Vol. of June 10, No. THE OF U.S.A. in Estrogen Regulation ... · PDF fileEstrogen Regulation...

THE JOURNAL OF Bromcrc~~ CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 269, No. 23, Issue of June 10, pp. 16433-16442, 1994 Printed in U.S.A.

Estrogen Regulation of the Insulin-like Growth Factor I Gene Transcription Involves an AP-1 Enhancer*

(Received for publication, December 1, 1993, and in revised form, March 1, 1994)

Yutaka UmayaharaS, Ryuzo Kawamori, Hirotaka Watada, Eiichi Imano, Norimichi Iwama, Toyohiko Morishima, Yoshimitsu Yamasaki, Yoshitaka KajimotoO, and Takenobu Kamada From the First Department of Medicine, Osaka University School of Medicine, Suita 565, Japan

As a step toward elucidating the physiological role of insulin-like growth factor-I (IGF-I) in mediating estrogen action, we sought to determine the molecular basis of the phenomenon. In HepG2 cells expressing exogenous estrogen receptors (ER), a reporter gene plasmid containing 600 base pairs of the chicken IGF-I promoter enhanced expression of luciferase 8.6-fold in response to lo-‘ M 17P-estradiol, indicating that the IGF-I promoter is a target of estrogen regulation. Although no conventional estrogen-responsive element was identified within the promoter fragment, the AP-1 motif located therein was shown to be essential; the estrogen-responsive enhancement of the Fos-Jun binding to the AP-1 motif, which takes place by means of post-translational modification, mediates the estrogen action. A direct or indirect interaction between the estrogen-ER complex and the Fos-Jun complex seems to facilitate the Fos-Jun binding to the target DNA. Although ER binding to the target DNA was not considered to be involved in the signaling pathway, the DNA binding domain-deficient ER did not mediate the phenomenon, providing support for the existence of a unique function of the DNA binding domain of ER in facilitating some protein-protein interaction. In conclusion, our present observations demonstrate that the chicken IGF-I gene promoter is controlled by estrogen through a unique pathway involving Fos, Jun, and the DNA binding domain of ER.

Insulin-like growth factor I (IGF-I)’ is a 70-residue single- chain polypeptide that has multiple effects on cellular growth and metabolism (for review see Refs. 1 and 2). Historically, IGF-I has been known as an endocrine factor, produced in the liver under the control of growth hormone (GH). Besides the endocrine effects, many recent studies have shown that IGF-I is produced in most organs and tissues and functions as an autocrine or paracrine growth stimulator (for review see Refs.

* This work was supported in part by Grant-in-aid for Scientific Re- search 2671099 (to R. K.) and grants from the Ministry of Education of Japan and the Foundation of Growth Science of Japan (to Y. U. and to Y. K., respectively). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Recipient of a fellowship from the Japan Society for the Promotion of Science for Japanese Junior Scientists.

Medicine, Osaka University School of Medicine, 2-2 Yamadaoka, Suita 5 To whom correspondence should be addressed: First Department of

City, Osaka Pref. 565, Japan. Tel.: 81(Japan)-6-879-3633; Fax: 81(Ja- pan)-6-879-3639.

The abbreviations used are: IGF-I, insulin-like growth factor I; GH, growth hormone; ER, estrogen receptor; ERE, estrogen-responsive element; Ab, antibody; EBNA-1, Epstein-Barr virus nuclear antigen-1; CAT, chloramphenicol acetyltransferase; RACE, rapid amplification of cDNA ends; TPA, 12-0-tetradecanoylphorbol-13-acetate; bp, base paifis); PBS, phosphate-buffered saline.

2 and 3). Although in most tissues the major trophic factor regulating IGF-I is GH (2,3), several other hormones including thyroid hormone (4, 51, epidermal growth factor (61, and para- thyroid hormone (7) have been shown to modify IGF-I expression. Estrogen is also known as one of the regulators of IGF-I, enhancing its expression in certain estrogen-sensitive cells and tissues, Ernst et al. (8) have demonstrated that estradiol treatment increases IGF-I mRNA in osteoblastic cells and that antibodies against IGF-I inhibit the estradiol effect of increasing both cell number and thymidine incorporation into the cells. These observations are noteworthy from the clinical stand- point, since they may be related to postmenopausal osteoporo- sis (8). In vivo studies on the estrogen regulation of IGF-I have been done with rat uterus. Murphy et al. (9) have shown that estradiol treatment increases IGF-I mRNA in the uterus of ovariectomized prepuberty rat. However, in the liver of ovariectomized rat, estradiol did not affect the quantity of IGF-I mRNA(10) and decreased the GH-induced increase (10). In the presence of the protein synthesis inhibitor cycloheximide, only the GH-induced IGF-I mRNA increase in the liver was abol- ished, with the estradiol-induced increase not being affected (11). These observations suggest that although both estrogen and GH regulate expression of the IGF-I gene, the underlying mechanisms may be different. In most cases, the estrogen receptor (ER) mediates estrogen actions by simply binding as a homodimer to specific target DNA sequences known as the estrogen-responsive element (ERE) and thus stimulates transcription of a target gene (for review see Refs. 12-14). The results of RNA analyses using cycloheximide have suggested that the signaling pathways for estrogen regulation of IGF-I gene expression do not involve de nouo protein synthesis in rat uterus (ll), as described above, or in osteoblasts in culture (15). This led to the suggestion that an ERE exists in the regulatory regions of IGF-I genes (15, 16). However, contrary to expecta- tion, no consensus ERE has been identified to date in the characterized portion of IGF-I gene promoters (17-191, suggesting that more complicated mechanisms may underlie the estrogen regulation of IGF-I gene expression.

To understand the molecular basis of IGF-I regulation by estrogen, we performed a series of gene transfer studies and examined whether and how the IGF-I gene promoter is a target of estrogen regulation. The IGF-I-luciferase reporter plasmids containing segments of the promoter of the recently characterized chicken IGF-I gene (19) were transfected into HepG2 cells which transiently express exogenous ER. We report here that the IGF-I gene promoter is a target of estrogen regulation in chicken and that the AP-1 motif located in the 5”flanking DNA of the gene and the post-translational regulation of Fos-Jun binding to the motif play major roles in signal transduction.

EXPERIMENTAL PROCEDURES Materials-Restriction enzymes, DNA and RNA polymerases, and

other enzymes were purchased from commercial suppliers (Takara,

16433

16434 Estrogen Regulation of an IGF-I Gene Promoter Kyoto, Japan; Stratagene, San Diego; Promega Biotec, Madison, WI, New England Biolabs, Beverly, MA; Life Tec~ologies, Inc.). Radio- nucleotides (CY-~S-~ATP, [yaP1dATP, [LU-~PI~ATP) and [35Slmethionine were purchased from Amersham Japan (Tokyo), and ['*Clchlorampheni- col and 16~~-'~~1-3,17P-estradiol was from DuPont NEN (Boston, MA). Estradiol and diethylstilbestrol were obtained from Sigma. Tissue culture media were purchased from Nakarai Tesque (Kyoto, Japan), and fetal bovine serum was from ICN Biomedicals, Inc. (Costa Mesa, CA). Poly(d1-dC) was obtained from Pharmacia Biotech Inc. Oligonucleotides were synthesized with a DNARNA synthesizer (Applied Biosystems, model 394). Anti-c-Fos mouse monoclonal antibody (c-Fos(Ab-1); catalog OP17), anti-c-Fos rabbit affinity-purified polyclonal antibody (c-Fos(Ab- 2); catalog PC05), and anti-cJun rabbit affinity-purified polyclonal antibody (c-Jun/AP-l(Ab-2); catalog PC07) were purchased from Oncogene Science (Uniondale, NY), and anti-ER monoclonal antibody (catalog W 4 2 8 ) was from Chemicon Inte~ational, Inc. (Temecula, CA). The peptide antigens c-Fos(Peptide-1) and c~u~AP-l(Peptide-2), which are immunogens for c-FosiAb-1) and c ~ ~ A P - l { A ~ 2 ) , respectively, were purchased from Oncogene Science. Epstein-Barr virus nuclear antigen-1 (EBNA-1) DNA probe and EBNA-1 extract were purchased as components of the Bandshift Kit from Pharmacia.

