VIRUS-HOST INTERACTIONS IN THE CASSAVA...

VIRUS-HOST INTERACTIONS IN THE CASSAVA

BROWN STREAK DISEASE PATHOSYSTEM

IBRAHIM UMAR MOHAMMED

A thesis submitted in partial fulfilment of the requirements of the

Degree of Doctor of Philosophy

Natural Resources Institute (NRI)

University of Greenwich

UK

March 2012

i

DECLARATION

I certify that this work has not been accepted in substance for any degree and is

not concurrently submitted for any degree other than that of Doctor of Philosophy

(PhD) of the University of Greenwich. I also declare that this work is the result of

my own investigations except where otherwise identified by references and that I

have not plagiarised the work of others.

Student: Ibrahim U. Mohammed...................................Date..............................

Supervisors: Dr. Maruthi M.N. Gowda...............................Date........................

Dr. Rory J. Hillocks....................................................Date.................................

ii

To my parents: my father Mohammad Sani Umar who advised that I should go to

school at very late age and to the memory of my late mother Zainab Umar

Mohammad who assured me that I can do it at that time when I wanted to retreat.

May her soul rest in perfect peace and may ‘Allah’ reward her good deeds with

“Jannatul-Firdausi.’’

iii

ACKNOWLEDGEMENTS

The work reported in this thesis received wide range of support such that it is not

possible to mention all the people who were involved on this single page.

Nonetheless, I would like to thank especially Dr. Maruthi M.N. Gowda for his

supervision, guidance and constant encouragement throughout the study. He

made this thesis possible by giving me an ample share of his time and placing no

restrictions on his collection of literature, but any error here are solely mine. I am

also deeply grateful to Dr. Rory J. Hillocks who generously provided cassava

materials, supervision, contribution to my studies and writing up of the thesis

especially its presentation. I would like to thank staff and colleagues at Natural

Resources Institute (NRI) for their support during this study. I wish to particularly

thank Drs Muawiya Musa Abarshi, Peter Wasswa, John Orchard, Mr Mark

Parnell and especially Prof Andrew Westby, for their support and encouragement.

I thank Drs Carl Collins, Bettina Otto and Sue Seal for their invaluable help, in

the glasshouse, insectary and molecular biology laboratory. I also thank Dudley

Farman, Charles Whitfield Simon Springate and Mrs Natalie Morley, for

technical assistance. I acknowledge the assistance of Dr. Stephen Young, with the

statistical analysis (Chapters 4 and 6). I specially thank Elizabeth Roe (Mum) for

lending me money to pay for my first year registration at the time when funding

from Kebbi State was stopped and for her assistance and support to my family

and myself. I would like to thank the Kebbi State Government of Nigeria for

funding my studies. My many friends and relatives constantly showered me with

love and support in the good and bad times that a Ph.D. inevitably involves. All

the above transformed my endeavour into a surmountable enjoyable and

worthwhile experience.

Last but not least, I wish to thank my family who, in a very special way, enabled

me to realise my dream of completing my studies. To Nafisatu S.T. Sulaiman, my

wife, thank you for your support, encouragement and taking care of our teenage

children while I was always in the school. To Zainab Ummi Ibrahim, Ahmed

Abba Ibrahim, Hussainatu Mami Ibrahim and Mohammad Mahmood Ibrahim,

thank you for your support, encouragement and belief that the sky was the limit in

your father’s pursuit of his studies.

iv

ABSTRACT

The research seeks to understand the virus-host plant interactions for cassava

brown streak disease (CBSD) caused by two viruses, Cassava brown streak virus

(CBSV) and Ugandan Cassava brown streak virus (UCBSV) of the genus

Ipomovirus, family Potyviridae. The diversity of six CBSD isolates from the

endemic (Kenya, Malawi, Mozambique and Tanzania) and the recently developed

epidemic areas (Uganda) of the disease in eastern Africa was studied. Five

cassava varieties differing in virus resistance levels; Albert, Columbian,

Ebwanateraka, TMS60444 (all susceptible) and Kiroba (tolerant) were graft-

inoculated with the UCBSV and CBSV isolates. Based on a number of

parameters, the isolates can be grouped into two main categories; severe and

milder forms. Transmission of viruses using non-vector modes confirmed that

CBSV was sap transmissible from cassava to cassava. Graft-inoculation of

infected scions onto CBSD-free cassava plants was the most efficient mode of

transmission which resulted in 80 and 100% rate for UCBSV and CBSV

respectively. The two virus isolates were not transmitted through contaminated

tools and hands. The effect of host-tolerance on virus was investigated in a long-

term experiment where three cassava varieties Albert, Kiroba and Kaleso (field-

resistant to CBSD) were graft-inoculated with UCBSV and CBSV. The three

cassava varieties showed differences in virus movement, symptom development,

severity and relative virus titres. The mechanisms of resistance to CBSD were

investigated by making cuttings, from various parts of the plants, and a greater

number of disease-free plants were generated from cuttings made from Kaleso

than Kiroba and Albert. The fecundity of B. tabaci and its ability to transmit the

virus were determined and results indicated no significant differences in the

ability of the three cassava varieties to support whitefly development. Finally,

thermal and chemical treatments of tissue cultured plants were conducted and the

combinations of both treatments produced the greatest number of disease-free

plants in all three varieties; Kaleso (50%), Kiroba (44%) and Albert (35%). The

information generated in this thesis has greatly improved our understanding of the

interactions between the three biotic factors; the host, virus and vector in the

CBSD-pathosystem, which would be highly useful in designing effective disease

management strategies.

v

TABLE OF CONTENTS DECLARATION ............................................................................................................ i

ACKNOWLEDGEMENTS .......................................................................................... iii

ABSTRACT .................................................................................................................. iv

LIST OF TABLES ......................................................................................................... x

LIST OF FIGURES ..................................................................................................... xii

ABBREVIATIONS .................................................................................................... xiv

CHAPTER 1: General introduction, objectives and experimental plan ................ 1

1.1 Importance of cassava in Africa .............................................................................. 1

1.2 History and importance of CBSD ............................................................................ 2

1.3 Aims and Objectives ................................................................................................ 4

1.4 Experimental plan .................................................................................................... 4

CHAPTER 2: Literature review................................................................................. 6

2.1. Global cassava production ...................................................................................... 6

2.1.1 Cassava origin and distribution in Africa ............................................................. 8

2.1.2 Cassava taxonomy ................................................................................................ 9

2.1.3 Cassava utilization .............................................................................................. 10

2.1.4 Cassava production constraints ........................................................................... 11

2.2. Cassava brown streak disease occurrence and distribution .................................. 13

2.2.1 The viruses infecting cassava in Africa .............................................................. 15

2.2.2 CBSV transmission ............................................................................................. 19

2.2.3 CBSD symptoms ................................................................................................. 20

2.2.4 The whitefly vector, Bemisia tabaci ................................................................... 22

2.2.5 Virus-vector interactions ..................................................................................... 23

2.2.6 Economic losses due to CBSD ........................................................................... 25

2.2.7 Control methods .................................................................................................. 26

2.2.8 Plant infectivity assays ........................................................................................ 31

2.2.9 Electron microscopy ........................................................................................... 32

2.2.10 Enzyme linked immunosorbent assay ............................................................... 32

2.2.11 PCR-based detection of viruses ........................................................................ 33

2.2.12 Virus elimination techniques ............................................................................ 34

2.2.13 Mechanisms of resistance to virus infection ..................................................... 35

2.2.14 Evaluation of CBSD resistance ......................................................................... 37

CHAPTER 3: General materials and methods ....................................................... 38

vi

3.1. Cassava varieties and growth conditions .............................................................. 38

3.2. UCBSV and CBSV isolates .................................................................................. 38

3.2.1 Media Preparation ............................................................................................... 39

3.2.2 Surface sterilizations and inoculation of nodes into the media ........................... 40

3.2.3 Transfer of plantlets to the soil ........................................................................... 40

3.2.4 Virus transmission by graft-inoculation of cassava varieties ............................. 41

3.2.5 Buffer solutions ................................................................................................... 41

3.2.6 Sterilisation of solutions and equipment ............................................................. 42

3.2.7 RNA extraction ................................................................................................... 42

3.2.8 Reverse transcriptase (RT) .................................................................................. 43

3.2.9 Polymerase chain reactions (PCR) ...................................................................... 44

3.2.10 Primers used in RT-PCR reactions ................................................................... 45

3.2.11 Gel electrophoresis ............................................................................................ 45

CHAPTER 4: The effect of virus diversity on CBSD symptom expression on

cassava and herbaceous host plantsa ........................................................................ 47

4.1. Introduction ........................................................................................................... 47

4.2. Materials and methods .......................................................................................... 48

4.2.1 Cassava varieties and CBSD isolates .................................................................. 48

4.2.2 Graft-inoculation of virus isolates for recording rate of transmission ................ 48

4.2.3 CBSD symptom severity ..................................................................................... 48

4.2.4 Sap-inoculation of herbaceous host plants .......................................................... 49

4.2.5 Sampling of plant tissues and virus detection by RT-PCR ................................. 49

4.2.6 Measuring virus concentration in infected plants ............................................... 50

4.2.7 Statistical analyses .............................................................................................. 50

4.3 Results .................................................................................................................... 50

4.3.1 CBSD symptom types on cassava....................................................................... 50

4.3.2 Rate of transmission of UCBSV and CBSV isolates by graft-inoculation ......... 53

4.3.3 Sprouting of the CBSD-infected cuttings ........................................................... 54

4.3.4 CBSD leaf symptoms severity on cassava varieties ........................................... 55

4.3.5 CBSD symptom development on cassava varieties ............................................ 57

4.3.6 CBSD symptom severity on herbaceous host plants .......................................... 59

4.3.7 RT-PCR detection of UCBSV and CBSV isolates ............................................. 62

4.3.8 Measuring virus concentration in infected plants ............................................... 62

4.4 Discussion .............................................................................................................. 64

vii

4.4.1 Conclusions ......................................................................................................... 67

CHAPTER 5: Examining the non-vector modes of transmission of Cassava

brown streak viruses .................................................................................................. 68

5.1 Introduction ............................................................................................................ 68

5.2 Materials and Methods ........................................................................................... 68

5.2.1 Cassava varieties and UCBSV and CBSV isolates............................................. 68

5.2.2 Sap-inoculation ................................................................................................... 69

5.2.3 Sap-injection ....................................................................................................... 69

5.2.4 Leaf picking ........................................................................................................ 70

5.2.5 CBSD-contaminated tools .................................................................................. 71

5.2.6 Graft-inoculation ................................................................................................. 72

5.3 Results .................................................................................................................... 72

5.3.1 Sap-inoculation ................................................................................................... 72

5.3.2 Sap-injection ....................................................................................................... 74

5.3.3 Leaf picking ........................................................................................................ 74

5.3.4 CBSD-contaminated tools .................................................................................. 74

5.3.5 Graft-inoculation ................................................................................................. 74

5.4 Discussion .............................................................................................................. 76

5.4.1 Conclusions ......................................................................................................... 77

CHAPTER 6: Mechanisms of resistance to CBSD in cassava varieties ............... 79

6.1. Introduction ........................................................................................................... 79

6.2. Materials and methods .......................................................................................... 80

6.2.1 Cassava varieties and virus isolates .................................................................... 80

6.2.2 Grafting of cassava varieties, symptom development and severity .................... 80

6.2.3 Sampling for measuring virus detection and movement in cassava ................... 81

6.2.4 RT-qPCR............................................................................................................. 81

6.2.5 Measuring virus titres in cassava ........................................................................ 82

6.2.6 Data analysis from RT-qPCR ............................................................................. 84

6.2.7 Assessment of reversion in CBSD-infected cassava varieties ............................ 84

6.2.8 Whitefly fecundity studies to determine the mechanisms of resistance ............. 86

6.2.9 Whitefly inoculation studies ............................................................................... 87

6.3. Results ................................................................................................................... 89

6.3.1 Rate of graft-transmission, symptoms development and severity on cassava

varieties ........................................................................................................................ 89

viii

6.3.2 Virus detection and movement within cassava varieties .................................... 96

6.3.3 Measuring virus titres in three cassava varieties ............................................... 100

6.3.4 Assessment of reversion on CBSD-infected cuttings ....................................... 102

6.3.5 Effect of stem cuttings on plant regeneration and rate of reversion ................. 104

6.3.6 Effect of stem position (lower, middle and upper portions) on reversion ........ 105

6.3.7 Fecundity and survival of B. tabaci on cassava varieties ................................. 107

6.3.8 Resistance/susceptibility of cassava varieties to CBSV upon transmission by

B. tabaci ..................................................................................................................... 109

6.3.9 Relationship between visual observations of CBSD-symptoms and CBSV

detection in B. tabaci inoculated cassava plants ........................................................ 109

6.3.10 Classification of cassava varieties into different resistance groups ................ 110

6.4. Discussion ........................................................................................................... 112

6.4.1 Conclusions ....................................................................................................... 117

CHAPTER 7: Developing methods to eliminate UCBSV and CBSV from

infected cassava varieties ......................................................................................... 119

7.1. Introduction ......................................................................................................... 119

7.2. Materials and methods ........................................................................................ 119

7.2.1 Cassava varieties and CBSD isolates ................................................................ 119

7.2.2 Tissue culturing ................................................................................................. 120

7.2.3 Comparison of the position of the nodes for virus elimination ........................ 120

7.2.4 Thermotherapy .................................................................................................. 120

7.2.5 Chemotherapy ................................................................................................... 121

7.3.6 Simultaneous application of the therapies for in vitro regeneration of

cassava and UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] ....................... 122

7.2.7 Assessment of the efficacy of the therapies ...................................................... 122

7.3 Results .................................................................................................................. 123

7.3.1 Tissue culturing ................................................................................................. 123

7.3.2 Comparison of the position of nodes as material for starting explants ............. 126

7.3.3 Thermotherapy .................................................................................................. 126

7.3.4 Chemotherapy ................................................................................................... 129


CBSD-affected cassava .............................................................................................. 133

7.3.6 Assessment of the efficacy of the therapies ...................................................... 135

7.4 Discussion ............................................................................................................ 137

ix

7.4.1 Conclusions ....................................................................................................... 140

CHAPTER 8: General Discussions and Conclusions ........................................... 141

REFERENCES .......................................................................................................... 148

APPENDIX 1 ............................................................................................................. 187

APPENDIX 2 ............................................................................................................. 193

APPENDIX 3 ............................................................................................................. 195

x

LIST OF TABLES

2.1 Cassava production in the world, Africa and specifically some

East African countries 7

2.2 Taxonomy and classification of the cassava plant 10

3.1 Six CBSD isolates used in this study 38

3.2 Master Mix 1 for cDNA synthesis from virus RNA 43

3.3 Master Mix 2 for cDNA synthesis from virus RNA 44

3.4 Reaction mixture PCR amplification 44

3.5 The temperature profiles and thermal cycling conditions 45

3.6 Primers used in PCR and RT-PCR reactions for the detection of

CMD and CBSD isolates 45

4.1 The rate of graft transmission of six CBSD isolates to different

cassava varieties 53

4.2 The effects of CBSD infections on the sprouting of cassava stem

cuttings 54

4.3 Mean symptom severity scores for each CBSD isolate on

different cassava varieties 55

4.4 Time taken to express symptoms on CBSD-infected cuttings and

graft-inoculated plants in the glasshouse 57

4.5 Herbaceous hosts inoculated with CBSV and UCBSV isolates 60

5.1 Summary of non-vector modes of transmission of UCBSV and

CBSV 75

6.1 Primers used in qPCR reactions for the quantification of UCBSV

and CBSV in cassava varieties 83

6.2 Reaction mixture for qPCR quantification of the viral cDNA 83

6.3 Temperature profile and thermal cycling condition 83

6.4 Rate of graft-transmission of UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] on cassava varieties 90

6.5 CBSVs movement from the point of inoculation to other parts of

CBSV-[MZ:Nam1-1:07] on cassava varieties 100

6.6 Effect of CBSD on the sprouting of cassava cuttings 104

6.7 Assessment of reversion in CBSD-infected cuttings of different

length 105

xi

6.8 Rate of CBSV transmission in three different cassava varieties

and number of CBSV-infected plants as per detection by PCR 109

6.9 Summarised tabular form of the resistance mechanisms 111

7.1 Effect of tissue culture in eliminating UCBSV-[UG:Kab4-3:07]

CBSV-[MZ:Nam1-1:07] from infected cassava varieties 125

7.2 Comparison of the success of the transfer in tissue culture media

and in the soil of nodes from different part of cassava varieties 126

7.3 Effect of thermotherapy on UCBSV and CBSV-elimination from

infected cassava varieties 128

7.4 Effect of chemotherapy for UCBSV and CBSV- elimination

from infected cassava varieties 132

7.5 Effect of the three therapies for UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] elimination from infected cassava

varieties 134

7.6 Effect of therapies on regeneration of cassava plants for UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-elimination 136

xii

LIST OF FIGURES

2.1 Particle morphology of UCBSV and CBSV and their genome

structure 19

2.2 CBSD symptoms in different parts of cassava plant 22

3.1 A sketch map of eastern African countries showing the collection

sites of CBSD isolates from the disease epidemic and endemic

areas 39

4.1 Cassava leaves (Albert plants) showing CBSD symptoms 52

4.2 CBSD symptoms on leaves of affected cassava plants 56

4.3 Typical CBSD symptom development from one month to three

months on cassava variety Albert 58

4.4 CBSD-symptoms on N. benthamiana 61

4.5 Typical symptoms observed on N. clevelandii plants 61

4.6 Detection of UCBSV and CBSV using CBSV F3 and CBSV R3

primers 62

4.7 Detection of UCBSV and CBSV in serial dilutions 63

5.1 Collection of CBSD-infected sap 70

5.2 Leaf picking in the field by a farmer in Tanzania 71

5.3 Transmission of UCBSV and CBSV using infected secateurs 72

5.4 A representative picture of agarose gel electrophoresis 73

6.1 Cassava stems planted as part of CBSD reversion experiment 86

6.2 B. tabaci colony maintained in the NRI insectary 87

6.3 CBSD-infected plants of var. Ebwanaterak used as virus source 88

6.4 Percentage CBSD stems symptoms indicating the resistance

status of cassava varieties based on their reactions to stem

infection 91

6.5 CBSD stem symptoms observed on Albert, example of the

harvested root of Kaleso 2.5 years after planting 92

6.6 Leaf and root symptoms by UCBSV-[UG:KAB4-3:07] and

CBSV-[MZ:Nam1-1:07] on Kaleso 93

6.7 Leaf and root symptoms by UCBSV-[UG:KAB4-3:07] and

CBSV-[MZ:Nam1-1:07] on Kiroba 94

6.8 Leaf and root symptoms by UCBSV-[UG:Kab4-3:07] and

xiii

CBSV-[MZ:Nam1-1:07] on Albert 95

6.9 Symptom severity recorded on the roots of three cassava

varieties for UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] 96

6.10 Detection of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-

1:07] at four days after graft-inoculation 97


1:07] at 12 weeks after graft-inoculation 98


1:07] at 36 weeks after graft-inoculation 99

6.13 Mean fold change in UCBSV-[UG:Kab4-3:07] titres in Kaleso

Kiroba and Albert 101

6.14 Mean fold change in CBSV-[MZ:Nam1-1:07] titres in Kaleso,

Kiroba and Albert 101

6.15 Proportion of cuttings sprouted from virus-affected cassava

varieties 102

6.16 Proportion of disease-free plants grown from virus-affected

cuttings as an effect of reversion 103

6.17 Plants of varieties Kaleso (a) showing reversion from CBSD 103

6.18 Effects of isolate and variety on the rate of reversion for cuttings

taken from smaller, middle and upper parts of the stems of three

cassava 106

6.19 Total number of eggs, nymphs and adults B. tabaci recorded on

the three cassava varieties 108

6.20 Development of B. tabaci on three cassava varieties 108

7.1 Regeneration of CBSD-infected node cuttings from cassava

varieties by tissue culture for eliminating UCBSV-[UG:Kab4-

3:07] and CBSV-[MZ:Nam1-1:07] 124


varieties by thermotherapy at different temperature regimes 127


varieties by chemotherapy and reaction of the varieties at

different ribavirin concentrations 130

7.4 Untreated control node cuttings 131

xiv

ABBREVIATIONS

ACMV

a.s.l.

BAP

Bt

bp

CMD

CMBs

CAD

CBB

CBSD

CBSV

UCBSV

CP

cDNA

CVYV ON OS

$

DRC

DB

EACMV

EAAFRO

EACMV-UG

EDTA

ESP

ET

Ha

CIAT

IITA

ILTAB

IRAT

KARI

African cassava mosaic virus

Above sea level

Benzlaminopurine

Bacillus thuringiensis

Base pair

Cassava mosaic disease

Cassava mosaic begomoviruses

Cassava anthracnose disease

Cassava bacterial blight

Cassava brown streak disease

Cassava brown streak virus

Ugandan Cassava brown streak virus

Coat protein

Complementary deoxynucleic acid

Cucumber vein yellowing virus

Degree north

Degree south

Dollar

Democratic Republic of Congo

Die back

East African cassava mosaic virus

East African Agriculture and Forestry Research Organisation

East African cassava mosaic virus-Uganda

Ethylenediaminetetraacetic Acid

Epidemic Spastic Paraparesis

Efficiency of therapy

Hectare

International centre for tropical agriculture

International institute for tropical agriculture

International Laboratory for Tropical Agricultural Biotechnology

Institute de Recherches Agronomiques Tropicales

Kenya Agricultural Research Institute

xv

Kcal

KDa

LM

LC

LCH

LL

Mo

M

M.

Mt

MS

NRI

N.

NPV

PCR

Pr

RNA

RT-PCR

RT-qPCR

Spp.

SPMMV

SDW

SG

SSA

TMS

TME

TC

UK

US

USD

VC

Kilocalories

Kilodaltons

Leaf mottling

Leaf collapse

Leaf chlorosis

Local lesion

Mosaic

Marker

Manihot

Metric tonnes

Murashige and Skoog

Natural Resources Institute

Nicotiana

Nuclear polyhedrosis virus

Polymerase chain reaction

Percentage response

Ribonucleic acid

Reverse transcription polymerase chain reaction

Reverse transcription-quantitative polymerase chain reaction

Species

Sweet potato mild mottle virus

Sterile distilled water

Stunted growth

Sub-Saharan Africa

Tropical Manihot selection

Tropical Manihot esculenta

Tissue culture

United Kingdom

United States of America

United States of America dollar

Vein clearing

1

CHAPTER 1: General introduction, objectives and experimental plan

1.1 Importance of cassava in Africa

Cassava is one of the world’s most important food crops (Nassar and Ortiz, 2010;

Legg et al., 2011) as it is the source of carbohydrate for more than 800 million

people in the tropical world (Dixon, et al., 2002) and providing over 500 daily

calories for over 100 million people (Chavez et al., 2005). Cassava is the third

most important source of carbohydrates in Sub-Saharan Africa (SSA) and the

most important food crop in Nigeria, superseded only by rice, maize and millet

within the tropics (Mbwika, 2002; Nassar, 2002; Herzberg et al., 2004; Devries et

al., 2011). Cassava generates cash income for a large number of households in

comparison with other food staples (Nassar, 2002) making it an essential

contributor to food security, poverty alleviation and economic growth in the SSA

region (Kawano, 2003). The roots and leaves are available throughout the year

(Ntawuruhunga et al., 2006), thus cassava is an important food security crop,

especially in drought-stricken areas (Chavez et al., 2005).

Cassava is the main source of carbohydrates, vitamins and minerals for the many

poor in SSA, some parts of East Asia and large parts of Latin America (Salcedo et

al., 2010). There is an increased need for cassava production in developing

nations to meet the demand for cassava as a human food. The search for energy

has also stimulated research into cassava as a source of bio-ethanol (Plucknett,

1984). Thus cassava provides a major opportunity to increase foreign exchange

earnings for SSA countries. Cassava has several advantages over other food

staples including rice, maize, sorghum and millet, especially in areas where there

are weak market infrastructures, scanty, uncertain rainfall and poor resource base

(Nweke et al., 2002). Food security is the first priority for farming households in

Africa. This security however, is being threatened by two important virus

diseases: cassava mosaic disease (CMD) and cassava brown streak disease

(CBSD).

2

1.2 History and importance of CBSD

CBSD was first described in East Africa by Storey (1936). Its causative pathogen

has been confirmed relatively recently as Cassava brown streak virus (CBSV)

(Monger et al., 2001a). CBSD is now known to be caused by two viruses CBSV

and Ugandan Cassava brown streak virus (UCBSV) of the genus ipomovirus,

family potyviridae (Alicai et al., 2007; Mbanzibwa et al., 2009; Monger et al.,

2010; Winter et al., 2010; Mbanzibwa et al., 2011). Differences in symptom

expression associated with UCBSV and CBSV have been demonstrated using the

herbaceous test plant, Nicotiana benthamiana, but such differences were less

apparent for infections in cassava (Winter et al., 2010). The genome structure of

CBSV (9069-9070 nt) is longer than that of UCBSV (8995-9008 nt) and both

encodes a polyprotein of 2912-2916 and 2901-2902 aa respectively (Mbanzibwa

et al., 2011).

CBSD is endemic among the East African coastal cassava growing areas, where it

was earlier believed to be restricted to only low and mid altitudes of up to 1000 m

above sea level (a.s.l.) (Nichols 1950; Hillocks et al 1996). CBSD is now

reported in Tanzania, Uganda, Malawi, Kenya, Mozambique, and Zambia

(Hillocks, 2003; Hillocks, 2006; Alicai et al., 2007; Winter et al., 2010). CBSD is

a more important cause of crop loss in these regions than was earlier believed

(Hillocks and Jennings, 2003) since the disease causes both quantitative and

qualitative reduction in total root yield by rotting of roots, rendering them

unmarketable and unpalatable. CBSD is thus threatening the livelihood and food

securities of millions of producers and cassava consumers in SSA. The rapid

spread of CBSD in areas considered previously to be outside the natural range of

the disease requires development of control measures that will be appropriate and

sustainable for cassava producers.

CBSD can be controlled by cultural practices such as roguing, selecting disease-

free planting materials, early harvesting and planting resistant varieties (Hillocks

et al., 1996; Hillocks and Jennings, 2003; Kanju et al., 2003). As the root

symptoms of CBSD usually begin to develop 4-8 months after sprouting, farmers

harvest early to avoid the disease. The method of early harvesting before the crop

reaches its full potential results in less yields (Hillocks et al., 2002). Therefore,

3

the best control method for CBSD is the use of tolerant and resistant varieties,

since most of the tolerant varieties matured without root symptoms or with only

mild root symptoms (Hillocks, 2003; 2006). This would allow cassava to be left

in the fields to achieve maximum yield potential and permit staggered harvesting,

which would increase overall production and enhance the role of cassava as a

famine reserve crop in SSA.

Research has been conducted since the 1930s in an attempt to secure resistance to

CBSD (Storey, 1947). However, the mechanisms of resistance/tolerance in

cassava to CBSD are still not fully understood. Determining the mechanisms of

host-plant resistance to CBSD could be of great practical assistance to cassava

breeders as the recent outbreak of CBSD from the endemic areas to high coastal

areas of Uganda requires urgent control.

Little information is available on virus-host plant interactions in the CBSD

pathosystem. It was unknown if the so called ‘resistance’ to CBSD is due to a

host response mechanism after infection with the virus, or inability of the

whiteflies (Bemisia tabaci), the vector of UCBSV and CBSV, to transmit the

viruses to a particular variety. These were investigated by measuring rate of virus

multiplication, virus movement and spread in CBSD-susceptible and -tolerant

cassava varieties in long-term experiments. Whether the tolerance/resistance to

CBSD is because of the inability of its whitefly vector to feed on tolerant/resistant

cassava was also investigated by conducting whitefly fecundity experiments and

the rate of UCBSV and CBSV transmission by B. tabaci on cassava varieties with

different CBSD tolerance levels. Reversion is a characteristic feature of virus-

resistant cassava varieties where healthy plants can be obtained from making

stem cuttings of the previously diseased plants (Fondong et al., 2000). This has

been well documented for CMD while no such studies have been conducted on

CBSD. Whether or not reversion occurred for CBSD was investigated by making

stem cuttings of diseased plants. Attempts were also made to regenerate virus-free

cassava plants by eliminating the virus using tissue culture techniques,

thermotherapy, chemotherapy and simultaneous application of the three therapies.

4

1.3 Aims and Objectives

The main aim of this study was to achieve an improved understanding of the

mechanisms of resistance to CBSD through several host-virus-vector interaction

experiments. The research has the following four inter-linked objectives;

Objective 1: To determine symptom development and diversity by different

CBSD isolates on cassava and herbaceous host plants with the aim of determining

whether a severe form of the virus is associated with the recent CBSD outbreak in

Uganda.

Objective 2: To determine the mode of transmission of CBSV by non-vector

methods such as graft and mechanical transmission, using contaminated tools,

and cultural practices such as cassava leaf harvesting/picking.

Objective 3: Understanding the mechanisms of resistance/tolerance to CBSD in

cassava by determining virus-host-vector interactions (rate of virus

multiplication, spread and titre) and through reversion experiments.

Objective 4: To eliminate virus from CBSD-infected cassava varieties by tissue

culture, thermotherapy, and chemotherapy and through the simultaneous

application of the most effective therapies.

1.4 Experimental plan

Objective 1: Determine symptom diversity in CBSD isolates on cassava and

herbaceous host plant

Experiment 1: Inoculate five susceptible cassava varieties with six CBSV

isolates from different countries and compare symptom development and

variations.

Experiment 2: Inoculate selected herbaceous experimental host plants (Nicotiana

species) with six virus isolates and compare symptom variations.

Objective 2: To determine the non-vector modes of CBSV transmission and their

efficiency.

Experiment 1: Inoculate selected susceptible cassava varieties using sap-

inoculation, sap-injection, contaminated tools, leaf picking and graft-inoculation.

Objective 3: Understanding the mechanisms of resistance/tolerance to CBSD in

cassava by determining the virus-host-vector interactions

5

Experiment 1: Examine virus distribution in the host in relation to leaf and root

symptoms

Experiment 2: Compare varieties with respect to rate of virus spread within the

plants

Experiment 3: Compare tolerant and susceptible varieties with respect to virus

titre

Experiment 4: Can virus-free cuttings be obtained from infected plants? – Make

cuttings from various parts of the plant both in the susceptible and resistant

varieties and study mechanisms of reversion.

Experiment 5: Measure the fecundity and survival of whiteflies and the rate of

UCBSV and CBSV transmission by B. tabaci on susceptible (Albert), tolerant

(Kiroba) and resistant (Kaleso) cassava varieties.

Objective 4: To eliminate virus from CBSD-infected cassava varieties

Experiment 1: Attempts to eradicate virus from the plant by tissue culture

techniques, thermotherapy, chemotherapy and simultaneous application of the

therapies.

6

CHAPTER 2: Literature review

2.1. Global cassava production

In recent years global cassava production has shown a tremendous increase and is

expected to show continued growth over the coming years, with Africa producing

more than half of the global production. Over 234 million tonnes of cassava were

produced worldwide in 2009, of which over 119 million tonnes were from Africa

(FAOSTAT, 2009). Nigeria is the world’s leading cassava producer, generating

over 37 million tonnes in 2009 (FAOSTAT, 2009). East African countries

produced 27 million tonnes of cassava in 2009 and ranked third in production in

Africa (Table 2.1). In most areas where cassava is produced it was believed that

increased production is due to increases in area under cultivation rather than yield

per hectare (Hillocks, 2002). Cassava is cultivated by planting either stem

cuttings or seeds. For cassava plants grown from stem cuttings tuberous roots are

formed by secondary thickening of a proportion of the adventitious roots that

develop usually at the basal end of the cutting. Plants grown from seed initially

form a taproot from which adventitious roots arise later, some of which develop

into storage roots (Cooke and Coursey, 1981). Roots of cassava plants are the

main storage organ and economic part of the plant and their characteristics differ

between varieties (Alves, 2002).

Cassava is one of the simplest crops to produce because propagation by cuttings

is relatively easy and most varieties can tolerate poor climatic conditions, pests,

diseases and deteriorated soil conditions (Hillocks and Jennings, 2003; Jaramillo

et al., 2005). Cassava productivity per unit area per unit time is the greatest when

compared to sweet potato (Ipomoea batatas), potato (Solanum tuberosum), millet

(Pennisetum typhoides Burm), sorghum (Sorghum bicolor L.), maize (Zea mays

L) and rice (Oryza sativa), (Scott et al., 2000) at 25% more than maize and 40%

more than rice (Agwu and Anyaeche, 2007). In areas of high population density,

such as southern Malawi, cassava is replacing maize as a primary food crop

(FAO, 2010), which may be due to the combined effects of declining soil fertility

and climate change.

7

Table 2.1: Cassava production in the world, Africa and specifically in some East

African countries

Country Cassava production (tonnes) Yield (tonne/hectare)

World 234.0 × 106 12.4

Africa 119.0 × 106 9.7

Western Africa 59.0 × 106 11.7

Central Africa 33.0 × 106 9.4

East Africa 27.0 × 106 7.2

Tanzania 5.9 × 106 5.5

Mozambique 5.7 × 106 5.3

Uganda 5.2 × 106 12.6

Madagascar 2.7 × 106 6.7

Malawi 3.9 × 106 20.3

Rwanda 1.0 × 106 7.2

Zambia 0.9 × 106 4.5

Kenya 0.8 × 106 11.6

Source of data: FAOSTAT (2009)

Increased cassava production in Africa could also be attributed to the rapid

population growth and poverty which encouraged subsistence farmers to search

for cheaper sources of food energy. Genetic research and better agronomic

practices were the two main driving forces that have also contributed to the rapid

growth of cassava production in Africa (Nweke et al., 2002).

Cassava is mainly grown for human consumption and provides 60% of the daily

energy intake in SSA (Taylor et al., 2004). Cassava is grown and consumed by

the world’s poorest and most food insecure households (Carter et al., 1992; Henry

and Hershey, 2002) and adopted in most areas where it is now grown in some

SSA countries as a famine-reserve crop (Hahn, 1984). Before the introduction of

cassava from South America, the traditional staple crops in most cassava

producing areas of Africa were sorghum, millet, rice and yam. Cassava’s

reliability as a source of food and its ability to fill the hungry gap when other food

staples are not available, particularly in the time of drought, favoured its

cultivation in SSA (Barratt, et al., 2007). Further expansion of cassava production

in most African countries may have been constrained by the current CMD and

8

CBSD epidemic occurring in Africa, especially in the non coastal highland areas

of East Africa.

2.1.1 Cassava origin and distribution in Africa

About 98 species of the wild genus Manihot exist in the western hemisphere of

which only Manihot esculenta does not exist in wild state (Rogers and Appan,

1973). The geographical origin of agricultural domestication of cassava has been

disputed for a long time. Archaeological evidence indicates that cassava

originated in the South and Central America (Rogers, 1963; Leone, 1977). Wood

(1985) suggested Brazil as the place of cassava origin. Portuguese traders first

introduced cassava into West Africa between 16th and 18th century in slave ships

(Jones, 1959; Nweke et al., 2002; Monger et al., 2010). The growth of cassava

production and distribution in Nigeria and Benin Republic are attributed to the

freeing of Brazilian slaves who returned to the area around 1800 (Agboola, 1968).

Other attributes possessed by cassava are its low labour requirements during

cultivation and flexibility of its harvest period (Rhodes, 1996). Ability to produce

a crop in poor soils was thought by earlier researchers to be a reason favouring

cassava distribution (Jones, 1959). This was supported by Agboola (1968), who

thought increased importance of cassava was associated with declining fallow

lengths in the Savannah area of West Africa. The diffusion of cassava into

African agriculture was described as ‘self–spreading’ by Nweke et al. (2002).

Cassava arrived in East Africa in the 19th century (Jones, 1959). Purseglove

(1968) indicates that cassava was taken to East Africa from Brazil in 1736 and

was noted in Zanzibar in 1799. The explorer Speke, found no cassava on the

western shore of Lake Victoria in 1862, but the crop was recorded in Uganda in

1878 (Hillocks, 2002). In addition, Wood (1985) noted that Mbunda migrants

from northeast Angola introduced cassava to the upper Zambezia in the 1830s.

Linguistic studies based on the similarity of local names for cassava identified

several routes, which accounted for the distribution of cassava between Central

and East Africa (Pasch, 1980). The first route extended from Angola to

Mozambique, while a second route led from central Zaire to northern Zimbabwe.

A third route connected the Lozi (Zimbabwe borders) to the Tonga in Zambia. In

the 1850s, cassava was noted by German travellers in north Cameroon among

9

Fulani who were probably responsible for the spread of the crop in the area

(Ekanayake et al., 1997). Moreover, cassava was also thought by earlier scientists

to promote laziness, soil depletion and malnutrition (Ross, 1975). This view may

likely be due to low labour requirement in its cultivation; its ability to grow well

on marginal soil and its low-level protein, vitamin and mineral content.

Nevertheless, cassava’s special characteristics make it well adapted to farmers’

risk bearing strategies and allow it to be grown under a great diversity of

circumstances. The crop is now widely grown in tropical and subtropical areas

including Africa, South Asia and South America (Hillocks, 2002).

2.1.2 Cassava taxonomy

Cassava (Manihot esculenta Crantz) belongs to the Fruiticosae section of the

genus Manihot of the dicotyledonous family Euphorbiaceae (Table 2.2).

Comprising about 7200 species, the Euphorbiaceae include several economically

important plants such as: rubber tree (Hevea brasiliensis), castor oil plant

(Ricinus comunis), ornamental plants (Euphorbia spp) and cassava (Roggers and

Appan, 1973). One defining feature of Euphorbiaceae is that all members are

known to produce latex. The Fruiticosae consist of shrubs that are adapted to

savannah or desert condition where as the Arboreae consist of tree species

(Jennings and Iglesias, 2002). Wild and cultivated cassava species so far studied

are diploid with a chromosome number of 2n =36 chromosomes that have regular

bivalent pairing at meiosis (Nassar, 1995). Although, polyploidy has been

reported in some species such as M. glaziovii, it has been suggested that M.

esculenta is likely to have been derived from the subspecies flabellifolia rather

than from several progenitor species (Jennings, 1976).

10

Table 2.2: Taxonomy and classification of the cassava plant

Classification Taxonomy

Class

Sub-class

Order

Family

Sub-family

Genus

Species

Dicotyledoneae

Archchlamydeae

Euphorbiales

Euphorbiaceae

Manihotae

Manihot

Manihot esculenta Crantz

Source: Format adapted from IITA (2005).

2.1.3 Cassava utilization

Cassava is a tropical crop grown between 30 oN and 30 oS; it has numerous traits

that confer comparative advantages in marginal environments (Henry and

Hershey, 2002). Cassava tubers can be processed into a wide variety of food,

animal feeds and industrial products (Taylor et al., 2004). Due to rapid

physiological deterioration of cassava, fresh tuberous roots cannot be stored for

long. Cassava is therefore mostly processed after harvest in order to increase its

storage life and to reduce the level of toxic cyanide (Bokanga and Otoo, 1991).

More than 100 million people obtain over 500 kilocalories (Kcal) per day from

cassava (Bokanga and Otoo, 1994). An increase in cassava utilization is expected

from 173 million tonnes to 275 million tonnes in the period 1993-2020 (Westby,

2002). This could be due to the recent interest in cassava as one of the alternative

feedstocks for ethanol production. This was viewed as an opportunity for the

African countries to reduce their exposure to disequilibrium in foreign trade

balance (Patino, 2007). Cassava roots and chips are the cheapest feedstock for

bio-fuel in comparison with other crop sources such as maize, sugarcane and rice

(Patino, 2007). Cassava roots give an ethanol yield of up to 16,000 litres per

hectare per unit time as compared to sugar-cane 7,200 litres per hectare per unit

time and maize 800 litres per hectare per unit time (Kambewa, 2007). In addition,

dried cassava flour was reported to give a yield of 500 litres per tonne of bio-fuel

(Bamikole, 2007). It is apparent that establishment of cassava based ethanol

industries in Africa would create stable market and boost cassava production in

the region (Mhone et al., 2007).

11

Worldwide starch production from cassava has been estimated to be worth around

US $20 billions (FAO, 2010). Cassava utilization in Africa for human

consumption alone is 88% with 12% of the crop used as animal feeds and starch

(Westby, 2002). In spite of Africa being the world’s largest provider of cassava

outputs, it has the lowest yield per hectare, perhaps because of low utilization of

the crop for purposes other than subsistence (Bokanga, 2007).

Human diseases have been associated with cassava consumption in areas where it

is staple food (Westby, 2002; Nzwalo and Cliff, 2011). Cassava contains a

potential goitrogenic agent that may aggravate iodine deficiency disorders

causing goiter and cretinism, a severe form of mental retardation (Jose and Dorea,

2004). Cassava consumption may result in cyanide exposure if cyanogenic

glucosides and their breakdown products are not sufficiently removed from the

roots during processing. Dietary cyanide is converted to thiocyanate in the human

body. Thiocyanate mimics those of iodine deficiency (Bokanga et al., 1994).

However, the goitrogenic action of cassava depends on the glucoside levels in

fresh roots, the effectiveness of processing, the frequency of cassava consumption

and the iodine intake (Jose and Dorea, 2004). Cretinism and epidemic spastic

paraparesis ESP, related to cassava consumption have been reported from

Tanzania (Mlingi et al., 2011), Mozambique (Ernesto et al., 2002; Cliff et al.,

2011), Zaire (Chabwine et al., 2011) and several other countries.

2.1.4 Cassava production constraints

The low rate of seed multiplication limits cassava production. A mother plant of

cassava produces a maximum of 30 stem cuttings at maturity, whereas in true

seed propagation such as millet a single plant can produce hundreds of seeds

(Leihner 2002). In most cassava producing areas the yield is far below the

potential (Nweke, et al., 1994; Hillocks, 2002), maybe due to several factors such

as poor yielding varieties, poor quality planting materials, poor agronomic

practices, unavailability of labour, decline in soil fertility as well as the pest and

disease incidence. Cassava suffers from many pests and diseases, which can

affect the quality and quantity of planting material. A number of diseases are

commonly found on cassava throughout the growing season (Harrison et al.,

1995). Important diseases of cassava include CMD, CBSD, cassava anthracnose

12

disease (CAD) (Collectotrichum gloeosporioides Penz) (Neunschwander et al.,

1987), cassava bacterial blight (CBB) (Xanthomonas axonopodis Bondar) and

cassava root rot (Munga and Thresh, 2002). Several viruses have been isolated

from cassava in SSA, Asia and Americas (Calvert and Thresh, 2002). Of these,

CMD and CBSD are the worst. CBSD and CMD pandemics are the result of new

encounter situation between host and pathogen (Legg et al., 2011). CMD occurs

wherever cassava is grown in SSA. Several different geminiviruses including

various forms of African cassava mosaic virus (ACMV) and East African

cassava mosaic virus (EACMV) have been reported to be responsible for CMD

epidemics (Fauquet and Fargette, 1990; Thresh et al., 1998).

