Contents lists available at ScienceDirect

Veterinary Parasitology: Regional Studies and Reports

journal homepage: www.elsevier.com/locate/vprsr

Original article

Molecular evidence of the reservoir competence of water buffalo (Bubalusbubalis) for Anaplasma marginale in Cuba

Dasiel Obregóna,b,⁎, Belkis G. Coronab, José de la Fuentec,d, Alejandro Cabezas-Cruze,Luiz Ricardo Gonçalvesf, Carlos Antonio Matosf, Yasmani Armasa, Yoandri Hinojosab,Pastor Alfonsob, Márcia C.S. Oliveirag, Rosangela Z. Machadof

aUniversidad Agraria de La Habana, Carretera Tapaste y Autopista Nacional, CP 32700, Apartado Postal 18-19, San José de Las Lajas, Mayabeque, Cubab Centro Nacional de Sanidad Agropecuaria, Carretera de Jamaica y Autopista Nacional, CP 32700, Apartado Postal 10, San José de Las Lajas, Mayabeque, Cubac SaBio, Instituto de Investigación en Recursos Cinegéticos IREC (CSIC-UCLM-JCCM), 13005 Ciudad Real, Spaind Department of Veterinary Pathobiology, Center for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK 74078, USAeUMR BIPAR, INRA, ANSES, Ecole Nationale Vétérinaire d'Alfort, Université Paris-Est, Maisons-Alfort 94700, FrancefUniversidade Estadual Paulista, Campus de Jaboticabal, Via de Acesso Prof. Paulo Donato Castellane, S/N - Vila Industrial, 14884-900 Jaboticabal, São Paulo, Brazilg Embrapa Pecuária Sudeste, Rodovia Washington Luiz, km 234, CEP 13560-970 São Carlos, São Paulo, Brazil

A R T I C L E I N F O

Keywords:Water buffaloCattleA. marginaleRickettsemiaGenetic diversityCross-transmission

A B S T R A C T

Water buffalo (Bubalus bubalis) is a potential reservoir for Anaplasma marginale in livestock ecosystems of tropicalcountries. However, their participation in the epidemiological process of bovine anaplasmosis in endemic areasremains unclear. In the present study, the reservoir competence of water buffalo for A. marginale was explored byfocusing on the analysis of rickettsemia levels in carrier animals, and the genetic characterization of A. marginalestrains from cattle and buffalo. Eight groups of cattle and water buffaloes were randomly selected from coha-biting herds in four livestock ecosystems of Cuba, together with two control groups from unrelated cattle andbuffalo herds. A total of 180 adult animals (88 water buffalo and 92 cattle) were sampled. Rickettsemia in carrieranimals was determined by quantitative real-time PCR. The rickettsemia (parasitemia) levels in cattle werehigher than in buffaloes, however the rickettsemia in buffalo may be enough to infect R. microplus ticks. Thegenetic diversity of A. marginale was assessed by strain characterization and phylogenetic analysis of 27 msp1αgene sequences. The results showed genetic similarity among strains from cattle and water buffalo, suggestingthe occurrence of cross-species transmission.

1. Introduction

Anaplasma marginale (Rickettsiales: Anaplasmataceae) is the etio-logical agent of bovine anaplasmosis, a hemolytic disease that affectsboth dairy and beef industries, representing a major constraint to cattleproduction in tropical and subtropical regions of the world (OIE, 2015).Cattle of all breeds and ages can be infected by A. marginale; however,the severity of the disease depends on age, nutritional status, andmanagement (Aubry and Geale, 2011). The Giemsa-stained bloodsmear is a conventional diagnosis method in clinically infected animals.However, carrier animals have low levels of rickettsemia ranging be-tween 103 and 107 infected erythrocytes/ml blood (IE/ml) (Brown andBarbet, 2016). Such levels are undetectable by blood smear, posing achallenge to the direct diagnosis that currently requires PCR assays.Notably, carrier animals are the main infection source for competentvectors in endemics areas (Aubry and Geale, 2011).

Although cattle are the natural hosts for A. marginale, this rickettsiais a multi-host pathogen that can infect several ruminant species, in-cluding water buffalo (Bubalus bubalis) and other wild animals such asAmerican bison (Bison bison), white-tailed deer (Odocoileus virginianus),black-tailed deer (O. hemionus culumbianus), mule deer (O. h. hemionus)and other cervids (Kocan et al., 2010), being even found in non-rumi-nants (Guillemi et al., 2016). These species only have been regarded ascarrier host of A. marginale (Kuttler, 1984; Kocan et al., 2010). How-ever, there are no substantiating field studies that demonstrate thetransmission of A. marginale between cattle and wild ruminants, whichmight be incidental hosts, unable to maintain a transmit the pathogen(reservoir competence) (Aubry and Geale, 2011; Kocan et al., 2015).

The reservoir of a multi-host pathogen can be one or more epide-miologically connected populations in which the pathogen persists andfrom which it is transmitted to the target population (Haydon et al.,2002). Under this approach, cattle and other species could form the

https://doi.org/10.1016/j.vprsr.2018.06.007Received 25 May 2017; Received in revised form 18 June 2018; Accepted 22 June 2018

⁎ Corresponding author.E-mail address: dasiel@usp.br (D. Obregón).

Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

Available online 23 June 20182405-9390/ © 2018 Elsevier B.V. All rights reserved.

T

reservoir of A. marginale in a given endemic region, depending on thereservoir competence of such species. For vector-borne pathogens, fourfactors determine the reservoir competence of a host: 1) the probabilitythat a host acquires the infection when bitten by an infected vector; 2)the ability of the pathogen to magnify and persist in the host; 3) theprobability that a vector acquires the pathogen from an infected host(host infectiousness); 4) the host ability to sustain vector populations(LoGiudice et al., 2003; Cronin et al., 2010).

The water buffaloes are robust and easily adapt to the tropicalconditions, which are characterized by poor pastures and high tem-perature and humidity. Further, water buffaloes are more resistant tomany infectious and parasitic diseases, constituting an alternative tocattle livestock. Consequently, this species is in expansion in LatinAmerica and the Caribbean countries (FAO, 2014). In this region, it iscommon that buffalo and cattle cohabit in the same livestock ecosys-tems, which turns buffaloes into potential reservoirs of A. marginale.Yet, to our knowledge, there is no scientific evidence on the occurrenceof cross-species transmission. In addition, a few studies have analyzedthe infection prevalence of A. marginale in buffalo herds, and thesestudies generally found low prevalence rates, even in endemic areas(Khan et al., 2004; Rajput et al., 2005; Silva et al., 2014a).

Recently, a molecular survey carried out in Brazil by Silva et al.(2014b), using the gene msp1α as genetic marker, found strains of A.marginale infecting buffaloes which were genetically related withstrains previously reported from cattle in nearby areas. However, de-spite the clear suggestions of cross-transmission, this finding wasreached in a randomized study that did not include any bovine popu-lation, and epidemiological links (i.e., spatial distance, common ex-posure to vectors, cattle movements and within-herd contacts) betweencattle and buffalo herds were not considered. Consequently, new stu-dies on the subject should deepen the significance and patterns of suchepidemiological relationships. In this regard, the genetic and/or anti-genic characterization of strains in different host populations is cur-rently the most powerful tool to identify components in the reservoirstructure of a certain pathogen (Haydon et al., 2002; Viana et al.,2014).