Reporter Gene Constructs and Other Expression Plasmids-Reporter plasmids pIGFI Lud-600 and pIGFI Lud-2100 were described previously (19). The insertionless control pLucf0 (PO Luc) (20) was a gift from Dr. A. Brasier of Massachusetts General Hospital. Reporter gene constructs, pIGFI Luc/-600M/ERE and pIGFI Lud-6OOWAP-1, were prepared by polymerase chain reaction-mediated site-directed mutagenesis (21). Expressing plasmids HE0 (22) and HEll (23) were gifts from Dr. P. Chambon of CNRS, France.

Cell Culture and D ~ A - ~ e d ~ t e d Gene Transfer"HepG2 (Riken Cell Bank, Tsukuba, Japan, catalog RCB459) cells were maintained in Earle's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, nonessential amino acids, penicillin, and streptomycin (growth medium). For analyses on the reporter gene, hormone binding, Northern blot, Western blot, and gel mobility-shift, cells were replated at a density o f 5 x lo6 cells/100-mm plate and kept overnight in phenol red-free Earle's modified Eagle's medium supplemented with 10% charcoal-treated, heat-inactivated fetal bovine serum and nonessential amino acids (replating medium) to allow them to become attached to the plate. The next morning, the medium was changed to phenol red-free Earle's modified Eagle's medium supplemented with 6.25 pg/ml insulin, 6.25 pg/ml transferrin, 6.25 ng/ml selenous acid, 1.25 mg/ml bovine serum albumin, and 5.85 pg/mI lino- leic acid (serum-free medium); 4 h later, DNA-mediated gene transfer was performed as required for each experiment by calcium phosphate precipitation, followed 4 h later by a glycerol shock (24).

Reporter Gene Analysis-HepG2 cells were replated and transfected in serum-free medium as described above with 2 pg of pRSV CAT plasmid (25), 8 pg of an IGF-I-luciferase fusion plasmid, and 8 pg of an ER expression plasmid (HE0 or HEll) or pSG5. Transfected cells were incubated for 24 h; fresh medium was added, and, when required, 1O"j or M 17P-estradiol was added simultaneously. After another 24-h incubation, cell lysates were prepared, and luciferase assay (26) was performed using a PicaGene Kit (Toyo Ink Inc., Tokyo). Five percent of the lysates was used for luciferase assay following the manufacturer's directions. Light emission was measured by integration over 20 s of reaction, using Lumat LB9501 (Belthold, Postfach, Germany). CAT activity was measured as described (27), using 10% of the cell lysates.

Hormone Binding Assay-Cytosol extracts were prepared from two plates of HepG2 cells. Each plate was transfected 24 h earlier as described above, with 8 pg of HE0 or HE11. Eight micrograms of pIGFI Lud-2100 and 2 pg of pRSV CAT were cotransfected to achieve transfection efficiency similar to that in reporter gene analysis. The hormone binding assay was carried out essentially as described (28). Miquots (100 p1) of the cytosol extracts were incubated overnight a t 4 C with various concentrations of 1Z61-estradiol with or without 200-fold excess of diethylstilbestrol. To remove the unbound labeled estradiol, 500 pl of dextran-coated charcoal was added to each tube which was then incubated for 10 min under gentle shaking. After centrifugation, 500 pl was withdrawn from each supernatant and subjected to radioactivity count- ing.

Determination of Transcription Start Sites in the IGF-I-Luciferase Fusion Gene-Complementary DNAs derived from an IGF-I-luciferase fusion plasmid were prepared following the 5' RACE (29) procedure essentially as described in the literature (30). Twenty-four hours after replating, 8 pg of pIGFI Lucf-2100 and 8 pg of HE0 were transfected into HepG2 cells as described above. After a 24-h incubation, x 17P-estradiol was added, and 3 h later, total RNA was isolated. Using 2

pg of RNA, first strand cDNAs were reverse transcribed with avian myeloblastosis virus reverse transcriptase and a specific o~gonucl~t ide complementary to nucleotides +121 through +140 of the firefly luciferase gene (261. After "tailing" of the cDNAs at their 5' terminus with terminal deoxynucleotidyltransferase and dATP, a polymerase chain reaction was performed successively with oligo(dT) adapter, 5' adapter, and nested specific primers complementary to nucleotides +lo0 through +119 of luciferase gene and to nucleotides +68 through +86 of chicken IGF-I exon 1. The amplified products were extracted with phenol/ chloroform, purified and concentrated in Centricon C-30 (W. R. Grace & Co., Beverly, MA), and subcloned into plasmid Bluescript. DNA sequencing was performed using dideoxy chain termination inhibitors and CY-~~S-~ATP.

Preparation of Whale Celt Lysates-HepG2 cells were transfected as described above with 8 pg of HEO. Eight micrograms of pIGF1 Lucf -2100 and 2 pg of pRSV CAT were cotransfected to achieve transfection efficiency similar to that in reporter gene analyses. Twenty-four hours after transfection, lo4 x 17P-estradiol or M TPA was added, and incubation was done as required. Cycloheximide (10 pg/ml) was added to the plate 30 min before the addition of estradiol or "PA, when required. Whole cell lysates were prepared from the cells, following the procedure described by Kumar and Chambon (23).

Gel Mobility-shift Assay-Gel mobility-shift assays were performed essentially as described elsewhere (31). Five micrograms (protein) of each whole cell lysate was preincubated with 1 pg of poly(d1-dC) at 4 C in a 20-pl reaction mixture containing 50 m~ Ms-HC1 (pH 7.8, 5 m~ KC1,l m~ dithiothreitol, and 25% glycerol (v/v%). Fifteen minutes later, the binding reaction was initiated by adding 100 pg (6 x lo4 cpm) of 5' end 32P-labeled (32) wild type AP-1 probe (see Fig. 7) or of EBNA-1 DNA probe, as well as nonradioactive competitor DNA as indicated, followed by incubation carried out at room temperature for 30 min. In some of the binding assays, a specific antibody (0.5 pg of c-Fos(Ab-l), 0.5 pg of c~un/AP-1(~-2) , or 5 pl of anti-ER antibody) was added to the binding reactions 30 min before the addition of the wild type AP-1 probe or the EBNA-1 DNAprobe. For the competition assay, 0.2 pg of c-FosfAb-1) or c-Jun/AP-l(Ab-2) antibody was preincubated with or without 2 pg of the peptide competitor c-Fadpeptide-1) or c-Jun/AP-UPeptide-2) for 24 h in phosphate-buffered saline (PBS; 25 mM sodium phosphate buffer (pH 7.4) containing 150 m~ sodium chloride), as recommended by the sup- plier. Protein-bound probes were separated from free probes using non- denaturing polyacrylamide gel electrophoresis.

RNA Isolation and Analysis"HepG2 cells were transfected as described above with 8 pg of HEO. Eight micrograms of pIGFI Lud-2100 and 2 pg of pRSV CAT were again cotransfected as described above. Twenty-four hours after transfection, i,r 17P-estradiol or loe7 M TPA was added, and incubation was done as required. Total RNA was extracted from the cells by homogenization in guanidine thiocyanate (33k and poly(A)+ RNA was prepared using OligoTex dT30 (Nippon Roche, Tokyo). Northern blots followed standard procedures (34) using 6 pg each of poly(A)+ RNA, and the buffer conditions were as described (19). The hybridization probe was 7 x lo6 cpm of 32P-labeled (35) human c-fos genomic DNA probe (purchased from Takara) and v-jun cDNA probe (a gift from Dr. K. Nakajima, Osaka University). After hybridization, the filters were washed for 120 min at 42 C in buffer containing 15 mM sodium chloride, 1.5 mM sodium citrate (pH 7.01, and 0.1% SDS and were exposed to Kodak XAR-5 film using intensifying screens for 3 days a t -80" C .

