Viroplasm Protein P9-1 of RBSDV Preferentially Binds to...
Transcript of Viroplasm Protein P9-1 of RBSDV Preferentially Binds to...
1
Viroplasm Protein P9-1 of RBSDV Preferentially Binds to 1
Single-Stranded RNA in its Octamer Form and the Central 2
Interior Structure Formed by this Octamer Constitutes the 3
Major RNA Binding Site 4
Jianyan Wu 1, Jia Li
1, Xiang Mao
2, Weiwu Wang
3, Zhaobang Cheng
4, Yijun Zhou
4, Xueping 5
Zhou 5,6 *
, Xiaorong Tao
1 * 6
7
1 Key Laboratory of Integrated Management of Crop Diseases and Pests (Ministry of Education), 8
Department of Plant Pathology, Nanjing Agricultural University, Nanjing 210095, P. R. China; 9
2 College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, P. R. China; 10
3 College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, P. R. China; 11
4 Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, P.R. 12
China; 13
5 State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, 14
Hangzhou 310029, P.R. China; 15
6 State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, 16
Chinese Academy of Agricultural Sciences, Beijing, P. R. China. 17
18
* Corresponding author: Xiaorong Tao ([email protected]); Xueping Zhou 19
([email protected]) 20
21
Running title: 22
Structure and Function of RBSDV P9-1 Binding to ssRNA 23
24
Abstract word count: 224 25
Text word count: 6285 26
27
28
JVI Accepts, published online ahead of print on 25 September 2013J. Virol. doi:10.1128/JVI.02264-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
2
Abstract 29
The P9-1 protein of Rice black-streaked dwarf virus (RBSDV) is an essential part of 30
the viroplasm. However, little is known about its nature or biological function in the 31
viroplasm. In this study, the structure and function of P9-1 were analyzed for in vitro 32
binding to nucleic acids. We found that the P9-1 protein preferentially bound to 33
single-stranded (ss) vs. double-stranded (ds) nucleic acids; however, the protein 34
displayed no preference for RBSDV vs. non-RBSDV ssRNA. The gel mobility shift 35
assay revealed that the RNA gradually shifted as increasing amounts of P9-1 were 36
added, suggesting that multiple subunits of P9-1 bind to ssRNA. Using discontinuous 37
blue native gel and chromatography analysis, we found that the P9-1 protein was 38
capable of forming a dimer, tetramer and octamer. Strikingly, we demonstrated that 39
P9-1 preferentially bound to ssRNA in its octamer form, rather than a dimer. Deletion 40
of the C-terminal arm resulted in P9-1 no longer forming an octamer; consequently, 41
the deletion mutant bound to ssRNA with significantly lower affinity and with fewer 42
copies bound per ssRNA. Alanine substitution analysis reveals that electropositive 43
amino acids among residues 25-44 are important for RNA binding and map to the 44
central interior structure that was only formed by the P9-1 octamer. Collectively, our 45
findings provide novel insights into the structure and function of the viroplasm protein 46
P9-1 of RBSDV binding to RNA. 47
48
49
50
51
52
53
54
55
56
57
58
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
3
INTRODUCTION 59
The replication and assembly of viruses are often concentrated in specific locations 60
within infected cells. For the viruses in the Reoviridae family, distinctive 61
electron-dense structures appear throughout the cytoplasm of infected cells at early 62
timepoints after viral entry. These cytoplasmic structures are called viroplasms 63
(Rotavirus, Phytoreovirus and Fijivirus) (13, 20, 35), viral factories (VF) (mammalian 64
Reovirus) (26) or viral inclusion bodies (VIB) (Orbivirus) (5). These inclusion bodies 65
are believed to be the sites in which viral replication and assembly occur. In previous 66
studies, nonstructural proteins from each virus were shown to be required for forming 67
the cytoplasmic structures, and they are regarded as key players in viral 68
morphogenesis. In orbiviruses such as the bluetongue virus (BTV), the VIBs 69
predominantly consist of a nonstructural protein, NS2, which is responsible for 70
recruiting both the core proteins and newly synthesized transcripts (15, 31, 32). In 71
phytoreoviruses such as the rice dwarf virus (RDV), the nonstructural protein Pns12 72
forms viroplasm-like structures (VLS) (35). In contrast, rotaviruses encode two 73
nonstructural proteins, NSP2 and NSP5, which must be co-expressed to form 74
viroplasms (7, 23). However, only NSP2 contributes to the binding of the innermost 75
capsid protein (25), the RNA-dependent RNA polymerase (16), and to the binding of 76
single-stranded RNA (ssRNA) (30). In the mammalian Reovirus genera, µNS alone is 77
sufficient to form viral factory structures (3), and it recruits σNS into the viral 78
factories (21). The µNS protein acts as a scaffold to recruit viral core surface proteins 79
(21), while σNS binds preferentially to ssRNA (9, 10). 80
81
Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the 82
family Reoviridae, causes serious diseases in rice and maize fields in China (4). The 83
virus, transmitted by Laodelphax striatellus in a persistent, circulative-propagative 84
manner (27), has a double shelled, icosahedral capsid of approximately 75 to 80 nm in 85
diameter and contains 10 segments of double-stranded RNA (dsRNA). The nucleotide 86
sequences of the RBSDV genome range in size from 1.8 to 4.5 kb (37, 38). The core 87
particle of RBSDV comprises at least four proteins, P1 (RNA-dependent RNA 88
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
4
polymerase), P2 (major core protein) (37, 38), P3 (putative capping enzyme) (29), and 89
P8 (minor core protein) (13). The outer layer of the RBSDV particle consists of two 90
proteins, P4 (B-spike) and P10 (major capsid protein) (13, 18). RBSDV encodes at 91
least three nonstructural proteins: P6, P7-1, and P9-1. P6 possesses a silencing 92
suppressor activity (39), P7-1 has been characterized as a putative tubular protein, and 93
P9-1 accumulates in viroplasms (Vps) (29). P6 and P9-1 have been shown to interact 94
and co-localize with each other (34). Viroplasm protein P9-1 has also been shown to 95
interact with itself in vitro and in vivo (36), and its crystal structure was recently 96
determined, showing that neighboring dimers interact with each other to form the 97
octamer structure (1). Expression of P9-1 in the absence of other viral proteins leads 98
to the formation of viroplasm-like inclusions in the Arabidopsis protoplast (36) and in 99
Sf9 insect cells (1). The capacity of RBSDV P9-1 to form viroplasms has been shown 100
to be necessary for viral replication. Transgenic rice plants designed to target the 101
expression of viroplasm protein P9-1 are immune to infection by RBSDV (28). 102
103
Although the P9-1 protein is known to be an essential part of the viroplasm, little is 104
known about the nature or biological function of RBSDV P9-1 in the viroplasm. One 105
of the major biological functions of viroplasm proteins is that they can recruit viral 106
RNA transcripts for synthesis of double-stranded genomic RNA. In this study, the 107
structure and function of P9-1 were analyzed for in vitro binding to nucleic acids 108
using gel mobility shift assays. We found that the P9-1 protein bound preferentially to 109
single-stranded (ss) vs. double-stranded (ds) nucleic acids; it did not show any 110
preference for binding to RBSDV ssRNA vs. non-RBSDV ssRNA. Using gel 111
mobility shift assays and discontinuous blue native gel analysis, we demonstrated that 112
P9-1 preferentially binds to ssRNA as an octamer rather than a dimer. Alanine 113
substitution analysis further revealed that electropositive amino acids among residues 114
25-44 are important for RNA binding and that these RNA binding sites map to the 115
central interior structure that was only formed by the P9-1 octamer. Our findings 116
provide novel insights into the structure and function of RBSDV P9-1. 117
118
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
5
MATERIALS AND METHODS 119
Construction of the plasmids 120
The full-length open reading frame (ORF) of the P9-1 gene was amplified from cDNA 121
of RBSDV Lianyungang isolate (accession number KC875238) and cloned into the 122
bacterial expression vector pET28c (Novagen, Darmstadt, Germany) and pXT99, 123
which was engineered to contain a TEV cleavage site based on pET28. Site-directed 124
mutagenesis was used to substitute amino acids 25-44, 319-327 or single site at R26, 125
R39, K43 and K44 individually or jointly with alanine using the two-step PCR 126
procedure described by Higuchi et al. (11). P9-1 deletion mutants were generated by 127
direct PCR amplification using a combination of specific primer pairs (Table 1); the 128
products were then inserted into pET28c. The templates for in vitro transcription, i.e., 129
the plus or minus strand of full-length RBSDV S9 (1,900 nt), the 5’ terminal fragment 130
of S9 (150 nt), and full-length S4 of Rice stripe virus (RSV) (2,157 nt), were 131
amplified from the cDNA of RBSDV or RSV. For each amplification, the upstream 132
primer possessed a T7 promoter sequence, and the downstream primer contained a 133
Spe I restriction site (Table 1). The PCR products were cloned into pMD19-T vector 134
(TaKaRa, Dalian, China) and positive clones were selected by forward insertion. All 135
primers used in this study can be found in Table 1. 136
137
Protein expression and purification 138