MSP1 is a heterodimer composed of two structurally unrelatedproteins: MSP1a which is encoded by a single gene msp1α, and MSP1bwhich is encoded by members of the msp1β multigene family(Camacho-Nuez et al., 2000). The msp1β is a sensitive and specifictarget for detection of A. marginale, which has been used for diagnosticsin nested PCR (nPCR) (Molad et al., 2006) and quantitative real-timePCR (qPCR) assays (Carelli et al., 2007; Decaro et al., 2008). Of thesetwo PCR approaches, qPCR was shown to be the most appropriate assayfor detection of A. marginale in blood samples from cattle (Chaisi et al.,2017). The gene msp1α is associated with tick transmission fitness andplasticity to infect multiple host species, evolving under immune se-lection pressure, making it a good predictor of the genetic diversity in arestricted geographical area (de la Fuente et al., 2007a; Estrada-Peñaet al., 2009). The strains of A. marginale can be identified by differencesin the molecular weight of MSP1a because of the variable number of20–31 amino acid serine-rich tandem repeats (TR) located in the N-terminal region of the protein (Cabezas-Cruz et al., 2013).

In Cuba, the bovine anaplasmosis had a high incidence and mor-tality in adult cattle in the 80s (Corona et al., 2005). Subsequently, theepidemiological situation evolved to endemic stability characterized byannual average rates of 200 outbreaks and 0.03% of incidence duringthe last 25 years (LNP, 2014). Concurrently, the bubaline species wasintroduced and widespread throughout the country during this period,occupying farms generally close to cattle herds (Mitat, 2009). Pre-liminary studies in the Western regions found buffaloes infested by R.microplus (Obregón et al., 2010), and also infected by A. marginale(Corona et al., 2012). To determine the contribution of water buffalo tothe epidemiological process of anaplasmosis will contribute to thesurveillance program of this disease in Cuba.

This work aims to explore the reservoir competence of water

buffaloes for A. marginale in endemic areas from Cuba. Particularly, weaddressed two questions: the host competence, through the analysis ofrickettsemia levels in carrier animals, and the occurrence of cross-spe-cies transmission, in cattle and water buffalo herds cohabiting in con-tiguous grazing areas.

2. Materials and methods

2.1. Study site and sample collection

A cohort study was conducted in livestock areas of Habana andMayabeque provinces, Cuba. The climate of the region is tropical,seasonally humid, with an annual average of temperature between 22and 28 °C, and a relative humidity of 80% (INSMET, 2016). In theseprovinces, R. microplus is the only tick diagnosed in cattle, which ismaintained throughout the year with population increases during thedry season (December–March) (LNP, 2014). Mechanical vectors asstable flies (Stomoxys calcitrans) and some tabanid species (Diptera:Tabanidae) may be present, however they are of little importance in thetransmission of A. marginale in the region (Alonso et al., 1992), al-though there are no in-depth studies on this topic in Cuba.

Four farms were randomly selected. In these farms, both cattle andwater buffalo herds coexist together in contiguous grazing areas in-fested with ticks. The geographical areas of sample collection weredivided in “ecosystems” and nominated as “I”, “II, “III” and “IV”(Fig. 1). Herds with only cattle or only buffaloes were included ascontrol groups (Fig. 1) and they belonged to farms 5 km away from theherds in ecosystems “I”, “II, “III” and “IV” as well as any other popu-lation of cattle or buffaloes respectively. In each ecosystem, 20 cattleand 20 buffaloes were randomly selected, however, in “II” only nineand 11 samples of each species were included, respectively. In total, theanimals sampled were 180 (88 buffalo and 92 cattle). Only adult ani-mals (≥ 2 years) were included in this study. During the study period,there were no clinical cases of anaplasmosis or animal introductions inany of the selected herds.

The blood samples were obtained by puncturing the jugular vein,collected in 4mL vacutainer tubes containing K2 EDTA (BDVacutainer), and kept frozen at −80 °C in cryovials until processing.DNA was extracted from 200 μL of thawed blood using DNeasy® Bloodand Tissue DNA Purification Kit (Qiagen, USA). The DNA samples wereexamined (concentration and purity) using a NanodropSpectrophotometer 1000 v.3.5 (Thermo Fisher Scientific, USA) andstored at −20 °C.

2.2. Molecular detection and quantification

The TaqMan-based real-time PCR assay based on the amplificationof a 95 bp sequence from msp1β gene was used, as described by Carelliet al. (2007) with modifications. Briefly, the qPCR reactions were car-ried out in 10 μL containing 5 μL of (2×) TaqMan® Gene ExpressionMaster Mix (Qiagen, USA), 0.5 μL of forward and reverse primers(10 μM), 0.2 μL of TaqMan probe (10 μM), 1 μL of DNA template andnuclease-free water (Qiagen, USA). The amplifications were performedin a CFX96 Thermal Cycler (BioRad, USA), starting in 95 °C for 10min,followed by 40 cycles at 95 °C for 15 s and 60 °C for 1min. All sampleswere tested in duplicate, and no-template reactions (NTC) were in-cluded in each trial as contamination control.

The quantification of the copy number of DNA target sequence (CN)was performed using the IDT pSMART plasmids (Integrated DNATechnologies, USA) containing the target DNA sequence. Ten-fold serialdilutions from 2×107 CN μL−1 to 2× 100 CN μL−1 were made toobtain a standard curve. The copy number in the standard dilutions (CNμL−1) was estimated according to the formula: CN=Conc. (g μL−1) xNA / MW (gmol−1), where: NA -Avogadro constant (6.022× 1023 copymol−1), MW- molecular weight of the nucleotide pair (660) multipliedby the plasmid size (bp).

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

181

On each qPCR positive sample, the CN was estimated according totheir quantification cycle (Cq). Subsequently, the number of rickettsiaper mL of blood was estimated with the formula described by Ros-García et al. (2012) with modifications: P = CN (VB/VEX) (VEL/VT) (1/GCN); where: P- rickettsia ml−1, VB- reference blood volume (1mL),VEX- blood volume for DNA extraction (200 μL), VEL=DNA elutionvolume (100 μL), VT- DNA in the qPCR reaction (1 μL) and GCN-genecopy number. Five gene-copies of msp1β were considered (Rodríguezet al., 2009).

Afterwards, the rickettsemia level or percent of infected ery-throcytes per milliliters of blood (iRBC) was estimated according to theformula: iRBC (%)=P/(RI × RBC) × 100, where: RI- internal rick-ettsia number and RBC- Number of erythrocytes per ml of blood. RIvalue was set in six, considering an inclusion body (IB) by erythrocyteand six initial corpuscles by IB, and the RBC count according the re-ference values of each host species, at 7.06 ± 0.07×106 RBC μL−1

(Wills, 2010) and 6.70 ± 0.08× 106 E μL−1 in cattle (Wood andQuiroz-Rocha, 2010).

