3 % (w/v) CTAB

1,4 M NaCl

0,2 % (v/v) β-Mercaptoethanol

20 mM EDTA, pH 8.0

100 mM Tris-HCl, pH 8.0

1 % (w/v) PVP40

10x DNA loading buffer 0.1 % (w/v) Bromphenolblue

0.1 % (w/v) Xylencyanol

in TBE buffer

KPi buffer for protein extration 1 M KH2PO4 , pH 7.6

1 M K2HPO4

Phosphate buffer (0.1 M) 19 % (v/v) of 200 mM NaH2PO4

81 % (v/v) 9.9 mM Na2HPO4

Protein denaturation buffer 1.05ml KPi buffer

6 % (v/v) EOTH

110 mM (w/v) Urea

1ml (v/v) Methanol

10x PBS 1.37 M NaCl

27 mM KCl

81 mM Na2HPO4

15 mM KH2PO4, pH 7.4

26

Phosphate buffered saline-Tween (PBST) 1x PBS (pH 7.4)

0.05 % (w/v) Tween 20

5x Reducing protein loading buffer 62.5 mM Tris-HCl (pH 6.8)

30 % (v/v) Glycerol

4 % (w/v) SDS

0.05 % (w/v) Bromophenol Blue

10 % (v/v) ß-Mercaptoethanol

5x SDS-PAGE running buffer 125 mM Tris-HCl pH 8,3

960 mM Glycine

0.5 % (w/v) SDS

10x TBE electrophoresis buffer 900 mM Tris-base

900 mM Boric acid

25 mM EDTA, pH 8,3

4X Separation buffer: 1.5 M Tris base

0.4% (w/v) SDS

adjusted pH to 8.8 with HCl

dH2O to 500ml, filter sterilize.

4X Stacking buffer: 30.25g Tris base

2g SDS

adjusted pH to 6.8 with HCl

dH2 O to 500ml, filter sterilize.

2X Sample buffer: 125mM Tris 6.8

6% (w/v) SDS

20% (w/v) glycerol

0.025% (v/v) bromophenol blue.

Fixation solution 4% (w/v) Paraformaldehyde (PFA)

0.2% (w/v) Glutaraldehyde

27

Media and Additives

Escherichia coli

LB (pH 7.0) 1.0 % (w/v) NaCl

1.0 % (w/v) Trypton

0.5 % (w/v) Yeast extract

Glycerol Stock Medium (GSM) 50 % (v/v) Glycerol

100 mM MgSO4

25 mM Tris (pH 7.4)

Antibiotics

Antibiotics Final concentration Stock solution

Escherichia coli

Ampicillin (Amp) 100 mg l-1

100 mg ml-1

H2O

Kanamycin (Kan) 25 mg l-1

100 mg ml- H2O

Agrobacterium tumefaciens

Rifampicin (Rif) 100 mg l-1

100 mg ml-DMSO

Kanamycin (Kan) 25 mg l-1

100 mg ml-H2O

Carbenicillin (Carb) 100 mg l-1

100 mg ml-EtOH 50%

Plants

Phosphinotricin (PPT) 2-3 mg l-1

10 mg ml-H2O

Enzymes and reaction kits

Restriction and ligation enzymes used for DNA digestion were purchased from New

England Biolabs and Fermentas. DNA Taq polymerase produced by the Fraunhofer IME

(Aachen) was used for PCR amplification. The following kits were used:

QIAprep spin Miniprep kit Qiagen

QIAquick® gel extraction kit Qiagen

QIAquick® PCR purification kit Qiagen

QIAquick® plasmid Midi kit Qiagen

28

QIAquick® plasmid Maxi kit Qiagen

Bacterial strains

Escherichia coli strain DH5α (F- (f80d Lac2ΔM15) Δ(LacZYA-argF) U169end A1 rec1

hsdR17(rk- mk-) deoR thi-1 supE44 gyrA96 relA1 λ-, Ausubel et al., 1994) was used as

host cells for plasmid amplification.

II.1.3. Plants

The wheat (Tricitum aestivum) variety BobWhite was used for the generation of stable

transformed plants.

II.1.4. Vectors

The pTRA (Thomas Rademacher, Institut für Biologie VII, RWTH Aachen, Germany)

vector was used for wheat transformation.

II.1.5. Resin and membranes

The Resin from London Resin Company Ltd, UK was used for immunocytochemistry

analysis. HybondTM-C nitrocellulose membranes of size 0.45µm from Amersham

Bioscience and Whatman paper no.1 from Whatman were used in immonoblot analysis.

II.1.6. Equipment

1. DNA gel electrophoresis apparatus: DNA agarose electrophoresis (BioRad, München)

and power supplies (BioRad)

2. Electroporation apparatus: Gene pulserTM, Pulse controller unit, Extender unit

(BioRad) and 0.2 cm or 0.4 cm cuvettes (BioRad)

3. Centrifuges: Eppendorf 5424, 5415R, PICO 21 (Thermo Scientific)

4. PCR Thermocyclers: MJ Mini (BioRad)

5. Photometers: Infinite M200 (TECAN)

6. Sonicator: Transsonic T310 (CAMLAB)

7. Protein gel electrophoresis equipment: Mini PROTEAN supplied from BioRad

8. UV-Transilluminators: Molecular Imager. Gel Doc XR+ imaging system (BioRad)

9. Particle bombardment device: PDS/He1000 particle bombardment system ( BioRad)

29

10. Biobench. SAFE 2010, HERA Guard (Thermo Scientific)

11. Shaker: Innova 4430 (New Brunswick Scientific GmbH, Nürtingen)

12. Microwave: Severin

13. Incubator: MAXQ 8000, Heraus Incubator (Thermo Scientific)

14. Balance: VICON (Acculab), Sartorius (INULA)

15. Vortex: Vortex-2 Genie (Scientific Industries)

16. Oven: Heraeus (Thermo Scientific)

17. Ice Machine: ZIEGRA GmbH

18. pH meter: Hi 221 (Hanna), Phonomenal (VWR)

19. Vibrator: Retsch MM400

20. Light Chamber: RUMED (Rubarth Apparatus GmbH)

II.2. Methods

All the experiments in this study were performed performed in accordance with S1 safety

regulations and were approved by the Regierungspräsidium des Landes NRW. [(AZ 521-

K-1-8/98: AI3-04/1/0866/88 (S1) and 55.8867/-4/93 (greenhouses)].

II.2.1. Transformation, selection and characterisation of recombinant bacteria

Escherichia coli (E.coli) cells were used for plasmid DNA (II.3.1) magnification. These

cells were grown at 37°C either in LB medium (with amp) in a shaker incubator at 225

rpm, or on agar-solidified 1.5% (w/v) LB plates (amp). For glycerol stocks, 600µL of

overnight (o/n) grown liquid culture was mixed with an equal volume of 40% (v/v)

glycerol and placed at -80C° for long term storage.

II.2.2. Preparation of competent E. coli cells for heat-shock transformation

Competent Bacterial (E.coli) strain DH5α cells were prepared for heat shock

transformation. The growth of E.coli was performed with a single bacterial colony

inoculated in 5 ml of LB broth and cultured at 37°C over night (o/n). 500 micro-litres (µl)

30

of fresh o/n culture were added into 100 ml of LB broth and cultured at 37°C for 3-4

hours. When the culture reached an OD600nm of 0.6-0.7 were then transferred to an ice-

cold tube. The cell liquid was placed on ice for 10 min and the cells were recovered by

centrifugation (2,000g/4°C/20 min). The centrifugation step was repeated again. The

pellets were gently resuspended in 200 ml ice-cold sterile distilled water. Then, added to

200 ml 10% (v/v) ice-cold glycerol and finally in 1 ml of 10% (v/v) ice-cold glycerol.

Aliquotes of 200µl of competent cells were frozen immediately in liquid nitrogen and

stored at -80°C.

II.2.3. Transformation of E. coli by heat-shock

The Competent E.coli (II.2.2) was thawed on ice and 10µg of plasmid DNA or ligation

products were mixed gently. The competent cells were put on ice for 30 min. The cells

were incubated for 2 min at 42°C and placed on ice for 2min. After quick cooling 800 µl

of LB media was added to the eppendorf tubes and transformed cells were incubated at

37°C for 1 hour. The volume of 200, 100 and 50µl of cells were plated onto separate LB-

agar plate supplemented with appropriate antibiotics and were incubated at 37°C overnight

until the colonies appeared. Colonies were inoculated for DNA mini and medi

preparations.

II.2.4. Preparation of competent E. coli cells for electroporation

The amount of 5ml of LB medium was inoculated with a single colony of transformed

E.coli strain with vigorous agitation overnight at 37°C. The 5-ml culture was used to

inoculate 500 ml of LB medium at 37°C until the culture reached an OD600nm of 0.6-0.7.

The culture was then removed from shaker and placed on ice for 20-25 min. The bacterial

cells were centrifuged at 3,000g at 4°C for 10 min. The E.coli cells were washed three

times with sterilized water and suspended in ice-cold 10% (v/v) glycerol and 200 µl of ice-

cold distilled water. Finally 40 µl aliquots were stored at -80°C.

II.2.5. Transformation of E. coli by electroporation

The plasmid DNA (II.2.3; 50-100ng) was used for transformation of electro-competent

cells (II.2.1.3). The cells were thawed on ice and the mixture was transferred to the bottom

31

of prechilled (0.2cm) cuvette and assembled into a safety chamber. An electric pulse (25

μF, 2.5 kV, 200 Ω) was applied and then cells were diluted in 1 ml of LB medium and

incubated at 37°C with shaking for 1 h for regeneration of cells. Different volumes i.e 50-

100 µl of the transformed cells were plated onto LB agar (amp) and incubated at 37°C o/n.

II.3. Recombinant DNA techniques

II.3.1. Isolation of plasmid DNA

Plasmid DNA was purified using QIAprep® Plasmid Isolation Mini/medi Kit according to

the manufacturers‟ instructions. Quality and quantity of DNA was confirmed by analytical

agarose gel electrophoresis. Isolated DNA (II.3.1) samples were stored at –20 °C.

II.3.2. Restriction enzyme digestion

DNA restriction analysis was carried out for plasmid DNA (II.3.1) obtained from mini or

maxi-preparation. Restriction buffers were provided by the company and were chosen

according to manufacturer‟s recommendations. Double digests with two restriction

enzymes were carried out in buffer providing 70%-100% activity for either enzyme used.

1ng of plasmid DNA was restricted with 2U of enzyme for 1hrs at 37º C. If restriction

fragments were used for ligation, 0.5-1 µg of vector DNA (II.3.1) and 3-8µg of insert

DNA depending on the ratio of the insert with the plasmid were digested with 10U of

restriction enzyme for 2hrs are recommended temperature. Reactions were stopped by

freezing at 20°C until further processing. Fragments were subsequently separated by

agarose gel electrophoresis and photo-documented.

II.3.3. Agarose gel electrophoresis

Undigested plasmid DNA (II.3.2), PCR fragments (II.3.6) and enzyme restricted plasmid

DNA (II.3.2) was electrophoretically separated with agarose gels. Analysis for Plasmid

DNA from mini/midi preparation or digestion (II.3.2) or ligation fragments (II.3.4) were

separated with gel electrophoresis as described (Frisch et al., 1996) in 1.2% (w/v) agarose

gels supplemented with ethidium bromide (0.1g/ml). Ethidium bromide as visual marker

was added to the gel solution and TBE electrophoreses running buffer before to the

experiment. Known amount of DNA marker such as 1Kb and 100bp ladder digested with

32

PstI were used as size and concentration control. The DNA bands were visualised directly

upon illumination with a UV transilluminator at 302 nm. The pictures were taken with

camera and documented.

II.3.4. Ligation of DNA

The digested DNA fragments (II.3.2) were ligated 1μl Quick T4 DNA-Ligase (NEB) in

buffer systems recommended in the manufacturer‟s protocol in a final volume of 20μl.

The vector–insert ratio was calculated depending on the size of insert in relation to total

plasmid size. The ligation was carried out for 16 hours at 4º C. Sticky-end ligations were

carried out at room temperature for 5 to 30min depending on the ligase used.

II.3.5. DNA isolation

Total genomic DNA from wheat was isolated from young wheat leaves. Approximately

10cm long, young and fresh leaves were collected from plants and immediately frozen into

liquid nitrogen and were homogenized with pestle. Five hundred microlitre DNA

extraction buffer (1% (w/v) SDS, 100mM NaCl, 100mM Tris base, 100mM Na2EDTA,

pH=8.5 by HCl) was added to the crushed wheat leaf material. Equal volume (500l) of

phenol: chloroform: isoamylalcohol (in a ratio of 25:24:1) was then added and tubes were

shaken vigorously until a homogenous mixture was obtained. Samples were then

centrifuged at 5000rpm for 5 minutes. The aqueous phase was transferred to a fresh 15ml

tube. One-tenth volume (50l) of 3M sodium acetate (PH= 4.8) and equal volume (500l)

isopropanol was added in the tube to precipitate the DNA. The samples were then

centrifuged at 5000 rpm for 5min to make the DNA pellet. After removing the

supernatant, the pellet was washed with 70% (w/v) ethyl alcohol and was dried at room

temperature for an hour and re-suspended in 40l TE buffer (10mM Tris, 1mM EDTA and

PH = 8.0). To remove RNA, DNA was treated with 40g RNAse-A at 37C for 1 hour.

After RNAse treatment, DNA samples were stored at 4C. For PCR analysis, the wheat

DNA was diluted to 1: 4 in highly purified water.

33

II.3.6. Polymerase chain reaction

The Polymerase Chain Reactions were carried out using modified protocols of Devos and

Gale (1992). For PCR, DNA primers (Table II.1) weredeveloped for DsRed sequences.

Total of 25l PCR reaction was used containing 50-100ng total genomic DNA template,

0.25M of each primer, 200M of each dATP, dGTP, dCTP, dTTP, 50mM KCl, 10mM

Tris, 1.5mM MgCl2 and 2.5 units of Taq DNA polymerase. The PCR conditions were set

for amplification of the DNA. i) Denaturation step of 4 minute at 94C ii) 40 cycles each

consisting of a denaturation step of 1 min at 94C iii) annealing step of 1 minute at 34C

and iv) an extension step of 2 minutes at 72C. The last cycle was followed by 10 minutes

extension at 72C. All amplification reactions were performed using (name of the PCR in

the lab) programmable thermocycler. The amplification products were electrophoresed on

1.5 % (w/v) agarose/TBE gel, and visualized by staining with ethidium bromide (EtBr)

under ultra-violet (U.V) light. Sequence information for primers are given in Table II.1.

Table II.1: The sequences information of the primers used for DsRed detection.

II.3.7. Purification of DNA from agarose gel

Gel electrophoresis (II.3.3) was used to purify the desired DNA fragments (II.3.7)

obtained from restriction/ligation (II.3.2; II.3.4) of plasmid DNA (II.3.1). The fragments

of interest were made visible under UV light and cut out of the gel using a new razor blade

for each band. DNA was purified using QiaQuick spin columns (Qiagen, Studio City, CA)

following the manufacturer‟s protocol. Total elution volume was 50µl for further analysis.

S.No

Oligo Name Sequence (5'-3') Size (bp) Applification

product(bp)

1 DsRed 56e TACCCTGGTAGCTGCACAGG 20

362

2 DsRed 55e TATGTCAAGCACCCTGCCGA 20

34

II.3.8. Determination of the DNA concentration

The purified DNA was analysed by spectrophotometry by measuring the absorbance of the

solution at 260 nm, the wavelength at which both DNA and RNA absorb maximally to

determine the DNA concentration, 50µg/ml DNA equal an absorbance of 1 at 260 nm

(Fritsch et al., 1996).

II.3.9. DNA sequencing

A single plasmid colony (II.3.4) was amplified with by Qiagen minipreparation or

QiaFilter maxi preparation (II.3.1). The correct nucleotide sequencing of expression

construct was verified by sequencing of the purified DNA. The nucleotide sequencing was

performed at Fraunhofer Institute for Molecular Biology and Applied Ecology (IME),

RWTH Aachen using an ABI DNA sequencing apparatus for evaluation of sequence

correctness; results were compared with published sequences using Clone manager

software. The clones containing correct sequences were used in further studies.

II.4. Wheat transformation

Immature wheat (Triticum aestivum L. cv Bobwhite) were used as explants and grown in

the light chambers at Institute for Molecular Biotechnology (Biology-VII), RWTH

Aachen University and at Vienna Institute for Biotechnology, Department of Applied

Genetics and Cell Biology (DAGZ), University of Natural Resources and Life Sciences

(BOKU), Vienna, Austria. Plants were germinated in soil at 14ºC under 16h photo-period

light for three week until plantlets produce 3-4 tillers per plants (about three weeks). The

plantlets were taken to 25ºC day/night, 16h light. Pests and diseases were kept to

minimum by using cold treatment of soil at -80ºC for 2 days and by good housekeeping

practices. Plants with disease symptoms were discarded immediately. Immature embryos

of 13-15 days after anthesis (DAA) were used as starting material for wheat

transformation.

35

II.4.1. Isolation and pre-culture of immature embryo

The wheat seeds of 13-15 DAA were selected for isolation of immature wheat embryos.

All procedures were done microscopically in a sterile environment. The immature

embryos were removed with a size of approximately 0.5-1.5 mm which are generally most

responsive for callus induction. The germination response is relatively higher with such

embryos but there is genotypic variation as well. For each 9 cm petri-dish approximately

20-30 scutella were placed on induction medium (Table II.2). The embryos were located

within a central target area and orientating them with the uncut scutellum uppermost i.e.

the uncut side is bombarded (see Fig. III.5A). As negative control, 20 embryos were

placed on induction media for bombardment only with gold particles and without DNA.

Prior to bombardment, the donor material was incubated in the dark at 26 ºC for the next

5-6 days.