To express the wild-type and mutants of P9-1, each plasmid was transformed into 139
Rossetta (DE3). The cells were cultured to reach an OD600 of 0.6 and then induced 140
with 0.1 mM IPTG at 20°C for 12 h. The cells were harvested and lysed by sonication 141
for 20 min on ice in suspension buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM 142
imidazole, pH 8.0). The lysed cells were centrifuged at 10,000 rpm for 1 h. The 143
supernatants were incubated with 1 mL nickel-nitrilotriacetic acid (Ni-NTA) agarose 144
at 4°C for 2 h and then loaded onto a chromatographic column (BioRad, CA, USA). 145
After washing the Ni-NTA column three times with 20 mM imidazole wash buffer (50 146
mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0), the proteins were eluted 147
with 250 mM imidazole elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM 148
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
6
imidazole, pH 8.0). After dialysis of the protein into storage buffer (50 mM NaH2PO4, 149
300 mM NaCl, pH 8.0), the sample was dispensed into aliquots and stored at −70°C 150
until use. To purify the free tag P9-1 protein, we removed the N-terminal His-tag from 151
6xHis-P9-1 protein which was expressed from pXT99-P9-1 by a recombinant 152
6His-TEV protease as described by Tropea et al. (33). 153
154
Western blot analysis 155
The proteins were separated on a 10% SDS-PAGE gel and transferred to a 156
nitrocellulose membrane. The antigen on the membrane was probed with a rabbit 157
anti-6xHis tag (1:1,000 dilution; made in this lab) and recognized with AP-coupled 158
goat anti-rabbit IgG (Sigma, 1:10,000 dilution). The membrane blot was developed in 159
5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate 160
solution (Shenggong, Shanghai, China). 161
162
Discontinuous blue native gel electrophoresis and size exclusion chromatography 163
analysis 164
The discontinuous blue native gel electrophoresis was carried out as described by 165
Niepmann and Zheng (24). The protein samples were mixed with loading buffer (100 166
mM Tris-Cl pH 8.0, 40% glycerol, 0.5% Coomassie brilliant blue G-250) and 167
incubated for 10 min at room temperature. The mixtures were analyzed on a 4-16% 168
polyacrylamide gradient gel using 100 mM histidine (adjusted to pH 8.0 using 169
Tris-base) as the cathode buffer. The gels were destained with several changes of 170
7.5% acetic acid and 5% ethanol. 171
172
Size exclusion chromatography (SEC) analysis was carried out with a Superdex 200 173
pg column (GE Healthcare, Shanghai, China) as described by Akita et al. (1). The 174
column was equilibrated with the buffer containing 10 mM Tris-HCl (pH 7.4) and 150 175
mM NaCl. SEC was performed at a flow rate of 0.5 ml/min. Elution was monitored at 176
UV absorbance 280 nm. The following standards were used to calibrate the column: 177
blue dextran, ferritin, catalase, conalbumin, ovalbumin, and carbonic anhydrase (GE 178
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
7
Healthcare, Shanghai, China). 179
180
In vitro transcription and RNA labeling 181
The plasmid DNA used as template was linearized with Spe I. RNA transcripts were 182
labeled with DIG-UTP (Roche, Shanghai, China) using a T7 Riboprobe in vitro 183
Transcription System (Promega, Shanghai, China). Each transcription reaction was set 184
up to include supplied buffer, 1 mM each of ATP, CTP, GTP, 0.65 mM UTP, 0.35 mM 185
DIG-11-UTP, 500 ng of linearized template, 20 unit RNAse inhibitor, and 40 unit T7 186
polymerase. For preparation of unlabeled transcripts, 2.5 mM each of ATP, CTP, GTP, 187
and UTP were used for each reaction. The reactions were carried out for 2 h at 37oC. 188
Two units of RNase-free DNase I were then added and incubated at 37oC for 30 min. 189
Following extraction with phenol/chloroform, the transcripts were precipitated with 190
dehydrated alcohol in the presence of 300 mM sodium acetate (pH 5.2). The transcript 191
pellets were then washed with 70% alcohol, air-dried at room temperature, and 192
resuspended in Rnase-free double-distilled H2O (ddH2O). The concentration of RNA 193
transcripts were determined at OD260 nm using a NANODROP 1000 194
spectrophotometer (Thermo Electron, Shanghai, China). 195
196
Gel mobility shift assay 197
In a typical binding assay, increasing amounts of P9-1 or mutants proteins were 198
incubated in 10 µl binding buffer (45 mM Tris, 45 mM boric acid, pH 8.4) with 3.1 199
nmol of DIG-11-UTP-labeled ssRNA S9-1900nt or 39 nmol ssRNA S9-150nt. The 200
reaction mixtures were incubated for 10 min at room temperature, then 5 µl loading 201
buffer (0.1% bromphenol blue, 0.1% xylene cyanole, 15% Ficoll 400 in 0.5x TBE 202
buffer) was added. The reaction mixtures were separated by electrophoresis in 1% 203
agarose with 0.5× TBE (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8.0). All 204
buffers were prepared with diethyl pyrocarbonate-treated ddH2O to eliminate potential 205
RNase activity. 206
207
The gel was electroblotted onto a nylon membrane (Hybond N+; GE Health, 208
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
8
Shanghai, China). The ssRNA was fixed to the membranes with 0.25 J/cm2 of UV 209
light (UVP, CA, USA). The electrophoretic retardation of the DIG-labeled RNAs was 210
detected using digoxigenin-AP Fab fragments (Roche, Shanghai, China), and the blots 211
were developed with BCIP/NBT substrate solution (Shenggong, Shanghai, China). 212
213
Competition assays 214
A DIG-labeled S9 full-length RNA probe (3.1 nmol) was mixed with various amounts 215
of unlabeled competitors, 4.6 µmol of P9-1 was then added, and the mixtures were 216
incubated for 10 min at room temperature. For one set of reactions, P9-1 was 217
combined with DIG-labeled RNA probe and incubated for 10 min as described earlier, 218
after which the competitor was added, and the samples were incubated for an 219
additional 10 min. The competitors used for competition between ss- and dsRNA and 220
ss- and dsDNA were: ssRNA, full-length in-vitro-transcribed S9 RNA transcript; 221
dsRNA, annealing product of the plus and minus strand of the full-length S9 RNA; 222
ssDNA, M13mp18 phage (NEB, Beijing, China); dsDNA, PCR amplified product of 223
the full-length RBSDV S9. The samples were separated electrophoretically and 224
visualized as described for the gel mobility shift assay. The bound RNA was 225
quantified as described by Gillian et al. (10). The ratios of unlabeled competitor to 226
labeled RNA were calculated from masses of nucleic acid. 227
228
Crystal structure visualization and analysis 229
The RBSDV P9-1 crystal structure (3VJJ) (1) was downloaded from the RCSB 230
Protein Data Bank (www.rcsb.org). Visualization and analysis of the amino acid 231
residues on the crystal structure were carried out using the PyMOL program. 232
233
RESULTS 234
P9-1 protein binds preferentially to single-stranded (ss) over double-stranded (ds) 235
nucleic acids 236
To obtain large amounts of P9-1 protein for biochemical characterization, we cloned 237
full-length RBSDV P9-1 into pET28c. After induction, the N-terminal 6xHis-tagged 238
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
9
recombinant P9-1 protein was purified by Ni-NTA resin and separated on a 10% 239
SDS-PAGE gel. Expression of high levels of a 40-kDa protein was observed in the 240
fraction eluted by 250 mM imidazole buffer (Fig. 1A). The nature of the purified 241
protein was further verified by using 6xHis antiserum. Western blot assay showed that 242
the purified P9-1 protein reacted specifically with the antiserum (Fig. 1A). 243
244
The RNA-binding activity of purified P9-1 was examined using an agarose gel 245
mobility shift assay (EMSA). DIG-labeled RNA transcripts representing full-length 246
plus strand ssRNA of the RBSDV S9 genome were incubated with the P9-1 protein. 247
As shown in Fig. 1B, the DIG-labeled S9 ssRNA was retarded by the addition of P9-1 248
in the EMSA. Addition of protease K caused the DIG-labeled ssRNA to shift back to 249
the fast mobility band (Fig. 1B). The DIG-labeled S9 ssRNA was not retarded by the 250
addition of BSA (Fig. 1B), suggesting that P9-1 was able to bind to ssRNA. 251
252
To compare the affinities of P9-1 for ssRNA and other nucleic acids, we performed 253
competition assays. DIG-labeled S9 RNA was combined with unlabeled competitor 254
nucleic acids (ssRNA, dsRNA, ssDNA or dsDNA) before the addition of P9-1. The 255
RNA-protein complexes were then analyzed using the agarose gel mobility shift assay 256
(Fig. 2A). Both ssRNA and ssDNA competed efficiently with the labeled ssRNA 257
probe for P9-1 binding, whereas dsRNA and dsDNA competed inefficiently (Fig. 2A). 258
For example, when 30-fold more ssRNA or ssDNA competitor was added, only 22% 259
± 3% or 21% ± 5% of the labeled S9 RNA was bound, respectively. In contrast, 260
when 30-fold more dsRNA or dsDNA competitor was added, 94% ± 4% or 91% ± 261
5% of the labeled RNA was bound, respectively. Hence, P9-1 bound efficiently to 262
single-stranded, but not double-stranded, nucleic acids. 263
264
P9-1 protein does not bind preferentially to RBSDV over non-RBSDV ssRNA 265
Sequences at the 5′ and 3′ terminus of all 10 RBSDV RNAs are quite conserved (37, 266
38) and therefore may be involved in distinguishing RBSDV from non-RBSDV RNA 267
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
10
for binding by P9-1. To test whether P9-1 exhibits specific binding activity for 268