2.3. Amplification of msp1α gene

For msp1α gene amplification, 27 positive samples with high valuesof DNA copy number (CN uL−1) were selected, being 13 cattle and 15water buffalo from all the ecosystems studied. The primers 1733F (5′TGTGCTTATGGCAGACATTTCC 3′), 3134R (5′ TCACGGTCAAAACCTTTGCTTACC 3′), and 2957R (5′ AAACCTTGTAGCCCCAACTTATCC 3′)were used to amplify the msp1α gene by semi-nested PCR, as previouslyreported (Lew et al., 2002).

In both steps (PCR and nPCR), reactions were carried out in 20 μL,with 10 μL of Taq PCR Master Mix Kit (2×) (2.5 U Taq DNA poly-merase, 1× buffer, 200 μM dNTPs, 1.5mM MgCl2) (Qiagen, USA),0.5 μL of each primer (10 μM) and nuclease-free water (Promega). Twomicroliters of DNA template were used in the PCR step and 1 μL of PCRproduct in nPCR. The same PCR cycling program was used in bothstages, with an initial denaturation at 94 °C for 4min, followed by39 cycles of 94 °C for 45 s, 59 °C for 1min and 72 °C for 2min, with a

final extension step at 72 °C for 7min. The amplified fragments werevisualized by electrophoresis on a 1% agarose gel (Sigma, USA) in TBE(1×) containing ethidium bromide (0.015%).

2.3.1. SequencingThe amplicons were purified directly from the PCR product by using

Silica Bead DNA Gel Extraction Kit (Thermo Fisher Scientific, USA), andsequenced with Big Dye Terminator Cycle Sequencing Ready Reaction(Perkin-Elmer Applied Biosystems, USA) in a sequencer ABI PRISM3700 DNA Analyzer (Applied Biosystems, USA).

The sequences were assembled with the software Sequencher v.4.8(Gene Codes Corporation, USA). The nucleotide sequences were de-posited in GenBank at NCBI. Theoretical translation of nucleotide se-quences into amino acid sequences using online bioinformatics tools,available on the ExPASy molecular biology server (http://www.expasy.org), and the protein sequences were aligned using the Clustal W, in-cluded in the package BioEdit v.7.0.0 (Tom Hall Ibis Biosciences, USA).

2.3.2. Strain classificationThe strain classification was made according to Cabezas-Cruz et al.

(2013), including microsatellite (genotype)-structure of tandem repeat,and identified as GenBank Id /host/locality. Microsatellite genotypingwas due to 5′-UTR microsatellite located between the putative Shine-Dalgarno (SD) sequence (GTAGG) and the translation initiation codon(ATG), with the typical sequence GTAGG (G/A TTT)m (GT)n T ATG(bold letters) (Estrada-Peña et al., 2009). The SD-ATG distance wascalculated in nucleotides as (4 × m)+ (2 x n) +1, and genotypesidentified by letters A – K according to Cabezas-Cruz et al. (2013).

The MSP1a sequences were analyzed and classified by the TR se-quence and number following the nomenclature proposed by de laFuente et al. (2007a, 2007b) and>230 TR- known from all over theworld (Cabezas-Cruz et al., 2013; Ybañez et al., 2014; Castañeda-Ortizet al., 2015).

2.3.3. Phylogenetic analysisThe phylogenetic analysis was conducted with all MSP1a amino

Fig. 1. Geographical location of sampling areas (ecosystems) where blood samples from cattle and water buffalo were collected. These ecosystems are representativeof several livestock areas of the country, in which both species coexist in nearby areas, sharing grazing areas, and therefore exposed to the same tick vectorpopulations. Cattle and buffalo indicate the control groups.

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

182

acid sequences, including other 25 sequences from GenBank, fromcattle in Cuba (GenBank accession numbers: KT732269; KT732269;AY489564), USA (AY127055; AY127058; AY010242; AY010245;AY127052; M32871), Mexico (AF345870; AF345869), Argentina(DQ833257; DQ833258), South Africa (DQ813551; DQ813553), Israel(AY846868; AY355284) and Australia (AF407543; AF407544), andfrom water buffalo in Brazil (KJ575600; KJ575588; KJ626201;KJ626200) and bison in USA (AY253144) and Canada (AY253141),respectively. These sequences were selected from around 500 strains(MSP1a) available in the GenBank. They represent the greatest geneticdiversity and geographic distribution.

The sequences were aligned with MAFFT v.7 (Katoh and Standley,2013) using the following settings and parameters: Strategy L-INS-i(recommended for< 200 sequences with one conserved domain andlong gaps) (Katoh et al., 2005); scoring matrix for nucleotide sequences,200PAM/k = 2; gap opening penalty, 1.53; offset value, 0.00 and maxiterate, 1000. The best-fit model of sequence evolution was selectedbased on Corrected Akaike Information Criterion (cAIC) and BayesianInformation Criterion (BIC) as implemented in Molecular EvolutionaryGenetics Analysis (MEGA) v.6.00 (Tamura et al., 2013). The JTT (Joneset al., 1992) model of amino acid evolution, which had the lowest va-lues of cAIC and BIC, was chosen for tree reconstruction.

The Phylogenetic tree was reconstructed using the maximum like-lihood (ML) method as implemented in MEGA. Reliability of internalbranches was assessed using the bootstrapping method (1000 re-plicates) and approximate likelihood ratio test (aLRT–SH-Like)(Anisimova and Gascuel, 2006). Graphical representation and editing ofthe phylogenetic trees were performed with MEGA. The clusters weredifferentiated in four groups, according to the predominant TR.

2.4. Statistical analysis

The Fischer's exact tests, with a confidence level (CL) of 95%, wereused to compare the frequency of carrier animals (qPCR-positive) bygroups. The Bonferroni's multiple comparisons test was used to com-pare the mean of the DNA copy number values (LogCN) between host-species groups across ecosystems, afterward a non-repeated measurestwo-way ANOVA with subsequent post-hoc Tukey's HSD test (CL. 95%)were used to determine the effects of host species and origin (ecosys-tems) on the A. marginale DNA CN in carrier host. The parasitemia le-vels were compared between host species using the two-tailed Student'st-test, p < 0.05 was considered significant. All analyses were madeusing Prism GraphPad v. 5.01. (GraphPad Software Inc., USA).

3. Results

3.1. Parasitemia of A. marginale in cattle and buffaloes

Prevalence rates (qPCR-positive) of A. marginale in cattle and waterbuffalo groups are shown in Table 1. The frequency of infected animalswas higher in cattle in all ecosystems, except in II (F=11.3; p < 0.05).The patterns of infection prevalence were different between host spe-cies over the ecosystems. Prevalence of A. marginale in cattle was above90% in all ecosystems but II, whereas in buffalo it was relatively low in Iand IV. Thus, the prevalence of A. marginale in buffaloes seems to bemore dependent on environmental factors and/or management condi-tions in each farm.

In the control groups, the difference in prevalence was not sig-nificant, which suggests that the infection prevalence in buffalo herdsdoes not depend on the immediate proximity to bovine herds. In ad-dition,> 50% of the water buffaloes were positive, suggesting thatthere is a high prevalence of A. marginale in buffalo herds in the studiedregions, matching with the findings of Corona et al. (2012).