The earliest epidemic of CMD occurred in Uganda, in the 1930s and 1940s in

which CMD-resistant varieties and phytosanatary measures were used to control

the disease for several decades (Jameson, 1964). Until the late 1980s when a

major epidemic of a severe form of CMD was reported in north-central Uganda

(Otim-Nape et al., 1994), the disease had for a long time remained endemic in the

country (Thresh et al., 1998). The situation with CMD in Uganda then changed to

be characterised by the very severe form CMD symptoms which also coincided

with an upsurge in whitefly populations (Gibson et al., 1996; Otim-Nape et al.,

1997). This had devastated cassava production in the area and led to the almost

complete elimination of the most susceptible cassava varieties (Legg et al., 2011).

During the early 1990s, many cassava fields were abandoned and widespread

food scarcity and some hunger-related deaths were reported in Uganda (Thresh et

al., 1994). Spread of CMD to the neighbouring countries of the Great Lakes

region and beyond was reported (Gibson, 1996), resulting in the classification of

the overall occurences as a pandemic (Otim-Nape et al., 1997). Molecular

characterization of the viruses occurring in the area indicated presence of

recombinant CMG variant, EACMV-UG (Zhou et al., 1997), as well as

occurrence of mixed infections of EACMV-UG and ACMV (Pita et al., 2001).

The CMD pandemic expanded across many countries in 2005 and annual losses

due to CMD in Africa were estimated to be greater than 13 million tonnes (Legg

et al., 2011). Most recent pandemics are from Angola (Lava Kumar et al., 2009)

and Cameroon (Akinbade et al., 2010).

13

CMD has been the most researched of all cassava virus diseases, since the

breeding of resistant varieties at the Amani research station in the colonial

Tangayika in the 1930s. Plants infected with CMD are not killed but their leaves

are distorted, root size and number are reduced and stem diameter is also reduced

(Otim-Nape, 1990; Owor et al., 2005). Yield reduction maybe severe and losses

of up to 82% have been reported especially in cassava plants dually infected with

ACMV and EACMV forms (Owor et al., 2005). CBSD was considered to be

more damaging than CMD in the coastal areas of East Africa with recorded

incidences of up to 100% (Hillocks et al., 2001, 2002). However, until recently

little importance was given to CBSD (Nweke et al., 2002), which is currently the

major threat to cassava productivity throughout East Africa, Malawi and northern

Mozambique.

2.2. Cassava brown streak disease occurrence and distribution

In his earlier work on CMD in the season of 1935, Storey recognized the

appearance of another virus disease, which he believed to be different from CMD

due to leaf mottling (Storey, 1936). While CMD chlorosis is present on young

leaves as they unfold, the young leaves in this new disease were normal and only

developed the mottle after ageing (Nichols, 1950). This new disease was CBSD

and the name derives from the production of dark brown stripes on the otherwise

green stem, which are not necessarily the most obvious visible characteristic

features of the disease (Hillocks et al., 1996). Hillocks and Jennings (2003)

reviewed in detail the distribution of CBSD. Storey (1939) reported that CBSD

was widespread in Tanzania, at smaller altitudes only, but was absent at

elevations above 1000 m a.s.l. However the disease was later reported at an

elevation of 1200 m a.s.l., but these are thought to be due to the movement of

infected cassava cuttings from the coast, as whitefly vectors for CBSV (Hillocks

and Jennings, 2003; Maruthi et al., 2005), used not to be favoured at such high

elevations. CBSD was earlier reported as endemic in all coastal cassava-growing

regions of East Africa, from Tanzania extending to the north in Kenya and south

in Mozambique (Nichols, 1950). Isolated incidences from several surveys (Bock,

1994; Hillocks et al., 1996, 1999; Legg and Raya, 1998; Mtunda et al., 2003;

Gondwe et al., 2003; Alicai et al., 2007) confirmed the findings of Nichols

(1950). In 1987, cassava fields were severely affected by CBSD between Kibaha

14

and Morogoro in Tanzania (Thresh, 2003). This finding led to renewed interest to

CBSD and root crop researchers called for concerted effort to control the disease

(Hillocks and Jennings, 2003).

Until the 1990s, earlier reports on the CBSD incidences were descriptive (Storey,

1939; Nichols, 1950; Bock, 1994). The first quantitative data on CBSD

incidences was reported in Tanzania, where the incidence ranged from 19 to 36%

in three coastal regions and the southeast region of Mtwara (Legg and Raya

1998). Another more detailed survey conducted in southern Tanzania confirmed

greater incidences of CBSD reaching 50% in some fields that are situated close to

the coast (Hillocks et al., 1999; Muhanna and Mtunda, 2003). Nichols (1950) had

also over 60 years ago reported CBSD in Nyasaland now Malawi. Rossel and

Thresh again confirmed the presence of the disease in 1993 (Sauti and Chipungu,

1993). An extensive survey undertaken throughout Malawi in July and September

2001 showed that the disease was present at incidences above 75% in many fields

along the lakeshore, and those incidences were greater than common at similar

altitudes above 600 m in Tanzania (Hillocks and Jennings, 2003). CBSD was

reported to be widespread at lower altitudes in the Southern province of Malawi,

particularly towards the border with Mozambique, which led Nichols (1950) to

conclude that the disease must occur also in Mozambique. However it was not

until 1999 that the disease was first reported in Mozambique (Hillocks et al.,

2002). Extensive surveys carried out in 1999 confirmed the occurrence of CBSD

at high incidences in the Nampula and Zambezia province of Mozambique; these

are the major cassava growing areas of the country (Calvert and Thresh, 2002).

The overall incidences of CBSD in these areas were 31% in Nampula and 43% in

Zambezia (Thresh and Hillocks, 2003). In the coastal areas of northern

Mozambique, very high incidences of up to 90 to 100% have been reported

(Hillocks et al., 2002; Thresh and Hillocks, 2003).

Nichols (1950) reported further observations of CBSD in Uganda at both Serere

and Kaberamaido in the north-eastern part of the country. Since then, reports of

CBSD in Uganda have been rare and unconfirmed until November 2004, when

leaf symptoms typical of CBSD, were observed at Mukono in central Uganda

(Alicai et al., 2007). This confirms the re-emergence of CBSD in Uganda 74

15

years after it was first observed in the 1930s in cassava introduced from Tanzania

and controlled by eradication (Jameson, 1964). In Kenya, CBSD was said to be

confined largely to the coast and widely distributed (Munga and Thresh, 2002)

and the reported incidences of the disease were contradictory. Bock (1994)

reported that the disease incidence was low in Kenya, but Munga and Thresh

(2002) reported high incidences of 30 to 60%. Among the relatively few records

of CBSD occurrences in Kenya, several cases were said to relate to varieties,

mostly contained in the National collection (KARI, 1983). In 1999, a molecular

diagnostic survey for viruses infecting cassava was conducted in all cassava-

growing regions of Kenya and identified the presence of CBSV in most of the

samples tested (Were et al., 2004). In addition, a significant outbreak of CBSD

has been reported from a large multiplication site in the Yala swamp area of

western province of Kenya (Ntawuruhunga and Legg, 2007).

Calvert and Thresh (2002) reported a likely movement of cassava planting

material across the border into Zimbabwe and Zambia where CBSD is known to

occur. Until recently the disease had not been reported in Angola or any of the

West and Central African countries. The first report of CBSD symptoms in

Angola was in 2005 when Mutunda et al. (2003), noted the disease on the local

variety ‘Rosa’, introduced into central Angola from Vigre, a town in northern

Angola which borders DRC (Mahungu et al., 2003). This may partially explain

the disease spread in Angola, as CBSD was already reported in DRC (Mahungu

et al., 2003). With recognition of the threat posed by CBSD to food security in

South, East and Central Africa control of the disease has become a priority for

research.

2.2.1 The viruses infecting cassava in Africa

Sixteen different viruses have been isolated from cassava of which nine were

from Africa (Calvert and Thresh, 2002) and these belong to at least four families

and genera, namely; Comoviridae: Nepovirus, Geminiviridae: Begomovirus,

Potyviridae: Ipomovirus, and Caulimoviridae: Caulimovirus (Legg and Thresh,

2003). Only two genera are of economic importance in Africa with regard to

cassava, namely Ipomovirus: UCBSV and CBSV of the family Potyviridae and

Begomovirus: CMBs of the family Geminiviridae.

16

CMBs: CMD has been assumed to be caused by a virus for many years

(Zimmermann, 1906). Storey and Nichols (1938) provided the first

epidemiological information of the virus and further grouped virus strains based

on disease severity, into mild and severe forms. Storey and Nichols (1938) further

described the mechanism of transmission and concluded that the whitefly B.

tabaci was the vector. However, CMD etiology was not clear until in the late

1970s when Bock and Guthrie (1978) described a virus that could be transmitted

by sap inoculation from CMD-infected cassava to Nicotiana clevelandii and they

named the casual agent of CMD as Cassava latent virus (CLV). Again Bock and

Woods (1983) determined the etiology of the virus and named it ACMV.

Serological methods with a panel of 17 antibodies (MAbs) to ACMV were used

on Geminiviruses to determine the epitope profiles of a number of geminivirus

strains from cassava and considerable differences were identified (Hong et al.,

1993). ACMV reacted with 15 monoclonal antibodies and was found in Burundi,

Kenya, Uganda, Cameroon, Chad and South Africa (Swanson and Harrison,

1994) while EACMV reacted with nine monoclonal antibodies and was found in

Madagascar, Malawi, Zimbabwe, Kenya and Tanzania (Swanson and Harrison,

1994). EACMV was also reported in Cameroon (Fondong et al., 2000), where it

was previously thought not to occur. Indian cassava mosaic virus occurred in

India and Sri Lanka, and reacted with only three monoclonal antibodies (Swanson

and Harrison, 1994).

Further, molecular approaches to the study of CMBs has led to identification of

more viruses such as South African cassava mosaic virus (SACMV), (Berrie et

al., 1998), the Uganda variant of EACMV known as EACMV-UG, which is a

recombinant virus with most of the coat protein gene of ACMV inserted in an

EACMV-like DNA-A component (Zhou et al., 1997). EACMV-UG variants have

been isolated in Uganda and were described EACMV-UG1, EACMV-UG2 and

EACMV-UG3 (Pita et al., 2001). Other examples of recombination in CMBs

include; East African cassava mosaic Zanzibar virus (EACMZV) (Maruthi et al.,

2002), and East African cassava mosaic Malawi virus (EACMMV) (Zhou et al.,

1998). Although CMBs are important in all cassava growing regions of Africa,

CBSV is now the most economically important virus of cassava in East Africa.

17

CBSVs: Despite Storey’s (1936; 1939) assumption that the infectious agent of

CBSD is likely to be a virus, there has been some uncertainty in the past over the

virus responsible for the disease. Storey’s speculation was supported by Kitajima

and Costa, (1964) who described elongate virus-like particles that were detected

in CBSD-infected samples using an electron microscope. Lennon et al. (1986)

reported the isolation of elongate filamentous particles 650-690 nm long (Figure

2.1a) from CBSD-infected samples of N. benthamiana and concluded that CBSD-

infected plants were infected with a novel virus or a complex of two dissimilar

viruses. However, Karamagioli (1994) disagreed with Lennon et al. (1986)

opinions because results from the reverse transcription polymerase chain reaction

(RT-PCR) using primers specific to Carlavirus and Potyvirus, failed to produce

amplified products from cassava leaves infected with CBSD.

The particle length of 650 nm was morphologically similar to carlaviruses, hence

the suggestion that CBSV belonged to the genus Carlavirus. Further work on

affected plants led to more conflicting conclusion that CBSD is caused by two

virus complex of a Carlavirus and a Potyvirus (Brunt et al., 1996). Again western

analysis with an antiserum using Cowpea mild mottle virus and CBSV material

was reported to have confirmed a serological relationship between these viruses

(Brunt, 1996). This caused confusion in assigning the actual genus and family to

which CBSV belongs. A more advanced work by Harrison et al., (1995), later

highlighted the presence of ‘pin-wheel’ inclusions typical of potyviruses in

CBSD-affected plants. The result of this finding that potyviruses could be

involved due to pin-wheel inclusions was later supported by Lecoq et al. (2000).

The molecular approach to the study of CBSV begun with partial virus

purification from CBSD-infected cassava material collected from Tanzania

(Monger et al., 2001a). Total RNA was extracted from these purifications and

converted to double-stranded cDNA, which were amplified using the polymerase

chain reaction (PCR) (Legg and Thresh, 2003). The 3´ terminal region of the

genome of CBSV was sequenced, including the coat protein (CP) (Monger et al.,

2001b). Findings of this experiment identified CBSV as a member of the genus

Ipomovirus and provided no evidence that a Carlavirus was involved. Other

ipomoviruses includes; Sweet potato mild mottle virus (SPMMV), Cucumber vein

yellowing virus (CVYV) and Squash vein yellowing virus (SqVYV) (Adams et al,

18

2005, Lecoq et al., 2000). The full genome size of CBSV is reportedly 9,100 bp

(Mbanzibwa et al., 2009; Winter et al., 2010). In comparison the partial CP

sequences of CBSV revealed close identity with SPMMV in which the genome

size is 10,800 bp (Colinet et al., 1996; 1998), CVYV, with genome size as 9,700

bp (Lecoq et al., 2000; Janssen et al., 2005) and SqVYV, with genome size as

9,800 bp (Weimin et al., 2008; Li et al., 2008). Recent studies have confirmed the

occurrence of a new viral species of the virus which was detected in higher

altitude areas in Uganda (Alicai et al., 2007; Mbanzibwa et al., 2009 Monger et

al., 2010; Winter et al., 2010), which is now referred to as Ugandan cassava

brown streak virus (UCBSV) (ICTV, 2010).

The unique features of both CBSV and UCBSV are; (a) they both contain a

single-stranded (+) ssRNA genome structure, (b) one of the proteins (HAMlh)

they encoded is homologous, (c) they both contain a single P1 proteinase and (d)

are both lacking the helper component proteinase (HCpro) at the N-proximal part

of the poly-protein (Mbanzibwa et al., 2009; ICTV, 2010). The differences

between CBSD-associated viruses are found only in the sizes of their genome and

poly-protein structures (Mbanzibwa et al., 2009; Winter et al., 2010). The

genome structure of CBSV (9069-9070 nt) is longer than that of UCBSV (8995-

9008 nt) and both encodes a polyprotein of 2912-2916 and 2901-2902 aa

respectively (Mbanzibwa et al., 2011). The current view on CBSV and UCBSV

genome (Figure 2.1b) (Mbanzibwa et al., 2009; Winter et al., 2010) suggests a

deviation from the earlier report that the genome structure for Potyviridae is

conserved throughout the family (Adams, 2008). Deviation from the viral

Potyviridae genome has also been reported in other ipomoviruses such as CVYV

(Lecoq et al., 2000) and SqVYV (Weimin et al., 2008).

Figuet aThepoly

2.2.

List

plan

back

con

CBS

tran

that

by t

But

usin

faile

the

Cas

be f

indi

natu

diff

(Ca

Fiel

betw

(Hil

was

cass

ure 2.1: Paal. (1986) ae boxes seyprotein.

.2 CBSV tr

ter (1959) r

nts from ca

k transmitt

nfirmed the

SV is perpe

nsmission an

t CBSD was

then B. taba

t an attempt

ng the aphid

ed (Storey,

vector. De

ssava clones

free from C

icated to H

urally. More

ferent sites

alvert and Th

ld observat

ween the in

llocks et al.

s achieved

sava and vir

rticle morphand their geeparated by

ansmission

reported suc

assava infec

ed to susce

Lister (195

etuated in t

nd graft-tra

s caused by

aci was alre

t to prove t

d Myzus per

1947; Lenn

spite the fa

s introduced

CBSD, how

Hillocks and

eover, cassa

in Mozam

hresh, 2002

ions in Tan

ncidences a

, 1999). Th

in a glassh

rus-free cas

hology of Cenome strucy lines ind

n

ccessful sap

cted leaves

eptible cass

59) findings

three ways;

ansmission

y a virus wh

eady establi

this by Boc

rsicae, five

non et al.,

ailure, spec

d from othe

wever, becam

d Jennings

ava plants o

mbique, Ke

2).

nzania duri

and spread

he first recor

house and

ssava plants

19

CBSV and Ucture (b) fordicate the

p transmiss

and isolate

sava after s

s on sap tra

by plantin

(Storey, 19

hose vector

ished as the

ck (1994) w

e other spec

1986), whic

culation on

r areas of A

me infected

(2003) that

obtained from

enya and

ing the 199

of CBSD a

rded succes

insectaries

s (Maruthi e

UCBSV (a)rmat adopteputative c

ion of CBS

es from infe

several trial

ansmission

g infected c

936). Storey

was likely t

e vector of c

was not suc

ies of aphid

ch created s

whitefly in

Africa or Sou

d in CBSD

t the virus

m Africa an

Tanzania a

90s indicate

and whitefl

sful vector

at NRI be

et al., 2005

) adopted fred from ICcleavage si

SV to herba

ected host p

ls. Bock et

of CBSV.

cuttings, by

y (1939) ea

to be white

cassava gem

ccessful. Tr

ds and mea

some uncer

nvolvement

outh Americ

endemic a

is indeed

nd raised fro

also becam

ed a close

fly populatio

transmissio

etween CBS

), although

om LennonTV (2010).ites of the

aceous host

plants were

t al. (1978)

In the field

y whiteflies

arlier stated

fly because

miniviruses.

ransmission

lybugs also

rtainty over

continued.

ca known to

areas which

transmitted

om seeds at

me infected

association

on changes

on of CBSV

SV-infected

at low rate

n . e

t

e

)

d

s

d

e

.

n

o

r

.

o

h

d

t

d

n

s

V

d

e

20

(22%). Maruthi et al (2005) further pointed out that the feeding behaviour of B.

tabaci on cassava plant may influence CBSV transmission and that B. afer and

the spiralling whitefly (Aleurodicus dispersus) Russel might also transmit CBSV

under suitable conditions. This was later confirmed by Mware et al. (2009).

2.2.3 CBSD symptoms

The first description of CBSD symptoms was by Storey (1936). CBSD symptoms

are unusual in that they affect all parts of the plant; stems, leaves storage roots

and fruits (Hillocks et al., 1999). On the stem during periods of dry cool weather,

the disease can cause shoot die back and necrotic lesions. CBSD symptoms are

expressed as brown lesions, which appear on the young green stem, and these

were first regarded as the most conspicuous symptom of the disease. However,

Hillocks et al. (1996) noted that this symptom is not the only prominent symptom

and it is often absent. Nichols (1950) distinguished foliar chlorosis symptom

associated with CBSD at Amani in northern Tanzania and presented a more

comprehensive description of the disease. Plants may be infected with CBSD but

disease incidence and severity depends on the environmental condition, growth

stage of the plant, time of infection and varietal sensitivity (Hillocks, 1997).

CBSD symptoms can be masked by CMD symptoms particularly where both

diseases and green mite attack plants. Both CMD and CBSD show foliar chlorotic

symptom but unlike CMD, in which symptom expression occurs on young leaves,

CBSD symptoms show varying patterns of chlorosis on the old leaves (Figure

2.1a) and do not cause distortion on the lamina (Hillocks, 1997).

Leaf symptoms: In his work, Nichols (1950) described certain types of foliar

chlorosis associated with CBSD and these were further explained by Hillocks

(1997); (1) a leaf chlorosis which starts along the margins of secondary veins

expanding to the tertiary veins and finally produces chlorotic blotches. (2) A

chlorosis which develops in roughly circular patches between the main veins and

may affect much of the lamina. This type is the most common in which smaller

leaves of the severely affected plants present a striking appearance in contrast to

the fully green young leaves (Hillocks and Thresh, 1998). Disease symptoms are

not present on newly formed foliage during hot seasons (Hillocks, 1997).

21

Stem symptoms: Stem symptoms may not always be associated with CBSD,

except in highly susceptible varieties (Hillocks, 1997). Purple/brown lesions may

be observed on the outer-surface which is seen to have penetrated into the cortex.

When the outer bark is stripped, the necrotic lesions in the leaf scars became

prominent after leaves shedding due to normal senescence. In severe infections,

these lesions kill the dormant auxiliary buds. This is followed by general

shrinkage of node and death of internode tissue leading to branch necrosis from

the tip downwards, to cause what is known as ‘die back’ (Figure 2.1b).

Root symptoms: Symptoms vary on the outside of the storage root and may

occur as radial constrictions in the surface bark. Tissue surrounding this

constriction is stained brown or black under which the cortex is necrotic. The

internal symptoms consist of yellow/brown, corky necrosis of the roots or with

black streaks (Hillocks et al., 1996). In sensitive varieties, almost the whole of the

roots may be affected (Figure 2.1c). In advanced stages, the presence of

secondary organisms, decay and soft rot may occur. Symptoms on roots usually

develop after leaf symptoms and the latent period of root necrosis is variety

specific. Root symptoms occurred eight months after planting (MAP) in certain

varieties, despite the earlier presence of symptoms on leaves (Hillocks et al.,

1996). In susceptible varieties, where CBSD-infected cuttings were used as

planting materials, root symptoms were observed 5-7 MAP (Hillocks, 2003).

In a survey conducted by Legg et al. (1994) only the leaf and stem (Figure 2.1d)

symptoms but not the root symptoms were seen (Jennings 1960b; Thresh et al.,

1994). Hillocks (1997) noted that there may be recovery from leaf and shoot

symptoms during the active period of plant growth. Studies in Tanzania showed

that greater than 90% of the susceptible varieties obtained from diseased stems

showed leaf symptom at the time of sprouting, while many of the same plants 12-

59% (depending on the varieties) expressed root symptoms during harvest

(Hillocks et al., 2001).

Figusymlesio

2.2.

The

by

spec

Aleu

wid

1-3

feed

incl

vect

199

estim

(Ma

that

ure 2.2: Cmptoms, (b)

on on the st

.4 The whit

e whitefly, B

sucking jui

cies of whi

uordicinae

despread) (K

mm in len

ding rostrum

luding host

tor may lik

92; Brown e

mated by co

aruthi et al.

t an adult fe

CBSD sym plant diebtem. Photos

tefly vector

B. tabaci, is

ices from p

iteflies (Ma

(mostly f

Ko, 2001) of

ngth, have

m and anten

preference

kely influen

et al., 1995

ounting the

, 2005); wh

emale B. tab

mptoms in back, (c) stos adopted fro

r, Bemisia t

s an insect

plant leaves

artin et al.,

found in

f the family

four wing

nnae (Martin

e, host rang

nce vector-h

5; Maruthi e

number of

hile surviva

baci lived o

22

different porage root om (R.J. Hi

tabaci

pest whose

s and stems

, 2000), wh

South Am

y Aleyrodida

s are seven

n et al., 200

ge, fecundity

host interac

et al., 2005

eggs ovipo

al or longev

on a plant (P

parts of casymptoms

illocks).

larvae and

s. There are

hich are un

merica) and

ae. Adult w

n segments

00). Biotic v

y and dispe

ctions in ca

5). Fecundit

sited by the

vity is the m

Perring, 200

assava planand (d) br

d adults obta

re approxim

nder two s

d Aleyrodi

whiteflies me

, fully mob

variations o

ersal behav

assava (Bur

ty of B. tab

e female eve

maximum ti

01). Whitefl

nt (a) leafrown streak

ain nutrient

mately 1500

ub-families

nae (more

easure from

bile with a

of whiteflies

viour of the

rban et al.,

baci can be

ery 48 hour

ime in days

lies damage

f k

t

0

s

e

m

a

s

e

,

e

r

s

e

23

crop plants in four ways: mechanical damage through feeding, secretion of

honeydew, physiological disorders (Martin et al., 2000) and transmission of

viruses (Maruthi et al., 2005; Mware et al., 2009). In addition, virus diseases

associated with whiteflies were also reported in non-crop plants in the tropical

and non-tropical agro-ecosystems (Verma, 1963; Bock, 1982).

Most plant viruses depend on vectors for plant-to-plant spread (Ng and Falk,

2006). Over 80% of plant viruses depend on insects for transmission (Holn,

2007). The piercing-sucking mouth parts of insects such as aphids, whitefly and

leafhoppers facilitate efficient extraction of plant sap as well as transmission of

plant viruses. Crop plants typically infected by whitefly-transmitted viruses in

Eastern Hemisphere are cassava, brassicas, tobacco, tomato, legumes (Vigna and

Phaseolus) species (Muniyappa, 1980; Mound, 1983); in the Western

Hemisphere are bean (Phaseolus vulgaris), cotton, soybean and tobacco (Bird,

1978; Brown, 1990; Polston, 1997; Paximadis et al., 1999).

About 144 plant viruses are transmitted by whiteflies, of which B. tabaci

transmits 111 and 33 by two other species of whiteflies; Trialeurodes

vaporariorum and T. abutilonia (Jones, 2004). B. tabaci is polyphagous feeding

on over 500 species of plants (Brown et al., 1995) and thus has the potential to

transmit viruses to a wide range of host-plants. About 90% of the whitefly

transmitted virus species belong to the genus Begomovirus, 6% Crinivirus and

4% belong to the remaining genera in the Closterovirus and Ipomovirus (Jones,

2004).

2.2.5 Virus-vector interactions

CMVs and CBSVs are the most damaging whitefly transmitted viruses of cassava

in Africa (Bock, 1982; Legg et al., 1994; Maruthi et al., 2005; Mware et al.,

2009). Earlier studies have shown that B. tabaci vector variants differ in ability to

transmit certain viruses and transmission can be more or less effective (Bird,

1957). It was earlier believed that B. tabaci does not adapt well to elevation above

1000 m a.s.l. (Morales and Aderson, 2001), and thus believed to be outside the

zone of CBSD. However, plenty of whiteflies were observed recently in the

CBSD epidemic areas of Uganda and Lake Victoria at altitudes at least up to

24

1300 m a.s.l and 1100 m a.s.l., respectively (Legg et al., 2011). In addition, B.

tabaci is widely adapted in a region extending from more than 30 oS and 40 oN

and this limit does not relate to temperature which seems to vary widely over the

altitude range (Mware et al., 2009).

The interactions between virus and vector during transmission are very specific

(Ng and Falk, 2006). This interaction is believed to be mediated through capsid

and helper components of certain viruses (Pirone and Thornbury, 1988; Ammar et

al., 1994). Early studies on virus transmission by vectors (Watson and Roberts,

1939) indicated the requirement for optimum times for the virus-vector

interaction to occur. The acquisition access period (AAP) and the inoculation

access period (IAP) required for the interactions have led to three different

categories of vector-transmitted viruses (Ng and Falk, 2006).

a) Non persistent, stylet-borne (occurs within few minutes to hours of feeding), b)

semi-persistent, foregut-borne (hours to days) and c) persistent, circulative (days

to months or even years). In addition a ‘propagative’ form of virus transmission,

in which the virus passes to the vector’s progeny, was also described as the fourth

category (Nault, 1997).

The preference of B. tabaci for cassava to other field crops in the hot-humid

tropics makes it an ideal vector for the viruses infecting cassava such as UCBSV

and CBSV. The assumed mode of CBSV transmission to cassava is similar to that

described by Pirone (1981) in which the virus is retained in the foregut of B.

tabaci and later introduced into new plants by an ejection-ingestion mechanism

(semi-persistent). It involves continuous feeding by the whitefly upon phloem to

acquire the virus, such that the virus remains in the vector for up to a few days.

The interaction between CBSV and B. tabaci is semi-persistent. Maruthi et al.,

(2005) reported a 48 h each for AAP and IAP for successful CBSV-transmission.

The semi-persistent interaction between B. tabaci and a virus was also reported in

CVYV (Harpaz and Cohen, 1965), a close relative of CBSV. Specific studies on

CBSV describing the nature of interaction with B. tabaci are lacking. However,

the involvement of the capsid protein (CP) as reported in vector-based

transmission of CVYV (Janssen et al., 2005) could be characteristics of CBSV.

25

2.2.6 Economic losses due to CBSD

CBSD causes up to 70% losses in root weight in some sensitive varieties

(Hillocks et al., 2001). The poor quality of the tuberous roots resulted in a greater

loss of economic yield (Nichols, 1950). The extent of weight loss was dependent

on the earliness of maturity of the tubers and the relative susceptibility of the

varieties to the virus (Hillocks and Jennings, 2003). The success in overcoming

the CMD pandemic that ravaged Uganda in the 1990s is somewhat overshadowed

because many varieties resistant to CMD are now found susceptible to CBSD.

Alicai et al. (2007) reported that in Mukono district of Uganda, one out of four

farmers’ field planted with cassava variety 92/0057, which is known to be

resistant to CMD showed symptoms of CBSD. The impact of CBSD is said to

affect 20 million people in rural communities in the areas where the disease is

endemic (Legg and Hillocks, 2003; Hillocks, 2005). Hunger and the lost

household income have left many families in total dilemma (Pearce, 2007).

CBSD has turned the long-term chronic food shortage in Malawi and

Mozambique into an acute one (Shaba et al., 2003; Steel, 2003). In Malawi,

farmers adopted early harvesting and selective harvesting to minimize the impact

of CBSD on yield loss (Hillocks et al., 2001; Gondwe et al., 2003), implying a

great challenge to the quality of cassava as a food reserve. The likely negative

impact of these harvesting methods is that the diseased plants left in the field

become the pool for next season’s planting material. Stem necrosis decreases the

viability of cuttings, leading to low plant populations.

In southern Tanzania, CBSD is reported to render 20 to 80% of roots unusable for

human consumption (Katinila et al., 2003). Gondwe et al. (2003) and Shaba et al.

(2003) also reported a yield loss of 18 to 60% in Malawi. CBSD caused huge

economic losses in these areas. For example, the annual yield loss caused by

CBSD in Malawi was estimated to be over 1.4 million tonnes of cassava, which

translates to US $7 million (Gondwe et al., 2003). For CMD, loss assessment has

been fully documented and total cassava losses due to CMD in Uganda were

estimated to be about 24% (Gibson et al., 1996; Pita et al., 2001; Legg and

Thresh, 2003). Under favourable conditions, CBSD was said to cause total loss of

the cassava crop which CMD rarely does (Legg et al., 2011). The first recognized

effect of CBSD was on the development of cuttings, because the disease destroys

26

many of the buds and infected cuttings often fail to produce shoots (Storey,

1938). In experimental plots at Mvuazi, DRC, high incidences of leaf symptoms

and root necrosis of up to 100% were recorded (Mahungu et al., 2003).

Areas ravaged by CBSD in Mozambique have experienced food insecurity

(McSween et al., 2006). Up to 100% yield loss was recorded in Mozambique due

to the impact of CBSD (Hillocks, 2005). This posed a serious threat to the

livelihood of people living in this area. For instance Mogincual District in

Mozambique, where a variety called Calamidade was grown and farmers

obtained nothing but a mass of rotting tuber tissue due to root necrosis caused by

CBSD (McSween et al., 2006). The threats posed by CBSD forced poor farmers

to harvest cassava before reaching full yield potential and discourage the storage

ability of the crop in the field for long (Hillocks and Jennings, 2003). Yield losses

of up to 60% from CBSD root necrosis were estimated in Masasi District of

Mtwara Region in Tanzania (Kanju, 1989).

A moderate infection by CBSD (10-30% damage to root surface area) decreases

the market value drastically by 90%, fetching under $5 per tonne, as opposed to

US $55 for fresh healthy cassava root. A severe disease completely destroys roots

and makes them unfit for market or even own consumption by farm family

(McSween et al., 2006). Current estimates indicate that CBSD causes economic

losses of up to $100 million annually to African farmers (IITA, 2005). Root

necrosis, constriction and pitting cause primary yield losses, while secondary

losses arise from the reduced number of roots due to CBSD (Gondwe et al., 2003;

Hillocks et al., 2001; Kanju et al., 2003a).

2.2.7 Control methods

Attempts to understand and provide adequate control measures to virus diseases

of cassava, through selection and use of resistant cassava cultivars date back to

1927 (Storey, 1938). Hillocks (2002) in Tanzania advocated screening of local

landraces as a rapid way of obtaining locally adapted varieties with resistance to

CBSD. Sanitation techniques could be used which include taking cuttings from

healthy plants only and subsequently removing any plant which is diseased

(roguing), as well as cultural practices (Kanju et al., 2003a). Cultural practices

27

such as good farm hygiene and removal of weeds around cassava farm could be

recommended in the control and management of whitefly since many weed

species are hosts to whitefly. However, sanitation has its own limitations in that

the disease free material selected is no more resistant than its parent stock, re-

infection may also occur in areas of greater disease pressure and the excessive

rouging will result in a limited crop stand (Bock, 1983 and Fargette et al., 1985).

The effectiveness of sanitation depends on the inoculum pressure. Hillocks

(2002) suggested disease incidence of below 20% for roguing to be effective. It

was also believed that sanitation has an important role in the development of an

integrated strategy for the control of CBSD (Legg and Thresh, 2003). In Uganda,

roguing has been used to eradicate CBSD in the past (Jameson, 1964). In

addition, Mtunda et al. (1998) reported the use of roguing in Tanzania to produce

breeding stocks from cassava plants initially showing symptoms of CBSD.

However, these measures are not fully implemented for various reasons itemised

by Hillocks (2003): 1) Farmers have difficulty in recognising CBSD symptoms

due to variability in symptom expression. 2) Planting material is taken at different

times of the year and often it is in scanty supply, limiting the ability to select

disease-free material. 3) Farmers are reluctant to rogue since roguing lowers plant

density, thereby resulting in less yield (Kanju et al., 2003b).

In East Africa, selection for increased resistance was seen as an option (Storey,

1936) although resistance is lacking for CBSD. Emphasis was given to the need

to transfer resistance to cassava from related species such as Manihot glaziovii

Muell-Arg., M. catingae Ule, and M. dichotoma Ule (Hillocks, 2003). The recent

trend in the selection for resistance employed farmer participatory selection as a

key to development of new varieties that are resistant to CBSD (Kanju et al.,

2003a). The following varieties tolerant to CBSD were identified in Tanzania:

Nachinyaya, Kiroba, Kigoma Red, Namikonga, Kitumbua, Kalulu, Kikumbe,

UKG 93/041, TMS 8475, TMS 82/0061 and Naliendele 34 in Mozambique,

Nikwaha, Mulaleia, Chigoma Mafia, Mwento, Waloya, Binte Massuea, MZ89001

and MZ89186, in Malawi, Gomani, Kirobeka, Nyankwazi, CH95/196, CH95/102,

BA95/070 and MK96/054 (Hillocks, 2006). Resistance in some of these earlier

28

selections was reported to be broken down subsequently (R.J. Hillocks, personal

communication, 2010).

Recent studies have associated the increase in whitefly populations with greater

incidences of CBSD in Uganda (Alicai et al., 2007), Tanzania (Robertson, 1987;

Hillocks and Jennings, 2003; Maruthi et al., 2005) and Malawi (Legg and Raya,

1997). Severe CMD pandemic that spread from Uganda to neighbouring

countries since the 1988 was also linked to greater population of B. tabaci (Deng

et al., 1997; Legg, 1994; Otim-Nape et al., 2001). There were concerns that the

large whitefly numbers that have persisted on selected cassava varieties in

Tanzania such as Naliendele 34 may affect the stability of resistance to CBSD.

Little attention is given to control CMD or CBSD by managing whitefly vector as

has been the case for other virus diseases, such as cotton leaf curl virus and

tomato yellow leaf curl virus which targeted both the viruses and the vector B.

tabaci (Rapisarda and TropeaGarzia, 2002).

Chemical pesticides, biopesticides such as Bt and NPV, use of natural enemies

and physical barriers have been used to control B. tabaci on cassava in Latin

America (Belloti, 2002), but in SSA this has not been attempted for economic

reasons. It’s an expensive strategy to many resource poor farmers in Africa and

also insecticides are not readily available (Hillocks, 2002). Moreover, chemical

control is only effective where the vectors feed on a crop for several hours before

the virus is transmitted. If the virus transmission occurs with minimal feeding

time, infection is likely to occur before the vector is killed by the insecticide

(Ahmad et al., 2003). A number of insecticides have effectively controlled pests

in the past but many pests have now developed resistance.

Parasitoids could be used in biological control of whitefly. Biological control of

the vectors can be very effective but the cost of producing and releasing natural

enemies is very high (Hillocks, 1997). Seed propagation may control viral

diseases as seeds of some viral infected plants may be virus-free but this may not

be an option in some crops like cassava because of the high variability in the seed

derived progeny (Ekanayake et al., 1997). The need to put in place strict control

measures was advocated in order to check the movement of cassava germplasm

29

from one geographical location to another (Kanju et al., 2003b). Legg and Thresh

(2003) reported that Africa’s major cassava producers such as Nigeria, Ghana,

Benin and Cote d’Ivoire seem to have favourable environments for CBSD.

Therefore control of the movement of cassava cuttings from one country to

another should be strictly regulated.

Use of resistant varieties: Virus diseases cannot be chemically controlled the

way some fungal or bacterial diseases are (Hillocks, 2002). Therefore, strategies

for viral disease control focus on preventive measures, provided such measures

are simple, inexpensive and within the limited capacity of the farmers. This can

be achieved in diverse ways which include quarantine measures, early harvesting,

use of resistant varieties and use of virus-free planting material.

Strict quarantine measures are effective in disease free areas (Legg and Thresh,

2003). Early harvesting of cassava was practiced by farmers in Mozambique and

Tanzania to avoid CBSD from destroying the roots (Hillocks et al., 2002).

However, this strategy threatens the role of cassava as a famine reserve crop as it

cannot be left in the field as a food reserve (Kanju et al., 2003). The use of

resistant varieties is recommended for managing CBSD (Storey, 1939; Hillocks

and Jennings, 2003), especially where the disease pressure is high (Hillocks and

Thresh, 2003). For example, Nanchinyaya, Namikonga and Kiroba in Tanzania,

which were the local tolerant varieties identified and recommended to farmers

(Hillocks et al., 2001; 2003; 2005; 2006; Kanju et al., 2003a).

Resistant varieties have obvious advantages in decreasing the losses due to viral

diseases (Nichols, 1947). Resistant cultivars can be developed through

conventional breeding programmes or through transformation with resistance

genes (Okogbenin et al., 2007; Takeshima, 2010). Resistance genes for CBSD

can be transferred from cassava related species, such as, M. glaziovii, M.

dichotoma, M. catingae and ‘tree’ cassava, believed to be a natural hybrid

between M. esculenta and M. glaziovii (Nichols, 1947; Jennings, 1957; Allem,

2002). A few cassava cultivars such as Macaxiera Alpin are resistant to CBSD

(Jennings, 1957). Another two shrub-like species M. saxicola and M. melanobasis

30

are also highly resistant to CBSD but their roots contain high concentration of

hydrocyanic acid (Jennings, 1957).

A limitation with conventional breeding for resistance to CBSD is that it is

laborious and requires much time. Each generation takes not less than three years

and a series of backcrosses are needed to remove the undesirable characteristics

such as tree like characteristics and high cyanide level while retaining resistance

to CBSD (Jennings, 1957). Another limitation is that crops are usually infected by

several distinct viruses (Mukasa et al., 2003) and this might require several

separate gene incorporations.

Reversion in cassava varieties: Reversion was first reported for virus infection

in the 1930s when symptomatic cassava varieties infected with ACMV sprouted

without CMD symptoms (Storey and Nichols, 1938). Since then a number of

researchers have observed and confirmed reversion (Gibson and Otim-Nape,

1997; Fondong et al., 2000). In addition varietal differences have also been

reported to influence reversion in cassava plants (Jennings, 1960b; Rossel et al.,

1992; Thresh et al., 1994; Fargette et al., 1996; Gibson and Otim-Nape, 1997).

Use of virus-free planting material: Viruses can be transferred between

generations in crops which have seed-borne virus diseases or which are

vegetatively propagated, such as cassava (Mtunda et al., 1998). In the absence of

resistant cultivars, the benefits of selecting virus-free stems when replanting

cannot be overlooked towards the control of viral diseases. Currently there are no

cultivars resistant to CBSD and many cultivars such as TME 14, TME 204,

NASE 10, NASE 12, I95/0087 and I92/0057 have been bred and selected for

yield, quality and resistance to CMD but are highly susceptible to CBSD (Alicai

et al., 2007). In such a situation, use of virus-free planting material remains a

hopeful alternative.

The major drawbacks with selecting virus-free material are; (1) possibility of re-

infection and the difficulty that farmers, extension workers or even researchers

can face in correctly identifying virus-free planting material by visually looking

at the symptoms (Hillocks, 1997). CBSD foliar symptoms are often not clear and

31

normally occur only on mature leaves. The young expanding leaves commonly

appear symptomless (Hillocks et al., 1999). Several diagnostic and virus

elimination techniques are now available for testing and free planting material

from viruses/diseases. Virus-free planting materials are of little value in areas of

high CBSD incidence, because provided whitefly numbers are sufficient, re-

infection from the surrounding cassava will be rapid.

2.2.8 Plant infectivity assays

Different plants vary in their susceptibility to viruses and in their ability to show

clear and distinctive symptoms after infection with different viruses. Those which

show clear symptoms are known as indicator plants (Lister, 1959). The choice of

indicator plants depends on the virus and species, those commonly used include

Chenopodium quinoa, C. amaranticolor, Gomphrena globosa, Ipomoea setosa,

Phaseolus vulgaris and Nicotiana species. For CBSV, Petunia hybrida, Nicotiana

debneyi, N. benthamiana, N. tabacum and N glutinosa (Lister, 1959). The optimal

stage of growth at which the indicator plant is used also varies depending on

indicator plant species. Most Nicotiana species are used at the four leaf stage. The

leaves of beans are very sensitive to some viruses whilst plants like Chenopodium

can be used up to the ten leaf stage (Bock, 1994).

Several methods for inoculating plants are available which include grafting, use

of dodder plants, use of vector and sap inoculation (Boissot et al., 2008). Since

viruses systemically infect their hosts, they can be inoculated through graft unions

between diseased and healthy plants by allowing vascular union between stock

and scion (Idris et al., 2001). Graft inoculation has been used for inoculating

Yellow vein mosaic virus in okra (Abelmoschus esculentus) (Boissot et al., 2008)

and ACMV and CBSV in cassava (Ogbe et al., 2002). Although graft-inoculation

may be limited to plants that are closely related, plants like solanaceous species of

tobacco, tomato, potato and thorn apple are also graft compatible (Akhtar et al.,

2003). With sap inoculation, virus suspension in sap from infected plants is

introduced into healthy indicator plants. Purified virus preparation is preferred

although inoculation can usually be achieved with crude sap (Mumford et al.,

2006; Boissot et al., 2008; Ogwok et al., 2010). Inoculum can be applied in

various ways, for example by stroking the plants with a virus contaminated

32

finger, piece of muslin, soft brush or by a spray gun which injects inoculum

deeply into the tissues of the host plant.

The rubbing method involves using an abrasive such as carborundum or celite to

produce entry wounds on the leaves of indicator plants (Mumford et al., 2006).

The abrasive is either added to the homogenized tissue of infected plants or can

be blown onto leaves of indicator plants before inoculation (Lister, 1959).