Western Blot Analysis-An aliquot of the whole cell lysates containing 30 pg of protein was added to an equal volume of 2 x gel loading buffer containing 100 rn Ms-HC1 (pH 6.8),200 mM dithiothreitol, 4% SDS, 0.2% bromphenol blue, and 20% glycerol (36) and boiled for 3 min. Protein was separated on 7.5% SDS-polya~lamide gel electrophoresis and then transferred to nitrocellulose membranes. After the membranes were blocked with 5% nonfat milk in PBS containing 0.1% Tween 20 (PBS-T) for 1 h at room temperature and washed three times with PBS-T, they were incubated for 1 h with the antibody c-Fos(Ab-l), c-Fos(Ab-2), or c-Jun/AP-l(Ab-2), as indicated. The membranes were then washed in PBS-T and incubated for 1 h with anti-mouse or anti- rabbit immunoglobulin G conjugated to horseradish peroxidase, as required. After another washing in PBS-T, immunoreactive bands were visualized by incubation with luminol (ECL Western blotting system, Amersham) and exposure to Kodak XAR-5 film.

Determination of Protein Synthesis Rate-HepG2 cells, which had been plated in 24-well dishes, were cultured in growth medium. When the cells reached 95% confluence, the medium was replaced with fresh medium containing the appropriate amount of cycloheximide. After incubation at 37" C for 30 min, the cells were washed twice with serum- free medium lacking L-methionine and then incubated for 10 min at

Estrogen Regulation of an IGF-I Gene Promoter 16435

FIG. 1. Structures of plasmids used in the gene transfer studies. Panel A, the pIGFI Lud-2100 and pIGFI Lud-600 plasmids contain 2100 and 600 bp, respectively, of the 5‘-flanking DNA plus the first 86 bp of exon 1 cloned 5‘ to a luciferase reporter (19). The plasmid pLuc/O (20) contains no IGF-I sequences. Panel B, the HE0 plasmid (22) is an ER-expressing plasmid that contains human ER cDNA cloned in highly expressing vector pSG5. Panel C , the pRSV CAT plasmid (25), in which the CAT gene is driven by the Rous sarcoma virus long terminal repeat (RSV- LTR 1.

A)

pIGFl Lucl- 2100

pIGn Lucl-BOO

PLUCI 0 5 ‘

No I n r n 1 3 ’

-2000 -600 -500 -400 -300 -200 -100 0 100 300 400b

37” C in 70 pl of methionine-free medium containing the appropriate amount of cycloheximide and 60 pCi of ~-[~~Slmethionine. The cells were washed twice in cold PBS and then lysed in 100 pl of 0.5% SDS, and 50 mM Tris-HC1 (pH 6.8) followed by boiling for 5 min. Measurement of the [35Slmethionine-labeled proteins precipitated by trichloroacetic acid was performed as described elsewhere (37).

RESULTS

Estrogen-induced Promoter Activation of the Chicken IGF-I Gene-We recently showed that the chicken IGF-I gene promoter directs accurate transcription of IGF-I-luciferase fusion gene and enhances luciferase activity in the HepG2 cell (30). Using HepG2 cells as host cells, a series of reporter gene analyses was performed to examine whether the IGF-I gene promoter is a target of regulation by estrogen. Although no specific binding sites for estrogen were detected in the cell (data not shown), the exogenous ER was allowed to be expressed in the HepG2 cells to confer estrogen responsiveness. According to previous reports, transient exogenous expression of ER suc- cessfully conferred estrogen responsiveness to various cells including COS-1 cells (23), HeLa cells (38, 39) and chicken em- bryonic fibroblasts (381, which are originally insensitive to estrogen. The feasibility of HepG2 cells as host cells for gene transfer studies was investigated in terms of ER expression. The results of a hormone binding assay indicated that human ER expression plasmid HE0 (22)-transfected HepG2 cells have 2.2 fmol/mg protein of specific estradiol binding sites (Figs. 1B and 2), whereas no specific binding sites for estradiol were detected in the HepG2 cells transfected with the insertionless vector pSG5 (data not shown).

Cis-active elements necessary to generate basal promoter activities in HepG2 cells are located in two separate regions of the chicken IGF-I gene: between positions -2100 and -600 and between -490 and -360 (30). We therefore used the two reporter gene constructs pIGFI Lud-2100 and pIGFI Lud-600 (19) for the following reporter gene analysis (Fig. lA). The pRSV CAT plasmid (25) was cotransfected as an internal control, allowing normalization of the results of the luciferase assay with respect to transfection efficiency (Fig. 1C). The results of reporter gene studies are presented as relative light units with the promoter activity in HEO-transfected HepG2 cells of estradiol-unstimulated pIGFI Lud-2100 being arbitrarily set at 100% (Fig. 3). When M 17P-estradiol was added, promoter activities of 2100- and 600-bp DNA fragments increased 4.6-fold (100455%) and 8.6-fold (35-300%), respectively, in the HEO-transfected HepG2 cells. A smaller increase (2.6-fold, 100- 255%) in the promoter activity of the 2100-bp DNA fragment

(fmollmg) B

2.0 -

1.0 -

l , ,

50 100 (fmolltube) ‘*I- Estradiol added

FIG. 2. Estrogen binding assay using HEO-transfected HepG2 cells. Cytosolic extracts were prepared from HEO-transfected HepG2

ings with ‘251-estradiol are shown. The inset shows Scatchard plots of cells as described under “Experimental Procedures.” The specific bind-

these data.

was observed even in response to lo-’ M 17P-estradiol, indicating that a physiological concentration of estrogen readily causes this phenomenon. On the other hand, neither the 2100-bp nor the 600-bp fragment displayed a response to estrogen in terms of its promoter activity in pSG5-transfected HepG2 cells (Fig. 3).

To demonstrate that the promoter activity induced by estrogen is derived from the authentic IGF-I promoter, we mapped the transcription initiation sites of a fusion plasmid pIGFI Luc/ -2100 in the estrogen-treated, exogenous ER-expressing HepG2 cells using a modified 5’ RACE (29) and DNA-sequencing method (see “Experimental Procedures”). Three clones of the putative IGF-I-luciferase fusion cDNA were isolated, and their DNA sequencing revealed that they represent three types of IGF-I-luciferase fusion cDNAs. As shown in Fig. 4, the 5’ ends of all of the three clones were mapped just on or close to the natural transcription initiation sites in chicken muscle (19). Despite a minimal difference being observed between the transcription initiation sites used in chicken muscle and in estrogen-stimulated HepG2 cells, the results indicate that the estrogen-responsive increase in promoter activities arises from the authentic IGF-I promoter. Taken together, these observations demonstrate that the 600-bp 5”flanking DNA of chicken

16436

% 500 1

Estrogen Reguhtion of an IGF-I Gene Promoter % %

5007 r - p S G 5 ~ r- H E 0 1 500 1

.- 400 u) 400

r' .- m 300 2 300

3 .- - C 3

r PSG 5 1 r HE 0 -I

- W .- - 0) .- - z 200 ,$ 200

4-

d - 2 100 100

0 lo-* M 0 10-"10-~ 0 10-alO-b M 0 . 10" 0 lo-" M Estradiol conc. Estradiol conc. Estradiol conc.