II.4.2. Preparation of DNA coated gold particles

The preparation of gold particle and coating was performed according to Sanford et al.,

1993. Prior to DNA coating, gold particle stocks of 150 ml containing 150 mg of gold

particle (0.6 – 0.9 µm) in size were prepared. For bombardment, 25mg of gold particles

were thawed and ultra-sonicate for 15sec. Gold particle were coated with plasmid DNA

with concentration of 20µg at final volume of 1 ml. The required amount of DNA was

adjusted, depending on the concentration of DNA. The required amount of DNA was

mixed with 25 mg of gold particle and double distilled water up to 100µl with constant

vortex. Added 200µl CaCl2 (2.5 M) and continued vortexing for 2 min. 100µl of fresh

made spermidin (0.1 M) was added to the mixture and vortex for additional 10 min. The

supernatant was removed after centrifugation at 13,000 rpm for 5 min. 500 ml of ice

chilled 100% ethanol was added and sonicated briefly. The washing was repeating again

with centrifuge at the same condition and supernatant were removed. 1ml of 100% ethanol

from the freezer were added to the pellet and sonicated for 15 sec. 160 µl of coated

solution was used for loading the macro-carriers.

36

II.4.3. Micro-projectile bombardment

The PDS-1000/He particle gun (BioRad, Munich, Germany) delivery system was used for

the delivery of coated DNA into 5-6 days old wheat embryos. For using biolistics,

appropriate safety precautions described by the manufacturer were followed.

All the accessories required such as rupture disks (650, 900 and 1100psi), micro and

macrocariers, rupture disc holder, stopping screen, and gold particles (0.6-0.9 µm) were

purchased from BioRad. A tank containing Hellium (He) gas with purity grad 5.0 was

used for pressure. A pump was used to create a desired amount of vacuum inside the

bombardment chamber of the gene gun.

Recommended settings were followed for PDS 1000/He as optimized: gap 2.5cm,

stopping plate aperture 0.8 cm, target distance 5.5cm, vacuum 28 Hg, vacuum flow rate

5.0, vent flow rate 4.5. All the equipments were sterilised with 70% (v/v) ethanol.

Sterilised the macro-carrier holders, macrocarriers, stopping screens and rupture discs by

dipping in 100% ethanol and allowed to evaporate completely before use. The DNA

coated gold particles were briefly vortexed before 160 ul of coated gold were taken.

Placed centrally onto the macro-carrier membrane and allowed to dry. Rupture disc of 650

psi and 950 psi was placed into rupture disc retaining cap and tightened. Macro-carrier

holder containing macro-carrier gold particles/DNA was placed over the stopping screen

in the nest that maintained its position using the retaining ring. Placed a sample on the

target stage of 2.5 cm gap, draw a vacuum of 27-28 Hg and fired the gun.

II.4.4. Tissue culture and selection of transformants

Immature wheat embryos (IEs) were cultured on MS-based (Murashige and Skoog, 1962)

Callus Induction Medium (W-ID), Induction Selection Medium (W-SM), Regeneration

Medium (W-Z10), Osmotic Medium (W-Osm) and Rooting Medium (W-R), with macro

elements, micro elements, recommended additives and plant hormones. The media were

solidified with 0.2% (w/v) gelrite. The ingredients for each media and other supplements

are listed in Table II.2.

37

Immature wheat zygotic embryos were used as explant for transformation. IEs were

isolated aseptically and bombarded (II.4.3) with DsRedzenH construct. Isolated IEs were

cultured immediately on W-ID medium and kept under dark at 26°C for 5-6 days. The IEs

were transferred to W-Osm 4 hours before bombardment and were transferred to W-SM

after 16-20 hours after bombardment. The Callus induction medium contained 2mg/L 2, 4-

D as auxin source for initiation and proliferation of calli while MS was used as nutrient

source for plant material in all tissue culture media. For selection of transformed cells the

proliferating calli were started one week after bombardment by transferring to W-SM

containing 2mg/L of herbicide Phosphenothricin (PPT) where selection continued for

transgenic Calli on SM-2 for two weeks in the dark at room temperature. Embryogenic

calluses are subsequently transferred to regeneration media (W-Z10) for shoot induction

under light at standard tissue culture conditions with 26°C temperature and 2000 lux light

intensity for 16h per day. Wheat regenerating media was supplied with zeatin as growth

hormone with MS and 3mg/L of PPT. Shoots regenerated from transgenic calli were

observed within three weeks on regenerating media (W-Z10). The calli were sub-cultured

on to fresh, hormone-free medium every three weeks. Shoots and plantlets of 3-5cm size

were transferred to ½ strength MS with 3mg/L PPT selection for proper plant

development. After three to four weeks plantlets of reasonable size and with developed

root system and were transferred to growth rooms in normal soil.

38

TableII.2: Media ingredients used for wheat tissue culture.

Ingredients

W-ID

W-SM

W- Osmoticum

W-Z10

W-RM

MS Basal Salts/g 4.39 4.39 4.39 4.39 2.19

Sucrose/g - - 20 10

Manitol/g - - 36.4 - -

Maltose/g 40 40 30

Sorbitol/g - 36.4 - -

Glutamine/mg 500 500 500 - -

2,4-D/mg 2 2 2 - -

Zeatin/mg - - - - -

PH w/ NaOH 5.8 5.8 5.8 5.8 5.8

Gelrite/g 2.5 2.5 2.5 2.5 2.5

After autoclaving

PPT/mg - 2 - 2 3

Zeatin - - - 10

Vit-mix (500X)/ml 2 2 2 2 1

Temperature (°C) 24-25 24-25 24-25 24-25 24-25

Stock Ingredients

MS Vitamins

Using Duchefa stock powder, 1000X solution were prepared and filter sterilised with a

0.25um filter. Stored at 4°C for maximum duration of 3 months.

Stock solutions

Make up stock of 4mg/ml 2,4-D in 100% (v/v) Ethanol and were stored at 4°C. Prepared

stock of 10mg/ml of PPT in 70% (v/v) ethanol. The solutions were stored indefinitely at –

20°C.

39

Table II.3: List of ingredient and suppliers

Ingredient Supplier Catalogue Number

MS Basal Salts Duchefa M0221

MS Vitamin Stock Duchefa M0409

Sucrose Grade I Sigma S5390

Sucrose Grade II Sigma S5391

Mannitol Roth NA*

Sorbitol Roth NA*

L-Glutamine Sigma G8540

Casein Hydrosylate Sigma C7290

2,4-D Duchefa D0911

Zeatin Sigma (also Duchefa) Z0164

*NA. Not available.

TableII.4: MS vitamin ingredients

Made up to 500X solution with 100ml distilled water. Filter sterilised with a 0.25um filter

and stored at 4°C for up to 3 months.

Ingredients

Amount (mg)

Myo-Inositol 5000

Glycine 100

Nicotinic Acid 25

Pyridoxine HCl 25

Thiamine HCl 5

40

II.4.5. Selection and propagation of transgenics

Selection of transgenic plants was carried out by three methods listed below.

II.4.5.1. DsRED expression

The cells carrying transgene can be easily screened by DsRed expression under

fluorescent microscope. The red fluorescence can be observed in embryo cells after 18

hours of the bombardment and the images were documented.

II.4.5.2. PPT assay for transgenic plants selection

Transgenic wheat plants were selected by spraying the herbicide solution (PPT) on two

weeks old plants. Solution contained 150mg/L of PPT were applied twice after

transferring the regenerating plantlets to the soil. The plants were treated by spraying or

dipping the wheat leaves into PPT solution. The non-transformed plants were dried or died

with the herbicide application facilitating the final transgenic selection. Wheat plants

surviving under selection pressure were grown in growth rooms under standard conditions

till maturity and the seeds were harvested to advance to the next generation.

II.4.5.3. Regeneration and segregation on selection media

T1 generation wheat seeds were soaked overnight in distilled water and the embryos were

removed aseptically and cultured on MS half media with 3.0 mg/L of PPT. The transgenic

lines showed fast regeneration compared to wild type (Wt) BobWhite wheat embryos as

negative control. The transgenic lines showed a 3:1 segregation pattern. A total of 50

embryos were checked for regeneration and segregation. The wheat line resistant to

herbicide phosphenothricin (PPT) was used as positive control.

II.5. Protein analysis

II.5.1. Isolation of total soluble proteins from wheat tissues

Total proteins were extracted from wheat leaves, endosperm and embryo of the transgenic

lines (II.5.1). Using vibrator, the three tissues were frozen in liquid nitrogen and grounded

to a fine powder. The samples were homogenized with 3 volume of protein extraction

41

buffer (II.1.2). Centrifuge for 15sec and the 100ul of supernatant was added to new 1.5

eppendorf tube. Centrifuge again for 40 min at 13,000 rpm at 4°C. Discarded the

supernatant and the pellet was re-suspended in 5X loading buffer for further analysis.

II.5.2. SDS-polyacrylamide gel electrophoresis of proteins

SDS-polyacrylamide gels (SDS-PAGE) were used for separation of proteins with stacking

and separating gels (II.1.2). The plant extract (II.5.1) re-suspended in 5x protein loading

buffer, were analysed using 12% Polyacrylamide (PAA) gels following manufacturer‟s

instructions. Samples were denatured by incubation in a boiling water-bath or on heater at

100°C for 10 min. SDS-PAGE was performed using BioRad electrophoresis apparatus

with timely increasing voltage of 50V for 5min, 100V for 10min, and 150V for 10min and

finally at 200V for 90 min or until the bromophenol blue front ran out of the gel.

II.5.3. Coomassie brilliant blue staining

The proteins separated on SDS-PAA gels were revealed by staining with Coomassie

Brilliant Blue for 1 hour in Coomasie staining solution (II.1.2) at RT under constant

rocking. Coomassie staining was removed with de-staining solution (II.1.2) until the bands

were clearly visible. SDS-PAA separated proteins were analysed to Western blot (II.5.4).

The pictures were saved for documentation.

II.5.4. Western blot

Electrophoretically separated protein by SDS-PAA gels (II.5.2) were analysed for gamma-

zein with specific antibodies. In the presence of transfer buffer, Electrotransfer was carried

out with the BioRad Mini-Transfer apparatus to HybondTM-C nitrocellulose membrane

(0.45um). The transfer was done under constant cooling at 60V for 90 minutes. The

membrane was washed 3 times with PBS-T and once with PBS. The successfully

transferred protein membrane was blocked with PBS buffer (II.1.2) containing 5% (w/v)

skim milk for one hour. The membrane was washed 3X with PBS-T and once with PBS.

Then, the membrane was labelled with the primary antibody (Rabbit 27kD γ-zein) at

dilution of 1/1000 for overnight at 4 ºC. The protein membrane was kept 30min at room

temperature, followed by 3x washing with PBS-T and once with PBS. The the bound

42

antibody was revealed by addition of secondary antibody (Anti Rabbit IgG) for 1hours at

concentration of 1/5000 at room temperature. The membrane was washed three times with

PBS-T and once with PBS buffer. The targeted protein was finally detected by substrate

NBT/ BCIP (BioRad) in distilled water for 15min or until the bands appeared.

II.6. Immunolocalization studies

II.6.1. Fixation and embedding

Different wheat tissues i.e. leaf, endosperm and embryo were fixed for

immunocytochemistry and structural analysis. Wheat samples were processed for

immunolocalization and ultrastructural analysis as described previously by Arcalis et al.,

2004.

II.6.2. Fixation for immunocytochemistry

The samples were sliced mm³ and fixed in fixed in 4% (w/v) paraformaldehyde and 0.2%

(v/v) glutaraldehyde in phosphate buffer (II.1.2). Samples were incubated in fixation

solution for overnight at 4°C. The samples were washed 5 times each with 0.1M for

15min. Dehydration was carried out first by passing the specimens through an ethanol

series (Table II.6). Samples were incubate each for 90 min in 50% (v/v), 70% (v/v) at 4°C

and followed by 96% (v/v) and 100% (v/v) ethanol at room temperature, each for the same

time. Specimens were therefore infiltrated in LR White Resin (London Resin Company

Ltd, UK), in a series 1:1, 1:2, 1:3 ethanol:resin (v/v), for 1 h each, and 100% (v/v) resin

overnight at 4°C. The specimens were transferred to inclusion molds filled with pure resin

avoiding air bubbles. The samples were allowed to polymerize at 60°C for 48 h. Then,

100-nm ultrathin sections (for electron microscopy) or 1μm sections (for light

microscopy) were obtained using a Leica Ultracut E ultramicrotome and collected on

Formvar-coated 200 mesh gold grids (Sigma) for electron microscopy or on glass slide for

fluorescent microscopy.

II.6.3. Fixation for ultra-structure

Wheat samples including endosperm, leaves and embryos tissues were sliced in 1mm size

and fixed overnight in fixation solution (II.1.2) at 4°C. The vibratome sections were

43

washed 5 times for 15min with 0.1M phosphate buffer (PB). The samples were processed

in 1% (w/v) osmium in 0.1M phosphate buffer (PB) supplemented with 0.8% (w/v)

KFeCN for 3 hours. The osmification was performed under fume hood and used osmium

solution was discarded in a container filled with plant oil. Samples were washed with

0.1M phosphate buffer (PB) 5 times for 15min each. Dehydration was followed after

washing in a series of acetone solution. The acetone dehydration series was carried out

according to the table (Table II.5)

Table II.5. Series of acetone dehydration used for ultra structure fixation.

The specimens were infiltrated in different mixture of ethanol and spur resin as given in

the table below. The specimens were heated to polymerize at 60°C for 48 h.

Table II.6. Mixture of resin/ethanol used for ultra structure fixation of the tissues.

Resin/Ethanol (v/v) Time Temperature

1:3 3 Hours RT

2:2 3 Hours RT

3:1 3 Hours RT

Pure resin Overnight 4 °C

Acetone % Time (min) Temperature (°C)

30 1*10 4

50 2*10 4

70 3*10 4

96 3*10 4

100 3*15 4

44

The ultra-thin sections were made using Leica Ultracut E ultramicrotome. 100-nm

ultrathin sections were used for electron microscopy and 1-μm sections for light

microscopy and fluorescent microscopy.

II.6.4. Light and electron microscopy

Ultrathin sections were cut using a Leica Microsystems Ultracut UCT, mounted on 300-

mesh nickel grids and immunogold labeled. Grids were floated on drops 5% (w/v) bovine

serum albumin (BSA) in 0.1M phosphate buffer for 15 min at room temperature. The

sections were incubated with primary antibody (Polyclonal DsRed) for overnight at 4°C.

The primary antibody was diluted at 1:500 as prescribed by the manufacturer. The sections

were washed with PBS-T two times for 10 min at room temperature. Incubated with

secondary antibody i.e. Goat anti-Rabbit Alexa-546 at the concentration of 1:30

conjugated with 15nm gold particles. At room temperature, washed twice with phosphate

buffer (0.1M) for 10min. Washed again two times for 10min each. The samples were air

dried before used for electron microscopy analysis. Controls were processed following the

same protocol. For light microscopy, the samples were stained in toluidine blue and

starches were stained by incubating section with Lugol‟s iodine solution for 5min.

II.6.5. Immunofluorescent labeling

The wheat seed and leaf samples were fixed as described (Arcalis et al., 2004). The 60 to

100 µm vibratome sections were prepared and dried well. The specimens were blocked

with bovine serum albumin (BSA) in 0.1M phosphate buffer pH 7.4 for 15min at room

temperature. The specimens were ncubated with primary antibody (DsRed Polyclonal

antibody) at concentration of 1/500 overnight at 4°C. The thin sections were washed with

PB-T (II.1.2), followed by incubation with secondary antibody (goat anti Rabbit, Alexa

546) at dilution of 1/30 in 0.1M phosphate buffer under dark conditions. The samples

were washed with phosphate buffer (0.1M, pH 7.4). Finally the thin sections were washed

with distilled water and air dried in dark for confocal and florescent microscopic analysis.

45

II.6.6. Fluorescence microscopy

Fluorescent markers (DsRed) exclude the sample preparation for protein detection in plant

cells. Therefore the wheat seed and leaf samples were cut in 0.1 M phosphate buffer pH

7.4 and applied directly for fluorescent microscopy analysis. Red fluorescent images were

detected under the green light filter.

II.6.7. Confocal microscopy

The wheat seed and leaf containing DsRed as fluorescent marker did not require any

sample preparation for confocal microscopy. Therefore, the samples were cut in 0.1 M

phosphate buffer pH 7.4 and applied examined for confocal microscopy analysis. Red

fluorescent images were collected after 543 nm excitation using a 550-600 nm emission

window.

46

III. RESULTS

The maize seed storage protein γ-zein is a class of prolamin that can induce the formation

of protein bodies in its native environment, the endosperm. However, the expression of γ-

zein in diverse eukaryotic cells has shown that it also induces the formation of novel

compartments in many heterologous backgrounds making it potentially useful as a more

general approach for recombinant protein expression. We generated an expression

construct comprising 90 amino acids sequences i.e repetitive (VHLPPP)8 and Pro-X

domain of maize prolamin (γ-zein) fused with Discosoma spp. red fluorescent protein

DsRed under the control of a constitutive ubiquitin promoter (Fig. III.1), allowing the

protein to be expressed in both seed and non-seed tissues in wheat plants. Transgenic

wheat lines produced by particle bombardment (II.4.3) were used to analyze the

expression and distribution of the recombinant model proteins, focusing on the formation

of fluorescent protein bodies which were investigated using a range of molecular,

immunological and imaging methods. Recombinant fusion protein (γ-zeinDsRed)

accumulated in the artificial protein bodies in all tissues analyzed. The subcellular

localization of constitutively expressed recombinant fusion proteins were examined in

both seed and green tissues. The possible degradation of the fusion proteins was

investigated by immunoblot analysis (II.5.4) and their accumulation within novel protein

bodies was confirmed by the immunofluorescence labeling (II.6.5) of leaf, endosperm and

embryo tissues from transgenic wheat plants.

III.1. Fusion protein expression construct

The fusion protein containing the entire DsRed coding sequence joined to the 90 amino

acids of γ-zein comprising proline rich repetitive (PPPVHL)8 and Pro-X domain. The

fusion gene was inserted into the pTRA vector downstream of the constitutive ubiquitin

promoter, and in frame with a His6 tag to facilitate affinity purification. The vector

backbone included an Escherichia coli origin of replication and ampicillin resistance gene

for cloning, and the bar resistance gene conferring resistance to the herbicide

phosphinothricin (PPT) for selection in plants. Transcription bar gene is also driven by the

constitutive promoter ubiquitin. The final expression vector was named DsRedzenH (Fig.