Susceptible indicator plants may react by forming localized lesions on the

inoculated leaves which normally appear in 4-7 days or by showing systemic

symptoms on the youngest leaves in a week or more (Lister, 1959). The period

before symptoms appear on indicator plants can be influenced by the amount of

inoculum applied and the temperature (Lister, 1959; Ogwok et al., 2010). It is

therefore important that the plants be kept long enough to allow the symptoms to

appear. The limitation with plant infectivity technique is that it requires more

time to perform than the serological assays.

2.2.9 Electron microscopy

Because of their small size, all virus particles can only be visualised using an

electron microscope (MacRae and Mukesh, 1998). Elongated virus particles such

as CBSV which are flexuous rods and other rod shaped or filamentous were more

readily distinguished than spherical ones (Kitajima and Costa, 1964; MacRae and

Mukesh, 1998). However, this technique is only reliable if relatively high

concentrations of viruses are present (MacRae and Mukesh, 1998).

2.2.10 Enzyme linked immunosorbent assay

Enzyme immonosorbent assay (ELISA) is very sensitive as it can be used to

detect as little as 11 ng of virus. ELISA is suited to testing large number of

samples and can be use for quantifying the virus as well (Hammond et al., 1992).

Different types of ELISA are available depending on the number of antibodies

used during the reaction (Abouzid et al., 2002). By using different antibodies, it is

possible to test plants for different viruses (James et al., 2006). However,

antibodies that can detect some viruses such as CMV and CBSV are readily

available but antibodies for the detection of some viruses like SPLCV are not yet

33

developed. ELISA is less sensitive than PCR especially if the virus titre in the

sample is low (Hu, 1995).

2.2.11 PCR-based detection of viruses

PCR detection techniques are highly sensitive and for CBSV, RT-PCR technique

can detect the virus in young leaves of cassava that are not yet showing symptoms

(Abarshi et al., 2010). PCR techniques, however, require that the sequence of the

viral genome is known and two small sections of 20 or less nucleotide bases are

chosen and used to produce the primers (Gibbs and Mackenzie, 1997). Some

primers can be designed using regions of the viral genome which are conserved

among viruses of one group and these can be used to detect more than one virus

within the group (Chen and Adams, 2001). The use of reverse-transcription

quantitative PCR (RT-qPCR) has revolutionized PCR based detection of viruses.

The technique is more efficient (90% detection by RT-qPCR versus 45%

detection by conventional RT-PCR) (Kokkinos and Clark 2006). Despite this,

RT-qPCR equipment is not commonly available in Africa and requires expensive

consumables.

Use of RT-PCR for the detection of UCBSV and CBSV: The molecular

technique for CBSV and UCBSV detection using RT-PCR was first developed by

Monger et al., (2001a). Using CBSV gene-specific primers, the virus was isolated

from infected cassava samples and sequenced. Using this technique, possible

occurrence of two CBSV strains was described (Monger et al., 2001b). The

robustness and high sensitivity of the RT-PCR technique has promoted its wide

use. In East Africa, the technique was used effectively to detect and confirm the

presence of CBSV in infected plants (Alicai et al., 2007). Since CBSD symptoms

are often unclear RT-PCR based detection can be used to ensure that starting

material for cutting multiplication schemes is virus-free. To achieve this,

systematic virus-testings are recommended especially for experimental purposes

and primary multiplication sites (Abarshi et al., 2010). Detection of both CBSV

and UCBSV in a single RT-PCR was first described by Abarshi et al. (2010). In

Uganda, a new technique was developed and used for the detection and

discrimination of the two viruses by a single RT-PCR test and this can be used to

34

study for mixed infections of UCBSV and CBSV in East Africa (Mbanzibwa et

al., 2011).

2.2.12 Virus elimination techniques

Several methods are employed to eliminate viruses from propagation material.

These include electrotherapy, chemotherapy, thermotherapy, cryopreservation

and tissue culture methods. However, virus elimination is an extremely

pathogen/host dependant process and no generalizations can be made (Lizarraga

et al., 1980). In vitro micro propagation of cassava has been achieved in several

studies.

In a study conducted by Korean (2003) it was observed that adventitious roots

and shoots from the explants of cassava differentiated more efficiently in liquid

medium than in solid medium (Kaiser and Teemba, 1989). Root formation was

inhibited by callus forming on the cut-end of the node cuttings on medium with

zeatin at high concentrations (Ezeibekwe et al., 2009). On the other hand, root

formation was not inhibited in a medium supplemented with NAA and kinetin at

low concentration (Encina et al., 2001). In vitro thermotherapy has been

successfully used for virus elimination in several crops. Leonhard et al. (1998)

reported successful eradication of virus from Australian grape vine varieties.

Thermotherapy has also been a successful method for eliminating several viruses

in sweet potato, potato and cassava (Kaiser and Teemba, 1989; Griffiths et al.,

1990; Meybodi et al., 2011). Heat therapy of cassava for eliminating CMBs was

achieved in vitro at 37oC for 6 weeks under a regime of 16 h light and 8 h dark

(Kaiser and Teemba, 1989). Walkey (1976) also observed complete eradication of

Cucumber mosaic virus (CMV) from Nicotiana rustica when cultures were kept

continuously at 32oC for 25 days under a 16 h light and 8 h dark period.

Inactivation of CMV in cultured N. rustica by alternating diurnal periods, 40 oC

for 16 h of light and 22 oC for 8 h of darkness for 12 days was later proposed by

Walkey and Freeman (1977).

Thermotherapy for the elimination of CBSV from cassava was carried out

directly on fully grown in vitro cassava plantlets (Wasswa et al., 2010). The

success of elimination of viruses depends on the type of plant viruses, the hosts

35

(varieties) and if the plant is single or mixed infected (Zapata et al., 1995).

Temperature and time of exposure may be complicated by heat tolerance of the

cassava varieties. It is therefore, important to select a temperature regime which is

above the optimum for growth, but not lethal to the plant.

Another method used for virus eradication is chemotherapy. The incorporation of

ribavirin (1-ß-ribofuranosyl-1, 2, 4-triazole-3-carboxamide), which is an anti-

metabolite chemical; in the tissue culture medium has been studied (Cassells and

Long, 1982; Klein and Livingston, 1982; Nascimento et al 2003; Mahfouze et al.,

2010). Ribavirin has been shown to have some activity against virus replication in

humans (Sarver and Stollar, 1978) and plants (Walkey, 1985). Some virus-free

plants from CMV- and PVY-infected tobacco explants were regenerated using

ribavirin (Cassells and Long, 1982). The simultaneous application of

chemotherapy and thermotherapy methods has been also efficient for eliminating

viruses in potatoes (Nascimento et al 2003). However, anti-viral chemicals (such

as ribavirin) can be toxic which can inhibit host development (Sarver and Stollar,

1978; Elia et al., 2008).

2.2.13 Mechanisms of resistance to virus infection

Mechanisms of resistance to CBSV are not fully understood, although Nichols,

(1950) and Jennings (1960b) speculated that resistant cassava varieties are likely

to localise the virus in their roots. Wilson and Jones (1992) reported that the

mechanism of resistance to plant viruses involves resistance to the phloem

transport of viruses. However, resistance to viruses may involve one or all of the

following itemised mechanisms, described by Solomon-Blackburn and Baker

(2001) as follows:

1- Plants rapid defence cause by hypersensitive reaction (HR) that resulted in the

necrosis of few cells at the site of infection, preventing spread of infection to

other areas.

2- Prevention of virus multiplication at the early stages of infection called

extreme resistance (ER), but this is not normally associated with the death of

cells.

3- Plants being unattractive to vectors or resist virus infection.

36

4- Resistance to virus accumulation, where plants are infected, but the virus

accumulation is very low in the plant and restriction of virus movement from

inoculation sites to other parts of the plant.

RNA silencing: Mechanism of resistance employed by plants against the foreign

genes entering the plant is referred to as gene silencing (Waterhouse et al., 2001;

Vaucheret, 2001; Voinnet, 2001). Foreign RNAs are degraded by the

endoribonuclease Dicer into small effector molecules called siRNAs (small

interfering RNAs) (Waterhouse et al., 2001). Dicer was originally identified as a

nuclease involved in the RNA interference (RNAi) pathway of animals (Bernstein

et al., 2001). The method of siRNA is triggered by long double-stranded RNA

(dsRNA) (Fire et al., 1998). The dsRNA trigger is cleaved by Dicer into 22-nt

RNAs (Elbashir et al., 2001). The 22-nt RNAs, known as small interfering RNAs

(siRNAs), act as guide RNAs to target homologous mRNA sequences for foreign

RNAs degradation (Bernstein et al., 2001). Typically siRNAs are incorporated

into RNA-induced silencing complex (RISC) which consists of several proteins

including the Argonaute (AGO) protein (Elbashir et al., 2001). RISC is

presumably located in the RNA degradation center in the cytoplasm (Bernstein et

al., 2001). After RISC-mediated mRNA cleavage, the resulting degraded

products are further subjected to the exonucleolytic degradation (Ratcliff et al.,

1997). Threfore, plants combat virus infection by gene silencing, a general

mechanism normally used for maintaining homeostasis (Covey et al., 1997;

Ratcliff et al., 1997). On the other hand, viruses attempt to suppress host gene

silencing at an early stage of infection (Brigneti et al., 1998; Jones et al., 1998;

Kasschau and Carrington, 1998). Gene silencing is either at the post-

transcriptional level, in which the silencing mechanism targets mRNA before it is

translated into respective proteins (Hamilton and Baulcombe, 1999; Dalmay et

al., 2001) or transcriptional level (Vaucheret, 2001), in which RNA silencing is

before transcription. Here the gene is made unattainable to transcriptional

machinery by RNA silencing mechanism (Baulcombe, 1996). The silencing

system is very specific and precise, degrading only foreign and unusual mRNA,

at sites of infection, followed by a systemic signal sent to distal parts of the plant

to degrade any particles homologous to mRNA perceived by the plant to be

abnormal (Ruiz et al, 1998; Llave et al., 2002). Another pathway which seemed

37

to be similar to RNA silencing s involves the use of microRNAs (miRNA)

(Carrington and Ambros, 2003). Using these pathways as basis, development of

transgene-based control techniques for CBSV and UCBSV and testing of target

strategies has been initiated by Patil et al. (2010). It was advocated that such

studies should focus on incorporating transgenes conferring robust CBSD-

resistance into conventionally bred CMD-resistant varieties (Legg et al., 2011).

2.2.14 Evaluation of CBSD resistance

Breeding for resistance to cassava viruses is posed with the problem of

researchers not having standard terminologies in evaluating for resistance.

Lapidot and Friedmann (2002) reported that while, breeders emphasise the effect

of resistance on yield and quality; pathologists consider the fate of the virus in the

plant. In the past many attempts have been made to evaluate resistance to CBSD

(Nichols, 1947; Jennings, 1957; 1960b; 2003). Hillocks et al. (1996) described a

scoring scale of 1 to 5 to score for CBSD symptoms severity of leaf and stem. In

addition, Hillocks and Jennings (2003) described two other approaches for

evaluating resistance to CBSD. The first approach involves planting cuttings from

CBSD symptom-free plants and growing them in hot spot areas to permit

substantial plant-to-plant transmission of viruses. A new incidence of leaf and

stem symptoms are recorded monthly and root necrosis is recorded at harvest.

The second approach involves evaluating cassava varieties for resistance to

infection with CBSV based on four resistance groups as follows:

1- Resistant cassava varieties that remained symptom-free after exposure to

infection

2- Moderately resistant, in which varieties developed mild symptoms in a few

plants

3- Slightly resistant, in which varieties developed CBSD symptoms in over 90%

of the plants. However, the symptoms are mild, or restricted to the stem or leaves

in 40% of plants

4- Susceptible, in which cassava varieties expressed severe CBSD symptoms in

all the plants (99% of the plants).

5- Reversion, in which virus free plants are obtained from plants of CBSD-

infected cuttings grown.

38

CHAPTER 3: General materials and methods

General materials and methods common to this study are explained here while

specific details for each study are given in respective Chapters (4-7).

3.1. Cassava varieties and growth conditions

Plants used in this study were obtained as stem cuttings of six disease-free

cassava variety of Kaleso (from Kenya), Ebwanatereka (from Uganda), Albert

and Kiroba (both from Tanzania) from farmer’s fields. Cassava variety

Columbian was obtained from the University of Bristol, UK, and TMS60444

from the International Laboratory for Tropical Agricultural Biotechnology

(ILTAB), St. Louis, USA. Plants were grown at 28 ± 2 oC, 50-60% relative

humidity (RH) in the quarantine glasshouse and observed for CMD and CBSD

symptom expression. Plants were tested using RT-PCR tests and the absence of

CBSV was confirmed using primers CBSV10 and 11 (Monger et al., 2001a), and

CMBs using Deng primers (Deng et al., 1994; Maruthi et al., 2002) (PCR

methodologies explained below in sections 3.2.7, 3.2.8 and 3.2.9). Plants without

any symptoms and free of viruses were further propagated through the micro

propagation of nodal buds using tissue culture (TC) techniques as described

below (section 3.2.1, 3.2.2 and 3.2.3).

3.2. UCBSV and CBSV isolates

Six UCBSV and CBSV isolates (Patil et al., 2010) were used in the study, which

were collected as stem cuttings (Table 3.1) of unknown cassava varieties in

farmers fields (Figure 3.1).

Table 3.1: Six UCBSV and CBSV isolates used in this study.

Virus isolatesa Place collected Country Collection date Collector

UCBSV-[UG:Kab4-3:07] Kabanyolo Uganda 2007 R. W. Gibson

UCBSV-[KE:Mwa16-2:08] Mwalumba Kenya 2008 M. N. Maruthi

UCBSV-[TZ:Kib10-2:03] Kibaha Tanzania 2003 M. N. Maruthi

CBSV-[TZ:Nal3-1:07] Naliendele Tanzania 2007 R. J. Hillocks

CBSV-[TZ:Zan6-2:08] Zanzibar Tanzania 2008 M. N. Maruthi

CBSV-[MZ:Nam1-1:07] Nampula Mozambique 2007 R. J. Hillocks

aIsolates were described by Patil et al. (2010).

39

Plants were grown in NRI’s quarantine glasshouse and observed for symptom

expression. All the isolates expressed typical but varying CBSD foliar symptoms.

Presence of CBSD virus was further confirmed in RT-PCR tests using CBSV 10

and 11 primers (Monger et al., 2001a).

Figure 3.1: A sketch map of eastern African countries showing the collection sites of CBSD isolates from the disease epidemic and endemic areas.

3.2.1 Media Preparation

The tissue culture method of Frison (1994) was optimised and used in this study

for propagation and cleaning experimental plant materials. Basal medium

Murashige and Skoog (MS) (Sigma, UK) (Murashige and Skoog, 1962), 2.2 gram

(g) and 20 g of sucrose were dissolved in SDW in a beaker, 2 millilitres (ml) of

Plant Preservative Mixture (PPM), which is a broad-based and effective pesticide

against bacteria and fungi was used. PPM is heat stable and so was autoclaved

with media. 50 µl of a growth regulator 1-Naphthaleneacetic acid (NAA)

(Thomas, 2006) were added to enhance rooting. The volume was adjusted to 1 L

and the pH adjusted to 5.8. Phytagel (Sigma UK) 2 g was added to the solution

and dissolved. The media was boiled and 10 ml was dispensed into 25 ml glass

tubes (Sterilin, UK). Tubes were closed with plastic caps and autoclaved for 15

minutes (min) at 115 oC /15 pound per square inch pressure (PSI). All tools,

tubes, and media bottles were wrapped in aluminium foil, and autoclaved (15

min, 121oC) as described by Chandler and Haque (1984). A few bottles

40

containing distilled water were also autoclaved. The laminar airflow cabinet

(Esco, UK) was surface sterilised under UV light for 10 min before use. The

bench was cleaned with 100% (v/v) ethanol. The outer surface of each autoclaved

tube, bottle, or rack was also each spread with 100% (v/v) ethanol before these

were placed in the sterile laminar airflow cabinet.

3.2.2 Surface sterilizations and inoculation of nodes into the media

Young succulent shoots were selected from cassava plants and cut into small

pieces of 1 cm long having at least one nodal bud. The cuttings were washed with

running water and sterilized with 70% ethanol for 3-5 sec. The cuttings were

transferred into the 10% (v/v) sodium hypochlorite (bleach) and 2-drops of

Tween-20 and sterilised by vigorous shaking for 30 min. The cuttings were then

washed in sterile SDW 3-4 times until no foam was left in the jar. Using sterile

conditions, node cuttings were excised 0.4-0.8 cm in length and transferred into

sterile tubes containing MS basal medium. The tubes were covered with sterile

plastic lids, labelled and put in the TC growth room for 4-6 weeks under constant

environment at 25 ± 2 oC, RH 60% and 12 h of light (L12): 12 h of darkness

(D12).

3.2.3 Transfer of plantlets to the soil

After 4-6 weeks, plantlets were removed from the glass tubes, treated with a

systemic fungicide, 0.1% Carbendazim solution (Bayer garden, UK) before

planting into plastic pots containing John Innes No. 2 compost. Pots were soaked

with a Bacillus thuringiensis (Bt)-based biological insecticide Gnat-Off (Hydro

garden, UK) 1 ml/litre of water following manufacture’s instructions for the

control of fungus gnat. Plants were moved to the glasshouse and grown under

propagator lids for further 2-3 weeks at 28 ± 2 oC, RH 50-60%. Plants were

slowly hardened for another 1-2 weeks by slowly lifting the lids. Plants were fed

with fertilizer Phostrogen (Bayer Garden, UK) fortnightly and grown for a further

8 weeks before being used in experiments. Plants so obtained were tested by RT-

PCR (section 3.1) and used as healthy plants in subsequent experiments.

41

3.2.4 Virus transmission by graft-inoculation of cassava varieties

In order to test the efficiency of graft transmission for UCBSV and CBSV, five

cassava varieties (vars), Albert, Kiroba, Ebwanateraka, Columbian and

TMS60444, were graft-inoculated with CBSD isolates. Scions of about 10 cm in

length were collected from CBSV-infected cassava plants of var. Ebwanateraka

expressing clear CBSD symptoms. Scions were cut and all the leaves were

removed except for the first unopened and second opened leaves, while the buds

were left intact. Sharp scalpels were used to make wedge shaped on scions and a

‘V’ shaped downward cut on one side of the stem of a rootstock. Scion was

immediately inserted into freshly cut rootstock plant. The scion and rootstock

plants were secured by wrapping gently but tightly with long strips of plastic tape.

On each scion 1-2 young leaves were retained to encourage the exchange of water

and nutrients, thus virus movement, with the rootstock. To prevent the excessive

loss of moisture and drying of scions, they were enclosed in plastic bags with a

few punch holes. After two weeks the protective plastic bags were removed and

plants were kept in the glasshouse for symptoms observation. The six UCBSV

and CBSV isolates described above (section 3.2.) were used for the graft-

inoculation experiments. Five plants were inoculated for each virus-variety

combination and allowed to grow for six months. All the control plants were

grafted with scions from healthy plants.

3.2.5 Buffer solutions

Preparation of cetyltrimethylammonium bromide (CTAB) buffer for nucleic

acid extraction: For 400 ml extraction buffer is 8 g CTAB (2% w/v), 224 ml of

2.5 M NaCl2, 40 ml 100 mM Tris-HCl, pH 8.0, 16 ml of 20 mM EDTA. The

solutions were mixed together and made up the final volume of 400 ml and the

pH was adjusted to 8.0.

Preparation of Tris-borate (TBE) buffer: To prepare 10×TBE 108 g of 0.45 M

Tris-borate and 55 g of H3BO3 (Boric acid) was dissolved into 40 ml of 0.5 M

EDTA. The final volume was made to 1 L. The working concentration of the

buffer (0.5 l) was prepared by adding 50 ml of 10×TBE into 1 L of autoclaved

SDW. All manipulations were carried out under sterile conditions in a laminar

flow. Buffers and media were prepared using SDW.

42

The sap inoculation buffer prepared as follows:

Solution A: 0.6 M K2HPO4 was prepared by dissolving 10.45 g of K2HPO4 in

100 ml of sterile distilled water (SDW).

Solution B: 0.6 M KH2PO4 was prepared by dissolving 8.17 g of KH2PO4 in 100

ml of SDW.

The potassium phosphate buffer (inoculation buffer) was prepared by mixing 80.2

ml of 0.6 M K2HPO4 solution with 19.8 ml 0.6 M KH2PO4 solution. This was

diluted to a final volume of 1000 ml to obtain 0.06 M potassium phosphate

buffer. Buffer pH was adjusted to 7.4 with HCl and autoclaved. The buffer was

used for preparing virus inoculum and sap inoculation.

3.2.6 Sterilisation of solutions and equipment

All glass flask, bottle and plastic equipment, including different sizes (0.5 ml, 1

ml and 1.5 ml) of microcentrifuge tubes and pipette tips used in the experiments

were sterilised by autoclaving for 15 min at 115 oC / 15 PSI. Other glassware,

ceramics and metals were soaked in 5% (v/v) sodium hypochlorite (bleach) for a

minimum of 1 h, washed with deionised water and baked for 2 h at 180 oC. All

solutions and media were prepared with deionised water and sterilised by

autoclaving. Metal instruments, including tweezers, scissors and scalpels, were

sterilised by soaking in 100% (v/v) ethanol and then burning off excess alcohol in

a Bunsen flame.

3.2.7 RNA extraction

The CTAB protocol described by Lodhi et al. (1994) and optimised for cassava

viruses (Maruthi et al., 2002), was used for the total ribonucleic acid (RNA)

extractions. The protocol was described below:

Total RNA was extracted separately from cassava leaves and experimental host

plants (Nicotiana spp) infected with UCBSV and CBSV. The third, fourth or fifth

leaves from the top of the plants were picked for RNA extraction.

About 100 milligram (mg) of CBSD leaf tissue was placed into a thick gauge

plastic bag and ground using roller and mixed with 1000 µl of CTAB extraction

43

buffer (2% w/v, 1.4 M NaCl, 0.2% (v/v) 2- mercaptoethanol, 20 mM EDTA, 100

mM Tris-HCl, pH 8.0).

About 750 µl of the samples was poured into a 1.5 ml eppendorf tube and the

samples were incubated at 60 oC for 30 min. Samples were mixed with 750 µl of

phenol: chloroform: isoamylalcohol (25:24:1) by vortexing, to remove protein

contaminants. Samples were then centrifuged at 13,000 rpm for 10 min. The top

aqueous phase was transferred into new 1.5 ml eppendorf tube.

The samples were precipitated by adding 0.6 volumes (300 µl) of cold

isopropanol and incubated at -20 oC overnight. The samples were further

centrifuged at 13,000 rpm at 4 oC for 10 min and the supernatants were discarded.

The pellets were washed in 0.5 ml 70% ethanol by vortexing and then centrifuged

at 13,000 rpm for 5 min. The ethanol was removed and the pellets were vacuum

dried for 5 min. The dried pellets were diluted each in 1000 µl 1x TE buffer (10

mM Tris-HCl, pH 8.0) and stored at -20 oC.

3.2.8 Reverse transcriptase (RT)

For cDNA synthesis of viral RNA, ImProm-IITM Reverse Transcriptase kit was

used following the manufacturer’s instructions (Promega, UK). Syntheses was

performed as master mix one 5 µl (MM1) and master mix two 15 µl (MM2) in a

total volume of 20 µl as described in the reaction mixture below (Table 3.2; Table

3.3).

Table 3.2: Master Mix 1 for cDNA synthesis from virus RNA.

MM1 was incubated at 70oC for 5 min and quickly chilled in ice

Reagents × 1 sample (µl)

SDW

Oligo-dT primer (20 µM)

RNA template

Total

1.0

1.0

3.0

5.0

44

Table 3.3: Master Mix 2 for cDNA synthesis from virus RNA.

cDNAs were prepared by mixing MM1 and MM2 in which aliquots were placed

in 0.5 ml microfuge tubes. The mixtures were then incubated at 25 oC (annealing)

for 5 min, 40 oC (first strand extension) for 60 min and 70 oC (reverse

transcriptase inactivation) for 15 min. Thus generated cDNAs were ready for use

in PCR. The cDNAs amplification was carried out in a thermal cycler Gene

Amp® PCR System 9700 (Applied Biosystems, USA).

3.2.9 Polymerase chain reactions (PCR)

For PCR amplifications of viral cDNAs, Red hot polymerase kit (Thermo

Scientific, UK) was used. PCR reactions in the final volume of 25 μl included the

following reaction mixture (Table 3.4).

Table 3.4: Reaction mixture for PCR amplification of viral cDNAs.


SDW

5x Impromo-TS-buffer

MgCl2 (25 mM)

dNTPs (25 mM)

Impromo-IITMReverseTranscriptase (200 U/µl)

Total

7.5

4.0

2.0

1.0

0.5

15.0


SDW

10×PCR buffer

MgCl2 (2.5 mM)

dNTPs (2.5 mM)

Forward primer (20 µM)

Reverse primer (20 µM)

Red hot polymerase (5 U/µl)

cDNA template

Total

15.9

2.5

1.5

2.0

0.5

0.5

0.1

2.0

25.0

45

Table 3.5: The temperature profiles and thermal cycling conditions.

3.2.10 Primers used in RT-PCR reactions

The primers designed previously were used in this study to avoid duplication of

work and are listed below (Table 3.6).

Table 3.6: Primers used in PCR and RT-PCR reactions for the detection of CMV,

UCBSV and CBSV isolates.

Virus name

Primer

name Primer sequence (5´-3´)

Product

size Reference

Geminivirus

Deng A TAATATTACCKGWKGVCCSC

530 bp

Deng et al.,

1994 Deng B TGGACYTTRCAWGGBCCTTCACA

CBSV-CP

CBSV10 ATCAGAATAGTGTGAACTGCTGG

230 bp

Monger et al.,

2001a CBSV11 ATGCTGGGGTACAGACAAG

CBSV-CP

CBSVF3 GGARCCRATGTAYAAATTTGC

283 bp

Abarshi et al.,

2012 CBSVR3 AGGAGCWGCTARWGCAAA

3.2.11 Gel electrophoresis

RT-PCR products were separated electrophoretically on a 1.2% (w/v) agarose

(Themo Fisher Scientific, UK). The gel was prepared by dissolving the agarose in

100 ml of 0.5× TBE buffer (0.045 M Tris-borate, 0.5 mM EDTA, pH 8). The

agarose-buffer solution was heated in a microwave oven for 3 min and was

cooled to ~ 40 oC before pouring into a gel tray that was fitted with a gel comb.

The gel was allowed to solidify for 20 min before loading samples. About 15 µl

of the sample was mixed with 5 µl of 5× orange G loading dye and loaded into

separate wells on the gel. About 5 µl DNA markers (100 or 1000 base pair (bp)

Steps Temperature (oC) Time Number of cycle

Initial denaturation

Final denaturation

Annealing

Initial extension

Final extention

94

94

52

72

72

1 min

½ min

½ min

1 min

10 min

×35 cycles

46

were loaded into each end slots of the gel. Electrophoresis was performed at 80V

for ~ 1 h. The gel was stained in 0.5 µg/ml ethidium bromide solution. The gel

was observed under UV light (Syngene G: Box).

47

CHAPTER 4: The effect of virus diversity on CBSD symptom expression on

cassava and herbaceous host plantsa

4.1. Introduction

Prominent CBSD symptoms appear on leaves in varying patterns of chlorosis

based on which, Nichols (1950) identified two types of CBSV isolates. Leaf

chlorosis appears in a feathery pattern, first along the margins of the secondary

veins, later affecting tertiary veins and may develop into chlorotic blotches.

Alternatively, the chlorosis may not be clearly associated with the veins but

appears in roughly circular patches between the main veins. In advanced stages of

the disease, much of the lamina may be affected. On senescing leaves of some

varieties, there is an unusual effect of ‘symptom reversion’ where the previously

chlorotic areas immediately surrounding the veins turn into green areas while the

rest of the leaf become chlorotic with bright yellow colours (Hillocks and

Jennings, 2003). There is considerable variation in the expression of foliar

symptoms depending on variety, growing conditions (temperature, rain fall, and

altitude), age of the plant and the virus isolate involved in causing the symptoms

(Hillocks et al., 1996). Some cassava varieties show marked foliar symptoms but

without or delayed root symptoms and vice versa. Symptoms of the disease

become more difficult to recognize in older plants as the leaves with prominent

symptoms are lost (Hillocks et al., 2002). New leaves produced from these plants

often do not show symptoms, especially at high temperatures. Symptoms can also

be transient when a period of active growth produces symptom-free tissues

(Jennings, 1960b). However, it’s difficult to interpret these observations precisely

because they have been made in the field situations with varying agro-climatic

conditions on cassava varieties with differing virus resistance levels and crop age,

and possibly infected with different virus strains, which all singly or in

combination, affect symptom expression.

aThe work in this Chapter was published in Advances in Virology, see appendix 3

48

It is expected that these studies on CBSV diversity will contribute to an improved

understanding of CBSD symptoms diversity which is an essential component of

CBSD field diagnosis. These studies are also expected to determine if a severe

form of virus is associated with the recent outbreaks of the disease in Uganda.

4.2. Materials and methods

4.2.1 Cassava varieties and CBSD isolates

Five disease-free cassava varieties Ebwanateraka, Albert, Kiroba, Colombian and

TMS60444 (section 3.1) were virus-indexed and the symptomless plants were

cultivated through the micro-propagation of nodal buds (section 3.2.2). The six

virus isolates were; CBSV-[MZ:Nam1-1:07], CBSV-[TZ:Nal3-1:07], CBSV-

[TZ:Zan6-2:08], UCBSV-[KE:Mwa16-2:08], UCBSV-[TZ:Kib10-2:03] and

UCBSV-[UG:Kab4-3:07] (Patil et al., 2010; Mbanzibwa et al., 2011) (section

3.2) were used in this study for virus-inoculation on cassava varieties for

symptom diversity experiments.

4.2.2 Graft-inoculation of virus isolates for recording rate of transmission

The graft-inoculation protocol described before (section 3.2.4) was used for the

transmission of the six CBSD isolates onto two-month-old healthy cassava plants

of the above five varieties (section 4.2.1). Plants were kept in a relatively constant

environment at 28 ± 5 oC and 50-60% relative humidity (RH) for symptom

development. Various parameters were recorded at weekly intervals for

determining the rate of graft-transmission of each isolate on cassava varieties.

Time taken for symptom expression and development was recorded on graft-

inoculated cassava varieties and on plants grown from CBSD-affected cuttings.

Symptoms were recorded for a period of 10 weeks. Data obtained were used to

estimate UCBSV and CBSV incubation times in each cassava variety. Two plants

grafted with healthy scions in each variety per isolates were used as control.

4.2.3 CBSD symptom severity

For each virus-variety combination, 10 cuttings of 10 cm were made from graft-

inoculated plants (section 4.2.2) and grown in the quarantine glasshouse. A total

of 900 cassava plants were examined for the effect of CBSD infection on the

49

sprouting of cuttings from infected cassava plants. The effect of virus on cassava

growing buds, disease symptom diversity and severity on the leaves of cassava

plants were recorded at 28 ± 5 oC and 50-60% RH. Number of cuttings that

sprouted from each cassava variety was recorded to measure the effect of CBSD

on sprouting of young cuttings. Leaf symptom severity was scored on 3-month

old plants using a five point scale where 1 = no visible CBSD symptoms, 2 =

mild foliar symptoms on some leaves, 3 = pronounced foliar symptoms but no

die-back, 4 = pronounced foliar symptoms which might include slight die-back of

terminal branches, and 5 = severe foliar symptoms and plant die-back (Hahn et

al., 1989; Hillocks et al., 1996). Plants grown from healthy cuttings were scored

as control.

4.2.4 Sap-inoculation of herbaceous host plants

Sap transmission of CBSV and UCBSV was conducted at the NRI quarantine

glasshouse from March to November, 2008. Thirteen herbaceous plant

species/varieties were tested for their response to CBSV by sap-inoculations. For

each isolate, a cassava leaf showing clear CBSD symptoms was collected and

ground separately in 20 ml of the inoculation buffer using a pestle and mortar.

The leaf debris was separated from the sap by squeezing through sterile muslin

cloth. Fully-open young leaves of herbaceous plants were sprinkled with fine 600

mesh carborundum powder. The viral sap inoculum was picked up using a cotton

wool pad and applied gently on the leaf always stroking from petiole to the leaf

tip. Virus inoculated leaves were rinsed thoroughly using a jet of water 10 min

after the application of sap and the plants were kept at 28±5 oC and 50-60% RH

for symptom development. Plants inoculated with buffer alone served as controls.

Various parameters were recorded at weekly intervals for determining rate of sap-

transmission, symptom type, symptom severity and development.

4.2.5 Sampling of plant tissues and virus detection by RT-PCR

Leaf samples were collected by taking the third leaf from the top of cassava and

herbaceous plants for CBSV detection by RT-PCR. Samples were collected seven

days after inoculation and weekly thereafter for up to 24 weeks. Collected

samples were stored at -80 oC prior to CBSV testing. The CTAB protocol (section

3.2.7) was used for total nucleic acid extractions. The RT-PCR protocols

50

(sections 3.2.8 and 3.2.9) were used for both cDNA syntheses and PCR product

amplification. Samples that produced bands of expected sizes were classified as

positive for CBSV.

4.2.6 Measuring virus concentration in infected plants

Virus concentrations of the six CBSD isolates were determined by serial dilutions

of cDNA from infected leaf samples with SDW. Total nucleic acids were

extracted from CBSD-infected cassava leaves of vars. Albert, Kiroba, Colombian,

Ebwanateraka and TMS60444 for each of the six CBSD-isolates. cDNAs were

prepared on two samples per isolate using the primer OligodT and diluted

subsequently 10-1, 10-2, 10-3, 10-4 and 10-5 folds. RT-PCR was then carried out on

diluted cDNAs using virus-specific primers CBSVF3 and CBSVR3 (Abarshi et

al., 2011). The concentration of virus particles (RNA) was calculated by

recording the initial amounts of cDNAs in each sample using the BioPhotometer

(Eppendorf, UK).

4.2.7 Statistical analyses

The statistical analyses of the data were carried out using R-software (PC-

window, 2009 version). The data for symptom severity scores were processed by

two-way analysis of variance p<0.005 (ANOVA) using the Tukey test to

determine the interaction between viruses and varieties. See section appendix for

details of the data analysis.

4.3 Results

4.3.1 CBSD symptom types on cassava

CBSD symptoms in general were highly variable on cassava but there were two

consistent patterns associated with particular isolate/species

UCBSV pattern: Irregular concentric yellow patches. Initial symptoms of this

pattern appeared as faint yellowing in small patches along the secondary and

tertiary veins of the affected leaf which later developed into bright yellow patches

of usually irregular to occasionally circular shapes. The yellow patches are

vividly defined and restricted to affected areas. They are not uniformly distributed

51

throughout the leaflet leaving some parts of the leaf without symptoms. As the

symptoms developed further, much of the leaf turned bright yellow while some

areas remained green before leaf senescence. These symptoms were associated

with isolates from Kabanyolo , Kibaha and Mwalumba (Table 3.1), which are

infected with UCBSV and individually be referred to in this study as UCBSV-

[UG:Kab4-3:07] (for Kabanyolo isolate), UCBSV-[TZ:Kib10-2:03] (for Kibaha

isolate) and UCBSV-[KE:Mwa16-2:08] (for Mwalumba isolate) (Figure 4.1a).

CBSV pattern: Severe leaf feathering and uniform vein clearing symptoms: Initial

symptoms of this type appeared as faint green spots which later turned into

yellow and eventually became necrotic. The spots were distributed throughout the

leaf and not necessarily along the veins. This is followed by the development of

feathery yellowing along the secondary and tertiary veins. The yellowing of veins

is mostly even, spreading throughout the affected leaf which unlike the UCBSV

pattern did not develop into concentric bright yellow patches. These are similar to

the classical CBSD symptoms commonly described in the literature.

Senescing leaves appeared completely yellow and the feathery pattern

occasionally appeared like a ‘water colour painting’ on older leaves. These

symptoms were associated with the isolates from the coastal lowland areas of

Zanzibar, Naliendele (both in Tanzania) and Nampula in Mozambique, which are

infected with CBSV and individually be referred to as CBSV-[TZ:Zan6-2:08] (for

Zanzibar isolate), CBSV-[TZ:Nal3-1:07] (for Naliendele isolate) and CBSV-

[MZ:Nam1-1:07] (for Nampula isolate) (Figure 4.1b).

FiguUCBCBSsym

ure 4.1: CaBSV isolatSV isolates

mptoms.

assava leavtes, which s, which a

es (Albert pare mild ir

are severe

52

plants) showrregular coleaf feathe

wing symptncentric yering and u

toms expreellow patchuniform ve

essed by (a)hes and (b)in clearing

) ) g

53

4.3.2 Rate of transmission of UCBSV and CBSV isolates by graft-inoculation

Plants graft-inoculated with the CBSV-isolates became infected in less than two

weeks after grafting and the rates of transmission varied among cassava varieties

(Table 4.1). All five cassava varieties graft-inoculated with CBSV expressed

symptoms, while only between 2-4 out of five plants graft-inoculated with

UCBSV isolates expressed symptoms. The results suggested a smaller UCBSV

rate of transmission for grafting compared to CBSV isolates. Development of

symptoms on graft-inoculated plants varied between the isolates and for the two

virus types. Two CBSV isolates (CBSV-[TZ:Nal3-1:07] and CBSV-[MZ:Nam1-

1:07]) infected all plants of the five cassava varieties (Table 4.1) although for the

CBSV isolates it was 80-100%. In comparison, the transmission of UCBSV

isolates ranged from 60-76%. Amongst the UCBSV isolates; UCBSV-

[KE:Mwa16-2:08] produced the greatest percentage transmission (76%). Least

transmission was recorded from UCBSV-[UG:Kab4-3:07] (60%)). None of the

plants used as control expressed CBSD symptoms (Table 4.1).

Table 4.1: The rate of graft transmission of six CBSUV and CBSV isolates on

cassava.

1Plants were tested by RT-PCR six months after graft-inoculation 2Number of infected plants for each cassava variety. 3Number of infected plants for each virus isolate.

Cassava variety Number of plants infected/grafted with each virus isolate1 Total

number of

infected/

grafted

plants2 (%)

UCBSV- CBSV-

[UG:Ka

b4-3:07]

[KE:Mwa

16-2:08]

[TZ:Kib

10-2:03]

[TZ:Zan

6-2:08]

[MZ:Na

m1-1:07]

[TZ:Nal3-

1:07]

Albert 4/5 3/5 4/5 4/5 5/5 5/5 25/30 (83)

Kiroba 3/5 4/5 4/5 5/5 5/5 5/5 26/30 (87)

Ebwanateraka 3/5 4/5 3/5 3/5 5/5 5/5 23/30 (77)

Colombian 3/5 4/5 3/5 4/5 5/5 5/5 24/30 (80)

TMS 60444 2/5 4/5 3/5 4/5 5/5 5/5 23/30 (77)

infected/grafted

plants3 (%)

15/25

(60)

19/25

(76)

17/25

(68)

20/25

(80)

25/25

(100)

25/25

(100)

121/150

(81)

Control 0/10 0/10 0/10 0/10 0/10 0/10 0/60 (0)

54

4.3.3 Sprouting of the CBSD-infected cuttings

CBSD-infected cuttings sprouting were recorded in all five cassava varieties at

three months after planting. Amongst the isolates, maximum number of cuttings

sprouted from the epidemic isolate UCBSV-[UG:Kab4-3:07] (96%) and the least

number of cuttings from CBSV-[TZ:Nal3-1:07] (74%) (Table 4.2). Death of

plants due to CBSV started within one month of sprouting. In TMS60444, by the

end of three months after sprouting, more than half of the CBSV-affected plants

had failed to sprout. A limited number of plants failed to sprout in variety Kiroba

and Colombian in the UCBSV-infected cuttings (Table 4.2). UCBSV had less

severity effect on the cassava growing plants compared to CBSV. All plants used

as control have sprouted and none expressed CBSD symptoms.

Table 4.2: The effects of CBSD infections on the sprouting of cassava stem

cuttings three months after planting

Cassava variety Number of CBSD-infected cuttings that sprouted/planted3 Total number

of sprouted/

planted

cuttings1 (%)

UCBSV- CBSV-

[UG:Ka

b4-3:07]

[KE:Mwa

16-2:08]

[TZ:Kib

10-2:03]

[TZ:Zan

6-2:08]

[MZ:Na

m1-1:07]

[TZ:Nal

3-1:07]

Albert 9/10 9/10 8/10 9/10 9/10 9/10 53/60 (88)

Kiroba 10/10 8/10 10/10 9/10 8/10 6/10 51/60 (85)

Ebwanateraka 10/10 7/10 10/10 8/10 9/10 10/10 54/60 (90)

Colombian 10/10 10/10 8/10 10/10 9/10 10/10 57/60 (95)

TMS 60444 9/10 10/10 10/10 5/10 4/10 2/10 40/60 (67)

Total number of

sprouted/ planted

cuttings2 (%)

48/50

(96)

44/50

(88)

46/50

(92)

41/50

(82)

39/50

(78)

37/50

(74)

255/300

(85)

Control4 10/10 10/10 10/10 10/10 10/10 10/10 60/60

(100)

1Number of sprouted and fully grown plants for each cassava variety. 2Number of sprouted and fully grown plants for each virus isolate. 3All 10 cuttings were obtained from plants infected with viruses and showing typical CBSD symptoms. Sprouting was recorded at three months after planting. 4All the cuttings used as control were obtained from CBSD-free plants

55

4.3.4 CBSD leaf symptoms severity on cassava varieties

Amongst the varieties, the greatest mean severity score was observed on

TMS60444 (score 3.1), followed by Ebwanateraka, Albert and Colombian (3.0)

while Kiroba had the lowest mean severity score (2.3) (Table 4.3). Amongst the

isolates, CBSV-[MZ:Nam1-1:07] was the severest (score 3.8), followed by

CBSV-[TZ:Nal3-1:07] (3.7) and CBSV-[TZ:Zan6-2:08] (3.0). UCBSV isolates

were least severe with scores ranging from 1.9 to 2.7 (Table 4.3). The leaf

symptom severity score for each variety varied (Figure 4.2). When a multiple

comparison using two-way analysis of variance (ANOVA), significant

differences among cassava varieties were observed for the severity of CBSD

symptoms on leaves (P < 0.001), virus isolates (P < 0.001) and variety versus

isolates interactions (P<0.034), indicating that some varieties were differentially

affected by certain isolates. Plants affected by UCBSV takes long time with no

symptoms of CBSD while plants affected by CBSV always developed symptoms

from the beginning of sprouting (Table 4.3; Figure 4.2). All plants that sprouted

from CBSD-affected cuttings but not showing symptoms have average symptom

severity scores of only 1. None of the plants used as control expressed CBSD

symptoms (Figure 4.2).

Table 4.3: Mean symptom severity scores for each CBSD isolate on different

cassava varieties (on a 1-5 scale using the procedure of Hillocks et al., 1996).