RBSDV RNA, we used a competition assay to compare the affinities of P9-1 for 269
RBSDV RNAs representing the full length of the RBSDV S9 plus strand (1,900 nt) 270
and non-RBSDV sequences derived from RSV S4 (2,157 nt). DIG-labeled S9 RNA 271
was incubated with unlabeled competitor RNAs (RBSDV S9 or RSV S4) before 272
addition of P9-1. The RNA–protein complexes were then analyzed using the 1% 273
agarose gel mobility shift assay. In this assay, both RBSDV S9 and RSV S4 274
competitor RNAs competed to similar levels with DIG-labeled S9 RNA for binding to 275
P9-1 (Fig. 2B). For example, when 20-fold more RBSDV S9 or RSV S4 competitor 276
RNA was added, only 30%±5% or 34%±4% of the DIG-labeled S9 RNA was bound 277
by P9-1. When 30-fold more RBSDV S9 or RSV S4 competitor RNA was added, 278
only 15%±5% or 19%±4% of the DIG-labeled S9 RNA was bound. These results 279
suggest that the P9-1 protein does not have preference for binding to RBSDV 280
sequences. 281
282
To investigate the stability of preformed RNA–protein complexes, DIG-labeled S9 283
RNA was incubated with P9-1 before the addition of competitor RNA. As shown in 284
Fig. 2B, competitor RBSDV ssRNAs did not displace DIG-labeled S9 ssRNA that 285
was already bound to P9-1, even when 30-fold excess of competitor RNAs was added. 286
These data indicate that, once P9-1 bound to RNA, it formed a stable complex that 287
could not be easily disrupted by subsequent addition of other RNA. 288
289
Multiple units of P9-1 protein bind to ssRNA 290
To investigate the nature of the P9-1 that binds to ssRNA, the DIG-labeled full-length 291
RNA transcript of RBSDV S9-1900 (3.1 nmol) was incubated with increasing 292
amounts of P9-1 protein (Fig. 3A). As the amount of P9-1 was increased from 0.037 293
to 0.37 µmol, the S9 ssRNA band shifted drastically. When the amount of P9-1 was 294
further increased from 0.37 to 2.94 µmol, the mobility of the S9 ssRNA was 295
progressively retarded and clearly distinguishable, different size complexes were 296
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
11
observed. With larger amounts of P9-1 (5.74 to 22.97 µmol), a lowest-mobility 297
complex was formed, accumulated, and not further retarded with the addition of more 298
protein. The gradual shifting of the RNA band suggested that multiple units of P9-1 299
could bind to the 1900-nt S9 ssRNA. To further examine this property of P9-1, and 300
because smaller ssRNAs might better display intermediate size complexes if P9-1 301
binds to the ssRNA as multiple units, a 150-nt RNA transcript (39 nmol) was 302
incubated with increasing amounts of P9-1 (Fig. 3B). Indeed, intermediate size 303
complexes begin to form upon addition of 0.037–0.18 µmol of P9-1 protein (Fig. 3B). 304
When 0.18–0.37 µmol of P9-1 protein was added, another intermediate, retarded band 305
was formed; consequently, the smaller, intermediate size complexes started to 306
disappear. When the amount of P9-1 was further increased from 0.37 to 2.94 µmol, 307
differently sized complexes were again distinguishable. Upon addition of more P9-1 308
protein (5.74–22.97 µmol), the 150-nt ssRNA was no longer retarded. These results 309
suggested that multiple units of P9-1 protein could bind to RNA. A similar RNA 310
retardation pattern has also been reported for viroplasm protein NSP2 of Rotavirus 311
and σNS of Reovirus (10, 30). 312
313
P9-1 forms a range of high order oligomers 314
To investigate what type of high order oligomers P9-1 can form, a discontinuous blue 315
native polyacrylamide gradient gel was used. Discontinuous blue native protein gel 316
electrophoresis, which maintains native protein conformation and protein complex 317
quaternary structure, allows the separation of proteins according to their size and 318
shape (24). Discontinuous blue native PAGE is a powerful tool for the analysis of 319
protein–protein interactions and protein oligomeric formations. It has been widely 320
used in protein complex analysis in numerous studies (2, 6, 8, 17, 22). To examine the 321
oligomeric formation of P9-1, we analyzed the purified 6xHis-tag P9-1 on a 4–16% 322
blue native polyacrylamide gradient gel. GAPDH was loaded as a size marker. 323
According to the size of the GAPDH oligomers, P9-1 was capable of forming a range 324
of oligomers, from low order to high order (Fig. 4A). The major bands corresponded 325
to 80, 160, and 320 kDa, suggesting that P9-1 forms a dimer, tetramer, and octamer. 326
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
12
Size exclusion chromatography analysis further confirmed that P9-1 can form a 327
similar pattern of high-order oligomers (Fig. 4B). 328
329
Both discontinuous blue native PAGE and chromatography analysis demonstrated that 330
viroplasm protein P9-1 forms dimers, tetramers and octamers. However, 331
chromatography experiments performed by Akita et al (2012) showed that the vast 332
majority of the protein assembled into an octamer (1). Our construct pET28c-P9-1 333
expressed the His-tag P9-1 with 34 extra amino acids at its N-terminus. The His-tag 334
P9-1 expressed by Akita et al (2012) has an extra 21 amino acids at its N-terminus. To 335
address whether the difference on the dominant form of P9-1 protein is due to the 336
number of extra amino acids at its N-terminus, we also constructed pXT99-P9-1, 337
which expressed His-tag P9-1 with an extra 21 amino acids at the N-terminus as 338
described by Akita et al. (1). However, in both blue native PAGE and 339
chromatography experiments, pXT99-P9-1 formed a pattern of dimers, tetramers, and 340
octamers similar to that of pET28c-P9-1 (Fig. 4C and D). An alternative possibility is 341
that the extra amino acids at the N-terminus of P9-1 may affect the dominant form of 342
P9-1 oligomers; thus, we purified free tag P9-1 and found that the free tag P9-1 343
formed a pattern of oligomers very similar to that of pXT99-P9-1 and pET28c-P9-1 344
(Fig. 4D). Although a slightly stronger octamer band was observed for free tag P9-1, 345
the dominant form of oligomers was still the dimer and tetramer (Fig. 4D). Because 346
P9-1 with or without the tag formed similar oligomers, the His-tag protein expressed 347
by pET28c-P9-1 was used in all the subsequent experiments. 348
349
P9-1 prefers to bind to ssRNA as an octamer 350
Given observations that P9-1 forms a dimer, tetramer, and octamer, and together with 351
the detection of the gradually shifted RNA band over the range of P9-1 amounts 352
added, there are two models that can be proposed for interpreting these results. The 353
first was the dimer step-binding model proposed earlier by Gillian et al. (2000) and 354
Taraporewala et al. (1999) for the Reovirus sigmaNS and Rotavirus NSP2 (10, 28). In 355
this model (Fig. 4E), more than one unit of viroplasm protein can bind to each 356
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
13
molecule of the RNA. Each binding unit of viroplasm protein is hypothesized to be a 357
small oligomer of that protein (a dimer for P9-1). In addition, the saturated complex 358
represents RNA molecules that could each have been bound by the maximum number 359
of protein units (an octamer for P9-1). 360
361
To determine whether the dimer step-binding model (Fig. 4E) represents P9-1 binding 362
to ssRNA, we incubated a fixed amount of P9-1 protein (11.48 µmol) with increasing 363
amounts of 150-nt ssRNA and analyzed the reaction products in a 4–16% blue native 364
polyacrylamide gradient gel. With increasing amounts of ssRNA, surprisingly, the 365
dimer and tetramer bands did not shift in an obvious manner, while the octamer band 366
shifted dramatically (Fig. 4F). For example, the addition of 3 µmol ssRNA reduced 367
the intensity of the octamer band somewhat. When the ssRNA was increased to 9 368
µmol, the octamer was completely gone. At the same concentration of ssRNA, the 369
intensity of the tetramer and dimer bands did not change. We observed a slight 370
reduction in the dimer and tetramer bands only when the ssRNA was increased to 18 371
µmol (Fig. 4F). These data suggest that the octamer is the form that either is required 372
for RNA binding or binds to RNA with very high affinity. 373
374
These findings strongly support an octamer-binding model (Fig. 4G), in that the 375
octamer of P9-1, rather than the dimer, is the form that prefers to bind to ssRNA. With 376
increasing amounts of P9-1, some of the P9-1 octamer binds to ssRNA; then more 377
octamer binds to the unoccupied space of the ssRNA until the binding space of the 378
ssRNA is completely saturated. Eventually, this forms the saturated, lowest-mobility 379
P9-1::ssRNA complex. 380
381
The P9-1 C-terminal-arm deletion mutant no longer forms an octamer and binds 382
to ssRNA with significantly lower affinity 383
To further examine the octamer-binding model, we took advantage of the P9-1 crystal 384
structure (1), in which the C-terminal arm formed by each dimer interacts with the 385
adjoining dimer, with each holding the other at the “shoulder”, to form the octamer 386
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
14
(Fig. 5A and B). Based on our observations that P9-1 preferentially binds to ssRNA as 387
an octamer, we hypothesized that deletion of the C-terminal arm could cause the 388
oligomeric state of P9-1 to shift from a higher to lower order; subsequently, the 389
mutant would bind ssRNA with lower affinity and fewer copies of the P9-1 mutant 390