III.1).

47

12386 bps

2000

4000

6000

8000

10000

12000

AscI

SalIXhoI

NcoI

SalIBamHI

SalI

SacIIKpnI

SalIXhoI

NcoIEcoRINcoI

BstXI

NotIXhoISacI

BamHI

PmeI

MscI

PvuI

SapI

SAR

Pubi

5'UT

intron

bar

pA35S

SAR

Pubi 5'UTintron

CHS

LPHglycoDsRed

gamma-zeinhis6-tagpA35S

SAR

RB

RK2 ori

bla

ColE1 ori

LB

Figure III.1 Vector map of pTRAbux-DsRed.zen-H (DsRedzenH). E. coli DH5α competent cells (II.2.2)

were transformed by heat shock (II.2.2) and single colonies were tested by PCR (II.3.6) to confirm the

presence of an insert (II.3.9). The recovered plasmids (II.3.7) were digested with restriction enzymes (II.3.2)

to verify the orientation of the insert, and its integrity was confirmed by sequencing (II.3.9).

48

Figure III.2 Structure of the pTRAbux-DsRed-zenH (DsRedzenH) expression vector.

III.2. Transformation of wheat plants

Approximately 1500 immature wheat embryos were bombarded (II.4.3) with DNA-coated

metal particles (Fig. III.4) and the tissues were cultured for 14 days to induce the

formation of callus. Individual explants were transferred to selection medium (Table II.2)

containing 2 mg/ml PPT and subcultured onto the same medium at regular intervals (Fig.

III.5). Following selection (II.4.5), independent transgenic callus lines were placed on

regeneration medium (Table II.2) containing 3 mg/ml PPT for 3 weeks in natural light.

Transgenic shoots ~15 cm in length were transferred to soil in the greenhouse, and

checked for PPT resistance after 2–3 weeks by spraying with 250 mg/L PPT every 2 days.

Ten transgenic plants were recovered but only three were selected for further analysis

based on highest expression of DsRed in leaves (II.4.3) and were cultivated in the

greenhouse until mature. The wheat transformation protocol is summarized in Figure III.3.

49

Figure III.3 Wheat plant transformation procedure. A. Immature wheat embryos were isolated

aseptically 14 days after anthesis (II.4.1) and maintained on induction medium (Table II.2) for 6 days in

darkness. B. Six-day-old embryos were placed on osmoticum medium (Table II.2) before bombardment C.

Bombardment was carried out using the PDS-1000/HE (II.4.3) D. Fluorescence imaging (II.6.6) confirmed

DsRed expression in wheat cells 24 h post-bombardment. E. Transgenic wheat callus pieces began to

regenerate under illumination. F. Three-week-old wheat plants continued to flourish on regeneration

medium (Table II.2) G. Transgenic plantlets developed on ½MS medium (Table II.2) containing PPT

(II.4.4) H. The plantlets were transferred to the greenhouse and maintained under selective conditions

(II.4.4). T. Transgenic wheat plants were grown to maturity in the greenhouse.

50

Figure III.4 Bio-Rad PDS1000/He particle bombardment apparatus.

Figure III.5 Wheat tissue culture: from immature embryos to shoot development. A. Immature

embryos (14 days after anthesis) on induction medium (Table II.2). B. Seven-day-old wheat embryos pre-

bombardment (II.4.3) C. Wheat callus 5 days post-bombardment (II.4.3) D. Three-week-old transgenic

callus on selection medium (II.4.5.2) E. Wheat callus producing shoots (II.4.5.3) on regeneration medium

(Table II.2) under illumination. F. Shoot development after 3 weeks on regeneration medium (Table II.2)

under illumination.

51

III.3. Selection of wheat plants using PPT

Wheat callus derived from immature embryos was bombarded (II.4.3) with plasmid

DsRedzenH (Fig. III.1) containing the bar gene for selection with PPT (Fig. III.5). When

the primary transformants reached maturity, T1 seeds were harvested to generate T1 plants

for segregation analysis under PPT selection (II.4.5.3). We analyzed 20 T1 plants for each

line (WA-07, WB-21 and WB-28) by applying an aqueous solution containing 150 mg/L

or 250 mg/L PPT on the 15th

and 25th

days after germination (Fig. III.6). Two weeks later,

the appearance of the plants was recorded and the surviving plants were evaluated for the

presence of the transgene. All three transgenic lines produced plants that were resistant to

PPT whereas the sensitivity of all wild-type plants was apparent (Fig. III.6).

The segregation ratio was determined by harvesting 50 immature seeds at least 15 days

post-anthesis from each line, surface sterilizing the seeds and rescuing the embryos

(II.4.1). The embryos were placed on ½MS medium (Table II.2) containing 3.0 mg/L of

PPT and the proportion of resistant and sensitive embryos was determined (Fig. III.7).

Transgenic PPT-resistant wheat plants were used as positive controls and wild-type plants

as negative controls (Fig. III.7). We observed the expected 3:1 Mendelian segregation

ratio for all three transgenic lines (WB-21, WB-28 and WA-07) after 10 days, indicating

single-locus integration.

52

Figure III.6 Wheats plant after PPT application. The transgenic wheat leaves were examined under

fluorescence microscope (II.6) for DsRed expression and were selected for PPT analysis. The plants were

sprayed with an aqueous solution containing 150 mg/L or 250 mg/L PPT on the 15th

and 25th

days after

germination. Two weeks later, the appearance of the plants was recorded and the surviving plants were

evaluated for the presence of the transgene.

A, B, C. Wild type cv. Bobwhite plants are affected with PPT application. D, E, F. Transgenic wheat lines

WB-21, WB-28 and WA-07, respectively, showing resistance to PPT.

53

Figure III.7 Segregation of transgenic wheat lines: Embryos were removed aseptically from the

transgenic wheat seeds and were placed on ½MS medium (Table II.2) containing 3.0 mg/L of PPT. The petri

dishes were placed in growth chamber at 25 ˚C for one week and germination of the embryos was observed.

1. Growth of T1 embryos after one week on ½MS medium (Table II.2) with PPT. A, B. Transgenic line WB-

21. C, D. Transgenic line WB-28. E, F. Transgenic line WA-7 shows high resistance to PPT with normal

germination N. No germination was observed for wild type wheat (cv. Bobwhite) used as negative control 2.

Growth of wheat embryos after 10 days on ½MS medium (Table II.2) to confirm growth of positive and

negative controls on PPT containing media. A Normal growth was observed for positive control (PPT-

resistant wheat line) B. Embryos show no germination for wild type wheat cv. Bobwhite used as negative

control.

54

III.4. Molecular verification of transgenic wheat lines

Transgene integration in the wheat lines was confirmed by testing immature embryos of T1

plants rescued under PPT selection (II.4.6.2) by PCR (II.3.6). Germinating embryos

(Fig.III.5) developed into plants after transfer to soil (Fig.III.3T). The total genomic DNA

was extracted from leaves (II.3.5) and amplified using forward and reverse primers

specific for the DsRed transgene (Table II.1). The anticipated 362-bp product was

identified in all three transgenic lines (Fig. III.8) matching the plasmid positive control (II.

3.1). There was no product amplified in the negative control (wild-type wheat cv.

Bobwhite).

Figure III.8 Confirmation of transgene integration by PCR. PCR was performed as described (II.3.6)

for total genomic DNA isolated (II.3.5) from transgenic wheat leaves. 5µl from 25 µl reaction was applied

on to 1.2% TAE agarose gel (II.3.3). PCR products of 362 bp were amplified using primers designed for

DsRed (Table II.1). All three transgenic wheat lines (WB21, WB 28 and WA07) yielded a 362-bp

amplification product, matching the positive control, DsRedzenH (II.3.1). There was no band in the negative

control lane corresponding to wild-type wheat leaves. 100bp ladder was used as marker.

55

III.5. DsRed as a marker for selection and protein

trafficking

Fluorescent marker DsRed was utilized as fusion protein to monitor the expression of

recombinant proteins in transgenic wheat tissues. As fusion, DsRed was found very

beneficial for transgene selection at very early stages of transformation process.

Fluorescence microscopy (II.6.6) revealed strong DsRed fluorescence in transgenic callus

18 h after bombardment (Fig.III.10). A more detailed time-course analysis confirmed

DsRed fluorescence in rapidly-dividing callus cells (Fig. II.10 A, B, C, D, E, F), allowing

these cells to be selected for regeneration. Transgenic plants from lines WA-7, WB-21 and

WB-28 showed a high and consistent level of transgene expression in the leaves, and were

selected for further analysis (Fig. III.11A, B,C). Leaves from wild type plants showed no

evidence of fluorescence (Fig. III.11D).

DsRed was also used as fluorescence marker for trafficking of recombinant proteins,

reflecting the detection of labeled protein bodies by fluorescence (II.6.6) and confocal

microscopy (II.6.7) from 8-10 days post anthesis. In addition, the fusion protein could also

be detected using DsRed-specific antibodies for immunofluorescence analysis (Fig. III 15,

16 and 18). The γ-zein-DsRed protein was also identified immediately after the isolation

of total soluble protein from transgenic wheat leaves and seeds (III.5.1) when the protein

pellet was illuminated with green light (Fig. III.9). No DsRed fluorescence was detected in

extracts from the wild type cv. Bobwhite (negative control).

56

Figure III.9 Protein pellets extracted from wheat leaves under green light. Leaf tissues from transgenic

wheat line (WA-07) were homogenized with 3 volume of protein extraction buffer (II.1.2). The mixture was

centrifuged for 40 min at 13,000 rpm at 4 ˚C and examined under green light with red filter.

A. Red fluorescence was observed in the bottom pellet shows evidence of recombinant proteins

accumulation in transgenic wheat leaf. B. Protein extracts (II.5.1) from wild type wheat cv. Bobwhite protein

shows no fluorescence.

57

Figure III.10 DsRed expression during transgenic callus development. Wheat immature embryos (after

14 days post anthesis) were placed on W-ID medium (Table II.2) for six days under dark condition at room

temperature. The plasmid DNA (II.3.1) was coated with gold particles (II.4.2) and regenerating wheat calli

were bombarded as described (II.4.3).

Fluorescence images (II.6.6) A, B, C, D, E, F taken 1, 2, 6, 12, 16 and 20 days after bombardment (II.4.3).

The expression of recombinant protein (γ-zein-DsRed) is visible in growing wheat calli 18 hours after

bombardment (II.4.3).

58

Figure III.11. DsRed as a visual selection marker in transgenic wheat lines. Young transgenic leaves

were cut into small pieces in 0.1 M phosphate buffer, pH 7.4 (II.1.2) and examined for the expression of

recombinant proteins.

Fluorescence microscopy images (II.6.65) confirms DsRed transgene expression in A. WB-21, B. WB-28

and C. WA-7 transgenic leaves, compared to D. No red fluorescence was observed in wild-type cv.

Bobwhite used as negative control. Bars, 500 µm (A, B, C, D).

59

Figure III.12 Expression of induced protein bodies in wheat endosperm cells. Transgenic wheat seeds

were analyzed 17 days post anthesis for recombinant protein production in wheat endosperm cells. The seeds

were sliced in 0.1 M phosphate buffer, pH 7.4 (II.1.2) and observed under florescence microscope (II.6.6).

Fluorescence microscopy (II.6.6) images are shown at progressively higher magnifications. Numerous

DsRed bodies were observed throughout the endosperm cells confirmed the accumulation of recombinant

proteins (γ-zein-DsRed) in wheat storage tissues. Bars 500 µm (A), 200 µm (B), 100µm (C), 50µm (D).

60

Figure III 13. Expression of DsRed protein bodies in wheat embryo cells. Transgenic wheat seeds were

analysed 17 days post anthesis for recombinant protein production in wheat embryo cells. The embryos were

isolated and sliced in 0.1 M phosphate buffer, pH 7.4 (II.1.2) and observed under florescence microscope

(II.6.6).

Fluorescence microscopy (II.6.6) images are shown at progressively higher magnifications. The fluorescence

micrographs confirm the accumulation of recombinant proteins in wheat embryo cells. Higher expressions of

recombinant proteins were observed in wheat embryo than endosperm cells. Bars 200 µm (10X), 100 µm

(20X), 50µm (40X), 50µm (63X).

61

III.6. Model fusion protein in wheat tissues

After successful transgenic plant generation, the expression and subcellular localization of

the recombinant fusion protein in wheat seed and vegetative tissues was investigated by

immunoblot (II.5.4), fluorescence (II.6.6) and confocal microscopy (II.6.7) and

immunolocalization experiments (II.6).

III.6.1. Presence and stability of the recombinant protein

The heterologous expression of repeated and Pro-X portion from γ-zein resulted in

ubiquitous expression the partner protein (DsReD) in a tissue independent manner in

wheat plant. Western blot analysis of wheat leaf, endosperm and embryo tissues extracts

(II.5.1) confirmed the integrity of the fused proteins, with an apparent molecular mass of

approximately 37 kDa (Fig.III.14 A). Total soluble proteins were extracted from wheat

tissues (II.5.1) separated by SDS-PAGE (II.5.2), transferred to a membrane (II.5.4) and

probed with a primary (rabbit anti-27kD γ-zein) and secondary antibody (goat anti-rabbit

IgG) and visualized using NBT/BCIP substrate. The presence of anticipated 37-kDa band

in all three tissues revealed that the recombinant fusion protein has been successfully

accumulated in wheat seed and vegetative tissues (Fig. III.14A). There was no equivalent

band in total soluble protein extracted (II. 5.1) from corresponding tissues in wild-type

wheat cv. Bobwhite. Total protein extracted (II.5.1) from transgenic tobacco leaves

expressing DsRed-zenH was used as a positive control.

To find out the possible degradation of the recombinant fusion protein in seed tissues

(endosperm, embryo), transgenic wheat seeds were stored for five months at normal room

conditions. The total proteins extracted (II.5.1) from wheat endosperm and embryo tissues

were subjected to SDS-PAGE (II.5.2) and western blot analysis (II.5.4). The protein

extracts were probed with the primary (rabbit anti-27kD γ-zein) and secondary (goat anti-

rabbit IgG) antibodies. The presence of 37-kDa bands presented the evidence that no

significant degradation in the endosperm and embryo tissues were detected (Fig.III.14B).

62

Figure III. 14. Immunoblot confirming the presence and stability of the recombinant γ-zein-DsRed

fusion protein in wheat tissues. Immunoblot confirms the accumulation of the recombinant γ-zein-DsRed

fusion proteins in different wheat tissues. Total soluble protein extracted from three wheat tissues (II, 5.1)

was separated by 12% (w/v) SDS-PAGE (II.5.2) and blotted onto a nitrocellulose membrane (II.5.4) for

immunodetection with antibodies against γ-zein. Visualization was performed using NBT/BCIP substrate.

Transgenic wheat seeds were stored for 5 months at room temperature. To find out possible degradation of

recombinant proteins, total protein extract from leaf, endosperm and embryo (II. 5.1) were separated by 12%

(w/v) SDS-PAGE (II.5.2) and blotted onto a nitrocellulose membrane (II.5.4) for immunodetection with

27kDa- γ-zein antibody and visualized using NBT/BCIP substrate.

A. Immunoblot micrograph for fresh wheat tissues extracts (II, 5.1).1. Pre-stained plus protein ladder. 2.

Positive control extract from transgenic tobacco expressing the DsRedzenH construct (II,5.1). 3. Negative

control extract from wild type wheat seed extract (II, 5.1) shows no band. 4. Young transgenic wheat leaf

extract (II, 5.1), containing the 37-kDa fusion protein. 5. Transgenic wheat endosperm extract (II, 5.1),

containing the recombinant fusion protein. 6. Transgenic wheat embryo extract (II, 5.1), containing the

recombinant fusion protein. B. The prescence of the recombinant fusion proteins (DsRed-zeinH) in wheat

seed tissues after five months storage. The existence of 37-kDa bands demonstrates that no degradation

products were detected in wheat tissues including 1. whole seed 2. embryo 3. endosperm.

63

III.6.2. Model fusion protein expression and accumulation in

transgenic wheat leaves

The detailed expression profile of the γ-zein-DsRed fusion protein in leaves was analyzed

by fluorescence (II.6.6) and confocal microscopy (II.6.7) revealing strong and constitutive

expression (Figures III.15A and III.11). The signal is clearly concentrated within small

protein aggregates approximately 2 µm in diameter, which is similar to the native zein

bodies in maize endosperm. The induced protein bodies in leaves appeared to be larger

than those induced in embryo cells. Figure III.15C shows leaf cross-sections stained with

anti-DsRed antibodies, revealing the anticipated formation of abundant and uniformly-

distributed protein bodies in the cytoplasm (Fig. III.15A, B). Immunolocalization

experiments showed that these recombinant DsRed bodies were always intracellular

(Fig.III.15C) and no signal was detected outside the cell wall confirmed that recombinant

fusion proteins were not secreted (Fig. III. 15C). Furthermore, no fluorescence was in the

negative control samples (wild type Bobwhite cv).

64

Figure III.15 DsRed protein bodies in leaf cells. Small squares of transgenic wheat leaf were fixed in 4%

(w/v) formaldehyde, 0.2% (w/v) glutaraldehyde in 0.1 M phosphate buffer, pH 7.4 (II.1.2). Microtome

sections were infiltrated and polymerised at 60˚C for 48 hours in LR White Resin. For immunolabeling,

ultrathin sections of 1-µm were obtained and incubated with primary antibody (DsRed polyclonal antibody)

at concentration of 1/500 at 4˚C overnight and secondary antibody (goat anti Rabbit, Alexa 546) at dilution

of 1/30 in 01 M phosphate buffer pH 7.4 (II.1.2) under dark conditions. For fluorescent (II.6.6) and confocal

microscopy analysis (II.6.7), the samples were cut in 0.1 M phosphate buffer pH 7.4 (II.1.2) and examined

under microscope.

A. Fluorescence micrograph (II, 6.6) of transgenic wheat leaf expressing recombinant fusion proteins which

are sequestered in cytosol. B. Confocal micrograph (II.6.7) of transgenic leaf expression numerous induced

protein bodies dispersed all over leaf cells, C. Immunofluorescence labeling (II, 6.5) of leaf ultra thin

sections showing the localization of recombinant protein bodies in leaf cells D. Fluorescent micrograph of

wild type wheat (Bobwhite) leaf where no red signals were observed. Bars 500 µm (A,B, D), 25 µm (C).