PLUG/ 0 pIGFI LUG," 21 00 pIGFI LUG," 600 FIG. 3. Effect of 17f#-estradiol on promoter activities of IGF-I gene in ER-expressing HepG2 cells. The plasmids pLud0 (left), pIGFI

LUG'-2100 (center), and pIGFI LUG'-600 (right) were individually cotransfected with pSG5 or HE0 (Fig. 1) into HepGZ cells, and 24 h later, lo* M or lo-' M (pIGFI Lud-2100 only) l7p-estradiol was added. Luciferase and CAT assays were performed 24 h after the addition of estradiol. The results of luciferase assays were normalized with respect t o transfection efficiency using the results of CAT assays and are expressed as relative light units with that of estradiol- unstimulated pIGFI Lud-2100 in HEO-transfected HepG2 cells being arbitrarily set at 100%. All data are presented as means of at least four individual experiments.

- 136 A G C G T A A G ~ ~ C T G C T A A C C C C T C A G T C A C T A A l T C A ~ ~ ~ G ~ ~ T A T ~ ~ ~ G T ~ T ~ A G ~ ~ T G ~ G G T

- 36 A T G A T ~ A m G T C A C C A T ~ ~ G T ~ A ~ T ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ T ~ T ~ ~ G C T G ~ ~ ~ G

tion initiation sites of IGF-I-lucifer- 65 T C I A C A G T G T C T G T G T ~ T G T A ~ T ~ T ~ ~ ~ ~ C T C T ~ T ~ T ~ C T G ~ ~ ~ T ~ ~ C T G T ~ C T ~ T ~ T ~ G A ~ A G A T A G ase fusion plasmids in HepG2 cells. In the upper panel, the transcription initia- 165 A G C C I G C G C A A T G ~ T A A ~ T ~ ~ C A ~ G C T C T ~ ~ T ~ ~ C A T C T C T C T ~ ~ C ~ C T C A T ~ ~ A C T ~ T ~ C tion sites of the fusion plasmid are indicated by vertical arrows and the natural 265 ~ ~ ~ ~ C ~ G A C m G C A C T m A ) $ I A A G C A A I G G A A A A M T C A G T ~ ~ ~ ~ ~ ~ ~ ~ G T ~ T ~ G T G A ~ C ~ G A A G g t transcription initiation sites in chicken MatGluL~sllsAsnSerLsuStrThrGlnLeu~alLy~CysC~~PhaCvsAspPheL~uLys muscle (19) by arrowheads. Total RNA was extracted 3 h after the addition of

365 aaatctttatta~tatttcaaataattttttagttttattttactgtgtgttgtctgctt ..... 3'

M l7p-estradiol from HepG2 cells transfected with both pIGFI Lud-2100 and HEO. A modified 5' RACE (29) procedure was performed using primers shown in the lower panel; primer 1 was used for the first strand cDNA synthesis, and primers 2 and 3 were for successive polymerase chain reactions.

v ERE- like v V

FIG. 4. Identification of transcrip- t t t

A I G

5' -" 3' Gene

4 Fusion

IGF- I IGF - I Luciferase 5' -flanking Exon1

IGF-I gene contains enough cis-active elements to mediate estrogen-induced promoter activation, and that, like any other estrogen action, the phenomenon is mediated by ER.

Absence of Conventional ERE within the 600-Base Pair 5'- Flanking DNA of the Chicken IGF-I Gene-The existence of ERE in the regulatory region of an IGF-I gene has been as- sumed (11, 16). However, like any characterized portion of 5'- flanking sequences of mammalian IGF-I genes (17, 18), the 600-bp 5"flanking DNA of chicken IGF-I gene lacks a consensus ERE (19). Since even a nonconsensus ERE occasionally acts as a weak ERE (231, the 600-bp 5"flanking sequence was sur- veyed for a region carrying similarities to ERE. Consequently, only a region 70% homologous to the ERE consensus sequence was identified between nucleotide positions +5 and -1-17 (Fig. 5). To examine whether this ERE-like sequence functions as an authentic ERE in vivo and mediates estrogen regulation of the IGF-I gene promoter, another series of gene transfer studies was performed using a reporter plasmid whose ERE-like sequence was destroyed by site-directed mutagenesis to eliminate any similarity to the ERE consensus sequence (pIGFI LuU"6OOhWERE in Fig. 5). The results of reporter gene analyses revealed that the 600-bp promoter, even with mutations introduced into its ERE-like region, readily enhances luciferase

-41

4 3 4 2

1OOnt. -

activity in response to estradiol treatment (10-fold, 28-285%), which was similar to the findings for the wild type promoter (Fig. 5). This observation indicates that the ERE-like sequence does not function as an authentic ERE. Thus, no conventional ERE exists within the 600-bp 5"flanking DNAof chicken IGF-I gene despite the estrogen responsiveness of its promoter activity.

An Essential Role for@-1 Motif in Signaling Estrogen Regu- lation of the Chicken IGF-I Gene-We showed recently that the AP-1-like sequence located between positions -427 and -420 in the 5"flanking sequence of the chicken IGF-I gene functions as an authentic AP-1 site (301, which is known as a binding site for the cellular proto-oncogene products Fos and Jun (40). Al- though the AP-1 enhancer has been widely accepted as part of the protein kinase C pathways, it may also be involved in mediating estrogen efTects; the transcription factor AP-1 and ER occasionally coactivate a gene promoter through an AP-1 motif (38, 41). Accordingly, we investigated whether the AP-1 enhancer plays a role in the estrogen-responsive IGF-I gene activation. Another reporter gene analysis was performed using a reporter plasmid whose AP-1 motif was destroyed. As we found previously using the 2100-bp promoter fragment and the same cells (30), destruction of the AP-1 motif caused major


Exon 1 -. . . . . . 5’- flanking t 9 t z 1

5

EGTAACTTTGCCA I l l I I I I GG T C A n n n TGA CC ERE C O O I ~ S Y I

v) Y ”1 lpIGFl Luc/- 600M/ERE1

0 M

Estradiol conc.

FIG. 5. Effect of mutations introduced into the ERE-like se-

panel depicts an ERE-like region, and its nucleotide sequence is aligned quence on estrogen regulation of IGF-I gene promoter. The upper

with the ERE consensus sequence (14). Untranslated and translated regions of IGF-I exon 1 are shown by a shaded and a solid box, respectively, and the 5’-flanking region by the line. The lowerpanel illustrates the results of reporter gene analysis using pIGFI Lud-6OOMiERE. The mutations introduced into the ERE-like sequence between positions +9 and +21 were as follows: wild type, 5”GGTAACmGCCA (pIGFI Lud -600); mutated type, 5”GGAATCTTACCCA (pIGFI Lud-6OOMiERE). The plasmid pIGFI Lud-6OOMiERE was cotransfected into HepG2 cells with HE0 and pRSV CAT, and luciferase and CAT assays were performed 24 h after the addition of M 17P-estradiol. The results are expressed as relative light units with that of estradiol-unstimulated pIGFI Lud-2100 in HEO-transfected HepG2 cells being arbitrarily set at 100%. All data are presented as means of three individual experiments.

reduction of the basal promoter activity of the 600-bp fragment (Fig. 6). Apart from this observation, the destruction also caused complete loss of estrogen responsiveness of the IGF-I promoter (0.81-fold induction, Fig. 61, supporting an essential role for the AP-1 motif in mediating estrogen effects on the IGF-I gene transcription.

To examine the direct involvement of the AP-1 motif in the estrogen-induced IGF-I gene activation, a gel mobility-shift analysis was performed. The binding probe used in the experiment was a 32P end-labeled double-stranded oligonucleotide reproducing the AP-1 motif, and its flanking sequences were located between positions -433 and -413 (Fig. 7). The results show that bands corresponding to specific protein bindings to the AP-1 probe increased their intensity as early as 0.5 h after estradiol was added, with the increase continuing at least until 6 h (Fig. 7). Unlabeled wild type probe (lanes 5 ,6 ,9 ,10,13, and 141, but not unlabeled mutated type probe (lanes 7,11, and 15), which has point mutations in the AP-1 motif, competed for protein binding to the AP-1 motif. These observations indicate that estrogen enhances specific protein binding to the AP-1 motif and support the idea that the AP-1 enhancer of the chicken IGF-I gene is part of the signaling apparatus of estrogen action. Because no conventional ERE could be identified in the promoter sequence which displays estrogen responsiveness (Fig. 51, it is likely that the AP-1 enhancer plays a primary role in mediating estrogen-responsive IGF-I gene expression in chicken.