1Mean symptom severity for each variety. 2Mean symptom severity for each virus isolate. Plants were scored for symptom severity at six months after sprouting.

Cassava

variety

Mean symptom severity scores for each virus isolate Mean symptom severity1

UCBSV- CBSV-

[UG:Ka

b4-3:07]

[KE:Mwa1

6-2:08]

[TZ:Kib

10-2:03]

[TZ:Zan

6-2:08]

[MZ:Nam

1-1:07]

[TZ:Nal

3-1:07]

Albert 1.9 2.9 2.2 2.8 4.0 3.9 3.0

Kiroba 1.9 2.0 2.0 2.4 3.0 2.7 2.3

Ebwanateraka 1.9 2.6 2.1 2.8 4.0 4.0 3.0

Colombian 1.9 2.9 2.1 2.9 4.0 4.0 3.0

TMS 60444 2.1 2.9 2.7 3.1 4.0 4.0 3.1

Mean symptom

severity2

1.9 2.7 2.2 3.0 3.8 3.7 2.8

56

Figure 4.2: CBSD symptoms on leaves of affected cassava plants. Plants were visually assessed for development of symptoms at six months after graft-inoculation with UCBSV and CBSV infectious scions. Each plant was scored on a scale of 1–5 where score 1 = symptomless, 2 = mild foliar symptoms on leaves and stems, 3 = pronounced foliar symptoms on leaves, but no die back, 4 = pronounced foliar symptoms on leaves, might or not include die back, 5 = pronounced foliar symptoms including severe die back.

57

4.3.5 CBSD symptom development on cassava varieties

Time taken for the development of CBSD symptoms were recorded on Albert

infected with UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]. From the

first week of symptom appearance, a diseased leaf lasted for about 8-12 weeks

after first symptom appearance before dropping off (Figure 4.3). Ninety percent

of the leaves dropped within three months of first appearance of the symptoms.

For CBSV, symptoms first appeared within two weeks after the graft-inoculation

and three weeks for UCBSV except in Kiroba where first symptoms were

observed five and six weeks after inoculation, respectively. In plants grown from

infected cuttings, symptoms developed on first leaves in weeks 1-2 for both

CBSV and UCBSV isolates (Table 4.4). Generally, it took between 3-8 weeks for

plants infected with UCBSV and CBSV to attain 100% infection.

Table 4.4: Time taken to express symptoms on CBSD-infected cuttings and graft-

inoculated plants in the glasshouse.

Cassava

variety

First/ last symptoms (in weeks) expressed by UCBSV and CBSV isolatesa

UCBSV-

[UG:Kab4-3:07] [KE:Mwa16-2:08] [TZ:Kib10-2:03]

cutting grafted cutting grafted cutting grafted

Albert 2/5 4/4 2/5 3/5 2/5 3/6

Kiroba 4/8 6/9 3/8 6/8 4/7 6/8

Ebwanateraka 1/4 4/4 1/4 3/5 1/3 3/5

Columbian 2/4 4/5 2/4 3/6 2/3 3/4

TMS60444 2/4 4/5 1/4 3/5 2/3 3/4

CBSV-

[TZ:Zan6-2:08] [MZ:Nam1-1:07] [TZ:Nal3-1:07]

cutting grafted cutting grafted cutting grafted

Albert 2/4 3/5 1/2 2/4 2/3 2/4

Kiroba 3/6 5/7 2/4 5/7 2/4 5/5

Ebwanateraka 1/5 2/6 1/2 3/5 1/2 2/6

Columbian 2/4 3/7 1/5 2/4 2/3 2/4

TMS60444 1/3 2/5 1/1 2/2 1/2 2/2 aIndicates time to the first symptom appearance/time when all the plants showing symptoms were recorded in weeks.

Figmon(A1= sysymCBSin tmon

gure 4.3: Tnths on cas = initial U

ymptom devmptom at thSV-[MZ:Nathe secondnths).

Typical CBssava variet

UCBSV-[UGvelopment ihree montham1-1:07]sy

d month an

BSD symptoty Albert u

G:Kab4-3:07in the secon

hs) and CBymptom in nd B3 = C

58

om developupon infect7] symptom

nd month anBSV-[MZ:N

the first moCBSV-[MZ

pment fromion by UC

ms observednd A3 = UCam1-1:07] onth, B2 = s

Z:Nam1-1:07

m one monCBSV-[UG:d in the firstCBSV-[UG:

isolates (Bsymptom de7] symptom

nth to threeKab4-3:07] month, A2Kab4-3:07]

B1 = initialevelopmentm at three

e ] 2 ] l t e

59

4.3.6 CBSD symptom severity on herbaceous host plants

All six CBSD isolates infected Datura stramonium, Nicotiana clevelandii, N.

benthamiana N. glutinosa, N. tabacum nn, N. tabacum NN and N. rustica with

varying rates of infection (Table 4.5). All plants of N. clevelandii were infected

with each isolate. Most but not all plants of N. tabacum nn, N. tabacum NN and

N. rustica were also infected with each isolate.

Symptom severity on herbaceous host plants varied especially on N. clevelandii

and N. benthamiana. Plants infected with CBSV-[TZ:Nal3-1:07] and CBSV-

[MZ:Nam1-1:07] were severely stunted and subsequently wilted by developing

leaf necrosis (Figures 4.4; 4.5). Most of these plants died usually within four

weeks of virus inoculation. Plants infected with the remaining isolates developed

various patterns of chlorosis, vein clearing, leaf malformation and stunting but

not necrosis and death. Symptoms on other hosts also varied but in general

included leaf chlorosis, mosaic and mottling. Local lesions were seen on N.

tabacum nn, chlorosis/ mosaic patterns in N. tabacum NN and vein clearing in N.

benthamiana by all the isolates. All herbaceous host plants infected with UCBSV

and CBSV expressed varying symptoms except N. tabacum nn, which expressed

local lesions only (Appendix 1.1).

Time taken for first symptom expression on these hosts varied for each isolate

and it depended on the virus and plant species infected. Amongst the isolates,

CBSV-[MZ:Nam1-1:07] produced symptoms in all hosts within a week of

inoculation, which is closely followed by CBSV-[TZ:Nal3-1:07]. Symptom

expression ranged from week 1-4 for the remaining five isolates. Of the plant

species, N. clevelandii was most susceptible, showing symptoms on all plants

between weeks 1-3. About 3-7 weeks were required to attain 100% incidence in

all the infected N. benthamiana and N. clevelandii inoculated with CBSV isolates

compared to the 3-8 weeks for the UCBSV isolates (Appendix 1.2). None of the

plants used as control expressed CBSD symptoms (Figure 4.5).

60

Table 4.5: Herbaceous hosts inoculated with CBSV and UCBSV isolates

Species/variety Number of plants infected/ inoculated for each isolate

UCBSV- CBSV-

[UG:Ka

b4-3:07]

[KE:Mwa

16-2:08]

[TZ:Kib

10-2:03]

[TZ:Zan

6-2:08]

[MZ:Nam

1-1:07]

[TZ:Nal

3-1:07]

Mean

C. quinoa 0/10 0/10 0/10 0/10 0/10 0/10 0/10

C. maxima 0/10 0/10 0/10 0/10 0/10 0/10 0/10

Datura metel 0/10 0/10 0/10 0/10 0/10 0/10 0/10

D. stramonium 4/10 2/10 2/10 3/10 9/10 4/10 4/10

Solanum lycopersicum 0/10 0/10 0/10 0/10 0/10 0/10 0/10

I. batatas 0/10 0/10 0/10 0/10 0/10 0/10 0/10

N. benthamiana 40/40 5/40 40/40 20/40 40/40 40/40 31/40

N. clevelendii 10/10 10/10 10/10 10/10 10/10 10/10 10/10

N. glutinosa 20/40 13/40 23/40 12/40 37/40 40/40 24/40

N. hesperis 0/10 0/10 0/10 0/10 0/10 0/10 0/10

N. tabacum nn 19/20 17/20 20/20 20/20 20/20 20/20 19/20

N. tabacum NN 10/10 10/10 10/10 7/10 9/10 10/10 9/10

N. rustica 18/20 17/20 15/20 20/20 20/20 20/20 18/20

Positive /inoculated 121/210

(58%)

74/210

(35%)

120/210

(57%)

92/210

(44%)

145/210

(69%)

144/210

(69%)

116/210

(55%)

Figusymsymplan

Figuinoc[MZCBSKab

ure 4.4: Cmptom on thmptoms in thnt.

ure 4.5: Tyculated witZ:Nam1-1:0SV-[TZ:Zanb4-3:07]; 7 =

CBSD-symphe newly ophe form of

ypical sympth sap ext07]; 2 = CBn6-2:08]; 5= Healthy c

ptoms on Npened leavesnecrosis, tw

ptoms obsertracted froBSV-[TZ:N5 = UCBScontrol plan

61

N. benthams in the formwisting of le

rved on N. com infectedNal3-1:07]; 3SV-[KE:Mw

nt.

iana showim of mosaiceaves and s

clevelandii d cassava 3 = CBSV-wa16-2:08];

ing (a) milc and (b) sestunting of t

plants 5-6 wplants. 1

-[TZ:Kib10; 6 = UC

ld UCBSVvere CBSVthe infected

weeks after= CBSV-

0-2:03]; 4 =CBSV-[UG:

V V d

r -= :

4.3.

CB

teste

R3.

isol

from

Figuprim(b) [TZ[TZ[TZladdEng

4.3.

Rela

fold

CBS

dilu

dilu

CBS

.7 RT-PCR

BSD-infecte

ed for the p

These prim

ates were re

m cassava s

ure 4.6: Dmers from (

(Albert). LZ:Kib10-2:0Z:Zan6-2:08Z:Nal3-1:07der (M) at egland Biolab

.8 Measurin

ative virus

d indicated

SV-[MZ:Na

utions (Figu

utions of up

SV.

R detection

d leaf tissu

presence of U

mers produ

eadily detec

amples (Fig

Detection of(a) herbaceoLanes 1 an3], 5 and

8], 9 and 1], 13 = wa

each border bs).

ng virus co

concentrati

that virus

am1-1:07],

ure 4.7). U

p to 10-2 an

of UCBSV

ues of cassa

UCBSV an

uced expecte

cted in RT-P

gure 4.6b).

f UCBSV aous host pl

nd 2 = UC6 = UCB

10 = CBSVater controlof the gels

oncentratio

ions in a ser

was detect

UCBSV-is

UCBSV and

nd 10−3, UC

62

V and CBSV

ava plants

nd CBSV us

ed RT-PCR

PCR from N

and CBSV lants (N. be

CBSV-[UG:KSV-[KE:MwV-[MZ:Nam

and 14= ais the 100 b

n in infecte

rial dilution

table at 10-

solates were

d CBSV is

CBSV-isola

V isolates

and herbace

sing primers

R fragments

N. bentham

using CBSenthamiana)Kab4-3:07]wa16-2:08]m1-1:07], 1a known Rbp molecula

ed plants

n of viral cD5 dilutions

e not detect

solates were

ates produc

eous host p

s CBSV F3

s of sizes 2

miana (Figur

SV F3 and ) and cassa], 3 and 4=], 7 and 8 11 and 12

RNA controar weight m

DNA from

only from

table at 10

e easily de

ced fainter

plants were

and CBSV

283 bp. All

re 4.6a) and

CBSV R3ava samples= UCBSV-

= CBSV-= CBSV-

ol. The sizemarker (New

10-1 to 10-5

the severe-4 or above

etectable at

bands than

e

V

l

d

3 s ---e

w

5

e

e

t

n

Figu1 to[UG[KE[MZ14 (the

ure 4.7: De 10-5 folds

G:Kab4-3:07E:Mwa16-2Z:Nam1-1:0(+) = a kno100 bp mol

etection of Uusing CBSV7], 3 and :08], 7 and07], 11 and own RNA clecular weig

UCBSV andV F3 and C4= UCBS

d 8 = CB12 = CBSV

control. Theght marker (

63

d CBSV in CBSV R3 pSV-[TZ:KibBSV-[TZ:ZaV-[TZ:Nal3e size ladde(New Engla

serial dilutiprimers. Lan10-2:03], 5an6-2:08], -1:07], 13 (r at left bor

and Biolabs

ions of cDNne 1 and 2 5 and 6 =9 and 10

(-) = water rder of the

s, UK).

NA from 10-

= UCBSV-= UCBSV-

= CBSV-control andgels (M) is

-

---d s

64

4.4 Discussion

Until recently, research on CBSD diversity/severity has largely been restricted to

observations in the field on cassava plants of different age, genetic make up and

grown in different agro-ecological zones with varying environmental conditions

and possibly infected with different virus strains, all of which can singly or in

combination, influence symptom development. This made the comparison of the

field observations between the various studies particularly difficult and the

question of whether a severe form of CBSD is associated with the latest epidemic

in Uganda has remained unanswered. Inoculation of herbaceous host plants by

various researchers provided somewhat uniform conditions for symptom diversity

studies (Bock, 1994) but until recently no such comparison has been made with

isolates from the coastal endemic and inland epidemic areas involving the two

different species of CBSVs (Mbanzibwa et al., 2009; Winter et al., 2010). It was

particularly difficult to conclude whether the severe CBSD symptoms observed in

the fields of coastal Mozambique and Tanzania (Hillocks et al., 1996), for

example, or the relatively milder leaf symptoms seen in Uganda (severity score of

2.0, Alicai et al., 2007) were due to the effect of virus isolate or the

tolerance/susceptibility of the cassava varieties being grown in those regions. In

this study these external variations were eliminated by carrying out experiments

in controlled environmental conditions in a glasshouse and on a standard range of

CBSD isolates from both the endemic and epidemic regions to determine if

indeed virus from one region was more virulent than others. This was particularly

relevant to understand if the new outbreaks of CBSD at high altitudes in Uganda

and the Lake Zone areas of Tanzania were due to the development of a severe

form of the virus, similar to those observed during the course of CMD pandemic

in Uganda in the early 1990s.

In order to investigate this, a number of parameters were used to assess the

severity levels between one epidemic and five endemic CBSD isolates including

the symptoms on leaves of five infected cassava varieties, the effect of virus on

sprouting of cassava stem cuttings, the rate of graft transmission, virus titres in

infected leaves as well as symptom severity on herbaceous host plants. Amongst

the isolates examined, the endemic isolates CBSV-[MZ:Nam1-1:07] and CBSV-

[TZ:Nal3-1:07] produced the most severe symptoms with mean symptom severity

65

scores of 3.7-3.8 on a five-point scale (Hillocks et al., 1996). In comparison, the

epidemic UCBSV-[UG:Kab4-3:07] isolate was the mildest with a mean leaf

severity score of 1.9. The severity of CBSVs can also be estimated by their ability

to affect the young growing buds of infected cassava plants (Nichols, 1950).

Using these earlier observations as cues, the differences in the severity levels of

the epidemic and endemic isolates were further demonstrated when a significantly

greater number of cuttings failed to sprout from the severe endemic isolates

compared to the milder epidemic isolate. Between 22-26% of the cuttings failed

to sprout when infected with CBSV-[MZ:Nam1-1:07] or CBSV-[TZ:Nal3-1:07]

while only 4% of the cuttings were similarly affected by the infection of UCBSV-

[UG:Kab4-3:07]. These observations were further supported by the greater rates

of virus transmission by grafting of the endemic severe isolates which is probably

due to high virus titre (about 1000-times greater virus titre in the two severe

endemic isolates CBSV-[MZ:Nam1-1:07] or CBSV-[TZ:Nal3-1:07] compared to

the epidemic isolate UCBSV-[UG:Kab4-3:07]). A notable difference observed

between this and earlier studies, however, is the infection of Albert by all isolates

of this study. In graft inoculation experiments, Winter et al. (2010) failed to infect

Albert by the CBSD isolates from Kenya, Uganda and Malawi. While the

difference between these two similar studies could not be explained at this stage,

these results nonetheless have great implications for developing disease

management strategies since Albert once considered being a potential source of

resistance to CBSD in Kenya, Uganda and Malawi is now proven susceptible. In

southern Tanzania, growing of Albert has been largely abandoned due to its

susceptibility to CBSD there (RJ Hillocks, unpublished).

The differences in the symptoms were also observed on infected herbaceous

hosts. Compared to the previously reported N. benthamiana (Mbanzibwa et al.,

2009; Winter et al., 2010), N. clevelandii in particular was highly susceptible to

both CBSV and UCBSV in our conditions, and this could be an excellent

differential host for separating severe and milder isolates. On N. clevelandii, the

severe isolates CBSV-[MZ:Nam1-1:07] and CBSV-[TZ:Nal3-1:07] produced

symptoms early, caused severe stunting of infected plants, leaf necrosis and often

plant death. The remaining isolates including UCBSV-[UG:Kab4-3:07] caused

various forms of leaf chlorosis, the symptoms were less severe and non-lethal.

66

Put together, these collective observations on symptom diversity did not indicate

the association of a severe form of CBSD in Uganda. These results are indeed

consistent with studies on another epidemic isolate (Namulonge) from Uganda

(Winter et al., 2010) and especially agree with field observations in which the

maximum average severity recorded at the onset of CBSD in Uganda was only

2.0 (Alicai et al., 2007). In the absence of a particularly virulent virus in Uganda,

our results, however, raise serious questions as to the factors responsible for the

current outbreaks of CBSD in eastern African countries. The possible

explanations for this are the presence of unusually high populations of whitefly

vectors (B. tabaci) on cassava that may be responsible for the rapid spread of the

virus in the field, the recent widespread introduction of CMD-resistant varieties

that are particularly susceptible to CBSD, or the combination of both. Recent

surveys in Uganda indeed confirmed these possibilities, where more than 70% of

the cassavas grown in 23 districts were CMD-resistant ‘improved’ varieties, all of

which are susceptible to CBSD. These varieties also support high whitefly

numbers, in excess of 200 adults for top five leaves (Maruthi MN, personal

observations in the field). Although such ‘elite’ cassava has not been introduced

in high quantities to the Lake Zone Tanzania, the high susceptibility of local land

races grown in the region and the sudden development of unusually high whitefly

populations on cassava there is ensuring the spread of CBSD (Jeremiah and Legg,

2008; Legg et al., 2011). Identification of severe forms of CBSVs in CBSD

endemic regions is particularly worrying because the spread of these isolates into

areas of high whitefly population has greater potential to cause even more severe

damage to cassava production than yet encountered. Our results emphasize the

need for exercising strict quarantine measures for preventing further spread of

CBSD between country borders and have also identified the need for developing

cassava varieties with broad spectrum resistance to both viruses.

67

4.4.1 Conclusions

The main conclusions arising from Chapter 4 are:

1. All the five cassava varieties infected with UCBSV-[UG:Kab4-3:07]) isolate

produced relatively milder symptoms compared to the same varieties infected

with the remaining five isolates.

2. Differences in symptom severity following infection by CBSV isolates and

UCBSV isolates is attributed to differences between the virus species and

also, to differences between the host varieties.

3. CBSV-[MZ:Nam1-1:07] and CBSV-[TZ:Nal3-1:07] are more pathogenic on

N. benthamiana and N. clevelendii than the remaining four isolates.

68

CHAPTER 5: Examining the non-vector modes of transmission of Cassava

brown streak viruses

5.1 Introduction

The whitefly, B. tabaci, was shown to be the vector of cassava brown streak

viruses (Maruthi et al., 2005; Mwere et al., 2009). Recently there was increased

spread of CBSD in many areas of East Africa (Alicai et al., 2007; Legg et al.,

2011) and this has raised additional questions on the mode of CBSV

transmission. This was because the low rates of transmission obtained by Maruthi

et al. (2005) and Mwere et al. (2009) in controlled laboratory conditions could

not explain the high rates of disease spread in the field. Previous attempts to

transmit the virus by other suspected insect vectors such as the aphid, Myzus

persicae Sulz (Hemiptera: Aphididae) were also unsuccessful. The lack of

appreciable rate of transmission by vector has brought about suspicion over the

contribution of non-vector modes in the spread of the virus. The rate of

transmission of virus was not stated clearly in artificial sap-inoculation conducted

by Lister (1959), or the efficiency of the method in comparison to other methods.

Similarly, graft-inoculation of CBSV described by Storey (1936; 1939) did not

report the efficiency of the technique as compared to other methods.

CBSD was also thought to be transmitted naturally between healthy and infected

cassava plants the field (Hillocks et al., 1999; Kanju et al., 2003a). Other non-

vector methods of virus transmission including contaminated tools, hand leaf

picking (a procedure followed in some SSA countries to harvest leaves) and by

sap have no t previously been studied. Studies were therefore, undertaken to

determine if CBSVs can be transmitted by a) contaminated tools while cutting

infected and uninfected plants, (b) leaf picking (c) sap-inoculation of cassava

varieties and (d) to compare these to that of virus inoculation by grafting.

5.2 Materials and Methods

5.2.1 Cassava varieties and UCBSV and CBSV isolates

Two disease-free susceptible cassava varieties Albert and TMS60444 were grown

and tested to confirm the absence of virus in them. Albert and TMS60444 were

69

used because of their susceptibility to both UCBSV and CBSV. UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] were used in the experiments.

5.2.2 Sap-inoculation

Sap-inoculation experiments were conducted from February to December, 2008.

The protocol followed for sap-inoculation of the healthy plants of vars. Albert

and TMS60444 is described in section 4.2.4. Each treatment comprised of 10

plants for each variety-virus combination, and the experiment was repeated three

times which contained a total of 120 inoculated plants for two varieties (10 plants

x 3 replications x 2 varieties x 2 isolates = 120). The inoculated plants were

further grown in the quarantine glasshouse and observed for symptom

development for at least three months. Plants inoculated with buffer alone served

as controls. The efficiency of transmission of UCBSV and CBSV was determined

by assessing the presence of the virus in inoculated plants six months after

inoculation. The number of weeks to the first appearance of CBSD leaf symptoms

was recorded and plants were tested for virus by RT-PCR.

5.2.3 Sap-injection

CBSD-infected sap was collected directly from 10 month old CBSD-infected

plants of var. Ebwanateraka (Figure 5.1a) using 10 ml sterile syringe (Plastipak,

UK) and 5 mm rubber tube (Smith medical international, UK). Plants were cut at

about 1-2 feet from the bottom and the cut end was attached to the rubber tube.

The sap that was released from the cut end was collected in the rubber tube,

which was collected using a syringe. The collected sap was then injected onto the

healthy cassava plants of Albert and TMS 60444 using a needle. Sap was injected

at the base of the leaf petiole as this was the soft part of the plant (Figure 5.1b).

Ten plants for each variety-virus combination were sap-injected and observed for

symptom development. The experiment was replicated thrice, which contained a

total of 120 inoculated plants. Plants injected with sap collected from healthy

plants served as controls. The efficiency of transmission of UCBSV and CBSV

by this method was determined as described above (section 5.2.2).

Figuplan

5.2.

An

whi

and

NRI

TM

Ebw

affe

viru

plan

and

betw

UCB

5.2.

ure 5.1: Conts (b).

.4 Leaf pick

experiment

ich is a pro

d animal fee

I, from Ma

MS60444 we

wanatareka.

ected as wel

us by contam

nts for Albe

d observed

ween the he

BSV and C

2).

ollection of

king

t to test the

cess comm

eds (Figure

arch to Dec

ere grown in

At three

ll as -free p

minated han

ert and TMS

for CBSD

ealthy plant

CBSV by th

f CBSD-infe

e possibility

monly practi

e 5.2), was

cember, 20

n pots alon

months of

plants altern

nds. Leaf pi

S60444. Exp

D symptom

ts served as

his method

70

fected sap (a

y of virus tr

ced by farm

conducted

09. Ten pl

ngside 20 CB

f age, leave

natively with

icking was d

perimental p

expression

s controls. T

was determ

a), injection

ransmission

mers for lea

d in the qua

ants for ea

BSD-infect

es were ha

h the intenti

done three t

plants were

n for six m

The efficien

mined as des

n onto healt

n through le

aves as sou

arantine gla

ach variety

ted cuttings

arvested fro

tion of trans

times for a t

kept in the

months. Le

ncy of trans

scribed abo

thy cassava

eaf picking,

rce of food

asshouse at

Albert and

of the var.

om CBSD-

smitting the

total of 120

glasshouse

eaf picking

smission of

ove (section

a

,

d

t

d

.

-

e

0

e

g

f

n

FiguR.J.

5.2.

To

exp

CBS

pots

mon

The

sing

this

and

inoc

wer

and

ure 5.2: Le. Hillocks)

.5 CBSD-co

assess infec

eriments we

SV-infected

s alongside

nths, a pair

e contamina

gle cut of an

process, 30

d CBSV). Th

culated plan

re cut using

d CBSV by t

eaf picking

ontaminate

cted cutting

ere conduct

d cuttings of

e 50 healthy

of secateur

ated secateu

n infected st

0 plants we

he experime

nts. Ten pla

g uninfected

this method

in the field

ed tools

g tools (Sec

ted from Ap

f the var. Eb

y plants fo

rs was used

urs were the

tem was fol

ere inoculat

ent was rep

ants of each

d secateurs.

d was determ

71

by a farme

ateurs) as a

pril to Dece

bwanaterak

or each Alb

d to cut an

en used to c

llowed by a

ted for each

licated thric

h variety w

. The effici

mined as de

er in Tanzan

a potential s

ember, 2008

ka were esta

bert and TM

infected ste

cut healthy

cut on a he

h variety an

ce, which co

were maintai

ency of tra

scribed abo

nia (photo:

source of vi

8. Twenty C

ablished ind

MS60444.

em var. Ebw

plants (Fig

ealthy plant

nd virus typ

ontained a t

ined as con

ansmission

ove (section

courtesy of

irus spread,

CBSUV and

ividually in

After three

wanateraka.

gure 5.3). A

. Following

pe (UCBSV

total of 120

ntrol, which

of UCBSV

5.2.2).

f

,

d

n

e

.

A

g

V

0

h

V

FiguCBSexp 5.2.

The

mon

effic

vect

con

each

of t

desc

5.3

5.3.

CBS

cass

5.1)

in th

CBS

(Fig

ure 5.3: TrSD-infectederiment (b)

.6 Graft-ino

e graft-inocu

nth old plan

ciency of U

tor transmis

ntained a to

h variety w

transmission

cribed abov

Results

.1 Sap-inoc

SV-[MZ:Na

sava to viru

). A period

he sap-inoc

SV-[MZ:Na

gure 5.4).

ransmissiond stem cut.

oculation

ulation prot

nts of Alber

UCBSV an

ssion metho

tal of 120

ere graft-in

n of UCBS

ve (section 5

culation

am1-1:07]

us-free cass

of eight we

culated plan

am1-1:07] t

n of CBSUttings used

tocol describ

rt and TMS

nd CBSV tr

ods. The ex

graft-inocu

noculated wi

SV and CB

5.2.2).

was trans

sava varieti

eks was req

nts. A total o

tested positi

72

UV and CBd as virus

bed before (

S60444 wer

ransmission

xperiment w

ulated plants

ith healthy

SV by this

smitted by

ies but not

quired befor

of 23% of T

ive for the v

SV using isource fo

(section 3.2

e graft-inoc

n in compa

was also rep

s for each

scions as co

method w

sap-inocu

UCBSV-[U

re the CBSD

TMS60444

virus compa

infected secor contamin

2.5) was foll

culated to c

arison with

peated three

variety. Te

ontrols. The

was also det

ulation from

UG:Kab4-3

D symptom

plants inoc

ared to 17%

cateurs (a),nated tools

lowed. Five

compare the

other non-

e times, and

en plants of

e efficiency

termined as

m infected

:07] (Table

s expressed

culated with

% for Albert

, s

e

e

-

d

f

y

s

d

e

d

h

t

Figuampexpinoctranfrom100

ure 5.4: A plified proeriments usculation, (bnsmission. (m CBSD-in0 bp molecu

representatoducts for sing CBSV ) samples t-) negative

nfected planular weight m

tive picturesamples

F3 and CBested from control from

nt. The size markers (Ne

73

e of agarosefrom UCB

SV R3 primgraft-inocum healthy cladder (M)

ew England

e gel electrBSV and

mers. (a) Samulation and control plan) at each bod biolabs).

rophoresis oCBSV tr

mples tested(c) for othe

nts; (+) positorder of the

of RT-PCRransmissiond from sap-er modes oftive control

e gels is the

R n -f l e

74

5.3.2 Sap-injection

None of the plants from both Albert and TMS60444 sap-injected with the two

isolates exhibited CBSD symptoms. All plants tested negative in RT-PCR after

six months (Figure 5.4; Table 5.1).

5.3.3 Leaf picking

Similarly, none of the tested plants from Albert and TMS60444 expressed CBSD

symptoms in the leaf picking experiment for the two virus isolates. All plants

tested were negative by RT-PCR (Figure 5.4; Table 5.1).

5.3.4 CBSD-contaminated tools

None of the cuttings made from virus contaminated secateurs sprouted with

CBSD symptoms six months after planting. CBSVs were not detected by RT-

PCR (Figure 5.4; Table 5.1).

5.3.5 Graft-inoculation

CBSV-[MZ:Nam1-1:07] was transmitted with 100% efficiency to both varieties

while the rates of UCBSV-[UG:Kab4-3:07] transmission varied between 77-80%

(Table 5.1). The time taken for symptom expression between the viruses also

varied. Plants infected with CBSV-[MZ:Nam1-1:07] expressed symptoms in 1-2

weeks, while UCBSV-[UG:Kab4-3:07]-infected plants took 4-5 weeks. All the

symptomatic plants were tested positive by RT-PCR (Figure 5.4; Table 5.1) and

asymptomatic and control plants tested negative.

75

Table 5.1: Summary of non-vector modes of transmission of UCBSV and CBSV.

Control

Time to CBSD

symptoms (week)

CBSVs-positive

(RT-PCR)

Efficiency of

transmission (%)

Treatment UCBSV CBSV UCBSV CBSV UCBSV CBSV UCBSV CBSV

Sap-inoculation

Albert 0/10 0/10 - 8 0/30 5/30 0 17

TMS60444 0/10 0/10 - 7 0/30 7/30 0 23

Sap-injection

Albert 0/10 0/10 - - 0/30 0/30 0 0

TMS60444 0/10 0/10 - - 0/30 0/30 0 0

Leaf picking

Albert 0/10 0/10 - - 0/30 0/30 0 0

TMS60444 0/10 0/10 - - 0/30 0/30 0 0

Contaminated tools

Albert 0/10 0/10 - - 0/30 0/30 0 0

TMS60444 0/10 0/10 - - 0/30 0/30 0 0

Graft-inoculation

Albert 0/10 0/10 5 2 23/30 30/30 77 100

TMS60444 0/10 0/10 4 1 24/30 30/30 80 100

-; indicated no CBSD symptom was observed and no CBSVs detected by RT-PCR at six months after inoculation.

76

5.4 Discussion

The main objective of this study was to determine the efficiency of transmission

using non-vector modes of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-

1:07] to two susceptible cassava varieties. In sap-inoculation experiments,

slightly greater transmission rates of CBSV-[MZ:Nam1-1:07] (23%) was

achieved on TMS60444 compared to Albert (17%), which probably indicates that

TMS60444 is more susceptible to CBSD than Albert, although no differences

were observed in symptom expression.

Graft-inoculation was the most efficient and effective of the techniques assessed

because up to 100% transmission was attained, notably for the CBSV-

[MZ:Nam1-1:07] isolate. UCBSV-[UG:Kab4-3:07], which was not transmitted

through sap-inoculation, but 77-80% graft-transmissible. The rate of graft-

transmission of UCBSV on TMS60444 obtained in this study was low compared

to rate obtained by Yadav et al. (2011) (100%). In addition, a relatively short time

was required for virus detection and symptom expression when UCBSV-

[UG:Kab4-3:07] or CBSV-[MZ:Nam1-1:07]-infected scions were grafted onto

healthy cassava plants, which further suggests that this technique is ideal for virus

transmission studies. The findings of this study are consistent with CABRI (1998)

that graft-inoculation is an efficient way of transmitting viruses that are not

readily or not at all transmissible by sap to susceptible host plants. The study

further demonstrated that graft-inoculation is achievable for both viruses and at

high transmission rates, suggesting the technique is suitably efficient for indexing

and detection of UCBSV and CBSV.

Both UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] were not transmitted

through hand leaf picking, contaminated tools or sap-injection which contradicts

results obtained in other virus studies (Ferguson, 2009; Calvert and Thresh,

2002). These results are not entirely surprising since both infected and healthy

cassava plants are cut using single tool both by farmers and researchers, often

unknowingly, but incidences of diseases transmitted by contaminated tools have

not been known and these techniques may therefore not contribute to the spread

of UCBSV and CBSV. However, there are viruses and virus-like particles

(viroids) that can be transmitted by contaminated tools, which include Cassava

77

common mosaic virus (CsCMV) in cassava, spindle tuber viroid, citrus exocortis

viroid in citrus, Potato virus X in potato and Pepino mosaic virus (Manzer and

Merriam, 1961; Broadbent et al., 1968; Calvert and Thresh, 2002; Ferguson,

2009). The findings of this study are promising with regard to the avoidance of

non-vector sources of virus transmission in that it is not necessary to sterilize

pruning tool in order to prevent transmission of UCBSV and CBSV. This

knowledge will be of particular value to farmers and researchers alike; who

routinely produce cuttings using single cutting tools, and should reassure users

that such practice will not lead to the transmission of UCBSV and CBSV. Of

relevance to researchers working on cassava viruses, the lack of transmission of

the UCBSV and CBSV through contaminated tools suggests a safe base for in

situ maintenance and propagation of different CBSD isolates together in one

place in the glasshouse which offers a great opportunity for research purposes

through the economy of space.

The lack of transmission of the virus through leaf picking suggests that ‘normal’

agronomic practices including touching the plants and leaf picking/harvesting

does not contribute to the spread of UCBSV and CBSV. The inability of both

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] to be spread from

infected hand is important not just for disease epidemiology but also for research

purposes as keeping two viruses in a laboratory does not result in cross

contamination.

5.4.1 Conclusions


1. Both virus isolates produced symptoms in both varieties upon graft-

inoculation

2. CBSV and UCBSV are not transmissible from contaminated secateurs,

leaf picking between diseased and healthy plants and direct injection of

sap collected from CBSD-infected cassava plant.

78

3. Among all the non-vector transmission techniques tested, graft-

inoculation is most efficient for transmitting both UCBSV and CBSV.

However, since graft-inoculation is not a routine practice done by farmers

and yet the other routine management practice seemed not to contribute to

UCBSV and CBSV spread. Whitefly (B. tabaci) and use of already

cassava-infected materials are responsible for CBSD perpetuation in

farmer’s field.

79

CHAPTER 6: Mechanisms of resistance to CBSD in cassava varieties

6.1. Introduction

The symptoms of CBSD on cassava vary, depending largely on the tolerance

level of the varieties and the virus type (Hillocks et al., 1996). Cassava varieties

in the field differ in their symptom expression. Those that show foliar symptoms

but in which the expression of root necrosis is delayed or absent are referred to as

CBSD ‘tolerant’ varieties (Hillocks et al., 2002; Walkey, 1985). Some varieties

show decreased incidence of foliar symptoms and may or may not succumb to

root necrosis (Hillocks and Jennings, 2003). The term ‘resistance’ in this context

means that fewer plants become infected or that disease development is restricted

after infection. A variety of cassava is considered susceptible if the virus can fully

complete three main processes in the host: genome replication, cell to cell

movement (local) and long distance (vascular-dependent) movement (Carrington

and Whitham, 1998). Symptom expression within a susceptible host may vary

depending on virus isolate, environmental conditions and physiological aspects of

the host’s response to infection. These interactions collectively result in changes

in host’s physiology, growth and symptoms. Variation in the expression of CBSD

among cassava varieties was reported (Hillocks and Jennings, 2003), suggesting

that some inherent characteristics of the varieties control resistance/susceptibility.

There are no reported studies on virus-host interactions for CBSD that have

investigated the mechanisms of susceptibility or resistance under uniform

controlled conditions. There is limited and conflicting information on resistance

to CBSD. Due to the limited molecular information on virus–host interactions,

especially concerning resistance or susceptibility, experiments were initiated for a

greater understanding of the mechanisms of resistance to CBSD by assessing the

differences in cassava varieties with respect to (i) symptom expression and virus

replication over time (ii) determine the rate of reversion from UCBSV and CBSV

infection (iii) determine varietal differences in terms of vector fecundity,

reproduction and survival, and (v) to determine the susceptibility of cassava

varieties to the viruses by whitefly (B. tabaci) transmission.

80


6.2.1 Cassava varieties and virus isolates

Cassava varieties Albert (CBSD susceptible), Kiroba (tolerant), and Kaleso

(field-resistant) were tested for virus as described before (section 3.2.1, 3.2.2 and

3.2.3). Kaleso is a widely adopted CBSD-resistant variety in Kenya, and Kiroba

is a widely grown Tanzanian landrace (Hillocks, 2003; 2005; 2006). The two

virus isolates that were identified in the symptom diversity study (section 4.3.4);

CBSV-[MZ:Nam1-1:07] (severe) and UCBSV-[UG:Kab4-3:07] (relatively mild)

were used in experiments to measure virus movement, titre and the rate of

reversion. Transmission by the whiteflies was done only with CBSV-[MZ:Nam1-

1:07]. The isolates were graft-inoculated on to the healthy cassava plants

following the protocol described before (section 3.2.4). The methods for in vitro

propagation of cassava varieties and sample preparations, RNA extractions using

CTAB method, cDNA synthesis and RT-PCR were also described in Chapter 3

(section 3.2.1, 3.2.2, 3.2.3, 3.2.7, 3.2.8 and 3.2.9). Three months after planting

(MAP), plants were transferred and grown in relatively large pots (283 mm

diameter, which can accommodate 10 litres of compost) to facilitate robust

growth and the development of roots for sampling.

6.2.2 Grafting of cassava varieties, symptom development and severity

The graft-inoculation protocol described (section 3.2.4) was used for the

transmission of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] isolates

onto two-month-old healthy cassava plants of the above three cassava varieties

(section 6.2.1). Grafting was repeated at four week intervals until all the plants

became infected. Plants were kept in a relatively constant environment at 28 ± 5 oC and 50-60% RH for symptom development. The efficiency of UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] transmission by graft-inoculation,

on each variety was calculated as the number of plants with CBSD leaf (chlorosis,

vein clearing, and blotches), stem (brown streak or lesion) or root symptoms

(necrosis or constrictions) expressed as a percentage of the total number of plants

in each variety. CBSD symptoms on leaves were recorded on each variety at four

week interval. The severity of symptoms was rated according to the Hillocks et

al. (1996) scale, as described in section 4.3.4. Symptoms on roots were recorded

81

96 weeks after graft-inoculation of all the plants by cutting the roots at 1 cm

interval. A cut was made from the distal end of each root and photographed

(using camera Nikon D5000). The severity of root necrosis was rated by visual

inspection on a 5 point scale of 1-5 using the scoring methods of Hillocks et al.

(2001) and McSween (2006), which was described as: 1 = no visible root

discoloration, 2 = presence of small yellow or brown necrosis on the cross

sections of the root, 3 = presence of medium (2-10%) brown or black necrosis on

the cross section of the root, 4 = presence of severe (10-30%) brown or black

necrosis on the cross section of the root, 5 = very severe (>30%) brown or black

necrosis on the cross section of the root.

6.2.3 Sampling for measuring virus detection and movement in cassava

Twentyfour hours after graft-inoculation, leaves and root samples from three

cassava varieties (Kaleso, Kiroba and Albert) were collected and analysed by RT-

PCR. Three graft-inoculated plants were selected for sampling from each cassava

variety infected with UCBSV-[UG:Kab4-3:07] or CBSV-[MZ:Nam1-1:07].

Samples were taken from leaves (third or fourth leaf from top), secondary and

tertiary roots at 24 h intervals in the first week. Subsequently, samples were

collected at weekly interval for 4 weeks, followed by monthly interval for 9

months (36 weeks). A total of 36 samples were collected at each time point on

three selected plants for each variety-virus combination (i.e., 3 plants × 2 samples

per plant × 3 varieties × 2 viruses = 36). This resulted in the collection of a total

of 144 (36 samples × 4 collection times) samples in the first week after graft-

inoculation, followed by weekly collections for three weeks 108 (36 weekly

samples x 3 weeks) by the end of 4 weeks. After four weeks 288 samples were

collected at four weeks intervals (36 samples × 8). Overall a total of 540 roots and

leaf samples were collected by the end of 36 weeks (9 months) and 468 were

analysed for virus detection, movement and concentrations. Samples were tested

by RT-PCR.

6.2.4 RT-qPCR

Total nucleic acids were extracted from cassava samples as described previously

in Chapter 3 (section 3.2.7). The quality and quantities of RNA in each sample

was assessed using a Biophotometer (eppendorf, UK). ImProm-IITM Reverse

82

Transcriptase kit was used following the manufacturer’s instructions (Promega,

UK) for cDNA synthesis. The amount of RNA used in each cDNA synthesis

reaction was 1 µg as recommended by Moreno et al. (2011). Samples were

DNase-treated using RNase-free DNase RQ 1 treatment kit (Promega, USA)

according to manufacturer’s instructions to remove DNA. The DNase treated

samples were used for first strand cDNA synthesis for real-time reverse

transcription-quantitative PCR (RT-qPCR) (Bustin et al., 2009). To minimize any

errors due to pipetting differences, cDNA was synthesised in duplicates of each

sample and their threshold cycle (Ct) values were averaged during data analysis

as described by Kokkinos and Clark (2006). In addition, every plate included a

non-template water control (NTC). Three µl of random primer mix (New England

Biolabs, UK) was used in the first master mix. The cDNA synthesis protocol for

the second master mix was the same as described (section 3.2.8).

6.2.5 Measuring virus titres in cassava

For quantification of the virus titre in cassava varieties; the RT-qPCR method

described by Moreno et al. (2011) was used to quantify gene expression in

Albert, Kiroba and Kaleso. CBSVs-specific primers, forward (Abarshi et al.,

2012) and reverse were used for virus amplification (Table 6.1). Previously

identified reference genes, ribulose biphosphate carboxylase oxygenase gene

(RubiscoL) and the ribosomal protein (L2) were used as internal controls for data

normalization. Primers used were RubiscoLF and RubiscoLR designed to amplify

a PCR product size of 171 bp (Nassuth et al., 2000; Alabi et al., 2008; Abarshi et

al., 2012) and L2F and L2R with PCR fragment of 135 bp (Nicot et al., 2005). A

typical qPCR reaction mixture contained a total volume of 25 μl (Table 6.2). The

mixture was dispensed into qPCR plates using robot Ep Motion 5070 (Hamburg,

Germany) to avoid pipeting error. The qPCR plates were sealed using adhesive

Master clear qPCR film (eppendorf, UK) to provide protection against

evaporation. Thermal cycling conditions used in qPCR are described below

(Table 6.3): The qPCR reactions were performed with the Master Cycler Ep

RealPlex PCR system (Hamburg, Germany) using the SDS software for data

measurement and analysis.