65

III.6.3. DsRed mobility in wheat leaf tissues

Time-lapse confocal imaging revealed that the fluorescent protein bodies were highly

dynamic, exhibiting unpredictable although unidirectional and continuous movement

within the leaf cells. This is the first time that the mobility of a recombinant protein has

been documented in wheat cells, although a similar phenomenon has been observed in

Nicotiana benthamiana leaves with a green fluorescent protein (GFP) elastin like peptide

(ELP) fusion (Conley et al., 2009). The significance of ceaseless moment of red bodies for

protein trafficking in wheat cells is unclear as they were moving within the cell without a

final destination. The precise intracellular pathway of the recombinant fusion protein

could not be predicted due to their unpredictable and unidirectional movement in each

cell.

III.6.4. Model fusion protein expression and accumulation in

transgenic wheat endosperm

The expression of γ-zein-DsRed fusion proteins in the endosperm cells was next

investigated. The recombinant fusion protein also induced protein bodies in the wheat

endosperm tissue. Fluorescence (II.6.6) and confocal microscopy (II.6.7) analyses

revealed the presence of numerous, evenly-distributed protein bodies containing DsRed,

but we observed a size gradient from the young endosperm cells below the aleurone layer

to the older cells in the deeper starchy endosperm 10 days post anthesis (Fig. III.16 A,C

and III.12). Figure III.17A and B show the presence of DsRed protein bodies in the

endosperm particularly in large vacuolar compartments containing aggregates of

endogenous storage protein bodies. The DsRed protein bodies can be seen as separate

peripheral entities in the prolamin bodies (Fig. III.16 C, B and III.17A,B). In addition, the

fluorescence signals of γ-zein-DsRed in endosperm cells appeared to be slightly weaker than

those observed in leaf and embryo cells. No labeling was detected in the apoplast or in any

other cell compartment such as starch granules (Fig. III.16B) and in the wild type wheat

endosperm. In the starchy endosperm cells, the artificial DsRed bodies were found spherical

structures of approximately 2-µm in size (Fig. III.16A), which strongly resemble in size and

appearance to the native zein bodies found in maize endosperm.

66

Immunolocalization experiments (II.6) of endosperm thin section tagged with polyclonal

DsRed antibody revealed the trafficking of recombinant proteins in the ectopic tissues. We

report that the recombinant fusion proteins in endosperm tissues were found localized in

artificial protein bodies. The recombinant DsRed bodies were either found separate

entities or sequestered into central PSVs (Fig. III.17A). In ectopic wheat endosperm cells,

the recombinant proteins most probably followed the bulk of endogenous glutenins. The

artificial protein bodies containing recombinant proteins could be seen in the cytoplasm

were apparently in the process of entering the central vacuole (arrow; Fig. III.17A). Figure

III. 16B demonstrate that the recombinant fusion protein has been localized in the central

PSV where recombinant γ-zein proteins could be found at the exterior of the central

storage vacuole (arrow). In transgenic wheat endosperm, the PSV contained two types of

prolamins, the native and recombinant fusion protein (maize prolamin). However, the

recombinant prolamins (γ-zein-DsRed) were distinguished by their fluorescence (Fig.

III.18A, B). Unlike leaf cells, the movement of the recombinant bodies could not be seen

in endosperm cell.

67

Figure III.16 Recombinant DsRed protein bodies in wheat endosperm. Small squares of transgenic

wheat endosperm were fixed in 4% (w/v) formaldehyde, 0.2% (w/v) glutaraldehyde in 0.1 M phosphate

buffer, pH 7.4 (II.1.2) as described (II.6.5). Specimen were infiltrated and polymerised at 60 ˚C for 48 hours

in LR White Resin. For immunolabeling, ultrathin microtome sections of 1-µm were obtained and incubated

with primary antibody (DsRed polyclonal antibody) at dilution of 1/500 and secondary antibody (goat anti

Rabbit, Alexa 546) at dilution of 1/30 in 01 M phosphate buffer (II.1.2) under dark conditions. For

fluorescent (II.6.6) and confocal microscopy (II.6.7), samples were cut in 0.1 M phosphate buffer pH 7.4

(II.1.2) and examined under microscope.

A. Fluorescence micrograph (II.6.6) of transgenic wheat endosperm expressing γ-zein-DsRed bodies

(arrows) are abundant in storage tissues. B. Immunofluorescence labeling (II.6.5) of transgenic wheat show

the locations of the tagged recombinant proteins in endosperm cells. DsRed bodies (arrows) are found

embedded in the protein bodies of wheat endosperm cells and at the periphery of storage vacuole (PSV). The

arrows indicate the recombinant protein accumulated in protein bodies within the PSV of wheat endosperm

cells C. Confocal microscopy (II.6.7) of transgenic wheat endosperm where DsRed bodies appear evenly

distributed within the endosperm. A closer view reveals that DsRed bodies are highly abundant in the seed

coat (sc) and also in the endosperm cells. Bars, 100 µm (A); 25 µm (B); 500 µm (C). Starch (s).

68

Figure III.17 Accumulation of recombinant DsRed protein bodies in transgenic wheat endosperm

cells. Small pieces of transgenic wheat endosperm were sliced in 0.1 M phosphate buffer, pH 7.4 (II.1.2)

and examined directly under a confocal microscope.

A Confocal images (II.6.7) show the accumulation of DsRed in the protein bodies in a large central protein

storage vacuole (PSV) of transgenic wheat endosperm cells (arrow). The induced protein bodies containing

recombinant proteins can also be seen in the cytoplasm (arrow). B. Corresponding transmission light image.

Bars, 50 µm (A and B)

III.6.5. Model fusion protein expression and accumulation in

transgenic wheat embryo

We report that engineered γ-zein portion also triggered the formation of artificial protein

bodies in wheat embryos cells. Fluorescence (II.6.6) and confocal images (II.6.7; Fig.

III.13; III.18 A, B) confirmed the well-define and highly fluorescent bodies distribution in

the embryo cells. Interestingly, the induced protein bodies were found to be smaller (~0.6

µm) than those found in endosperm and leaf tissues (Fig. III. 18A, B). Strong fluorescence

signals were observed in the tissues below the scutellum. However, the expression was not

equally distributed indicating that the ubiquitin promoter was not equally active in all

embryo tissues (Fig. III.18A). In comparison with endosperm cells, accumulation of

recombinant fusion proteins was recorded at earlier stages of seed development, eight days

post anthesis. The intensity of DsRed fluorescence also increased as the embryonic cells

matured.

69

The subcellular localization of recombinant fusion proteins in embryonic cells was also

identified. Immunofluorescence labeling (II.6.5) with primary antibody (anti-DsRed

polyclonal) followed by incubation with secondary antibody (goat anti rabbit, Alexa 546)

revealed the final destination of recombinant proteins in embryo cells. The ultra-thin

sections of the embryo showed the accumulation of recombinant proteins in the protein

bodies, those were found sequestered in the central storage vacuole (arrow; Fig. III.18 C).

The trafficking of recombinant proteins in embryonic tissues was consistent to those

observed in endosperm tissues.

70

Figure III.18 Accumulation of DsRed protein bodies in transgenic wheat embryos. Small squares of

transgenic wheat embryo were fixed in 4% (w/v) formaldehyde, 0.2% (w/v) glutaraldehyde in 0.1 M

phosphate buffer, pH 7.4 (II.1.2) as described (II.6.5). Specimen were infiltrated and polymerised at 60 ˚C

for 48 hours in LR White Resin. For immunolabeling (II.6.5), ultrathin microtome sections of 1-µm were

obtained and incubated with primary antibody (DsRed Polyclonal antibody) at dilution of 1/500 and

secondary antibody (goat anti Rabbit, Alexa 546) at dilution of 1/30 in 01 M phosphate buffer pH 7.4

(II.1.2) under dark conditions. For fluorescent (II.6.6) and confocal microscopy (II.6.7), samples were cut in

0.1 M phosphate buffer pH 7.4 and examined under microscope.

A. Fluorescence micrograph (II.6.6) Presence of numerous DsRed bodies (arrow) confirms the expression of

recombinant proteins in wheat embryo. However, in some tissues the recombinant expression is absent

(arrow). B. Confocal micrograph (II.6.7) shows the presence of recombinant DsRed bodies in wheat embryo

tissues. C. Immunofluorescence labeling (II.6.5) reveals the presence of abundant artificial protein

bodies in the embryo tissues aggregated at the periphery of the central PSV (arrow).

71

IV. DISCUSSION

Plants have been used for the experimental production of many different pharmaceutical

proteins, including vaccines (Streatfield, 2007), antibodies (Twyman et al. 2007),

hormones, signaling proteins, blood products and replacement enzymes (Stoger et al.

2002, 2005), and industrial enzymes (Fischer et al. 2003). As more recombinant proteins

are developed as industrial products, the demand increases for simple and economical

production platforms that allow the large-scale production of inexpensive heterologous

proteins. The advantages of plant-based production platforms have been widely

acknowledged, and although no single platform has emerged as a primary candidate for

process-scale manufacturing. Plant cell cultures offer the advantages of containment,

simplicity, consistency and simpler downstream processing, making them the most likely

platform in the short term to yield pharmaceutical products that comply with good

manufacturing practice (GMP). However, they suffer the same limitations in terms of

scalability and reliance on bioreactor-based infrastructure as other fermentation platforms.

Alternatively, transient expression systems offer the prospect of rapid and highly-scalable

production, but incapable of co-expressing two or more polypeptides, which are essential

for the assembly of heterooligomeric proteins. None of the plant-based production

platforms can yet challenge the yields possible using more established platforms such as

E. coli and mammalian cells (Ramessar et al., 2008) but their advantages in terms of

safety, scalability, economy and unique delivery mechanisms make it imperative to carry

out research for the improvement of productivity of plants for molecular farming. Among

plant expression systems, cereal crops are most attractive because seeds are potentially

one of the most economical systems for heterologous proteins (Kermode et al., 2012). The

recombinant proteins can be targeted to the naturally evolved protein storage organelles

such as ER derived protein bodies for protein function; prevent degradation and stable

accumulation for years (Ramessar et al., 2008). However, enhancing yield and efficient

methods for downstream processing of recombinant proteins are the greatest challenges

that must be overcome before seed based system can become as alternative for large-scale

production of heterologous proteins.

72

There are several reasons to select wheat plants as host for this study. Wheat has a well-

established global infrastructure for cultivation, harvest, storage and distribution,

providing the foundation for recombinant protein production in industrialized and

developing countries. Like other cereals, wheat seeds maintain recombinant proteins in a

stable form for years that makes it an attractive bioreactor for recombinant protein

production. Wheat has two major advantages over other crops such as maize in that it is

self-pollinating (thus reducing the likelihood of out-crossing from transgenic crops) and

has a low producer price compared to other cereals. As a cereal crop, it is generally

recognized as safe (GRAS) by the European Food Safety Authority (EFSA) and, therefore,

is an ideal production crop for oral vaccines and topical formulations. Potential

disadvantages of wheat include the challenging transformation procedure and the

generally low expression levels that have been achieved with other recombinant proteins,

hence the development of novel strategies to improve protein yields in this thesis. In

addition, the trafficking of recombinant proteins has been rarely studied in wheat seed

tissues. The recombinant protein production via γ-zein sequences and the insight of

heterologous protein trafficking in seed tissues would make it an attractive host for

molecular farming.

In this thesis, wheat seed tissues were chosen as preferred target for recombinant protein

production. This is because dry seeds provide an optimal environment for the stable

accumulation of recombinant proteins and are considered suitable as vehicles for

molecular farming (Stoger et al., 2002a). Seeds have been used for the production of many

recombinant proteins, including vaccine antigens, antibodies, hormones, proteases and

their inhibitors, growth factors and enzymes for industrial or medical applications (Boothe

et al., 2010). Targeting of recombinant proteins to naturally available storage organelles in

seed tissues assist higher accumulation and purification means for efficient production

system. Several publications have demonstrated convincingly that recombinant proteins in

mature seeds show no detectable loss of stability or activity when stored for several years

at ambient temperatures (Stoger et al. 2000, Nochi et al., 2007). In addition to stability,

high-yielding field-grown cereal crops also provide the benefit of scalability, simply by

planting more crops over a larger area.

73

In this study, wheat transformation was achieved by the particle bombardment using

immature embryos (III.2). This type of ex-plant was favored in early transformation

protocols (Becker et al., 1994; Rasco-Gaunt et al., 2001) although other targets have been

used for both particle bombardment and Agrobacterium-mediated transformation. One of

the key advantages of particle bombardment is that it is a genotype-independent method,

whereas Agrobacterium-mediated transformation must be optimized for individual

genotypes because of its high dependency on the biological properties of the target.

Particle bombardment is also suitable for the transient expression of endosperm (Knudsen

and Müller, 1991) or epidermal cells (Douchkov et al., 2005) to test the efficacy of

expression constructs. We achieved a low transformation frequency of up to < 1%, which

is comparable to early results reported by Altpeter et al. (1996) and is regarded as an

acceptable efficiency of gene transfer given the recalcitrance of wheat explants, the need

to culture explants on induction medium for several months and the challenge of

regenerating explants into transgenic plantlets (Stöger et al., 2000). The transformation

frequency is also dependent on the genotype, explant type and transformation

methodology, therefore, careful optimization was required to achieve this transformation

frequency in the Bobwhite cultivar.

In this thesis, we demonstrate the expression and sub-celullar accumulation of

recombinant proteins in three different wheat tissues by exploiting the natural ability of γ-

zein to induce the formation of artificial storage organelles in ectopic tissues. Our results

demonstrate that proline-rich repetitive (VHLPPP)8 and PX domains of maize prolamin

(γ-zein) are capable to trigger formation of artificial protein bodies in wheat seed and

vegetative tissues (III.6). In all tissues tested, the artificial protein bodies facilitated the

accumulation of recombinant proteins in dense protein bodies preventing them from

adverse enzymatic cell environment. The induced protein bodies in wheat tissues were

found as insoluble discrete spherical bodies that would allow their efficient and simple

isolation by low speed centrifugation. Our results illustrate that the γ-zein has maintained

the wild type characteristics of the native PBs in wheat tissues. Our findings suggest that

protein body formation and accumulation of recombinant protein in artificial 2-µm

spherical bodies is conserved in wheat leaf, endosperm and embryo tissues.

74

In maize (Zea mays), zeins are the major storage prolamins in the endosperm, and their

accumulation in zein bodies, derived from the endoplasmic reticulum, is well

characterized (Arcalis et al., 2010). Several zein classes (α, β, γ, δ), form large complexes

known as protein bodies within the ER-lumen. Interestingly, the 27 kDa γ-zein protein in

maize endosperm contains N-terminal signal peptide but retain intra-cellular in the ER

rather than being secreted. Moreover, γ-zein lacks the (H/K)DEL motif for ER retention

but localizes to the periphery of the protein bodies surrounding aggregates of other zein

proteins (Geli et al., 1994; Ludevid et al., 1994; α, β and δ-zein). When expressed

hetrologously, these gamma-zeins were able to trigger the formation of novel bodies both

in seed and vegetative tissues. However, the origin and mechanism by which γ-zein form

these novel cell organelles has not been elucidated. Nevertheless, experiments with the

mutated γ-zeins in Arabidopsis thaliana have provided evidence that both, the repeated

polypeptide and the C-terminal cystein rich domains, are responsible for protein bodies

induction, which may include protein-protein interactions or interactions with the ER

membranes (Geli et al., 1994). Various studies on zein accumulation in heterologous

expression systems suggest that the presence of γ-zein and β confers the stability of α and

δ zeins and facilitates their sequential assembly in the protein body in ER lumen. This

stabilizing effect of γ and β zein on the other zeins (α and δ) has been recognized in

transgenic tobacco and Arabidopsis plants (Bagga et al., 1997; Coleman et al 1996).

The heterologous expression of N-terminal proline rich domain of γ-zein result in the

ectopic formation of spherical structures suggests that some structural motifs are

responsible for de novo protein body formation (Saito et al., 2009). Two domains present

within γ-zein i.e. the repeat (PPPVHL)8 and Pro-X domains are involved in the ectopic

protein body formation. Whereas, repeated region of γ-zein is considered crucial for PB

biogenesis. The fusion protein lacking the repetitive portion (PPPVHL)8 to fluorescent

proteins resulted in the secretion of the fusion proteins but this repeat by itself did not

form PBs in tobacco vegetative tissues (Llop-Tous et al., 2010). More recently, the model

for Zera-induced PB biogenesis in tobacco leaves proposed by Llop-Tous and colleagues

(2010) highlighted the sequence elements responsible for protein body biogenesis.

According to their results, the eight repeat of (PPPVHL)8 is not only crucial for PB

formation but also important for the correct morphology of protein bodies. Shortening of

PPPVHL sequences (4-6) was still able to form PBs but comparatively smaller structures.

75

The presences of six Cystein residues present in repeated and PX domains are also vital

for protein biogenesis and may serve to stabilize the protein body assembly via

intermolecular disulfide bonds. Expression of zeolin in transgenic tobacco plant also

predicts the involvement of Cys residues for fusion protein polymerization and

accumulation in the ER (Pompa and Vitale 2006). Experiments with Cysteine residues in

Zera sequences explained that the two N-terminal Cys residues (Cys7 and Cys9) of Zera

are critical for oligomerization.