Cattle presented higher levels of A. marginale DNA copy numberthan water buffaloes in all ecosystems (Fig. 2a). Consequently, sig-nificant differences in the DNA CN values were associated to host

species (F=118.68; p < 0. 05) and the ecosystems (F=9.25; p < 0.05), as well as to the interaction between these factors (F=8.82;p < 0. 05), hence the host species was the most influential factor onthe total variance of the A. margianle DNA copy number, with 30.49%of contribution, when compared to ecosystems (9.50%) and the bothfactors interaction (9.06).

Based on these values of DNA copy number, the rickettsemia in eachhost was estimated, resulting in average value of1.52×10−2 ± 2.25×10−2% iRBC in cattle, and ranged between5.69×10−6 and 9.26× 10−2% iRBC, whereas the average value was1.48×10−4 ± 2.99×10−4% iRBC in buffaloes, ranging between3.80×10−7 and 1.10×10−3% iRBC (Fig. 2b). Therefore, carrierbuffaloes showed lower rickettsemia levels than carrier cattle(t=3.951; p < 0. 05).

3.2. Classification of A. marginale strains using msp1α sequence data

The amplicons of msp1α gene showed molecular weights between600 and 1000 bp, corresponding with typical polymorphic changesdescribed in MSP1a protein by variation in the number of TR (Cabezas-Cruz et al., 2013). The 27 sequences obtained were deposited in Gen-Bank under accession numbers KT121538 - KT121564.

The A. marginale strains were firstly classified using the msp1α mi-crosatellite (Cabezas-Cruz et al., 2013; Estrada-Peña et al., 2009). Onlythe genotypes (microsatellites) G, C, H, and D were found (Table 2), andthe most frequent was genotype G followed by genotype C, in bothcattle and water buffaloes. The genotypes H and D were only found inbuffaloes from ecosystem III and in cattle from ecosystems IV, respec-tively.

Regarding the structure of MSP1a, 16 previously reported TRs (T, B,M, C, F, Ѳ, γ, α, β, 27, 13, 14, N, 78, 15, and 46) were found, and theywere present in strains from cattle and buffalo. In addition, four new TRsequences were found and were identified as Cub1-4 (Table 3), of whichthe Cu1 was found in a strain from buffaloes and all the others on cattle,specifically Cu2 was found in three strains from two ecosystems.

According to the MSP1a protein sequences analysis, 14 types of TRsequences were found to be repeated between one and six times, as-sociated with one genotype in each case (Table 4). Regarding the dis-tribution of strains by host species, eight strains found in cattle and sixin buffalo included T-B-C-F which was found in both cattle and buffa-loes (Table 4). Interestingly, T-B-C-F was found in buffalo and cattle indifferent ecosystems, so it may exist other ecological factors underlyingthe distribution of this hemoparasite, regardless of between-herds clo-seness. In addition, several strains were found in the same herd, sug-gesting a wide genetic diversity among A. marginale strains on thestudied region, including cattle and buffalo herds.

Table 1Prevalence of A. marginale infection in cattle and water buffaloes of Cuba basedon qPCR.

Ecosystems Host species n qPCR-positive (%)⁎

I Buffalo 20 4 (20)cCattle 20 20 (100)a

II Buffalo 9 8 (89)abCattle 11 4 (36)c

III Buffalo 20 13 (65)bCattle 20 19 (95)ab

IV Buffalo 20 3 (15)cCattle 20 20 (100)a

Control Buffalo 19 18 (95)abCattle 21 21 (100)a

Total Buffalo 88 46 (52)Cattle 92 85 (92)

⁎ Different letters indicate values significantly different between groups.

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

183

3.3. Phylogenetic relationship between A. marginale strains from buffaloesand cattle

The outcome of the phylogenetic analysis with MSP1a sequences isshown in Fig. 3. Forty-eight percent of the strains were grouped into alarge cluster TB, which included all the reference sequences from NorthAmerica and 50% of the strains from this work. Furthermore, the strainsfrom buffaloes and cattle cohabiting in the same ecosystems (I, II andIV) in Cuba clustered together. The cluster α-β only included strainsfrom water buffalo in this work; however, these strains showed simi-larity with strains from buffalo in Brazil and cattle in Mexico, respec-tively. The remaining strains from buffaloes in ecosystems III in thiswork were grouped in cluster FeN, and they were close to strains fromcattle in ecosystems I and distant from those from Israel.

4. Discussion

As expected, the water buffaloes showed lower infection prevalenceand lower parasitemia levels than cattle cohabiting in the same grazingareas. These results are indicative of a greater natural resistance to A.marginale in water buffaloes, considering the natural resistance as me-chanisms that reduce infection and/or pathogen multiplication in the

infected host (Woolhouse et al., 2002). The natural resistance in waterbuffaloes could also be related to their resistance to tick infestation.This fact is well understood in Bos taurus indicus cattle, which areequally susceptible to anaplasmosis as B. t. taurus but with a lower in-tensity of ticks infestation, and correspondingly, lower inoculation rateof tick-borne pathogens (Aubry and Geale, 2011). Similarly, the waterbuffaloes are resistant to R. microplus, characterized by low larval sur-vival rates in adult animals in which engorged females are uncommon(Obregón et al., 2010; Benitez et al., 2012).

According to Miller et al. (2014), the transmission dynamics ofvector-borne pathogens in a multi-host system is influenced by thecontribution of hosts with different parasitemia levels infecting vectors(host infectiousness profile). In this work, the parasitemia values foundin water buffaloes were close to 0.002%. These parasitemia levels are

Fig. 2. Infection levels of A. marginale in carrier cattle and water buffalo raised in contiguous areas. A. DNA copy number (LogCN μL−1) in both cattle and buffaloacross sampled sites (ecosystems), each bar represents the mean and standard error of group. *Statistical significance of differences between species in eachecosystem (p < .05). B. Parasitemia values estimated in carrier buffaloes and cattle, the line in the box is the median, and+ indicate the mean value in each group.*Statistical differences (p < .05).

Table 2Structure and occurrence of microsatellites (genotypes) in A. marginale strainsidentified in water buffaloes and cattle.

Genotype m (G/ATTT)

n (GT) SD-ATGdistance

Frequency In Buffaloes In Cattle

G 3 5 23 13(48%) 8 5C 2 5 19 7(26%) 3 4H 3 6 25 4(15%) 4 –D 2 7 23 3(11%) – 3

Table 3Sequences of novel MSP1a tandem repeats identified in A. marginale strainsfrom water buffaloes and cattle.

Identifier Amino acid sequences AA number Host

β⁎ TDSSSAGDQQQGSGVSSQSGQASTSSQLG 29 CattleCu2 ADSSSATGQQQESSVSSQSGQASTSSQLG 29 CattleCu3 ADSSSASGQQQESGVLSQSSQASTSSQLG 29 CattleCu4 ADSSSASGQQQESSVLSQSG-ASASSQLG 28 CattleCu1 ADSSSAGG————VLSQSGQASTSSQLG 23 Buffalo

⁎ Reference tandem repeat.

Table 4Classification of A. marginale strain based on tandem repeats (TR) in the MSP1aprotein from cattle and water buffaloes across farms (ecosystems) in WesternCuba.