5’- flanking region Exon 1

-421 -420 3

ATG

I I I I I I I I Tg A G T CA G AP- 1 consensus

PI GFI Luc/- 6OOM/AP - 11

Estradiol conc.

FIG. 6. Effect of mutations introduced in the AP-1 motif on estrogen regulation of IGF-I gene promoter. The upper panel depicts the location of an AP-1 motif, and its nucleotide sequence is aligned with the AP-1 consensus (42). Untranslated and translated regions of IGF-I exon 1 are shown by a shaded and a solid box, respectively, and the 5’-flanking region by the line. The lower panel illustrates the results of reporter gene analysis using pIGFI Lud-6OOlWAP-1. The mutations introduced into the AP-1 sequence between positions -427 and -419 were as follows: wild type, 5”TTAGTCAG (pIGFI Lud-2100); mutated-type, 5’”lTCGGCCG (pIGFI Lud-21OOWAP-1). The experimental designs for transfection, luciferase and CAT assays are as described in Fig. 5. All data are presented as means of three individual experiments.

A Major Role of Post-translational Modulation of Fos-Jun Activity in the Signaling Pathway-Estrogen enhances e-fos and c-jun gene expression in rat uterus (42, 431, and the c-fos gene even has an ERE in its regulatory region (39). To examine whether the increased specific binding to the AP-1 motif is due to the transcriptional or translational regulation of AP-1 binding proteins by estrogen, we measured c-fos, c-jun transcripts and their products (proteins) in exogenous ER-expressing HepG2 cells with or without estradiol stimulation. The results of Northern blot analysis and Western blot analysis revealed that estradiol treatment induces neither gene expression (Fig. &i, lanes 2 4 ) nor protein synthesis (Fig. 8B, lanes 1 3 , 5 - 7 ) of those AP-1 binding factors, whereas M TPA, which was used as a control, increased the amounts oftranscripts (Fig. a, lane 5 ) but not of proteins (Fig. BB, lanes 4 and 8). Together with the observation, described below in Fig. 11, that the gel- shift complex induced by estrogen includes c-Fos and c-Jun proteins as its component, these results support the idea that post-translational modulation of Fos-Jun activity plays a major role in mediating the estrogen-responsive IGF-I gene activation.

A discrepancy was observed between the amounts of the mRNA and the proteins of the AP-1 binding factors in responses to TPA (Fig. 8, A and B) . We performed a time course study (0, 45, 120, and 240 min) of c-Fos protein accumulation following the addition of TPA and found no change in the protein amount (data not shown). Even with a different anti-c-Fos antibody (c-Fos(Ab-2)), the same result was obtained (data not shown). A similar observation was reported previously for the amounts of c-fos mRNA and of protein in mouse thymoma cell line EL4 (44).

16438 Estrogen Regulation of an IGF-I Gene Promoter

E? (-1 E, (+) , I

30rnin. 2hr. 6hr. b I 1 .: Wild X l O X 5 0 X l O X 5 0 X l O X 5 0 X 10 X 5 0

FIG. 7. Estrogen-responsive in- ' [ (-1 (-1 (-1 (-1 crease in specific protein bindings Mutated X 50 X 50 X 50 to the AP-1 motif. A gel mobility-shift assay was performed using whole cell extracts isolated from ER-expressing HepG2 cells that were untreated (lanes 1 3 ) or pretreated with IO-' M 17P-estradiol (E,) for 30 min (lanes 4-7), 2 h (lanes 8-11), or 6 h (lanes 12-15). Nucleotide sequences of the sense strands of the double-stranded oligonucleotide probes were as follows: wild type AP-1 probe, 5'- AGGTTTTAATTGTTAGTCAGCATGTA;

AWGTTCGGCCGCATGTA. A "P-labeled mutated type AP-1 probe, 5'-AGGT"A-

probe was incubated with the extracts, and, where specified, a competing unlabeled probe was also added to the binding reactions.

Lanes 1 2

Failure of Expression of DNA Binding Domain-deficient E R to Cause Estrogen Responsiveness in the IGF-I Gene Promoter-To characterize further the mechanism underlying the estrogen regulation of IGF-I, we sought to determine whether the DNA binding domain of ER is required for signaling of the phenomenon. For this purpose, a mutant, DNA binding domain-deficient ER was allowed to be expressed in the HepG2 cells by cotransfection of the expression plasmid HE11 (23). The estrogen binding assay detected 2.8 fmoVmg protein of specific estrogen binding in HEll-transfected HepG2 cells (Fig. 9B), which is comparable to the result obtained with HEO- transfected HepG2 cells (Fig. 2). The results of reporter gene analyses revealed that estradiol stimulation of HepG2 cells expressing exogenous, DNA binding domain-deficient ER re- sulted in only a slight increase (100-120%) of the promoter activity of 2100-bp 5"flanking DNA. The data suggest that the DNA binding domain of ER is of great importance for signal transduction.

No de Novo Protein Synthesis Is Necessary for Estrogen- induced IGF-I Gene Expression-The necessity of the DNA binding domain naturally suggests that the estrogen-ER complex binds to an ERE located in a regulatory region of a gene encoding an unknown mediator of estrogen action and that the mediator would be involved in post-translational modulation of the Fos-Jun activity. To test this hypothetical pathway, which would require synthesis of the mediator protein, we examined whether de novo protein synthesis is required in signal transduction. Another series of gel-mobility shift assays was performed using the protein synthesis inhibitor cycloheximide. Measurement of the protein synthesis rate, performed prior to the gel-shift assay, showed that the concentration of cycloheximide used in the experiment was high enough to block most of the protein synthesis in HepG2 cells (Fig. 1OB). The results of the gel-mobility shift assay revealed that the protein-DNAcom- plex induced by estrogen is not eliminated by the addition of cycloheximide (Fig. 1OA). This observation indicates that de novo protein synthesis is not necessary for signal transduction and thus denies the involvement of an unknown mediator with its gene transcription being regulated in an estrogen-responsive manner. Although the DNA binding domain of ER is essential for signal transduction (Fig. 91, the binding of the estrogen-ER complex to an ERE does not seem to be necessary.

3 4 5 6 7 8 9 10 1 1 12 13 14 15

Inhibition of Gel-shift Complex Formation by an Anti-ER Antibody-To identify the proteins constituting the gel-shift complex induced by estrogen and to clarify further how the estrogen-ER complex is involved in signal transduction, we determined the effects of the presence of specific antibodies against c-Fos, c-Jun, and ER on the formation of the estrogen- induced gel-shift complex. Those specific antibodies were individually added to the binding mixtures containing the cell extract prior to the addition of oligonucleotide probes. As shown in Fig. 1L4, both gel-shift complexes induced by estradiol and by TPA showed identical mobility in the gel (lanes 2 and 7), and both were eliminated by c-Fos(Ab-1) and c-JudAP-l(Ab-2) added to the binding reactions before the gel-shift complex formation (lanes 3 , 4 , 8, and 9).