In this study, the expression of the recombinant fusion protein in wheat leaves was

confirmed with immunoblot analysis of young leaves extracts (III.14 A). The availability

of DsrRed bodies in these tissues was also validated with fluorescence and confocal

microscopy (III.15). In leaves, the fluorescent protein accumulated in ectopic protein

bodies 2 m in diameter which were dispersed throughout the cytoplasm (III.6.2). These

were similar in size and appearance to the native protein bodies found in maize

endosperm, and also to heterologous protein bodies induced in tobacco leaves using the N-

terminal γ-zein sequences (Torrent et al., 2009). In plants, the fusion of N-terminal

sequences of γ-zein (known as Zera®) with other proteins resulted in its accumulation in

novel protein bodies (Saito et al., 2009; Torrent et al., 2009a). Torrent and colleagues

(2009) fused the coding sequence for enhanced cyan fluorescent protein (ECFP) to either

the Zera domain or to an ER-retention signal (KDEL) and expressed the constructs in

tobacco epidermis. The Zera-ECFP protein accumulated in protein bodies within the

epidermal cells, the ECFP-KDEL protein accumulated in the ER lumen and a control

ECFP protein lacking Zera and KDEL was secreted. Similarly, the γ-zein N-terminal

sequences were also fused to the bean storage globulin phaseolin, and the recombinant

fusion protein (zeolin) was expressed in tobacco leaves where zeolin was accumulated in

the protein bodies (Mainieri et al. 2004). The same γ-zein N-terminal domain was unable

to increase yields of the recalcitrant HIV-1 Nef protein either as an N-terminal or C-

terminal fusion, but the entire zeolin protein as a fusion partner increased the yield of

zeolin-Nef to 1.5% total soluble protein and induced the formation of ectopic, ER-derived

protein bodies (de Virgilio et al., 2008). Llompart et al. (2010) produced human growth

hormone as a Zera fusion by transient expression in Nicotiana benthamiana leaves,

resulting in recombinant protein yields of up to 10% total soluble protein. Llop-Tous and

colleagues (2011) transiently produced an active insoluble aggregate of xylanase fused to

76

Zera in tobacco plant. Zera-xylanase fusion protein accumulated within ER-derived

protein bodies in leaves as active aggregates. That could later easily be extracted by a

simple density-based downstream process. Recently, Joseph and colleagues (2012)

utilized the zera sequences fused with DsRed fluorescent (Zera-DsRed) to target the fusion

partner into induced protein bodies and optimize the downstream purification of newly

formed PBs in Nicotiana benthamiana leaves. The fusion of zera sequences increased

accumulation of partner protein in induced protein bodies (up to 85% total TSP).

However, 195 additional proteins were also deposited in the Zera-DsRed polymer.

Interestingly, our results show that induced protein bodies resulted from model fusion

protein (γ-zein-DsRed) expression in leaf cells were observed as extremely mobile

organelles (III.6.3). To our knowledge, this study is the first to show recombinant protein

body mobility in wheat tissues. All the DsRed bodies were generally moving with the

same speed and transported in a unidirectional manner in each leaf cell. Experiments of

Conley and colleagues (2009) with ELP-GFP induced protein bodies are of great interest

to predict the factors affecting protein bodies mobility in Nicotiana benthamiana leaf

cells. The findings suggested that PB movement is dependent upon the integrity of actin

microfilaments and a functional actomyosin motility system (Conley et al., 2009). The

movement of our γ-zein-DsRed bodies in wheat cells are consistent with PBs movement

observed in tobacco epidermal cells where γ-gliadins-protein bodies like structure (PBLS)

were found highly mobile and were moving throughout the cells along with ER network

with no continuous direction. However, the movement observed under confocal

microscopy were concluded for possible correlation between PBLS size, movement, and

duration of expression. Furthermore, actin cytoskeleton dependent movement were also

verified in transgenic leaves (Francin-Allami et al., 2011). Recently, transient expression

of wheat γ-gliadin and low molecular weight (LMW) glutelin as fusion with green

fluorescent protein (GFP) in tobacco leaves formed protein body like structures (PBLS).

These spherical structures were also found highly mobile in tobacco leaves. The authors

explained the movement as actin-dependent (Francin-Allami et al., 2012). Above

mentioned experiments highlight that the mobility of ectopic protein bodies is not

restricted to certain plant species. Therefore, the involvement of cytockeleton in

trafficking of our recombinant γ-zein-DsRed bodies in transgenic wheat tissues cannot be

neglected and further investigations are highly recommended.

77

In addition to leaves, the recombinant fusion proteins were also expressed in wheat

endosperm and embryo cells to investigate the trafficking and accumulation of the protein

in seed tissues. This study is quite interesting to determine the impact of recombinant

protein expression in wheat endosperm and embryo, which forms its own endogenous

compartments as a major sink for storage proteins. We found that the recombinant fusion

protein (γ-zein-DsRed) was expressed in wheat seed tissues but that the expression profile

driven by the constitutive ubiquitin promoter was potentially constrained by the specific

cell type (III.6.4). In the endosperm, the highest expression was achieved in subaleurone

layer cells. This may reflect a genuine difference in the activity of the ubiquitin promoter

in different specialized cell types within the seed, but may also be explained by

differential activity in terms of protein synthesis and accumulation as the cells mature,

and/or the properties of the cells that affect the visibility of the fluorescence signal.

Subaleurone cells are younger than the central endosperm cells and generally contain more

protein bodies, whereas older cells contain more starch and the vacuole is reabsorbed.

Therefore, the visualization of protein bodies within the central vacuole is easier in the

subaleurone cells, where DsRed fluorescence could be detected from 10 to 25 days after

anthesis, peaking during days 14–18. The protein bodies appeared clustered or aggregated

in the central endosperm cells, perhaps reflecting a genuine difference in distribution

compared to leaves in combination with the clearer fluorescence signal in the larger

vacuoles of older cells. These results are in accordance with the behavior of endogenous

protein bodies, which also accumulate within large vacuoles. The γ-zein-DsRed protein

bodies in the inner endosperm cells were partially obscured by large starch granules.

Cell-specific differences in expression were also observed when we expressed the γ-zein-

DsRed fusion protein in wheat embryos (III.6.5). Strong fluorescence was observed in the

tissues below the scutellum, indicating that the ubiquitin promoter was not active in all of

the embryo tissues or that protein synthesis and accumulation were inefficient. At the level

of individual cells, the fusion protein appeared to be expressed more strongly in the

embryo than the endosperm. DsRed protein bodies were observed in clusters of cells

within the embryo from as early as 8 days after anthesis. However, the protein bodies in

embryo cells were less dynamic than those in leaf cells, as determined by real-time

confocal microscopy.

78

Degradation of recombinant proteins is critical because higher expression level does not

always insure the higher yield. Our recombinant fusion protein showed accumulation in all

three tissues tested. No degradation products were detected in wheat endosperm and

embryo tissues after five months (III.6.1). We suppose that the accumulation of

recombinant proteins in the novel protein bodies segregated the fusion protein away from

the secretory pathway (as no evidence of recombinant proteins in the apoplast) as well as

from ER associated degradation (ERAD) pathways (Benyair et al., 2011) and therefore

maintained the expression after five months. Similar to our results, Torrent and colleagues

(2009) also showed that the Zera sequences maintained the stability of the fusion partner,

allowing functional recombinant protein to be recovered after five months at room

temperature. The stability of proteins in protein bodies was also demonstrated by Nochi et

al. (2007), who expressed the cholera toxin B subunit in rice protein bodies and showed

they were highly resistant to proteolytic digestion in the gastrointestinal tract.

The expression and accumulation of the fusion protein in seed and vegetative tissues did

not appear to alter the growth or development of the transgenic wheat plants, neither in

terms of the general phenotype nor in terms of the impact at the cellular level. The

transgenic γ-zein-DsRed plants germinated were fertile and growth was identical to wild

type wheat plants. In another study (Torrent et al., 2009), there was also no evidence for

enhanced apoptosis in experiments using the Zera domain to express ECFP in tobacco

leaves. Also, targeting recombinant protein into induced protein bodies in cereal seed and

vegetative tissues with fluorescent protein GFP did not interfere with the plant growth and

development of tobacco plant (Saito et al., 2009). Other than plants, induced protein

bodies also did not alter growth when expressed in CHO and fungal cells (Torrent et al.,

2009). These results suggest that proline rich sequences of γ-zein when expressed as

fusion with other protein do not adversely affect plant growth.

In this thesis, we report the trafficking of recombinant fusion proteins in wheat seed and

vegetative tissues. In plant seed, enormous storage protein synthesis with diverse

subcellular destinations creates a logistic challenge for the endomembrane system. Protein

transport in cereal endosperm is complicated by the abundance of ER derived and vacuolar

protein bodies (Arcalis et al., 2004). In wheat seed tissues, prolamins are synthesized on

rER and then deposited to PSVs as their final destination. The movement from ER to PSV

79

occurs via two major transport routes, one bypassing and one passing through Golgi

complex. However, proteins travelling along each route merge at vacuole (Arcalis et al.,

2004). This final movement of storage proteins and their deposition into vacuole is still

controversial. Studies on protein trafficking in wheat demonstrate that prolamins assemble

in PBs within ER (Levanony et al, 1992; Rubin et al., 1992) and later bud off and

transported to vacuole by a process similar to autophagy (Galili et al., 1993). The role of

the Golgi apparatus has been controversial but generally, the Golgi independent pathway is

more widely accepted, although a Golgi-dependent pathway has also been proven for small

amounts of prolamins (Levanony et al., 1992). Golgi complex is the site for protein

glycosylation. In wheat seed tissues, prolamins are generally not glycosylated. However,

very low amount of glycosylation that may occur is very difficult to detect (Shewry, 1996).

In order to know how recombinant proteins respond to the wheat intracellular sorting

machinery, we investigated the trafficking of recombinant proteins in seed and leaf tissues.

For this reason, fluorescent reporter protein, DsRed was tracked for the final destination of

recombinant proteins. In vegetative tissues, the recombinant proteins were accumulated in

the novel protein bodies and were found dispersed in the cytoplasm (III.6.2).

Immunolocalization and fluorescent microscopic experiments confirmed that no ER or

apoplast accumulating signals were detected. These 2 µm red fluorescent bodies were

found highly mobile in leaf cells with no specific direction; however the movement were

recorded within the leave cells (III.6.3). Therefore, we conclude that the recombinant

proteins were targeted to novel protein bodies those were retained intracellularly in the

cytoplasm. In addition, the zigzag movement of recombinant bodies do not explain the

exact trafficking pattern in transgenic leaf cells.

The trafficking of the recombinant maize prolamins (γ-zeinDsRed) in the unique wheat

endosperm was of great interest in this thesis. Fluorescence, confocal and

immunofluorescent labelling experiments revealed that recombinant fusion proteins were

localized in artificial protein bodies and were found sequestered in the large protein

storage vacuoles which occupy the central part of both endosperm and embryo cells

(III.6.4; III.6.5). Furthermore, there was no trace of the molecule found in apoplast. In

wheat endosperm cells, the prolamins assemble in the protein bodies in the ER and

translocated to central PSVs in autophagy like process (Levanony et al., 1992). The

80

recombinant fusion protein bodies were found aggregated in the same compartment;

however they were distinguished with red fluorescence (III.6.4). In maize endosperm, the

vacuolar sequestration of prolamins has not been reported. We, therefore, conclude that

recombinant fusion protein followed the bulk of wheat endogenous glutenins in seed

tissues and deposited in the central PSV. Recombinant bodies were mostly found

aggregated at the periphery of the storage vacuole (PSV) in both endosperm and embryo

tissues (III.6.4 and III.6.5). In maize endosperm, four different types of zeins aggregate in

protein body where α-zein dominates the interior while γ-zeins are located at the periphery

(Coleman et al., 1999). The deposition of recombinant γ-zeinDsRed reflected the wild

type pattern but in different cell organelle and found at the exterior of central PSV in

wheat endosperm. The transgenic wheat embryo tissues also accumulated numerous novel

protein bodies. These artificial bodies were found aggregated in the central vacuole

(III.6.5). Different in expression of recombinant proteins were observed in transgenic

wheat endosperm and embryo tissues, however, the trafficking of recombinant proteins in

both tissues were found similar, accumulating in the central PSV as their final destination.

Our results are consistent with Coleman and his colleagues (2004), where heterologous

expression of zein in tobacco seed resulted in its sequestration into PSVs (Coleman et al.,

2004). Similarly, Bagga and colleagues (1995) observed the localization of 15kDa zein in

protein bodies sequestered into PSVs in tobacco seeds. These protein inclusions in the

seeds and leaves were also surrounded by membrane suggesting their derivation from the

ER. In wheat, recombinant proteins seem to favour their accumulation into PSVs in seeds

and follow the pathway exists for endogenous wheat prolamins in seed tissues. Also, the

recombinant protein (human serum albumin) containing a signal peptide was sequestered

into PBs and deposited into PSVs in wheat endosperm cells (Arcalis et al., 2004). Whereas

the same protein showed secretion when expressed in tobacco leaves (Verwoerd et al,

1995) and M. Truncatula seed cotyledons (Abranches et al., 2008). Similarly,

immunoglobulin compounds expressed for secretion in maize and rice endosperm was

accumulated in ER derived PBs and in PSVs (Nicholson et al, 2005).

We report that the combination of maize (γ-zein-DsRed) and native prolamins in seed

tissues did not alter cell functionality. Our results also report that fluorescent fusion

proteins are useful reporter molecules for confirmation of trafficking pathways. This is

81

because they could not only be tagged in immunolocalization experiments but also were

tracked with their fluorescence. These finding are of practical importance in molecular

farming applications, where the final destination of the heterologous proteins may

influence the activity, functionality and productivity.

Molecular farming initially focused on upstream productivity by improving gene

expression and protein stability, but as more products have moved towards commercial

development the focus has shifted to downstream processing for process-scale

manufacturing. The aggregation of the γ-zein-DsRed fusion protein into dense protein

bodies would simplify the purification process by allowing initial recovery by crude

fractionation, followed by the re-solubilization of relatively pure protein aggregates which

means that expensive chromatography-based separations are only needed for polishing to

remove trace impurities (Llop-Tous 2011). The accumulation of recombinant proteins in

novel protein bodies will therefore lower production costs by increasing upstream

productivity and by replacing expensive downstream processing steps (Joseph et al.,

2012).

This thesis also presents a protein fusion-based strategy to simplify the recombinant

protein purification via creation of artificial organelles. Although, the molecular farming

can be cheaper alternative to conventional platforms, however, downstream processing is

economically crucial because it represents 80 % of overall production cost (Fischer et al.,

2012). The expression of recalcitrant recombinant proteins as fusions with stability-

inducing partners is a generally useful strategy to improve product accumulation and to

assist in their subsequent purification (Conley et al., 2011; Llop-Tous et al., 2011).

However, the use of seed storage proteins as stabilizing partners provides additional

advantages including the induction of protein body-like aggregates in cells that normally

lack such organelles, offering further advantages such as protection from degradation,

alternative purification strategies and post-harvest encapsulation. The advantages of seed-

based systems can therefore be combined with the rapid biomass accumulation that is

possible in leafy plants. The protein-body inducing fusion partner that provide these

enhanced benefits include natural zeins, synthetic elastin-like peptides (ELPs) and fungal

hydrophobins (Table 2), all three of which can induce protein bodies and facilitate the

process-scale production and purification of recombinant proteins (Conley et al., 2011).

82

Both in plant and non-plant hosts, zein fusion strategy resulted in dense protein bodies and

favour the simple recovery by low speed centrifugation. In comparison, protein bodies

formed by the other two fusion partners were not dense and therefore the downstream

processing required transition cycling (ELP) and two phase procedure (Hydrophobin;

Llop-Tous et al., 2011)

ELPs are biochemically similar to γ-zein, and have been used to test the accumulation of

GFP targeted to the cytoplasm, plastids, apoplast and ER in several different N.

benthamiana tissues, with the ER variants showing the highest accumulation (Colney et

al., 2009). ELPs have also been used to increase the expression of pharmaceutical proteins

in transgenic tobacco leaves (Patel et al. 2007; Floss et al., 2008). The induction of protein

bodies using 100 ELP repeats fused to single-chain antibody resulted in yields of 40%

total soluble protein in tobacco seeds and 25% in leaves (Scheller et al., 2006).

Hydrophobins are small (ca. 10 kDa) and surface-active proteins derived from filamentous

fungi and can be either secreted or remain intracellular. When targeted to the ER,

recombinant hydrophobin fusion proteins also induce the formation of novel protein

bodies in fungi (Conley et al., 2011) and in tobacco leaves (Joensuu et al., 2010). In the

latter study, GFP was expressed using the Trichoderma reesei HFBI hydrophobin

sequence as a fusion partner, resulting in an unprecedented expression level equivalent to

51% total soluble protein in leaves, up to 91% of which could be recovered by aqueous

two-phase extraction (Joensuu et al., 2010).

The γ-zein fusion strategy was envisaged to produce stable vaccine antigens as prolamin

aggregates in wheat, but we found instead that separate fusion protein bodies were formed

and deposited in the PSV, which would also be useful for the development of seed-based

vaccines. Cold chains are usually required for vaccine distribution which is challenging in

developing countries, but seed-based oral vaccines provide a solution by allowing the

distribution of stable vaccine antigens at ambient temperatures using existing distribution

infrastructures for food (Ramessar et al., 2008). Edible seeds containing oral vaccines

would require minimal processing (enough to ensure dosing accuracy) and this could be

done by traditional techniques in developing country settings, such as the preparation of

flour paste (Lamphear et al., 2002; Takagi et al., 2005). Alvarez et al. (2010) expressed

Yersinia pestis F1-V antigen as a Zera fusion in Nicotiana benthamiana, Medicago sativa

83

(alfalfa) and Nicotiana tabacum (tobacco) NT1 cells. The yield was increased three-fold

compared to the native protein without affecting plant growth and development (Alvarez

et al., 2010).

Mucosal surface is the main entry source for many pathogens into the body; therefore,

both passive and active immunization approaches targeted to the mucosa have been

developed, with many researchers focusing on oral delivery (Hefferon et al., 2010). In

plants, the production of vaccine antigens have clear advantages because plant tissues

containing vaccine antigens can directly be consumed without processing avoiding costly

purification processes. However, the potential hurdle is the digestive system that may

cause destruction of the vaccine antigens before they can reach the immune cell in the

ileum, clustered in regions know as Peyer‟s patches. The production of vaccine antigens in

plants offers further advantage of extended partial protection from digestive enzymes and

permits more time for the antigen to interact with immune cells. This shielding effect is

improved through the targeting recombinant proteins into storage organelles such as

protein bodies (Takagi et al, 2010) and starch granules (reviewed in Khan et al., 2012;

Stephen et al, 2006).