83

Table 6.1: Primers used in qPCR reactions for the quantification of UCBSV and

CBSV in cassava varieties

Table 6.2: Reaction mixture for qPCR quantification of the viral cDNA

Reagent × 1 sample (μl)

SDW 8.5

SYBR Green (1000×) 12.5

Forward primers (5 µM) 1.5

Reverse primers (5 µM) 1.5

cDNA template 2.5

Total 25.0

Table 6.3: Temperature profile and thermal cycling conditions

Steps Temperature (oC) Time Number of cycles

Initial denaturetion 95 15 min

× 40 cycles

Final denaturation 94 ¼ min

Annealing 55 ½ min

Extension 72 ½ min

Primer name Primer sequence (5´-3´)

Product

size Reference

CBSVF3 GGARCCRATGTAYAAATTTGC 130 bp Abarshi et al., 2012

CBSVR4a GCWGCTTTTATYACAAAMGC

RubiscoLF CTTTCCAAGGCCCGCCTCA 171 bp Nassuth et al., 2000

RubiscoLR CATCATCTTTGGTAAAATCAAGTCCA Alabi et al., 2008

L2F TGGTGTTGCCATGAACCCTGTAGA 135 bp Nicot et al., 2005

L2R CGACCAGTCCTCCTTGCAGC

84

6.2.6 Data analysis from RT-qPCR

For data analysis the default settings of the Master Cycler Ep Realplex PCR

system software were used and qPCR efficiency was calculated based on the raw

fluorescence data (∆Rn) exported as output file and subsequently imported into

the qPCR program (Ruijter et al., 2009). Relative quantifications were performed

based on the cycle threshold (Ct) method described by Livak and Schmittgen

(2001). The Ct value is defined as the cycle number at which the ∆Rn crosses the

threshold. The fold change in virus (target gene) relative to the reference gene

(RubiscoL) was determined by the Ct formula given as:

Ct = 2^-ΔΔCt: Ct = 2 ⁻ [(Ct target gene) – (Ct reference gene)] – [(mean Ct target gene) – (mean

Ct reference gene)]

Where: Ct = threshold cycle, ΔΔCt = Mean fold change. The geometric averaging

of one of the two internal controls was used for data normalization. Leaf samples

collected from the three cassava plants in each variety were pooled according to

the protocol described by Nicot et al. (2005) and used as templates in the qPCR

assay and their Ct values were compared. Adequate performance of the qPCR

method was confirmed by low standard deviations for technical duplicates. A

comparison between qPCR normalized data for each infected variety was done

using the Microsoft Excel and the data presented to indicate relative virus load in

each variety at each time point. The shifted Gompertz model was tested to

determine its appropriateness to describe the virus titre progress curve (Appendix

1.3) from the same Ct data using the formula:

Ct = bze-ηz (1+η (1-z))

Where z = e-bt, b = the scale parameter, η = the shape parameter, t = time (in

weeks) and a constant multiplier (e = 2.7183).

6.2.7 Assessment of reversion in CBSD-infected cassava varieties

Stem cuttings from Kaleso, Kiroba and Albert were obtained from 20 months old

CBSD-infected plants. For each virus-variety combination, 54 cuttings of 10 cm

were made from graft-inoculated plants of each variety (section 6.2.2) and

planted into plastic pots containing John Innes No. 2 compost. The plants were

grown in the quarantine glasshouse. The proportion of the plants that sprouted

85

from each variety per isolate was recorded monthly. The term reversion is used to

describe the production of symptom-free plants from cuttings derived from

diseased plants (Fondong et al., 2000). The rate of reversion in CBSD-infected

cuttings was assessed based on the proportion of plants that did not develop

symptoms upon sprouting and grown up to six months after planting. Symptoms

were recorded weekly by visual observations. The presence or absence of

UCBSV and CBSV on symptom-free plants (by visual observation) in each

variety was further confirmed by RT-PCR at six months after planting. The role

of several parameters including the length of the cassava stem cutting and the

position of the stem (upper, middle and smaller) were investigated;

Length of stem cuttings on reversion: Different lengths of stem cuttings were

taken from CBSD-infected plants of Kaleso, Kiroba and Albert. Cuttings were

made short (10 cm), intermediate (15 cm) and long (20 cm) pieces and planted in

pots of 0.5 litres. Twenty cuttings were made for each length-variety-virus

combinations and were replicated thrice. The rate of reversion was assessed as the

percentage of disease-free plants obtained six months after planting.

Effect of cutting position on reversion: Stems were taken from CBSD-affected

plants and divided into; lower (woody stem), middle (rigid stem) and upper (soft

stem) parts. From each part of the plant, 10 cm cuttings were made and grown in

the NRI quarantine glasshouse (Figure 6.1). Eighteen cuttings were planted for

each stem position and virus-variety combinations and the experiment was

repeated three times using the same mother plant as source material. Plants were

observed for symptoms for up to six months. Reversion in different stem

positions was compared using a multiple comparison (ANOVA) to determine the

effects of stem position on reversion.

Figu

6.2.

The

cass

wer

con

rear

exp

wer

cass

Alb

repl

x 3

then

60%

surv

nym

und

AN

perc

to a

Pr =

Wh

ure 6.1: Ca

.8 Whitefly

e colony of

sava in Uga

re collected

ntaining two

red in the n

eriment (Fi

re collected

sava plant.

bert, Kiroba

licate exper

varieties x

n removed

% RH and

vival of B.

mphs develo

der a stereo

OVA to de

centage resp

adults was c

= {(ex) / (1+

ere x = logi

assava stems

y fecundity

cassava B.

anda (Marut

from the ca

o young cas

new cage fo

gure 6.2). A

and transfe

The top fiv

and Kaleso

riment to giv

3 replicatio

mechanical

L12:D12 f

tabaci was

oped and th

o binocular

etermine the

ponse of eg

alculated fr

+ ex)} × 100

it, Pr = perc

s planted as

studies to d

tabaci use

uthi et al., 2

ages and re

ssava plant

or four week

Adult whitef

erred into a

ve leaves of

o. Fifty trea

ve a total o

ons). White

lly. Plants w

for the egg

s recorded

he adults em

r microsco

e effect of

ggs that surv

rom the logi

0

centage resp

86

s part of CB

determine

d in this stu

001, 2002)

eleased into

ts of the va

ks to obtain

flies of mix

clip cage w

f 10 plants

atments wer

f 450 inocu

eflies were

were kept i

to develop

by measuri

merged on e

ope. The d

varieties on

vived to nym

it estimates

ponse and th

SD reversio

the mechan

udy was ori

. A total of

a new cage

ariety Colum

n adequate n

xed sex likel

which was at

were inocu

e made for

ulated leave

allowed to

n the insec

p into adult

ing the num

each cassav

data obtaine

n the fecun

mphs, nymp

using the fo

he constant

on experime

nisms of re

iginally obt

f 1000 B. ta

e of 112 x 5

mbian. B. t

number nee

ly (5:5 male

attached to t

ulated for e

each variet

es (10 plants

lay eggs fo

ctary at 28

lts. The fec

mber of egg

va variety b

ed were an

ndity of B. t

mphs to adul

formula:

e = 2.7183.

ent.

esistance

tained from

abaci adults

50 x 50 cm,

tabaci were

eded for the

e to female)

the leaf of a

each variety

ty in a three

s x 5 leaves

or 48 h and

± 2 oC and

cundity and

gs laid, the

by counting

nalysed by

tabaci. The

lts and eggs

m

s

,

e

e

)

a

y

e

s

d

d

d

e

g

y

e

s

Figuadu

6.2.

Thi

cass

adu

(dim

you

1:07

plac

acce

Thir

tota

taba

six

mon

tran

perc

ure 6.2: (a)ults (white sp

.9 Whitefly

s experime

sava varietie

ult B. tabac

mension 60

ung cassava

7] (Figure

ced onto le

ess period (

rty treatmen

al of 90 ino

aci were re

months at

nitored on i

nsmission w

centage of t

) B. tabacipots) on the

y inoculatio

ent was car

es when CB

ci were co

cm long x

a plants of

6.3). B. ta

eaf number

IAP, Appro

nts were ma

oculated pla

moved mec

28 ± 2 o

inoculated l

was determ

the total num

colony mae newly ope

on studies

rried out to

BSV was tra

ollected from

x 60 cm wi

f var. Ebwa

abaci adults

three of th

oximately 3

ade per var

ants (10 pl

chanically aoC and 60%

leaves and

mined as pro

mber of plan

87

aintained in ened cassava

o determine

ansmitted b

m the colo

de x 90 cm

anateraka in

s were then

he test plan

0).

iety in a thr

ants x 3 va

after inocul

% RH. CB

on entire re

oportion of

nts tested.

the NRI ina leaf in the

e the susce

y whiteflies

ony and in

m high) for

nfected wit

n transferre

nts, for 24h

ree replicate

arieties x 3

ation. Thes

BSD sympto

ecipient pla

f infected p

nsectary, (be colony.

eptibility o

s. Approxim

ntroduced in

24 h conta

th CBSV-[

ed into the

h of virus

e experimen

3 replication

se were mai

om develo

ants. The ef

plants expr

b) B. tabaci

f the three

mately 1000

nto a cage

aining three

MZ:Nam1-

e clip-cages

inoculation

nt to give a

ns). The B.

intained for

pment was

fficiency of

ressed as a

i

e

0

e

e

-

s

n

a

r

s

f

a

Figuon wleafsym

ure 6.3: (a)which whitef circled re

mptom expre

) CBSD-infeflies were

ed) in the cession.

fected plantallowed to cage, and

88

ts of var. Ebfeed freely(b) CBSV-

bwanaterakon sympto

-transmitted

ka used as vomatic leaved plants inc

virus sourcees (examplecubated for

e e r

89

6.3. Results

6.3.1 Rate of graft-transmission, symptoms development and severity on

cassava varieties

Plants graft-inoculated with the CBSV-[MZ:Nam1-1:07] became infected in less

than two weeks and the rate of transmission varied among cassava varieties

(Table 6.4). Development of symptoms on graft-inoculated plants varied between

the isolates. CBSV-[MZ:Nam1-1:07] produced the earliest and greatest rate of

transmission on all three cassava varieties (Table 6.4). All inoculated plants were

infected at 16 weeks after graft-inoculation.

CBSD symptoms on cassava leaves were observed on all the three varieties. The

type of leaf symptoms expressed by each cassava variety depended on the isolate

and they were similar to the ones observed in previous experiments, in which

relatively milder symptoms were expressed by the plants infected with UCBSV-

[UG:Kab4-3:07] compared to the severe symptoms by CBSV-[MZ:Nam1-1:07].

Both virus isolates produced lesions on stems on all plants of Albert, and only

40% of the Kiroba plants produced CBSV-[MZ:Nam1-1:07] symptoms (Figure

6.4a and b). Stem symptoms were seen on Albert but not on Kaleso by either

isolate (Figure 6.5a and b).

Depending on the isolate, root necrosis was observed on all the cassava varieties,

albeit with differing severity. Root necrosis was found in all the roots harvested

from Albert with the two viruses. Roots harvested from Kaleso infected with

UCBSV-[UG:Kab4-3:07] were symptomless while CBSV-[MZ:Nam1-1:07]

infections did cause small necrotic dots (Figure 6.6, 6.7 and 6.8). The scores for

the root symptom severity were on average 1.8 for UCBSV-[UG:Kab4-3:07] and

2.3 for CBSV-[MZ:Nam1-1:07]. The lowest score was recorded on Kaleso while

the greatest on Albert (scores 3 and 4). The mean root severity score on Kiroba

was 1.5 for CBSV-[MZ:Nam1-1:07] and 1.7 for UCBSV-[UG:Kab4-3:07]

(Figure 6.9).

90

Table 6.4: Rate of symptoms development of UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] on cassava varieties.

Cassava

varieties Number of

graftsa

Number graftedb

Number

infected/Number

re-grafted

Proportion

(%)

UCBSV CBSV UCBSV CBSV UCBSV CBSV

Kaleso 1st 5 5 0/5 0/5 0 0

2nd 5 5 0/5 3/5 0 60

3rd 5 2 2/5 2/2 40 100

4th 3 - 3/3 - 100 -

Kiroba 1st 5 5 0/5 2/5 0 40

2nd 5 3 2/5 3/3 40 100

3rd 3 - 3/3 - 100 -

4th - - - - - -

Albert 1st 5 5 4/5 5/5 80 100

2nd 1 - 1/1 - 100 -

3rd - - - - - -

4th - - - - - - aNumber of repeated graftings on cassava varieties. bNumber of plants grafted for each repeated grafting in each variety and isolate - indicated no grafting was done on the variety because all the plants in that variety expressed CBSD with previous grafting.

91

Figure 6.4: CBSD symptoms on stems of three cassava varieties.

0

10

20

30

40

50

60

70

80

90

100

4 8 12 16CB

SD

inci

den

ce o

n s

tem

(%

)

Weeks after graft-inoculation

CBSUV-[UG:Kab4-3:07]

Kaleso

Kiroba

Albert

0102030405060708090

100

4 8 12 16

CB

SD

inci

den

ce o

n s

tem

(%

)

Weeks after graft-inoculation

CBSV-[MZ:Naml-1:07]

Kaleso

Kiroba

Albert

a

b

Figuharv

ure 6.5: (avested root

a) CBSD steof Kaleso 2

em sympto2.5 years aft

92

oms observeter planting.

ed on Alber.

rt, (b) exammple of thee

Figu[MZ

ure 6.6: LeZ:Nam1-1:0

eaf and roo07] on Kale

ot symptomso with mil

93

ms by UCBd necrosis (

SV-[UG:Ka(red arrow).

ab4-3:07] a.

and CBSV-

-

FiguCBS

ure 6.7: LeSV-[MZ:Na

eaf and rootam1-1:07] (

t symptoms(c and d) on

94

s by UCBSn Kiroba.

V-[UG:Kabb4-3:07] (a and b) and

d

Figuand

ure 6.8: Led b), and CB

eaf and rooBSV-[MZ:N

ot symptomNam1-1:07]

95

ms on Alber(c and d).

t by UCBSSV-[UG:Kabb4-3:07] (a

a

96

Figure 6.9: Symptom severity recorded on the roots of three cassava varieties for UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]. Symptom severity was based on a scale of 1 (no symptoms) to 5 (very severe symptoms) (Hillocks et al., 2001; McSween et al., 2006).

6.3.2 Virus detection and movement within cassava varieties

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] were not detected from

the leaves in any of the plants 24 and 48 h after graft-inoculation. CBSV-

[MZ:Nam1-1:07] was first detected in the roots from 1 out of 3 plants in Albert at

four days after graft-inoculation, which indicated that the first movement of the

virus from the graft-inoculation point was down to the roots (Figure 6.10a and b).

None of the samples from Kaleso and Kiroba inoculated with CBSV-[MZ:Nam1-

1:07] tested positive by RT-PCR at four days after graft-inoculation. Similarly,

UCBSV-[UG:Kab4-3:07] was not detected in any of the samples at four days

after graft-inoculation (Figure 6.10a and b).

Both viruses were detected at one week after graft-inoculation from both leaves

and roots in Albert, while at 12 weeks both viruses were detected in roots and

leaves of all the sampled plants in all the three varieties (Figure 6.11a, b, c and d).

At 28 weeks, only two of the three Kaleso plants had UCBSV-[UG:Kab4-3:07] in

the roots, while the virus was fluctuating in leaves. Like in Kaleso, the number of

roots that had virus varied at 36 weeks in Kiroba (Figure 6.12c; Table 6.5). Albert

did not show the fluctuation in the number of samples containing the viruses up to

36 weeks after graft-inoculation (Table 6.5).

0

1

2

3

4

5

Kaleso Kiroba Albert Kaleso Kiroba Albert

CBSUV-[UG:Kab4-3:07] CBSV-[MZ:Nam1-1:07]

Roo

t nec

rosi

s se

veri

ty

Figuat fothreRNACBSCBSKiro12 athe CBS3 sa

ure 6.10: Dfour days afee cassava A isolated SV-[MZ:NaSV-[MZ:Naoba, 7, 8 anand 13 = kngels is the

SV-[MZ:Naamples from

Detection of fter graft-inovarieties ufrom graft-

am1-1:07] (am1-1:07] (nd 9 = Albenown CBSV

100 bp mam1-1:07] w

m Albert lan

f UCBSV-[Uoculation in

using RT-PC-inoculated (from top le(from the roert, 10 and V RNA con

molecular wewas detecte

ne 8.

97

UG:Kab4-3n top leavesCR using Cplants in (

eaves), (c) Uoots). Lanes11 = health

ntrols. The eight markeed at four da

:07] and CBs (a and b), CBSVF3 an(a) UCBSVUCBSV-[Us 1, 2 and 3 hy cassava psize ladder ers (New Eays after gr

BSV-[MZ:Nand roots (

and CBSVRV-[UG:Kab4UG:Kab4-3:

= Kaleso, 4plants used(M) at eac

England Bioraft-inoculat

Nam1-1:07](c and d) ofR3 primers.4-3:07], (b)07] and (d)4, 5 and 6 =

d as control,h border ofolabs, UK).tion in 1 of

] f . ) ) = , f . f

Figuat 1threisol[MZ[MZKiro12 athe

ure 6.11: D2 weeks af

ee cassava vated from gZ:Nam1-1:0Z:Nam1-1:0oba, 7, 8 anand 13 = kngels is the 1

Detection of fter graft-inovarieties by graft-inocul07] (from to07] (from tnd 9 = Albenown CBSV100 bp mole

f UCBSV-[Uoculation inRT-PCR uated plants

op leaves), (the roots). ert, 10 and V RNA conecular weig

98

UG:Kab4-3n top leaves

using CBSVin (a) UCB

(c) UCBSVLanes 1, 211 = health

ntrols. The ght markers

:07] and CBs (a and b)

V F3 and CBBSV-[UG:KV-[UG:Kab42 and 3 = Khy cassava psize ladder (New Engla

BSV-[MZ:Nand roots (

BSV R3 priKab4-3:07], 4-3:07] and Kaleso, 4, plants used(M) at eac

and Biolabs

Nam1-1:07](c and d) ofmers. RNA(b) CBSV-(d) CBSV-5 and 6 =

d as control,h border ofs, UK).

] f

A --= , f

Figuat 3cassCBSUCBUCBLanhealThemar

ure 6.12: D6 weeks aftsava varietiSV-F3 andBSV-[UG:KBSV-[UG:K

nes 1, 2 andlthy cassava

e size ladderkers (New

Detection of fter graft-inoies using thd CBSV-R3Kab4-3:07],Kab4-3:07]

d 3 = Kalesoa plants useer (M) at eaEngland Bi

f UCBSV-[Uoculation inhe two-step3. RNA is, (b) CBSV

and (d) o, 4, 5 and 6ed as controach border iolabs, UK)

99

UG:Kab4-3n (a and b) tp RT-PCR usolated fromV-[MZ:NamCBSV-[MZ6 = Kiroba,ol, 12 and 1of the gels.

:07] and CBtop leaves (using CBSVm graft-inom1-1:07] (fZ:Nam1-1:0 7, 8 and 9 3 = known

s is the 100

BSV-[MZ:N(c and d) roV-specific poculated plafrom top l07] (from

= Albert, 1 CBSV RN

0 bp molecu

Nam1-1:07]ots of threeprimer pairants in (a)leaves), (c)the roots).

10 and 11 =NA controls.

ular weight

] e r ) ) .

= . t

100

Table 6.5: Movement of CBSVs from the point of inoculation to other parts of the

plants

Number of plants positive by RT-PCR/Number testeda

UCBSV-[UG:Kab4-3:07] CBSV-[MZ:Nam1-1:07]


Weeks leaf root leaf root leaf root leaf root leaf root leaf root

1 0/3 0/3 0/3 2/3 1/3 1/3 0/3 0/3 0/3 0/3 1/3 2/3

2 0/3 1/3 0/3 2/3 0/3 2/3 0/3 0/3 1/3 2/3 1/3 2/3

4 0/3 0/3 0/3 0/3 1/3 3/3 0/3 0/3 1/3 2/3 3/3 3/3

8 2/3 2/3 3/3 2/3 3/3 3/3 2/3 1/3 1/3 2/3 3/3 3/3

12 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 2/3 3/3 3/3

16 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3

20 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3

24 3/3 3/3 3/3 3/3 3/3 3/3 3/3 2/3 3/3 3/3 3/3 3/3

28 3/3 2/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3

32 2/3 2/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3

36 3/3 2/3 3/3 2/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 aNumber of plants infected by UCBSV-[UG:Kab4-3:07] and for CBSV-[MZ:Nam1-1:07] after graft-inoculation in the three cassava varieties, Kaleso, Kiroba, and Albert.

6.3.3 Measuring virus titres in three cassava varieties

Titres of CBSV-[MZ:Nam1-1:07] were greater in all the three cassava varieties

than UCBSV-[UG:Kab4-3:07] (Figures 6.13 and 6.14). Among cassava varieties,

Albert showed the greatest virus titre compared to Kiroba and Kaleso, which

showed medium and low level of titres, respectively. Virus titres did not vary

considerably throughout the sampling periods in Kaleso, while UCBSV-

[UG:Kab4-3:07] increased from 1 at one week to about 13.7 fold at 16 weeks

after graft-inoculation in Kiroba (Figure 6.13). The expression of CBSV-

[MZ:Nam1-1:07] in Kiroba also followed similar trend, which ranged from 1 fold

at one week to 41.9 fold at 24 weeks after grafting. In CBSV-[MZ:Nam1-1:07]-

infected plants of Albert, the virus titre increase consistently from 1 fold at week

one to about 281.7 fold at 36 weeks after graft-inoculation, which is consistent

with severe symptoms (section 6.3.1).

101

Figure 6.13: Mean fold change in UCBSV-[UG:Kab4-3:07] titres (Change in expression level = 2^-ΔΔCt) over time (weeks) in Kaleso, Kiroba and Albert.

Figure 6.14: Mean fold change in CBSV-[MZ:Nam1-1:07] titres (Change in expression level = 2^-ΔΔCt) over time (weeks) in Kaleso, Kiroba and Albert.

0

50

100

150

200

250

1 2 4 8 12 16 20 24 28 32 36

Rel

ati

ve

vir

us

titr

e

Kaleso

Kiroba

Albert

0

50

100

150

200

250

300

1 2 4 8 12 16 20 24 28 32 36

Rel

ativ

e vi

rus

titr

e

Kaleso

Kiroba

Albert

102

6.3.4 Assessment of reversion on CBSD-infected cuttings

About 80% of UCBSV-[UG:Kab4-3:07]- and 75% of CBSV-[MZ:Nam1-1:07]-

infected cuttings sprouted and grew fully from Kaleso. From Kiroba (75 and

64%) and Albert (69 and 57%), a decreasing number of cuttings sprouted (Figure

6.15), while the remaining cuttings died. Reversion was observed on all the three

cassava varieties, which was confirmed at six months after planting, when all the

cassava plants not showing CBSD symptoms were tested by RT-PCR and found

negative for the virus. Similarly, significant differences (P<0.0004) in the

reversion were observed between the three cassava varieties. In Albert, a smaller

percentage of reversion was recorded in UCBSV-[UG:Kab4-3:07] and CBSV-

[MZ:Nam1-1:07]-infected cuttings (18 and 12% respectively). This was followed

by Kiroba (21 and 16%). Kaleso (38 and 23%) showed significantly high

percentage of plants (P<0.001) recovered from UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07]-infections (Figures 6.16 and 6.17).

Figure 6.15: Proportion of cuttings sprouted from virus-affected cassava varieties. n = 54 for each variety.

0

10

20

30

40

50

60

70

80

90

100

Kaleso Kiroba Albert

% S

prou

ting


CBSV-[MZ:Nam1-1:07]

Figucutt

FigufromNRI

%re

vers

ion

ure 6.16: tings as an e

ure 6.17: Pm CBSD anI quarantine

0

10

20

30

40

50

60

70

80

90

100

% r

ever

sion

Proportion effect of rev

Plants of varnd Albert (be glasshouse

Kaleso

of diseaseversion, n =

rieties Kaleb) has not loe.

103

e-free plant54 cuttings

eso (a) showost the virus

Kirob

ts that grews for each va

wing reversis five month

a

w from virariety.

ion (loss of hs after plan

Al

CBSUV-[UG:K

CBSV-[MZ:N

rus-affected

symptoms)nting in the

bert

Kab4-3:07]

am1-1:07]

d

) e

104

6.3.5 Effect of stem cuttings on plant regeneration and rate of reversion

About 68% of cuttings (from 10 cm length) infected with UCBSV-[UG:Kab4-

3:07] each for vars. Kaleso and Kiroba, were sprouted and grown fully into

cassava plants. The percentage of cuttings that were sprouted in Albert was 65%.

The growth of plants from UCBSV-[UG:Kab4-3:07]-infected cuttings of 15 cm

length were 90%, 92% and 80% from Kaleso, Kiroba and Albert respectively.

The percentage of cuttings that sprouted from UCBSV-[UG:Kab4-3:07]-infected

cuttings of 20 cm were greater than in 10 cm and 15 cm (Table 6.6).

The sprouting of plants from CBSV-[MZ:Nam1-1:07]-infected cuttings also

followed similar pattern with greater number of cuttings been grown from 20 cm

long cuttings than 10 cm and 15 cm (Table 6.7). There was considerable variation

in the reversion resulting from stem cuttings of different lengths. Ten cm cuttings

resulted in most reversion, followed by cuttings measuring 15 cm and reversion

was least in 20 cm stem cuttings. Stem cuttings from plants of UCBSV-

[UG:Kab4-3:07] infection gave more reversion compared to those from CBSV-

[MZ:Nam1-1:07].

Table 6.6: Effect of CBSD on the sprouting of cassava cuttings of different

length.

% plants sprouted from each cutting length


Cuttings length Cuttings length

Variety

10 cm

%

15 cm

%

20 cm

%

Meana

%

10 cm

%

15 cm

%

20 cm

%

Meana

%

Kaleso 68 90 97 85 67 88 92 82

Kiroba 68 92 95 85 62 90 85 78

Albert 65 80 95 80 57 72 85 72

Meanb 67 87 95 62 83 87 aMean of cuttings that were sprouted across different cuttings length. bMean of cuttings that were sprouted across three varieties for different cuttings sizes.

105

Table 6.7: Assessment of reversion of CBSD-infected cuttings of different length

% virus-free plants at six months after plantinga

UCBSV-[UG:Kab4-3:07] RT-PCR CBSV-[MZ:Nam1-1:07] RT-PCR

Cuttings length Meanb

%

Cuttings length Meanb

Variety 10 cm 15 cm 20 cm 10 cm 15 cm 20 cm %

Kaleso 42 37 5 28 32 23 2 19

Kiroba 33 20 4 19 28 16 2 15

Albert 22 17 2 14 16 9 0 8

Meanc % 32 25 11 25 16 1 aCuttings grown from CBSD-infected mother plants for 6 months without CBSD symptoms were further tested by RT-PCR and plants that tested negative were considered reverted (virus-free). bMean (%) plants that were tested negative by RT-PCR in the three cassava varieties across different cuttings length. cMean (%) plants that were tested negative by RT-PCR in different cuttings across the three cassava varieties.

6.3.6 Effect of stem position (lower, middle and upper portions) on reversion

Reversion was greatest in cuttings taken from the upper and middle parts of the

stem compared to the lower part (Figure 6.18), especially for UCBSV-[UG:Kab4-

3:07]-infected cuttings. Overall, reversion in cuttings from CBSV-[MZ:Nam1-

1:07] infection range from 2% in the lower stems of Albert to 38% from the

middle stems of Kaleso. For UCBSV-[UG:Kab4-3:07], it ranged from 5% in the

lower stems of Albert to 43% from the upper stems of Kaleso (Figure 6.18).

Significant differences among cassava varieties (P<0.001) and virus isolates

(P<0.0094) were observed in reversion to CBSD in the three cassava varieties.

The effect of the stem positions at which cuttings were taken (lower, middle and

upper) across the three cassava varieties was also significant (P<0.01). Albert

differed significantly from Kaleso and Kiroba for reversion from cutting position

(P<0.001), but no significant differences were observed between Kaleso and

Kiroba (P>0.7). Likewise there were significant differences between middle and

lower stem (P<0.008) and also between upper and lower stem (P<0.02), but no

significant differences (P>0.9) between upper and middle stem.

106

Figure 6.18: Effects of isolate and variety on the rate of reversion for cuttings taken from smaller, middle and upper parts of the stems of three cassava varieties.

0

10

20

30

40

50

60

70

80

90

100

Kaleso Kiroba Albert Kaleso Kiroba Albert Kaleso Kiroba Albert

Lower stem Middle stem Upper stem

Rev

ersi

on

(%

)


CBSV-[MZ:Nam1-1:07]

107

6.3.7 Fecundity and survival of B. tabaci on cassava varieties

All three cassava varieties supported the reproduction of whitefly equally (Figure

6.19). Minor differences observed in the numbers of eggs laid, nymphs developed

and adults emerged on each variety were not statistically significant between the

three cassava varieties. The variety Albert supported a greater number of eggs

(319) and nymphs (288) than Kiroba (304), (273) and Kaleso (316), (286)

respectively. Adult eclusion was favoured by varieties Kaleso (262) and Albert

(261) than Kiroba (252) (Figure 6.19). But these differences were not statistically

significant when an ANOVA test was carried out on the data.

The differences in mean development time for B. tabaci among cassava varieties

for eggs to nymphs, nymphs to adults and eggs to adults were also not significant

(P > 0.05). The percentage eggs that survived to nymphs across varieties ranged

from 90-91%, nymphs to adults were 91-92% and eggs to adults were 82-84%

(Figure 6.20). The greatest percentage survival from eggs to adults was observed

on Kaleso (84%); followed by Kiroba (83%), while the lowest survival from eggs

to adults was observed on Albert.

108

Figure 6.19: Total number of eggs, nymphs and adult B. tabaci recorded on the three cassava varieties.

Figure 6.20: Development of B. tabaci on three cassava varieties. Bars represent percent number and survival of B. tabaci on cassava var. Albert, Kaleso and Kiroba.

0

50

100

150

200

250

300

350

eggs nymphs adults

To

tal N

um

ber

Albert

Kaleso

Kiroba

0

10

20

30

40

50

60

70

80

90

100

eggs-nymphs nymphs-adults eggs-adults

% s

urv

ival

Albert

Kaleso

Kiroba

109

6.3.8 Resistance/susceptibility of cassava varieties to CBSV upon

transmission by B. tabaci

The overall transmission rate recorded was 36% across all three varieties tested.

The greatest transmission rate was recorded in var. Albert 57%, followed by

Kiroba (47%). Kaleso was the most resistant variety with infection recorded on

one plant (3%) (Table 6.8). The differences among cassava varieties for the rate

of CBSV transmission were highly significant (P<0.001). The number of weeks

required from inoculation to symptom appearance varied; in Albert the first plant

showed symptoms three weeks after inoculation while in Kiroba and Kaleso, first

symptoms appeared five and eight weeks after inoculation, respectively.

Symptoms in vector-transmitted plants were similar to those seen in plants

obtained from CBSV-infected cuttings and graft-inoculated plants.

Table 6.8: Rate of CBSV transmission in three different cassava varieties and

number of CBSV-infected plants detect by RT-PCR.

Variety Experiment 1 Experiment 2 Experiment 3

CBSV

positive/nd

CBSV

positive/nd

CBSV

positive/nd Total

% infected

plantsa

Kaleso 1/10 0/10 0/10 1/30 3

Kiroba 6/10 5/10 3/10 14/30 47

Albert 6/10 6/10 5/10 17/30 57

Total 13/30 11/30 8/30 32/90

% infected

plantsb 43 37 27 36 36c aAverage rate of transmission recorded in each cassava variety bAverage rate of transmission in each experiment across the varieties cAverage rate (%) of transmission in 90 cassava plants used in CBSV transmission experiments. dNumber of plants with CBSV/Number used for whitefly transmission in each experiment.

6.3.9 Relationship between visual observations of CBSD-symptoms and

CBSV detection in B. tabaci inoculated cassava plants

The relationship between the observation of CBSD foliar symptoms and presence

of the virus was established for the above 90 samples inoculated by B. tabaci. The

var. Albert had most of CBSV-infected plants with chlorotic spots, followed by

110

Kiroba and Kaleso, (Appendix 1.4). In the first experiment, 60% plants each of

Albert and Kiroba, and 10% of Kaleso, produced typical CBSV symptoms. In the

second experiment, the rate of infection was similar on Albert and Kiroba but

Kaleso was not infected. A smaller rate of infection was recorded in the third

experiment, in which 50% of Albert were CBSV positive, while only 30% were

infected in the Kiroba (Appendix 1.5). There was a positive relationship between

visual observation of symptoms in all the three varieties and detection of CBSV

by RT-PCR, except for one or two cases in Kiroba (Appendix 1.6).

6.3.10 Classification of cassava varieties into different resistance groups

The three cassava varieties were tested with UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] and a number of parameters including the severity of

symptoms, disease incidence in leaves, stems, roots, virus replication and

movement was analysed by RT-PCR and virus titres were recorded based on

these parameters, none of the varieties had complete immunity to CBSV-

[MZ:Nam1-1:07], but Kaleso was found to have a greater level of resistance,

while Kiroba was tolerant to CBSV-[MZ:Nam1-1:07], but had moderate

resistance to UCBSV-[UG:Kab4-3:07] and Albert was most susceptible (Table

6.9).

111

Table 6.9: Summarised tabular form of the resistance mechanisms.

aResistance status of cassava varieties based on their reactions to infections with UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] by graft-inoculation. CBSVs infection based on the number of plants per isolate that developed CBSD leaf, stem and root symptoms after graft-inoculation, CBSD symptom severity score, virus spread within cassava varieties and high virus load. Varieties were classified as: S = susceptible, HS = highly susceptible, T = tolerant, MR = moderately resistant, R = resistance, HR = highly resistant and NA = not assessed.

Parametersa



Graft-inoculation MR MR S R T HS

Leaf incidence MR MR S R T HS

Stem incidence HR MR S R T HS

Leaf severity MR MR S R T HS

Root necrosis HR MR S R T HS

Virus replication HR MR S R T HS

Virus titre HR MR S R T HS

Reversion MR MR S R T HS

B. tabaci fecundity HS HS HS HS HS HS

B.tabaci-inoculation NA NA NA HR S HS

112

6.4. Discussion

This study was initiated to investigate the interactions between two CBSD

isolates with their cassava host, to improve our understanding of the mechanisms

of resistance to CBSD. All three cassava varieties (Kaleso field-resistant, Kiroba

tolerant and Albert susceptible) were infected by graft-inoculation. Clear

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] infections similar to those

seen earlier (Winter et al., 2010) were obtained but the rate of transmission and

the time it took to express symptoms varied between varieties (Table 6.4).

Grafting was highly effective for screening cassava for CBSD resistance and to

differentiate between resistant and susceptible cassava varieties. The reaction of

the varieties to infection by graft-inoculation varied with the number of grafts and

time to the first appearance of symptoms. Albert became infected with both

viruses with one graft-inoculation, while more than one grafting was necessary to

infect Kaleso and Kiroba and symptom expression was delayed. These

observations were consistent with earlier reports that resistant cassava varieties

are known to suppress CMV multiplication and movement in infected plants

(Thresh and Cooter, 2005).

The findings of this study were also similar to the results obtained in earlier

studies in which all cassava varieties selected for resistance in the field became

infected when graft-inoculated (Storey, 1947; Ogbe et al., 2002). This may be

because the normal mechanism of vector transmission was bypassed when high

virus titres were inoculated with grafting. Similar observations have been made

on begomoviruses in which resistance was lost when an infected scion was

grafted on resistant tomato plants (Vidavsky and Czosnek, 1998). In grafting, the

virus was delivered directly into the vascular system continually for as long as the

scion remains viable, thus suppresses resistance mechanisms (Kheyr-Pour et al.,

1994). Also important to note is that the graft-inoculated scion was derived from

a susceptible cassava variety, which provides a reservoir on the inoculated plant

in which virus replication might continue regardless of the resistance of the stock

plants. Such conditions of introducing high viral inoculums do not exist with

whitefly transmitting the viruses. With B. tabaci transmission, success of

infection depends on successful replication and translocation of the few virus

particles ingested during vector feeding.

113

The symptom type and the time interval between graft-inoculation and symptoms

appearance depended on the variety. Symptom development was delayed

significantly on Kiroba and Kaleso compared to Albert, which was consistent

with field observations (Hillocks et al., 2001; Hillocks, 2003). This varietal

difference was previously described as due to the restricted movement of virus on

resistant cassava varieties (Walkey, 1985). Although such evidence is lacking for

CBSD, Thottappilly et al. (2003) described six types of resistance mechanisms to

CMD in cassava; resistance to inoculation, field vector resistance, virus titre

resistance, symptom severity, resistance to virus spread and development of

symptoms over time. In this study, we used field-resistant, tolerant and

susceptible cassava varieties, which enabled us to observe the differences in

response of different varieties to infection by UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] over a long period of 96 weeks. Our data on the

detection of viruses in leaves and roots indicated that resistance of cassava to

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] can be manifested in the

restriction of virus movement as well as the suppression of virus multiplication in

Kaleso. The findings of this study are in agreement with the earlier study on

ACMV, which was incompletely systemic in resistant cassava (Rossel et al.,

1992; 1994; Njock et al., 1996).

We have followed the distribution of UCBSV-[UG: Kab4-3:07] and CBSV-[MZ:

Nam1-1:07] in graft-inoculated Kaleso, Kiroba and Albert. Early detection of

CBSV in roots compared to shoots is consistent with the classical study on the

nature of virus movement in plants as demonstrated by Samuel (1934) with

Tobacco mosaic virus (TMV). TMV particles were shown to be systemically

translocated through phloem to lower parts of the tomato plant and subsequently

re-distributed to the youngest leaves and the rest of plant shoots. Jennings (1960a)

observed that virus introduced to upper part of the plants can move down to infect

roots even in resistant plant. This downward movement was confirmed in graft-

inoculation experiment. The interaction of UCBSV-[UG:Kab4-3:07] and CBSV-

[MZ:Nam1-1:07] with cassava varieties in CBSD-pathosystem can be seen as

molecular arms race between the virus and host defence mechanisms. These

interactions were reported to have depended on the immune systems of the host

(Boevink and Oparka, 2005) and might explain the reason why cassava varieties

114

differ greatly in CBSD symptom development, severity, virus movement and

titre, even when infection occurs at the same time.

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] have different

pathogenicities on cassava varieties. Kiroba was tolerant to both viruses.

Although Kaleso can be infected by both UCBSV-[UG:Kab4-3:07] and CBSV-

[MZ:Nam1-1:07], the variety does not show severe symptoms, while Albert is

susceptible. The qPCR results are consistent with recent studies that reported

correlation between symptom severity and virus titres in CBSV (Moreno et al.,

2011). In our studies Albert infected with CBSV-[MZ:Nam1-1:07] expressed

severe symptoms and showed high virus titre. UCBSV-[UG: Kab4-3:07]

produced milder symptoms on Albert, which was reflected in the relatively low

virus titre. A similar effect was observed in all three cassava varieties, where the

titres of milder UCBSV-[UG: Kab4-3:07] was smaller than the severe CBSV-

[MZ: Nam1-1:07]. The observed decline in virus titre in resistant cassava

varieties was suggested to be due to reversion phenomenon by Van den Bosch et

al. (2007).

An obvious advantage of this information will be for screening cassava varieties

for virus resistance by measuring virus titre in leaves together with an assessment

of symptoms. If reduced viral replication in leaves can be correlated to the

absence of severe symptoms, the RT-qPCR could be used as an effective tool for

screening for CBSD resistance. Our results reported for the first time the effect of

resistance mechanisms in restricting virus replication and spread.

The greatest proportion of disease-free plants was obtained (reversion) from the

resistant variety Kaleso. These results extend previous findings for CMBs that

reversion is more likely to occur in resistant plants than in susceptible varieties

(Jennings, 1960b; Rossel et al., 1992; Thresh et al., 1994; Fargette et al., 1996).

Fondong et al. (2000) observed reversion in CMD-affected plants Gibson and

Otim-Nape (1997) also confirmed reversion occurring in CMD-resistant var.

TMS 30572, but not in the susceptible Bao. For CBSD, reversion was observed in

our studies in the susceptible var. Albert, albeit at a smaller rate than the tolerant

(Kiroba) and resistant (Kaleso). The virulence levels of the viruses are also

115

believed to play an important role in reversion. Studies on CMD have associated

reversion with both mild and severe forms of the virus (Gibson and Otim-Nape,

1997; Pita et al., 2001). A similar observation was made in this study, where

CBSD-affected stem cuttings from the severe CBSV-[MZ:Nam1-1:07] produced

less disease-free plants and a smaller percentage reversion compared to the mild

UCBSV-[UG:Kab4-3:07]. Storey (1938) noted that some cassava cuttings taken

from CBSD-affected plants sprouted without symptoms. He also observed

differences in symptom severity of different varieties affected by CBSD and

referred to them as due to distinct strains. Cassava varieties differed in the

expression of CBSD symptoms, and one reason could be a difference in their

ability to revert as result of the differences in the ability of the viruses to suppress

posttranscriptional gene silencing in different cassava plants. For instance, amino

acid substitutions in HC-Pro lead to less titres of Potato virus A of the genus

Potyvirus in tobacco leaves leading to reversion in most of the plants (Andrejeva

et al., 1999). Reversion was earlier reported to be as result of RNA silencing

mechanism for CMD (Fondong et al., 2000). It is therefore very likely that the

reversion observed for CBSD is also due to RNA silencing, which will have to be

verified in future studies.

The greatest number of virus-free plants was grown from middle and upper

portions of CBSD-affected cuttings compared to lower part of the stems.

However, high mortality occurred in the cuttings taken from the upper part of the

plants which could be due to the tenderness of cuttings from this part of the

stems. Nevertheless, the findings of this study are in agreement with the earlier

suggestion of Hillocks and Jennings (2003) that CBSV distribution in cassava

could be localised such that cuttings taken from a certain part of infected plants

could become symptomless and sprout without symptoms. In areas of high CBSD

incidence, farmers can be encouraged to take planting material only from the

middle and upper parts of the cassava stems to exploit the inherent mechanism of

reversion from virus infection by cassava plants. Taking planting material from

middle part of the stems can minimise the risk of poor crop establishment that

was earlier associated with cuttings taken from the upper part of the stems

(Gibson and Otim-Nape, 1997). The length of cuttings also affected both plant

regeneration and reversion in CMD (Fondong et al., 2000). Similarly, in this

116

study, short cuttings of 10 cm produced most number of virus-free plants than

longer ones (15 and 20 cm), although overall plant regeneration was high in

longer cuttings. The general trend indicated that the smaller the length of the

cuttings, the greater the probability of producing CBSD-free plants of Kaleso,

Kiroba and Albert.

The findings of the study on the fecundity and survival of B. tabaci on the three

cassava varieties are in agreement with an earlier report which pointed to the lack

of differences in the fecundity of whiteflies on cassava varieties (Maruthi et al.,

2001). Hahn et al. (1980) similarly observed no differences in B. tabaci survival

on CMD-resistant, tolerant and susceptible cassava varieties and thus concluded

that resistance to the vector was unlikely in cassava, although Fargette et al.