To eliminate the possibility that the blocking effects of these antibodies on the formation of gel-shift complexes are due to nonspecific inhibition, a competition assay was performed using the antibodies' immunogen peptides, c-FodPeptide-1) for c-Fos(Ab-1) and c-Jun/AF"l(Peptide-2) for c-Jun/AP-l(Ab-2), as peptide competitors. As shown in Fig. 11B, the blocking effect of c-Fos(Ab-1) was attenuated when the antibody was preincubated with its immunogen peptide c-FodPeptide-1) (lanes 2 and 3) . In contrast, preincubation with c-JudAP-UPeptide-2) did not neutralize the blocking effect of c-Fos(Ab-1) (lane 4 ) . Similar results were obtained for c-JudAP-1(Ab-2) (lanes 5-7). Furthermore, the antibodies did not prevent the binding of bacterially synthesized EBNA-1 presuspended in the HepG2 cell extract to the EBNA-1 binding site (data not shown). These control experiments thus proved that the blocking effects of the antibodies are specific. Therefore, the data shown in Fig. 1L4 indicate that the DNA-binding proteins constituting the two gel-shift complexes induced by estrogen and by TPA are probably identical, contain c-Fos and c-Jun, and lack the estrogen-ER complex.

In spite of this observation, the gel-shift complex induced by estrogen, but not that induced by TPA, was eliminated when a specific antibody against ER had been added to the binding reaction (Fig. llA, lanes 5 and IO). This indicates that the modification of the Fos-Jun complex caused by the estrogen stimulation is reversible in the binding mixtures and that an intact estrogen-ER complex must be present in the binding


2 c C G " 2 F

Incubation Time (hr) 0.5 1.0 6.0 0.5 -

1 2 3 4 5

c- fos

c- jun

18s

time (hr)

69 - (kDa)

46 -

Lanes 1

0.5 2.0 2.0 0.5 2.0 2.0 ._ . .

, - C-FOS

c- Jun C

2 3 4 5 6 7 FIG. 8. Effect of estradiol on c-fos and c-jun transcripts and

products in ER-expressing HepG2 cells. Panel A, autoradiographs of Northern blot analyses using 6 pg of poly(A)+ RNA. The probes were 32P-labeled c-fos genomic DNA (upper panel) and v-jun cDNA (middle). Total RNAs were isolated from HEO-transfected HepG2 cells that were untreated (lane I ) or pretreated with M 17P-estradiol (E2, lanes 2 4 ) or M TPA (lane 5). The incubation time after the addition of 17P-estradiol or TPA is indicated above the autoradiograph. The lower panel shows 18 S rRNA. Panel B, results of Western blot analysis using the anti-c-Fos and the anti-cJun antibody. Whole cell extracts were prepared from HEO-transfected HepG2 cells that were untreated (lanes 1 and 5) or pretreated with M 17P-estradiol (lanes 2,3,6, 7) or lo-' M TPA (lanes 4 and 8). Aliquots of whole cell extracts (30 pg) were separated by SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and allowed to react with c-Fos(Ab-1) (lanes 1 4 ) or c-JudAP-l(Ab-2) (lanes 5-8).

reactions when the Fos-Jun and the AP-1 motif form the complex in an estrogen-dependent manner.

DISCUSSION Several lines of evidence have suggested that AP-1 binding

proteins such as Fos and Jun are involved in various interactions with other transcription factors including various nuclear receptors (38, 41, 45-53), myogenic helix-loop-helix proteins (54,551, and the DNA-binding component of the nuclear factor of activated T cell (56) and thus contribute to a wide range of tissue- or cell-specific gene regulations. Glucocorticoid receptor (45-48), retinoic acid receptor (49-521, vitamin D, receptor (52, 531, and ER (38,411 are among those nuclear receptors that can modify the effect of the Fos-Jun complex. Most of the modifi- cations by the first three receptors result in negative effects on the AP-1 enhancer activity, possibly because of interaction with overlapping binding sites (45, 52,53) or inhibition of the activity through direct protein-protein interaction (46-48, 51). On the other hand, positive effects result from ER activity on the AP-1 enhancer; Tzukerman et al. (41) have shown that estra-

vl c .- c 400

c JZ .- - (JI 300

al .- 2 200

B -

100

0 10 0 M

Estradiol conc.

B) B

(fmol/rng) 3.0 1

2.0 -

1.0 -

i.0 2.0 3.0 8 (fmollmg)

. I I I I I I I I I I

50 100 (frnol/ tube)

'*'I- Estradiol added

FIG. 9. Effect of deletion of the DNA binding domain of ER on estrogen regulation of IGF-I gene promoter. Panel A, promoter activities of 2100-bp 5"flanking DNAin untreated and estradiol-treated HEll-transfected HepG2 cells. The plasmids pIGFI Lud-2100, HE11 and pRSV CAT were cotransfected into HepG2 cells, and 24 h later, 10" M l7P-estradiol was added if required. Luciferase and CAT assays were performed 24 h after the addition of estradiol. The results are presented as relative light units with the promoter activity of the 2100-bp DNA fragment in untreated, HEO-transfected HepG2 cells being arbitrarily set a t 100%. The results obtained with the 2100-bp promoter in HEO- transfected HepG2 cells (Fig. 3) are shown on the left to facilitate comparison. All data are presented as means of four individual experiments. Panel B, specific bindings with '251-estradiol detected in HE11- transfected HepG2 cells. Cytosolic extracts prepared from HepG2 cells transfected 24 h earlier with HE11 were used for the assay. The inset shows Scatchard plots of these data.

diol enhances TPA-induced promoter activity of rat type a1 collagen gene in HeLatk- cells expressing small numbers of exogenous ER. A more extensive study by Gaub et al. (38) has shown that the promoter of chicken ovalbumin gene containing an AP-1-like sequence can be coactivated by c-Fos, d u n , and estrogen-ER complex. This study also showed that expression of mutant ER, which lacks a DNA binding domain, functions equally in mediating the estrogen action and thus led to the suggestion that specific DNA recognition by ER is not required for the coactivation (38).

In our study, we showed that the 600-bp 5"flanking DNA of chicken IGF-I gene is enough to enhance the luciferase activity in response to estrogen (Fig. 31, despite the fact that no conventional ERE was detected in this region (Fig. 5). The results of the reporter gene analyses (Fig. 6) revealed that the estrogen-ER complex activates transcription of the chicken IGF-I gene through the AP-1 motif, whereas an estrogen-responsive


A -2 - 8 E2 (+) u- - TPA (+ )

+ + (-1 + +

Lanes 1 2 3 4 5 6 7 8 9 1 0 1 1

B E?( + 1 Peotide rc-Fos DeDtide Aa + + ‘S Competitorstc-Jun peptide A i (-1 +

anti-c-Fos Ab + + + Antibodies [ n

anti-c-Jun Ab + + + g +:

Lanes 1 2 3 4

10 clg/ml Cycloheximide conc.

FIG. 10. Effect of inhibition of protein synthesis on estrogen- induced specific protein binding to the AP-1 motif. Panel A , gel mobility-shift assay using labeled wild type AP-1 probe and whole cell extracts isolated from ER-expressing HepG2 cells that were untreated (lane 1 ) or pretreated with M 17s-estradiol (E,) for 30 min (lanes 2 4 ) . For lane 3, 10 pg/ml cycloheximide was added to the medium 30 min prior to the addition of 17s-estradiol. For lane 4, cold competitors (200-fold excess) were added to the binding reaction. Panel B, line graph of the rate of protein synthesis inhibition by cycloheximide. The results are expressed as relative protein synthesis rate with that of untreated HepG2 cells being arbitrarily set at 100%. The measurement was performed as described under “Experimental Procedures.”

increase in specific protein binding to the motif but not an increase in the amount of c-Fos or c-Jun proteins was detected. These observations suggest that post-translational modulation of the Fos-Jun activity plays a major role in signaling estrogen regulation of the chicken IGF-I gene. Thus, our findings for the chicken IGF-I gene promoter are similar to those for the chicken ovalbumin gene (38) described above, suggesting that post-translational modulation ofAP-1 activity by estrogen may be a widely utilized signaling pathway for regulation of genes that lack a conventional ERE.