Remarkably, Takagi and colleagues (2010) compared the survival of a known oral

tolerogen when administered either as a synthetic peptide, or as transgenic rice grain, in

which the antigen was targeted either to ER-derived protein bodies or PSVs. The rice

endosperm derived antigens showed more resistance to in vitro digestion with pepsin than

the soluble form. This is particularly noteworthy that antigens targeted to protein bodies

were more effective provided more resistance than PSVs. Therefore, the data presented the

evidence that bio-encapsulated delivery of tolerogen significantly enhanced the

immunological efficacy for the suppression of allergen-specific IgE responses. Ogawa and

colleagues (1987) also showed that rice PBs are partially digested and many protein

bodies were excreted. More recently, cholera toxin B subunit (Nochi et al., 2007) and

recombinant antibodies expressed in pea seeds (Zimmermann et al., 2009). In the latter

case, flour from the transgenic pea seeds was more potent than the purified antibody

fragments. Furthermore, the recombinant antibodies showed no detectable degradation

products in pea seed, possibly reflecting the existence of protease inhibitors (reviewed in

Khan et al., 2012; Zimmermann et al., 2009).

84

V. Conclusion

In this thesis, we show that a fusion strategy can be very efficient at producing

recombinant proteins in wheat plants. We report the introduction of exogenous organelles

in wheat seed and non-seed tissues using the maize prolamin γ-zein sequences as a fusion

for long-lasting production of recombinant proteins. Our results show that the addition of

proline rich polypeptide of maize prolamin to DsRed maintained the main characteristics

of wild-type γ-zein, resulted in the ubiquitous formation of PB-like structures and their

accumulation in PSVs in diverse wheat seed tissues. The results explain the encapsulation

of recombinant proteins into protein bodies generally enhances/maintain the stability both

in planta and post-harvest. This approach could therefore be implemented for the proteins

which are poorly secreted or degraded within the proteolytic cell conditions. Therefore,

the extension of our study to other cereals and proteins would be very interesting.

Knowledge of recombinant protein trafficking in wheat seed is more likely to be useful for

molecular farming applications.

85

VI. References

Abhary, M., Siritunga, D., Stevens, G., Taylor, N. J., and Fauquet, C. M. (2011).

Transgenic biofortification of the starchy staple cassava (Manihot esculenta) generates a

novel sink for protein. PLoS ONE 6, e16256.

Altpeter, F., Vasil, V., Srivastava, V., Stoger, E., Vasil, IK. (1996). Accelerated

production of transgenic wheat (Triticum aestiuum L.) plants. Plant Cell Rep 16, 12-17.

Alvarez, M., Topal, E., Martin, F., and Cardineau, G. (2010). Higher accumulation of F1-

V fusion recombinant protein in plants after induction of protein body formation. Plant

Mol Biol 72, 75-89.

Ao, Z., and Jane, J. l. (2007). Characterization and modeling of the A- and B-granule

starches of wheat, triticale, and barley. Carbo Poly 67, 46-55.

Arcalis, E., Marcel, S., Altmann, F., Kolarich, D., Drakakaki, G., Fischer, R., Christou, P.,

and Stoger, E. (2004). Unexpected deposition patterns of recombinant proteins in post-

endoplasmic reticulum compartments of wheat endosperm. Plant Physiol 136, 3457-3466.

Arcalis, E., Stadlmann, J., Marcel, S., Drakakaki, G., Winter, V., Rodriguez, J., Fischer,

R., Altmann, F., and Stoger, E. (2010). The changing fate of a secretory glycoprotein in

developing maize endosperm. Plant Physiol 153, 693-702.

Bagga, S., Adams, H., Kemp, J. D., and Sengupta-Gopalan, C. (1995). Accumulation of

15-kilodalton zein in novel protein bodies in transgenic tobacco. Plant Physiol 107, 13-23.

Bagga, S., Adams, H. P., Rodriguez, F. D., Kemp, J. D., and Sengupta-Gopalan, C.

(1997). Coexpression of the maize delta-zein and beta-zein genes results in stable

accumulation of delta-zein in endoplasmic reticulum-derived protein bodies formed by

beta-zein. Plant Cell 9, 1683-1696.

Becker, D., Brettschneider, R., and Lörz, H. (1994). Fertile transgenic wheat from

microprojectile bombardment of scutellar tissue. The Plant J 5, 299-307.

86

Benyair, R., Ron, E., Lederkremer, G. (2011). Protein quality control, retention, and

degradation at the endoplasmic reticulum. Int Rev Cell Mol Biol, 292:197-280.

Boothe, J., Nykiforuk, C., Shen, Y., Zaplachinski, S., Szarka, S., Kuhlman, P., Murray, E.,

Morck, D., and Moloney, M. M. (2010). Seed-based expression systems for plant

molecular farming. Plant Biotech J 8, 588-606.

Boothe, J. G., Saponja, J. A., and Parmenter, D. L. (1997). Molecular farming in plants:

Oilseeds as vehicles for the production of pharmaceutical proteins. Drug Devel Res 42,

172-181.

Breiteneder, H., and Mills, E. N. C. (2005). Plant food allergens structural and functional

aspects of allergenicity. Biotechnol Adv 23, 395-399.

Buléon, A., Colonna, P., Planchot, V., and Ball, S. (1998). Starch granules: structure and

biosynthesis. Inter J of Biol Macro 23, 85-112.

C. Neal, S., Jr. (2005). Monitoring the presence and expression of transgenes in living

plants. Trends in Plant Sci 10, 390-396.

C. Neal, S., Jr. (2006). Go with the glow: fluorescent proteins to light transgenic

organisms. Trends in Biotechnol 24, 155-162.

Canizares, M. C., Nicholson, L., and Lomonossoff, G. P. (2005). Use of viral vectors for

vaccine production in plants. Immunol Cell Biol 83, 263-270.

Chaudhary, S., Parmenter, D. L., and Moloney, M. M. (1998). Transgenic brassica

carinata as a vehicle for the production of recombinant proteins in seeds. Plant Cell Rep

17, 195-200.

Chikwamba, R. K., Scott, M. P., Mejía, L. B., Mason, H. S., and Wang, K. (2003).

Localization of a bacterial protein in starch granules of transgenic maize kernels. PNAS

100, 11127-11132.

Coleman, C. E., Herman, E. M., Takasaki, K., and Larkins, B. A. (1996). The maize

gamma-zein sequesters alpha zeins and stabilizes its accumulation in protein bodies of

transgenic tobacco endosperm. Plant Cell 8, 2335-2345.

87

Conley, A., Joensuu, J., Menassa, R., and Brandle, J. (2009a). Induction of protein body

formation in plant leaves by elastin-like polypeptide fusions. BMC Biol 7, 48.

Conley, A. J., Joensuu, J. J., Jevnikar, A. M., Menassa, R., and Brandle, J. E. (2009b).

Optimization of elastin-like polypeptide fusions for expression and purification of

recombinant proteins in plants. Biotechnol Bioeng 103, 562-573.

Conley, A. J., Joensuu, J. J., Richman, A., and Menassa, R. (2011). Protein body-inducing

fusions for high-level production and purification of recombinant proteins in plants. Plant

Biotechnol J 9, 419-433.

Conley, A. J., Mohib, K., Jevnikar, A. M., and Brandle, J. E. (2009c). Plant recombinant

erythropoietin attenuates inflammatory kidney cell injury. Plant Biotechnol J 7, 183-199.

Conrad, U., and Fiedler, U. (1998). Compartment-specific accumulation of recombinant

immunoglobulins in plant cells: an essential tool for antibody production and

immunomodulation of physiological functions and pathogen activity. Plant Mol Biol 38,

101-109.

Cunha, N., Murad, A., Ramos, G., Maranhão, A., Brígido, M., Araújo, A., Lacorte, C.,

Aragão, F., Covas, D., Fontes, A., Souza, G., Vianna, G., and Rech, E. (2011).

Accumulation of functional recombinant human coagulation factor IX in transgenic

soybean seeds. Trans Res 20, 841-855.

Dahleen, L., and Manoharan, M. (2007). Recent advances in barley transformation. In

Vitro Cel & Dev Biol Plant 43, 493-506.

de Virgilio, M., De Marchis, F., Bellucci, M., Mainieri, D., Rossi, M., Benvenuto, E.,

Arcioni, S., and Vitale, A. (2008). The human immunodeficiency virus antigen Nef forms

protein bodies in leaves of transgenic tobacco when fused to zeolin. J of Exper Bot 59,

2815-2829.

Ding, S.-H., Huang, L.-Y., Wang, Y.-D., Sun, H.-C., and Xiang, Z.-H. (2006). High-level

expression of basic fibroblast growth Factor in transgenic soybean seeds and

characterization of its biological activity. Biotechnol Lett 28, 869-875.

88

Douchkov, D., Nowara, D., Zierold, U., and Schweizer, P. (2005). A high-throughput

gene-silencing system for the functional assessment of defense-related Genes in barley

epidermal cells. Mol Plant-Micr Inter 18, 755-761.

Downing, W. L., Galpin, J. D., Clemens, S., Lauzon, S. M., Samuels, A. L., Pidkowich,

M. S., Clarke, L. A., and Kermode, A. R. (2006). Synthesis of enzymatically active human

α-l-iduronidase in Arabidopsis cgl (complex glycan-deficient) seeds. Plant Biotechnol J 4,

169-181.

Drakakaki, G., Marcel, S., Arcalis, E., Altmann, F., Gonzalez-Melendi, P., Fischer, R.,

Christou, P., and Stoger, E. (2006). The intracellular fate of a recombinant protein is tissue

dependent. Plant Physiol 141, 578-586.

Dus Santos, M. Ì. a. J., Wigdorovitz, A. s., Trono, K., Ros, R. l. D., Franzone, P. M., Gil,

F., Moreno, J., Carrillo, C., Escribano, J. M., and Borca, M. V. (2002). A novel

methodology to develop a foot and mouth disease virus (FMDV) peptide-based vaccine in

transgenic plants. Vaccine 20, 1141-1147.

Erlendsson, L. S., Muench, M. O., Hellman, U., Hrafnkelsdóttir, S. M., Jonsson, A.,

Balmer, Y., Mäntylä, E., and Örvar, B. L. (2010). Barley as a green factory for the

production of functional Flt3 ligand. Biotechnol J 5, 163-171.

Fiedler, U., and Conrad, U. (1995). High-level production and long-term storage of

engineered antibodies in transgenic tobacco seeds. Biotechnol (N Y) 13, 1090-1093.

Fischer, R., Liao, Y. C., Hoffmann, K., Schillberg, S., and Emans, N. (1999). Molecular

Farming of Recombinant Antibodies in Plants. Biol Chem 380, 825-839.

Fischer, R., Schillberg, S., Hellwig, S., Twyman, R. M., and Drossard, J. (2012). GMP

issues for recombinant plant-derived pharmaceutical proteins. Biotechnol Adv 2, 434-439.

Fischer, R., Stoger, E., Schillberg, S., Christou, P., and Twyman, R. M. (2004). Plant-

based production of biopharmaceuticals. Curr Opin Plant Biol 7, 152-158.

Fischer, R., Twyman, R. M., and Schillberg, S. (2003). Production of antibodies in plants

and their use for global health. Vaccine 21, 820-825.

89

Floss, D. M., Falkenburg, D., and Conrad, U. (2007). Production of vaccines and

therapeutic antibodies for veterinary applications in transgenic plants: an overview. Trans

Res 16, 315-332.

Floss, D. M., Sack, M., Stadlmann, J., Rademacher, T., Scheller, J., Stoger, E., Fischer, R.,

and Conrad, U. (2008). Biochemical and functional characterization of anti-HIV antibody-

ELP fusion proteins from transgenic plants. Plant Biotechnol J 6, 379-391.

Foresti, O., De Marchis, F., de Virgilio, M., Klein, E. M., Arcioni, S., Bellucci, M., and

Vitale, A. (2008). Protein domains involved in assembly in the endoplasmic reticulum

promote vacuolar delivery when fused to secretory GFP, indicating a protein quality

control pathway for degradation in the plant vacuole. Mol Plant 1, 1067-1076.

Foresti, O., Frigerio, L., Holkeri, H., de Virgilio, M., Vavassori, S., and Vitale, A. (2003).

A phaseolin domain involved directly in trimer assembly is a determinant for binding by

the chaperone BiP. Plant Cell 15, 2464-2475.

Francin-Allami, M., Axelle, Bouder., and Popineau, Y. (2012).Comparative study of

wheat low-molecular-weight glutenin and α-gliadin trafficking in tobacco cells. Plant Cell

Rep DOI: 10.1007/s00299-012-1343-8.

Francin-Allami, M., Saumonneau, A., Lavenant, L., Bouder, A., Sparkes, I., Hawes, C.,

Popineau, Y. (2011). Dynamic trafficking of wheat cgliadin and of its structural domains

in tobacco cells, studied with fluorescent protein fusions. J Exp Bot 62, 4507–4520.

Frigerio, L., Hinz, G., and Robinson, D. G. (2008). multiple vacuoles in plant cells: rule or

exception? Traffic 9, 1564-1570.

Frigerio, L., Pastres, A., Prada, A., and Vitale, A. (2001). Influence of KDEL on the fate

of trimeric or assembly-defective phaseolin: selective use of an alternative route to

vacuoles. Plant Cell 13, 1109-1126.

Fujiwara, Y., Aiki, Y., Yang, L., Takaiwa, F., Kosaka, A., Tsuji, N. M., Shiraki, K., and

Sekikawa, K. (2010). Extraction and purification of human interleukin-10 from transgenic

rice seeds. Prot Expr and Puri 72, 125-130.

90

Galili, G. (2004). ER-derived compartments are formed by highly regulated processes and

have special functions in plants. Plant Physiol 136, 3411-3413.

Galili, G., Altschuler, Y., and Levanony, H. (1993). Assembly and transport of seed

storage proteins. Trends in Cell Biol 3, 437-442.

Geli, M. I., Torrent, M., and Ludevid, D. (1994). Two structural domains mediate two

sequential events in gamma-zein targeting: Protein endoplasmic reticulum retention and

protein body formation. Plant Cell 6, 1911-1922.

Goff, S. A., Ricke, D., Lan, T.-H., Presting, G., Wang, R., Dunn, M., Glazebrook, J.,

Sessions, A., Oeller, P., Varma, H., Hadley, D., Hutchison, D., Martin, C., Katagiri, F.,

Lange, B. M., Moughamer, T., Xia, Y., Budworth, P., Zhong, J., Miguel, T., Paszkowski,

U., Zhang, S., Colbert, M., Sun, W.-l., Chen, L., Cooper, B., Park, S., Wood, T. C., Mao,

L., Quail, P., Wing, R., Dean, R., Yu, Y., Zharkikh, A., Shen, R., Sahasrabudhe, S.,

Thomas, A., Cannings, R., Gutin, A., Pruss, D., Reid, J., Tavtigian, S., Mitchell, J.,

Eldredge, G., Scholl, T., Miller, R. M., Bhatnagar, S., Adey, N., Rubano, T., Tusneem, N.,

Robinson, R., Feldhaus, J., Macalma, T., Oliphant, A., and Briggs, S. (2002). A draft

sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296, 92-100.

Guerrero-Andrade, O., Loza-Rubio, E., Olivera-Flores, T., Fehervari-Bone, T. s., and

Gomez-Lim, M. A. (2006). Expression of the newcastle disease virus fusion protein in

transgenic maize and immunological studies. Trans Res 15, 455-463.

Hadlington, J. L., and Denecke, J. (2000). Sorting of soluble proteins in the secretory

pathway of plants. Curr Opi in Plant Biol 3, 461-468.

Hamada, S., Ishiyama, K., Choi, S.-B., Wang, C., Singh, S., Kawai, N., Franceschi, V. R.,

and Okita, T. W. (2003a). The transport of prolamine RNAs to prolamine protein bodies

in living rice endosperm cells. The Plant Cell 15, 2253-2264.

Hamada, S., Ishiyama, K., Sakulsingharoj, C., Choi, S.-B., Wu, Y., Wang, C., Singh, S.,

Kawai, N., Messing, J., and Okita, T. W. (2003b). Dual regulated RNA transport pathways

to the cortical region in developing rice endosperm. The Plant Cell 15, 2265-2272.

91

Hara-Nishimura, I., Shimada, T., Hatano, K., Takeuchi, Y., and Nishimura, M. (1998).

Transport of storage proteins to protein storage vacuoles is mediated by large precursor-

accumulating vesicles. The Plant Cell 10, 825-836.

He, Y., Ning, T., Xie, T., Qiu, Q., Zhang, L., Sun, Y., Jiang, D., Fu, K., Yin, F., Zhang,

W., Shen, L., Wang, H., Li, J., Lin, Q., Sun, Y., Li, H., Zhu, Y., and Yang, D. (2011).

Large-scale production of functional human serum albumin from transgenic rice seeds.

PNAS 10.1073/pnas.1109736108

Hefferon, K. (2010). The mucosal immune response to plant-derived vaccines. Phar Res

27, 2040-2042.

Herman, E., and Schmidt, M. (2004). Endoplasmic reticulum to vacuole trafficking of

endoplasmic reticulum bodies provides an alternate pathway for protein transfer to the

vacuole. Plant Physiol 136, 3440-3446.

Herman, E. M. (2008). Endoplasmic reticulum bodies: solving the insoluble. Curr Opin

Plant Biol 11, 672-679.

Herman, E. M., and Larkins, B. A. (1999). Protein storage bodies and vacuoles. The Plant

Cell 11, 601-614.

Hiatt, A., Cafferkey, R., and Bowdish, K. (1989). Production of antibodies in transgenic

plants. Nature 342, 76-78.

Hinz, G., Hillmer, S., Baumer, M., and Hohl, I. (1999). Vacuolar storage proteins and the

putative vacuolar sorting receptor BP-80 exit the golgi apparatus of developing pea

cotyledons in different transport Vesicles. The Plant Cell 11, 1509-1524.

Hohl, I., Robinson, D. G., Chrispeels, M. J., and Hinz, G. (1996). Transport of storage

proteins to the vacuole is mediated by vesicles without a clathrin coat. J. of Cell Sci 109,

2539-2550.