No Ecosystem Hostspecies

Genotype TR structure Sample Id. GenBank Id.

1 I Buffalo G T-B-B-M 138 KT1215382 I Buffalo G T-B-B 52 KT1215453 I Buffalo G T-B-B 56 KT1215444 I Buffalo C Cu1-β-β-γ 64 KT1215435 I Cattle C Cu2-F-F-N 84 KT1215396 I Cattle C Cu2-F-F-N 75 KT1215427 I Cattle G B-B-C-F 76 KT1215618 I Cattle C M 79 KT1215419 II Buffalo G T-B-B-M 8 KT12156310 II Buffalo G T-B-B-M 1 KT12156411 II Buffalo G T-B-C-F 49.1 KT12154712 III Buffalo H α-β-γ 13.3 KT12155913 III Buffalo H α-β-γ 17.3 KT12155814 III Buffalo H α-β-γ 19.3 KT12155715 III Buffalo H α-β-γ 8.3 KT12156216 III Cattle C Cu2-F-F-N 30.3 KT12155617 IV Buffalo G T-B-B-M 13 KT12156018 IV Cattle G T-B-C-F 49 KT12154819 IV Cattle G T-B-C-F 40 KT12155220 IV Cattle D 78-78-Cu3-15 38 KT12155421 IV Cattle D 13-13 46 KT12155022 Control Buffalo C M-F-F-F-F-N 46.3 KT12154923 Control Buffalo C M-F-F-F-F-N 50.3 KT12154624 Control Buffalo G T-B-B 43.3 KT12155125 Control Cattle G 27-13-13-14 80.3 KT12154026 Control Cattle D 46-27-Cu4-14 39.3 KT12155327 Control Cattle G 13-13-Ѳ-Ѳ 36.3 KT121555

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

184

lower than typical parasitemia values in carrier cattle (0.01%) fromendemic areas (Scoles et al., 2005). However, 0.002% parasitemia maybe enough to infect R. microplus ticks. The lower parasitemia levels inbuffalo hosts can be amplified by within-vector multiplication of A.marginale in competent tick vectors. Within-vector multiplication canreach 104–106 organisms per salivary gland pair regardless of theparasitemia level of the vertebrate host (Scoles et al., 2008). Therefore,this finding suggests that, despite low parasitemia, the water buffaloescan be competent hosts of A. marginale.

The genetic similarity found among strains of A. marginale (MSP1a)from cattle and buffalo is strong evidence of cross-species transmission.Despite the fact that msp1α gene evolves under selection pressure fromboth host populations and ticks transmission fitness, their mutation rateis low and the TR structure remains the same in a given strain, pro-viding insight on the evolution of host-pathogen-vector interactions(Ruybal et al., 2009; Cabezas-Cruz et al., 2013; Mutshembele et al.,2014). Hence, the accumulation of mutations occur at approximatelythe same timescale as transmission, and therefore the transmissionchain is genetically distinguishable. Regarding this approach, severalreservoirs of animal and human disease have been identified by meansof genetic inference on cross-species transmission (Haydon et al., 2002;Viana et al., 2014).

The distribution of microsatellites in A. marginale strains is inagreement with the findings of Estrada-Peña et al. (2009) who observedthat genotypes G, H, C, and D were the most widespread in ecologicalregions where R. microplus is the main vector of this Rickettsia. In ad-dition, these authors found a relation between the SD-ATG distance (seemethods) and the expression levels of msp1α gene. A shorter SD-ATGdistance (19 nucleotides in genotype C vs. 23 nucleotides in genotypeG) was associated with a lower msp1α gene expression (Estrada-Peña

et al., 2009). As MSP1a binds tick cells (de la Fuente et al., 2003), thissuggests that the SD-ATG distance may influence the interaction of A.marginale with host cells (Estrada-Peña et al., 2009). Regarding geno-type and host species association, Silva et al. (2014b) only found gen-otype E in several strains from buffaloes, while other genotypes werefound in cattle at the same region in Brazil, which it could be suspectedof host-strain specificity. However, in our results, the presence of gen-otypes G and C in cattle and buffaloes demonstrated that host specieswas not a differentiation factor for the strains.

The similar distribution of TR in cattle and water buffaloes in thiswork provided another important evidence of cross-species transmis-sion. The TR present functional residues that act as adhesins in theinvasion process of tick cells and erythrocytes by A. marginale (Cabezas-Cruz et al., 2013). Consequently, immunological evasion and trans-mission fitness are driving forces of genetic diversification, conduciveto the emergence of new TR variants due to homologous recombination,in order to achieve a competitive advantage (Mutshembele et al.,2014). This criterion matches the discovery of new TR in cattle andbuffalo in this work, indicating that this biological process occurs si-milarly in both species.

On the other hand, while the TR of MSP1a are highly variable, ty-pical repeats are commonly represented among worldwide strains(Cabezas-Cruz et al., 2013). The global distribution of several TR maybe the result of the international trade of cattle (de la Fuente et al.,2007b), whereas the genetic diversity of strains in endemic areas ismaintained through stochastic transmission by ticks (Palmer et al.,2004). Accordingly, we found the same TR present in strains from Cubaand those from other related countries (i.e., B, β, and M are the mostcommon in strains from American countries; Cabezas-Cruz et al., 2013),including USA wherein T, γ, α, N, 27, and 13 are also common (de la

Fig. 3. Phylogenetic relationship of A. marginale strains from water buffaloes and cattle raised in livestock ecosystems of Western regions of Cuba. The consensus treeof maximum likelihood (ML) built with MSP1a sequences. The numbers and dots in the internal branches represent bootstrap values (only higher than 50 are shown)and aLRT values (≥70), respectively (1000 replicates). Strains achieved in this work (marked with *) were shown in the following format: GenBank Id.-Sample Id.-Host/Ecosystem, while strains from GenBank were show as GB Id.-Country-Locality (or strain Id) and including host specie if it was not cattle. The outer circle (linecolors) indicates the origin country of isolates included in the analysis, the inner circle distinguishes four large clusters, identified according to predominant tandemrepeated (TR).

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

185

Fuente et al., 2007b). This suggests the introduction of A. marginalestrains in Cuba through cattle importation, corresponding to Canadianand USA origins of the main imports of cattle in Cuba during the last50 years (Pérez, 1999; MINAGRI, 2012).

The postulate of genetic diversity and common distribution of TRdue to cattle trade is partially supported by the epidemiological situa-tion in Australia, where A. marginale strains only have the TR 8(ADGSSAGDQQQESSVSSQSGASTSSQSG) (Estrada-Peña et al., 2009).This is attributed to the limited introduction of A. marginale into thiscountry, associated with the introduction of R. microplus in the 19thcentury (Lew et al., 2002). Coincidentally, > 90% of the initial popu-lation of water buffaloes in Cuba was imported from Australia (Mitat,2009), while the TR 8 was not found in the strains analyzed. Theseresults confirm that cohabiting water buffalo and cattle are usuallyinfected by the same strains of A. marginale in the livestock areas inCuba.

