VeraCodeTM Assay Guide - SNP Genetics€¦ · VeraCode Assay Guide 1 Chapter 1 Overview Topics...

ILLUMINA PROPRIETARY

Part # 11220990

FOR RESEARCH ONLY

VeraCodeTM

Assay Guide

Notice

This publication and its contents are proprietary to Illumina, Inc., and are intended solely for the contractual use of its customers and for no other purpose than to operate the system described herein. This publication and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina, Inc.

For the proper operation of this system and/or all parts thereof, the instructions in this guide must be strictly and explicitly followed by experienced personnel. All of the contents of this guide must be fully read and understood prior to operating the system or any parts thereof.

FAILURE TO COMPLETELY READ AND FULLY UNDERSTAND AND FOLLOW ALL OF THE CONTENTS OF THIS GUIDE PRIOR TO OPERATING THIS SYSTEM, OR PARTS THEREOF, MAY RESULT IN DAMAGE TO THE EQUIPMENT, OR PARTS THEREOF, AND INJURY TO ANY PERSONS OPERATING THE SAME.

Illumina, Inc. does not assume any liability arising out of the application or use of any products, component parts or software described herein. Illumina, Inc. further does not convey any license under its patent, trademark, copyright, or common-law rights nor the similar rights of others. Illumina, Inc. further reserves the right to make any changes in any processes, products, or parts thereof, described herein without notice. While every effort has been made to make this guide as complete and accurate as possible as of the publication date, no warranty or fitness is implied, nor does Illumina accept any liability for damages resulting from the information contained in this guide.

Illumina, Making Sense Out of Life, Sentrix, GoldenGate, DASL, Oligator, Infinium, BeadArray, Array of Arrays, BeadXpress, VeraCode, IntelliHyb, iSelect, CSPro, and Solexa are registered trademarks or trademarks of Illumina, Inc. Other brand and product names mentioned herein may be trademarks or registered trademarks of their respective owners.

© 2006-2007 Illumina, Inc. All rights reserved.

The BeadXpress and VeraCode technology is covered by U.S. Patent Nos. 6,355,431, 6,489,606, 6,681,067, 7,106,513, 7,126,755, and pending patent applications.

VeraCode Assay Guide iii

Revision History

Revision Date

Rev. A May 2007

Beta December 2006

VeraCode Assay Guide v

Table of Contents

Notice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iii

Revision History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v

Table of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii

List of Figures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xiii

List of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xv

Chapter 1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2GoldenGate Assay for 96 and 384 Multiplex Genotyping. . . . . . . . . . . . . . . 3Multiplex Genotyping with VeraCode Universal Oligo Beads . . . . . . . . . . . . 3Multiplex Protein and Nucleic Acid Assays with VeraCode Carboxyl Beads . 3BeadXpress Reader . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3System Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

Laboratory Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5Scanning Well Plates with the BeadXpress Reader . . . . . . . . . . . . . . . . . 5Analyzing Data with BeadStudio . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

Chapter 2 GoldenGate Assay Standard Operating Procedures . . . . . . 7

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8GoldenGate Assay. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Acronyms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10Preventing PCR Product Contamination . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

Physical Separation of Pre- and Post-PCR Areas . . . . . . . . . . . . . . . . . . 11Dedicated Equipment and Supplies . . . . . . . . . . . . . . . . . . . . . . . . . . . 11Daily and Weekly Bleaching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11Items Falling to the Floor. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12Use of Uracil DNA Glycosylase and dUTP . . . . . . . . . . . . . . . . . . . . . . . 13Detection of PCR Product Contamination. . . . . . . . . . . . . . . . . . . . . . . 13Reagent Reuse. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

General Safety Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13Equipment, Materials, and Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

GoldenGate Equipment, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . . 14GoldenGate Equipment, Illumina-Supplied . . . . . . . . . . . . . . . . . . . . . 14GoldenGate Genotyping Materials and Reagents, User-Supplied . . . . 15GoldenGate Genotyping Materials and Reagents, Illumina-Supplied . 17

General Lab Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

VeraCode Assay Guide vii

viii Table of Contents

Calibrating the Vortexer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19Balancing the Centrifuge. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20Preparing Multichannel Pipettes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20Applying Barcode Labels to Plates . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20Preparing for Sample Tracking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21Preparing Fewer than 96 Samples. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21

Chapter 3 GoldenGate Assay Protocols for VeraCode . . . . . . . . . . . . 23

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24Lab Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24Prepare Project Management Worksheet . . . . . . . . . . . . . . . . . . . . . . . . . . 27Prepare Lab Tracking Worksheets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27Create Sample Sheet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

Save Sample Sheet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Make DNA Quantitation Plate (OPTIONAL) . . . . . . . . . . . . . . . . . . . . . . . . 30

Reagents, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Make QDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Mix & Serially Dilute DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31Prepare PicoGreen Dilution Plates . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Read QDNA Plate (OPTIONAL) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34Equipment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34Read QDNA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

Make Single-Use DNA (SUD) Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Populate Sample Sheet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Make SUD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

Precipitate SUD Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40Precip SUD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

Resuspend SUD Plate. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Resuspend SUD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42

Make Multi-Use DNA (MUD) Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43Populate Sample Sheet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43Make MUD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

Precipitate Multi-Use DNA (MUD) Plate. . . . . . . . . . . . . . . . . . . . . . . . . . . . 45Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45Precip MUD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

Resuspend MUN Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Resuspend MUN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

Make ASE Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

Part # 11220990 Rev. A

Table of Contents ix

Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48Make ASE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

Add Master Mix for Extension & Ligation . . . . . . . . . . . . . . . . . . . . . . . . . . 50Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50Add MEL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50

Make PCR Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53Make PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53

Inoculate PCR Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54Inoc PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54

Thermal Cycle PCR Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56Cycle PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56

Bind PCR Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57Bind PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

Make Intermediate Plate for VeraCode Bead Plate . . . . . . . . . . . . . . . . . . . 59Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59Make INT VBP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

Hybridize VeraCode Bead Plate. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61Reagents, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61Reagents, Illumina-Supplied . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61Add Neutralized MH2 to INT VBP. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61HYB VBP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61

Wash VeraCode Bead Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Reagent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Wash VBP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

Scan VeraCode Bead Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Scan VBP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

Troubleshooting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65DNA Sample Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Hyb VBP. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Signal Intensity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66

Chapter 4 Bead Kitting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70Materials. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70Kitting VeraCode Beads. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71

Kitting the Beads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73Storing Kitted VeraCode Beads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82Cleaning the VeraCode Bead Kitting System . . . . . . . . . . . . . . . . . . . . . . . 82

VeraCode Assay Guide

x Table of Contents

Chapter 5 Universal Oligo Beads Example Protocol . . . . . . . . . . . . . . 83

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84

Equipment, Materials, and Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86Universal Oligo Equipment, User-Supplied. . . . . . . . . . . . . . . . . . . . . . 86Universal Oligo Equipment, Illumina-Supplied . . . . . . . . . . . . . . . . . . . 86Materials and Reagents, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . . 87Materials, Reagents, and Universal Oligo Bead Sets, Illumina-Supplied88

Designing PCR/ASPE Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89PCR Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89ASPE Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89

Matching ASPE Primers to VeraCode Capture Sequences . . . . . . . . . . . . . 91Primer and Oligo Guidelines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91Primers Used for Thrombosis Panel. . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

Contamination and Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93Containing Contamination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

Two-Plate Protocol for Low-Plex Genotyping . . . . . . . . . . . . . . . . . . . . . . . 94PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94Two-Plate Protocol SAP/EXO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95Two-Plate Protocol ASPE. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97

Single-Plate Protocol for Low-Plex Genotyping. . . . . . . . . . . . . . . . . . . . . . 99PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99Single-Plate Protocol SAP/EXO. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100Single-Plate Protocol ASPE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102

Troubleshooting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104Optimization Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104Additional Information. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105

Chapter 6 Carboxyl Beads Example Protocols . . . . . . . . . . . . . . . . . 107

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108Equipment, Materials, and Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109

Carboxyl Equipment, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . . . . 109Carboxyl Equipment, Illumina-Supplied . . . . . . . . . . . . . . . . . . . . . . . 109Materials and Reagents, User-Supplied . . . . . . . . . . . . . . . . . . . . . . . 110Materials, Reagents, and Carboxyl Bead Sets, Illumina-Supplied. . . . 111

One-Step Carbodiimide Coupling of Amine-Terminated Oligos to Carboxyl VeraCode Beads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112

Materials/Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112Additional Equipment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112Procedure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112

Two-Step Protein Immobilization to Carboxyl VeraCode Beads . . . . . . . . 114Materials/Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114Antibody Immobilization Procedure . . . . . . . . . . . . . . . . . . . . . . . . . . 116

Quantitation and Manual Bead Kitting . . . . . . . . . . . . . . . . . . . . . . . . . . . 117Materials/Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117Additional Equipment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117Manual Quantitation Procedure for Carboxyl Beads. . . . . . . . . . . . . . 117

Part # 11220990 Rev. A

Table of Contents xi

Manual Kitting Procedures for Carboxyl Beads. . . . . . . . . . . . . . . . . . 117Multiplex Cytokine Reagent Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . 120

Prepare Multiplex Detection Antibody . . . . . . . . . . . . . . . . . . . . . . . . 120Prepare Streptavidin Phycoerythrin Conjugate . . . . . . . . . . . . . . . . . . 120Prepare PBS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120

Multiplex Cytokine Protein Assay. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Materials/Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Procedure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122

Troubleshooting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124High Background. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124No Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124Too Much Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125Low or Flat Standard Curve . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125Poor Replicates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126Poor Reproducibility (Assay-to-Assay) . . . . . . . . . . . . . . . . . . . . . . . . . 126No Signal in Samples, Standard Curve Fine . . . . . . . . . . . . . . . . . . . . 127Sample Values too High, Standard Curve Fine . . . . . . . . . . . . . . . . . . 127

Appendix A GoldenGate Assay Controls . . . . . . . . . . . . . . . . . . . . . . . 129

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Viewing the Control Graphs. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130VeraCode Bead Types and IllumiCode Sequence IDs. . . . . . . . . . . . . . . . 131Control Oligo Diagrams. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132

Allele-Specific Extension Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132PCR Uniformity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132Gender Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133Extension Gap Control (U3 & U5 Match) . . . . . . . . . . . . . . . . . . . . . . . 133First Hybridization Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134Second Hybridization Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134Contamination Detection Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . 135

Appendix B Carboxyl Bead Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138BeadCodes for VeraCode Carboxyl BeadSets. . . . . . . . . . . . . . . . . . . . . . 138

Appendix C Universal Oligo Bead Sets Individual . . . . . . . . . . . . . . . . 139

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140BeadCodes for Individual VeraCode Universal Oligo BeadSets . . . . . . . . 140

Appendix D Universal Oligo Bead Sets Pools . . . . . . . . . . . . . . . . . . . 145

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146BeadCodes for Pooled VeraCode Universal Oligo BeadSets . . . . . . . . . . 146


xii Table of Contents

Part # 11220990 Rev. A

List of Figures

Figure 1 Process Flow for BeadXpress Reader and VeraCode Assays. . . . . . . . . . . . . 4Figure 2 Oligo Configuration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Figure 3 Securing Plates to Vortexer Platform with Velcro Straps . . . . . . . . . . . . . . . 19Figure 4 Laboratory Process Flow, GoldenGate Assay for VeraCode . . . . . . . . . . . . 25Figure 5 Sample Sheet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Figure 6 MIDI Plate Wells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31Figure 7 Standard QDNA and Sample QDNA Plates . . . . . . . . . . . . . . . . . . . . . . . . 33Figure 8 Loading PicoGreen Protocol in SoftMax Pro . . . . . . . . . . . . . . . . . . . . . . . . 34Figure 9 Selecting Lambda Standards Screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

Figure 10 Beginning Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35Figure 11 Viewing Standard Curve . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36Figure 12 Reading the Plate. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36Figure 13 Using 8-Channel Pipette . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51Figure 14 Apply Label to Filter Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57Figure 15 VeraCode Bead Kitting System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72Figure 16 VeraCode Bead Kitting System, Deep Reservoir Down . . . . . . . . . . . . . . . 73Figure 17 Placing Rectangular Gasket into Deep Reservoir . . . . . . . . . . . . . . . . . . . . 73Figure 18 Adding Kitting Buffer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74Figure 19 Transferring Beads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75Figure 20 Adding Funnel Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75Figure 21 Pressing Gasket onto Funnel Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76Figure 22 Putting Plate on Gasket . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76Figure 23 Closing and Latching VeraCode Bead Kitting System. . . . . . . . . . . . . . . . . 77Figure 24 Shaking VeraCode Bead Kitting System . . . . . . . . . . . . . . . . . . . . . . . . . . . 78Figure 25 Flipping VeraCode Bead Kitting System . . . . . . . . . . . . . . . . . . . . . . . . . . . 78Figure 26 Tapping VeraCode Bead Kitting System . . . . . . . . . . . . . . . . . . . . . . . . . . . 79Figure 27 Opening VeraCode Bead Kitting System Slowly . . . . . . . . . . . . . . . . . . . . . 80Figure 28 Removing Funnel Plate and Gasket from Deep Reservoir. . . . . . . . . . . . . . 80Figure 29 Removing Plate from Deep Reservoir . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81Figure 30 PCR, ASPE Reaction, Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85Figure 31 Unwanted PCR Products from Poorly-Designed ASPE Primers . . . . . . . . . . 90Figure 32 PCR Gel, ASPE Gel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105Figure 33 Multiplex Cytokine Protein Assay. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122Figure 34 ASE Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132Figure 35 PCR Uniformity Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132Figure 36 Gender Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133Figure 37 Extension Gap Control (U3 & U5 Match) . . . . . . . . . . . . . . . . . . . . . . . . . . 133Figure 38 First Hybridization Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134Figure 39 Contamination-Free Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135Figure 40 Contaminated Environment without UDG Treatment . . . . . . . . . . . . . . . . 136Figure 41 Contaminated Environment with UDG Treatment. . . . . . . . . . . . . . . . . . . 136