would bind per ssRNA. To test this hypothesis, we generated two C-terminal-arm 391
deletion mutants, P9-1ǻC9
and P9-1ǻC23
(Fig. 5C); their oligomeric formations were 392
determined by discontinuous blue-native PAGE gel. As shown in Fig. 5D, both 393
C-terminal-arm deletion mutants produce a high intensity band corresponding to the 394
dimer and a lower intensity band corresponding to the tetramer; additionally, neither 395
forms an octamer. 396
397
To determine the RNA binding capability of P9-1 C-terminal-arm deletion mutants, a 398
fixed amount of S9 RNA transcripts (3.1 nmol) was incubated with increasing 399
amounts of P9-1 deletion mutants and analyzed using an agarose gel mobility shift 400
assay. Wild-type P9-1 protein was loaded on the same gel for comparison. As shown 401
in Fig. 5E and F, when the amount of protein was increased, the mobility of the 402
ssRNA::wild-type P9-1 complex was progressively retarded, whereas the 403
ssRNA::P9-1ǻC9
or ssRNA::P9-1ǻC23
complex was less retarded (Fig. 5E and F). 404
405
In the preliminary salt gradient experiments, we found that the salt start to compete 406
out dig-probe from binding of wild-type P9-1 when the NaCl was increasing up to 407
300 mM (data not shown). To further examine whether RNA binding affinity of 408
P9-1ǻC9
and P9-1ǻC23
mutant is much different than that of wild-type protein, the gel 409
mobility shift assay was performed in the presence of 200 mM NaCl. As shown in Fig. 410
6A, the ssRNA::P9-1ǻC9
or ssRNA::P9-1ǻC23
complex band was significantly less 411
retarded compared with the wild-type complex band in the presence of 200 mM NaCl. 412
These data suggest that the dimer or tetramer of P9-1 do bind to ssRNA, whereas the 413
octamer has much stronger binding affinity for ssRNA than the dimer or the tetramer 414
does. 415
416
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
15
To further investigate the RNA binding activity of octamer-defective mutants, a fixed 417
amount of P9-1ǻC9
or P9-1ǻC23
protein (11.48 µmol) was incubated with increasing 418
amounts of 150-nt ssRNA and analyzed in the 4–16% blue native PAGE gel. With 419
increasing amounts of ssRNA, the dimer and tetramer bands of P9-1ǻC9
or P9-1ǻC23
420
protein did not shift (Fig. 6B and C). Band intensity was not reduced even in the 421
presence of up to 18 µmol ssRNA. These results suggested that the binding affinity of 422
dimer or tetramer of P9-1 to ssRNA might be low. 423
424
In summary, deletion of the C-terminal arm of P9-1 yielded mutants that no longer 425
formed an octamer; consequently, the mutants bound to ssRNA with significantly 426
lower affinity, and fewer copies were bound per ssRNA. 427
428
Amino acids 25–44 are the critical RNA binding sites and map to the central 429
interior structure formed by the octamer of P9-1 430
Using an online RNA binding residue prediction software, 431
BindN (http://bioinfo.ggc.org/cgi-bin/bindn/bindn.pl), we found that amino acid 432
residues 25–44 and 319–327 were predicted to be major RNA-binding sites on P9-1. 433
The precise role of these predicted residues was confirmed by substituting amino acid 434
residues 25–44 (Bind1m) and 319–327 (Bind2m) with alanines (Fig. 7A), and the 435
oligomeric formation of the mutants was determined by discontinuous blue-native 436
PAGE gel. As shown in Fig. 7B, the 25–44-aa substitution mutant (Bind1m) formed 437
an oligomeric structure comparable to that formed with wild-type P9-1, except that 438
the Bind1m mutant lacked octamer formation. The oligomeric state of the Bind2m 439
mutant, however, was drastically affected. Although the Bind2m mutant could form 440
dimers, tetramers and octamers, the amount of each was significantly reduced; in 441
addition to these changes, Bind2m formed more monomers than the wild type P9-1 442
did. 443
444
To check the RNA binding activity of the P9-1 Bind1m and Bind2m mutants, a fixed 445
amount of S9-1900 ssRNA (3.1 nmol) was incubated with increasing amounts of P9-1 446
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
16
alanine mutants and analyzed by agarose gel mobility shift assay. Wild-type P9-1 447
protein was loaded on the same gel as a positive control. As the amount of P9-1 448
Bind1m was increased from 0 to 1.47 µmol, the S9 ssRNA band did not shift (Fig. 449
7C). Only when the amount of P9-1 was increased to 2.94 µmol did the S9-1900 450
ssRNA band display some retardation, but the retarded band was significantly lower 451
than the wild-type complex band (Fig. 7C). The S9-1900 ssRNA band was not further 452
retarded by the addition of larger amounts of P9-1 protein (data not shown). These 453
data suggest that P9-1 Bind1m almost lost the ability to bind ssRNA. Compared with 454
P9-1 Bind1m, P9-1 Bind2m had a very different binding behavior. As the amount of 455
P9-1 Bind2m was increased from 0 to 0.74 µmol, the S9-1900 ssRNA band did not 456
shift (Fig. 7D). When the amount of P9-1 Bind2m was increased from 1.47 to 2.94 457
µmol, the S9-1900 ssRNA band shifted drastically (Fig. 7D), suggesting that P9-1 458
Bind2m has lower binding affinity. 459
460
When amino acid residues 25–44, that were critical for RNA binding, were mapped 461
onto the crystal structure of P9-1, we found that they were corresponding to the 462
disordered region in the crystal structure. So the flanking amino acids in this region 463
(aa 20, 42–44, KTKK) were mapped onto the P9-1 crystal structure instead. Notably, 464
these amino acid residues were mapped to a central interior structure that was formed 465
only by the octamer of P9-1 (Fig. 7E and F). 466
467
Eletropositive amino acids among residues 25–44 are important for RNA binding 468
Among residues 25–44 are four positively charged amino acids: R27, R39, K43 and 469
K44. To investigate whether these amino acids are responsible for RNA binding, we 470
used an alanine scanning strategy to mutate each positively charged amino acid 471
individually or jointly (Fig. 8A). A fixed amount of S9 RNA transcripts (3.1 nmol) 472
was incubated with either 0.74 or 2.94 µmol of each alanine-scanning mutant. 473
Compared with the wild-type protein, all the single alanine mutants, R26A (Bind3m), 474
R39A (Bind4m), K43A (Bind5m) and K44A (Bind6m), had the same RNA binding 475
affinity as the wild-type P9-1 (Fig. 8A and B). While the double mutant, K43A-K44A 476
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
17
(Bind7m) had a less-retarded RNA band, and the triple alanine mutant, 477
R39A-K43A-K44A (Bind8m), had a continuously less-retarded band. The quadruple 478
alanine mutant, R26A-R39A-K43-K44A (Bind9m), which had a band that was even 479
less retarded, lost most of its ability to bind to RNA (Fig. 8A and B). These data 480
demonstrated that the positively charged amino acids among the residues 25–44 are 481
important for P9-1 binding to ssRNA. 482
483
The oligomeric formation of alanine scan mutants was also determined by 484
discontinuous blue-native PAGE gel. As shown in Fig. 8C, all single alanine mutants, 485
R26A (Bind3m), R39A (Bind4m), K43A (Bind5m) and K44A (Bind6m), form an 486
octamer that was comparable to that of wild-type P9-1. However, the double (Bind7m) 487
mutant formed a weak octamer band. Most strikingly, the triple (Bind8m) and the 488
quadruple (Bind9m) mutants were unable to form octamers. These data together with 489
the above results that the Bind1m mutant lack octamer formation suggested that those 490
positively charged amino acids may also be required for the formation of the octamer, 491
a structure that has a higher affinity to ssRNA. 492
493
To further investigate whether those positively charged amino acids represent RNA 494
binding sites. We introduced the quadruple alanine mutations into P9-1ǻC23
, which 495
was unable to form an octamer but still bound to RNA to a certain degree. A fixed 496
amount of S9 ssRNA (3.1 nmol) was incubated with increasing amounts of P9-1ǻC23
497
quadruple alanine mutant (P9-1ǻC23
-Bind9m) and analyzed with the agarose gel 498
mobility shift assay. As shown in Fig. 8D and E襯the P9-1ǻC23
-Bind9m mutant was 499
still able to form dimers and tetramers; however, it completely lost its RNA binding 500
ability, suggesting that the eletropositive amino acids among residues 25–44 are 501
important for RNA binding. 502
503
DISCUSSION 504
In this study, we demonstrated that the P9-1 protein preferentially bound to 505
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
18
single-stranded vs. double-stranded nucleic acids; however, the protein displayed no 506
preference for RBSDV vs. non-RBSDV ssRNA. We further revealed that the P9-1 507
protein forms dimers, tetramers and octamers. Strikingly, RBSDV P9-1 preferentially 508
bound to ssRNA in its octamer form over the dimer form. The electropositive amino 509
acids among the residues 25–44 were demonstrated to be the major RNA binding sites 510
and mapped to a central interior structure formed only by the P9-1 octamer. 511
512
P9-1 binds to the full length of RBSDV S9 ssRNA in a nonsequence-specific manner, 513
although S9 RNA contains both the 5′ and 3′ conserved terminal end sequence. It is 514
plausible that other cofactors increase the RNA binding specificity of RBSDV P9-1 in 515
vivo; the best candidate would be the P6 protein, which has been shown to interact 516
and co-localize with P9-1 (34). Another possibility is that viral mRNAs are retained 517