Holm, P. B., Olsen, O., Schnorf, M., Brinch-Pedersen, H., and Knudsen, S. (2000).

Transformation of barley by microinjection into isolated zygote protoplasts. Trans Res 9,

21-32.

92

Horvath, H., Huang, J., Wong, O., Kohl, E., Okita, T., Kannangara, C. G., and von

Wettstein, D. (2000). The production of recombinant proteins in transgenic barley grains.

PNAS 97, 1914-1919.

Hsieh, K., and Huang, A. H. C. (2004). Endoplasmic reticulum, oleosins, and oils in seeds

and tapetum cells. Plant Physiol 136, 3427-3434.

Huang, A. H. C. (1996). Oleosins and oil bodies in deeds and other organs. Plant Physiol

110, 1055-1061.

Ibl, V., and Stoger, E. The formation, function and fate of protein storage compartments in

seeds. (2011) Protop 249, 1-14.

Jach, G., Binot, E., Frings, S., Luxa, K., and Schell, J. (2001). Use of red fluorescent

protein from Discosoma sp. (dsRED) as a reporter for plant gene expression. The Plant J

28, 483-491.

James, M. G., Denyer, K., and Myers, A. M. (2003). Starch synthesis in the cereal

endosperm. Cur Opi in Plant Bio 6, 215-222.

Jane ek, ., and ev k, J. (1999). The evolution of starch-binding domain. FEBS Letters

456, 119-125.

Janecek, S., Svensson, B., and Henrissat, B. (1997). Domain evolution in the α-Amylase

family. J of Mol Evo 45, 322-331.

Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W. (1987). GUS fusions: beta-

glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO

J 6, 3901-7.

Ji, Q., Vincken, J.-P., Suurs, L. C. J. M., and Visser, R. G. F. (2003). Microbial starch-

binding domains as a tool for targeting proteins to granules during starch biosynthesis.

Plant Mol Bio 51, 789-801.

Jiang, L., Phillips, T. E., Hamm, C. A., Drozdowicz, Y. M., Rea, P. A., Maeshima, M.,

Rogers, S. W., and Rogers, J. C. (2001). The protein storage vacuole. The J of Cell Bio

155, 991-1002.

93

Joensuu, J. J., Brown, K. D., Conley, A. J., Clavijo, A., Menassa, R., and Brandle, J. E.

(2009). Expression and purification of an anti-Foot-and-mouth disease virus single chain

variable antibody fragment in tobacco plants. Trans Res 5, 685-96

Joensuu, J. J., Conley, A. J., Lienemann, M., Brandle, J. E., Linder, M. B., and Menassa,

R. (2010). Hydrophobin fusions for high-level transient protein expression and

purification in nicotiana benthamiana. Plant Physiol 152, 622-633.

Joseph, M., Ludevid, D., Torrent, M., Rofidal, V., Tauzin. M., Rossignol. M., and Peltier

J. (2012). Proteomic characterisation of endoplasmic reticulum-derived protein bodies in

tobacco leaves. BMC Plant Biol.12, 1471-2229

Kawakatsu, T., Hirose, S., Yasuda, H., and Takaiwa, F. (2010). Reducing rice seed storage

protein accumulation leads to changes in nutrient quality and storage organelle formation.

Plant Physiol 154, 1842-1854.

Kay, R., Chan, A., Daly, M., and McPherson, J. (1987). Duplication of CaMV 35S

promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302.

Kermode, AR. (2012). Seed expression systems for molecular farming. In: Wang A, Ma S

(eds) Molecular farming in plants: recent advances and future prospects. Springer Science

Business Media, New York, 89–123

Khan, I., Twyman, M., Arcalis, E., and Stoger, E. (2012). Using storage organelles for the

accumulation and encapsulation of recombinant proteins. Biotechnol J 7, 1099–1108.

Knudsen, S., and Müller, M. (1991). Transformation of the developing barley endosperm

by particle bombardment. Planta 185, 330-336.

Kogan, M. J., Dalcol, I., Gorostiza, P., Lopez-Iglesias, C., Pons, M., Sanz, F., Ludevid, D.,

and Giralt, E. (2001). Self-assembly of the amphipathic helix (VHLPPP)8. A mechanism

for zein protein body formation. J Mol Biol 312, 907-913.

Kogan, M. J., Dalcol, I., Gorostiza, P., Lopez-Iglesias, C., Pons, R., Pons, M., Sanz, F.,

and Giralt, E. (2002). Supramolecular properties of the proline-rich gamma-zein N-

terminal domain. Biophys J 83, 1194-1204.

94

Kreis, M., Forde, B. G., Rahman, S., Miflin, B. J., and Shewry, P. R. (1985). Molecular

evolution of the seed storage proteins of barley, rye and wheat. J of Mol Biol 183, 499-

502.

Krishnan, H. B., Franceschi, V. R., and Okita, T. W. (1986). Immunochemical studies on

the role of the Golgi complex in protein-body formation in rice seeds. Planta 169, 471-

480.

Kühnel, B., Alcantara, J., Boothe, J., van Rooijen, G., and Moloney, M. (2003). Precise

and efficient cleavage of recombinant fusion proteins using mammalian aspartic proteases.

Prot Eng 16, 777-783.

Kumamaru, T., Ogawa, M., Satoh, H., Okita, T., and Olsen, O.-A. (2007). Protein body

biogenesis in cereal endosperms. Endosperm 8, 141-158.

Kusnadi, A. R., Hood, E. E., Witcher, D. R., Howard, J. A., and Nikolov, Z. L. (1998).

Production and purification of two recombinant proteins from transgenic corn. Biotechnol

Progr 14, 149-155.

Lau, O. S., and Sun, S. S. M. (2009). Plant seeds as bioreactors for recombinant protein

production. Biotechnol Adv 27, 1015-1022.

Le Gall, F., Kipriyanov, S. M., Moldenhauer, G., and Little, M. (1999). Di-, tri- and

tetrameric single chain Fv antibody fragments against human CD19: effect of valency on

cell binding. FEBS Lett 453, 164-168.

Le Gall, F., Reusch, U., Moldenhauer, G., Little, M., and Kipriyanov, S. M. (2004).

Immunosuppressive properties of anti-CD3 single-chain Fv and diabody. J Immunol Meth

285, 111-127.

Lending, C. R., Kriz, A. L., Larkins, B. A., and Bracker, C. E. (1988). Structure of maize

protein bodies and immunocytochemical localization of zeins. Protopl 143, 51-62.

Levanony, H., Rubin, R., Altschuler, Y., and Galili, G. (1992). Evidence for a novel route

of wheat storage proteins to vacuoles. J Cell Biol 119, 1117-1128.

95

Li, X., Wu, Y., Zhang, D. Z., Gillikin, J. W., Boston, R. S., Franceschi, V. R., and Okita,

T. W. (1993). Rice prolamin protein body biogenesis: A BiP-mediated process. Science

262, 1054-1056.

Lichty, J. J., Malecki, J. L., Agnew, H. D., Michelson-Horowitz, D. J., and Tan, S. (2005).

Comparison of affinity tags for protein purification. Pro Expr and Purif 41, 98-105.

Lin, M., Rose-John, S., Grotzinger, J., Conrad, U., and Scheller, J. (2006). Functional

expression of a biologically active fragment of soluble gp130 as an ELP-fusion protein in

transgenic plants: purification via inverse transition cycling. Biochem J 398, 577-583.

Linder, M. B., Qiao, M., Laumen, F., Selber, K., Hyytia, T., Nakari-Setala, T., and

Penttila, M. E. (2004). Efficient purification of recombinant proteins using hydrophobins

as tags in surfactant-based two-phase systems. Biochem 43, 11873-11882.

Llompart, B., Llop-Tous, I., Marzabal, P., Torrent, M., Pallissé, R., Bastida, M., Ludevid,

M. D., and Walas, F. (2010). Protein production from recombinant protein bodies. Pro

Biochem 45, 1816-1820.

Llop-Tous I., Ortiz, M., Torrent, M., Ludevid, MD. (2011). The expression of a xylanase

targeted to ER-protein bodies provides a simple strategy to produce active insoluble

enzyme polymers in tobacco plants. PLoS One 2011, 6: e19474.

Ma, J. K., Barros, E., Bock, R., Christou, P., Dale, P. J., Dix, P. J., Fischer, R., Irwin, J.,

Mahoney, R., and Pezzotti, M. (2005). Molecular farming for new drugs and vaccines.

Current perspectives on the production of pharmaceuticals in transgenic plants. EMBO

Rep 6, 593-599.

Ma, J. K. C., Drake, P. M. W., and Christou, P. (2003). The production of recombinant

pharmaceutical proteins in plants. Nat Rev Genet 4, 794-805.

Mainieri, D., Rossi, M., Archinti, M., Bellucci, M., De Marchis, F., Vavassori, S., Pompa,

A., Arcioni, S., and Vitale, A. (2004). Zeolin. A new recombinant storage protein

constructed using maize gamma-zein and bean phaseolin. Plant Physiol 136, 3447-3456.

96

Mas, P., Devlin, P. F., Panda, S., and Kay, S. A. (2000). Functional interaction of

phytochrome B and cryptochrome 2. Nature 408, 207-211.

Matheson, L. A., Hanton, S. L., and Brandizzi, F. (2006). Traffic between the plant

endoplasmic reticulum and Golgi apparatus: to the Golgi and beyond. Curr Opin Plant

Biol 9, 601-609.

Matthew J, H. (2004). Control of storage-product synthesis in seeds. Curr Opi in Plant

Biol 7, 302-308.

Matz, M. V., Fradkov, A. F., Labas, Y. A., Savitsky, A. P., Zaraisky, A. G., Markelov, M.

L., and Lukyanov, S. A. (1999). Fluorescent proteins from nonbioluminescent Anthozoa

species. Nat Biotechnol 17, 969-973.

Menassa, R., Nguyen, V., Jevnikar, A., and Brandle, J. (2001). A self-contained system

for the field production of plant recombinant interleukin-10. Mol Breed 8, 177-185.

Menassa, R., Zhu, H., Karatzas, C. N., Lazaris, A., Richman, A., and Brandle, J. (2004).

Spider dragline silk proteins in transgenic tobacco leaves: accumulation and field

production. Plant Biotechnol J 2, 431-438.

Menkhaus, T. J., Bai, Y., Zhang, C., Nikolov, Z. L., and Glatz, C. E. (2004).

Considerations for the recovery of recombinant proteins from plants. Biotechnol Progr 20,

1001-1014.

Meyer, D. E., and Chilkoti, A. (1999). Purification of recombinant proteins by fusion with

thermally-responsive polypeptides. Nat Biotechnol 17, 1112-1115.

Meyer, D. E., and Chilkoti, A. (2004). Quantification of the effects of chain length and

concentration on the thermal behavior of elastin-like polypeptides. Biomacro 5, 846-851.

Miflin, B. J., Burgess, S. R., and Shewry, P. R. (1981). The development of protein bodies

in the storage tissues. J of Exper Bot 32, 199-219.

Miki, B., and McHugh, S. (2004). Selectable marker genes in transgenic plants:

applications, alternatives and biosafety. J of Biotechnol 107, 193-232.

97

Mishra, S., Yadav, D. K., and Tuli, R. (2006). Ubiquitin fusion enhances cholera toxin B

subunit expression in transgenic plants and the plant-expressed protein binds GM1

receptors more efficiently. J of Biotechnol 127, 95-108.

Mohamed-Yasseen, Y., Barringer, S., Splittstoesser, W., and Costanza, S. (1994). The role

of seed coats in seed viability. The Bot Rev 60, 426-439.

Molina, A., Hervás-Stubbs, S., Daniell, H., Mingo-Castel, A. M., and Veramendi, J.

(2004). High-yield expression of a viral peptide animal vaccine in transgenic tobacco

chloroplasts. Plant Biotechnol J 2, 141-153.

Moravec, T., Schmidt, M. A., Herman, E. M., and Woodford-Thomas, T. (2007).

Production of Escherichia coli heat labile toxin (LT) B subunit in soybean seed and

analysis of its immunogenicity as an oral vaccine. Vaccine 25, 1647-1657.

Muench, D. G., Chuong, S. D. X., Franceschi, V. R., and Okita, T. W. (2000). Developing

prolamine protein bodies are associated with the cortical cytoskeleton in rice endosperm

cells. Planta 211, 227-238.

Muench, D. G., Wu, Y., Zhang, Y., Li, X., Boston, R. S., and Okita, T. W. (1997).

Molecular cloning, expression and subcellular localization of a BiP homolog from rice

endosperm tissue. Plant Cell Physiol 38, 404-412.

Müntz, K., Belozersky, M. A., Dunaevsky, Y. E., Schlereth, A., and Tiedemann, J. (2001).

Stored proteinases and the initiation of storage protein mobilization in seeds during

germination and seedling growth. J of Exper Bot 52, 1741-1752.

Nicholson, L., Gonzalez-Melendi, P., van Dolleweerd, C., Tuck, H., Perrin, Y., Ma, J. K.,

Fischer, R., Christou, P., and Stoger, E. (2005). A recombinant multimeric

immunoglobulin expressed in rice shows assembly-dependent subcellular localization in

endosperm cells. Plant Biotechnol J 3, 115-127.

Nochi, T., Takagi, H., Yuki, Y., Yang, L., Masumura, T., Mejima, M., Nakanishi, U.,

Matsumura, A., Uozumi, A., Hiroi, T., Morita, S., Tanaka, K., Takaiwa, F., and Kiyono,

H. (2007). Rice-based mucosal vaccine as a global strategy for cold-chain- and needle-free

vaccination. PNAS USA 104, 10986-10991.

98

Nykiforuk, C., Shewmaker, C., Harry, I., Yurchenko, O., Zhang, M., Reed, C., Oinam, G.,

Zaplachinski, S., Fidantsef, A., Boothe, J., and Moloney, M. (2012). High level

accumulation of gamma linolenic acid (C18:3Δ6.9,12 cis) in transgenic safflower

(Carthamus tinctorius) seeds. Trans Res 9, 1-15.

Obregon, P., Chargelegue, D., Drake, P. M. W., Prada, A., Nuttall, J., Frigerio, L., and

Ma, J. K. C. (2006). HIV-1 p24–immunoglobulin fusion molecule: a new strategy for

plant-based protein production. Plant Biotechnol J 4, 195-207.

Ow, D. W., De Wet, J. R., Helinski, D. R., Howell, S. H., Wood, K. V., and Deluca, M.

(1986). Transient and stable expression of the firefly luciferase gene in plant cells and

transgenic plants. Science 234, 856-859.

Parmenter, D. L., Boothe, J. G., Rooijen, G. J. H., Yeung, E. C., and Moloney, M. M.

(1995). Production of biologically active hirudin in plant seeds using oleosin partitioning.

Plant Mol Bio 29, 1167-1180.

Patel, J., Zhu, H., Menassa, R., Gyenis, L., Richman, A., and Brandle, J. (2007). Elastin-

like polypeptide fusions enhance the accumulation of recombinant proteins in tobacco

leaves. Trans Res 16, 239-249.

Patel, M., Johnson, J. S., Brettell, R. I. S., Jacobsen, J., and Xue, G.-P. (2000). Transgenic

barley expressing a fungal xylanase gene in the endosperm of the developing grains. Mol

Breed 6, 113-124.

Perrin, Y., Vaquero, C., Gerrard, I., Sack, M., Drossard, J. r., Stoger, E., Christou, P., and

Fischer, R. (2000). Transgenic pea seeds as bioreactors for the production of a single-

chain Fv fragment (scFv) antibody used in cancer diagnosis and therapy. Mol Breed 6,

345-352.

Persson, J., Nyström, L., Ageland, H., and Tjerneld, F. (1999). Purification of recombinant

and human apolipoprotein A-1 using surfactant micelles in aqueous two-phase systems:

Recycling of thermoseparating polymer and surfactant with temperature-induced phase

separation. Biotechnol and Bioeng 65, 371-381.

99

Petruccelli, S., Otegui, M. S., Lareu, F., Tran Dinh, O., Fitchette, A. C., Circosta, A.,

Rumbo, M., Bardor, M., Carcamo, R., and Gomord, V. (2006). A KDEL-tagged

monoclonal antibody is efficiently retained in the endoplasmic reticulum in leaves, but is

both partially secreted and sorted to protein storage vacuoles in seeds. Plant Biotechnol J

4, 511-527.

Pompa, A., and Vitale, A. (2006). Retention of a bean phaseolin/maize gamma zein fusion

in the endoplasmic reticulum depends on disulfide bond formation. Plant Cell 18, 2608-

2621.

Prat, S., Cortadas, J., Puigdomenech, P., and Palau, J. (1985). Nucleic acid (cDNA) and

amino acid sequences of the maize endosperm protein glutelin-2. Nucl Acids Res 13,

1493-1504.

Qian, B., Shen, H., Liang, W., Guo, X., Zhang, C., Wang, Y., Li, G., Wu, A., Cao, K., and

Zhang, D. (2008). Immunogenicity of recombinant hepatitis B virus surface antigen fused

with preS1 epitopes expressed in rice seeds. Trans Res 17, 621-631.

Rademacher, T., Sack, M., Arcalis, E., Stadlmann, J., Balzer, S., Altmann, F., Quendler,

H., Stiegler, G., Kunert, R., Fischer, R., and Stoger, E. (2008). Recombinant antibody

2G12 produced in maize endosperm efficiently neutralizes HIV-1 and contains

predominantly single-GlcNAc N-glycans. Plant Biotechnol J 6, 189-201.

Ramessar, K., Capell, T., and Christou, P. (2008). Molecular pharming in cereal crops.

Phytochem Rev 7, 579-592.

Ramirez, N., Ayala, M., Lorenzo, D., Palenzuela, D., Herrera, L., Doreste, V., Perez, M.,

Gavilondo, J. V., and Oramas, P. (2002). Expression of a single-chain Fv antibody

fragment specific for the hepatitis B surface antigen in transgenic tobacco plants. Trans

Res 11, 61-64.

Randall, J., Bagga, S., Adams, H., and Kemp, J. D. (2000). A modified 10 kD zein protein

produces two morphologically distinct protein bodies in transgenic tobacco. Plant Sci 150,

21-28.