VeraCode Assay Guide xiii

xiv List of Figures

Part # 11220990 Rev. A

List of Tables

Table 1 Acronyms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10Table 2 Vortexer Calibration Speeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20Table 3 Pre-PCR Protocol Descriptions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26Table 4 Post-PCR Protocol Descriptions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27Table 5 Sample Sheet Guidelines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Table 6 Concentration of Lambda DNA Standards . . . . . . . . . . . . . . . . . . . . . . . . . 31Table 7 QDNA Plate Reagent Volumes (μl) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32Table 8 Thermal Cycler Run Parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56Table 9 DNA Sample Preparation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

Table 10 Hyb VBP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Table 11 Signal Intensity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66Table 12 Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66Table 13 Materials for Kitting VeraCode Beads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70Table 14 Buffers for VeraCode Bead Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71Table 15 Assay Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87Table 16 Additional Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87Table 17 Factor V . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92Table 18 Factor II . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92Table 19 MTHFR 667 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92Table 20 MTHFR 1298 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92Table 21 PCR Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95Table 22 SAP/EXO Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95Table 23 ASPE Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97Table 24 PCR Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100Table 25 SAP/EXO Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100Table 26 ASPE Master Mix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102Table 27 Optimization Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104Table 28 Antibody Immobilization, Total Volume . . . . . . . . . . . . . . . . . . . . . . . . . . 114Table 29 Dilution of Sulfo-NHS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115Table 30 Dilution of EDC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115Table 31 High Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124Table 32 No Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124Table 33 Too Much Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125Table 34 Low or Flat Standard Curve . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125Table 35 Poor Replicates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126Table 36 Poor Reproducibility. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126Table 37 No Signal in Samples, Standard Curve Fine . . . . . . . . . . . . . . . . . . . . . . . 127Table 38 Sample Values too High, Standard Curve Fine . . . . . . . . . . . . . . . . . . . . . 127Table 39 VeraCode Bead Types and IllumiCode Sequence IDs. . . . . . . . . . . . . . . . 131Table 40 VeraCode Carboxyl Bead Sets. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138Table 41 VeraCode Bead Codes for Individual Universal Oligo Bead Sets . . . . . . . 140Table 42 VeraCode Bead Codes for Pooled Universal Oligo Bead Sets . . . . . . . . . 146

VeraCode Assay Guide xv

xvi List of Tables

Part # 11220990 Rev. A

Chapter 1

Overview

Topics2 Introduction

3 GoldenGate Assay for 96 and 384 Multiplex Genotyping

3 Multiplex Genotyping with VeraCode Universal Oligo Beads

3 Multiplex Protein and Nucleic Acid Assays with VeraCode Carboxyl Beads

3 BeadXpress Reader

4 System Workflow

VeraCode Assay Guide 1

2 CHAPTER 1Overview

Introduction

Illumina’s BeadXpress Reader System is a highly efficient and cost-effective SNP genotyping system that includes:

The BeadXpress ReaderVeraCode Bead PlatesVeraCode Universal Oligo BeadsVeraCode Carboxyl Beads

Illumina’s VeraCode technology and BeadXpress Reader System leverage the power of digital holographic codes to provide a robust detection method for multiplex bioassays requiring high precision, accuracy, and speed. VeraCode is a technology solution that grows with your needs and remains relevant during dynamic changes in research pursuits. The advantages of this system include:

High Data Quality

Industry-leading measurement density and sensitivity due to inherent stringency of code detection.Broad Multiplexing Capability

Using a patented digital holographic coding technology, the BeadXpress Reader System enables development of a broad range of multiplexing. Assays ranging from single-plex to 384-plex per sample can be per-formed from a single well of a standard 96-well plate.Use of Codes for Increased Quality Metrics

Bead codes can be utilized in the assay as identifiers for internal controls, as well as for unique identifiers such as reagent lots, test kits, and sample ID.Assay Versatility

A broad range of applications, including genotyping, gene expression, and protein-based assays can be performed on a single platform.Dual-Color Laser Detection

The dual-color laser detection of the BeadXpress Reader enables ulti-mate flexibility in assay design. Assays utilizing either two-color detection (e.g., the GoldenGate Assay) or single-color detection (ASPE) can be run on this platform.

To support the broadest range of applications and multiplexing needs, Illumina has developed the following products for the BeadXpress Reader System:

BeadXpress ReaderGoldenGate 96- or 384-plex Genotyping Assay for VeraCodeVeraCode Universal Oligo BeadsVeraCode Carboxyl BeadsVeraCode Test and Calibration KitVeraCode Bead Kitting SystemBeadXpress Read Buffer

Part # 11220990 Rev. A

GoldenGate Assay for 96 and 384 Multiplex Genotyping 3

GoldenGate Assay for 96 and 384 Multiplex Genotyping

Illumina combines the proven GoldenGate Genotyping Assay with cutting-edge VeraCode technology to deliver one of the most robust systems for SNP genotyping in the industry. Ideally suited for those interested in biomarker validation or creation of custom assay panels, you can now achieve 96 and 384 multiplexing within a single well of a standard microplate.

The GoldenGate Assay process is described in Chapter 3, GoldenGate Assay Protocols for VeraCode. This assay uses an oligo-directed detection method that results in fluorescent products which are hybridized to VeraCode beads, then scanned on the BeadXpress Reader.

Multiplex Genotyping with VeraCode Universal Oligo Beads

Flexibility in the development of multiplex SNP genotyping assays can now be achieved with Illumina’s VeraCode Universal Oligo Bead Sets. With these highly stable, uniquely-coded bead sets that are pre-coupled with captured oligonucleotides, you can develop your own assays based on your desired multiplex and preferred assay methodology.

Chapter 4, Universal Capture Beads Example Protocol, describes one of the many assay design possibilities using this product.

Multiplex Protein and Nucleic Acid Assays with VeraCode Carboxyl Beads

A diverse range of bioassay applications can be explored using VeraCode Carboxyl Beads. These bead sets enable covalent attachment of proteins, peptides, nucleic acid, and other ligands in a highly multiplexed format that can save time, money and precious samples. VeraCode Carboxyl Beads are highly stable. Simple immobilization chemistry enables rapid assay design for a variety of analytes, and provides a truly open platform for laboratory-developed tests.

Chapter 6, Carboxyl Beads Example Protocols, provides an example of one of the many protocols that can be used with this product.

BeadXpress Reader

VeraCode Bead Plates are imaged using the Illumina BeadXpress Reader, a two-channel, 30 μm-resolution non-confocal laser scanner. The BeadXpress Reader can simultaneously (via menu-driven software) scan a well plate at two wavelengths and create an image file for each channel.

For information about the Illumina BeadXpress Reader, see the BeadXpress Reader System Manual (Illumina part # 11220957).


4 CHAPTER 1Overview

System WorkflowFigure 1 illustrates the basic workflow of the BeadXpress Reader System and VeraCode assays.

Figure 1 Process Flow for BeadXpress Reader and VeraCode Assays

Part # 11220990 Rev. A

System Workflow 5

LaboratoryProtocols

Illumina laboratory protocols are designed to promote efficiency and minimize the risk of contamination.

Chapter 2, GoldenGate Assay Standard Operating Procedures documents standard operating procedures and tools for an Illumina assay lab and explains how to set up and maintain separate pre- and post-PCR areas.

Chapter 3, GoldenGate Assay Protocols for VeraCode, shows how to perform the VeraCode assay protocol with clearly divided pre- and post-PCR processes.

Chapter 4, Bead Kitting, describes the bead kitting procedure used to kit universal oligo and carboxyl beads.

Chapter 5, Universal Oligo Beads Example Protocol, provides guidelines for developing an ASPE assay for low-plex genotyping.

Chapter 6, Carboxyl Beads Example Protocols, provides guidelines for developing protein-based assays on carboxyl beads.

Scanning WellPlates with the

BeadXpressReader

Illumina’s BeadXpress Reader scans well plates containing VeraCode beads at two wavelengths and creates intensity files for downstream analysis. As fluorescence data in two colors (corresponding to the two possible alleles present at each SNP locus) are collected, intensity values are determined for each bead type.

For information about scanning well plates with the BeadXpress Reader, see the BeadXpress Reader System Manual (Illumina part # 11220957).

Analyzing Datawith BeadStudio

The BeadStudio Genotyping Module consists of several features that allow you to determine and edit the genotype cluster locations of the AA, AB, and BB clusters for each locus of your custom SNP assay. You can save this information by creating a cluster file (*.egt file) containing the genotype cluster locations for a specific oligo pool. Genotype calls are made using the cluster file and your BeadXpress Reader intensity data files (*.idat files). Genotype calls are saved in text file format. Using the BeadStudio Genotyping Module, you can also generate reports for viewing and analyzing the results of your experiments. You can create reports to analyze by DNA or locus, select specific data, and compare data.

For a detailed description of how to use the BeadStudio Framework (common elements of the BeadStudio graphical user interface) and the BeadStudio Genotyping Module, see the BeadStudio Framework User Guide (Illumina part # 11204578), and the BeadStudio Genotyping Module User Guide (Illumina part # 11207066).


6 CHAPTER 1Overview

Part # 11220990 Rev. A

Chapter 2

GoldenGate Assay Standard Operating Procedures


10 Acronyms

11 Preventing PCR Product Contamination

13 General Safety Statement

14 Equipment, Materials, and Reagents

19 General Lab Setup


8 CHAPTER 2GoldenGate Assay Standard Operating Procedures

Introduction

This chapter describes the standard operating procedures associated with the GoldenGate Assay for VeraCode.

The GoldenGate Assay for VeraCode and the BeadXpress Reader is nearly identical to the GoldenGate Assay for the BeadArray Reader, but differs in the following ways:

CAUTIONStrict regard for the prevention of PCR product contamination is required for this process.

GoldenGate Assay for the BeadArray Reader

GoldenGate Assay for VeraCode and the BeadXpress Reader

Reagent Used to Make Hyb Plate MH1 MH2

Hyb Temperature 60°C, then 45°C 45°C

Hyb Time Overnight 3 hours

Final Hyb Volume 50 μl 100 μl

Part # 11220990 Rev. A

Introduction 9

GoldenGate Assay Illumina's GoldenGate Assay targets specific SNPs in genomic DNA samples. The genotyping application is based on sequence-specific extension and ligation of correctly hybridized query oligos, which are distinguished by their shared primer landing sites (Figure 2).

Figure 2 Oligo Configuration

In the GoldenGate Assay, DNA is first activated through a chemical reaction with biotin. The biotinylated DNA is then purified from excess biotin. Assay oligonucleotides (oligos) are added and hybridized to the DNA, and the mixture is bound to streptavidin-conjugated paramagnetic particles (SA-PMPs). After the oligo hybridization, mis- and non-hybridized oligos are washed away. Allele-specific extension and ligation of the hybridized oligos is performed. The extended and ligated products form a synthetic template that is transferred to a PCR reaction and amplified. The strand containing the fluorescent signal in the PCR products is isolated and hybridized to the VeraCode beads via the address sequence. After the hybridization, the VeraCode beads are washed and scanned on the BeadXpress Reader.

U5

U3

GA

T

Illumicode Sequence



Acronyms

Table 1 Acronyms

Acronym Definition Acronym Definition

AM1 Add MEL 1 (reagent) OB1 Oligo Hybridization and DNA Binding Buffer 1 (reagent)

ASE Allele-Specific Extension (plate) PBST 1 X Phosphate Buffered Saline + 0.05% Tween 20

ASO Allele-Specific Oligo PC Personal Computer

DNA Deoxyribonucleic Acid PCR Polymerase Chain Reaction (plate)

GS Genotyping System PMPs Paramagnetic Particles

GT Genotyping Precip Precipitate

HYB Hybridize or Hybridization) PS1 Precipitation Solution 1 (reagent)

INT Intermediate Plate QDNA Quantitate DNA

Inoc Inoculate RS1 Resuspension Solution 1 (reagent)

IP1 Inoc PCR 1 (reagent) SNP Single Nucleotide Polymorphism

LSO Locus Specific Oligo SUD Single-Use DNA (plate)

MEL Master Mix for Extension/Ligation (reagent) UB1 Universal Buffer 1 (reagent)

MH2 Make HYB 2 (reagent) UB2 Universal Buffer 2 (reagent)

MM1 Make MUD 1 (reagent) UDG Uracil DNA Glycosylase

MMP Master Mix for PCR (reagent) μl Microliter(s)

MS1 Make SUD 1 (reagent) VBP VeraCode Bead Plate

MUD Multi-Use DNA (plate) VR1 VeraCode Read Buffer (reagent)

MUN Multi-Use Nucleic Acid (plate) VW1 VeraCode Wash Buffer (reagent)

NaOH Sodium Hydroxide xg Multiple of gravitational acceleration

Part # 11220990 Rev. A

Preventing PCR Product Contamination 11

Preventing PCR Product Contamination

The PCR (polymerase chain reaction) process is commonly used in the laboratory to amplify specific DNA sequences.

Unless you exercise sufficient caution, PCR products may contaminate reagents, instrumentation, and samples, causing inaccurate and unreliable results.

PCR product contamination can shut down lab processes and significantly delay normal operations.

The following sections outline practices that help reduce the risk of PCR product contamination.

Physical Separationof Pre- and Post-

PCR Areas

The laboratory space where pre-PCR processes (DNA extraction, quantification, and normalization) are performed should be physically separate from the laboratory space where PCR products are made and processed (post-PCR processes).

Ideally, pre-PCR processes should be performed in a separate, dedicated laboratory space.

For example:• Never use the same sink to wash pre- and post-PCR reservoirs• Never share the same water purification system for pre- and post-

PCR processes• Store all supplies used in the protocols in the pre-PCR area, and

transfer to the post-PCR area as needed

DedicatedEquipment and

Supplies

Separate full sets of instruments (pipettes, centrifuges, oven, heat block, etc.) should be dedicated to pre- and post-PCR lab processes, and must never be shared between processes.

Daily and WeeklyBleaching

Post-PCR Area

Reducing the amount of PCR product in the post-PCR area helps reduce the risk of contamination. Daily and weekly bleaching help reduce the risk of PCR contamination by controlling the amount of PCR product in the post-PCR area.

CAUTIONYou must establish procedures for preventing PCR product contamination before you begin work in the lab.

CAUTIONTo prevent sample or reagent degradation, ensure that all bleach vapors have fully dissipated before starting any processes.



Illumina recommends identifying post-PCR area “hot spots” that pose the highest risk of contamination, and cleaning these items daily with a 10% bleach solution.