(1996) indicated whitefly survival differed considerably between varieties in the

field. Results obtained in this study provide no evidence of differences between

the resistant, tolerant and susceptible cassava varieties to support whitefly

survival and reproduction. Our results did not provide a link between the

mechanisms of resistance to CBSV to unattractiveness of B. tabaci in these

varieties. These results however, provide a basis for comparing the rate of CBSV

transmission by whiteflies. The results of the fecundity study further support the

view that resistant features manifested by some cassava varieties are not affected

by the fecundity of B. tabaci on cassava, which supports the conclusions that the

resistance/tolerance to CBSV found in cassava varieties are due to the inherent

property of the varieties to the virus.

The transmission rates achieved in this study were high (up to 57%) compared to

the ones reported previously (22%) (Maruthi et al., 2005) and (28%) (Mware et

al., 2009). This could be due to the improvement in the transmission protocols

followed such as allowing the whiteflies to acquire the virus freely on a diseased

plant and using a set AAP and IAP of 24 h. Environmental conditions and feeding

behaviour of adult B. tabaci on cassava plants may adversely affect transmission

(Maruthi et al., 2005). For instance, in transmission with spiralling whitefly, high

humidity within the clip cages lead to mass mortality of spiraling whitefly, but B.

tabaci was able to survive humid conditions (Mware et al., 2009). The effect of

the environment was eliminated in this study as similar conditions were

117

maintained throughout the technical updates. High transmission of CBSV by the

B. tabaci was obtained in the field on susceptible and tolerant varieties, compared

to the resistant varieties (Mware et al., 2009). High B. tabaci populations in the

fields may be correlated with the high CBSD incidences as was observed in

Uganda (Alicai et al., 2007). This may explain the reason for the possible

outbreak of CBSD in cassava growing areas in high coastal areas of the country.

Management options need to focus on the control of the B. tabaci (vector),

propagation of cassava varieties that are resistant to UCBSV and CBSV infection,

in addition to other control measures. Kaleso which was identified in this study

can be one of such variety, since it was proved to be resistant to virus replication.

6.4.1 Conclusions


1- Development of CBSD symptoms over time is variety and isolate dependent.

CBSV-[MZ:Nam1-1:07] was severe on cassava compared to UCBSV-[UG:Kab4-

3:07], which is mild. Symptoms on leaves are associated with root symptom in

Albert infected with both viruses. In Kaleso and Kiroba, foliar chlorosis did not

associate well with root necrosis, particularly for UCBSV-[UG:Kab4-3:07] since

they had no or limited root symptoms, suggesting that root and leaf symptoms

can occur independently at least for some virus-variety combinations.

2- The resistance mechanisms that prevent or slow down the movement of

UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] following graft-

inoculation is dependent upon the tolerance level of the varieties. In resistant

cassava varieties, virus replication and titre are suppressed leading to recovery

from symptoms and virus. Reversion is observed for CBSD in cassava and it

depends on the levels of resistance/tolerance of the varieties.

3-The length of cuttings also affected plant regeneration and reversion in CBSD;

the smaller the length of the cuttings, the greater the CBSD-free plants.

118

4- For the cassava varieties used in this study, susceptibility to CBSD cannot be

attributed to differences in their ability to support B. tabaci. Resistance levels

observed therefore are for the virus.

119

CHAPTER 7: Developing methods to eliminate UCBSV and CBSV from

infected cassava varieties

7.1. Introduction

Elimination of virus from cassava by tissue culture was first described by Morel

and Martin (1952), by thermotherapy (Nyland and Goheen, 1969) and

chemotherapy (Quak, 1961) while tissue culture alone was found to be sufficient

for removing CMBs from cassava (Roca et al., 1984; Kartha, 1981). Cassava

varieties with complete resistant to UCBSV and CBSV are not known and

demands for healthy and certified planting materials have recently been increased

in SSA. Alternative ways of generating virus-free cassava therefore offers a way

of controlling CBSD. Development of an efficient virus eradication technique for

UCBSV and CBSV from cassava infected plants is also critical in quarantine and

germplasm collections in SSA.

Chemo and thermotherapies have been effective in eliminating several viruses

known to infect vegetatively propagated crops (Allam, 2000; Nascimento et al.,

2003). Recently, Wasswa et al. (2010) demonstrated that CBSV elimination in

cassava could be achieved by a combination of tissue culture and heat therapy.

These methods however, have not been developed for the cassava varieties with

different tolerant levels to CBSD and for both UCBSV and CBSV. The aim of the

study was to develop methods to eliminate UCBSV and CBSV from infected

cassava varieties. The therapies were then compared for their efficiency on plant

regeneration and the elimination of viruses.


7.2.1 Cassava varieties and CBSD isolates

Cassava plants of Kaleso, Kiroba and Albert that tested positive for UCBSV-

[UG:Kab4-3:07] or CBSV-[MZ:Nam1-1:07] by RT-PCR were selected (see

below).

120

7.2.2 Tissue culturing

Fifty single node cuttings from young stems of each of the three cassava varieties

were excised (~0.4 mm) and surface sterilised (section 3.2.2). The nodes were

cultured on basal medium (Murashige and Skoog, 1962), which was modified in

this study (see section 3.2.1). The plantlets were grown in a constant environment

for eight weeks, and then transferred into the soil and weaned as described in

Chapter 3 (section 3.2.3). The tissue culture experiments were repeated three

times using 50 nodal cuttings for cassava regeneration and virus elimination from

each variety (Kaleso, Kiroba and Albert) and virus. Twenty healthy nodal

cuttings from each cassava variety were inoculated into the tissue culture media

and used as controls for each set up.

7.2.3 Comparison of the position of the nodes for virus elimination

Nodes from each plant were numbered 1-10 from top to bottom and classified

into two categories for easy comparison as top (node numbers 1–5) and bottom

(node numbers 6–10). Nodes were surface sterilised as described previously

(section 3.2.2) and then transferred to their respective media and grown in the

tissue culture room. Tissue-cultured plantlets were scored for the

presence/absence of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]

using visual observations and tested by RT-PCR using virus-specific primers

(CBSV F3 and CBSV R3). Plants that showed disease symptoms after three

months were discarded, and symptom-free plants were allowed to grow for six

months and then tested by RT-PCR.

7.2.4 Thermotherapy

The thermotherapy experiment was a modification of protocol used for the

production of virus-free plants from yam (Balagne, 1985). Ten node cuttings each

from UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-infected plants of

vars. Kaleso, Kiroba and Albert were excised (~0.4 mm), inoculated into the

tubes containing supplemented MS media (section 3.2.1). The plantlets were kept

in the incubator (Leec, UK) at different temperature regimes of 30, 35, 40 and 45 oC for three weeks with 12 h of light and 12 h of darkness (L12:D12). Plantlet

survival was recorded from each temperature regime for each variety-virus

combination. After three weeks, the plantlets were removed from the incubator

121

and transferred into a tissue culture growth room for one week and then planted in

pots (0.5 litre) filled with steam sterilised compost:soil (1:1) in a quarantine

glasshouse. Plants were grown under propagator lids and the tending period

(section 3.2.3) was increased from 2 to 3–4 weeks to reduce plant mortality.

Presence or absence of CBSD symptoms was recorded monthly by visual

observation of treated plants. After six months, leaf samples were collected from

plants that were not showing CBSD symptoms and tested for viruses using RT-

PCR. The experiment was repeated three times using 10 nodal cuttings for each

variety-virus combination and four temperature regimes. Twenty healthy nodal

cuttings were inoculated into the tissue culture media for each temperature regime

per variety as control for each set up.

7.2.5 Chemotherapy

The antiviral chemical ribavirin (1,ß-D-Ribofuranosyl-1,2,4-triazole-3-

carboxamide) (Sigma R9644), (Scientific Laboratory, UK) supplied in powder

form was tested for its efficiency for the elimination of UCBSV-[UG:Kab4-3:07]

and CBSV-[MZ:Nam1-1:07] from three cassava varieties. Ribavirin has broad

spectrum anti-viral activities (Dawson, 1984; Fletcher et al., 1998). Three

concentrations (15 mg/l = 0.06 mM/l), (25 mg/l = 0.1 mM/l) and (50 mg/l = 0.21

mM/l) of ribavirin were tested and control media was made containing no

ribavirin. Ribavirin is a toxic compound so extreme care was taken when

handling it.

Chemotherapy was carried out on nodes from five plants of the three cassava

varieties for the two viruses; UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-

1:07]. Sterile single use plastic tubes (25 ml size, Sterilin, UK) were used since

ribavirin is toxic and the contaminated tubes could be disposed of after use by

incineration without the need for lengthy decontamination procedures. Fifty

nodes per variety for each treatment were transferred to glass tubes containing the

media supplemented with ribavirin. The experiment was repeated three times

using 50 nodes from each variety-virus combinations and for three ribavirin

concentrations. Fifty healthy nodal cuttings per variety were inoculated into the

tissue culture media without ribavirin to use as control for each set up.

122


cassava and UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]

Chemo and thermotherapy were carried out on tissue cultured plants of the three

cassava varieties from UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-

infected plants. Thirty nodes per variety were transferred to glass tubes containing

the media supplemented with ribavirin at 0.1 mM/l concentration. The plantlets

were kept in the incubator (Leec, UK) at 40 oC for three weeks with L12:D12.

Plantlet survival was recorded from each variety-virus combination. After three

weeks, the plantlets were removed from the incubator and transferred into a tissue

culture growth room for one week and then planted in pots (section 7.2.4) in a

quarantine glasshouse. Plants were grown under propagator lids for 3–4 weeks.

Presence or absence of CBSD symptoms was recorded monthly by visual

observation of treated plants. After six months, leaf samples were collected from

plants that were not showing CBSD symptoms and tested for UCBSV-[UG:Kab4-

3:07] and CBSV-[MZ:Nam1-1:07] using RT-PCR. The experiment was repeated

three times. Twenty healthy nodal cuttings per variety were cultured into the

media containing ribavirin and exposed to the same temperature regime to use as

control for each set up.

7.2.7 Assessment of the efficacy of the therapies

All the plantlets resulting from the therapy trials outlined above were tested for

presence or absence of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] at

six months after treatment to allow for proper plants growt. The RNA extraction

protocol described in Chapter 3 (section 3.2.7) was used followed by RT-PCR

using virus specific primers CBSV F3 and CBSV R3 as described in chapter 3

(section 3.2.8 and 3.2.9). In each trial, the number of plantlets regenerated over

the total number inoculated was indicated in tables. The efficiency of the therapy

(ET) was determined using the formula described previously (Hormozi-Nejad et

al., 2010; Mahfouze et al., 2010; Meybodi et al., 2011). The equation used was:

% ET = % plant regenerated x % virus-free plants / 100. The ET of tissue culture

alone, thermotherapy, chemotherapy and Simultaneous application of the

treatments were compared for their efficacy at eliminating UCBSV-[UG:Kab4-

3:07] and CBSV-[MZ:Nam1-1:07] from in vitro cassava plants.

123

7.3 Results

7.3.1 Tissue culturing

Elongation of auxillary buds and emergence of new leaves were observed two

weeks after seeding of the explants (Figure 7.1a) while root formation took three

weeks (Figure 7.1b). About 4-6 weeks after inoculations, plantlets were ready for

transfer into soil (Figure 7.1c); they were further tendered for 3-4 weeks and

observed monthly for 6 months. Dead and CBSD-affected plants were removed

monthly (Figure 7.1e and f). In general greater number of virus-free plants were

recorded from UCBSV-[UG:Kab4-3:07]-infected plants of the three varieties

compared to CBSV-[MZ:Nam1-1:07] (Table 7.1). All surviving plants that

remained symptom-free after six months were also shown to be virus-free by RT-

PCR. These data were used for the therapy efficiency analysis in section 7.3.6.

Figuby [MZmedbeen(e) a

ure 7.1: Retissue cu

Z:Nam1-1:0dia, plantletn transferreand CBSV-

egeneration ulture for 07]. (a) Exts at four w

ed into soil (-[MZ:Nam1

of CBSD-ieliminatin

xplants one weeks after(c), plantlet1-1:07]-posi

124

infected nodng UCBSV

week after inoculatios two monthitive (red ar

de cuttings V-[UG:Kab4er inoculatioon (b), planhs in the so

rrows) plant

from cassav4-3:07] anon into tis

ntlets six moil (d), virusts (f)

va varietiesnd CBSV-sue culture

months afters-free plants

s -e r s

125

Table 7.1: Effect of tissue culture in eliminating UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] from infected cassava varieties.

a15 nodes were planted into tissue culture media from each position. Results were recorded as number regenerated (Reg) per inoculated, the

number of virus free (V.f) plants.

Tissue culture

Number of virus-free plants by RT-PCR/Number testeda



Nodesa Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f

No1 0/15 nt 6/15 6/6 6/15 2/6 6/15 3/6 7/15 5/7 6/15 2/6

No2 10/15 6/10 12/15 9/12 9/15 3/9 10/15 4/10 10/15 4/10 9/15 3/9

No3 10/15 8/10 10/15 4/10 10/15 1/10 9/15 2/9 12/15 3/12 11/15 2/11

No4 6/15 4/6 9/15 5/9 8/15 2/8 10/15 4/10 12/15 6/12 9/15 1/9

No5 1/15 1/1 11/15 4/11 8/15 4/8 6/15 2/6 7/15 3/7 9/15 2/9

No6 9/15 3/9 12/15 3/12 8/15 0/8 8/15 0/8 9/15 1/9 11/15 3/11

No7 8/15 8/9 8/15 3/8 7/15 0/7 7/15 0/7 8/15 1/8 9/15 0/9

No8 10/15 2/10 10/15 2/10 10/15 1/10 9/15 0/9 11/15 2/11 9/15 0/9

No9 14/15 5/14 13/15 4/13 12/15 3/12 9/15 0/9 9/15 0/9 8/15 0/8

No10 8/15 0/8 13/15 5/13 8/15 0/8 8/15 0/8 8/15 0/8 9/15 0/9

Mean 76/150 37/76 104/150 45/104 86/150 16/86 82/150 15/82 93/150 25/93 90/150 13/90

126

7.3.2 Comparison of the position of nodes as material for starting explants

About 71% of nodes from the bottom of the plant (from positions 6 to 10)

grown in the tissue culture media survived whereas only 54% nodes from top

position (from positions 1 to 5) survived using our protocol. Contamination of

the nodes cutting recorded in the media was greater from lower positions

(19%) than from the upper (5%). Similarly, percentage node cuttings grown

into green state was greater from the lower position than from the upper

position. However, the percentage nodes that died in the media were greater

from the upper (24%) than from the lower part of the plants (Table 7.2).

Table 7.2: Comparison of the survival of cassava nodes in tissue culture media

four weeks after been grown on the media.

Tissue culture plants that survived in both media and after transferred in soil Number

in soilc

% Plant part

Contaminated

%

Dead

%

Green statea

%

Growthb

%

Upper (nodes 1-5) 5 24 71 62 54

lower (nodes 6-10) 19 5 77 75 71 aNodes that were still green or callus formation were all considered as “green state” bGrowth include roots, stems and/or leaf formation, but sometimes the developed tissue was insufficient for virus-testing purposes. cNodes that developed into fully grown plants after transfer into soil, including those of the control treatment.

7.3.3 Thermotherapy

Cassava plantlets showed varying responses to heat treatment. Heat stress

ranged from singed leaves and shoot tips (at 40 oC) to total death of the

plantlets in the three cassava varieties especially at the greatest temperature

(45 oC) while 30 oC and 35 oC appeared to have a positive effect on plant

growth and development (Figure 7.2 and Table 7.3). Greater number of virus-

free plants was obtained at 40 oC treatment compared to 30 oC and 35 oC

(Table 7.3). More virus-free plants were obtained from UCBSV-[UG:Kab4-

3:07]-infected node cuttings than from CBSV-[MZ:Nam1-1:07] (Table 7.3).

These data were used in the efficiency of the therapy analysis in section 7.3.6.

Figuvariwerelim

ure 7.2: Rieties by there kept in minating UC

Regeneratioermotherapythe incuba

CBSV-[UG:

on of CBSy at differenator (Leec, :Kab4-3:07]

127

D-infected nt temperatUK) for

] and CBSV

node cuttiture regimesthree week

V-[MZ:Nam

ings from s. Inoculateks at L12:D

m1-1:07].

cassava ed nodes D12 for

128

Table 7.3: Effect of thermotherapy on UCBSV-[UG:Kab4-3:07] and CBSV[MZ:Nam1-1:07]-elimination from infected cassava varieties.

aNodes were inoculated into tissue culture media for each variety-virus combination and transferred to the incubator (Leec, UK) for 3 weeks at L12:D12 for each temperature regime (Temp.oC). Results were recorded as number regenerated (Reg.) per number inoculated, number virus free (V.f) per number regenerated, nodes not tested (nt) due to contamination or dead.

Thermo

therapy

Number of virus-free plants viruses free by RT-PCR/Number testeda



Temp.oC Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f

30 21/30 11/21 26/30 18/26 22/30 9/22 26/30 12/26 28/30 15/28 24/30 5/24

35 28/30 17/28 28/30 25/28 25/30 11/25 27/30 19/27 27/30 21/27 29/30 16/29

40 14/30 13/14 16/30 16/16 16/30 12/16 10/30 8/10 19/30 18/19 15/30 11/15

45 0/30 nt 0/30 nt 0/30 nt 0/30 nt 0/30 nt 0/30 nt

Mean 63/120 41/63 70/120 59/70 63/120 32/63 63/120 39/63 74/120 54/74 68/120 32/68

129

7.3.4 Chemotherapy

Phytotoxic effects of the ribavirin at the greatest concentration of 0.21 mM/l

was observed which resulted in severe stunting of plantlets, thin stems, stunted

leaflets, sluggish root development and finally death of all the plantlets in all

three cassava varieties (Figure 7.3). The development of roots was sluggish

also (at 0.1 mM/l ribavirin). Greater number of virus-free plants was obtained

from 0.1 mM/l treatment compared to 0.06 mM/l (Table 7.4). Plantlets

regenerated after exposure to chemotherapy at 0.06 mM/l of ribavirin were

morphologically identical to those regenerated from non-treated control plants

(Figure 7.4).

The number of regenerated plantlets after growing on media supplemented

with ribavirin were greater from UCBSV-[UG:Kab4-3:07]-infected node

cuttings than CBSV-[MZ:Nam1-1:07]. Similarly, more virus-free plants were

obtained from UCBSV-[UG:Kab4-3:07]-affected plants compared to CBSV-

[MZ:Nam1-1:07] (Table 7.4). These data were also used to estimate the

efficiency of chemotherapy (section 7.3.6).

Figuvaricon

ure 7.3: Rieties by ch

ncentrations.

Regenerationhemotherapy.

n of CBSDy and react

130

D-infectedtion of the

node cuttivarieties at

ings from t different r

cassava ribavirin

Figumon[MZ

ure 7.4: (anths after tZ:Nam1-1:0

a) Untreatedtransfer to 07]-free plan

d control nthe soil (bnts of Kales

131

node cuttinb), UCBSV-so (c) Kirob

gs, sympto-[UG:Kab4ba and Albe

om free pla4-3:07] and ert (d).

ants two CBSV-

132

Table 7.4: Effect of chemotherapy for UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-elimination from infected cassava varieties.

a150 nodes were inoculated into tissue culture media in each variety per isolate and antiviral chemical ribavirin (Rn) was added at different concentrations in millimolar per litre (mM/l). Results were recorded as number regenerated (No. reg) per inoculated, number virus free (V.f) per regenerated, nodes not tested (nt) due to contamination or dead. Plantlets were tested for the absence of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] by RT -PCR using CBSV specific primers (F3 and R3).

Chemo

therapy

Number of plants regenerated or viruses-free by RT-PCR/Number testeda



Ribavirin

(mM/l)a Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f

0.06 117/150 55/117 108/150 50/108 114/150 50/114 93/150 30/93 99/150 40/99 108/150 40/108

0.10 102/150 60/102 90/150 60/90 102/150 60/102 105/150 61/105 102/150 60/102 90/150 51/90

0.21 0/150 nt 0/150 nt 0/150 nt 0/150 nt 0/150 nt 0/150 nt

Mean 219/300 115/219 198/300 110/198 216/300 110/216 198/300 91/198 201/300 100/201 198/300 91/198

133

7.3.5 Simultaneous application of the therapies for in vitro regeneration

of CBSD-affected cassava

Of the 30 nodes cultured in the tissue culture media supplemented with

ribavirin at 0.10 mM/l (25 mg/l) and exposed to thermotherapy at 40 oC, the

greatest number of virus-free plants were found from UCBSV-[UG:Kab4-

3:07]-infected plants compared to CBSV-[MZ:Nam1-1:07] (Table 7.5).

Dual effects of thermo and chemotherapies, applied on in vitro cassava

plants, were more efficient in eliminating UCBSV-[UG:Kab4-3:07] and

CBSV-[MZ:Nam1-1:07] from the three cassava varieties than single

treatment. However, regeneration of plantlets was low and this maybe due

to the combined effects of the therapies resulting in leaf scorching caused

by thermotherapy and phytotoxicity caused by ribavirin.

134

Table 7.5: Combined effect of the three therapies for UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] elimination from infected cassava

varieties.

Combined

therapies

TC+ TT + CT- UCBSV-[UG:Kab4-3:07]-elimination TC+ TT + CT -CBSV-[MZ:Nam1-1:07]-elimination


Nodesa Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f Reg. V.f

No1 0/3 nt 0/3 nt 0/3 nt 0/3 nt 0/3 nt 0/3 nt

No2 2/3 2/2 0/3 nt 1/3 1/1 1/3 1/1 0/3 nt 0/3 nt

No3 2/3 2/2 1/3 1/1 2/3 2/2 0/3 nt 0/3 nt 2/3 2/2

No4 3/3 3/3 2/3 2/2 3/3 1/3 2/3 2/2 1/3 1/1 2/3 1/2

No5 0/3 nt 2/3 2/2 0/3 nt 0/3 nt 2/3 2/2 0/3 nt

No6 1/3 1/1 3/3 2/3 2/3 2/2 1/3 1/1 3/3 2/3 2/3 2/2

No7 0/3 nt 1/3 1/1 3/3 1/3 0/3 nt 1/3 1/1 1/3 1/1

No8 3/3 3/3 1/3 1/1 3/3 2/3 2/3 1/2 1/3 1/1 2/3 2/2

No9 2/3 2/3 2/3 2/2 2/3 0/2 1/3 1/1 2/3 2/2 2/3 1/2

No10 3/3 2/3 3/3 2/3 1/3 0/1 2/3 2/2 3/3 3/3 3/3 1/3

Mean 16/30 15/16 15/30 13/15 17/30 9/17 9/30 8/9 13/30 12/13 14/30 10/14 a30 nodes from each variety per isolate were inoculated into tissue culture (TC) media supplemented with chemotherapy (CT, Ribavirin at 0.10 mM/l) and exposed to thermotherapy (TT, at 40 oC). Results were recorded as number of plants regenerated (Reg.), and number virus-free (vf). Nodes not tested (nt) due to contamination or death.

135

7.3.6 Assessment of the efficacy of the therapies

The number of plantlets that regenerated from node cuttings varied between

therapies and varieties (Table 7.6). For instance, 51% Kaleso, 69% Kiroba and

57% Albert plantlets regenerated from tissue cultured plants infected with

UCBSV-[UG:Kab4-3:07]. A similar percentage of plants were regenerated

from CBSV-[MZ:Nam1-1:07]-infected nodes (55% Kaleso, 62% Kiroba and

60% Albert). Simultaneous application of the three therapies resulted in

decreased regeneration of plantlets in Kiroba for both viruses, while in Kaleso

and Albert the decrease in plantlets regeneration was observed only in

UCBSV-[UG:Kab4-3:07]. Simple tissue culturing of nodes resulted in the

production of 49% and 18% of disease-free plants from Kaleso, 43% and 27%

from Kiroba, and only 19% and 14% from Albert infected with UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07], respectively.

Elimination of UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] by

thermotherapy, was more efficient than chemotherapy (Table 7.6). Combining

the three therapies together increased the elimination of both UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]. The ET of tissue culture on the

elimination of UCBSV-[UG:Kab4-3:07] was 25% for Kaleso, 10% for Kiroba,

and 30% for Albert. The differences between the ET of thermotherapy and

chemotherapy were not significantly different. Simultaneous application of the

three therapies resulted in lowest ET (27%) from CBSV-[MZ:Nam1-1:07] and

greatest (50%) from UCBSV-[UG:Kab4-3:07] on Kaleso (Table 7.6).

136

Table 7.6: Effect of therapies on regeneration of cassava plants for UCBSV-

[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-elimination.

Tissue culture

(TC)

% plantlets regenerated % virus elimination

ET


Variety % % % % % %

Kaleso 51 55 49 18 25 10

Kiroba 69 62 43 27 30 17

Albert 57 60 19 14 11 9

Thermotherapy

(TT)

% plantlets regenerated % virus elimination ET


Variety % % % % % %

Kaleso 53 53 65 62 34 33

Kiroba 58 62 84 73 49 45

Albert 53 57 51 47 27 27

Results are given in percentages, efficiency of therapy (ET) was determined as follows: % ET = % plant regenerated x % UCBSV-[UG:Kab4-3:07] or CBSV-[MZ:Nam1-1:07]-free plants / 100.

Chemotherapy



Variety % % % % % %

Kaleso 73 66 53 46 38 30

Kiroba 66 67 56 50 37 34

Albert 72 66 51 46 37 30

TC + CT + TT



Variety % % % % % %

Kaleso 53 30 94 89 50 27

Kiroba 50 43 87 92 44 43

Albert 66 47 53 71 35 33

137

7.4 Discussion

Trials on the production of virus-free plants were carried out from node

cuttings of CBSD-affected cassava plants of three different cassava varieties,

using tissue culture, thermotherapy and chemotherapy. A comparison was

made between node cuttings from positions 1-10 used as starting explants and

the therapy efficiencies on CBSD-elimination. Node cuttings have been

commonly used for plant propagation as well as for virus elimination. The

death of nodes from positions 1-5 was greater compared to 6-10 in all

treatments applied, including the control treatments. This is likely because the

nodes from the top of the plants are tender and fragile while contamination

with fungi and bacteria was more on the nodes from positions 6-10 which is

likely to be the result of high concentrations of bacteria and fungi on lower

parts of plants, due to concentration of photosynthates in phloem sap as they

moved downward to the roots (Gibson and Otim-Nape, 1997).

The size of the node cuttings was important for initial growth, particularly in

chemotherapy or thermotherapy. When node sizes of ~0.4 mm long were used

a low number of plants were regenerated suggesting that the node size may be

too small for plant growth. Large size nodes (0.6-0.8 mm) excised from yam

had significantly better survival compared to small size nodes (0.3–0.5 mm)

although it varied with the cultivar (Malaurie et al., 1998). The greatest virus

elimination rate in yam was obtained with explants of 0.2-0.3 mm long,

though the plant regeneration rate was decreased (Zapata et al., 1995). The

effect of node size for regeneration and virus elimination in cassava was

earlier reported by Kartha and Gamborg (1975) in which 135 of 150 plantlets

were regenerated with 60% virus elimination when explants were excised at

0.4 mm, but increasing the node size to 0.5 mm and 0.8 mm resulted in all the

plants regenerated, but exhibiting virus symptoms. Thus, the node sizes used

in this study are efficient for virus elimination, but the plantlet’s development

may have been compromised.

Thermo and chemotherapies were compared for the regeneration of plants as

well as for virus elimination. Three cassava varieties subjected to various

therapies adapted differently in tissue culture. A comparatively greater number

138

of nodes developed from Kiroba and Albert than from Kaleso. Interestingly,

plantlets from tissue culture alone and the ones treated with chemotherapy

developed at a slower rate than those exposed to temperature regimes of 30

and 35 oC. Node cuttings from cassava treated by thermotherapy at 35 oC have

also been reported to sprout quicker and develop into plantlets faster than the

untreated ones (Kartha and Gamborg, 1975). Similar results were obtained in

yams (Mantell et al., 1980; Chandler and Haque, 1984) and potatoes (Salazar

and Fernandez, 1988), although the effect of heat on plantlet development is

still unknown. Differences in the rate of virus elimination by thermotherapy

were greater than other therapies in the three varieties. Like other therapies,

thermotherapy was more efficient in eliminating mild UCBSV-[UG:Kab4-

3:07] than the severe CBSV-[MZ:Nam1-1:07]. This is consistent with the

elimination of potato viruses, in which thermotherapy was found to be more

efficient in eliminating mild potato virus X (PVX) than severe potato virus S

(PVS) (Stace-Smith and Mellor, 1968). Thus, the inactivation of virus with

heat depended on the temperature regime used and the virus isolate as well as

the host plant.

In this study greatest number of plantlets was regenerated at 35 oC compared

to other treatments. Similarly, a large number of plantlets were virus-free at 40 oC when tested by RT-PCR, suggesting that the virus was inhibited by high

temperature and new shoots produced during the thermotherapy could be

virus-free (Kassanis, 1957). It was earlier speculated that under high

temperature, the union of the protein sub-units (capsid) that protect the nucleic

acid of the virus becomes weaker and temporal fissures appear, allowing

attack by nucleases (Allam, 2000). The high rate of UCBSV-[UG:Kab4-3:07]

and CBSV-[MZ:Nam1-1:07]-elimination at high temperature could be

attributed to the possibility that increased temperatures destroy essential

chemical processes in the virus life cycle. The percentage of virus-free plants

obtained from thermotherapy in this study (47% from CBSV-infected Albert

to 84% from UCBSV-infected Kiroba) is high compared to that of Wasswa et

al. (2010) (49%) at 40 oC. Walkey (1976) further demonstrated that Cucumber

mosaic virus (CMV) did not multiply at 30 oC in N. rustica, the virus was

completely inactivated at 32 oC and the virus was eliminated after 30 days.

139

The highest3 temperature used in this study (45 oC) resulted in death of all the

plantlets of the three cassava varieties, indicating the temperature threshold at

which cassava nodes cannot survive.

The use of ribavirin at different concentrations did not positively influence

development of plantlets which was contrary to the results obtained by

Nascimento et al. (2003) who observed increased potato development in the

media supplemented with antiviral chemicals. A threshold was reached in this

study at 0.21 mM/l ribavirin concentration, where all the node cuttings from

the three cassava varieties did not survive (Figure 7.3; Table 7.4). Best plant

regeneration was registered when ribavirin was used at 0.10 mM/l, but plant

development was slow even at this concentration compared to the control

plants and other therapies. Ribavirin has also been shown to slow the

regeneration of potatoes (Klein and Livingston, 1982; Slack et al., 1987).

These observations confirmed that ribavirin is toxic for the in vitro

development of cassava and other plants. It was noted that developing virus-

free plants by chemotherapy (Klein and Livingston, 1982) will take longer

than thermotherapy (Stace-Smith and Mellor, 1968) or tissue culture alone.

Combined effects of the thermo and chemotherapies on in vitro cassava were

highly efficient in eliminating UCBSV-[UG:Kab4-3:07] and CBSV-

[MZ:Nam1-1:07]. Treatments that included addition of ribavirin at 0.10 mM/l

into the tissue culture media and exposure to 40 oC resulted in increased virus-

elimination compared to single treatments. Similar results were obtained from

PVY elimination in potato by Nascimento et al. (2003). The rates obtained in

this study were greater than those obtained by Dunbar et al. (1993), who

eliminated Peanut mottle virus (PeMoV) in 24% of plants.

The ET for UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07]-

elimination varied between the therapies and cassava varieties used.

Thermotherapy was most efficient for eliminating both viruses from Kaleso

and Kiroba when compared to Albert, in which chemotherapy alone was more

efficient for eliminating UCBSV than the simultaneous application of the three

therapies. Chemotherapy had the main disadvantage of using a chemical

140

Ribavirin which is toxic to human and plant tissue and they were also

expensive (Klein and Livingston, 1982; Ng et al., 1992; James et al., 1997).

Thermotherapy may well be an efficient method if the period of heat exposure

is extended from 21 days used in this study to 30 days or more.

Thermotherapy is therefore considered to be the preferred method due to high

rates of virus elimination and high plant regeneration.

7.4.1 Conclusions


1. The regeneration of in vitro cassava plantlets was greater from

node cuttings numbered 6-10 from the top than nodes from position

1-5 while virus elimination was greater from the top part of the

plants than from the bottom.

2. Both UCBSV-[UG:Kab4-3:07] and CBSV-[MZ:Nam1-1:07] can

be eliminated from cassava using in vitro tissue culture,

thermotherapy, chemotherapy or simultaneous application of the

therapies but at varied efficiencies depending on the variety.

3. Cassava varieties subjected to various therapies adapted differently

in tissue culture. A comparatively greater number of nodes

developed from Kiroba and Albert than from Kaleso.

4. Thermotherapy was most efficient for eliminating both viruses

from Kaleso and Kiroba when compared to Albert, in which

chemotherapy alone was more efficient than the simultaneous

application of the three therapies.

141

CHAPTER 8: General Discussions and Conclusions

The current study established vital concepts underlying the interactions of

UCBSV and CBSV with the host cassava in the CBSD-pathosystem. Studies

on symptom severity on cassava and herbaceous host plants has identified the

presence of severe and milder forms of CBSVs. CBSV-[MZ:Nam1-1:07] from

Mozambique and CBSV-[TZ:Nal3-1:07] from Tanzania expressed severe

symptoms on cassava, while UCBSV-[UG:Kab4-3:07] from Uganda, and to

some extent UCBSV-[TZ:Kib10-2:03] from Tanzania expressed relatively

milder symptoms. This observation was consistent on herbaceous host plants,

N. clevelandii and N. benthamiana, as plants infected with CBSV-[MZ:Nam1-

1:07] and CBSV-[TZ:Nal3-1:07] were severely stunted and subsequently

wilted while those infected with UCBSV-[TZ:Kib10-2:03] and UCBSV-

[UG:Kab4-3:07] developed various patterns of mild chlorosis, but not necrosis

and death. The severity of the viruses was because of their ability to increase

in titre in infected plants, which was confirmed by serial dilution of viral

cDNA which indicated that severe viruses were detectable at 10-5 while the

milder isolates were not detected below 10-3 dilutions or less. Our study

further agreed with the study conducted by Moreno et al. (2011) in which the

CBSD symptom severity correlated with high virus titre.

When plants were clonally propagated to determine virus severity and the

effect of CBSD on sprouting of infected cuttings, maximum number of

cuttings were sprouted from plants infected by the milder UCBSV isolates

(92%) and a relatively smaller number from plants infected by the severe

CBSV isolate (58%). This may be due to the hyper virulent nature of the

severe CBSV isolates (Nichols, 1950), which killed plants in fields. Spread of

these viruses into areas of high whitefly populations and the possibility of

mixed infections of UCBSV and CBSV are likely to cause even more severe

damage to cassava production than yet encountered. One such area that needs

further study is therefore the possibility of synergism between UCBSV and

CBSV isolates.

Early workers on CBSD also described variation in leaf symptoms (Nichols,

1950; Storey, 1939) and this was attributed to the inherent response to

142

infection of the respective varieties (Jennings, 1960b). Information on severity

of symptoms induced, host range and mode of transmission are vital for virus

classification, especially when differentiating between viruses (Shukla et al.,

1988). Moreover, information on virus host range and means by which it is

transmitted, as well as the different isolates involved in disease development

are important requirements for developing appropriate virus control methods

(Mathew, 1991).

Successful transmission of the viruses was achieved by sap inoculation of

herbaceous host plants from cassava and also from herbaceous to herbaceous

host plants, but the rate of sap transmission (17% and 23%) from cassava to

cassava was low. These results are in agreement with Lister (1959) as

transmission and spread of UCBSV and CBSV was considered to be mainly

through vectors and perpetuating infected cuttings (Hillocks et al., 2001;

Maruthi et al., 2005). In addition to confirming UCBSV and CBSV

transmission by methods including vectors, perpetuation through use of

infected cuttings, sap and graft inoculation, it was established in this study for

the first time that CBSVs are not transmitted through contaminated cutting

tools and harvesting of cassava leaves for vegetable consumption as is being

practiced in some countries or animal feeding. This is contrary to many other

plant viruses and virus like particles such as PVX and potato tuber viroid,

which were found to be transmitted by contaminated tools (Manzer and

Merriam, 1961). These results suggest that leaf picking or the use of

contaminated tools are not responsible for the recent upsurges in CBSD

incidences and control strategies should emphasise the use of clean planting

material.

Graft-transmission of CBSV gave 100% infection in susceptible varieties

making it the most reliable means of virus transmission in experiments. The

high whitefly transmission rates observed in this study (57%) compared to low

rates obtained by Maruthi et al. (2005) and Mware et al. (2009), however is

comparable to transmission rates of other ipomoviruses (Cucumber vein

yellowing virus, CVYV, 55%) by whitefly (Mansour and Al-Musa, 1993); this

could be due to some technical updates in the protocol followed such as

143

allowing the whiteflies to acquire the virus freely on a diseased plant and

using a set AAP and IAP of 24 h. All six UCBSV and CBSV isolates used in

this study were transmitted to healthy cassava plants by graft-inoculation and

resulted in virus infection without difficulty. Therefore, to improve our

understanding of the mechanisms of CBSD resistance in cassava, graft-

inoculation was preferred. Other researchers and plant breeders can also

conveniently use the method to inoculate cassava plants with the target virus

without the need for using whitefly transmissions. Graft inoculation is quick to

determine when an inoculation is successful through the survival of the graft.

However, the virus challenge in the graft-inoculated plant is greater than

challenge by whitefly inoculations and this may result in varieties with usable

field resistance being discarded.

The differences identified in the levels of resistance were shown to be due to a

combination of the interactions between the virulence of viruses and the

inherent resistance mechanisms of the plant. Legg (1994) and Solomon-

Blackburn and Baker (2001) described mechanisms to be considered while

selecting varieties for resistance. Firstly, virus multiplication at the early

stages of infection is delayed or prevented. Secondly, is the hypersensitive

reaction (HR), which is the ability of the variety to prevent spread of infection

to other parts of the plant beyond the immediate site of invasion (Cooper,

2001). The third mechanism is the resistance to vectors. Another mechanism is

resistance to virus accumulation, where plants are infected and the virus

spreads in the plant, but virus titre is very low. In this study the virus moved

quicker in Albert which is a known susceptible variety, than in Kiroba

(tolerant) and Kaleso (field-resistant). Both UCBSV and CBSV first spread

down to the root and then to the rest of the plant, which was similar to the

pattern of spread of ACMV (Gibson and Otim-Nape 1997). Regarding

resistance to vectors, B. tabaci fecundity and survival studies on Kaleso,

Kiroba and Albert demonstrated the absence of significant differences

between the ability of cassava varieties to support B. tabaci development. This

was in agreement with the observations of Maruthi et al. (2001) and Hahn et

al. (1980) who noted no differences in B. tabaci survival on CMD-resistant,

tolerant and susceptible cassava varieties and thus concluded that resistance to

144

the vector was unlikely to be found in cassava. In the absence of differences

between the varieties for B. tabaci development, our results lead to the

following conclusions: first, resistance to UCBSV and CBSV in cassava is not

because they are unattractive to B. tabac.

The virus titre in the susceptible Albert was high compared to Kiroba and

Kaleso. The three cassava varieties used in this study expressed different

CBSD symptom severities that matched with virus titre. CBSV-[MZ:Nam1-

1:07] titre in Albert was associated with severe symptoms. Albert infected

with UCBSV-[UG:Kab4-3:07] expressed milder symptoms and had low virus

titre than the infection of the same varieties with CBSV-[MZ:Nam1-1:07].

The milder UCBSV-[UG:Kab4-3:07] was also not associated with root

necrosis in varieties Kiroba and Kaleso which is in agreement with the

findings of Hillocks et al. (1996) that some cassava varieties expressed foliar

symptoms with or without root necrosis.

Reversion is another resistance mechanism earlier recognised in CMD-

resistant cassava varieties in East Africa (Storey and Nichols, 1938; Jennings,

1957; Rossel et al., 1992; Thresh et al., 1994; Fargette et al., 1996; Gibson

and Otim-Nape, 1997) and seemed to work on both local and improved

cassava varieties (Fondong et al., 2000). After infection with viruses, plants

employ RNA silencing mechanism against all foreign genes entering the plant

(Vaucheret, 2001; Voinnet, 2001). However, many viruses, in turn, employ

virus-encoded proteins which suppress RNA silencing allowing them to

successfully infect their host (Kasschau and Carrington, 1998; Voinnet et al.,

2000; Ahlquist, 2002; Moissiard and Voinnet 2004). In turn, however, plants

also evolved an even greater level of host resistance that restrain virus-

encoded RNA silencing suppression (Li et al., 1999) which is manifested

through possibilities of diseased plants to revert from virus infection.

Reversion also seems to work on the RNA silencing mechanism (Ratcliff et

al., 1999; Kreuze et al., 2002) but, severely CBSD affected plants do not

revert; the mechanism seems to be commonly deployed for more tolerant

varieties and reversion was observed especially from milder UCBSV and more

frequently in more resistant varieties for CBSD for the first time in this study.

145

It was previously suggested by Hillocks and Jennings (2003) that reversion in

CBSD-infected cassava is due to localised distribution of the virus. Reversion

was greatest in cuttings taken from the middle and upper portion of the stem

than from the bottom. Likewise, Gibson and Otim-Nape (1997) observed high

reversion from middle and upper portions of CMD-infected cassava compared

to least number from lower part of the stems. Although the greatest rate of

reversion occurred in shorter cuttings of 10 cm long, short cuttings were less

viable and grew weakly (Gibson and Otim-Nape, 1997), which could

predispose them to CBSVs re-infection, attack by pest and other pathogens

and this, may lead to poor yield. Cuttings of intermediate length of 15 cm

therefore will be suitable to achieve an optimum rate of reversion and

acceptable plants.

Besides the natural potential of some varieties to revert from UCBSV and

CBSV infection, eliminating UCBSV and CBSV from infected cassava

(Chapter 7) was investigated using thermo and chemotherapies, or simple

nodal culture. These eliminated both UCBSV and CBSV from infected

cassava. Tissue culturing alone resulted in virus elimination (up to 30%) of

plants and regeneration of relatively high number of virus-free plantlets in a

short period, suggesting a high potential of the in vitro methods for

regenerating virus-free cassava from CBSV-infected plants. Virus elimination

from these methods can be useful especially for the elite but susceptible

varieties infected with severe isolates from which they do not easily revert.

During heat treatment, there are probably unsuitable conditions for virus

movement and replication, thus the node cuttings elongate faster than the rate

at which the virus moves to the top. High metabolic activity observed in the

callus was well reported to interfere with virus replication due to competition

for resources (Valentine et al., 2002). Virus elimination from potato was

achieved by the combination of thermotherapy and the addition of ribavirin to

the tissue culture media (Dodds et al., 1989; Griffiths et al., 1990; Fletcher et

al., 1998). The combined effects of thermo and chemotherapies in this study

on cassava were highly efficient in eliminating both UCBSV-[UG:Kab4-3:07]

(53 to 94%) and CBSV-[MZ:Nam1-1:07] (71 to 92%). A significant drawback

with in vitro techniques, however, is that cassava varieties differed greatly

146

when planted in the tissue culture media therefore the protocol should be

optimised for each variety (Kaiser and Teemba, 1989).