This study provided additional information on the current epide-miological situation of anaplasmosis in Cuba. The wide diversity of TRand MSP1a sequences found in an area of approximately 40 km2, evenin the same herd, indicated that there is a high genetic diversity amongstrains of A. marginale in this region and potentially all over thecountry. This result is consistent with the situation in other Americancountries like Mexico or Venezuela, where R. microplus population ismaintained throughout the year, and the prevalence rates of A. mar-ginale in cattle herds are generally high (Cabezas-Cruz et al., 2013;Castañeda-Ortiz et al., 2015).

It has been suggested that frequent transmission cycles by ticks andthe pressure of the host immune response (at individual and populationlevels) promote the emergence of novel A. marginale strains which areable to infect naïve hosts and even infected hosts (superinfection)(Castañeda-Ortiz et al., 2015; Palmer and Brayton, 2013). The in-formation about the genetic diversity of A. marginale in other hostspecies is limited (de la Fuente et al., 2004); however, Silva et al.(2014c) found a low genetic diversity in buffalo from Marajó Island,Brazil, associated with a low prevalence (7.5%). Here, we found sixMSP1a sequences in 15 strains, and>50% of the buffaloes were car-riers, suggesting that genetic diversity and high prevalence are alsoclosely associated in water buffalo herds.

5. Conclusion

Summarizing, in this work we show that the water buffalo is acompetent host for A. marginale, with parasitemia levels that allow forthe infection of tick vectors, then within-vector multiplication favorsthe subsequent transmission to other vertebrate hosts. In addition, thegenetic similarity between isolate of msp1α gene from cattle and waterbuffaloes indicates that buffaloes can be competent reservoirs of A.marginale in endemic areas, especially when both ruminant speciescohabit and R. microplus is the main vector. Therefore, according to theapproach and terminology proposed by Haydon et al. (2002) and Vianaet al. (2014), we propose that buffalo herds are part of the reservoir ofA. marginale in several livestock areas in Cuba. Further analysis is re-quired on the reservoir capacity of water buffaloes, delving into factorsthat may influence their maintenance capability and their relationshipswith the transmission pathway of this rickettsia.

Conflict of interest

None of the authors has financial or personal relationships withother people or organizations that could inappropriately influence thecontent of the paper.

Ethical statement

The procedures involving animals in this work were according tothe principles established by The International Guiding Principles for

Biomedical Research Involving Animals (1985). The committee onethics and animal welfare at CENSA approved the experimental designof this research.

We conducted an observational study, in which the animals werekept in natural conditions, without interrupting the zootechnical flowin the farms under study. The animals were only manipulated once,which consisted in immobilizing a and extracting 10ml of blood fromthe jugular vein in each animal, using hypodermic needles and thevacuum extraction system.

Acknowledgments

This work was supported by funding from Fundacão de Amparo àPesquisa do Estado de São Paulo (FAPESP), Brazil (Process 2012/21371-4); and the National Priority Program for Animal and PlantHealth, Ministry of Agriculture (MINAGRI), Cuba (ProcessP131LH003007). Dasiel Obregon would like to acknowledge theConselho Nacional de Desenvolvimento Científico e Tecnológico(CNPq) and the Three World Academy of Science (TWAS) by hissandwich Ph.D. grant (TWAS-CNPq 2013, Process 302999/2013-2).

References

Alonso, M., Arellano-Sota, C., Cereser, V.H., Cordoves, C.O., Kessler, A.A., R, G., Solari,M.A., Vega, C.A., 1992. Epidemiology of bovine anaplasmosis and babesiosis in LatinAmerica and the Caribbean. Int. J. Epidemiol. 11, 713–733.

Anisimova, M., Gascuel, O., 2006. Approximate likelihood-ratio test for branches, a fast,accurate, and powerful alternative. Syst. Biol. 55 (539), 552. http://dx.doi.org/10.1080/10635150600755453.

Aubry, P., Geale, D.W., 2011. A review of bovine anaplasmosis. Transbound. Emerg. Dis.58, 1–30. http://dx.doi.org/10.1111/j.1865-1682.2010.01173.x.

Benitez, D., Cetrá, B., Florin-Christensen, M., 2012. Rhipicephalus (Boophilus) microplusticks can complete their life cycle on the water buffalo (Bubalus bubalis). J. BuffaloSci. 1, 193–197. http://dx.doi.org/10.6000/1927-520X.2012.01.02.11.

Brown, W.C., Barbet, A.F., 2016. Persistent infections and immunity in ruminants to ar-thropod-borne bacteria in the family Anaplasmataceae. Annu. Rev. Anim. Biosci. 4,1–21. http://dx.doi.org/10.1146/annurev-animal-022513-114206.

Cabezas-Cruz, A., Passos, L.M.F., Lis, K., Kenneil, R., Valdés, J.J., Ferrolho, J., Tonk, M.,Pohl, A.E., Grubhoffer, L., Zweygarth, E., Shkap, V., Ribeiro, M.F.B., Estrada-Peña, A.,Kocan, K.M., de la Fuente, J., 2013. Functional and immunological relevance ofAnaplasma marginale major surface protein 1a sequence and structural analysis.PLoS One 8, e65243. http://dx.doi.org/10.1371/journal.pone.0065243.

Camacho-Nuez, M., Lourdes Muñoz, M., Suarez, C.E., McGuire, T.C., Brown, W.C.,Palmer, G.H., 2000. Expression of polymorphic msp1β genes during acute Anaplasmamarginale rickettsemia. Infect. Immun. 68, 1946–1952. http://dx.doi.org/10.1128/IAI.68.4.1946-1952.2000.

Carelli, G., Decaro, N., Lorusso, A., Elia, G., Lorusso, E., Mari, V., Ceci, L., Buonavoglia, C.,2007. Detection and quantification of Anaplasma marginale DNA in blood samples ofcattle by real-time PCR. Vet. Microbiol. 124, 107–114. http://dx.doi.org/10.1016/j.vetmic.2007.03.022.

Castañeda-Ortiz, E.J., Ueti, M.W., Camacho-Nuez, M., Mosqueda, J.J., Mousel, M.R.,Johnson, W.C., Palmer, G.H., 2015. Association of Anaplasma marginale strain su-perinfection with infection prevalence within tropical regions. PLoS One 10,e0120748. http://dx.doi.org/10.1371/journal.pone.0120748.

Chaisi, M.E., Baxter, J.R., Hove, P., Choopa, C.N., Oosthuizen, M.C., Brayton, K.A.,Khumalo, Z.T.H., Mutshembele, A.M., Mtshali, M.S., Collins, N.E., 2017. Comparisonof three nucleic acid-based tests for detecting Anaplasma marginale and Anaplasmacentrale in cattle. Onderstepoort J. Vet. Res. 84, 1–9. http://dx.doi.org/10.4102/ojvr.v84i1.1262.

Corona, B., Rodríguez, M., Martínez, S., 2005. Bovine anaplasmosis. Rev. Electrónica Vet.VI 1–27.

Corona, B., Obregón, D., Martínez, S., Espinosa, I., Fonseca, A.H., Roque, E., 2012.Detección por PCR de Anaplasma marginale en búfalos de la región occidental deCuba. Rev. Salud Anim 34, 11–18.