These hot spots include, but may not be limited to:Thermal cyclersBench space used to process amplified DNADoor handlesRefrigerator and freezer door handlesComputer mouse and keyboard

Perform a thorough bleaching of the post-PCR area weekly. Include all bench tops and instruments that are not cleaned daily.

Mop floors with a 10% bleach solution weekly. Train personnel responsible for this activity on preventing PCR product contamination.

Pre-PCR Area

A daily and weekly bleaching schedule for the pre-PCR area similar to that of the post-PCR area helps eliminate PCR product that may have entered the pre-PCR area.

Identify high-risk pre-PCR items such as the ones listed below. Clean these items with a 10% bleach solution each morning before beginning any pre-PCR processes:

Bench topsDoor handlesRefrigerator and freezer door handlesComputer mouse and keyboard

Perform a thorough cleaning of all laboratory surfaces and instruments on a weekly basis.

Mop floors with a 10% bleach solution weekly. Train personnel responsible for this activity on preventing PCR product contamination.

Items Falling to theFloor

The floor is contaminated with PCR product transferred on the shoes of individuals coming from the post-PCR area; therefore, anything that has fallen to the floor should be treated as contaminated.

Throw away any disposable items that fall to the floor, such as empty tubes, pipette tips, gloves, lab coat hangers, etc.

Non-disposable items that fall to the floor (such as a pipette, an important sample container, etc.) should be immediately and thoroughly cleaned with a 10% bleach solution to remove PCR product contamination.

Individuals handling anything that has fallen to the floor, disposable or not, must throw away their lab gloves and put on a new pair.

NOTEBe sure to clean any lab surface with which a contaminated item has come into contact.

Part # 11220990 Rev. A

General Safety Statement 13

Use of Uracil DNAGlycosylase and

dUTP

You may choose to add UDG (uracil DNA glycosylase) to the PCR master mix to help prevent PCR product contamination.

The PCR master mix delivered with the GoldenGate Assay Kit for VeraCode contains a balanced mixture of the following items:

universal PCR primersPCR bufferdUTPdATPdGTPdCTP

The dUTP is incorporated into the PCR products and may be targeted for specific degradation by UDG in subsequent PCR reactions, should PCR products contaminate them.

The GoldenGate Assay Kit for VeraCode does not contain a thermostable DNA polymerase. Illumina requires that you add an Illumina-recommended DNA polymerase (see Reagents, User-Supplied on page 30) to the PCR master mix before using the master mix in the GoldenGate Assay for VeraCode.

Detection of PCRProduct

Contamination

The oligo pools include internal controls (see Appendix A, System Controls) to help determine whether contamination has occurred. PCR contamination detection controls are divided into four types, and only a single type is added to each oligo pool tube. When a single oligo pool is run, it is expected that only a single contamination control type will have high signal. Should two or more contamination control types have high signal, significant contamination may have occurred. See Contamination Detection Controls on page 135 for detailed descriptions of PCR contamination detection controls.

Reagent Reuse Never reuse excess reagents. Discard excess reagents according to your facility requirements.

General Safety Statement

CAUTIONPlease refer to the governmental and facility safety standards applicable to your site.



Equipment, Materials, and Reagents

GoldenGateEquipment,

User-Supplied

Safety glassesProtective glovesLab coatsTube vortexerMicrotiter plate centrifuge with g-force range of 8–3000 xg.Spectrofluorometer (optional)

Gemini XS or XPS (Molecular Devices)8-channel precision pipettes (5 μl to 200 μl)

Optional: twelve-channel precision pipette (5 μl to 200 μl)Stopwatch/timerCap mat applicator, Corning PN 3081Vacuum flask assembly (flask, stopper, tubing, and vacuum source)Vacuum regulator, Qiagen catalog # 1953096-well thermocycler with heated lid

included with:Illumina Catalog # VC-120-1300, Optional GoldenGate Accessory Kit for BeadXpress (110V) andIllumina Catalog # VC-120-1301, Optional GoldenGate Accessory Kit for BeadXpress (220V)

GoldenGateEquipment,

Illumina-Supplied

Illumina Catalog # VC-101-1000, BeadXpress Reader System, 110V or Illumina Catalog # VC-101-1001, BeadXpress Reader System, 220V

• BeadXpress Reader (110V or 220V)• Reagent carrier• Reagent and waste bottles• USB Cable, Type A-B, 1.0 Meter• Detachable AC Line Cord, 2.0.1• PC workstation with monitor• BeadXpress Reader System Manual (Illumina part # 11220957)• VeraCode Assay Guide (Illumina part # 11220990)• BeadXpress Reader System CD (Illumina part # 292015)• BeadXpress Starter Kit (110V or 220V)Illumina Catalog # VC-120-1000, BeadXpress Starter Kit 110V or Illumina Catalog # VC-120-1001, BeadXpress Starter Kit 220V

included with:Illumina Catalog # VC-101-1000, BeadXpress Reader System, 110V andIllumina Catalog # VC-101-1001, BeadXpress Reader System, 220V

• VeraCode Bead Kitting System• VeraCode Vortex Incubator (110V or 220V)

Part # 11220990 Rev. A

Equipment, Materials, and Reagents 15

Illumina Catalog # VC-120-1200, GoldenGate Satellite Kitfor BeadXpress (110V) or Illumina Catalog # VC-120-1201, GoldenGate Satellite Kit for BeadXpress (220V)

• Microplate Shaker (110V or 220V)— High-Temperature Loop Fastener

— Nylon Hook

• Raised Bar Magnet• Heat Block w/ Microtubes Block• Digital Optical Stroboscope• Combi Heat Sealer (110V or 220V)

— 96-Well Base Adapter

Illumina Catalog # VC-120-1300, Optional GoldenGate Accessory Kit for BeadXpress (110V) orIllumina Catalog # VC-120-1301, Optional GoldenGate Accessory Kit for BeadXpress (220V)• Refrigerated Benchtop Centrifuge (110V or 220V)

— Microplate Carrier for M4 Rotor

— Horizontal M4 Rotor

— Conical Insert, 9x15 mL, Set of 4

— 750 mL Bucket, Set of 4

• DNA Engine Thermocycler (110V or 220V)— Alpha Unit Module, 96V-Well

GoldenGateGenotyping

Materials andReagents,

User-Supplied

You must purchase the following materials and reagents from a third-party vendor in order to perform VeraCode GoldenGate Genotyping assays on the BeadXpress Reader System.

Materials96-well, black, flat-bottom Fluotrac 200 plates

Greiner, catalog # 655076Centrifuge tubes (50 mL and 15 mL)

Corning catalog # 430828 and #430055Aluminum foilSterile plastic container

100 mL capacity, minimum96-well 0.2 mL skirted microplates• Microseal 96-well skirted polypropylene microplates, 8x12 well array,

MJ Research, catalog # MSP-9601 or• Thermo-Fast 96 skirted microplates, ABgene catalog # AB-080096-well 0.8 mL deep-well V-bottom plate

ABgene, catalog # AB-0859Serological pipettes (10, 25, and 50 mL)Aerosol filter pipette tips (5 μl to 200 μl)Heat Sealing Foil Sheets



Thermo-Seal, ABgene catalog # AB-0559Foil Stripper (optional)

ABgene catalog # AB-0592Microplate clear adhesive film

2mil Sealplate Adhesive Film, Nonsterile, Phenix Research Products, catalog # LMT-SEAL-EX

Absorbent padsCap Mats

Mat Caps for Deep Well Plates, polypropylene, pierceable, ABgene catalog # AB-0566

Non-Sterile Solution Basins, 55 mLLabcor Products, Inc., catalog # 730-001 or VWR, catalog # 21007-970

Microseal “A” FilmPCR plate sealing film, MJ Research, catalog # MSA-5001

filter plates MultiScreen Filter Plates, 0.45 μM, clear, Styrene, Millipore, catalog # MAHV-N45 10/50

96-well V-bottom plates Corning Costar* Brand Polypropylene 96-Well, V-bottom Plates, Cap Mats not included, Fisher Scientific catalog # 07-200-695 (Corning # 3363)

96-well storage matsVWR International, catalog # 29445-122

ReagentsQuant-iT PicoGreen DNA quantitation reagent

Molecular Probes Invitrogen, catalog # P758110 mM Tris-HCL pH 8.0, 1 mM EDTALambda DNA

Invitrogen, catalog # 25250-0281X TE2-propanolTitanium Taq DNA Polymerase

Clontech catalog # 6392200.1 N NaOH

Sodium hydroxide, Sigma-Aldrich catalog # S0899Reagent alcohol

90% ethanol, 5% methanol, 5% isopropanolDeionized H2O5% KOH

Potassium hydroxide10% bleach

Plain, unscented household bleach

Part # 11220990 Rev. A


GoldenGateGenotyping

Materials andReagents,

Illumina-Supplied

This section includes Illumina-supplied materials that you must have in order to perform VeraCode GoldenGate Genotyping assays on the BeadXpress Reader.

You must have one of the two VeraCode GoldenGate kits (96 or 384), as well as the BeadXpress System Buffer kit and the VeraCode Test and Calibration kit.

Illumina Catalog # VC-201-0096, VeraCode 96-Plex GoldenGate Kit, 480 samples

BOX A VeraCode DNA Activation Kit

• MS1—Reagent used to activate sufficient DNA, single use• PS1—Precipitation solution for both single-use and multi-use

DNA activation• RS1—Resuspension solution used in both single-use and multi-use

DNA activationBOX B VeraCode GoldenGate Pre-PCR #1

• OB1—Oligo hybridization and cDNA and gDNA binding buffer• MMP—Master mix for PCR reagent• IP1—Reagent used to elute extended and ligated products• UB1—Universal buffer used to wash paramagnetic beads• UDG—Uracil DNA Glycosylase, used to help prevent PCR

product contaminationBOX C VeraCode GoldenGate Pre-PCR #2

• MEL—Reagent used for extension and ligation• AM1—Reagent used to wash away non-specifically hybridized and

excess oligos from the gDNABOX D VeraCode GoldenGate Post-PCR

• MPB—Magnetic particle reagent used to bind double-stranded PCR products

• MH2—Reagent used to make the HYB plate• UB2—Universal buffer used to wash magnetic particles and the SAM• VW1—Reagent used to wash the VeraCode beadsBOX E 96-Plex VeraCode Bead Plates

• 96-Plex VeraCode Bead Plate (x5)OPA GoldenGate Assay custom oligo pool, shipped separatelyOther materials:• QDNA barcode labels• GS#-DNA barcode labels• SUD barcode labels• MUD barcode labels• MUN barcode labels• ASE barcode labels• PCR barcode labels• Filter Plate: GS____________-PCR labels



• INT barcode labels• filter plate adaptor• Vortexer calibration Label

Illumina Catalog # VC-201-0384, VeraCode 384-Plex GoldenGate Kit, 480 samples

BOX A VeraCode DNA Activation Kit

• MS1—Reagent used to activate sufficient DNA, single use• PS1—Precipitation solution for both single-use and multi-use

DNA activation• RS1—Resuspension solution used in both single-use and multi-use

DNA activationBOX B VeraCode GoldenGate Pre-PCR #1

• OB1—Oligo hybridization and cDNA and gDNA binding buffer• MMP—Master mix for PCR reagent• IP1—Reagent used to elute extended and ligated products• UB1—Universal buffer used to wash paramagnetic beads• UDG—Uracil DNA Glycosylase, used to help prevent PCR

product contaminationBOX C VeraCode GoldenGate Pre-PCR #2

• MEL—Reagent used for extension and ligation• AM1—Reagent used to wash away non-specifically hybridized and

excess oligos from the gDNABOX D VeraCode GoldenGate Post-PCR

• MPB—Magnetic particle reagent used to bind double-stranded PCR products

• MH2—Reagent used to make the HYB plate• UB2—Universal buffer used to wash magnetic particles and the SAM• VW1—Reagent used to wash the VeraCode beadsBOX E 384-Plex VeraCode Bead Plates

• 384-Plex VeraCode Bead Plate (x5)OPA GoldenGate Assay custom oligo pool, shipped separatelyOther materials:• QDNA barcode labels• GS#-DNA barcode labels• SUD barcode labels• MUD barcode labels• MUN barcode labels• ASE barcode labels• PCR barcode labels• Filter Plate: GS____________-PCR labels• INT barcode labels• filter plate adaptor• Vortexer calibration label

Part # 11220990 Rev. A

General Lab Setup 19

The following materials are required for performing any assay on the BeadXpress Reader, including GoldenGate assays:

Illumina Catalog # VC-400-1001, BeadXpress System Buffer

• VR1 Buffer, 10X—Reagent used in the BeadXpress Reader (500 mL)Illumina Catalog # VC-321-1000, VeraCode Test and Calibration Kit

• 12 calibrations—Used to calibrate the BeadXpress Reader on a monthly basis.

General Lab Setup

Before performing GoldenGate Assay protocols, some basic setup is required. Setup tasks are described in the following sections.

Calibrating theVortexer

Follow the instructions below to calibrate the Signature High-Speed Microplate Shaker (VWR International, catalog # 13500-890).

1. Replace top tray of the vortexer (used to secure the plate) with 3 Velcro

straps for securing 96-well plates.

2. Cut six two-inch lengths of adhesive-backed Velcro hooks. Attach these hooks to the underside of the bottom tray of the shaker platform.

3. Cut three 20-inch lengths of Velcro loops. Use these as straps to secure the plates onto the vortexer platform (Figure 3).

Figure 3 Securing Plates to Vortexer Platform with Velcro Straps

NOTE

The displayed speed of the vortexer may vary from the actual speed. Illumina recommends using a digital stroboscope to determine the actual vortex speed.

Once you have determined the actual vortex speed, record it along with the displayed speed and use these measurements for reference throughout the assay. Check the vortexer speed periodically.



4. Set the digital stroboscope display speed to 1600 rpm.

5. Turn the vortexer on and adjust the vortexer speed until the actual vortex speed reaches 1600 rpm.

6. Record the vortexer display speed.

7. Use the method described above to determine the displayed speed for the actual vortex speed of 1800 rpm, 2000 rpm, and 2300 rpm. These four vortex speeds are used in the GoldenGate Assay.