In conclusion, the current study adopted a number of approaches to study the

relationship between CBSV-infection and symptoms expression. The severity

of the disease depends on the tolerance level of the variety, virus isolate and

the duration of infection. It was further demonstrated that there are differences

in the susceptibility between the tested cassava varieties which are not due to

differences in their ability to attract and support B. tabaci. Similarly, there

were differences in pathogenicity between the test virus isolates with two

viruses having been identified, one of which is associated with the Uganda

epidemic. Virus isolate from Uganda was less pathogenic than the

Mozambique isolate. Protocols were established for the efficient graft-

inoculation with 100% infection of susceptible cassava varieties. Differences

identified in the levels of susceptibility following graft-inoculation, are related

to different rates of virus movement and multiplication after initial infection.

UCBSV and CBSV first spread down to the root, then to the rest of the plant.

Virus titre results can indicate varieties with high reversion potential and such

varieties can then be used to breed for resistance to viruses.

Reversion was shown to occur with CBSD and is frequent in resistant

varieties. Therefore, CBSV-free plants can be generated from diseased plants.

Heat and chemical methods can be used to eradicate both UCBSV and CBSV

from infected plants. RT-PCR results indicated that tissue culturing alone had

a positive effect in removing the virus from 9 to 30% of the plants. The ET for

thermotherapy and chemotherapy ranged from 27 to 49%, and 30 to 38%

respectively, while the ET of the combined therapies ranged from 33 to 50%.

Consequently, chemotherapy is considered as a least effective method due to

its low efficiency as well as the toxic nature of ribavirin. Further work is

needed on; (1) the relationship between symptom severity and virus titres in

different cassava varieties, (2) the nature of interactions between UCBSV and

CBSV and UCBSVs in dual infected cassava plants, (3) rates of UCBSV

transmission by whitefly on different cassava varieties, (4) other mechanisms

of UCBSV and CBSV transmissions and (5) influence of different cassava

147

varieties, CBSD isolates and environment on the mechanism of resistance to

CBSD. Research gaps cited above open up opportunities for the academic

virologists, plant breeders, molecular biologists and/or researchers. The

findings from this study have contributed significantly to improve our

understanding of the role of host cassava, virus and the vector whitefly in

causing CBSD. In view of existing damage and threats posed by CBSD, it is

essential to identify and then implement effective management strategies for

the disease. Recognizing the existence of two forms of the virus and important

differences between them will greatly aid the development of effective

strategies. Management tactics for CBSD should seek for the high level of

effective resistance. This highlights the importance of developing host plant

resistance to CBSD that is of comparable robustness to that currently available

for CMD (Legg et al., 2011). This may likely be achieved if both conventional

and transgenic breeding approaches are explored. Equally important, is the

recognition of reversion to CBSD. This will help minimize the perpetuation of

CBSV and UCBSV through infected cuttings. The rate of transmissions of

CBSV obtained in this study suggests that whitefly management will not only

provide a solution to current CBSD pandemics, but in addition, will

significantly reduce the likelihood for the emergence of new epidemics caused

by variant isolates.

148

REFERENCES

Abarshi, M.M., Mohammed, I.U., Wasswa, P., Hillocks, R.J. Holt, J. Legg,

J.P., Seal, S.E. and Maruthi, M.N. (2010). Optimization of diagnostic RT-PCR

protocols and sampling procedures for the reliable and cost-effective detection

of Cassava brown streak virus. Journal of Virological Methods, 163: 353-359.

Abarshi, M.M., Mohammed, I.U. Jeremiah, S.C. Legg, J.P. Lava Kumar, P.

Hillocks, R.J. Maruthi M.N. (2012). Multiplex RT-PCR assays for the

simultaneous detection of both RNA and DNA viruses infecting cassava and

the common occurrence of mixed infections by two cassava brown streak

viruses in East Africa. Journal of Virological Methods, 18: 176-179.

Abouzid, A.M., Freitas-Astua, J., Purcifull, D.E., Polston, J.E.,

Beckham,K.A., Crawford, W.E., Petersen, M.A., Peyser, B., Patte, C. and

Hiebert, E. (2002). Serological studies using polyclonal antisera prepared

against the viral coat protein of four begomoviruses expressed in Escherichia

coli. Plant Disease, 86: 1109-1114.

Adams, M.J, Antoniw, J.F, and Fauquet, C.M. (2005). Molecular criteria for

genus and species discrimination within the family Potyviridae. Archives of

Virology, 150: 459-479.

Adams, M. (2008). Descriptions of plant viruses. Cleavage sites in the family

Potyviridae.http://www.dpvweb.net/potycleavage/index.html. Accessed on

12/08/2011.

Agboola, S.A. (1968). The introduction and spread of cassava in Western

Nigeria. Economic and Social Studies, 10: 369-385.

Agwu, A.E and Anyaeche, C.L (2007) Adoption of Improved Cassava

Varieties in six rural Communities of Anambra State, Nigeria. African Journal

of Biotechnology, 6: 089-098.

149

.Ahmad, M., Arif, M.I. and Denholm, I. (2003). High resistance of field

population of cotton aphid (A. gossypii) to pyrethroid insecticides in Pakistan.

Journal of Entomology, 96: 875-878.

Ahlquist, P. (2002). RNA-dependent RNA polymerases, viruses, and RNA

silencing. Science, 296: 1270-1273.

Akhtar, M., M. Ashraf and M.E. Akhtar (2003).Sugarcane yield gap analysis:

Future options for Pakistan. Science Technology and Development, 1: 38-48.

Akinbade, S.A., Hanna, R., Nguenkam, A., Njukwe, E., Fotso, A., Doumtsop,

A., Ngeve, J., Tenku, S.T.N., Lava Kumar, P. (2010). First report of the East

African cassava mosaic virus-Uganda (EACMV-UG) infecting cassava

(Manihot esculenta) in Cameroon. New Disease Report, 21: 22.

Alicai, T., Omongo, C.A., Maruthi, M.N., Hillocks, R.J., Baguma, Y.,

Kawuki, R., Bua, A., Otim-Nape, G.W. and Colvin, J. (2007). Re-emergence

of cassava brown streak disease in Uganda. Plant Disease, 91:24-29.

Alabi, O.J., Kumar, P.L., Naidu, R.A. (2008). Multiplex PCR for the detection

of African cassava mosaic virus and East African cassava mosaic Cameroon

virus in cassava. Journal of Virology Methods, 154, 111-120.

Allam, E.K. (2000). Eradication of Banana bunchy top virus and Banana

mosaic virus from diseased banana plants. Annals of Agricultural Science, 45:

33-48.

Allem, A.C. (2002). The origins and taxonomy of cassava. In: Cassava:

biology, production and utilization. Cambridge University Press. CAB

International, Wallingford, UK. Hillocks, R.J., Thresh, J.M. and Bellotti, A.

(eds). Pp 1-16.

Alves, A.A.C. (2002). Cassava botany and physiology, In: In: Cassava:

biology, production and utilization. Cambridge University Press. CAB

150

International, Wallingford, UK. Hillocks, R.J., Thresh, J.M. and Bellotti, A.

(eds). Pp 67-89.

Ammar, E.D. Järlfors, U., Pirone, T.P. (1994). Association of potyvirus helper

component protein with virions and the cuticle lining the maxillary food canal

and foregut of an aphid vector. Phytopathology, 84: 1054-60.

Andrejeva, J., Puurand, Ü., Merits, A., Rabenstein, F., Järvekülg, L. and

Valkonen, J.P.T. (1999). Potyvirus HC-Pro and CP proteins have coordinated

functions in virus-host interactions and the same CP motif affects virus

transmission and accumulation. Journal of General Virology, 80: 1133-1139.

Balagne, M. (1985). Le microbouturage in vitro de l'igname cousse couche

Dioscorea trifida en vue de son application pour la guérison des variétés

atteintes de viroses. Thèse de 3ème cycle, USTL, Montpellier, 144p.

Bamikole, O.T. (2007). Production of fuel ethanol from cassava in Nigera:

obstacles and benefits. In: 10th Triennial Symposium jointly organized by the

ISTRC-AB and Mozambique Agrarian Research Institute (IIAM). Joaquim

Chissano International Conference Centre, Maputo, Mozambique 8-12

October 2007. Mahungu, M.N. and Mkumbira, J. (eds.) 10p.

Barratt, C. B., Marenya, P.P., McPeak, J., Minten, B., Murithi, F., Oluoch-

Kosura, W. (2006). Welfare dynamics in rural Kenya and Madagascar.

Journal of Development Studies, 42: 248-277.

Baulcombe, D.C. (1996). Mechanisms of pathogen-derived resistance to

viruses in transgenic plants. The Plant Cell, 8: 1833-1844.

Bellotti, A.C. (2002). Arthropod pests, In: Cassava: Biology, Production and

Utilization. Cambridge University Press. CAB International, Wallingford, UK

Hillocks, R.J., Thresh, J.M. and Bellotti, A. (eds.). Pp 209-235.

151

Bernstein, E., Caudy, A.A., Hammond, S.M. and Hannon, G.J. (2001). Role

for a bidentate ribonuclease in the initiation step of RNA interference. Nature,

409:295-296.

Berrie, L. C., Palmer, K. E., Rybicki, E. P. and Rey, M. E. C. (1998).

Molecular characterisation of a distinct South African cassava infecting

geminivirus. Archives of Virology, 143: 2253-2260.

Bird, J. (1957). A whitefly transmitted mosaic of Jastroph gossypifolia.

Technical Paper. Agricultural Experiment Station Puerto Rico, 22: 1-35.

Bird, J. and Maramorosch, K. (1978). Viruses and virus diseases associated

with whiteflies. Advances in Virus Research, 22: 55-110.

Bock, K.R, Guthrie, E.J. and Meredith, G. (1978) Distribution, host range,

properties and purification of cassava latent virus, a geminivirus. Annal of

Applied Biology, 90: 361-367.

Bock, K.R. (1982). Geminivirus diseases in tropical crops. Plant Disease, 66:

266–270.

Bock, K.R. (1983). Epidemiology of cassava mosaic in Kenya. In: Plant virus

disease epidemiology. Blackwell, Oxford. Plumb, R.T. and Thresh, J.M. (eds.)

Pp 337- 347.

Bock, K.R., Woods, R.D. (1983). The etiology of African cassava mosaic

disease. Plant Disease, 67:994-995.

Bock, K.R. (1994). Studies on cassava brown streak virus disease in Kenya.

Tropical Science Journal, 34:134-145.

Boevink, P. and Oparka, K.J. (2005). Virus–host interactions during

movement processes. Plant Physiology, 138:1815-1821.

152

Boissot, N., Urbino, C., Dintinger, J., Pavis, C. (2008). Vector and graft

inoculations of Potato yellow mosaic virus reveals recessive resistance in

Solanu pimpinellifolium. Annalsof Applied Biology, 152: 263-269.

Bokanga A. and Otoo, E., (1991). Cassava based food, How safe are they? In

K.A. Taiwo, Utilization Potentials of cassava in Nigeria: The Domestic and

Industrial products. Food Reviews International, 22:29-42.

Bokanga, M. and Otoo, E. (1994). Cassava based food: how safe are they In:

Proceedings of the 9th Symposium of the International Society for Tropical

Root Crops, held at Accra, Ghana 20-26 October 1991. Ofori, F. and Hahn,

S.K. (eds.), 225p.

Bokanga, M., Ekanayake, I.J. and Dixon, A.G.O. (1994). Genotype-

Environment interactions for cyanogenic potential in cassava. In: Proceedings

of the International Workshop on Cassava Safety, held at Ibadan, Nigeria,

March 1 – 4, 1994. Bokanga, M., Essers, A.J.A., Poulter, N., Rosling, H. and

Tewe, O. (eds.). 132p.

Bokanga, M. (2007). Root crops biofuels and food security in Africa. In: 10th

Triennial Symposium jointly organized by the ISTRC-AB and Mozambique

Agrarian Research Institute (IIAM). Joaquim Chissano International

Conference Centre, Maputo, Mozambique 8-12 October 2007. Mahungu,

M.N. and Mkumbira, J (eds.) 7p.

Brigneti, G., Voinnet, O., Li, W.X., Ji, L.H., Ding, S.W. and Baulcombe, D.C.

(1998). Viral pathogenicity determinants are suppressors of transgene

silencing in Nicotiana benthamiana. EMBO Journal, 17: 6739-6746.

Broadbent P, Gollnow B.I., Gillings M.R. and Bevington K.B., (1968). Root

Grafting and Mechanical Transmission of Citrus Exocortis Viroid Within a

Citrus Budwood Multiplication Block. http://www. ivia. es/iocv/ archivos

/proceedings X/10th197_ 203 .pdf. accessed on 20/02/2011.

153

Brown, J.K. (1990). An update on the whitefly-transmitted geminiviruses in

the Americas and the Caribbean Basin. FAO Plant Protection Bulletin, 39: 5-

23.

Brown, J.K., Frohlich, D.R. and Rosell, R.C. (1995). The sweetpotato or

silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annual

Review of Entomology, 40: 511–534.

Brunt, A.A. (1996). Cassava brown streak – carlavirus? cassava brown streak

potyvirus? In: Plant Viruses Online journal. http:// biology. anu. edu. Au

/Groups /ME. Accessesd: 20/10/2008.Crabtree, K., Dallwitz, M.J., Gibbs,

A.J., Watson, L. and Zurcher, E.J. (eds.). Pp 56-63.

Burban, C., Fishpool, L.D.C, Fauquet, C., Fargette, D. and Thouvenel, J.C.

(1992). Host-associated biotypes within West African populations of the

whitefly Bemisia tabaci (Genn.), Homoptera: Aleyrodidae. Applied Journal of

Entomology, 113: 416-423.

Bustin, S.A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M.,

Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., and

Wittwer, C.T. (2009). The MIQE Guidelines:Minimum Information for

Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry,

55: 611-622.

CABRI (1998). Grafting of virus infected plant material to healthy host plants.

Laboratory procedures for plant cell viruses. The CABRI Consortium 1999-

2003.http:// www. cabri. org/ guidelines/ plant_virus/ pcv202ap3. html.

accessed on 23/04/2011.

Calvert, L.A. and Thresh, J.M. (2002). The viruses and virus diseases of

cassava. In: Cassava: Biology, Production and Utilization. Cambridge

University Press. CAB International, Wallingford, UK Hillocks, R.J., Thresh,

J.M. and Bellotti, A. (eds). Pp 238-242.

154

Carrington, J.C. and Whitham, S.A. (1998). Viral invasion and host defense:

strategies and counter-strategies. Institute of Biological Chemistry,

Washington State University press. Pullman, USA. 336p.

Carrington, J.C. and Ambros, V. (2003). Role of microRNAs in plant and

animal development. Science, 301: 336-338.

Carter, S.E., Fresno, L.O., Jones, P.G. and Fairbairn, J.N. (1992). An atlas of

cassava in Africa: Historical, Agroecological and Demographic aspects of

crop distribution. CIAT, Cali Colombia. Pp 2-9.

Cassels, A.C. and Long, R.D. (1982). The elimination of potato viruses X,Y,S

and M in meristem and explants cultures of potato in the presence of virazole.

Potato Research, 25: 165-173.

Chabwine, J.N., Masheka, C., Balol’ebwami, Z., Maheshe, B., Balegamire, S.,

Rutega, B., Lola, M., Mutendela, K., Bonnet, M.-J., Shangalume, O. and

Balegamire, J.M Nemery, B. (2011). Appearance of konzo in South-Kivu, a

wartorn area in the Democratic Republic of Congo. Food Chemical

Toxicology, 49: 644–649.

Chandler, F.L. and Haque, S.Q. (1984). The use of tissue culture in the

production of improved yam and sweet potato planting material. In:

Micropropagation of selected Root crops, palm, citrus and ornamental species.

FAO plant production and protection paper, N0. 59 Rome.

Chávez, A.L., Sánchez, T., Jaramillo, G., Bedoya, J.M., Echeverry, J.,

Bolaños, A., Ceballos, H., and Iglesias, C.A. (2005). Variation of quality traits

in cassava roots evaluated in landraces and improved clones. Euphytica, 143:

125-133.

Chen, J. and Adams, M.J. (2001). A universal PCR primer to detect members

of the Potyviridae and its use to examine the taxonomic status of several

members of the family. Archieves of Virology, 146: 757-766.

155

Cliff, J., Muquingue, H., Nhassico, D., Nzwalo, H., Bradbury, J.H. (2011).

Konzo and continuing cyanide intoxication from cassava in Mozambique.

Workshop on Toxico-nutritional neurodegenerations, September 2009, IPBO-

Ugent, Belgium. Food Chemical Toxicology, 49: 631-635.

Colinet, D., Kummert, J. and Lepoiver, P. (1996). Molecular evidence that the

whitefly – transmitted sweet potato mild mottle virus belongs to a distinct

genus of the Potyviridae. Archives of Virology, 141:125-135.

Colinet, D., Kummert J., and Lepoivre P. (1998). The nucleotide sequence and

genome organization of the whitefly transmitted sweetpotato mild mottle

virus: a close relationship with members of the family Potyviridae. Virological

Research, 53: 187-196.

Covey, S.N., Al-Kaff, V.S., Lángara, A. and Turner, D.S. (1997). Plants

combat infection by gene silencing. Nature, 385: 781-782.

Cooke, R.D. and Coursey, D.G. (1981). Cassava: a major cyanide-containing

food crop. In: Cyanide in Biology. Vennesland, B. Conn, E.E. and Knowles,

C.J. (eds.). Academic Press, New York. Pp 94-113.

Cooper, B. (2001). Collateral gene expression changes induced by distinct

plant viruses during the hypersensitive resistance reaction in Chenopodium

amaranticolor. The Plant Journal, 26: 339-349.

Crawley, M.J. (2009). Statistics an introduction using R... Imperial College

London UK: John Willey and Sons Ltd. 253P.

Dalmay, T., Horsefield, R., Braunstein, T.H. and Baulcombe, D.C. (2001).

SDE3 encodes an RNA helicase required for post-transcriptional gene

silencing in Arabidopsis. The EMBO Journal, 20: 2069-2077.

Deng, D., McGrath, P.F., Robinson, D.J. and Harrison, B.D. (1994). Detection

and differentiation of whitefly-transmitted geminiviruses in plants and vector

156

insects by the PCR with degenerate primers. Annals of Applied Biology, 125:

327-336.

Devries, S.C., Gerrie W.J. Martink, V., Ittersum, V. and Giller K. (2011). The

production-ecological sustainability of cassava, sugarcane and sweet sorghum

cultivation for bioethanol in Mozambique. GCB Bioenergy, 10: 1757-1707.

Dixon, A.G.O., Ngeve, J.M. and Nukenine, E.N. (2002). Response of Cassava

Geno-types to four Biotic Constraints in Three Agro-ecolgies of Nigeria.

African Crop Science Journal, 10: 12.

Dodds, J.H.; Lizarraga, R.; Griffiths, H.; Slack, S.A. (1989). Methods of virus

eradication. In: Planning coference on control of virus and virus-like diseases

of potato and sweet potato, Lima, 1989. Report 3,. Lima: International Potato

Center, 228p.

Dunbar, K.B.; Pinnow, D.L.; Morris, J.B.; PIttman, R.N. (1993). Virus

elimination from interspecific Arachis hybrids. Plant Disease, 77: 517-520.

Ekanayake, I.J., Osiru, D.S.O. and Porto, M.C.M. (1997). Agronomy of

cassava. IITA Research Guide 61. Training Program, IITA, Ibadan, Nigeria.

First edition. 30p.

Elbashir, S.M., Leneckel, W. and Tuschl, T. (2001). RNA interference is

mediated by 21- and 22-nucleotide RNAs. Genes and Development, 15:188-

200.

Elia, A., Constantinou, C. and Clemens, M.J. (2008). Effects of protein

phosphorylation on ubiquitination and stability of the translational inhibitor

protein 4E-BP1. Oncogene, 27: 811–822.

Encina, C.L., Constantin, M. and Botella, J. (2001). An easy and reliable

method for establishment and maintenance of leaf and root cell culture of

Arabidopsis. Plant Biology report. 19: 245-248.

157

Ernesto, M., Cardoso, A.P., Nicala, D., Mirione, E., Massaza, F., Cliff, J.,

Haque, M.R., Bradbury, J.H. (2002). Persistent konzo and cyanogen toxicity

from cassava innorthern Mozambique. Acta Tropica, 82: 357-362.

Ezeibekwe, I.O., Ezenwaka, C.L., Mbagwu, F.N. and Unamba C.I.N. (2009).

Effect of combination of different level of auxin (NAA) and Cytokinin (BAP)

on in vitro propagation of Dioscorea rotundata L (White yam). Journal of

Molecular Genetics, 1: 18-22.

Fargette, D., Fauquet, C. and Thouvenel, J.C. (1985). Field studies on the

spread of African cassava mosaic. Annals of Applied Biology, 106: 285- 294.

Fargette, D., Colon, L.T., Bouveau, D. and Fauquet, C.M. (1996).

Components of resistance of cassava to African cassava mosaic virus.

European Journal of Plant Pathology, 102: 645-654.

Fauquet, C.M. and Fargette, D. (1990). African cassava mosaic virus:

Aetiology, epidemiology and control. Plant Disease, 74: 404-011.

FAOSTAT, (2009). Production Statistics. http//faostat.fao.org accessed

23/07/2010.

FAOSTAT, (2010). Production Statistics. http//faostat.fao.org accessed

03/04/2011.

Ferguson, G. (2009). Potential New Invasive Pests for Canadian Greenhouse

Vegetable Crops. In: Canadian Greenhouse (C.G.C.) held on 7th October

2009. www.agric.wa.gov.au accessed on 23/10/11.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, SE and Mello, C.C.

(1998). Potent and specific genetic interference by double-stranded RNA in

Caenorhabditis elegans. Nature, 391:806-811.

158

Fletcher, P.J.; Fletcher, J.D.; Cross, R.J. (1998). Potato germplasm: in vitro

storage and virus reduction. New Zeland Journal of Crop and Horticultural

Science, 26: 249-252.

Fondong, V.N., Thresh, J.M. and Fauquet, C. (2000). Field experiments in

Cameroon on cassava mosaic virus disease and the reversion phenomenon in

susceptible and resistant cassava cultivars. International Journal of Pest

Management, 46: 211-217.

Frison, E.A. (1994). Sanitation techniques for cassava. Tropical Science, 34:

146-153.

Gibbs, A. and Mackenzie, A. (1997). A primer pair for amplifying part of the

genom of all potyvirids by RT-PCR. Journal of Virological Methods, 63: 9-16.

Gibson, R.W. (1996). The report of a survey monitoring the spread of the

epidemic of African cassava mosaic virus from Uganda into western Kenya.

Internal report. Natural Resources Institute, Chatham, UK, 18p.

Gibson, R.W., Legg, J.P. and Otim-Nape, G.W. (1996). Unusual severe

symptoms are characteristics of the current epidemic of mosaic virus disease

in Uganda. Annals of Applied Biology, 128: 479-490.

Gibson, R.W. and Otim-Nape, G.W. (1997). Factors determining recovery and

reversion in mosaic-affected African cassava mosaic virus resistant cassava.

Annals of Applied Biology, 131: 259-271.

Gondwe, F.M.T., Mahungu N.M., Hillocks, R.J., Raya, M.D., Moyo, C.C.,

Soko, M.M., Chipungu, F.P., and Benesi, I.R.M. (2003). Economic Losses

Experienced by Small-scale Farmers in Malawi Due to Cassava Brown Streak

Virus Disease. In Cassava Brown Streak Virus Disease: Past, Present, and

Future, J.P. Legg and R.J. Hillocks (eds). Aylesford, U.K.: Natural Resources

International Limited. Proceedings of an International Workshop, 27-30

159

October 2002, Mombasa, Kenya. forthcoming. Washington, DC: International

Food Policy Research Institute.

GriffithS, H.M.; Slack, S.A.; Dodds, J.H. (1990) Effect of chemical and heat

therapy on virus concentrations in in vitro potato plantlets. Canadian Journal

of Botanic, 68: 1515-1521.

Hahn, B. H., Ebling, F., Freeman, S., Clevinger, B., and Davie, J. (1980).

Cassava mosaic disease resistance, cassava bacterial blight resistance and

decreased cyanide content. Arthritis Rheumatology, 23: 942-945.

Hahn, S.K., John, C., Isoba, G. and Ikotun, T. (1989). Resistance breeding in

root and tuber crops at the IITA, Ibadan Nigeria. Crop Protection, 8: 147-168.

Hahn, S.K. (1984). Progress of root and tuber improvement at IITA. In:

Proceedings of the 6th Symposium of the International Society for Tropical

Root Crops Lima, Peru 20-25 February 1983. Shideler, F. S. and Rincon, H.

(eds.). 96p.

Hamilton, A.J. and Baulcombe, D.C. (1999). A species of small antisense

RNA in post-transcriptional gene silencing in plants. Science, 286: 950-952.

Harrison, B.D., Swanson, M.M. and Robinson, D.J. (1995). Cassava viruses in

the old world. In: proceedings of the second international scientific meeting,

Bogor, Indonesia, CIAT working document. Cassava Biotechnology Network,

150: 298-301.

Harpaz I and Cohen S. (1965). Semi persistent relationship between cucumber

vein yellowing virus (CVYV) and its vector, the tobacco whitefly (Bemisia

tabaci Gannadius). Phytopathology, 54: 240-248.

Henry, G. and Hershey, C. (2002). Cassava in South America and the

Caribbean. In: Cassava: Biology, Production and Utilization. Cambridge

160

University Press. CAB International, Wallingford, UK Hillocks, R.J., Thresh,

J.M. and Bellotti, A. (eds). 17p.

Herzberg, F. Mignouna, J. Mahungu, N.M. and Kullaya, A. (2004).

Assessment of Genetic Diversity of Local Verieties of Cassava in Tanzania

Using Molecular Markers. African Crop Science Journal, 12:171.

Hillocks, R.J., Raya, M. and Thresh, M.J. (1996). The association between

root necrosis and above ground symptoms of brown streak virus infection of

cassava in southern Tanzania. International Journal of pest management, 42:

285-289.

Hillocks, R.J. (1997). Cassava virus disease and their control with special

reference to southern Tanzania. International Journal of Pest Management, 2:

125-138.

Hillocks, R.J. and Thresh, J.M. (1998). Cassava mosaic and cassava brown

streak virus diseases in Africa: a comparative guide to symptoms and

aetiologies. Natural Resources Institute, UK. 11p.

Hillocks, R.J., Raya, M.D. and Thresh, J.M. (1999). Distribution and symptom

expression of cassava brown streak virus disease in southern Tanzania.

African Journal of Root and Tuber Crops, 3: 57-62.

Hillocks, R.J., Raya, M., Mtunda, K. and Kiozia, H. (2001). Effects of cassava

brown streak virus disease on yield and quality of cassava in Tanzania.

Journal of Phytopathology, 149: 389-394.

Hillocks, R.J. (2002). Cassava brown streak virus disease: Summary of present

knowledge on distribution, spread, effect on yield and methods of control. In:

Proceedings of international workshop, Mombasa, Kenya, 27-30 October

2002. Natural Resources International Limited, Aylesford, UK. 23p.

161

Hillocks, R.J., Thresh, J.M., Tomas, J., Botao, M. Macia, R. and Zavier, R.

(2002). Cassava brown streak disease in northern Mozambique. International

Journal of Pest Management. 48: 179-182.

Hillocks, R.J. (2003). Cassava Brown Streak Virus Disease: Summary of

Present Knowledge on Distribution, Spread, Effect on Yield and Methods of

Control. In Cassava Brown Streak Virus Disease: Past, Present, and Future,

ed. J.P. Legg and R.J. Hillocks. Aylesford, U.K.: Natural Resources

International Limited. Proceedings of an International Workshop, 27-30

October 2002, Mombasa, Kenya.

Hillocks, R.J. and Jennings, D.L. (2003). Cassava brown streak disease: a

review of present knowledge and research needs. International Journal of Pest

Management, 43: 225-234.

Hillocks, R.J. and Thresh, J.M. (2003). Cassava mosaic and cassava brown

streak diseases in Nampula and Zambézia provinces of Mozambique. Roots, 8:

10 -5

Hillocks, R.J. (2005). Promotion of control measures for cassava brown streak

disease. Final Technical Report 01 August 2002 – 31 March 2005. R8404 (ZA

0632). Pp 2-31.

Hillocks, R.J. (2006). Promotion of control measures for cassava brown streak

disease. Final Technical Report R8404 (ZA 0632). Pp 2-31.

Holn, T. (2007). Plant virus transmission from the insect point of view. PNAS,

104: 17905-17906.

Hong, Y.G., Robinson, D.J., Harrison, B.D. (1993). Nucleotide sequence

evidence for the occurrence of three distinct whitefly-transmitted

geminiviruses in cassava. Journal of General Virology, 74: 2437-2443.

162

Hormozi-Nejad, M.H., Mozafari, J. and Rakhshanderoo, F. (2010). Production

and certification of virus-free nucleus seeds incommon bean. Journal of Plant

Diseases and Protection, 117: 201-205.

Hu, J.S. (1995). Comparison of dot blot, ELISA and RT-PCR assays for

detection of two Cucumber mosaic virus isolates infecting banana in Hawaï.

Plant Disease, 79: 902-906.

ICTV (2010). http://www.ictvonline.org/index.asp?bhcp=1 accessed on 14

02/2012.

Idris, I., Gray, S. and Donnelly, R. (2001). Protein kinase C activation:

isozymespecific effects on metabolism and cardiovascular complications in

diabetes. Diabetologia 44: 659–673.

IITA (2005). Agronomy of cassava. IITA Research Guides. Training Program,

IITA, Ibadan, Nigeria. 39p.

James, D., Trytten, A., Mackenzie, D.J., Towers, G.H.N. and French, C.J.

(1997). Elimination of apple stem grooving virus by chemotherapy and

development of an immunocapture RT-PCR for rapid sensitive screening.

Annal of Applied Biology, 131: 459-470.

James, D., Varga, A., Pallas, V. and Candresse, T. (2006). Strategies for

simultaneous detection of multiple plant viruses. Journal of Plant Pathology,

28: 16-29.

Jameson, J.D. (1964). Cassava mosaic disease in Uganda. East African

Agricultural Journal, 2: 208-213.

Janssen, D., Martin, G., Velasco L., Gomez P., Segundo E., Ruiz L. and

Cuadrado I.M. (2005). Absence of a coding region for the helper component-

proteinase in the genome of the cucumber vein yellowing virus, a whitefly-

transmitted member of the potyviridae. Archives of Virology, 150: 1439-1447.

163

Jaramillo, G., Morante N., Perez, J.C., Calle, F., Ceballos, H., Arias, B.,

Bellotti, A.C. (2005). Diallel analysis in cassava adapted to the mid-altitude

valleys environment. Crop Science, 45: 1058–1063.

Jennings, D.L. (1957). Further studies in breeding cassava for virus resistance.

East African Agricultural Journal, 22: 213-219.

Jennings, D.L. (1960a). Observation on virus diseases of cassava in resistant

and susceptible varieties. 1. Mosaic disease. Empire Journal of Experimental

Agriculture, 28: 23-34.

Jennings, D. L. (1960b). Observations on virus diseases of cassava in resistant

and susceptible varieties. II. Brown streak disease. Empire Journal of

Experimental Agriculture, 28: 261-269.

Jennings, D.L. (1976). Breeding for resistance to African cassava mosaic

disease. In: Report of Inter-disciplinary Workshop held at Mugugga, Kenya,

19-22 February 1976. IDRC-071e, Ottawa, Canada. Nestel, B.L. (ed.). Pp 39-

44.

Jennings, D.L. and Iglesias, C. (2002). Cassava: Biology, Production and

Utilization. CAB International, Wallingford, UK. Hillocks, R.J., Bellotti, A.

and Thresh, J.M. (eds.). Pp 149-162.

Jennings D.L (2003). Historical perspective on breeding for resistance to

cassava brown streak virus disease. Pp 55-57. In: Legg JP and Hillocks RJ

(Eds), 2003. Cassava brown streak virus disease: Past, Present and Future.

Proceedings of an international workshop, Mombasa, Kenya, 27-30 October,

2002. Natural Resources International Limited, Aylesford, UK. 100p.

Jeremiah, S.C. and Legg, J.P. (2008). Cassava brown streak virus disease:

Farmers’ perspectives on a new outbreak of this disease from the Lake zone of

Tanzania in www.youtube.com/watch?v=CJdws9CnUw: accessed on

05/09/2011.

164

Jones, W.O. (1959). Manioc in Africa. Stanford University Press, Stanford,

CA USA 314p.

Jones, A.L., Thomas, C.L. and Maule, A.J. (1998). De novo methylation and

co-suppression induced by a cytoplasmically replicating plant RNA virus.

EMBO Journal 17: 6385-6393.

Jones, D.R. (2004). Plant viruses transmitted by whiteflies. European Journal

of plant Pathology, 109: 195-219.

Jose, G. and Dorea, F. (2004). Maternal Thiocyanate and Thyroid Status

during Breast-Feeding. Journal of the American College of Nutrition, 23: 97-

101.

Kaiser, W.J and Teemba, L.R. (1989). Use of tissue culture and

thermotheraphy to free East African cassava cultivars of African cassava

mosaic virus and cassava brown streak diseases. Plant Disease Reporter, 63:

780–784.

Kambewa, E. (2007). Assessing the feasibility and competitiveness of

cassava-based ethanol production in the SADC countries: Preliminary results.

In: 10th Triennial Symposium jointly organized by the ISTRC-AB and

Mozambique Agrarian Research Institute (IIAM). Joaquim Chissano

International Conference Centre, Maputo, Mozambique 8-12 October 2007.

Mahungu, M.N. and Mkumbira, J (eds.) 72p.

Kanju, E. (1989). Safari report to Masasi, 20-24 August 1989. Naliendale

Agricultural Research Institute, Mtwara Tanzania. 3p.

Kanju, E., Mahungu, N., Dixon, A. and Whyte, J. (2003a). Is

resistance/tolerance of cassava to brown streak disease associated with the

zigzag stem trait? Roots, 8:15-18.

165

Kanju, E.E, Mtunda, K.J, Muhana, M., Raya, M.D, and Mahungu, N.M.

(2003b). Management of cassava brown streak virus disease in Tanzania Pp

66-69. In: Legg JP and Hillocks RJ (Eds.), 2003. Cassava Brown Streak Virus

Disease: Past, Present and Future. Proceedings of an International Workshop,

Mombasa, Kenya, 27-30 October, 2002. Natural Resources International

Limited, Aylesford, UK. 100p.

Karamagioli, M. (1994). Molecular detection and characterization of African

cassava mosaic virus and Cassava brown streak virus. Msc Dessertation,

Department of Agriculture University Of Reading, U.K.

KARI, (1983). Scientist in East Africa looks for ways to combat virus

attacking cassava crops. Kenyan Agricultural Research Institute Newsletter.

23p.

Kartha, K.K. and Gamborg, O.L. (1975). Elimination of cassava mosaic

disease by meristem culture. Phytopathology, 65: 826-828.

Kartha, K.K. (1981). Meristem culture and cryopreservation methods and

applications in Plant Tissue Culture: Methods and Applications in

Agriculture. Thorpe, T.A. (ed.), Academic Press, New York. Pp181-211.

Kassanis, B. (1957). The Use of Tissue Culture to Produce Virus-free Potato

Varieties. Annal of applied Biology, 45: 422-427.

Kasschau, K.D. and Carrington, J.C. (1998). A counter defensive strategy of

plant viruses: suppression of post-transcriptional gene silencing. Cell, 95: 461-

470.

Katinila, N.A., Hamza, H. and Raya, M.D. (2003). Social Impact of Cassava

Brown Streak Virus Disease on Rural Livelihoods in Southern Tanzania. Pp

46-52. In: Legg JP and Hillocks 192 RJ (Eds), 2003. Cassava brown streak

virus disease: Past, Present and Future. Proceedings of an international

166

workshop, Mombasa, Kenya, 27-30 October, 2002. Natural Resources

International Limited, Aylesford, Uk. 100pp.

Kawano, K. (2003). Thirty years of cassava breeding for productivity:

biological and social factors for success. Crop Science, 43: 1325-1335.

Kheyr-Pour, A., Gronenborn, B. and Czosnek, H. (1994). Agroinoculation of

tomato yellow leaf curl virus (TYLCV) overcomes the virus resistance of wild

Lycopersicon species. Plant Breeding, 112: 228–233.

Kitajima, E.W. and Costa, A.S. (1964). Elongated particles found associated

with Cassava brown streak virus. East African Agriculture and Forestry

Journal, 29: 28-30.

Klein, R.E. and Livingston C.H. (1982). Eradication of potato virus X from

potato by ribavirin treatment of culture potato shoot tips. American Potato

Journal, 59: 359-365.

Ko, C.C. (2001). Systemic of Aleyrodidae- review and prospection. In:

Proceedings of the Symposium on the progress of Taiwan Entomological

Research at the Threshhold of 21st Century in Taichung. Pp 192 -199.

Kokkinos, C.D. and. Clark, C.A (2006). Real-Time PCR Assays for Detection

and Quantification of Sweetpotato Viruses. Plant Disease, 90: 783-788.

Korean, J. (2003). Micropropagation of cassava suspension culture derived

from node explants. Plant Tissue Culture, 27: 185-189.

Kreuze, J.F., Savenkov, E.I. and Valkonen, J.P.T. (2002). Complete genome

sequence and analysis of the subgenomic RNAs of Sweet potato chlorotic

stunt virus reveal several new features for the genus Crinivirus. Journal of

Virology, 76: 9260-9270.

167

Llave, C., Xie, Z., Kasschau, K.D. and Carrington, J.C. (2002). Cleavage of

Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA.

Science, 297: 2053-2060.

Lapidot, M. & Friedmann, M. (2002). Breeding for resistance to whitefly-

transmitted geminiviruses, Annal of Applied Bioliology, 140: 109-127.

Lava Kumar, P., Akinbade, S.A., Dixon, A.G.O., Mahungu, N.M., Mutunda,

M.P., Kiala, D., Londa, L., Legg, J.P. (2009). First report of the occurrence of

East African cassava mosaic virus-Uganda (EACMV-UG) in Angola. Plant

Pathology, 58: 402.

Lecoq, H., Desbiez, C., Delécolle, B., Cohn, S. and Mansour, A. (2000).

Cytological and molecular evidence that the whitefly-transmitted Cucumber

vein yellowing virus is a tentative member of the family Potyviridae. Journal

of General Virology, 81: 2289-2293.

Legg, J.P. (1994). Bemisia tabaci: the whitefly vector of cassava mosaic

Geminiviruses in Africa: An ecological perspective. African Crop Science

Journal, 4: 437-448.

Legg, J.P., Gibson, R.W. and Otim-nape, G.W. (1994). Genetic polymorphism

amongst Ugandan populations of Bemisia tabaci (Gennadius) (Homoptera:

Aleyrodidae), vector of African cassava mosaic geminivirus. Tropical Science,

34: 73-81.

Legg, J.P. and Raya, M. (1998). A survey of cassava virus disease in

Tanzania. International Journal of Pest Management, 44:17-23.

Legg, J.P. and Hillocks, R.J. (Eds), (2003). Cassava Brown Streak Virus

Disease: Past, Present and Future. Proceedings of an International Workshop,

Mombasa, Kenya, 27-30 October, 2002. Natural Resources International

Limited, Aylesford, UK. 100p.

168

Legg, J.P. and Thresh, M.J. (2003). Cassava virus disease in Africa. In:

Proceedings of the first International Workshop on Plant Virology in Sub-

Saharan Africa, 4-8 June 2003 Ibadan, Nigeria. IITA Publications Pp 517-

552.

Legg, J.P., Jeremiah, S.C., Obiero, H.M., Maruthi, M.N., Ndyetabula, I.,

Okao-Okuja, G., Bouwmeester H., Bigirimana, S., Tata-Hangy, W., Gashaka,

G., Mkamilo, G., Alicai, T. and Kumar, L.P. (2011). Comparing the regional

epidemiology of the cassava mosaic and cassava brown streak virus

pandemics in Africa. Virus Research, 159: 161-170.

Leihner, D. (2002). Agronomy and cropping systems. In: Biology, Production

and Utilization. Cambridge University Press. CAB International, Wallingford,

UK Hillocks, R.J., Thresh, J.M. and Bellotti, A. (eds). Pp 23-27.

Lennon, A.M., Aiton, M.M. and Harrison, B.D.H. (1986). Cassava viruses

from Africa. Report for 1985, Scottish Crop Research Institute. 168. Dundee,

Scotland: SCRI Wallingford, UK. 12p.

Leonhard W., Wawrosch, C.H., Aue, R.A. and Kopp, B. (1998). Monitoring

of virus diseases in Austrian grapevine varieties and virus elimination using in

vitro thermotherapy. Plant Cell Tissue and Organ Culture, 52: 71-74.

Leone, J. (1977). Origin, evolution and early dispersal of root and tuber crops.

In: Proceedings of the 4th Symposium of the International Society of Tropical

Root Crops held at CIAT, Cali, Colombia 1-7 August, 1976. IDRC-080e

Ottawa, Canada. Cock, J.H., McIntyre, R. and Graham, M. (eds.). Pp 20-30.

Li, H.W., Lucy, A.P., Guo, H.S., Li, W.X., Ji, L.H., Wong, S.M. and Ding,

S.W. (1999). Strong host resistance targeted against a viral suppressor of the

plant gene silencing defence mechanism. The EMBO Journal, 18: 2683-2691.

Li, W., Hilf, M.E., Webb, S.E., Baker, C.A. and Adkins, S. (2008). Presence

of P1b and absence of HC-Pro in Squash vein yellowing virus suggests a

169

general feature of the genus Ipomovirus in the family Potyviridae. Virus

Research, 135: 213-219.

Lister, R.M. (1959). Mechanical transmission of Cassava brown streak virus.

Nature, 183: 1588-1589.

Livak, K. and Schmittgen, T. (2001). Analysis of relative gene expression data

using real-time quantitative PCR and the 2-[Delta][Delta] CT method.

Methods 25: 402-408.

Lizarraga, R.E., Salazar, L.F., Roca, W.M. and Schilde-Rentschler, L.

(1980). Elimination of Potato spindle viroid by low temperature and

meristem culture. Pathology 70: 754-755.

Lodhi, M. A., Ye, G. N., Weeden, N. F. and Reisch, B. I. (1994). A simple and

efficient method for DNA extraction from grapevine cultivars and Vitis

species. Plant Molecular Biology Reporter, 12: 6–13.

MacRae, J. and Mukesh, S. (1998). Detection of viruses by electron

microscopy: An efficient approach. Journal of Virological Methods, 72:105-

108.