Cronin, J.P., Welsh, M.E., Dekkers, M.G., Abercrombie, S.T., Mitchell, C.E., 2010. Hostphysiological phenotype explains pathogen reservoir potential. Ecol. Lett. 13,1221–1232. http://dx.doi.org/10.1111/j.1461-0248.2010.01513.x.

Decaro, N., Carelli, G., Lorusso, E., Greco, M.S.L.G., Lorusso, A., Radogna, A., Ceci, L.,Buonavoglia, C., 2008. Duplex real-time polymerase chain reaction for simultaneousdetection and quantification of Anaplasma marginale and Anaplasma centrale. J. Vet.Diagn. Invest. 20, 606–611.

Estrada-Peña, A., Naranjo, V., Acevedo-Whitehouse, K., Mangold, A.J., Kocan, K.M., de laFuente, J., 2009. Phylogeographic analysis reveals association of tick-borne pa-thogen, Anaplasma marginale, MSP1a sequences with ecological traits affecting tickvector performance. BMC Biol. 7, 1–13 doi:1741-7007/7/57.

FAO, 2014. La alimentación y la agricultura en América Latina y el Caribe. In: AnuarioEstadístico de La FAO. FAO, Santigo de Chile, pp. 1689–1699. http://dx.doi.org/10.1017/CBO9781107415324.004.

Guillemi, E.C., de la Fourniere, S., Orozco, M., Peña Martinez, J., Correa, E., Fernandez,

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

186

J., Lopez Arias, L., Paoletta, M., Corona, B., Pinarello, V., Wilkowsky, S.E., Farber,M.D., 2016. Molecular identification of Anaplasma marginale in two autochthonoussouth American wild species revealed an identical new genotype and its phylogeneticrelationship with those of bovines. Parasit. Vectors 9, 305. http://dx.doi.org/10.1186/s13071-016-1555-9.

Haydon, D.T., Cleaveland, S., Taylor, L.H., Laurenson, M.K., 2002. Identifying reservoirsof infection: a conceptual and practical challenge. Emerg. Infect. Dis. 8, 1468–1473.http://dx.doi.org/10.3201/eid0812.010317.

INSMET. Instituto de Meteorología de la República de CUBA. Centro del Clima, 2016. Elclima de Cuba. Características generales. http://www.met.inf.cu/asp/genesis.asp<tb0=plantillas&tb1=climac&tb2=/clima/ClimaCuba.htm accessed 1.1.16.

Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation datamatrices from protein sequences. Comput. Appl. Biosci. 8, 275–282. http://dx.doi.org/10.1093/bioinformatics/8.3.275.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7,improvements in performance and usability. Mol. Biol. Evol. 30, 772–780.

Katoh, K., Kuma, K., Toh, H., Miyata, T., 2005. MAFFT version 5: improvement in ac-curacy of multiple sequence alignment. Nucleic Acids Res. 33, 511–518.

Khan, M.Q., Zahoor, A., Jahangir, M., Mirza, M.A., 2004. Prevalence of blood parasites incattle and buffaloes. Pak. Vet. J. 24, 193–195.

Kocan, K.M., de la Fuente, J., Blouin, E.F., Coetzee, J.F., Ewing, S.A., 2010. The naturalhistory of Anaplasma marginale. Vet. Parasitol. 167, 95–107. http://dx.doi.org/10.1016/j.vetpar.2009.09.012.

Kocan, K.M., De La Fuente, J., Cabezas-Cruz, A., 2015. The genus Anaplasma: newchallenges after reclassification. OIE Rev. Sci. Tech. 34, 577–586. http://dx.doi.org/10.20506/rst.34.2.2381.

Kuttler, K.L., 1984. Anaplasma infections in wild and domestic ruminants: a review. J.Wildl. Dis. 20, 12–20.

de la Fuente, J., Garcia-Garcia, J.C., Blouin, E.F., Kocan, K.M., 2003. Characterization ofthe functional domain of major surface protein 1a involved in adhesion of the rick-ettsia Anaplasma marginale to host cells. Vet. Microbiol. 91, 265–283. http://dx.doi.org/10.1016/S0378-1135(02)00309-7.

de la Fuente, J., Vicente, J., Höfle, U., Ruiz-Fons, F., Fernández De Mera, I.G., Van DenBussche, R.A., Kocan, K.M., Gortazar, C., 2004. Anaplasma infection in free-rangingIberian red deer in the region of Castilla-La Mancha. Spain. Vet. Microbiol. 100,163–173. http://dx.doi.org/10.1016/j.vetmic.2004.02.007.

de la Fuente, J., Lew, A., Lutz, H., Meli, M.L., Hofmann-Lehmann, R., Shkap, V., Molad,T., Mangold, A.J., Almazán, C., Naranjo, V., Gortázar, C., Torina, A., Caracappa, S.,García-Pérez, A.L., Barral, M., Oporto, B., Ceci, L., Carelli, G., Blouin, E.F., Kocan,K.M., 2007a. Genetic diversity of Anaplasma species major surface proteins andimplications for anaplasmosis serodiagnosis and vaccine development. Anim. HealthRes. Rev. 6, 75–89. http://dx.doi.org/10.1079/AHR2005104.

de la Fuente, J., Ruybal, P., Mtshali, M.S., Naranjo, V., Shuqing, L., Mangold, A.J.,Rodríguez, S.D., Jiménez, R., Vicente, J., Moretta, R., Torina, A., Almazán, C., Mbati,P.M., de Echaide, S.T., Farber, M., Rosario-Cruz, R., Gortazar, C., Kocan, K.M., 2007b.Analysis of world strains of Anaplasma marginale using major surface protein 1arepeat sequences. Vet. Microbiol. 119, 382–390. http://dx.doi.org/10.1016/j.vetmic.2006.09.015.

Lew, A.E., Bock, R.E., Minchin, C.M., Masaka, S., 2002. A msp1α polymerase chain re-action assay for specific detection and differentiation of Anaplasma marginale iso-lates. Vet. Microbiol. 86, 325–335. http://dx.doi.org/10.1016/S0378-1135(02)00017-2.

LNP, 2014. Sistema de informacion estadística del IMV: serie histórica de la anaplasmosisy babesiosis en Cuba. (Habana).

Logiudice, K., Ostfeld, R.S., Schmidt, K.A., Keesing, F., 2003. The ecology of infectiousdisease: effects of host diversity and community composition on Lyme disease risk.Proc. Natl. Acad. Sci. 100, 567–571. http://dx.doi.org/10.1073/pnas.0233733100.

Miller, E., Warburg, A., Novikov, I., Hailu, A., Volf, P., Seblova, V., Huppert, A., 2014.Quantifying the contribution of hosts with different parasite concentrations to thetransmission of visceral leishmaniasis in Ethiopia. PLoS One 8, 1–8. http://dx.doi.org/10.1371/journal.pntd.0003288.

MINAGRI, 2012. Sistema integral para la política genética animal. Importaciones,Habana, Cuba.

Mitat, A.O.B., 2009. Búfalos de agua en Cuba: origen y evolución. Rev. ACPA 3, 45–48.Molad, T., Mazuz, M.L., Fleiderovitz, L., Fish, L., Savitsky, I., Krigel, Y., Leibovitz, B.,

Molloy, J., Jongejan, F., Shkap, V., 2006. Molecular and serological detection of A.centrale- and A. marginale-infected cattle grazing within an endemic area. Vet.Microbiol. 113, 55–62. http://dx.doi.org/10.1016/j.vetmic.2005.10.026.