and concentrated in the viroplasm factories, whereas cellular mRNAs are excluded, 518
obviating the need for viroplasm-associated P9-1 to preferentially bind viral 519
sequences. 520
521
Using both discontinuous blue native PAGE and chromatography analysis, we found 522
that viroplasm protein P9-1 was capable of forming dimers, tetramers and octamers. 523
Whenever P9-1 was expressed with the N-terminal 6xHis-tag or with the free tag, the 524
dominant form of the protein was the dimer and tetramer. However, in 525
chromatography experiments of Akita et al. (1), using expressed His-tag P9-1 at its 526
N-terminus, the vast majority of the protein assembled as octamers. The reason for the 527
differences in the dominant form of P9-1 protein between our results and those of 528
Akita et al. (1) remains unknown and needs to be determined in the future. The 529
existence of the dimers, tetramers and octamers may indicate the equilibrium balance 530
of these high order oligomers, suggesting that in the P9-1 oligomerization process, 531
two dimers interact with each other to form a tetramer that further polymerize to form 532
an octamer. Perhaps the difference between our results and those of Akita et al. (1) 533
may be due to a difference in the equilibrium of oligomers caused by unknown 534
factor(s) such as different RBSDV isolate, different concentrations of P9-1 535
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
19
preparation ect. 536
537
The P9-1 protein of Mal de Río Cuarto virus (MRCV), a counterpart of the P9-1 538
protein of RBSDV, has also been shown to self-associate, giving rise to different high 539
molecular weight oligomers when expressed in bacteria (19). The RBSDV P9-1 540
protein shares 63% amino acid identity with the P9-1 protein of MRCV, which is in 541
the same genus (Fijivirus) and family (Reoviridae) as RBSDV. The amino acid 542
similarity between the two viruses suggests that their P9-1 proteins may have similar 543
biochemical properties such as nonspecific RNA-binding activity (19). 544
545
In the discontinuous blue native gel assay, the band corresponding to the octamer was 546
dramatically reduced, while a slight reduction in the intensity of the dimer and 547
tetramer bands was observed only with the addition of high amounts of RNA. The 548
reduced intensity of the dimer and tetramer could be due to the increased binding of 549
the octamer to the RNA, as this could result in a shift of equilibrium from low order 550
oligomers to the octamer. While based on the results from the EMSA assay of the 551
C-terminal deletion mutants, dimer and tetramer species are likely to be responsible 552
for RNA binding and associated mobility shift. The C-terminal deletion mutants did 553
not display a reduction in dimer or tetramer bands with a higher amount of RNA in 554
the discontinuous blue native gel, probably because the mole ratio of RNA to protein 555
is still low in the blue native gel assay. With the high mole ratio of RNA to protein 556
used for the C-terminal deletion mutant EMSA, the binding did occur. These findings 557
are consistent with the notion that dimer and tetramer species may bind to RNA but 558
that the affinity of the octamer is much stronger than that of the dimer or tetramer. 559
560
According to the crystal structure of P9-1, the deletion of the C-terminal arm should 561
not form higher order oligomers; however, these deletion mutants do form tetramers. 562
Although we do not know how the deletion mutants form tetramers, perhaps they 563
polymerize using other interacting surfaces. The residual RNA binding capacity of the 564
deletion mutants may have arisen from assembled octamers that were derived from 565
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
20
the tetramers and were not detectable on the gel. However, the residual RNA binding 566
capacity of the C-terminal deletion mutants may also be derived from the binding 567
activity of dimer or tetramer. 568
569
Amino acid residues 25–44 that were critical for RNA binding were mapped to a 570
central interior structure of the octamer of P9-1 (Fig. 7E and F), consistent with the 571
data that the C-terminal-arm deletion mutant was unable to form an octamer that 572
bound to the RNA with lower affinity. Although the dimer and tetramer have the same 573
amino acid sequence, they do not bind well to RNA. This region of amino acids may 574
undergo a conformational change when P9-1 forms an octamer because only the 575
octamer, not the dimer or tetramer, forms the central interior structure that is capable 576
of binding to RNA. It is interesting to note that residues 25–44 were disordered in the 577
crystal structure of P9-1; perhaps this disordered region becomes ordered when it 578
binds to RNA. 579
580
The RNA binding capability of alanine substitution mutant at residues 25–44 581
(Bind1m) suggests that the amino-terminus of P9-1 is important for RNA binding. 582
The amino-terminal portion of the Orthoreovirus protein sigma NS (9) and 583
bluetongue virus protein NS2 (40) have also been shown to be essential for ssRNA 584
binding. However, for rotavirus NSP2, in addition to the highly conserved residues in 585
the NSP2 enzymatic cleft, the C-terminal helix and other basic residues outside the 586
enzymatic cleft account for sequence-independent RNA binding of NSP2 (12). The 587
alanine mutant on residues 25–44 of P9-1 has some residual RNA binding activity. 588
An alternative RNA binding region of P9-1 may also be involved in ssRNA binding. 589
Such a binding site could be the region containing amino acid residues 319–327 as 590
substitution of these amino acids with alanines significantly reduced the RNA binding 591
affinity. However, oligomeric formation for this mutant was substantially changed; 592
thus, we cannot rule out the possibility that the lower binding affinity was also caused 593
by the conformational change from the mutation. 594
595
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
21
Akita et al. (2012) suggested earlier that the internal pore of P9-1 octamer might be 596
important for RNA binding (1). Our alanine-scanning mutants further demonstrate 597
that the positively charged amino acids among residues 26–44 are critical RNA 598
binding sites, and they map to the central interior structure of P9-1 octamer. Previous 599
cryoelectron microscopy studies with the rotavirus NSP2 octamer have shown that 600
ssRNA binds to the highly electropositive grooves that run diagonally across the 601
structure, while ssRNA does not bind to the central pore of the rotavirus NSP2 602
octamer (14). Our finding strongly implicates that the electropositive amino acids 603
along the central interior structure of the octamer, instead of the internal pore itself, 604
may be the real RNA binding sites for RBSDV P9-1. Surprisingly, both the alanine 605
substitution mutant at residues 25–44 (Bind1m) and the quadruple alanine mutant at 606
four positively charged amino acids among residues 26–44 (Bind9m) of RBSDV P9-1 607
no longer form octamers. The importance of the corresponding positively charged 608
amino acids in octamer/oligomers formation by rotavirus NSP2 or other viroplasm 609
proteins has not been reported previously. It is not known how these amino acids 610
contribute to the formation of octamers. The electropositive amino acids among 611
residues 26–44 of RBSDV P9-1 may map to sites needed to form octamers, a 612
structure that may be essential for RNA binding. Our finding leads to an important 613
new concept that the positively charged amino acids among residues 26–44 are not 614
only required for RNA binding, but also essential for octamer formation. The broad 615
implications of this finding await investigations of the structure and function of the 616
viroplasm protein from other viruses in the family of Reoviridae. 617
618
In summary, the results presented here reveal that the octamer of P9-1, rather than the 619
dimer, preferentially bind to ssRNA. Deletion of the C-terminal arm of P9-1 produces 620
a mutant that is unable to form an octamer; consequently, the deletion mutant bound 621
to ssRNA with significantly lower affinity and fewer copies. The positively charged 622
amino acids among the residues 25–44 are the critical RNA binding sites, which 623
mapped to a central interior structure in the P9-1 octamer. In light of these results, we 624
propose a unifying model for the structure and function of RBSDV viroplasm protein 625
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
22
in which the octamer of P9-1 is an important form that gradually binds to ssRNA to 626
form a saturated complex (Fig. 4G). 627
628
Acknowledgments 629
This work was supported by the Program for New Century Excellent Talents in 630
University (NCET-12-0888), National Program on Key Basic Research Project of 631
China (973 Program, 2014CB138400), National Natural Science Foundation of China 632
(31222045 and 31171813), Special Fund for Agro-scientific Research in the Public 633
Interest (201303021 and 201003031), Natural Science Foundation of Jiangsu 634
Province (SBK201222198). 635
636
References 637
638
1. Akita, F., A. Higashiura, T. Shimizu, Y. Pu, M. Suzuki, T. Uehara-Ichiki, T. Sasaya, S. 639
Kanamaru, F. Arisaka, T. Tsukihara, A. Nakagawa, and T. Omura. 2012. Crystallographic 640
analysis reveals octamerization of viroplasm matrix protein P9-1 of Rice black streaked dwarf 641