100

Randall, J. J., Sutton, D. W., Hanson, S. F., and Kemp, J. D. (2005). BiP and zein binding

domains within the delta zein protein. Planta 221, 656-666.

Rasco‐Gaunt, S., Riley, A., Cannell, M., Barcelo, P., and Lazzeri, P. A. (2001).

Procedures allowing the transformation of a range of European elite wheat (Triticum

aestivum L.) varieties via particle bombardment. J Exp Bot 52, 865-874.

Rubin, R., Levanony, H., and Galili, G. (1992). Evidence for the Presence of two different

types of protein bodies in wheat endosperm. Plant Physiol 99, 718-724.

Rymerson, R. T., Menassa, R., and Brandle, J. E. (2002). Tobacco, a platform for the

production of recombinant proteins. Molecular Farming of Plants and Animals for Human

and Veterinary Medicine, 1-32.

Saalbach, I., Giersberg, M., and Conrad, U. (2001). High-level expression of a single-

chain Fv fragment (scFv) antibody in transgenic pea seeds. J Plant Physiol 158, 529-533.

Saint-Jore, C. M., Evins, J., Batoko, H., Brandizzi, F., Moore, I., and Hawes, C. (2002).

Redistribution of membrane proteins between the Golgi apparatus and endoplasmic

reticulum in plants is reversible and not dependent on cytoskeletal networks. Plant J 29,

661-678.

Saito, Y., Kishida, K., Takata, K., Takahashi, H., Shimada, T., Tanaka, K., Morita, S.,

Satoh, S., and Masumura, T. (2009). A green fluorescent protein fused to rice prolamin

forms protein body-like structures in transgenic rice. J Exp Bot 60, 615-627.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: A laboratory

manual. 2.

Sanford, J.C., Smith, F. D., and Russell, J.A. (1993). Optimizing the biolistic process.

Meth in Enzy 217, 483-509.

Scheller, J., Henggeler, D., Viviani, A., and Conrad, U. (2004). Purification of spider silk-

elastin from transgenic plants and application for human chondrocyte proliferation. Trans

Res 13, 51-57.

101

Scheller, J., Leps, M., and Conrad, U. (2006). Forcing single-chain variable fragment

production in tobacco seeds by fusion to elastin-like polypeptides. Plant Biotechnol J 4,

243-249.

Schillberg, S., Emans, N., and Fischer, R. (2002). Antibody molecular farming in plants

and plant cells. Phytochem Rev 1, 45-54.

Schillberg, S., Fischer, R., and Emans, N. (2003). Molecular farming of recombinant

antibodies in plants. Cell and Mol Life Sci 60, 433-445.

Schmidt, M. A., and Herman, E. M. (2008). Proteome rebalancing in soybean seeds can be

exploited to enhance foreign protein accumulation. Plant Biotechnol J 6, 832-842.

Schünmann, P. H. D., Coia, G., and Waterhouse, P. M. (2002). Biopharming the

SimpliRED™ HIV diagnostic reagent in barley, potato and tobacco. Mol Breed 9, 113-

121.

Selber, K., Tjerneld, F., Collen, A., Hyytia, T., Nakari-Setala, T., Bailey, M., Fagerstra,

R., Kan, J., van der Laan, J., Penttila, M., and Kula, M.-R. (2004). Large-scale separation

and production of engineered proteins, designed for facilitated recovery in detergent-based

aqueous two-phase extraction systems. Proc Biochem 39, 889-896.

Shewry, P. R., and Halford, N. G. (2002). Cereal seed storage proteins: structures,

properties and role in grain utilization. J Exp Bot 53, 947-958.

Shewry, P. R., Napier, J. A., and Tatham, A. S. (1995). Seed storage proteins: Structures

and biosynthesis. The Plant Cell 7, 945-956.

Singh, N. K., Shepherd, K. W., Langridge, P., and Gruen, L. C. (1991). Purification and

biochemical characterization of triticin, a legumin-like protein in wheat endosperm. J Cer

Sci 13, 207-219.

Skerra, A., and Schmidt, T. G. M. (2000). Use of the strep- tag and streptavidin for

detection and purification of recombinant proteins. Meth in Enzy 326, 271-304.

Smith, A. M. (2001). The biosynthesis of starch granules. Biomacro 2, 335-341.

102

Smith, M. L., Richter, L., Arntzen, C. J., Shuler, M. L., and Mason, H. S. (2003).

Structural characterization of plant-derived hepatitis B surface antigen employed in oral

immunization studies. Vaccine 21, 4011-4021.

Stöger, E., Ma, J. K., Fischer, R., and Christou, P. (2005a). Sowing the seeds of success:

Pharmaceutical proteins from plants. Curr Opin Biotechnol 16, 167-173.

Stöger, E., Sack, M., Fischer, R., and Christou, P. (2002). Plantibodies: applications,

advantages and bottlenecks. Curr Opin Biotechnol 13, 161-166.

Stöger, E., Sack, M., Nicholson, L., Fischer, R., and Christou, P. (2005c). Recent progress

in plantibody technology. Curr Pharm Des 11, 2439-2457.

Stöger, E., Vaquero, C., Torres, E., Sack, M., Nicholson, L., Drossard, J., Williams, S.,

Keen, D., Perrin, Y., Christou, P., and Fischer, R. (2000). Cereal crops as viable

production and storage systems for pharmaceutical scFv antibodies. Plant Mol Biol 42,

583-590.

Streatfield, S. J. (2007). Approaches to achieve high-level heterologous protein production

in plants. Plant Biotechnol J 5, 2-15.

Takagi, H., Hiroi, T., Hirose, S., Yang, L., and Takaiwa, F. (2010). Rice seed ER-derived

protein body as an efficient delivery vehicle for oral tolerogenic peptides. Peptides 31,

1421-1425.

Takaiwa, F., Hirose, S., Takagi, H., Yang, L., and Wakasa, Y. (2009). Deposition of a

recombinant peptide in ER-derived protein bodies by retention with cysteine-rich

prolamins in transgenic rice seed. Planta 229, 1147-1158.

Takaiwa, F., Takagi, H., Hirose, S., and Wakasa, Y. (2007a). Endosperm tissue is good

production platform for artificial recombinant proteins in transgenic rice. Plant Biotechnol

J 5, 84-92.

Takaiwa, F., Takagi, H., Hirose, S., and Wakasa, Y. (2007b). Endosperm tissue is good

production platform for artificial recombinant proteins in transgenic rice. Plant Biotechnol

J 5, 84-92.

103

Tanaka, A., Ito, M., and Hiromi, K. (1986). Equilibrium and kinetic studies on the binding

of gluconolactone to almond beta-glucosidase in the absence and presence of glucose. J of

Biochem 100, 1379-1385.

Terpe, K. (2003). Overview of tag protein fusions: from molecular and biochemical

fundamentals to commercial systems. App Micro and Biotechnol 60, 523-533.

Thorpe, J. (1999). The application of LR Gold resin for immunogold labeling. Methods in

Molecular Biology: Elec Micros Meth and Prot 117, 99-110.

Torrent, M., Geli, M. I., Ruiz-Avila, L., Canals, J. M., Puigdomenech, P., and Ludevid, D.

(1994). Role of structural domains for gamma zein retention in xenopus oocytes. Planta

192, 512-518.

Torrent, M., Llompart, B., Lasserre-Ramassamy, S., Llop-Tous, I., Bastida, M., Marzabal,

P., Westerholm-Parvinen, A., Saloheimo, M., Heifetz, P., and Ludevid, M. D. (2009a).

Eukaryotic protein production in designed storage organelles. BMC Biology 7, 5.

Torrent, M., Llompart, B., Lasserre-Ramassamy, S., Llop-Tous, I., Bastida, M., Marzabal,

P., Westerholm-Parvinen, A., Saloheimo, M., Heifetz, P. B., and Ludevid, M. D. (2009b).

Eukaryotic protein production in designed storage organelles. BMC Biol 7, 5.

Torrent, M., Llop-Tous, I., and Ludevid, D. M. (2009c). Protein body induction: a new

tool to produce and recover recombinant proteins in plants. Rec Pro from Plants, Meth in

Mol Biol 483, 193-208.

Tosi, P., Parker, M., Gritsch, C. S., Carzaniga, R., Martin, B., and Shewry, P. R. (2009).

Trafficking of storage proteins in developing grain of wheat. J Exp Bot 60, 979-991.

Tsien, R. Y. (1998). The green fluorescent protein. Annu Rev Biochem 67, 509-544.

Tsuboi, T., Takeo, S., Iriko, H., Jin, L., Tsuchimochi, M., Matsuda, S., Han, E.-T., Otsuki,

H., Kaneko, O., Sattabongkot, J., Udomsangpetch, R., Sawasaki, T., Torii, M., and Endo,

Y. (2008). Wheat germ cell-free system-based production of malaria proteins for

discovery of novel vaccine candidates. Infec and Immunol 76, 1702-1708.

104

Twyman, R. M., Schillberg, S., and Fischer, R. (2005). Transgenic plants in the

biopharmaceutical market. Exp Opin on Emerg Drugs 10, 185-218.

Twyman, R. M., Schillberg, S., Fischer, R., and Ranalli, P. (2007). Molecular farming of

antibodies in plants. Improvement of crop plants for industrial end uses. 435-469.

Twyman, R. M., Stoger, E., Schillberg, S., Christou, P., and Fischer, R. (2003b).

Molecular farming in plants: host systems and expression technology. Trends Biotechnol

21, 570-578.

Urry, D. W. (1988). Entropic elastic processes in protein mechanisms. I. Elastic structure

due to an inverse temperature transition and elasticity due to internal chain dynamics. J of

Prot Chem 7, 1-34.

Van Droogenbroeck, B., Cao, J., Stadlmann, J., Altmann, F., Colanesi, S., Hillmer, S.,

Robinson, D. G., Van Lerberge, E., Terryn, N., Van Montagu, M., Liang, M., Depicker,

A., and Jaeger, G. D. (2007). Aberrant localization and underglycosylation of highly

accumulating single-chain Fv-Fc antibodies in transgenic Arabidopsis seeds. PNAS 104,

1430-1435.

Vasil, V., Castillo, A. M., Fromm, M. E., and Vasil, I. K. (1992). Herbicide resistant

fertile transgenic wheat plants obtained by microprojectile bombardment of regenerable

embryogenic callus. Nat Biotechnol 10, 667-674.

Verwoerd, T., Paridon, P., Ooyen, A., Lent, J., Hoekema, A., Pen, J. (1995). Stable

accumulation of Aspergillus niger phytase in transgenic tobacco leaves. Plant Physiol

109,1199–1205.

Vitale, A., and Ceriotti, A. (2004). Protein quality control mechanisms and protein storage

in the endoplasmic reticulum. A conflict of interests? Plant Physiol 136, 3420-3426.

Vitale, A., and Hinz, G. (2005). Sorting of proteins to storage vacuoles: how many

mechanisms? Trends in Plant Sci 10, 316-323.

105

Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient

expression system in plants based on suppression of gene silencing by the p19 protein of

tomato bushy stunt virus. Plant J 33, 949-956.

Washida, H., Sugino, A., Messing, J., Esen, A., and Okita, T. W. (2004). Asymmetric

localization of seed storage protein RNAs to distinct subdomains of the endoplasmic

reticulum in developing maize endosperm cells. Plant Cell Physiol 45, 1830-1837.

Wilson, S., Burton, R., Doblin, M., Stone, B., Newbigin, E., Fincher, G., and Bacic, A.

(2006). Temporal and spatial appearance of wall polysaccharides during cellularization of

barley (Hordeum vulgare) endosperm. Planta 224, 655-667.

Witte, C.-P., Noël, L., Gielbert, J., Parker, J., and Romeis, T. (2004). Rapid one-step

protein purification from plant material using the eight-amino acid StrepII epitope. Plant

Mol Biol 55, 135-147.

Woo, Y.-M., Hu, D. W.-N., Larkins, B. A., and Jung, R. (2001). Genomics analysis of

genes expressed in maize endosperm identifies novel seed proteins and clarifies patterns of

zein gene expression. The Plant Cell 13, 2297-2317.

Wu, J., Yu, L., Li, L., Hu, J., Zhou, J., and Zhou, X. (2007). Oral immunization with

transgenic rice seeds expressing VP2 protein of infectious bursal disease virus induces

protective immune responses in chickens. Plant Biotechnol J 5, 570-578.

Xie, T., Qiu, Q., Zhang, W., Ning, T., Yang, W., Zheng, C., Wang, C., Zhu, Y., and Yang,

D. (2008). A biologically active rhIGF-1 fusion accumulated in transgenic rice seeds can

reduce blood glucose in diabetic mice via oral delivery. Peptides 29, 1862-1870.

Yamagata, H., and Tanaka, K. (1986). The site of synthesis and accumulation of rice

storage proteins. Plant and Cell Physiol 27, 135-145.

Yang, J., Barr, L. A., Fahnestock, S. R., and Liu, Z.-B. (2005). High yield recombinant

silk-like protein production in transgenic plants through protein targeting. Trans Res 14,

313-324.

106

Yang, Y., Li, R., and Qi, M. (2000). In vivo analysis of plant promoters and transcription

factors by agroinfiltration of tobacco leaves. Plant J 22, 543-551.

Zakharov, A., Giersberg, M., Hosein, F., Melzer, M., Muntz, K., and Saalbach, I. (2004).

Seed-specific promoters direct gene expression in non-seed tissue. J Exp Bot 55, 1463-

1471.

Zhang, F., and Boston, R. S. (1992). Increases in binding protein (BiP) accompany

changes in protein body morphology in three high-lysine mutants of maize. Protoplasma

171, 142-152.

Zhang, Y., Darlington, H., Jones, H. D., Halford, N. G., Napier, J. A., Davey, M. R.,

Lazzeri, P. A., and Shewry, P. R. (2003). Expression of the gamma-zein protein of maize

in seeds of transgenic barley: effects on grain composition and properties. Theor and App

Gen 106, 1139-1146.

Ziemienowicz, A. (2001). Plant selectable markers and reporter genes. Acta Physiol Plant

23, 363-374.

Zimmermann, J., Saalbach, I., Jahn, D., Giersberg, M., Haehnel, S., Wedel, J., Macek, J.,

Zoufal, K., Glunder, G., Falkenburg, D., and Kipriyanov, S. (2009). Antibody expressing

pea seeds as fodder for prevention of gastrointestinal parasitic infections in chickens. BMC

Biotechnol 9, 79.

107

Appendix

List of Abbreviations

°C degree Celsius

µ micro

2,4-D 2,4-Dichlorophenoxyessigsäure

A. tumefaciens Agro-bacterium tumefaciens

aa amino acids

Ab antibody

Amp ampicillin

AP alkaline phosphatase

APO apoplast

BCIP 5-Bromo-4-Chloro-3-Indolyl-

Phosphat

bp base pair

CaCl2 calcium chloride

CaMV 35S 35S promoter from the cauliflower

mosaic virus

CaMV cauliflower mosaic virus

Carb carbenicillin

cDNA complementary DNA

CI chloroform/isoamyl alcohol (24:1)

cv. cultivar

Cys cysteine

DNA deoxyribonucleic acid

DNTP deoxyribonucleoside triphosphate

DsRed discosoma Red Flourescent Protein

E. coli Escherichia coli

e.g. exempli gratia

ER endoplasmic reticulum

EtBr ethidium bromide

EtOH ethanol

108

g relative centrifugal force (RCF)

GFP green fluorescent protein

GSM Agrobacteria glycerol stock media

h hour(s)

H or His6 six histidine residues tag

HCl hydrochloric acid

He helium

i.e. id est

kb kilobase pair

kDa kilodalton

KDEL KDEL (Lys-Asp-Glu-Leu) ER

retention signal

Km Kanamycin

L liter

LB Luria-Bertani medium

LBamp LB media containing ampicillin

m mili

M molar

M molar

min Minute(s)

mM millimolar

Mr Molecular mass

mRNA messenger RNA

MS Murashige and Skoog medium

Mw molecular weight

MW molecular weight

NA not available

NaCl nodium chloride

nd. not detectable

nt nucleotide

O/N over night

OD optical density

ORF open reading frame

109

Ori origin of replication

PAA poly-acrylamide

PAGE poly-acrylamide gel electrophoresis

PAT phosphinothricin acetyl transferase

pat-gene phosphinotricin-acetyltransferase

gene

PB protein bodies

PBS phosphate buffered saline

PBST 0.1% (v/v) Tween-20 in PBS

PCR polymerase chain reaction

PEG polyethylene glycol

pH A logarithmic measure of hydrogen

ion concentration

poly A polyadenylation signal

PPT phosphinothricin

psi pound per square inch

PSV protein storage vacuole

rec. recombinant

rHSA recombinant human serum albumin

RNA Ribonucleic acid

rpm Rounds per minute

RT room temperature

SDS-PAGE Sodium dodecyl sulfate-

polyacrylamide gel electrophoresis

sec second(s)

Taq Thermus aquaticus

TEMED N, N, N, N-tetramethylene-

ethylenediamine

temp. temperature

Tm melting temperature

TSP total soluble protein.

Tris Tris (Hydroxymethyl) aminomethane

110

Tween 20 polyoxyethylene sorbitan

monolaureate

ubi1-Promotor ubiquitin1-Promotor

UTR untranslated region

UV ultraviolet

UV ultraviolet light

v/v volume per volume

Vol. volume

w/v weight per volume

w/w weight per weight

α Apha

β Beta

γ Gamma

μg microgram

μl microliter

μm micrometer

μM micromolar

111

Curriculum Vitae

Name: Imran Khan

Gender: Male

Date of Birth: 1st April, 1980

Place of Birth: Peshawar, Pakistan

Nationality: Pakistani

Education

2008-2013 PhD in Molecular Biotechnology, RWTH Aachen University,

Aachen, Germany.

2004-2006 Master of Philosophy (M. Phil) in Biotechnology and Genetic Engineering,

NWFP Agricultural University, Peshawar, Pakistan.

2000-2004 BSc (Hons) in Plant Breeding and Genetics, NWFP Agricultural

University, Peshawar, Pakistan.

1996-1999 Higher Secondary School Certificate, Peshawar, Pakistan.

1986-1996 High School Certificate, Peshawar, Pakistan.