8. Place an Illumina-provided label on the vortexer with the calibration information. Table 2 lists the vortexer display speeds and actual speeds reflected on the Illumina-provided label.

Balancing theCentrifuge

Whenever centrifuging plates, Illumina recommends placing a “balance” plate opposite each plate being centrifuged.

PreparingMultichannel

Pipettes

Ensure that multi-channel pipettes are properly calibrated, clean, and decontaminated. Use close-fitting pipette tips to control the dispensing volume.

Applying BarcodeLabels to Plates

As a convention, apply barcode labels to the right side of the plate (column #12 end of the plate).

NOTEThis display speed represents an actual vortex speed of 1600 rpm.

Table 2 Vortexer Calibration Speeds

Display Speed Actual Vortex Speed

1450 rpm 1600 rpm

1625 rpm 1800 rpm

1800 rpm 2000 rpm

1975 rpm 2300 rpm

NOTEIn all protocols, the actual vortex speed, not the displayed value, is indicated.

Part # 11220990 Rev. A

General Lab Setup 21

Preparing forSample Tracking

You are responsible for tracking:The position of DNA samples in the plates.Lab tracking worksheets are provided on your BeadXpress Reader System CD (Illumina part # 292015).Appropriate information on your Sample Sheet.Sample sheet templates are included on the BeadStudio Genotyping Module Application & Documentation CD (Illumina part # 11207710).

Preparing Fewerthan 96 Samples

Each reagent tube supplied with your Illumina BeadXpress Reader System and GoldenGate Assay for VeraCode kit contains volume sufficient to process 96 samples at once, using a multichannel pipette and a reservoir.

When processing smaller sample batches (fewer than 96 samples) using a reagent reservoir, dead volume and pipetting error losses can increase. To ensure accurate reagent volume for all samples, single-pipette reagent into each well.

To store remaining reagent, Illumina recommends freezing aliquots, rather than repeatedly freezing and thawing the supplied reagent tube.



Part # 11220990 Rev. A

Chapter 3

GoldenGate Assay Protocols for VeraCode


24 Lab Protocols

27 Prepare Project Management Worksheet

27 Prepare Lab Tracking Worksheets

28 Create Sample Sheet

30 Make DNA Quantitation Plate (OPTIONAL)

34 Read QDNA Plate (OPTIONAL)

38 Make Single-Use DNA (SUD) Plate

40 Precipitate SUD Plate

42 Resuspend SUD Plate

43 Make Multi-Use DNA (MUD) Plate

45 Precipitate Multi-Use DNA (MUD) Plate

47 Resuspend MUN Plate

48 Make ASE Plate

50 Add Master Mix for Extension & Ligation

53 Make PCR Plate

54 Inoculate PCR Plate

56 Thermal Cycle PCR Plate

57 Bind PCR Products

59 Make Intermediate Plate for VeraCode Bead Plate

61 Hybridize VeraCode Bead Plate

63 Wash VeraCode Bead Plate

64 Scan VeraCode Bead Plate

65 Troubleshooting


24 CHAPTER 3GoldenGate Assay Protocols for VeraCode

Introduction

This chapter describes in detail the pre- and post-PCR laboratory protocols associated with the GoldenGate Assay for VeraCode.

Lab Protocols

Figure 4 graphically represents the GoldenGate Assay process flow. These protocols describe the procedure for preparing 96 DNA samples. If you are preparing fewer than 96 samples, scale down the protocols accordingly.

Part # 11220990 Rev. A

Lab Protocols 25

Figure 4 Laboratory Process Flow, GoldenGate Assay for VeraCode

Pre-PCR

Post-PCR

Make QDNA

InputsLambda DNA

PicoGreen dsDNAQuant Reagent

1X TE

OutputStandard QDNA Plate

Read QDNA

InputsStandard QDNA Plate

OutputElectronic file

containing informationabout the amount of

DNA in the plate

Day 1

Make ASE

InputsSUD or MUN Plate

OPA ReagentOB1 Reagent

OutputASE Plate

Make SUD

InputsMS1 Reagent

OutputSUD Plate

Precip SUD

Inputs2-propanol

PS1 ReagentSUD Plate

OutputSUD Plate

Resuspend SUD

InputsRS1 Reagent

SUD Plate

OutputSUD Plate

Make MUD

InputsMM1 Reagent

OutputMUD Plate

Precip MUD

Inputs2-propanol

PS1 ReagentMUD PlateMUN Plate

OutputMUN Plate

Resuspend MUN

InputsRS1 ReagentMUN Plate

OutputMUN Plate

Day 2

Add MEL

InputsASE Plate

MEL ReagentAM1 ReagentUB1 Reagent

OutputASE Plate

Make PCR

InputsPCR Plate

MMP Reagent

OutputPCR Plate

Inoc PCR

InputsASE PlatePCR Plate

UB1 ReagentIP1 Reagent

OutputPCR Plate

Pre-PCR

Cycle PCR

InputsPCR PlateOutput

PCR Plate

Bind PCR

InputsPCR PlateFilter Plate

MPB Reagent

OutputPCR Plate

Make INT VBP

InputsFilter PlateWaste Plate

INT PlateNaOH ReagentUB2 ReagentMH2 Reagent

OutputINT Plate

Hyb VBP

InputsVBP PlateINT Plate

MH2 ReagentNaOH Reagent

OutputVBP Plate

Wash VBP


VW1 Reagent

OutputVBP Plate

Scan VBP


OutputVBP Plate

Post-PCR

Good Stopping Point



Table 3 Pre-PCR Protocol Descriptions

Page Description

30(OPTIONAL) Make a quantitate-DNA (QDNA) plateThis process uses the Quant-iT PicoGreen dsDNA quantitation reagent to quantitate double-stranded DNA samples for the assay.

34(OPTIONAL) Read the QDNA plateThis process uses the Gemini XS or XPS Spectrofluorometer to provide DNA-specific quantitation.

38Make a single-use DNA (SUD) plateThis process uses the reagent MS1 to activate sufficient DNA of each individual sample to be used once in the VeraCode assay.

40Precipitate the DNA in the SUD platePS1 reagent and 2-propanol are added to the SUD plate to precipitate the activated DNA.

42Resuspend the DNA in the single-use DNA (SUD) plateRS1 reagent is added to the single-use DNA (SUD) plate to resuspend the sample.

43Make a multi-use DNA (MUD) plateThis process uses reagent MM1 to activate sufficient DNA of each individual sample to be used at least six times in the VeraCode assay.

45Activated DNA from the MUD plate is transferred to the multi-use nucleic acid (MUN) plate for precipitation. PS1 reagent and 2-propanol are added to the MUN plate to precipitate the activated DNA.

47Resuspend the sample in the MUN plateRS1 reagent is added to the MUN plate to resuspend the sample.

48Make an allele-specific extension (ASE) plateThe OPA (oligo pool) and OB1 reagent are dispensed to the allele-specific extension (ASE) plate. Then activated DNA is transferred from the SUD or MUN plate to the ASE plate.

50

Add master mix for extension/ligationAM1 and UB1 reagents are added to the ASE plate to wash away non-specifically hybridized and excess oligos from the DNA. MEL reagent (extension and ligation enzymes) is added to each sample in the ASE plate.

53Make polymerase chain reaction (PCR) plateMMP reagent, Illumina-recommended DNA polymerase enzyme, and Uracil DNA glycosylase (UDG) are used to create the PCR plate.

54Inoculate the PCR plateIP1 reagent is added to the ASE plate to elute the extended and ligated products. Eluted samples are transferred from the ASE plate to the PCR plate.

Part # 11220990 Rev. A

Prepare Project Management Worksheet 27

Prepare Project Management Worksheet

Use the Project Management Worksheet to organize, track, and manage individual laboratory projects. The Lab Manager should supply the worksheet for each project, with OPA and DNAs already recorded. As each project phase is completed, researchers and laboratory personnel should fill in all barcodes for that phase. The Project Management Worksheet (Project Management Worksheet.xls) is included on the BeadXpress Reader System CD provided with your system (Illumina part # 292015).

Prepare Lab Tracking Worksheets

Use the GoldenGate Assay Lab Tracking Worksheets for the VeraCode Bead Plate to identify which samples are placed in which wells on the VeraCode Bead Plate. You can print copies of the Lab Tracking Worksheets from the BeadXpress Reader System CD provided with your system (Illumina part # 292015).

Table 4 Post-PCR Protocol Descriptions

Page Descriptions

56Thermal cycle the PCR PlateThe PCR plate is placed in a thermal cycler and thermal cycled per the protocol.

57Bind polymerase chain reaction productsMPB reagent is added to the PCR plate to bind the double-stranded PCR products and the solution is transferred to the filter plate.

59Make intermediate plate for VeraCode Bead PlateThis process uses reagents UB2, MH1, and NaOH to make an intermediate plate, later used to hybridize the VBP.

61 Hybridize VeraCode Bead PlateThe VBP is hybridized.

63 Wash VeraCode Bead PlateThe VeraCode beads are washed after sample hybridization.

63 Scan VeraCode Bead PlateThe VBP is transferred into the BeadXpress Reader and the VeraCode beads are scanned.



Create Sample Sheet

To effectively track your samples and assay, Illumina recommends that you create a Sample Sheet. You will use the Sample Sheet with BeadStudio to analyze your data. For more information about data analysis, see the BeadStudio Genotyping Module User Guide (Illumina part # 11207066).

Create your Sample Sheet according to the guidelines provided in Table 5.

Table 5 Sample Sheet Guidelines

Section DescriptionRequired (R) or

Optional (O)

Sample_Name

For example, S12345If not user-specified, the BeadStudio application will assign a default sample name, concatenating the sample plate and sample well names.

O

Sample_Plate For example, GS0005623-DNAUser-specified name for the plate containing DNA samples. O

Sample_Well For example, A01The well containing the specific sample in the 96-well DNA plates. O

SentrixBarcode_AFor example, CK1234567-VBPThe VeraCode Bead Plate.

R

SentrixPosition_A The VeraCode Bead Plate well position to which the sample is hybridized. R

NOTESFigure 5 shows an example sample sheet. Your sample sheet header may contain any number of columns, and whatever additional information you choose. Your sample sheet must be in a comma-delimited (*.csv) file format

Part # 11220990 Rev. A

Create Sample Sheet 29

Save Sample Sheet Save the sample sheet under any name you wish (for example, your user-defined experiment name).

Figure 5 illustrates the flexible sample sheet format for VeraCode Bead Plates. The BeadStudio Genotyping Module Documentation CD (Illumina part # 11207710), includes an electronic, read-only sample sheet template file, Sample Sheet Template.csv, that you can copy and use as a basis for your sample sheets.

Figure 5 Sample Sheet



Make DNA Quantitation Plate (OPTIONAL)

This process uses the Quant-iT PicoGreen dsDNA quantitation reagent to quantitate double-stranded DNA samples for the GoldenGate Assay.

Illumina recommends the Molecular Probes PicoGreen assay for quantitation of dsDNA samples in the Illumina GoldenGate Assay for the BeadXpress System and VeraCode technology. The PicoGreen assay can quantitate small DNA volumes, and measures DNA directly. Other techniques may pick up contamination such as RNA and protein. Illumina recommends using a fluorometer, as fluorometry provides DNA-specific quantitation, whereas spectrophotometry may also measure RNA, and may yield values that are too high.

Reagents, User-Supplied

PicoGreen dsDNA quantitation reagentMolecular Probes Invitrogen, catalog # P7581

1X TELambda DNA

Invitrogen, catalog # 25250-028

Setup Determine the concentration of stock Lambda DNA.

Make QDNA

1. In well A1 of a 0.65 mL MIDI plate, dilute stock Lambda DNA to 75 ng/μl in a final volume of 233.3 μl.

2. Transfer 66.7 μl 1X TE to well B of column 1 of the same 96-well 0.65 MIDI plate (Figure 6).

3. Transfer 100 μl 1X TE to wells C, D, E, F, G, and H of column 1 of the same 96-well 0.65 mL MIDI plate (Figure 6).

NOTE

Before proceeding, remove PicoGreen reagent from freezer and thaw for 60 minutes at ambient temperature in a light-impermeable container. PicoGreen will be used at the Prepare PicoGreen Dilution Plates step on page 32.

NOTE

It may be helpful to use the following formula to calculate dilution of stock Lambda DNA:

(233.3 μl) X (75 ng/μl) = μl of stock Lambda DNA to add to A1 (stock Lambda DNA concentration)

Dilute the DNA standard in well A1 using the following formula:

μl of 1X TE to add to A1 = 233.3 μl - μl of stock Lambda DNA in well A1

Part # 11220990 Rev. A

Make DNA Quantitation Plate (OPTIONAL) 31

Figure 6 MIDI Plate Wells

Mix & SeriallyDilute DNA

1. Thoroughly mix the contents of A1 (10 mixes with P200 set to 100 μl is sufficient).

2. Serially dilute Lambda DNA by transferring 133.3 μl of Lambda DNA from well A1 into well B1, then pipette the mix contents of well B1 ten times.

3. Using a new pipette tip, transfer 100 μl from well B1 into well C1 and pipette the mix contents of well C1 ten times.

4. Again using a new pipette tip, transfer 100 μl from well C1 into well D1 and pipette the mix contents of well D1 ten times.

5. Using another new tip, transfer 100 μl from well D1 into well E1 and pipette the mix contents of well E1 ten times.

6. Using another new tip, transfer 100 μl from well E1 into well F1 and pipette the mix contents of well F1 ten times.

7. Again using a new tip, transfer 100 μl from well F1 into well G1 and pipette the mix contents of well G1 ten times.

8. Do not transfer solution from well G1 to well H1. Well H1 serves as the blank (0 ng/μl Lambda DNA).

Table 6 Concentration of Lambda DNA Standards

Row Column Conc. (ng/μl) Final Volume in Well (μl)

A1 75 100

B1 50 100

C1 25 100

D1 12.5 100

E1 6.25 100



9. Securely seal the 96-well MIDI plate with the cap mat, label it “Standard QDNA Plate,” and store it at 4°C for future use.

Prepare PicoGreenDilution Plates

1. Wrap aluminum foil around a 100 mL capacity sterile plastic container to prevent light penetration.

2. Make a 1:200 dilution of PicoGreen to 1X TE in the sterile plastic container. Table 7 outlines the required volumes for each reagent.