However, our present results indicate otherwise, because the

Lanes 1 2 3 4 5 6 7 8

FIG. 11. Effect of the presence of specific antibodies against C-FOS, c-Jun, and ER on estrogen-induced gel-shift complexes. Panel A, a gel-shift assay was performed using whole cell extracts isolated from ER-expressing HepG2 cells that were untreated (lane 1 ) or pretreated with M 17s-estradiol (E,) for 2 h (lunes 2-6) or M TPA for 2 h (lanes 7-11 ). A specific antibody against c-Fos (c-Fos(Ab-1)) (0.5 pg) (lanes 3 and 8), cdun (c-JudAP-UAb-2)) (0.5 gg) (lanes 4 and 91, or ER (5 pl) (lanes 5 and 10) was added, when required, to the binding mixtures 30 min prior to the addition of the labeled wild type AP-1 probe (see Fig. 7). In lanes 6 and 11, cold probe (200-fold excess) was added as a competitor. Panel B, a competition (gel-shift) assay was performed using anti-c-Fos and anti-c-Jun antibodies and their corresponding antigens. Whole cell extracts were isolated from ER-expressing HepG2 cells that were pretreated with lo-‘ M 17s-estradiol for 2 h. The two antibodies c-Fos(Ab-1) and c-JudAP-UAb-2) (0.2 gg each) were independently preincubated without a peptide competitor (lanes 2 and 5) or with 2 gg of c-Fos(Peptide-1) (lanes 3 and 6 ) or of c-JudAP- l(Peptide-2) (lanes 4 and 7 ) in PBS (pH 7.4) for 24 h a t 4 C. These preincubated antibodies (lanes 2-7) or the equal volume of PBS (lane 1 ) was added to the binding mixtures 30 min prior to the addition of the labeled wild type AP-1 probe. In lane 8, only the labeled probe was loaded.

mutant ER, which lacks a DNA binding domain, does not mediate the estrogen effects on the IGF-I gene promoter as efficiently as a wild type ER does (Fig. 9). It should be noted that this phenomenon cannot be ascribed to the inability of the mutant ER to be transferred to the nucleus. Even after the DNA binding domain was deleted, the mutant ER, which is derived from the HE11 expression plasmid, retains nuclear localization signals (57), and a study utilizing antibodies against a portion of ER has demonstrated that the mutant ER can be transferred into the nucleus as efficiently as the wild type ER (57). In terms of function, the mutant ER was shown to activate the ovalbumin gene in chicken embryo fibroblasts (38), which offers support for its efficient nuclear translocation.

Despite the need for the DNA binding domain of ER in this signal transduction, the results of the gel-mobility shift assay using cycloheximide revealed that de nouo protein synthesis is not necessary in the estrogen-induced binding of the Fos-Jun complex to t h e m - 1 motif (Fig. lo), indicating that activation of a gene encoding an unknown mediator, in which the direct


binding of ER to an ERE would be required, is not involved in signal transduction. This observation is consistent with the previous reports which demonstrated that the signaling pathways for estrogen-dependent IGF-I gene activation do not require d e nouo protein synthesis (11, 15). These observations raise questions about the role of the DNA binding domain of ER in signal transduction, which is not to facilitate the binding to the target DNA (ERE). Several previous studies, although performed with nuclear receptors other than ER, offer useful in- formation; Schule et al. have shown that post-transcriptional negative modulation of the Fos-Jun activity by glucocorticoid receptor (46) or retinoic acid receptor (51) requires an intact DNA binding domain in spite of their observation that glucocorticoid receptor and retinoic acid receptor do not need to bind to their target DNA in these pathways. An in vitro study by Kerppola et al. (58) has shown that the zinc finger motif of glucocorticoid receptor is sufficient for inhibiting the binding of Fos-Jun to the AP-1 motif despite the fact that the zinc finger motif itself does not bind to DNA. Although most of these interactions between AP-1-binding proteins and the nuclear receptors are inhibitory, Diamond et al. (45) showed that Jun homodimer and glucocorticoid receptor synergistically activate the proliferin gene promoter in a way that requires the DNA binding domain of glucocorticoid receptor. These observations support an essential role of the DNA binding domain of those nuclear receptors in facilitating the interactions between the receptors and AP-1-binding proteins. Considering the struc- tural similarities in the DNA binding domains o f these steroid receptors including the zinc finger motif (121, it may be reason- able that the DNA binding domain of ER also preserves some function in facilitating some protein-protein interaction.

Although the existence of the intact estrogen-ER complex is necessary to facilitate the estrogen-induced Fos-Jun binding to the AI?-1 motif (Fig. 111, the estrogen-ER complex seems to be not included in the estrogen-induced gel-shift complex (Fig. ll), thus leaving it obscure as to how the estrogen-ER complex interacts with the Fos-Jun complex. As for the interaction between glucocorticoid receptor and Fos/Jun, the results of cross- linking and immunoprecipitation experiments were not consistent; some studies showed that glucocorticoid receptor can be immunoprecipitated with Fos or Jun in support of the direct association between those two proteins (45, 47, 48), whereas others did not detect complexes between glucocorticoid receptor and Fos-Jun (46, 52). These observations suggest that the interaction between glucocorticoid receptor and Fos-Jun may be direct but rather weak, or perhaps indirect (58). Similarly, our current results from the gel-shift assay, in which the estrogen- induced gel-shift complex probably lacks ER, may suggest ei- ther a weak, direct interaction or an indirect interaction between ER and the Fos-Jun complex.

It is not known how the DNA binding domain-deficient ER can be functional in activating a certain gene (chicken ovalbumin gene (38)) but not another (chicken IGF-I gene). This may be due to differences in conditions for efiticient modulation of the Fos-Jun activity by the estrogen-ER complex depending on various factors o f the target gene. Flanking sequences of an A€"1 motif as well as the AF"1 core itself may be included among the factors that can influence the efficiency in modulat- ing Fos-Jun activity. Support for these ideas comes from the facts that all of the genes which have AP-1 motifs in their regulatory regions are not necessarily estrogen-responsive and that nucleotide sequences flanking the AP-1 palindrome core are important to the coactivation pathway (38). In connection with the latter fact, we should note that the flanking nucleotide sequences of the AP-1 motif of the IGF-I gene are entirely different from those of the ovalbumin gene (data not shown).

Structures of promoter elements o f IGF-I genes have been

highly conserved during vertebrate evolution, and yet no AP-1 consensus has ever been identified in the characterized portion of the regulatory sequences of mammalian IGF-I genes (17,181. Nagaoka et al. (59) have shown, however, that treatment with TPA increases the ans script ion rate of the IGF-I gene in a human macrophage-like cell line and that the effects are mediated, at least in part, by the activation of protein kinase C. These observations indicate that the human IGF-I gene also has a certain machinery that mediates the protein kinase C pathway and accordingly suggest that an AP-1 motif may be located somewhere in the uncharacterized portion of the gene, such as introns in which multiple DNase-I-hypersensitive sites were recently identified (60).

In summary, the findings described above demonstrate that an IGF-I gene promoter is a target of estrogen regulation, supporting the physiological importance of this growth factor as a direct mediator of estrogen action. Despite the lack of a conventional ERE in the IGF-I regulatory region, an estrogen signal can be transmitted through a pathway involving the AP-1 enhancer, suggesting that it may be a common alternative pathway of estrogen action in genes that lack a conventional ERE.

Acknowledgments-We thank Dr. Pierre Chambon of CNRS of France for kindly providing the human estrogen receptor expressing plasmids, Dr. Alan Brasier of Massachusetts General Hospital for the luciferase plasmids, Dr. Tatsuya Tanaka of Central Laboratory for Re- search and Education of Osaka University School of Medicine for pre- paring for oligonucleotides, Dm. Enyu Imai and Mitsuyoshi Yamazoe of the Osaka University School of Medicine for criticisms of the manu- script, and Miho Oda for excellent technical assistance.

~EFERENCES 1. Froesch, E. R., Schmid, C., Schwander, J., and Zapf, J. (1985) Annu. Reu.