virus. J Virol 86:746-56. 642
2. Brindley, M. A., and R. K. Plemper. 2010. Blue native PAGE and biomolecular 643
complementation reveal a tetrameric or higher-order oligomer organization of the 644
physiological measles virus attachment protein H. J Virol 84:12174-84. 645
3. Broering, T. J., J. S. Parker, P. L. Joyce, J. Kim, and M. L. Nibert. 2002. Mammalian 646
reovirus nonstructural protein microNS forms large inclusions and colocalizes with reovirus 647
microtubule-associated protein micro2 in transfected cells. J Virol 76:8285-97. 648
4. Chen, S. X., and Q. Y. Zhang. 2005. Advance in researches on rice black-streaked dwarf 649
disease and maize rough dwarf disease in China. Acta Phytophylacica Sinica 32:97-103. 650
5. Eaton, B. T., A. D. Hyatt, and J. R. White. 1987. Association of bluetongue virus with the 651
cytoskeleton. Virology 157:107-16. 652
6. Eubel, H., H. P. Braun, and A. H. Millar. 2005. Blue-native PAGE in plants: a tool in 653
analysis of protein-protein interactions. Plant Methods 1:11. 654
7. Fabbretti, E., I. Afrikanova, F. Vascotto, and O. R. Burrone. 1999. Two non-structural 655
rotavirus proteins, NSP2 and NSP5, form viroplasm-like structures in vivo. J Gen Virol 80 656
( Pt 2):333-9. 657
8. Fristedt, R., and A. V. Vener. 2011. High light induced disassembly of photosystem II 658
supercomplexes in Arabidopsis requires STN7-dependent phosphorylation of CP29. PLoS 659
One 6:e24565. 660
9. Gillian, A. L., and M. L. Nibert. 1998. Amino terminus of reovirus nonstructural protein 661
sigma NS is important for ssRNA binding and nucleoprotein complex formation. Virology 662
240:1-11. 663
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
23
10. Gillian, A. L., S. C. Schmechel, J. Livny, L. A. Schiff, and M. L. Nibert. 2000. Reovirus 664
protein sigmaNS binds in multiple copies to single-stranded RNA and shares properties with 665
single-stranded DNA binding proteins. J Virol 74:5939-48. 666
11. Higuchi, R., B. Krummel, and R. K. Saiki. 1988. A general method of in vitro preparation 667
and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic 668
Acids Res 16:7351-67. 669
12. Hu, L., D. C. Chow, J. T. Patton, T. Palzkill, M. K. Estes, and B. V. Prasad. 2012. 670
Crystallographic Analysis of Rotavirus NSP2-RNA Complex Reveals Specific Recognition of 671
5' GG Sequence for RTPase Activity. J Virol 86:10547-57. 672
13. Isogai, M., I. Uyeda, and B. C. Lee. 1998. Detection and assignment of proteins encoded by 673
rice black streaked dwarf fijivirus S7, S8, S9 and S10. J Gen Virol 79 ( Pt 6):1487-94. 674
14. Jiang, X., H. Jayaram, M. Kumar, S. J. Ludtke, M. K. Estes, and B. V. Prasad. 2006. 675
Cryoelectron microscopy structures of rotavirus NSP2-NSP5 and NSP2-RNA complexes: 676
implications for genome replication. J Virol 80:10829-35. 677
15. Kar, A. K., B. Bhattacharya, and P. Roy. 2007. Bluetongue virus RNA binding protein NS2 678
is a modulator of viral replication and assembly. BMC Mol Biol 8:4. 679
16. Kattoura, M. D., X. Chen, and J. T. Patton. 1994. The rotavirus RNA-binding protein NS35 680
(NSP2) forms 10S multimers and interacts with the viral RNA polymerase. Virology 681
202:803-13. 682
17. Kikuchi, S., T. Hirohashi, and M. Nakai. 2006. Characterization of the preprotein translocon 683
at the outer envelope membrane of chloroplasts by blue native PAGE. Plant Cell Physiol 684
47:363-71. 685
18. Liu, H., C. Wei, Y. Zhong, and Y. Li. 2007. Rice black-streaked dwarf virus outer capsid 686
protein P10 has self-interactions and forms oligomeric complexes in solution. Virus Res 687
127:34-42. 688
19. Maroniche, G. A., V. C. Mongelli, A. V. Peralta, A. J. Distefano, G. Llauger, O. A. Taboga, 689
E. H. Hopp, and M. del Vas. 2010. Functional and biochemical properties of Mal de Rio 690
Cuarto virus (Fijivirus, Reoviridae) P9-1 viroplasm protein show further similarities to animal 691
reovirus counterparts. Virus Res 152:96-103. 692
20. McNulty, M. S., W. L. Curran, and J. B. McFerran. 1976. The morphogenesis of a 693
cytopathic bovine rotavirus in Madin-Darby bovine kidney cells. J Gen Virol 33:503-8. 694
21. Miller, C. L., M. M. Arnold, T. J. Broering, C. E. Hastings, and M. L. Nibert. 2010. 695
Localization of mammalian orthoreovirus proteins to cytoplasmic factory-like structures via 696
nonoverlapping regions of microNS. J Virol 84:867-82. 697
22. Mine, A., A. Takeda, T. Taniguchi, H. Taniguchi, M. Kaido, K. Mise, and T. Okuno. 2010. 698
Identification and characterization of the 480-kilodalton template-specific RNA-dependent 699
RNA polymerase complex of red clover necrotic mosaic virus. J Virol 84:6070-81. 700
23. Mohan, K. V., J. Muller, I. Som, and C. D. Atreya. 2003. The N- and C-terminal regions of 701
rotavirus NSP5 are the critical determinants for the formation of viroplasm-like structures 702
independent of NSP2. J Virol 77:12184-92. 703
24. Niepmann, M., and J. Zheng. 2006. Discontinuous native protein gel electrophoresis. 704
Electrophoresis 27:3949-51. 705
25. Prasad, B. V., R. Rothnagel, C. Q. Zeng, J. Jakana, J. A. Lawton, W. Chiu, and M. K. 706
Estes. 1996. Visualization of ordered genomic RNA and localization of transcriptional 707
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
24
complexes in rotavirus. Nature 382:471-3. 708
26. Sharpe, A. H., L. B. Chen, and B. N. Fields. 1982. The interaction of mammalian reoviruses 709
with the cytoskeleton of monkey kidney CV-1 cells. Virology 120:399-411. 710
27. Shikata, E., and Y. Kitagawa. 1977. Rice black-streaked dwarf virus: its properties, 711
morphology and intracellular localization. Virology 77:826-42. 712
28. Shimizu, T., E. Nakazono-Nagaoka, F. Akita, T. Uehara-Ichiki, T. Omura, and T. Sasaya. 713
2011. Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice 714
plants by RNA silencing against the gene for the viroplasm component protein. Virus Res 715
160:400-3. 716
29. Supyani, S., B. I. Hillman, and N. Suzuki. 2007. Baculovirus expression of the 11 717
mycoreovirus-1 genome segments and identification of the guanylyltransferase-encoding 718
segment. J Gen Virol 88:342-50. 719
30. Taraporewala, Z., D. Chen, and J. T. Patton. 1999. Multimers formed by the rotavirus 720
nonstructural protein NSP2 bind to RNA and have nucleoside triphosphatase activity. J Virol 721
73:9934-43. 722
31. Theron, J., H. Huismans, and L. H. Nel. 1996. Site-specific mutations in the NS2 protein of 723
epizootic haemorrhagic disease virus markedly affect the formation of cytoplasmic inclusion 724
bodies. Arch Virol 141:1143-51. 725
32. Thomas, C. P., T. F. Booth, and P. Roy. 1990. Synthesis of bluetongue virus-encoded 726
phosphoprotein and formation of inclusion bodies by recombinant baculovirus in insect cells: 727
it binds the single-stranded RNA species. J Gen Virol 71 ( Pt 9):2073-83. 728
33. Tropea, J. E., S. Cherry, and D. S. Waugh. 2009. Expression and purification of soluble 729
His(6)-tagged TEV protease. Methods Mol Biol 498:297-307. 730
34. Wang, Q., T. Tao, Y. Zhang, W. Wu, D. Li, J. Yu, and C. Han. 2011. Rice black-streaked 731
dwarf virus P6 self-interacts to form punctate, viroplasm-like structures in the cytoplasm and 732
recruits viroplasm-associated protein P9-1. Virol J 8:24. 733
35. Wei, T., T. Shimizu, K. Hagiwara, A. Kikuchi, Y. Moriyasu, N. Suzuki, H. Chen, and T. 734
Omura. 2006. Pns12 protein of Rice dwarf virus is essential for formation of viroplasms and 735
nucleation of viral-assembly complexes. J Gen Virol 87:429-38. 736
36. Zhang, C., Y. Liu, L. Liu, Z. Lou, H. Zhang, H. Miao, X. Hu, Y. Pang, and B. Qiu. 2008. 737
Rice black streaked dwarf virus P9-1, an alpha-helical protein, self-interacts and forms 738
viroplasms in vivo. J Gen Virol 89:1770-6. 739
37. Zhang, H., J. Chen, J. Lei, and M. Adams. 2001. Sequence Analysis Shows that a Dwarfing 740
Disease on Rice, Wheat and Maize in China is Caused by Rice Black-streaked Dwarf Virus. 741
European Journal of Plant Pathology 107:563-567. 742
38. Zhang, H. M., J. P. Chen, and M. J. Adams. 2001. Molecular characterisation of segments 1 743
to 6 of Rice black-streaked dwarf virus from China provides the complete genome. Arch Virol 744
146:2331-9. 745
39. Zhang, L., Z. Wang, X. Wang, D. Li, C. Han, Y. Zhai, and J. Yu. 2005. Two virus-encoded 746
RNA silencing suppressors, P14 ofBeet necrotic yellow vein virus and S6 ofRice black streak 747
dwarf virus. Chinese Science Bulletin 50:305-310. 748
40. Zhao, Y., C. Thomas, C. Bremer, and P. Roy. 1994. Deletion and mutational analyses of 749
bluetongue virus NS2 protein indicate that the amino but not the carboxy terminus of the 750
protein is critical for RNA-protein interactions. J Virol 68:2179-85.751
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
25
Table 1. List of primers used for making RBSDV P9-1 constructs in this 752
study. 753
754
Clone Name Primer Name Primer Sequence Purpose
pET28c-P9-1 F XT420 CGGGATCCCGATGGCAGACCAAGAGCGGAG To amplify RBSDV P9-1
and clone into pET28c. R XT421 CCGCTCGAGTCAAACGTCCAATTTCAAG
pET28c-P9-1ǻC9 F XT420 CGGGATCCCGATGGCAGACCAAGAGCGGAG To amplify P9-1ǻC9 and
clone into pET28c. R XT736 CCGCTCGAGTCAAATAACGCAATCAACATT
GCC
pET28c-P9-1ǻC23 F XT420 CGGGATCCCGATGGCAGACCAAGAGCGGAG To amplify P9-1ǻC23 and
clone into pET28c. R XT939 CCGCTCGAGTCAGAATTTACGATATCTCTTG
pMD19-S9-1900-Sens
e
F XT545 CGTCAGAAATtaatacgactcactataggAAGTTTTTT
AGCCTGGAACTG
To amplify plus strand of
full length of RBSDV S9
(1,900 bp) and clone into
pMD19-T vector.