3. Cap the sterile plastic container and mix thoroughly.

4. Pour PicoGreen dilution into a new, non-sterile, disposable reservoir.

5. Using a multichannel pipette, transfer 195 μl PicoGreen dilution into rows A through H of columns 1 and 2 of a new 96-well black flat-bottom plate.

6. Using a multichannel pipette, transfer 195 μl PicoGreen dilution into all 96 wells of a new, black, flat-bottom sample plate.

F1 3.125 100

G1 1.5625 200

H1 0 100

Table 6 Concentration of Lambda DNA Standards (Continued)

Row Column Conc. (ng/μl) Final Volume in Well (μl)

CAUTIONPicoGreen reagent degrades quickly in the presence of light.

Table 7 QDNA Plate Reagent Volumes (μl)

# QDNA Plates PicoGreen Volume 1X TE Volume (mL)

1 115 23

2 215 43

3 315 63

NOTEDilutions should be made for a maximum of three sample plates at a time.

Part # 11220990 Rev. A

Make DNA Quantitation Plate (OPTIONAL) 33

Figure 7 Standard QDNA and Sample QDNA Plates

7. To each well of Rows A through H of columns 1 and 2, add 2 μl of stock Lambda DNA from the corresponding wells of the Standard QDNA plate (from step 9 on page 32).

8. Pipette mix the well contents of the Standard QDNA plate.

9. Immediately cover the plate with the aluminum adhesive seal and label it “Standard QDNA Plate.”

10. To each well of the black, flat-bottom sample plate, add 2 μl sample DNA to be quantitated.

11. Pipette the mix contents of the Sample QDNA plate.

12. Immediately cover the plate with the aluminum adhesive seal and label it “Sample QDNA” plate.

13. Proceed to Read QDNA Plate (OPTIONAL) on page 34.



Read QDNA Plate (OPTIONAL)

This process uses the Gemini XS or XPS Spectrofluorometer to provide DNA-specific quantitation. Illumina recommends using a fluorometer, as fluorometry provides DNA-specific quantitation, whereas spectrophotometry may also measure RNA, and may yield values that are too high.

Equipment User-SuppliedSpectrofluorometer

Gemini XS or XPS (Molecular Devices)

Setup 1. Turn on the spectrofluorometer.

2. At the PC, open the SoftMax Pro application.

Read QDNA 1. Load the Illumina QDNA.ppr file (provided on the GoldenGate Assay for BeadXpress Reader System CD (Illumina part # 292015) provided with your system.

2. Click Assays | Nucleic Acids | Illumina QDNA (Figure 8).

Figure 8 Loading PicoGreen Protocol in SoftMax Pro

3. Place the Standard QDNA Plate into the spectrofluorometer loading rack with well A1 in the upper left corner.

4. Highlight the Lambda Standard screen by clicking on the blue arrow to the left of Lambda Standard (Figure 9).

Part # 11220990 Rev. A

Read QDNA Plate (OPTIONAL) 35

Figure 9 Selecting Lambda Standards Screen

5. Click Read in the SoftMax Pro interface (Figure 10) to begin reading the Standard QDNA Plate.

Figure 10 Beginning Reading

When the reading is complete, the plate drawer opens.

6. Remove the Standard QDNA Plate from the drawer.

7. View the standard curve graph (Figure 11) by clicking the blue arrow next to Standard Curve. If the standard curve is acceptable, continue with the sample plate. Repeat Standard Curve if the results are unacceptable.



Figure 11 Viewing Standard Curve

8. Place the first sample plate in the reader with well A1 in the upper left corner.

9. Click the blue arrow next to QDNA#1, and select Read.

Figure 12 Reading the Plate

Part # 11220990 Rev. A

Read QDNA Plate (OPTIONAL) 37

When the reading is complete, the plate drawer opens.

10. Remove the plate from the drawer.

11. Repeat steps 8 through 10 for all sample plates to be quantified.

12. Once all plates have been read, select File | Save to save the output data file (*.pda file).Once you have saved the *.pda file, you must also export it as a text file.

13. Select File | Import/Export | Export.

14. Export the file as a *.txt file. The *.txt file may be opened with Excel for data analysis.



Make Single-Use DNA (SUD) Plate

This process activates sufficient DNA of each individual sample to be used once in the GoldenGate Assay.

Reagents User-Supplied10 mM Tris-HCl pH 8.0, 1 mM EDTA (TE)

Illumina-SuppliedMS1 (used to activate sufficient DNA for a single use)

Populate SampleSheet

In the appropriate columns of the Sample Sheet (see Figure 5), enter Sample_Name (optional) and Sample_Plate, for each Sample_Well defined in the Sample Sheet. See Save Sample Sheet on page 29.

Setup 1. Preheat the heat block to 95°C and allow the temperature to stabilize.

2. Turn on and preheat the heat sealer.

3. Remove the frozen MS1 reagent tube from the freezer and thaw to ambient temperature.

4. After the MS1 reagent tube has completely thawed, vortex the tube to fully mix its contents.

5. Pour the entire contents of the MS1 tube into a new, non-sterile, disposable reservoir.

6. Apply a SUD barcode label to a new 96-well 0.2 mL skirted microplate.

Make SUD 1. Normalize DNA samples in the GS#-DNA plate to 50 ng/μl with 10 mM Tris-HCl pH 8.0, 1 mM EDTA.

2. Add 5 μl MS1 reagent to each well of the SUD plate.

3. Transfer 5 μl normalized DNA sample to each well of the SUD plate.

4. Apply the microplate foil heat seal to the SUD plate and seal it with the heat sealer (3 seconds).

5. Pulse centrifuge to 250 xg to collect the contents at the bottom of the wells.

NOTE Change pipette tips between DNA sample dispenses.

CAUTION Ensure that all wells are completely sealed.

Part # 11220990 Rev. A

Make Single-Use DNA (SUD) Plate 39

6. Vortex at 2300 rpm for 20 seconds, making sure the plate is firmly strapped to the vortexer platform to prevent plate movement.

7. Pulse centrifuge sealed plate to 250 xg.

8. Incubate the SUD plate at 95°C for 30 minutes in the preheated heat block.

9. Using the heat block cover, cover the SUD plate to reduce condensation on the plate seal.

10. Remove the SUD plate from the heat block and pulse centrifuge to 250 xg to remove condensation from the walls of each well.

11. Proceed to Precipitate SUD Plate on page 40.

NOTEIt is important to centrifuge the SUD plate to 250 xg before the 95°C incubation to prevent the wells from drying out during incubation.

CAUTIONThe heat block cover must be in place to prevent complete evaporation of the 10 μl sample. Do not allow the 95°C incubation period to exceed 30 minutes.

NOTEIf you plan to proceed to the Make ASE protocol on the same day, immediately set the heat block to 70°C.



Precipitate SUD Plate

This process precipitates the DNA in the SUD plate and removes excess DNA activation reagent MS1.

Reagents User-Supplied2-propanol

Illumina-SuppliedPS1 (used in both single-use and multi-use DNA activation)

Setup 1. Pour 1 mL PS1 into a new disposable reservoir.

2. Pour 2 mL 2-propanol into a new disposable reservoir.

Precip SUD 1. Carefully remove the heat seal from the heated SUD plate, taking care to avoid splashing from the wells (see optional foil stripper, GoldenGate Genotyping Materials and Reagents, User-Supplied on page 15).

2. Add 5 μl PS1 reagent to each well of the SUD plate.

3. Using microplate clear adhesive film, seal the SUD plate and pulse centrifuge the sealed plate to 250 xg.

4. Vortex the sealed plate for 20 seconds at 2300 rpm (setting of 230) or until the solution is uniformly blue.

5. Remove the microplate clear adhesive film and add 15 μl 2-propanol to each well of the SUD plate.

6. Using microplate clear adhesive film, seal the SUD plate and vortex it for 20 seconds at 1600 rpm (setting of 160).

7. Centrifuge the sealed SUD plate for 20 minutes at 3000 xg.

8. Remove the SUD plate from the centrifuge.

CAUTION

Take care not to contaminate the pipette tips. To avoid tip contamination, place the tips against the top edge of the well (Figure 13). If you suspect the tips are contaminated with the contents of the well, discard them and use new tips.

NOTE Make sure the solution is uniformly blue.

Part # 11220990 Rev. A

Precipitate SUD Plate 41

9. Remove the plate seal.

10. Over an absorbent pad, decant the supernatant by inverting the SUD plate.

11. Smack the inverted plate down hard onto the absorbent pad to blot off the excess supernatant.

12. Place the SUD plate inverted on an absorbent pad and centrifuge it for 1 minute at 8 xg.

13. Remove the SUD plate from the centrifuge and allow it to dry for 15 minutes at ambient temperature.

14. Proceed to Resuspend SUD Plate on page 42.

NOTE

If you cannot see a faint blue pellet at the bottom of each well, the DNA has not precipitated. In some cases, depending on DNA quality, the blue pellet may appear diffuse at the bottom of the well(s).

CAUTIONDo not centrifuge the inverted plate at more than 8 xg. If you do, you may lose the sample.



Resuspend SUD Plate

In this process, the DNA in the SUD plate is resuspended.

Reagents Illumina-SuppliedRS1 (used in both single-use and multi-use DNA activation)

Setup Pour 1.2 mL RS1 into a new, non-sterile, disposable reservoir.

Resuspend SUD 1. Add 10 μl RS1 reagent to each well of the SUD plate.

2. Using microplate clear adhesive film, seal SUD plate.

3. Pulse centrifuge to 250 xg.

4. Vortex at 2300 rpm for 1 minute or until the blue pellet is completely resuspended. Ensure that plate is firmly strapped to vortexer platform to prevent plate movement.

5. Pulse centrifuge plate to 250 xg.

6. SUD sample plate activation is complete. Heat-seal the plate and store it at 4°C overnight.

NOTE

For long-term storage, the activated DNA may be frozen at -20°C. If the activated DNA is stored frozen, thaw completely and vortex to mix contents before use in the assay.

Part # 11220990 Rev. A

Make Multi-Use DNA (MUD) Plate 43

Make Multi-Use DNA (MUD) Plate

This process activates sufficient DNA from each individual sample to be used at least six times in the GoldenGate Assay. This process requires 2 μg of each DNA sample at 50 ng/μl.

Reagents User-Supplied10 mM Tris-HCl pH 8.0, 1 mM EDTA (TE)

Illumina-SuppliedMM1 (used to activate sufficient DNA for multiple uses)

Populate SampleSheet

In the appropriate columns of the Sample Sheet (see Figure 5 for an example), enter the Sample_Name (optional), and Sample_Plate for each Sample_Well defined in the Sample Sheet. See Save Sample Sheet on page 29 for more information.


2. Turn on and preheat the heat sealer.

3. Remove the MM1 reagent tube from the freezer and thaw it to ambient temperature.

4. Apply a MUD barcode label to a 96-well 0.2 mL skirted microplate.

5. Normalize the DNA samples to 50 ng/μl using 10 mM Tris-HCl pH 8.0, 1 mM EDTA.

6. After the MM1 reagent is completely thawed, vortex it to fully mix the contents of the tube.

7. Pour the MM1 tube contents into a new, non-sterile, disposable reservoir.

Make MUD 1. Add 40 μl MM1 reagent to each well of the MUD plate.

2. Add 40 μl normalized DNA sample to each well of the MUD plate.

3. Pipette mix the DNA sample and the MM1 reagent in the MUD plate.

4. Apply the microplate foil heat seal to the MUD plate and seal it with the heat sealer (3 seconds).

5. Pulse centrifuge the sealed plate to 250 xg.

CAUTION Ensure that all of the wells are completely sealed.

CAUTIONIt is important to centrifuge the MUD plate to 250 xg before the 95°C incubation to prevent the wells from drying out during the incubation.



6. Heat the MUD for 30 minutes at 95°C in the preheated heat block.

7. Using the heat block cover, cover the MUD plate to reduce condensation on the plate seal.

8. Remove the MUD plate from the heat block and pulse centrifuge it to 250 xg to remove the condensation from the walls of each well.

9. If you are proceeding to the Make ASE protocol on the same day, immediately set the heat block to 70°C.

10. Proceed to Precipitate Multi-Use DNA (MUD) Plate on page 45.

CAUTIONDo not allow the 95°C incubation period to exceed 30 minutes.

Part # 11220990 Rev. A

Precipitate Multi-Use DNA (MUD) Plate 45

Precipitate Multi-Use DNA (MUD) Plate

Activated DNA from the MUD plate is transferred to a larger container (MUN plate) and precipitated. Excess DNA activation reagent MM1 is also removed in the precipitation process.

Reagents User-Supplied2-propanol

Illumina-SuppliedPS1

Setup 1. Apply a MUN barcode label to a new 96-well 0.65 mL deep-well V-bottom plate.

2. Pour 5 mL PS1 into a new, non-sterile, disposable reservoir.

3. Pour 13 mL 2-propanol into another new, non-sterile, disposable reservoir.

Precip MUD 1. Carefully remove heat seal from heated MUD plate, taking care to avoid splashing from the wells (see optional Foil Stripper, GoldenGate Genotyping Materials and Reagents, User-Supplied on page 15).

2. Add 40 μl PS1 reagent to each well of the MUN plate.

3. Transfer the entire contents (80 μl) from each well of the heated MUD plate to the corresponding well of the MUN plate.

4. Using the cap mat, seal the MUN plate.

5. Pulse centrifuge to 250 xg to collect the contents to the bottom of the wells.

6. Vortex for 20 seconds at 2000 rpm (setting of 200), or until the solution is uniformly blue.

7. Pulse centrifuge to 250 xg.

8. Remove the cap mat and add 120 μl 2-propanol to each MUN plate well.

9. Seal the MUN plate with the cap mat.

10. Vortex for 20 seconds at 1600 rpm (setting of 160) or until the solution is uniformly blue.

11. Centrifuge the sealed MUN plate at 3000 xg for 20 minutes.

12. Remove the MUN plate from the centrifuge.

NOTEIf you cannot see a blue pellet at the bottom of each well, the DNA has not precipitated.



13. Remove the cap mat from the MUN plate.

14. Decant supernatant by inverting the MUN plate over an absorbent pad. Smack the inverted plate down hard onto the absorbent pad to blot off excess supernatant.