2. Daughaday, W. H., and Rotwein, P. (1989) Endoet: Rev. 10,68-90 3. Rotwein, P. (1991) Growth Factors 6,3-I8 4. Wolf, M., Ingbar, S. H., and M0ses.A. C. (1989) Endocrinology 126,2905-2914 5. Tollet, P., Enberg, B., and Mode, A. (1990) Mol. Endocrinol. 4, 1934-1942 6. Rogers, S. A,, Miller, S. B., and Hammerman, M. R. (1991) J. Clin. Znuest. 87,

7. McCarthy, T. L., Centrella, M., and Canalis, E. (1989) Endocrinology 124,

8. Ernst, M., Heath, J. K., and Rodan, G. A. (1989) Endocrinology 126,825333 9. Murphy, L. J., Murphy, L. C., and Friesen, H. G. (1987) Mol. Endocrinol. 1,

Physiol. 47,443-467

347451

1247-1253

445450 10. Murphy, L. J., and Friesen, H. G. 11988) Endocrinology 122,325332 11. Murphy, L. J., and Luo, J. (1989) Mol. Cell. Endocrinol. 64, 81-86

13. Green, S., and Chambon, P. (1988) Trends Genet. 4,309-314 12. Evans, R. M. (1988) Scknce 240,889-895

14. Beato, M. (1989) Cell 56,335-344 15. Ernst, M., and Rodan, G. A. (1991) Mol. Endocrinol. 5,1081-1089 16. Murphy, L. J., and Ghahary, A. (1990) Endocr. Rev. 11,443-453 17. Kim, S.-W., Lajara, R., and Rotwein, P. (1991) Mol. EndocrinoL 5, 1964-1972 18. Hail, L. J., Kajimoto, Y., Bichell. D., Kim, S.-W., James, l? L., Counts, D.,

Nixon, L. J., Tobin, G., and Rotwein, P. (1992) DNA Cell Biol. 11, 301-313

20. Brasier, A. R., Tate, J. E., and Habener, J. F. (1989) Biotechniques 7,1116-1122 19. Kajimoto, Y., and Rotwein, P. (1991) J. Biol. Chern. 266,9724-9731

21. Higuchi, R. (199O)PCR Protocols: A Guide to Methods and Applications (Innis,

Academic hess , San Diego M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds) pp. 177-183,

22. Green, S., Walter, P., Kumar, V., Krust,A., Bornet, J.-M., Argos, P., and Cham-

23. Kumar, V., and Chambon, P. (1988) Cell 55, 145-156 24. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, 2nd Ed., pp. 16.32-16.35, Cold Spring Harbor Labora-

25. Gonnan, C. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. tory, Cold Spring Harbor, NY

26. de Wet, J. R., Wood, K. V., De Luca, M., Helinski, D. R., and Subramani, S. H. (1982) Pmc. Natl. Acad Sei. U. S. A. 79,6777-6781

27. Seed, B., and Sheen. J.-Y (1988) Gene (Amst. f 67,271-277 (1987) Mol. CeZZ. Biol, 7, 725-737

28. Grill, H.-J., Manz, B., Belovsky, O., Krawielitzki, B., and Pollow, K. (1983) J. Clin.. Chem. Clin. Biochem. 21, 175-179

29. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Nutl. Acad. Sci. U. S. A. 85, 8998-9002

30. Kajimoto, Y., Kawamori, R., Umayahara, Y., Iwama, N., Imano, E., Morishima, T., Yamasaki, Y., and Kamada, T. (1993) Biochem. Biophys. Res. Cornmun. 190, 767-773

bon, P. (1986) Nature 320, 134-139

31. Strauss, F., and Varshavsky, A. (1984) Cell 37, 889-901 32. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A


33. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) tory, Cold Spring Harbor, NY


34. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201-5205 35. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A


36. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A tory, Cold Spring Harbor, NY


37. Gay, D. A,, Sisoda, S. S., and Cleveland, D. W. (1989) Proc. Natl. Acad. Sci. tory, Cold Spring Harbor, NY

38. Gaub, M. P., Bellard, M., Scheuer, I., Chambon, P., and Sassone-Corsi, P. (1990) U. S. A. 86, 5763-5767

39. Weisz, A., and Rosales, R. (1990) Nucleic Acids Res. 18, 5097-5106 Cell 63,1267-1276

40. Cbiu, R., Boyle, W. J., Meek, J., Smeal, T., Hunter, T., and Karin, M. (1988) Cell

41. Tzukerman, M., Zhang, X.-K., and Pfahl, M. (1991) Mol. Endocrinol. 5, 1983-

43. Weisz, A., Cicatiello, L., Persico, E., Scalona, M., and Bresciani, F. (1990) Mol. 42. Weisz, A., and Bresciani, F. (1988) Mol. Endocrinol. 2, 816-824

44. Jensen, D. E., Frankis, R. C., Jr., and Sando, J. J . (1991) Oncogene 6, 1219-

45. Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990)

46. Schule, R., Rangarajan, P., Kliewer, S., Ransone, L. J., Bolado, J., Yang, N.,

47. Yang-Yen, H.-F., Chambard, J.-C., Sun, Y.-L. Smeal, T., Schmidt, T. J., Drouin,

Biochemistry 18, 5294-5299

54,541-552

1992

Endocrinol. 4,1041-1050

1225

Science 249, 126CL1272

Verma, I. M., and Evans, R. M. (1990) Cell 62,1217-1226

J., and Karin, M. (1990) Cell 62, 1205-1215

48. Jonat, C., Rahmsdorf, H. J., Park, K-K., Cato, A. C. B., Gebel, S., Ponta, H., and Herrlich, P. (1990) Cell 62, 1189-1204

49. Yang-Yen, H.-F., Zhang, X.-K., Graupner, G., Tzukerman, M., Sakamoto, B., Karin, M., and Pfahl, M. (1991) New Biol. 3,12061220

50. Nicholson, R. C., Mader, S., Nagpal, S., Leid, M., Rochette-Egly, C., and Cham- bon, P. (1990) EMBO J. 9,4443-4454

51. Schule, R., Rangarajan, P., Yang, N., Kliewer, S., Ransone, L. J., Bolado, J., Verma, I. M., and Evans, R. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 60926096

52. Schule, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans,

53. Owen, T. A,, Bortell, R., Yocum, S. A., Smock, S. L., Zhang, M., Abate, C., R. M. (1990) Cell 61,497404

Shalhoub, V., Aronin, N., Wright, K. L., van Wijnen, A. J., Stein, J. L., Curran, T., Lian, J. B., and Stein, G. S. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,9990-9994

54. Li, L., Chambard, J.-C., Karin, M., and Olson, E. N. (1992) Genes & Deu. 6, 676-689

55. Bengal, E., Ransone, L., Scharfmann, R., Dwarki, V. J., Tapscott, S. J., Wein-

56. Jain, J., McCafFrey, P. G., Miner, Z., Kerppola, T. K., Lambert, J. N., Verdine, traub, H., and Verma, I. M. (1992) Cell 68,507-519

57. Ylikomi, T., Bocquel, M. T., Berry, M., Gronemeyer, H., and Chambon, P. (1992) G. L., Curran, T., and Rao, A. (1993) Nature 366,352-355

58. Kerppola, T. K., Luk, D., and Curran, T. (1993) Mol. Cell. Biol. 13, 3782-3791 EMBO J. 10,3681-3694

59. Nagaoka, I., Trapnell, B. C., and Crystal, R. G. (1990) J. Clin. Inuest. 85,

60. Kikuchi, K, Bichell, D. P., and Rotwein, P. (1992) J. Biol. Chem. 267,21505- 448455

21511

Vol. of June 10, No. THE OF U.S.A. in Estrogen Regulation ... · PDF fileEstrogen Regulation...

Documents

Transcript of Vol. of June 10, No. THE OF U.S.A. in Estrogen Regulation ... · PDF fileEstrogen Regulation...