R XT297 GGACTAGTGACGATAGCTGTTAGCCGGCTTG
pMD19-S9-1900-Anti
sense
F XT558 CGTCAGAAATtaatacgactcactataggACGATAGCT
GTTAGCCGGCTTG
To amplify minus strand
of full length of RBSDV
S9 (1,900 bp) and clone
into pMD19-T vector.
R XT296 GGACTAGTAAGTTTTTTAGCCTGGAACTG
pMD19-S9-150 F XT545 CGTCAGAAATtaatacgactcactataggAAGTTTTTT
AGCCTGGAACTG
To amplify the 5’ terminal
fragment of S9 (150 bp)
and clone into pMD19-T
vector.
R XT696 GGACTAGTAGAAGTCGATGAATTTGTG
pMD19-S4 F XT52 CGTCAGAAATtaatacgactcactataggACACAAAG
TCCAGGGCATTTG
To amplify full length of
RSV S4 (2,157bp) and
clone into pMD19-T
vector.
R XT126 GGACTAGTACACAAAGTCAGGGCATATC
pXT99-P9-1 F PV251 GGAATTCCATATGGCAGACCAAGAGCGGAG To amplify RBSDV P9-1
and clone into pXT99. R XT421 CCGCTCGAGTCAAACGTCCAATTTCAAG
pET28c-P9-1-Bind1m F XT879 GGCTGCAGCTGCTGCGGCAGCGGCTGCGGC
TGCAGCAGCGATCCCCCTACTCGATGACG
Alanine substitution of
amino acid residues 25-44
by site direct mutagenesis
based on pET28c-P9-1. R XT878 CTGCCGCAGCAGCTGCAGCCGCTGCAGCTG
CCGCAGCTGCTGGTTGGTCGTTTTTAATT
pET28c-P9-1-Bind2m F XT879 GGCTGCAGCTGCTGCGGCAGCGGCTGCGGC
TGCAGCAGCGATCCCCCTACTCGATGACG
Alanine substitution of
amino acid residues
319-327 by site direct
mutagenesis based on
pET28c-P9-1.
R XT878 CTGCCGCAGCAGCTGCAGCCGCTGCAGCTG
CCGCAGCTGCTGGTTGGTCGTTTTTAATT
pET28c-P9-1-Bind3m F PV252 AAACGACCAACCAAATGCAAACACAAATTC
ATCG
Alanine substitution of
amino acid R26 by site
direct mutagenesis based
on pET28c-P9-1.
R PV253 CGATGAATTTGTGTTTGCATTTGGTTGGTCGT
TT
pET28c-P9-1-Bind4m F PV306 CTCAATCTACTGAAAATGCTCTTTCAACCAA Alanine substitution of
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
26
GAA amino acid R39 by site
direct mutagenesis based
on pET28c-P9-1.
R PV307 TTCTTGGTTGAAAGAGCATTTTCAGTAGATT
GAG
pET28c-P9-1-Bind5m F PV308 AATCGTCTTTCAACCGCAAAAATCCCCCTAC
TCG
Alanine substitution of
amino acid K43 by site
direct mutagenesis based
on pET28c-P9-1.
R PV309 CGAGTAGGGGGATTTTTGCGGTTGAAAGAC
GATT
pET28c-P9-1-Bind6m F PV310 CGTCTTTCAACCAAGGCGATCCCCCTACTCG
ATG
Alanine substitution of
amino acid K44 by site
direct mutagenesis based
on pET28c-P9-1.
R PV311 CATCGAGTAGGGGGATCGCCTTGGTTGAAAG
ACG
pET28c-P9-1-Bind7m F PV407 CGTCTTTCAACCGCAGCGATCCCCCTACTCG
AT
Alanine substitution of
amino acid residues K43
and K44 by site direct
mutagenesis based on
pET28c-P9-1.
R PV408 ATCGAGTAGGGGGATCGCTGCGGTTGAAAG
ACG
pET28c-P9-1-Bind8m F PV254 CTCAATCTACTGAAAATGCGCTTTCAACCGC
GGCAATCCCCCTACTCGATG
Alanine substitution of
amino acid residues R39,
K43 and K44 by site
direct mutagenesis based
on pET28c-P9-1.
R PV255 CATCGAGTAGGGGGATTGCCGCGGTTGAAA
GCGCATTTTCAGTAGATTGAG
pET28c-P9-1-Bind9m F PV252 AAACGACCAACCAAATGCAAACACAAATTC
ATCG
Alanine substitution of
amino acid residues R26,
R39, K43 and K44 by site
direct mutagenesis based
on pET28c-P9-1-Bind8m.