15. Place MUN plate inverted on an absorbent pad and centrifuge at 8 xg for 1 minute.

16. Remove MUN plate from centrifuge and allow to dry at ambient temperature for 15 minutes.

17. Proceed to Resuspend MUN Plate on page 47.

CAUTIONDo not centrifuge the inverted plate at more than 8 xg,. If you do, the sample may be lost.

Part # 11220990 Rev. A

Resuspend MUN Plate 47

Resuspend MUN Plate

In this process, the DNA in the MUN plate is resuspended.

Reagents Illumina-SuppliedRS1 (used in both single-use and multi-use DNA activation)

Setup Pour 12 mL RS1 into a new, non-sterile, disposable reservoir.

Resuspend MUN 1. Add 100 μl RS1 reagent to each well of the MUN plate.

2. Use the cap mat to seal the MUN plate.

3. Vortex at 2000 rpm (setting of 200) for 1 minute or until the solution is uniformly blue.MUN sample plate activation is complete.

4. Pulse centrifuge the plate to 250 xg.

5. Do one of the following:a. For short-term storage, heat seal the plate and store it at 4°C.b. For long-term storage, freeze the activated DNA at -20°C. If the activated DNA is stored frozen, thaw it completely and vortex it to mix the contents before using it.



Make ASE Plate

This process combines the biotinylated gDNAs with query oligos, hybridization reagents, and paramagnetic particles in an Allele Specific Extension (ASE) plate. The plate is then placed in a heat block and the query oligos for each sequence target of interest are allowed to anneal to the biotinylated gDNA samples. The gDNA is simultaneously captured by paramagnetic particles. The resulting ASE plate is ready for the extension and ligation of the hybridized oligos on the bound gDNAs.

This process is designed for one plate, using one of the following plates as input:

• SUD for single-use DNA• MUN for multi-use DNA

Reagents Illumina-SuppliedOB1OPA


2. Remove the OPA reagent tube from the freezer and thaw it completely at ambient temperature.

3. Vortex the contents of the tube to mix them completely.

4. Pulse centrifuge to collect the contents at the bottom of the tube.

5. Remove the OB1 tube from the freezer and thaw it to ambient temperature.

6. Vortex the OB1 tube to completely resuspend the solution.

7. Invert the tube to verify that all paramagnetic particles are evenly suspended in solution.

8. Apply an ASE barcode label to a new, 96-well, 0.2 mL skirted microplate.

Make ASE 1. Pulse centrifuge one of the following plates to 250 xg to collect the contents at the bottom of the wells:• SUD• MUN

2. Pour 1.2 mL OPA into a new, non-sterile, disposable reservoir.

3. Add 10 μl OPA to each well of the ASE plate.

4. Pour the thawed and resuspended OB1 into another new, non-sterile, disposable reservoir.

CAUTION Do not centrifuge the OB1 tube.

Part # 11220990 Rev. A

Make ASE Plate 49

5. Add 30 μl OB1 to each well of the ASE plate.

6. Carefully remove the adhesive seal from the SUD or MUN plate, taking care to avoid splashing from the wells.

7. Transfer 10 μl biotinylated sample from one of the following plates to appropriate wells of the ASE plate:• SUD (10 μl is the entire volume)• MUN

8. Using a microplate heat seal, heat-seal the ASE plate (3 seconds).

9. Pulse centrifuge the ASE plate to 250 xg.

10. Vortex the ASE plate at 1600 rpm (setting of 160) for 1 minute, or until the beads are completely resuspended.

11. Place the sealed ASE plate on heat block preheated to 70°C. Immediately change the temperature setting of the heat block to 30°C and allow the ASE plate to sit in the heat block until it cools to 30°C.

12. Using the heat block cover, cover plate to reduce condensation on the plate seal.

13. If the MUN plate was used in this process, do one of the following:a. For short-term storage, seal the plate with cap mats and store it

at 4°C.b. For long-term storage, freeze the activated DNA at -20°C. If the

activated DNA is stored frozen, thaw it completely and vortex it to mix contents before using it.

14. Proceed to Add Master Mix for Extension & Ligation on page 50.

CAUTION Ensure that all of the wells are completely sealed.

NOTEThis should take approximately two hours. The ASE plate may remain on the heat block at 30°C for up to 16 hours.



Add Master Mix for Extension & Ligation

Once the query oligos are hybridized to the gDNA, mis-hybridized and excess oligos are washed away, and an extension and ligation master mix (consisting of extension and ligation enzymes) is added to each gDNA sample. The extension and ligation reaction occurs at 45°C.

Reagents Illumina-SuppliedAM1UB1MEL

Setup 1. Remove the MEL tube from the freezer and it thaw to ambient temperature.

2. Remove the AM1 and UB1 bottles from the refrigerator.

3. Remove the ASE plate from the heat block.

4. Reset the heat block to 45°C.

Add MEL 1. Centrifuge the ASE plate to 250 xg.

2. Place the ASE plate on the raised bar magnetic plate for approximately 2 minutes, or until beads are completely captured.

If you are using the Illumina-recommended raised bar magnetic plate, the beads in odd-numbered columns will be pulled to the right wall of the well, and the beads in even-numbered columns will be pulled to the left wall of the well.

3. Pour 11 mL (10 mL for each additional plate) AM1 into a new, non-sterile, disposable reservoir.

4. Pour 11 mL UB1 into another non-sterile, disposable reservoir.

5. Carefully remove the heat seal from the ASE plate, taking care not to splash the samples out of the wells.

6. Using an 8-channel pipette with new tips, remove all of the liquid (50 μl) from the wells and discard the liquid (leave the beads in the wells).

NOTE Make sure the AM1 is completely solubilized.

NOTEFor best performance, wait the full 2 minutes for bead capture to be complete.

Part # 11220990 Rev. A

Add Master Mix for Extension & Ligation 51

7. Visually inspect the pipette tips after removing solution from each column to ensure that no beads have been removed. If beads are visible in the pipette tips, re-place the solution into the same wells, allow the magnet to re-collect beads, and change the pipette tips.

8. With the ASE plate on the raised bar magnetic plate, use an 8-channel pipette with new tips to add 50 μl AM1 to each well of the ASE plate.

Figure 13 Using 8-Channel Pipette

9. Using microplate clear adhesive film, seal the ASE plate.

10. Vortex the ASE plate at 1600 rpm (setting of 160) for 20 seconds or until all of the beads are resuspended.

11. Place the ASE plate on the raised bar magnetic plate for approximately 2 minutes, or until the beads are completely captured.

12. Carefully remove the seal from the ASE plate, taking care to avoid splashing from the wells.

13. Using the same 8-channel pipette with the same tips, and leaving the beads in the wells, remove all AM1 reagent from each well.

NOTEIt is not necessary to change pipette tips again until the liquid has been removed from all 12 columns.

NOTE Do not discard the pipette tips.

CAUTION

Take care not to disturb the pellet or contaminate the pipette tips. To avoid tip contamination, place the tips against the top edge of the well (Figure 13). If you suspect the tips are contaminated with the contents of the well, discard the tips and use new tips.



14. Repeat steps 8 through 13 once.

15. Remove the ASE plate from the raised bar magnetic plate.

16. Using an 8-channel pipette with new tips, add 50 μl UB1 to each well of the ASE plate.

17. Place the ASE plate onto the raised bar magnetic plate for approximately 2 minutes, or until the beads are completely captured.

18. Using the same 8-channel pipette with the same tips, and leaving the beads in the wells, remove all UB1 reagent from each well.

19. Visually inspect the pipette tips after removing solution from each column to ensure that no beads have been removed. If beads are visible in the pipette tips, re-place the solution into the same wells, allow the magnet to re-collect the beads, and change the pipette tips.

20. Repeat steps 15 through 18 once.

21. Pour the thawed MEL tube contents into a third new, non-sterile, disposable reservoir.

22. Using an 8-channel pipette with new tips, add 37 μl MEL to each well of the ASE plate.

23. Using microplate clear adhesive film, seal the plate.

24. Vortex the plate at 1600-1700 rpm (setting of 160-170) for 1 minute to resuspend the beads.

25. Incubate the ASE plate on the preheated 45°C heat block for 15 minutes.

26. Reset the heat block to 95°C.

27. Proceed to Make PCR Plate on page 53.

NOTEIt is not necessary to change the pipette tips again until you have removed liquid from all 12 columns.

NOTEIt is not necessary to vortex the ASE plate after addition of UB1.

NOTEIt is not necessary to change pipette tips again until you have removed liquid from all 12 columns.

CAUTIONDo not allow the ASE plate to incubate at 45°C for longer than 15 minutes.

Part # 11220990 Rev. A

Make PCR Plate 53

Make PCR Plate

This process adds the Illumina-recommended DNA Polymerase and Uracil DNA Glycosylase (UDG optional) to the master mix for PCR (MMP reagent) and creates a 96-sample plate for use in the Inoc PCR process.

Reagents User-SuppliedTitanium Taq DNA Polymerase - Clontech catalog # 639220UDG (optional) - Uracil DNA GlycosylaseFor PCR contamination control, contact Illumina Customer Solutions

Illumina-SuppliedMMP

Setup 1. Add 64 μl Illumina-recommended DNA Polymerase (see Reagents on page 16) to the MMP tube.

2. [Optional] Add 50 μl Uracil DNA glycosylase to the MMP tube.

3. Vortex the tube to mix the contents.

4. Pour the contents of the tube into a new, non-sterile, disposable reservoir.

5. Apply PCR barcode label to new 96-well 0.2 mL skirted microplate (or a plate that matches the thermal cycler you are using).

Make PCR 1. Using an 8-channel pipette, aliquot 30 μl of the mixture into each well of the PCR plate.

2. Using microplate clear adhesive film, seal the PCR plate.

3. Pulse centrifuge to 250 xg to bring reagents to the bottom of the wells.

4. Proceed to Inoculate PCR Plate on page 54.



Inoculate PCR Plate

This process uses the template formed in the extension and ligation process in a PCR reaction. This PCR reaction uses three universal primers: two are labeled with fluorescent dyes and the third is biotinylated. The biotinylated primer allows capture of the PCR product and elution of the strand containing the fluorescent signal.

Reagents Illumina-SuppliedUB1IP1

Setup 1. Pour 6 mL UB1 into a new, non-sterile, disposable reservoir.

2. Pour entire contents of the IP1 tube into a new, non-sterile, disposable reservoir.

3. Remove the ASE plate from the heat block.If you are unable to continue at this time, the ASE plate may be stored at 4°C for up to 1 hour.

4. Verify that the heat block is set to 95°C.

5. Place the ASE plate on the raised bar magnetic plate for approximately 2 minutes, or until beads are completely captured.

Inoc PCR 1. Remove microplate clear adhesive film from the plate.

2. Using an 8-channel precision pipette, and leaving the beads in the wells, remove and discard the supernatant (~50 μl) from all wells of the ASE plate.

3. Visually inspect the pipette tips after removing solution from each column to ensure that no beads have been removed. If beads are visible in the pipette tips, re-place solution into the same wells, allow the magnet to re-collect beads, and change the pipette tips.

4. Leaving the plate on the magnet and using an 8-channel precision pipette with new tips, add 50 μl UB1 to each well of the ASE plate.

CAUTIONDo not transfer plate to 95°C heat block until all washes are completed.

NOTEIt is not necessary to change pipette tips again until liquid has been removed from all 12 columns.

Part # 11220990 Rev. A

Inoculate PCR Plate 55

5. To ensure that all the beads are collected, allow the plate to rest on the raised bar magnetic plate for at least 2 minutes.

6. Leaving the beads in the wells, remove and discard the supernatant (~50 μl) from all wells of the ASE plate.

7. Eject and discard the pipette tips.

8. Remove the plate from the magnet.

9. Using an 8-channel precision pipette with new tips, add 35 μl IP1 to each column the of ASE plate.

10. Using microplate clear adhesive film, seal the plate.

11. Vortex at 1800-1900 rpm for 1 minute, or until all beads are resuspended.

12. Place the plate on the preheated 95°C heat block for 1 minute.

13. Take the plate off the heat block and place it back onto the raised bar magnetic plate for 2 minutes, or until the beads have been completely captured.

14. Place new tips on an 8-channel pipette.

15. Carefully transfer 30 μl supernatant from the first column of the ASE plate to the first column of the PCR plate.

16. Eject and discard pipette tips.

17. Repeat steps 14 through 16 for each column of the ASE plate.

18. Using Microseal “A” PCR plate sealing film (or whatever seal is appropriate to the thermal cycler you are using), seal the PCR plate.

19. Immediately transfer the PCR plate to the thermal cycler.

20. Discard the ASE plate.

21. Proceed to Thermal Cycle PCR Plate on page 56.

CAUTION

Take care not to disturb the pellet or contaminate the pipette tips. To avoid tip contamination, place the tips against the top edge of the well (Figure 13, page 51). If you suspect the tips are contaminated with the contents of the well, discard the tips and use new tips.

NOTEIt is not necessary to change pipette tips again until liquid has been removed from all 12 columns.

CAUTIONTake special care not to disturb or transfer the beads when aspirating eluted product.



Thermal Cycle PCR Plate

This process thermal cycles the PCR plate to fluorescently label and amplify the templates generated in the pre-PCR process.

Cycle PCR 1. Place the sealed plate into the thermal cycler and run the thermal cycler parameters as shown in the table below.

2. Perform a total of 34 PCR cycles.

3. Proceed immediately to Bind PCR Products on page 57, or seal and store PCR plate at -20°C.

Table 8 Thermal Cycler Run Parameters

Temperature Time at this Temperature

37°C 10 minutes

95°C 3 minutes

95°C 35 seconds (34 cycles)

56°C 35 seconds (34 cycles)

72°C 2 minutes (34 cycles)

72°C 10 minutes

4°C 5 minutes

Part # 11220990 Rev. A

Bind PCR Products 57

Bind PCR Products

In this step, the double-stranded PCR products are immobilized by binding the biotinylated strand to paramagnetic particles. The solution is transferred to a filter plate and incubated at ambient temperature so that the PCR product may bind to the paramagnetic particles.

Reagents Illumina-SuppliedMPB

Setup 1. Retrieve one MPB tube from the refrigerator.