Mahfouze; S.A., El-Dougdoug, and K A. and. Allam, E.K. (2010). Production

of Potato Spindle Tuber Viroid-Free Potato Plant Materials in Vitro. Journal

of American Science, 6: 1570-1577.

Mahungu, N.M., Bidiaka, M., Tata., H., Lu-Kombo, S. and N’luta, S. (2003).

Cassava brown streak-like symptoms in Democratic Republic of Congo.

Roots, 8: 8-9.

Malauri, B.; Trouslot, M.; Bertraud, J.; Bousalem, M.; Pinel, A. and Dubern, J.

(1998). Medium-term and long-term in vitro conservation and safe

international exchange of yam (Dioscoria spp.) germplasm. Electronic

Journal of Biotechnology, 1:1-15.

170

Mantell, S.H., Haque, S.Q. and Whitehall, A.P. (1980). Apical meristem tip

culture for eradication of flexous rod viruses in yams (Dioscorea alata).

Tropical Pest Management, 26: 170-179.

Mansour, A. and Al-Musa, A. (1993). Cucumber vein yellowing virus; host

range and virus vector relationships. Journal of Phytopathology, 137: 73-78.

Manzer, F.E and Merriam, D. (1961). Field transmission of the potato spindle

tuber virus and virus X by cultivating and hilling equipment. American Potato

Journal, 38: 346-352.

Martin, J. H., Mifsud, D. and Rapisarda, C. (2000). The whiteflies (Hemiptera;

Aleyrodidae) of Europe and the Mediterranean basin. Bulletin of

Entomological Research, 90: 407-448.

Maruthi, M.N., Colvin, J. and Seal, S. (2001). Mating compatibility, life-

history traits and RAPD-PCR variation in Bemisia tabaci associated with the

cassava mosaic disease pandemic in East Africa. Entomologia Experimentalis

et Applicata, 99: 13-23.

Maruthi, M.N., Colvin, J., Seal, S., Gibson, G. and Cooper, J. (2002). Co-

adoptation between cassava mosaic geminiviruses and their local vector

populations. Virus Research, 86: 71-85.

Maruthi, M.N., Hillocks, R.J., Mtunda, K., Raya, M.D., Muhanna, M., Kiozia,

H., Rekha, A.R., Colvin, J. and Thresh, J.M. (2005). Transmission of Cassava

brown streak virus by Bemisia tabaci. Journal of Phytopathology, 153: 307-

312.

Mathews, R.E.F. (1991). Plant virology, second edition, Academic Press New

York. 23p.

Matthews, R.E.F. (2002). Plant Virology, Fourth Edition, Academic Press

Inc.,UK. 835p.

171

Mbanzibwa, D.R., Tian, Y.P., Tugume, A.K., Mukas, S.B., Tairo, F.,

Kyamanywa, S., Kullaya, A., Jari, P. and Volkonen, T. (2009). Genetically

distinct strains of Cassava brown streak virus in the Lake Victoria basin and

the Indian Ocean coastal area of East Africa. Archives of Virology, 154: 353-

359.

Mbanzibwa, D.R., Tian, Y.P., Tugume, A.K., Patil, B.L., Yadav, J.S.,

Bagewadi, B., Abarshi, M.M., Alicai, T., Changadeya, W., Mkumbira, J.,

Muli, M.B., Mukasa, S.B., Tairo, F., Baguma, Y., Kyamanywa, S., Kullaya,

A., Maruthi, M.N., Fauquet, C.M., Valkonen, J.P.T. (2011). Evolution of

cassava brown streak disease-associated viruses. Journal of General Virology,

92: 974-987.

McSween, S., Walker, T., Salegua, V. and Pitoro, R. and (2006). Economic

Impact on Food Security of Virietal Tolerance to Cassava Brown Streak

Disease in Costal Mozambique. Research Report No. 1E August 2006. Pp 2-

30.

Meybodi, D.E. Mozafari, J. Babaeiyan, N. and Rahimian, H. (2011).

Application of Electrotherapy for the Elimination of Potato Potyviruses.

Journal of Agricultural Science Technology, 13: 921-927.

Meyer, H. (1984). Les Barundi: Une étude ethnologique en Afrique orientale.

Société Française d'Histoire d'Outre-Mer, Paris.

Mhone, A., Sandifolo, V., Jumbo, S. and Mahungu, N. (2007). Cassava based

ethanol: could it compromise food security? In: 10th Triennial Symposium

jointly organized by the ISTRC-AB and Mozambique Agrarian Research

Institute (IIAM). Joaquim Chissano International Conference Centre, Maputo,

Mozambique 8-12 October 2007. Mahungu, M.N. and Mkumbira, J. (eds.)

21p.

Mkamilo, G.S. and Jeremiah, S.C. (2005). Current status of cassava

improvement programme in Tanzania. African Crop Science, 7: 1311-1314.

172

Mlingi, N.L.V., Nkya, S., Tatala, S.R., Rashid, S. and Bradbury, J.H. (2011).

Recurrence of konzo in southern Tanzania: Rehabilitation and prevention

using the wetting method. Food and Chemical Toxicology, 49: 673-677.

Moissiard, G. and Voinnet, O. (2004). Viral suppression of RNA silencing in

plants. Molecular Plant Pathology, 5: 71-82.

Monger, W.A., Seal, S., Cotton, S. and Foster, G.D. (2001a). Identification of

different isolates of Cassava brown streak virus and development of a

diagnostic test. Plant Pathology, 8: 768-775.

Monger, W.A., Seal, S., Isaac, A. M. and Foster, G.D. (2001b). Molecular

characterisation of cassava brown streak virus coat protein. Plant Pathology,

50: 527-534.

Monger, W.A., Alicai, T., Ndunguru, J., Kinyua, Z.M., Potts, M., Reeder,

R.H., Miano, D.W., Adams, I.P., Boonham, N., Glover, R.H. and Smith, J.

(2010). The complete genome sequence of the Tanzanian strain of Cassava

brown streak virus and comparison with the Ugandan strain sequence.

Archives of Virology, 155: 429-433.

Morales, F.J. and Anderson, P.K. (2001). The emergence and dissemination of

whitefly transmitted viruses in Latin America. Archives of Virology, 146: 415-

441.

Morel, G. and Martin, C. (1952). Guerison de dahlias atteints d'ume Maladie a

Virus. Comptes Rendus de l Academie des Sciences, 235: 1324-1325.

Moreno, I., Gruissem, W. and Vanderschuren, H. (2011). Reference genes for

reliable potyvirus quantification in cassava and analysis of cassava brown

streak virus load in host varieties. Journal of Virological Methods, 177: 49-54.

173

Mound, L.A. (1983). Biology and identity of whitefly vectors of plant

pathogens. In: Plumb, R.T. and Thresh, J.M., Editors, 1983. Plant Virus

Epidemiology, Blackwell, Oxford, UK, Pp 305–313.

Mtunda, K. Mahungu, N.M., Thresh, J.M., Kilima, M.S. and Kioza, H.C.

(1998). Phytosanitation involving the use of ‘clean’ planting material for the

control of cassava brown streak virus disease. S.R.I, SARRNET and NRI

Greenwich University Chatham United Kingdom. Pp 1 -5.

Mtunda, K.J., Muhanna, M., Raya, M.D., and Kanju, E.E. (2003). Current

Status of Cassava Brown Streak Virus Disease in Tanzania. In Cassava Brown

Streak Virus Disease: Past, Present, and Future, J.P. Legg and R.J. Hillocks

(eds). Aylesford, U.K.: Natural Resources International Limited. Proceedings

of an International Workshop, 27-30 October 2002, Mombasa, Kenya.

Muhanna, M. and Mtunda, K. (2003). Report on the study of cassava root rot

problem in Muheza District, Tanga Region, Tanzania. Submitted to the Tanga

District Director May 2002. 23p.

Mukasa, S.B., Rubaihayo, P.R. and Valkonen, J.T.P. (2003). Incidence of

viruses and viruslike disease of sweetpotato in Uganda. Plant Disease, 87:

329-335.

Mumford, R.A., Boonham, N., Tomlinson, J. and Barker, I. (2006). Advances

in molecular phytodiagnostics: New solutions for old problems. Journal of

Plant Pathology, 116: 1-19.

Munga, T. and Thresh, M.J. (2002). The incidence of cassava mosaic and

cassava brown streak diseases in coastal Kenya. Project Report, Natural

Resources Institute, Chatham, UK. 21p.

Muniyappa, V. (1980). Whiteflies. In: Vectors of Plant Pathogens. 1980.

Academic Press, New York. Harris, K.F. and Maramorosch, K. (eds.). Pp. 39-

85.

174

Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and

bioassay with tobacco tissue culture. Physiologia Plantarum 15: 473-497.

Mware, B., Narla, R., Amata, R., Olubayo, F., Songa, J. Kayamanua, S. and

Ateka, E.M. (2009). Efficiency of cassava brown streak virus transmission by

two whitefly species in coastal Kenya. Journal of General and Molecular

Virology, 1: 40-45.

Nascimento, L.C., Pio-Ribeiro, G., Willadino, L. and Andrade, G.P. (2003).

Stock indexing and potato virus y elimination from potato plants cultivated in

vitro. Scientia Agricola, 60: 525-530.

Nassar, N.M.A. (1995). Development of cassava interspecific hybrids for

savanna (cerredo) conditions. Journal of Root Crops, 22: 9-17.

Nassar N.M.A., (2002). Cassava, Manihot esculenta Crantz, genetic resources:

Origin of the Crop, its evolution and relationship with wild relatives. Genetic

and Molecular Research, 1: 298-305.

Nassar, N.M.A. and Ortiz, R. (2010). Cassava improvement: challenges and

impacts, Journal of Agricultural Science, 145: 163-171.

Nassuth, A., Pollari, E., Helmeczy, K., Stewart, S. and Kofalv, S.A. (2000).

Improved RNA extraction and one-tube RT-PCR assay for simultaneous

detection of control plant RNA plus several viruses in plant extracts. Journal

of Virology Methods, 90: 37–49.

Nault, L.R. (1997). Arthropod transmission of plant viruses: a new synthesis.

Annals of Entomological Society of America, 90: 522–41.

Ng, K.C., Handley, C.J., Preston, B.N. and Robinson, H.C. (1992). The

extracellular processing and catabolism of hyaluronan in cultured adult

articular cartilage explants. Archieve Biochemical Biophysiology, 298: 70-79.

175

Ng, J.C.K. and Falk, B.W. (2006). Virus-vector interactions mediating non-

persistent and semi persistent transmission of plant viruses. Annual Review of

Phytopathology, 44:183-212.

Nichols, R.F. (1947). Breeding cassava for virus resistance. East African

Agricultural Journal, 12: 184-194.

Nichols, R.F. (1950). The brown streak disease of cassava; distribution

climatic effects and diagnostic symptoms. East African Agricultural Journal,

15: 154-160.

Nicot, N., Hausman, J., Hoffmann, L.and. Evers, D. (2005). Housekeeping

gene selection for real-time RT-PCR normalization in potato during biotic and

abiotic stress. Journal of Experimental Botany, 56: 2907-2914.

Njock, T.E., Atiri, G.I., Thottappilly, G. and Thresh, J.M. (1996). Disease

development and recovery in resistant and susceptible cassava genotypes

infected by African cassava mosaic geminivirus. African Plant Protection, 2:

97-102.

Ntawuruhunga, P., Ssemakula G., Ojulong H., Bua A., Ragama P., Kanobe

C.and Whyte J. (2006). Evaluation of advanced cassava genotypes in Uganda.

African Crop Science Journal, 14: 15-27.

Ntawuruhunga, P. and Legg, J. (2007). Spread of cassava brown streak virus

disease and its implications for the movement of cassava Germplasm in the

east and central Africa region. Joint collaboration paper USAID and IITA

under Crop Crisis Control Project. 43p.

Nweke, F.I., Dixon, A.G.O., Asiedu, R. and Folayan, S.A. (1994). Cassava

varietal needs of farmers and the potential for production growth in Africa.

Working paper No. 10. Collaborative Study of Cassava in Africa. IITA,

Ibadan. Pp220-238.

176

Nweke, F.I., Spencer, D.S.C. and Lynam, J.K. (Eds.) (2002). The Cassava

Transformation. East Lansing: Michigan State University Press. 61p.

Nweke, F.I. (2003). New challenge in the cassava transformation in Nigeria

and Ghana. Paper presented at the InWEnt, IFPRI,NEPAD,CTA. ‘Successes

in African Agriculture’. 12p.

Nyland, G. and Goheen, A.C. (1969). Heat therapy of virus diseases of

perennial plants. Annual Review of Phytopathology, 7: 331-354.

Nzwalo, H. and Cliff J. (2011). Konzo: From Poverty, Cassava, and Cyanogen

Intake to Toxico-Nutritional Neurological Disease. Review, 5: e1051.

Ogbe, F.O., Dixon, A.G.O., Atiri, G.L. and Thottappilly, G. (2002).

Restriction of virus movement into axillary bud is an important aspect of

resistance in cassava to African cassava mosaic virus. Journal of

Phytopathology, 150:546-552.

Ogwok, E., Patil, B. L., Alicai, T. and. Fauquet, C.M. (2010). Transmission

studies with Ugandan Cassava brown streakvirus (Potyviridae: Ipomovirus)

and its interaction with abiotic and biotic factors in Nicotiana benthamiana.

Journal of Virological Methods, 169: 296-304.

Okogbenin, E., Porto, M.C.M., Egesi, C., Mba, C., Espinosa, E., Santos, L.G.,

Ospina, C., Marin, J., Barrera, E. and Gutierrez, J. (2007). Marker-Assisted

Introgression of Resistance to Cassava Mosaic Disease into Latin American

Germplasm for the Genetic Improvement of Cassava in Africa. Crop Science

Journal, 47: 1895-1904.

Otim-Nape, G.W. (1990). Root Crops in Uganda. In: Hartmans (ed).

Agricultural research in Uganda. Five year research plan, USAID, Kampala.

12p.

177

Otim-Nape, G.W., Bua, A., Baguma, Y. (1994). Accelerating the transfer of

improved crop production technologies: controlling African cassava mosaic

virus disease in Uganda. African Crop Science Journal, 2: 479-495.

Otim-Nape, G.W., Bua, A., Thresh, J.M., Baguma, Y., Ogwal, S., Semakula,

G.N., Acola, G., Byabakama, B., Martin, A. (1997). Cassava Mosaic Virus

Disease in Uganda: The Current Pandemic and Approaches to Control.

Natural Resources Institute, Chatham, UK. 3p.

Otim-Nape, G.W., Alicai, T. and Thresh, J.M. (2001). Changes in the

incidence and severity of cassava mosaic virus disease, varietal diversity and

cassava production in Uganda. Annals of Applied Biology, 138: 313-327.

Owor, B., Legg, J.P., Okao-Okuja, G., Obonyo, R. and Ogenga-Latigo, M.W.

(2005). The effect of cassava mosaic geminiviruses on symptom severity,

growth and root yield of a cassava mosaic virus disease-susceptible cultivar in

Uganda. Annals of Applied Biology, 145: 331-337.

Pacumbaba, R.P. (1985). Virus-free shoots from cassava stem cuttings

infected with cassava latent virus. Plant Disease, 69: 231-232.

Pasch, H. (1980). Linguistische Aspekte der Verbreitung Lateina merika

nischer Nutzpflanzen in Afrika. Unpublished PhD thesis, University of

Cologne, Cologne, Germany. Pp 23-45.

Patil, B.L, Ogwok, E., Wagaba, H., Mohammed, I.U., Yadav, J.S., Bagewadi,

B., Taylor N. J., Kreuze, J., Maruthi, M. N., Alicai, T. and Fauquet, C. (2010).

RNAi-mediated resistance to diverse isolates belonging to twovirus species

involved in Cassava brown streak disease. Molecular Plant Pathology, 12: 31-

41.

Patino, M.T. (2007). Economic feasibility for producing ethanol from cassava

in selected African countries. In: 10th Triennial Symposium jointly organized

by the ISTRC-AB and Mozambique Agrarian Research Institute (IIAM).

178

Joaquim Chissano International Conference Centre, Maputo, Mozambique 8-

12 October 2007. Mahungu, M.N. and Mkumbira, J (eds.). 72p.

Paximadis, M., Idris, A.M., Torres-Jerez, I., Villarreal, I., Rey, M.E.C. and

Brown, J.K. (1999). Characterization of geminiviruses of tobacco in the Old

and New World. Archives of Virology, 144: 703-717.

Pearce, F. (2007). Africa’s cassava comeback. New Scientist, Environment.

Magazine issue 2600.http://www.newscientist. com/ article/ mg19426002

.000-africas -cassava-comeback.html. Accesssed 24/09/2010.

Perring, T.M. (2001). The Bemisia tabaci species complex. Crop Protection,

20: 725-737.

Pirone, T.P. (1981). Efficiency and selectivity of the helper component

mediated aphid transmission of purified potyviruses. Phytopathology, 71:

922–24.

Pirone, T. P. and Thornbury, D. W. (1988). Quantity of virus required for

aphid transmission of a potyvirus. Phytopathology, 78: 104-107.

Pita, J.S., Fondong, V.N., Sangare, A., Otim-Nape, G.W., Ogwal, S. and

Fauquet, C.M. (2001). Recombination, pseudorecombination and synergism of

geminiviruses are determinant keys to the epidemic of severe cassava mosaic

disease in Uganda. Journal of General Virology, 82: 655- 665.

Plucknett, L.D. (1984). Tropical Root Crops in the Eighties In: Symposium of

International Society for Tropical root crops, 6th Lima, 20-25 February 1983.

Shideler, F. S. and Rincon, H. (eds.). 3p.

Polston, J.E. and Anderson, P.K. (1997). The emergence of whitefly-

transmitted geminiviruses in tomato in the Western hemisphere. Plant

Disease, 81: 1358–1369.

179

Purseglove, J.W. (1968). Tropical Crops: Dicotyledons, Longman, London,

UK. 56p.

Quak, F. (1961). Heat treatment and substances inhibiting virus multiplication

in meristem culture to obtain virus free plants. In: Proceedings 25 International

Horticultural Congress, 1: 144-155.

R Development Core Team (2010). R Foundation for Statistical Computing,

Vienna, Austria. ISBN 3-900051-07-0, URL http://www.R-project.org.

Accessed on 23/05/2010.

Raspisarda, C. and TropeaGarzia, G. (2002). Tomato yellow leaf curl Sardinia

virus and its vector B. tabaci in Sicilia, Italy: present status and control

possibilities. EPPO Bulletin, 32: 25-29.

Ratcliff, F., Harrison, B.D and Baulcombe, D.C., (1997). A similarity between

viral defense and gene silencing in plants. Science, 276: 1558-1560.

Ratcliff, F.G., MacFarlane, S.A. and Baulcombe, D.C. (1999). Gene silencing

without DNA: RNA-mediated cross-protection between viruses. Plant Cell,

11: 1207-1216.

Rhoades, R.E. (1996). The art of the informal agricultural survey. IITA

Research Guide 36. Training Program, International Institute of Tropical

Agriculture (IITA), Ibadan, Nigeria. 2nd edition. 57p.

Robertson, I.A.D. (1987). The whitefly, Bemisia tabaci (Gennadius) as a

vector of African cassava mosaic virus at the Kenya coast and ways in which

the yield losses in cassava Manihot esculenta Crantz caused by the virus can

be reduced. Insect Science Application, 8: 797-801.

Roca, W.M.; Rodrígues, J.A.; Mafla G. and Roa, J. (1984). Procedures for

recovering cassava clones distributed in vitro. CIAT, Colombia. 21p.

180

Rogers, D.J. and Appan, S.G. (1973). Manihot, Manihotoides

(Euphorbiaceae). Flora Neotropica, Mongraph 13, Hafner Press, New York.

12p.

Rogers, D.J. (1963). Studies of M. esculenta Crantz and related species.

Bulletin of the Torry Botanical Club, 90: 43-54.

Ross, H.B. (1975). The diffusion of the manioc plant from South America to

Africa: An essay in ethnobotanical culture history. PhD dissertation. Faculty

of Political Science, Columbia University, New York, USA. 135p.

Rossel, H.W., Asiedu, R. and Dixon, A.G.O. (1992). Resistance of cassava to

African cassava mosaic virus: what really happens. Tropical Root and Tuber

Crops Bulletin, 6: 2.

Rossel, H.W., Changa, C.M. and Atiri, G.I. (1994). Quantification of

resistance to African cassava mosaic virus in IITA- improved mosaic-resistant

breeding materials. In: Proceedings of the 5th Symposium of the International

Society for Tropical Root Crops. Root crops for food security in Africa. Africa

branch. IITA, Ibadan, Nigeria.Akoroda, M.O. (ed.). Pp 280-287.

Ruijter, J.M., Ramakers, C., Hoogaars, W.M.H., Karlen, Y., Bakker, O., van

den Hoff, M.J.B. and Moorman, A.F.M. (2009). Amplification efficiency:

linking baseline and bias in the analysis of quantitative PCR data. Nucleic

Acids Research, 37: 41-45.

Ruiz, M.T., Voinnet, O. and Baulcombe, D.C. (1998). Initiation and

maintenance of virus-induced gene silencing. Plant Cell, 10: 937-946.

Salcedo1, A., Valle1, A.D., Sanchez1, B., Ocasio1, V., Ortiz1, A., Marquez,

P., and Siritunga, D. (2010). Comparative evaluation of physiological post-

harvest root deterioration of 25 cassava (Manihot esculenta) accessions: visual

vs hydroxycoumarins fluorescent accumulation analysis. African Journal of

Agricultural Research, 5: 3138-3144.

181

Samuel, G. (1934). The movement of Tobacco mosaic virus within the plant.

Annals of Applied Biology, 21: 90-111.

Sarver, N. and Stollar, V. (1978). Virazole prevents production of Sindbis

virus and virus-induced cytopathic effect in Aedes albopictus cells. Virology,

91:267-282.

Sauti, R.F.N. and Chipungu, F.P. (1993). Root and Tuber Crops Annual

Report, Bvumbwe Research Station, Limbe Malawi. 13p.

Scott, G.J., Rosegrant, M. and Ringler, C. (2000). Roots and tubers for the

21st century: Trends, projections and policy options. Food, Agriculture and

the Enviornment Discussion Paper 31. Washington, D.C.: International food

policy research institute (IFPRI) and International potato centre (CIP)

Shaba, E.R., Chipungu, F. and Mazuma, E.D.L. (2003). Cassava brown streak

virus disease in Malawi. Pp 18-19. In: Legg JP and Hillocks RJ (Eds), 2003.

Cassava Brown Streak Virus Disease:Past, Present and Future. Proceedings of

an International Workshop, Mombasa, Kenya, 27-30 October, 2002. Natural

Resources International Limited, Aylesford, UK. 100p.

Slack, J.M.W., Darlington, B.G., Heath, J.K. and Godsave, S.F. (1987).

Mesoderm induction in early Xenopus embryos by heparin-binding growth

factors Nature, 326: 197-200.

Solomon-Blackburn, R.M. and Baker. H. (2001). Breeding virus resistant

potato (Solanum tuberosum): A review of traditional and molecular

approaches. Heredity, 86:17 -35.

Stace-Smith, R. and Mellor, F.C. (1968). Eradication of potato viruses X and S

by thermotherapy and axillary bud culture. Phytophatology, 58: 199-203.

Steel, J.A.C. (2003). Cassava brown streak virus disease management in

Mozambique: the NGOs’ Perspective. Pp 70-72. In: Legg JP and Hillocks RJ

(Eds), 2003. Cassava Brown Streak Virus Disease: Past, Present and Future.

182

Proceedings of an International Workshop, Mombasa, Kenya, 27-30 October,

2002. Natural Resources International Limited, Aylesford, Uk. 100p.

Storey, H. H. (1936). Virus diseases on East African plants - VII. A progress

reports on studies of diseases of cassava. East African Journal, 2: 34-39.

Storey, H.H. (1938). Cassava virus diseases. East African Agricultural

Research Station, Amani, Tanzania. Tenth Annual Report. Majesty’s

stationary office, London, UK. Pp 10- 13.

Storey, H.H. and Nichols, R.F. (1938). Studies of the mosaic disease of

cassava. Annals of Applied Biology, 25: 790-860

Storey, H.H. (1939). Report of the Plant Pathologist of the East African

Agricultural Research Station for 1939. Amani, Tanzania. 34p.

Storey, H.H. (1947). Virus diseases on East African plants-III- Plant

Pathology Reports. East African Research Institute. Amani, Tanzania. Pp 8-9.

Swanson, M.M. and Harrison, B.D. (1994). Properties, relationships and

distribution of cassava mosaic geminiviruses. Tropical Science, 34: 15-25.

Takeshima, H. (2010). Prospect for development of genetically modified

cassava in Sub-Saharan Africa. AgbioForum, 13: 63-75.

Taylor, N., Chavarriaga, P., Raemakers, K., Siritunga, D. and Zhang, P.

(2004). Development and application of transgenic technologies in cassava.

Plant Molecular Biology, 56: 671-688.

Thomas, P. (2006). Re-emergence of covert bacteria Bacillus pumilus and

Brevibacillus sp. in microbe-freed grape and watermelon stocks attributable to

occasional autoclaving-defying residual spores from previous cycles. Plant

Cell Tissue Organells Culture, 87: 155–165.

183

Thottappilly, G., Thresh, J.M., Calvert, L.A., and Winter S, (2003). Cassava.

in: Virus and virus-like diseases of major crops in developing countries.

Loebenstein G.and Thottappilly, G. (eds.) Kluwer Academic Publ., Dordrecht,

the Netherlands. Pp107-165.

Thresh, J.M., Fargette, D. and Otim-Nape, G.W. (1994). The viruses and virus

disease of cassava in Africa. African Crop Science Journal, 2: 459-478.

Thresh, J.M., Otim-Nape, G.W., Thankapan, M. and Muniyappa, V. (1998).

The mosaic diseases of cassava in Africa and India caused by whitefly-borne

geminiviruses. Review of Plant Pathology, 77: 935-945.

Thresh, J.M, (2003). Brief History of cassava brown streak virus disease. In:

Legg JP and Hillocks RJ (Eds), 2003. Cassava Brown Streak Virus Disease:

Past, Present and Future. Proceedings of an international workshop, Mombasa,

Kenya, 27-30 October, 2002. Natural Resources International Limited,

Aylesford, UK. 100pp.

Thresh, J.M. and Hillocks, R.J. (2003). Cassava mosaic and cassava brown

streak diseases in CBSV-[MZ:Nam1-1:07] and Zambezia Provinces of

Mozambique. Roots, 8: 10-15.

Thresh, J.M. and Cooter, R.J. (2005). Strategies for controlling cassava mosaic

virus disease in Africa. Plant Pathology, 54: 587–614.

Valentine, T.A., Roberts, I.M. and Oparka, K.J. (2002). Inhibition of tobacco

mosaic virus replication in lateral roots is dependent on an activated meristem-

derived signal. Protoplasma, 219: 184-196.

Van den Bosch, F., Jeger, M.J. and Gilligan, C.A. (2007). Disease control and

its selection for damaging plant virus strains in vegetatively propagated staple

food crops. Proceedings of the Royal Society: Biological Journal, 274: 11–18.

184

Vaucheret, H. and Fagard, M. (2001). Transcriptional gene silencing in plants:

targets, inducers and regulators. Trends in Genetics, 17: 29-35.

Verma, P.M. (1963). Transmission of plant viruses by whiteflies. Bulletin of

Natural Science, 24: 11-33.

Verma, N., Raja, R., Hallan, V., Kumar, K., Zaidi, A.A. (2004). Production of

Cucumber mosaic virus-free chrysanthemum by meristems tip culture. Crop

Protection, 23: 469-473.

Vidavsky, F. and Czosnek, H. (1998). Tomato breeding lines resistant and

tolerant to tomato yellow leaf curl virus issued from Lycopersicon hirsutum.

Phytopathology, 88: 910-914.

Voinnet, O., Lederer, C. and Baulcombe, D.C. (2000). A viral movement

protein prevents spread of the gene silencing signal in Nicotiana benthamiana.

Cell, 103: 157-167.

Voinnet, O. (2001). RNA silencing as a plant immune system against viruses.

Trends in Genetics, 17: 449-459.

Walkey, D.G.A. (1976). High temperature inactivation of Cucumber and

Alfalfa mosaic viruses in Nicotiana rustica cultures. Annals of Applied

Biology. 84: 183-192.

Walkey, D.G.A. and Freeman, G.H. (1977). Inactivation of Cucumber mosaic

virus in cultured tissues of Nicotiana rustica by diurnal alternating periods of

high and low temperature. Annals of Applied Biology, 87: 375-382.

Walkey, D.G.A. (1985). Applied Plant Virology. New York: Wiley

Interscience. Pp 237-241.

185

Wasswa, P., Alicai, T. and Mukasa, S.B. (2010). Optimisation of in vitro

techniques for cassava brown streak virus elimination from infected cassava

clones. African Crop Science Journal, 18: 235-241.

Waterhouse, P.M, Wang, M.B. and Lough, T. (2001). Gene silencing as an

adaptive defence against viruses. Nature, 411: 834-842.

Watson, H.A. and Roberts, F.H. (1939). A comparative study of the

transmission of Hyoscyamus virus 3, potato virus Y, and cucumber virus 1 by

the vectors Myzus persicae (Sulz.), M. circumflexus (Buckton) and

Macrosiphum gel (Koch). In: Proceedings of the Royal Society of London,

Series B, 127: 543-576.

Weimin, L., Mark, E.H., Susan, E.W., Carlye, A.B. and Scott, A. (2008).

Presence of P 1b and absence of HC-Pro in Squash vein yellowing virus

suggests a general feature of the genus Ipomovirus in the family potyviridae.

Virus Research, 135: 213-219.

Were, H.K., Winter, S. and Maiss, E. (2004). Viruses infecting cassava in

Kenya. Plant Disease, 88: 17-22.

Westby, A. (2002). Cassava utilization, storage and small-scale processing. In:

Cassava: Biology, Production and Utilization. Cambridge University Press.

CAB International, Wallingford, UK Hillocks, R.J., Thresh, J.M. and Bellotti,

A. (eds). Pp281-300.

Wilson, C.R. and Jones, R.A.C. (1992). Resistance to phloem transport of

potato leafroll virus in potato plants. Journal of General Virology, 73: 3219-

3224.

Winter, S., Koebler, M., Stein, B., Pietruszka, A., Paape, M. and Butgereitt, A.

(2010). The analysis of cassava brown streak viruses reveals the presence of a

distint virus species causing cassava brown streak disease in East Africa.

Journal of General Virology, 91: 365-376.

186

Wood, A.P. (1985). A century of development measures and population re-

distribution along the Upper Zambezia. In: Population and Development

Projects in Africa. Cambridge University Press, Cambridge, UK. Clarke, J.I.,

Khogali, M. and Kosinski, L.A. (eds.). Pp163-175.

Yadav, J.S., Ogwok, E., Wagaba, H., Basavaprabhu, L., Patil, B.B., Alicai, T.,

Gaitan-solis, E. Taylor, N.J. and Fauquet, C.M. (2011). RNAi-mediated

resistance to Ugandan Cassava brown streakvirus in transgenic cassava.

Molecular Plant Pathology 12: 677-687.

Zapata, C., Miller, J.C. and Smith, R.H. (1995). An in vitro procedure to

eradicate Potato viruses X, Y and S from russet norkotah and two of its strains.

In vitro Cell Development Biology, 31: 153-159.

Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G.W., Robinson, D.J.,

Harrison, B.D. (1997). Evidence that DNA-A of a geminivirus associated with

severe cassava mosaic disease in Uganda has arisen by interspecific

recombination. Journal of General Virology, 78: 2101-2111.

Zhou, X., Robinson, D. J. and Harrison, B. D. (1998). Types of variation in

DNA-A among isolates of East African cassava mosaic virus from Kenya,

Malawi and Tanzania. Journal of General Virolog, 79: 2835-2840.

Zimmermann, A. (1906). Die Krauselkrankheit des Maniok. Pflanzer, 2: 145

187

APPENDIX 1

Additional tables and figures for Chapters 4 and 6

Appendix 1.1: Major symptoms expressed by the hebaceous host-plants upon

inoculation by the CBSD isolates in the glasshouse

LM = Leaf mottling, VC = Vein clearing, SG = Stunted growth, LC = Leaf collapse, DB = Die back, LCH = Leaf chlorosis, MO = Mosaic, LL = Local lesion

UCBSV-

Hebaceous host plants [UG:Kab4-3:07] [TZ:Kib10-2:03] [KE:Mwa16-2:08]

Datura stramonium LM LM,LCH LM,SG

Nicotiana benthamiana VC, LM VC, LM VC, LM

Nicotiana clevelandii MO LCH LC, SG

Nicotiana glutinosa LCH,LM LCH/M LCH,MO,

Nicotiana tabacum nn MO,LCH LCH,M MO

Nicotiana tabacum NN LL LL LL

Nicotiana rustica LCH,LM LCH, SG,M LCH,MO,

CBSV-

Hebaceous host plants [TZ:Zan6-2:08] [MZ:Nam1-1:07] [TZ:Nal3-1:07]

Datura stramonium LM LM LM

Nicotiana benthamiana VC,LM, VC,LC,DB VC,LC,DB

Nicotiana clevelandii LCH, SG LC,S,NEC LC,S,NEC

Nicotiana glutinosa LCH,MO LCH MO

Nicotiana tabacum nn MO,S SG MO

Nicotiana tabacum NN LL LL LL

Nicotiana rustica LCH,LM LM SG

188

Appendix 1.2: Time taken for the first and last experimental host-plant to

express symptoms when inoculated by CBSD isolates in the glasshouse

First/ last symptoms (in weeks) by each CBSD isolate

UCBSV-

Herbaceous host plants [UG:Kab4-3:07] [TZ:Kib10-2:03] [KE:Mwa16-2:08]

Datura stramonium 1/3 2/2 2/4

Nicotiana benthamiana 3/5 1/4 2/3

Nicotiana clevelandii 3/5 2/2 2/3

Nicotiana glutinosa 1/2 3/4 3/3

Nicotiana tabacum nn 3/5 3/5 4/6

Nicotiana tabacum NN 5/7 4/6 3/5

Nicotiana rustica 3/5 2/6 2/3

CBSV-

Herbaceous host plants [TZ:Zan6-2:08] [MZ:Nam1-1:07] [TZ:Nal3-1:07]

Datura stramonium 3/3 1/5 2/3

Nicotiana benthamiana 1/2 3/6 3/3

Nicotiana clevelandii 1/3 1/2 1/2

Nicotiana glutinosa 4/4 2/3 1/3

Nicotiana tabacum nn 4/5 1/8 3/3

Nicotiana tabacum NN 3/4 1/8 3/5

Nicotiana rustica 2/3 2/5 2/5

App[MZlinefittewascom

pendix 1.3Z:Nam1-1:0es join the ved to the das chosen tombinations a

: RT-qPCR07] titre. Thvalues predata using tho cope withas described

R analysis ohe points ondicted by thhe non-lineah different d by Cowley

189

of UCBSVn the graphse shifted Gar least squCt levels f

y (2009).

-[UG:Kab4s represent

Gompertz muares methofor the diff

4-3:07] and data points

model. The mod in R. Thferent virus

CBSV- and the model is e model

s variety

190

Appendix 1.4: Relationship between visual observations and RT-PCR for

CBSV detection in vector transmission experiments

Experiment 1 Visual observationsa RT-PCR detectionb

Serial number of

plants Albert Kiroba Kaleso Albert Kiroba Kaleso

1 + + - + + -

2 - - - - - -

3 + + - + + -

4 + + - + + -

5 - - + - - +

6 - - - - - -

7 - + - - + -

8 + + - + + -

9 + - - + - -

10 + + - + + -

Healthy controlc - - - - - -

Transmission rate

(%)d 60 60 10 60 60 10 aCBSV was visually observed and plants were considered positive or negative for CBSV based on typical CBSD symptoms on leaves. bPlants were considered positive for CBSV only when the bands of the expected sizes were generated by RT-PCR. dPercent transmission in each variety in the experiment 1. - and + indicate negative and positive in RT-PCR, respectively.

191




Serial number of


1 + + - + + -

2 - + - - + -

3 + + - + + -

4 - - - - + -

5 - - - - - -

6 + - + + - -

7 - - - - - -

8 + + - + + -

9 + - - + - -

10 + - - + - -


Transmission rate


192




Serial number of


1 - - - - - -

2 - - - - - -

3 + - - + - -

4 - - - - - -

5 + + - + + -

6 - + - - + -

7 - - - + -

8 + - - + - -

9 + - - + - -

10 + - - + - -


Transmission rate


193

APPENDIX 2

Statistical Analysis of Data

Appendix 2.1: Summary of two-way analysis of variance (ANOVA) for

CBSD symptoms severity on cassava varieties

d.f = degree of freedom, P = probability at 95% confidence level

Appendix 2.2: Summary of analysis of deviance (Chi-square) for the

significant effects of Varieties, isolates and their effects on infected cuttings

sprouting

effect d.f (X2) P-value

Variety (V) 2 21.8 P<0.0001

Isolate (I) 1 13.3 P<0.0002

V x I 2 0.4 NS

d.f = degree of freedom, X2 = chi-square, N.S = no significant differences

Appendix 2.3: Summary of analysis of deviance (Chi-square) for the

significant effects of Varieties, isolates and their effects on CBSD revrsion in

cassava varieties

effect d.f (X2) P-value

Variety (V) 2 15.6 P<0.0004

Isolate (I) 1 2.9 NS

V x I 2 0.4 NS

d.f = degree of freedom, X2 = chi-square, N.S = no significant differences

parameter d.f s.s m.s.s. F- value P- value

Variety (v) 4 30.4 7.6 39.7 P< 0.001

Isolate (I) 5 155.9 31.2 163.1 P< 0.001

V x I 20 9.8 0.5 2.6 P< 0.003

194

Appendix 2.4: Summary of two-way analysis of variance (ANOVA) for the

effects of cutting position on CBSD reversion.

d.f = degree of freedom, s.s= sum of square, m.s.s = mean sum of square, N.S = no significant differences, P = probability at 95% confidence level. Appendix 2.5: Summary of two-way analysis of variance (ANOVA) on the

effects of cassava varieties and fecundity of B. tabaci.

d.f: Degree of freedom, s.s= sum of square, m.s.s = mean sum of square, N.S = no significant differences P: probability at 95% confidence level.

parameter d.f s.s m.s.s. F- value P- value

Variety (v) 2 0.6 0.3 13.5 P< 0.0001

Isolate (I) 1 0.2 0.2 7.5 P< 0.0093

Cutting position (CP) 2 0.2 0.1 5.2 P< 0.0100

V x I 2 0.1 0.0 1.6 NS

V x CP 4 0.0 0.0 0.4 NS

I x CP 2 0.0 0.0 0.0 NS

V x I x CP 4 0.0 0.0 0.01 NS

parameter d.f s.s m.s.s. F -Value P-Value

Eggs layed on varieties 2 1163.0 582.0 0.1 N.S

Nymphs on varieties 2 1422.0 711.0 0.1 N.S

Adults eclosion on varieties 2 685.0 342.0 0.1 N.S

Nymphs x adults x variety 2 7.2 3.58 0.3 N.S

195

APPENDIX 3

List of outputs generated from this and other related research on CBSD as

follows:

1) I. U. Mohammed, M. M. Abarshi, B. Muli, R. J. Hillocks, and M. N.

Maruthi (2011). The symptom and genetic diversity of cassava brown streak

viruses. Advances in Virolog, 10:1155-1165.

2) Abarshi, M. M., Mohammed, I. U., Legg, J. P., Kumar, L., Hillocks, R. J.

and Maruthi, M. N. (2012). Multiplex RT-PCR assays for the simultaneous

detection of both RNA and DNA viruses infecting cassava and the common

occurrence of mixed infections by two cassava brown streak viruses in East

Africa. Journal of Virological Methods, 18: 176-179.

3) M. M. Abarshi, I. U. Mohammed, P. Wasswa, R. J. Hillocks, J. Holt, J. P.

Legg, S. E. Seal and M. N. Maruthi, (2010). Optimization of diagnostic RT-

PCR protocols and sampling procedures for the reliable and cost effective

detection of Cassava brown streak virus. Journal of Virological Methods, 163:

353-359.

4) Patil, B.L., Ogwok, E., Wagaba, H., Yadav, J.S., Bagewadi, B., Taylor,

N.J., Kreuze, J.F., Maruthi, M.N., Mohammed, I.U., Alicai, T. and Fauquet,

C.M. (2010). RNAi mediated resistance to diverse isolates belonging to two

virus species involved in cassava brown streak disease. Molecular Plant

Pathology 12: 31-41.

Abstracts and poster presented in international conferences

Mohammed, I. U., Abarshi, M. M., Hillocks R. J. and Maruthi, M. N. (2012).

Mechanisms of resistance to Cassava brown streak disease in cassava

varieties. Oral presentation in: the conference ‘Advances in Plant Virology’

28-30th March 2012 in Dublin, North Ireland.

196

Mohammed, I. U., Abarshi, M. M., Hillocks R. J. and Maruthi, M. N. (2012).

Developing methods to eliminate UCBSV and CBSV from infected cassava

varieties. Poster in: the conference ‘Advances in Plant Virology’ 28-30th

March 2012 in Dublin, North Ireland.

Mohammed, I. U., Abarshi, M. M., Muli B., Hillocks R. J. and Maruthi, M.

N. (2010). Virus-host interaction studies reveal the occurrence of virulent and

milder forms of cassava brown streak virus. Oral presentation in: the

conference ‘Advances in Plant Virology’ 5-7 September 2010 in Netherlands.

Mohammed, I. U., Abarshi, M. M., Muli B., Hillocks R. J. and Maruthi, M.

N. (2010). Virus-host interactions in cassava brown streak disease

pathosystem. Poster in: the conference ‘Advances in Plant Virology’ 5-7

September 2010 in Netherlands.

Maruthi, M.N. Jeremiah, S., Mohammed, I.U. and Legg, J.P. (2011).

Investigations on Cassava brown streak virus transmission by the whitefly,

Bemisia tabaci. The Fourth European Whitefly Symposium. Held at Rehovot,

Israel, 11-16 September, 2011.

Maruthi, M.N, Jeremiah, S., Mohammed, I.U., Kumar, L. and Legg, J.P.

(2010). Investigations on Cassava brown streak virus transmission by

whiteflies, International Workshop on CBSD, May 2010, Uganda.

Maruthi, M.N, Abarshi, M. M., Mohammed, I. U., Seal, S. E. Hillocks, R. J.,

Kumar, L. and Legg, J.P. (2010). Cassava brown streak virus diversity and

development of improved virus diagnostics. In: Plant viruses: Exploiting

agricultural and Natural ecosystems. 11th International plant virus

epidemiology symposium and 3rd Workshop of the plant virus ecology

network. Held at Cornell, University Ithaca, New York, USA. 20 – 24 June,

2010. 17p.

VIRUS-HOST INTERACTIONS IN THE CASSAVA...

Documents

Transcript of VIRUS-HOST INTERACTIONS IN THE CASSAVA...