R PV253 CGATGAATTTGTGTTTGCATTTGGTTGGTCGT
TT
pET28c-P9-1ǻC23-Bind
9m
F XT420 CGGGATCCCGATGGCAGACCAAGAGCGGAG To amplify
P9-1ǻC23-Bind9m and
clone into pET28c. R XT939 CCGCTCGAGTCAGAATTTACGATATCTCTTG
BamH I site is underlined ; Xho I site is in bold; Nde I site is both underlined and in bold; Spe I site 755
is in italics; T7 promoter is in small letters and underlined. 756
757
758
759
760
761
762
763
764
765
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
27
Figure Legends 766
FIG. 1. Purification and RNA binding activity of RBSDV P9-1. (A) Expression and 767
purification of the P9-1 protein. Purified protein was separated by 10% SDS-PAGE 768
and visualized by either Coomassie blue staining (left, 10 µg P9-1 protein) or by 769
Western blot (right, 100 ng P9-1). The blot was probed with 6xHis rabbit antiserum 770
(1:1,000 dilution). (B) RNA-binding activity of RBSDV P9-1. DIG-labeled 771
full-length RNA transcript of RBSDV S9 (20 ng, 3.1 nmol) was incubated in the 772
absence (lane 1) or the presence (lane 2) of purified P9-1 protein (2 µg, 4.6 µmol) or 773
BSA (2 µg, 2.88 µmol) (lane 4). For lane 3, 50 ng of proteinase K was added after 774
incubation of P9-1 with the probe, and the sample was incubated for 10 min at room 775
temperature. Probe–protein complexes were separated by electrophoresis on a 1% 776
agarose gel and the blot was detected by anti-DIG AP-linked monoclonal antibody 777
(1:10,000 dilution). 778
779
FIG. 2. Competition and specificity assays for P9-1. (A) Increasing amounts of 780
unlabeled competitor ssRNA, dsRNA, ssDNA, or dsDNA were mixed with 3.1 nmol 781
DIG-labeled S9 ssRNA (1,900 nt); 4.6 µmol of purified P9-1 was added to each 782
sample, and the sample was incubated for 10 min at room temperature. Samples were 783
subjected to electrophoresis and visualized as described in Fig. 1B. (B) The assay was 784
performed as described in panel A except the unlabeled competitor ssRNAs were 785
from RBSDV S9 and RSV S4. For one set of samples, P9-1 protein was added to the 786
DIG-labeled RNA before addition of competitor S9 ssRNA. Each data point 787
represents the mean from three experiments, and error bars represent the standard 788
deviation of the mean. 789
790
FIG. 3. Formation of gradually shifted, higher-order complexes by P9-1 and RNA. (A) 791
Increasing amounts of P9-1 were incubated with 3.1 nmol DIG-labeled RBSDV 792
S9-1900 nt ssRNA. The complexes were resolved by electrophoresis on a 1% agarose 793
gel, and blots were visualized using anti-DIG antibody. (B) Gel mobility shift assays 794
were performed as described in panel A except the DIG-labeled ssRNA was a 150-nt 795
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
28
ssRNA from the 5′ terminus of RBSDV S9 (39 nmol). The positions of unbound (free) 796
probe and gradually shifted, higher-order complexes are indicated. 797
798
FIG. 4. P9-1 protein preferentially binds to ssRNA as an octamer. (A) Oligomeric 799
formation analysis of P9-1 in discontinuous blue native PAGE. Purified P9-1 protein 800
(80 µg) was applied to a 4–16% polyacrylamide gradient gel; 10 µg of GAPDH was 801
loaded as a size marker (M). Dimer, tetramer, and octamer positions are indicated. (B 802
and C) Size exclusion chromatography analysis of oligomeric formation of 803
pET28c-P9-1 (B) and pXT99-P9-1 (C). Each purified protein (1 mL of 10 mg/mL) 804
was loaded on the Superdex 200 pg column. (D) Discontinuous blue native PAGE 805
analysis of oligomeric formation of pET28c-P9-1, pXT99-P9-1 and free tag P9-1. 806
pET28c-P9-1 and pXT99-P9-1 expressed the His-tag P9-1 containing 34 and 21 807
amino acids, respectively, at its N-terminus. The positions of the dimer, tetramer, and 808
octamer are indicated. (E) Dimer step binding model to describe the formation of the 809
P9-1::RNA complex. More than one unit of viroplasm protein can bind each molecule 810
of RNA. Each binding unit of P9-1 is likely to be a dimer of this protein. The step 811
binding of the dimer results in the maximum number of protein units (octamer) 812
binding to RNA molecules to form the saturated complex. (F) Preference analysis of 813
different oligomers of P9-1 that bind to ssRNA using discontinuous blue native PAGE. 814
Increasing amounts of 150-nt ssRNA were incubated with fixed amount of P9-1 815
(11.48 µmol), and the complexes were resolved using a 4–16% polyacrylamide 816
gradient gel. (G) Octamer binding model for the formation of the P9-1::RNA complex. 817
In this model, the octamer preferentially binds to ssRNA. With increasing amounts of 818
P9-1, more and more P9-1 octamers bind to the unoccupied spaces of the ssRNA, 819
until they become saturated. 820
821
FIG. 5. P9-1 C-terminal-arm deletion mutants no longer form an octamer and bind to 822
ssRNA with lower affinity. (A) Visualization of C-terminal arm on the crystal 823
structure of the P9-1 dimer. The C-terminal 23 amino acids are labeled in blue on the 824
P9-1 dimer. (B) Visualization of the C-terminal arm on the crystal structure of the 825
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
29
P9-1 octamer. Each dimer is depicted in one of four colors. The C-terminal arm is 826
indicated by rectangle. The C-terminal arm formed by each dimer interacts with the 827
adjoining dimer, each holding the other at the “shoulder”, to form an octamer. (C) 828
Construct map of the RBSDV P9-1 wild type and the two C-terminal deletion mutants. 829
P9-1, wild-type P9-1; P9-1ǻC9
, deletion of the last 9 amino acids of the C terminus 830
(delta aa 339-347); P9-1ǻC23
, deletion of the last 23 amino acids of the C terminus 831
(delta aa 325-347). The blue box depicts the C-terminal arm of P9-1 on the construct 832
map. (D) Oligomeric formation analysis of the C-terminal deletion mutants in 833
discontinuous blue native PAGE; Eighty microgram of protein was loaded in each 834
lane, wild-type P9-1 was loaded as a positive control. The positions of the monomer, 835
dimer, tetramer, and octamer are indicated. (E and F) Gel-retardation analysis for 836
RNA-binding capacities of P9-1ǻC9
and P9-1ǻC23
deletion mutants. Increasing amounts 837
of P9-1ǻC9
or P9-1ǻC23
were incubated with 3.1 nmol S9-1900 nt ssRNA, and mixtures 838
were applied to a 1% agarose gel. Wild-type P9-1 was loaded on the same gel as a 839
positive control. The blots were probed as described in Fig. 1B. 840
841
FIG. 6. RNA binding analysis of P9-1 C-terminal-arm deletion mutants by salt 842
competition and blue native PAGE. (A) EMSA analysis for RNA-binding capacities 843
of P9-1ǻC9
and P9-1ǻC23
deletion mutants by salt competition. Increasing amounts of 844
P9-1ǻC9
or P9-1ǻC23
were incubated with 3.1 nmol S9-1900 nt ssRNA in the presence 845
of 200 mM NaCl, and the mixtures were applied to a 1% agarose gel. (B and C) RNA 846
binding analysis of dimer and tetramer species of P9-1ǻC9
(B) and P9-1ǻC23
(C) 847
deletion mutants in the discontinuous blue native PAGE. A fixed amount of P9-1ǻC9
848
or P9-1ǻC23
(11.48 µmol) was incubated with increasing amounts of 150 nt ssRNA, 849
and the complexes were resolved using a 4–16% polyacrylamide gradient gel. 850
851
FIG. 7. The major RNA binding sites map to the central interior structure formed by 852
the octamer of P9-1. (A) Construct map of P9-1 RNA binding mutants. Amino acids 853
25–44 and 319–327 were predicted to be possible RNA binding sites by the BindN 854
software. In Bind1m and Bind2m mutants, amino acid residues 25–44 and 319–327, 855
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
30
respectively, were all mutated to alanines. The blue box depicts residues 25–44 and 856
the green box depicts residues 319–327 on the construct map. (B) Oligomeric 857
formation analysis of RNA binding mutants using discontinuous blue native PAGE; 858
Eighty microgram of protein was loaded in each lane, wild-type P9-1 was loaded as a 859
control. The positions of the dimer, tetramer and octamer are indicated. (C and D) 860
RNA-binding activity of P9-1 Bind1m and Bind2m mutants by gel mobility shift 861
assay. Increasing amounts of Bind1m or Bind2m mutants were incubated with 3.1 862
nmol S9-1900 nt ssRNA, and mixtures were separated on a 1% agarose gel wth 863
wild-type P9-1 loaded as a positive control. The blots were probed as described as in 864
Fig. 1B. (E) Mapping amino acid residues 25–44 and 319–327 onto the crystal 865
structure of P9-1 dimer. (F) Visualization of amino acids 25–44 on the crystal 866
structure of the P9-1 octamer. Amino acid residues 21–41 were disordered in the 867
crystal structure of P9-1, so the flanking amino acids of this region (aa 20, 42–44; 868
KTKK) were mapped onto the crystal structure and labeled in cyan. Amino acid 869
residues 319–327 are labeled in green. 870
871
FIG. 8. Eletropositive amino acids among the residues 25–44 are important for RNA 872
binding. (A) Alanine scanning mutagenesis on the positively charged amino acids 873
among residues 25–44. Bind3m, Bind4m, Bind5m and Bind6m represent, respectively, 874
the single alanine substitution mutant of R26A, R39A, K43A and K44A. Bind7m, 875
Bind8m and Bind9m refer, respectively, to the double (K43A-K44A), triple 876
(R39A-K43A-K44A) and quadruple alanine substitution mutant. (B) RNA-binding 877
activity analysis of P9-1 alanine scanning mutants by gel mobility shift assay. 878
S9-1900 nt ssRNA (3.1 nmol) was incubated with 0.74 or 2.94 µmol of each alanine 879
scanning mutant, and mixtures were applied to a 1% agarose gel. The results from the 880
gel-retardation analysis are to the right of each mutagenesis in panel A; ++++ to + 881
indicates the RNA binding level, from strong to weaker, for the mutants. (C and E) 882
Oligomeric formation analysis of alanine scanning mutants (C) and P9-1ǻC23
883
quadruple alanine substitution mutant (P9-1ǻC23
-Bind9m) (E) using discontinuous 884
blue native PAGE. Fifty microgram of protein was loaded in each lane. The positions 885
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
31
of the dimer, tetramer and octamer are indicated. (D) Gel-retardation analysis for 886
RNA-binding capacities of P9-1ǻC23
quadruple alanine substitution mutant 887
(P9-1ǻC23
-Bind9m). Increasing amounts of P9-1ǻC23
-Bind9m mutant were incubated 888
with 3.1 nmol S9-1900 nt ssRNA, and mixtures were applied to a 1% agarose gel, 889
with P9-1ǻC23
as a positive control. The blots were probed as described in Fig. 1B. 890
891
on May 16, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from