2. Vortex the tube several times or until the beads are well resuspended.

3. Pour the MPB into a new, non-sterile, disposable reservoir.

4. Write the PCR plate barcode number in the space provided on a “Filter Plate: GS ____________-PCR” label.

5. Apply the filter plate label to the top surface of the filter plate adjacent to column 12 (Figure 14).

Figure 14 Apply Label to Filter Plate

Bind PCR 1. Pulse centrifuge the PCR plate to 250 xg.

2. Place new tips onto a multichannel pipette (5–50 μl).

3. Transfer 20 μl resuspended MPB from the reservoir into the first-column wells of PCR plate.



4. Repeat step 3 for all 12 columns of the PCR plate.

5. Discard pipette tips.

6. Using a multichannel pipette set to 85 μl with new tips, pipette the solution in the PCR plate up and down several times to mix the beads with the PCR product, then transfer the mixed solution into the first column of the filter plate.

7. Repeat step 6 for each column of the PCR plate. Change pipette tips between column dispenses.

8. Discard the empty PCR plate.

9. Cover the filter plate with its cover.

10. Store it at ambient temperature, protected from light, for 60 minutes.

11. Proceed to Make Intermediate Plate for VeraCode Bead Plate on page 59.

NOTEIt is not necessary to change pipette tips again until liquid has been transferred to all 12 columns.

CAUTION

To avoid tip contamination, place the tips against the top edge of the wells (see Figure 13 on page 51). If you suspect the tips are contaminated with the contents of the well, discard the tips and use new tips.

Part # 11220990 Rev. A

Make Intermediate Plate for VeraCode Bead Plate 59

Make Intermediate Plate for VeraCode Bead Plate

In this step, the PCR product is washed in the filter plate, then single-stranded, fluor-labeled material is eluted into the INT plate.

Reagents User-Supplied0.1N NaOH

Illumina-SuppliedUB2MH2

Setup 1. Apply a INT barcode label to a new 96-well V-bottom plate.

2. Using a serological pipette, transfer 6 mL UB2 into a sterile reservoir.

3. Pour 4 mL 0.1N NaOH into another sterile reservoir.

4. Pour the contents of one MH2 tube into another sterile reservoir.

Make INT VBP 1. Place the Filter Plate adapter on an empty 96-well V-bottom plate (waste plate).

2. Place the Filter Plate containing the bound PCR products onto the Filter Plate adapter.

3. Centrifuge at 1000 xg for 5 minutes at 25°C.

4. Remove the Filter Plate lid.

5. Using an 8-channel pipette (with new tips), add 50 μl UB2 from the sterile reservoir to all appropriate columns of the Filter Plate.

6. Re-lid the filter plate.

7. Centrifuge at 1000 xg for 5 minutes at 25°C.

8. Place new tips onto an 8-channel pipette.

9. Dispense 30 μl MH2 from the reservoir to all appropriate columns of the INT plate.

10. Replace waste plate with INT plate, and discard waste plate.

NOTE Dispense slowly so as not to disturb the beads.

CAUTIONTake care not to disturb the pellet or contaminate the pipette tips. To avoid tip contamination, place the tips against the top edge of the well (see Figure 13 on 51).



11. Orient the INT plate such that well A1 of the filter plate matches well A1 of the INT plate.

12. Place new tips onto the 8-channel pipette.

13. Dispense 30 μl 0.1N NaOH to all appropriate wells of the filter plate.

14. Re-lid the filter plate.

15. Centrifuge immediately at 1000 xg for 5 minutes at 25°C. No beads should be visible in the wells of the INT plate.

16. Discard the filter plate, but save the adapter for later use in other protocols.

17. Cover the INT plate with clear adhesive seal and set aside until you are ready to proceed to the HYB VBP process.

18. Proceed to Hybridize VeraCode Bead Plate on page 61.

CAUTIONBe sure to replace the waste plate with the INT plate. Failure to replace the waste plate will result in loss of samples.

CAUTION

Take care not to disturb the pellet or contaminate the pipette tips. To avoid tip contamination, place the tips against the top edge of the well (see Figure 13 on page 51).

CAUTION

Due to the sensitivity of the dyes to 0.1 N NaOH, proceed quickly. Prolonged incubation with NaOH is unnecessary; less than 5 minutes is sufficient. The DNA is denatured almost instantly.)

NOTEIf the INT plate is not used immediately in the HYB VBP protocol, store it at -20°C. Seal the plate with a 96-well storage mat before placing it in the freezer.

Part # 11220990 Rev. A

Hybridize VeraCode Bead Plate 61

Hybridize VeraCode Bead Plate

This process uses the VeraCode Vortex Incubator, an incubating microplate shaker, to hybridize the VeraCode Bead Plate. Once the samples are transferred to the VBP, they are ready for hybridization. The VBP is hybridized at 45°C for 3 hours.

Reagents, User-Supplied

0.1 N NaOH

Reagents, Illumina-Supplied

MH2VeraCode Bead Plate

Setup 1. With a serological pipette, transfer 3 mL MH2 into a 15 mL conical tube.

2. With a different serological pipette, transfer 3 mL 0.1 N NaOH to the 15 mL tube.

3. Vortex the 15 mL tube gently until the contents are mixed.

4. Pour the mixture into a sterile trough.

Add NeutralizedMH2 to INT VBP

1. If the INT plate has been frozen, thaw completely at ambient temperature in a light-protected drawer.

2. Once the INT plate is thawed, pulse centrifuge to 250 xg to collect any condensation.

3. Using an 8-channel pipette, dispense 50 μl of neutralized MH2 into each of the wells containing sample in your GS#-INT plate. Be careful not let the pipette tips touch the samples.

HYB VBP 1. Preheat the VeraCode Vortex Incubator to 45°C and allow to equilibrate.

2. Remove the VBP from 4°C and pulse centrifuge it to 250 xg.

3. Check to make sure that the beads in the VBP are on the bottoms of the wells. If they are not, pulse centrifuge again.

4. Remove the cap mat from the VeraCode Bead Plate, and save the cap mat for subsequent use in hybridization.

5. For each column of samples in the INT plate, gently mix by pipetting 4–5 times.

6. Using the same tips, transfer 100 μl of each assay product into corresponding well of VeraCode Bead Plate.

7. Reapply the cap mat to the VeraCode Bead Plate.

8. Place the VeraCode Bead Plate with samples into the VeraCode Vortex Incubator. Use another 96-well plate as a balance.



9. Close the lid and set the VeraCode Vortex Incubator speed to 85 (850 rpm), time to hold (HLD), and temperature 45°C.

10. Press the start button and allow the hybridization to proceed for 3 hours.

Part # 11220990 Rev. A

Wash VeraCode Bead Plate 63

Wash VeraCode Bead Plate

The VeraCode Bead Plate is removed from the VeraCode Vortex Incubator and washed two times using reagent VW1.

Reagent VW1

Setup Pour 45 mL of VW1 into a nonsterile, disposable reservoir.

Wash VBP 1. Stop the VeraCode Vortex Incubator. When the speed indicator reaches 0, open the lid and remove the VeraCode bead plate.

2. Pulse centrifuge to 250 xg to collect any condensation.

3. Remove the cap mat.

4. Using a multichannel pipette, add 200 μl VW1 buffer to each well, making sure to agitate the bead pellet.

5. Gently swirl the plate in a circular motion on the bench-top.

6. Wait 2 minutes for the beads to collect in the bottom of the well.

7. Aspirate the supernatent with the vacuum manifold.The recommended vacuum pressure is 50 mb.

8. Repeat addition of 200 μl VW1, swirling, and aspiration.

9. Do one of the following:a. Transport the VeraCode Bead Plate to the BeadXpress Reader to

be scanned.b. Seal the plate with an adhesive seal and store it in the dark at

ambient temperature until the BeadXpress Reader is ready.



Scan VeraCode Bead Plate

The BeadXpress Reader uses lasers to excite the Cy3 and Cy5 fluors of the single-stranded PCR products bound to the VeraCode beads. Light emissions from these fluors are then recorded in a data file. Fluorescence data are analyzed to derive genotyping results using Illumina’s BeadStudio software package.

Setup Prepare a Scan Settings file containing information about your samples, the BeadXpress Reader settings, and VeraCode beads.

Scan VBP For information about scanning VeraCode Bead Plates, see the section on scanning VeraCode Bead Plates in the BeadXpress Reader System Guide (Illumina part # 11220957).

Part # 11220990 Rev. A

Troubleshooting 65

Troubleshooting

Use the information in this section to troubleshoot various parts of the GoldenGate Assay for VeraCode.

DNA SamplePreparation

Use the following information as a guide for troubleshooting DNA sample preparation.

Hyb VBP Use the following information as a guide for troubleshooting the Hyb VBP step of the GoldenGate Assay for VeraCode.

Table 9 DNA Sample Preparation

Symptom Probable Cause Resolution Comments

Partial or entire contents of the wells in the XS#-SUR plate evaporated during the 95°C incubation.

The heat seal was not completely sealed to the plate, allowing evaporation.

Check the heat sealer to ensure that it is functioning properly. Some condensation

is normal.

The incorrect seal was used to seal the plate.

Use ABgene catalog # AB-0559 foil seals for this step.

Excessive condensation was observed on the bottom side of the heat seal after the Make ASE incubation.

The heated lid was not used.

Centrifuge the plate to remove condensation from the seal and proceed to the Add MEL step.

Condensation can be minimized by using a foil seal, ABgene catalog # AB-0559.

The heat block was left at 70°C overnight for the Make ASE incubation.

The heat block temperature was not set to 30°C after loading the plate into the heat block.

Repeat the experiment. The samples have been ruined.

Set the temperature to 30°C immediately after loading the GS#-ASE plate into the heat block.

Beads are difficult to resuspend during Add MEL and Inoc PCR.

The high-speed shaker may be out of calibration.

Recalibrate the high-speed shaker.

Particularly difficult samples can be resuspended manually using a pipetter.

Table 10 Hyb VBP


The cap mat came up in spots of the VBP during the 45°C incubation.

The cap mat was not completely sealed.

Use the cap mat applicator to ensure that the cap mat is completely sealed to the plate.



Signal Intensity Use the following information as a guide for troubleshooting signal intensity.

Analysis Use the following information as a guide for troubleshooting data analysis.

Table 11 Signal Intensity


Low intensity was observed in all the bead types of the VBP while scanning.

Incorrect wash buffer Repeat the experiment Use VW1 to wash the sample plate.

Incorrect PMT settingStop the current scan and rescan the VBP using a higher PMT setting.

This can only be done for the current column and those following it.

DNA concentration was too low

Recheck the DNA concentration with PicoGreen.

Table 12 Analysis


Low correlation between sample replicates

The incorrect cycler program was used or cycler temperature control problems occurred

Recheck the cycler program or measure the time for completion of GS#-PCR plate cycling. Expected times range from 2 hours and 45 minutes to to 3 hours and 5 minutes, depending on the cycler.

Times should always be recorded and compared to historical norms.

The post-hyb wash was not done after the 3-hour 45°C incubation

Repeat the experiment

Strong signal from multiple contamination controls observed in the control panel

The GS#-OPA tubes were pooled

For the contamination controls to be informative, do not pool the contents of multiple GS#-OPA tubes.

GS#-OPA tubs with the same barcode may still have different contamination controls.

Cross-contamination may have occurred

Avoid PCR amplicon contamination. Use the GoldenGate kit with UDG to control amplicon contamination. Treat lab work surfaces with 10% bleach and allow them to air-dry.

Part # 11220990 Rev. A

Troubleshooting 67

Cy3/Cy5 ratio was higher than usual in the second hybridization controls

The GS#-PCR plate with GS#-MPB beads in the Bind PCR process was subjected to excessive light

Protect GS-PCR plate from light exposure. Fluorescent lighting is permissible, but keep the plates in the dark when they are not in use.

Bleach or bleach fumes may have been present

Remove the bleach container during the procedure. Allow bleach fumes to dissipate after cleaning lab surfaces.

Bleach in sufficient concentration also affects Cy3

The post-washed VBP plate was subjected to excessive light prior to scanning

The samples appeared to have intensity but did not get called

There were fewer than three beads for that bead type.

The correct call can be made by looking at the raw intensities.

The genotyping results did not correlate with the samples

The plate orientations were reversed

Resort the data in inverse order, H12 to A1, and reanalyze it

Illumina recommends adding a positive known control sample in a standardized, non-symmetric well position.

The wrong Scan Settings file for use with the BeadXpress Reader and VeraScan software was loaded

Load the correct Scan Settings file.

The wrong OPA manifest was loaded into BeadStudio or associated with a sample sheet

Load the correct OPA manifest.

The samples were copied directly from the Scan Settings file to the sample sheet, or vice versa

Rearrange the sample names according to the templates for a row-major or column-major file

Table 12 Analysis (Continued)




Part # 11220990 Rev. A

Chapter 4

Bead Kitting


70 Materials

71 Kitting VeraCode Beads

82 Storing Kitted VeraCode Beads

82 Cleaning the VeraCode Bead Kitting System


70 CHAPTER 4Bead Kitting

Introduction

The VeraCode Bead Kitting System offers a unique approach to rapidly and accurately distribute VeraCode microbeads into standard 96-well microplates or stripwell plates.

Using the VeraCode Bead Kitting System streamlines the workflow of custom multiplexed assays by virtually eliminating manual pipetting. This system is specifically designed for use with VeraCode universal oligo and carboxyl bead sets.

Follow the bead kitting procedures described in this chapter to kit VeraCode beads for the assays described in Chapter 5, Universal Oligo Beads Example Protocol and Chapter 6, Carboxyl Beads Example Protocols.

Materials

Use the following materials and bead kitting procedure to kit VeraCode universal oligo or carboxyl beads.