Mutshembele, A.M., Cabezas-Cruz, A., Mtshali, M.S., Thekisoe, O.M.M., Galindo, R.C., dela Fuente, J., 2014. Epidemiology and evolution of the genetic variability ofAnaplasma marginale in South Africa. Ticks Tick. Borne. Dis. 5, 624–631. http://dx.doi.org/10.1016/j.ttbdis.2014.04.011.

Obregón, D., Rodríguez, J.D., Roque, E., Alemán, Y., 2010. Rhipicephalus (Boophilus)microplus (Acari: ixodidae) en búfalos (Bubalus bubalis), en Cuba. Rev. Salud Anim.32, 132–134.

OIE, 2015. Bovine anaplasmosis. In: Manual of diagnostic tests and vaccines for terrestrialanimals 2015. World Organization for Animal Health, Paris, France. http://dx.doi.org/10.1017/CBO9781107415324.004.

Palmer, G.H., Brayton, K.A., 2013. Antigenic variation and transmission fitness as driversof bacterial strain structure. Cell. Microbiol. 15, 1969–1975. http://dx.doi.org/10.1111/cmi.12182.

Palmer, G.H., Knowles, D.P., Rodriguez, J.-L., Gnad, D.P., Hollis, L.C., Marston, T.,Brayton, K.A., 2004. Stochastic transmission of multiple genotypically distinctAnaplasma marginale strains in a herd with high prevalence of Anaplasma infection.J. Clin. Microbiol. 42, 5381–5384. http://dx.doi.org/10.1128/JCM.42.11.5381-5384.2004.

Pérez, R., 1999. Changes in Cuban livestock production. World Anim. Rev. 96, 62–70.Rajput, Z.I., Hu, S.-H., Arijo, A.G., Habib, M., Khalid, M., 2005. Comparative study of

Anaplasma parasites in tick carrying buffaloes and cattle. J Zhejiang Univ Sci B 6,1057–1062. http://dx.doi.org/10.1631/jzus.2005.B1057.

Rodríguez, S.D., García-Ortiz, M.A., Jiménez, O.R., Vega, M.C.A., Garcia, O.M.A.,Jimenez, O.R., Vega, M.C.A., 2009. Molecular epidemiology of bovine anaplasmosiswith a particular focus in Mexico. Infect. Genet. Evol. 9, 1092–1101. http://dx.doi.org/10.1016/j.meegid.2009.09.007.

Ros-García, A., Nicolás, A., García-Pérez, A.L., Juste, R.A., Hurtado, A., 2012.Development and evaluation of a real-time PCR assay for the quantitative detectionof Theileria annulata in cattle. Parasit. Vectors 5, 171. http://dx.doi.org/10.1186/1756-3305-5-171.

Ruybal, P., Moretta, R., Perez, A., Petrigh, R., Zimmer, P., Alcaraz, E., Echaide, I., TorioniDe Echaide, S., Kocan, K.M., de la Fuente, J., Farber, M., 2009. Genetic diversity ofAnaplasma marginale in Argentina. Vet. Parasitol. 162, 176–180. http://dx.doi.org/10.1016/j.vetpar.2009.02.006.

Scoles, G.A., Broce, A.B., Lysyk, T.J., Palmer, G.H., 2005. Relative efficiency of biologicaltransmission of Anaplasma marginale (Rickettsiales: Anaplasmataceae) byDermacentor andersoni (Acari: Ixodidae) compared with mechanical transmission byStomoxys calcitrans (Diptera: Muscidae). J. Med. Entomol. 42, 668–675. http://dx.doi.org/10.1603/0022-2585.

Scoles, G.A., Miller, J.A., Foil, L.D., 2008. Comparison of the efficiency of biologicaltransmission of Anaplasma marginale (Rickettsiales: Anaplasmataceae) byDermacentor andersoni stiles (Acari: Ixodidae) with mechanical transmission by thehorse fly, Tabanus fuscicostatus Hine (Diptera: Muscidae). J. Med. Entomol. 45,109–114. http://dx.doi.org/10.1603/0022-2585.

Silva, J.B., Cabezas-Cruz, A., Fonseca, A.H., Barbosa, J.D., de la Fuente, J., 2014a.Infection of water buffalo in Rio de Janeiro Brazil with Anaplasma marginale strainsalso reported in cattle. Vet. Parasitol. 205, 730–734. http://dx.doi.org/10.1016/j.vetpar.2014.09.009.

Silva, J.B., Marcelo, W., Vinhote, S., Oliveira, C.M., André, M.R., Machado, R.Z., Fonseca,A.H., Barbosa, J.D.J., 2014b. Molecular and serological prevalence of Anaplasmamarginale in water buffaloes in northern Brazil. Ticks Tick. Borne. Dis. 5, 100–104.http://dx.doi.org/10.1016/j.ttbdis.2013.09.007.

Silva, J.B., Fonseca, A.H., Barbosa, J.D., Cabezas-Cruz, A., de la Fuente, J., 2014c. Lowgenetic diversity associated with low prevalence of Anaplasma marginale in waterbuffaloes in Marajó Island, Brazil. Ticks Tick. Borne. Dis. 5, 801–804. http://dx.doi.org/10.1016/j.ttbdis.2014.06.003.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecularevolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. http://dx.doi.org/10.1093/molbev/mst197.

Viana, M., Mancy, R., Biek, R., Cleaveland, S., Cross, P.C., Lloyd-Smith, J.O., Haydon,D.T., 2014. Assembling evidence for identifying reservoirs of infection. Trends Ecol.Evol. 29, 270–279. http://dx.doi.org/10.1016/j.tree.2014.03.002.

Wills, B.T., 2010. Hematology of water buffalo (Bubalus bubalis). In: Weiss, D.J.,Wardrop, K.J. (Eds.), Schalm's Veterinary Hematology. Blackwell Publishing Ltd,Ames, Iowa, USA, pp. 927–930.

Wood, D., Quiroz-Rocha, G.F., 2010. Normal Hematology of Cattle. In: Weiss, D.J.,Wardrop, K.J. (Eds.), Schalm's Veterinary Hematology. Blackwell Publishing Ltd,Ames, Iowa, USA, pp. 829–835.

Woolhouse, M.E.J., Webster, J.P., Domingo, E., Charlesworth, B., Levin, B.R., 2002.Biological and biomedical implications of the co-evolution of pathogens and theirhosts. Nat. Genet. 32, 569–577. http://dx.doi.org/10.1038/ng1202-569.

Ybañez, A.P., Ybañez, R.H.D., Claveria, F.G., Cruz-Flores, M.J., Xuenan, X., Yokoyama,N., Inokuma, H., 2014. High genetic diversity of Anaplasma marginale detected fromPhilippine cattle. J. Vet. Med. Sci. 76, 1009–1014. http://dx.doi.org/10.1292/jvms.13-0405.

D. Obregón et al. Veterinary Parasitology: Regional Studies and Reports 13 (2018) 180–187

187