VeraCode universal oligo beads or carboxyl beadsFor kitting VeraCode beads:

Table 13 Materials for Kitting VeraCode Beads

Item Source Catalog Number

VeraCode Bead Kitting System Illumina (included with the BeadXpress Reader System

VC-501-1000

8-pin aspirator Illumina included with VC-501-1000

Polypropylene strip wells or96-well polypropylene plate

Thermo Fisher orCorning

NC9514989 or3371

Polypropylene cap mat Corning 3080

Easy peel heat seals ABgene AB-0745

Storage plate cap strips ABgene AB-0981

EtOH 70% N/A N/A

EtOH 30% in 1X PBS, pH 7.4 N/A N/A

Vacuum manifold (or house vacuum) capability N/A N/A

Part # 11220990 Rev. A

Kitting VeraCode Beads 71

Kitting VeraCode Beads

Universal VeraCode beads are shipped in vials that contain enough beads for one 96-well plate. The vials may contain either a single bead type or a pool of 48 bead types. Each Universal VeraCode bead type has a unique sequence attached to its surface. These sequences are capture sequences for the downstream hybridization reaction. Vials of Universal VeraCode beads can be used individually, or they can be multiplexed to increase the number of bead types for a reaction. Universal VeraCode beads are supplied by Illumina in EtOH, and are stable in EtOH at -20°C.

Carboxyl VeraCode beads are shipped in vials that contain enough beads for six 96-well plates and are stable in EtOH at 4°C. After user-immobilization of the protein or nucleic acid, the immobilized Carboxyl VeraCode beads are quantitated and combined to form a multiplex bead pool. Protein-immobilized Carboxyl VeraCode beads are typically stored in a buffer containing protein (e.g., BSA), while nucleic acid-immobilized VeraCode Carboxyl beads are stored in a solvent (e.g., EtOH). Prior to kitting, protein-immobilized Carboxyl VeraCode beads stored in a BSA-containing buffer require a simple wash step to remove exogenous protein which interferes with the kitting process.

The VeraCode Bead Kitting System (Figure 15) is used to kit VeraCode beads for use with VeraCode assays. The VeraCode Bead Kitting System consists of three parts:

A deep reservoir (box)A funnel plate (funnel)A shallow reservoir (catch pan)

Table 14 Buffers for VeraCode Bead Types

VeraCode Bead Immobilized Molecule Storage Buffer Kitting Buffer

Universal Oligo Oligonucleotide 70% EtOH 70% EtOH

Carboxyl N/A 70% EtOH N/A

Carboxyl Protein 1x PBS/1% BSA 30% EtOH in 1x PBS

Carboxyl Oligonucleotide 70% EtOH 70% EtOH



Figure 15 VeraCode Bead Kitting System

In addition, the bead kitting process requires either a Thermo Fisher #NC9514989 strip well plate or a Corning #3371 polypropylene plate. Use strip well plates if you have fewer than 96 reactions in an experiment. The strips can be separated after kitting to enable you to perform multiples of eight reactions at a time.

Funnel Plate(Funnel)

(Catch Pan)Large Reservoir

(Box)Deep Reservoir

CAUTION

Do not cut a single well. The BeadXpress Reader needs eight wells per scan, although all eight wells don't have to be populated with beads. Do not try to kit a partial strip plate.

Part # 11220990 Rev. A


Kitting the Beads 1. Place the VeraCode Bead Kitting System on the lab bench, deep reservoir down (Figure 16).

Figure 16 VeraCode Bead Kitting System, Deep Reservoir Down

2. Press the rectangular gasket into place around the rim of the deep reservoir (Figure 17).

Figure 17 Placing Rectangular Gasket into Deep Reservoir

3. Add 160 mL kitting buffer to the deep reservoir (Figure 18).• For universal oligo beads: Use 70% EtOH as the buffer.• For carboxyl beads: Use 30% EtOH in 1X PBS, pH 7.4 as the buffer.



Figure 18 Adding Kitting Buffer

4. Perform the following steps to transfer the beads from the bead tube to the deep reservoir.

a. Vortex and pulse centrifuge prior to transferring the beads. This helps you dislodge beads from the walls and cap of the tube.

b. Using a 1000 μl pipette, transfer all of the bead solution to the deep reservoir (Figure 19).

NOTE

If you are using universal oligo beads and you need multiple codes in a plate, you must use multiple vials of beads.

If you are using stored protein-immobilized beads, remove enough beads from multiplex stock to deliver 30 beads per type per well. Wash 2x with 1x PBS, pH 7.4 to remove residual BSA from the storage buffer prior to kitting.

Part # 11220990 Rev. A


Figure 19 Transferring Beads

c. To rinse the tube, pipette 500 μl of buffer from the deep reservoir to the tube and transfer all of the rinse solution back into the deep reservoir.

d. Repeat the rinse 6x to ensure complete bead transfer.

5. Add the funnel plate to the deep reservoir (Figure 20).The funnel plate follows the guiding ribs to settle into the correct position.

Figure 20 Adding Funnel Plate

NOTEMake sure to rinse the walls and cap of the tube during the rinse steps.



6. Press the 96-hole gasket onto the funnel plate (Figure 21).

Figure 21 Pressing Gasket onto Funnel Plate

7. Put the plate upside-down on the gasket to match up with the funnel plate holes and press it down to seat it (Figure 22).

Figure 22 Putting Plate on Gasket

8. Close the VeraCode Bead Kitting System, and secure it with the latch (Figure 23).

Part # 11220990 Rev. A


Figure 23 Closing and Latching VeraCode Bead Kitting System

9. Holding the VeraCode Bead Kitting System with both hands, shake it with some force approximately 6 inches in every direction, as described in the following steps.

a. Rapidly shake the VeraCode Bead Kitting System 4x front to back, then 4x left to right.

b. Without pausing, repeat the shaking cycle for a total of 15-20 seconds (Figure 24).

CAUTION

Shake the VeraCode Bead Kitting System as fast as you can to ensure homogeneous bead distribution. If you shake in a slow, circular motion with little force, the beads will not mix properly.Do not pause between shaking and flipping as this will allow the beads to settle.

NOTEStep a. constitutes one shaking cycle and should take no more than 2-3 seconds.



Figure 24 Shaking VeraCode Bead Kitting System

c. Following the last shaking cycle, immediately flip the VeraCode Bead Kitting System upside-down onto the bench.

d. Tap the VeraCode Bead Kitting System firmly on the bench 5x to remove bubbles from the plate wells and funnel plate (Figure 25).

Figure 25 Flipping VeraCode Bead Kitting System

10. After tapping, place the VeraCode Bead Kitting System on the bench.

Part # 11220990 Rev. A


Let it rest for at least 1 minute to allow the beads to settle.

11. Perform the following steps to dislodge any beads that may be stuck on the funnel plate and walls of the VeraCode Bead Kitting System.

a. Firmly tap each of the four bottom edges of the VeraCode Bead Kitting System on the lab bench 5x (Figure 26).

Figure 26 Tapping VeraCode Bead Kitting System

b. Keeping the VeraCode Bead Kitting System level, firmly tap the bottom on the lab bench 5x.

c. Wait at least 1 minute to allow the beads to settle to the bottom of the wells.

d. Keeping the VeraCode Bead Kitting System level, firmly tap the bottom an additional 5x.

e. Wait at least 1 minute to let the beads settle.

12. Unlatch the VeraCode Bead Kitting System, wait 10—15 seconds to allow most of the excess liquid to seep out, then slowly open it (Figure 27).

CAUTIONWhen performing the following steps, do not tilt the VeraCode Bead Kitting System at an angle greater than 30°.



Figure 27 Opening VeraCode Bead Kitting System Slowly

13. Lifting straight up, remove the funnel plate and the attached gasket (Figure 28).

Figure 28 Removing Funnel Plate and Gasket from Deep Reservoir

Part # 11220990 Rev. A


14. Decant the excess liquid by angling the plate approximately 30 degrees against the side of the catch tray, and remove the plate from the catch tray (Figure 29).

Figure 29 Removing Plate from Deep Reservoir

15. Carefully aspirate off the kitting buffer using the 8-pin aspirator manifold.This leaves some EtOH in the bottom of each well. Do not try to remove all of the EtOH.For carboxyl beads only: a. Add 150 μl PBST (1 X Phosphate Buffered Saline + 0.05% Tween 20)

(0.05%) to the wells.b. Centrifuge at 1500 rpm for 5 seconds.c. Aspirate the wells with the 8-pin aspirator.d. Repeat steps a through c 2x.e. Do one of the following:

— If you are using the plate immediately:Proceed to the Multiplex Cytokine Protein Assay on page 121.

— If you are not using the plate immediately:Continue to Step 16.

16. Seal the plate by doing one of the following:For universal oligo beads: • If you are using Corning 96-well plates, seal with the cap mat

(Corning 3080). • If you are using the strip well plate, seal with strip caps

(ABgene AB-0981).For carboxyl beads: Add 150 μl PBS-BSA (1%) and seal the plate with the ABgene easy peel heat seal (AB-0745).



Storing Kitted VeraCode Beads

Store kitted VeraCode beads as described below.Store universal oligo beads at -20°C until you are ready to use them.Store carboxyl beads at 4°C until you are ready to use them.

Cleaning the VeraCode Bead Kitting System

To clean the VeraCode Bead Kitting System, perform the following steps:

1. Add about 100 mL of deionized water into the deep reservoir (box).

2. Place both gaskets into the deep reservoir.

3. Place the funnel plate into the deep reservoir.

4. Close the system with the latch.

5. Shake vigorously to clean the whole system.

6. Decant any liquid.

7. Repeat steps 1 through 6 2x.

8. Rinse the entire VeraCode Bead Kitting System (box, funnel, catch pan, and gaskets) under running deionized water to ensure that it is completely clean.

9. Let the VeraCode Bead Kitting System, gaskets, and funnels air-dry.

Part # 11220990 Rev. A

Chapter 5

Universal Oligo Beads Example Protocol



89 Designing PCR/ASPE Primers

91 Matching ASPE Primers to VeraCode Capture Sequences

93 Contamination and Controls

94 Two-Plate Protocol for Low-Plex Genotyping

99 Single-Plate Protocol for Low-Plex Genotyping

104 Troubleshooting


84 CHAPTER 5Universal Oligo Beads Example Protocol

Introduction

ASPE (Allele-Specific Primer Extension) is a method of SNP detection that uses two primers: one for the wildtype allele and one for the variant allele. Each ASPE primer is composed of two distinct regions. The 5' end contains the capture sequence which is used in subsequent hybridization reactions. The 3' end is the genomic region with the SNP nucleotide at the extreme 3' end.

The region of genomic DNA containing the SNP of interest is amplified by PCR. Both wildtype and variant ASPE primers are then annealed to the PCR product and undergo multiple rounds of primer extension incorporating biotin. In the case of a wildtype genotype, the wildtype primer extends preferentially over the variant primer because of the mismatch between the primer and the target DNA at the variant primer's 3' end. Likewise, in the case of a variant genotype, the variant primer extends preferentially over the wildtype primer. Only in the case of a heterozygote will both primers extend.

After the primer extension, the products are mixed with VeraCode beads. The capture sequence on the primers hybridizes to the capture sequence on the VeraCode beads. Wildtype and variant primers and products each hybridize to a unique bead type. Labeling is then performed with a streptavidin-fluorophore conjugate. Only biotinylated extension products will be labeled and subsequently produce a fluorescent signal during the scan.

The genotype of the SNP is determined by the ratio of the relative fluorescent levels (RFU) of the two bead types.

References S Bortolin, M Black H Modi, I Boszko, D Kobler, D Fieldhouse, E Lopes, J Lacroix, R Grimwood, P Wells, R Janeczko and R Zastawny, Validation of the Tag-It High-Throughput Microsphere-Based Universal Array Genotyping Platform: Application to the Multiplex Detection of a Panel of Thrombophilia-Associated Single-Nucleotide Polymorphisms, 2004, Clin Chem 50:11 2028-2036.

S Johnson, D Marshall, G Harms, C Miller, C Sherrill, E Beaty, S Ledered, E Roesch, G Madsen, G Hoffman, R Haessig, G Kipish, M Baker, S Benner, P Marrell, J Prudent, Multiplexed Genetic Analysis Using an Expanded Genetic Alphabet, 2004, Clin Chem 50:11 2019-2027.

NOTE

This protocol is an example of a low-plex genotyping assay protocol developed specifically for a thrombosis multiplexed panel of four SNPs. Optimization of other specific assays is required.

Part # 11220990 Rev. A

Introduction 85

Figure 30 PCR, ASPE Reaction, Hybridization




The following sections include information about the equipment, materials, and reagents you will need in order to perform VeraCode Assays using Universal Oligo Bead Sets on the BeadXpress Reader.

Universal OligoEquipment,

User-Supplied

Tube vortexerMicrotiter plate centrifuge with g-force range of 8–3000 xg.Spectrofluorometer (optional)

Gemini XS or XPS (Molecular Devices)8-channel precision pipettes (10 μl and 200 μl)

Optional: single-channel precision pipettes (10 μl and 200 μl)Stopwatch/timerCap mat applicator, Corning PN 3081Vacuum flask assembly (flask, stopper, tubing, and vacuum source)Vacuum regulator, Qiagen catalog # 19530

96-well thermocycler with heated lid

Universal OligoEquipment,

Illumina-Supplied


• BeadXpress Reader (110V or 220V)• Reagent carrier• Reagent and waste bottles• USB Cable, Type A-B, 1.0 Meter• Detachable AC Line Cord, 2.0.1• PC workstation with monitor• BeadXpress Reader System Manual (Illumina part # 11220957)• VeraCode Assay Guide (Illumina part # 11220990)• BeadXpress Reader System CD• BeadXpress Starter Kit (110V or 220V)Illumina Catalog # VC-120-1000, BeadXpress Starter Kit 110V or Illumina Catalog # VC-120-1001, BeadXpress Starter Kit 220V

included with:

Illumina Catalog # VC-101-1000, BeadXpress Reader System 110V or

Illumina Catalog # VC-101-1001, BeadXpress Reader System 220V or

• VeraCode Bead Kitting System• VeraCode Vortex Incubator (110V or 220V)• 8-pin vacuum manifold

Part # 11220990 Rev. A


Materials andReagents, User-

Supplied

This section describes materials and reagents that you must purchase from third-party vendors in order to perform VeraCode Assays using Universal Oligo Bead Sets on the BeadXpress Reader.

Safety glassesProtective glovesLab coatsPrimers for each SNP:• PCR primers (forward and reverse) for each target DNA• ASPE primers (wildtype and variant) for each SNPAssay reagents:

Additional materials:

Table 15 Assay Reagents


Platinum Taq Polymerase Invitrogen 10966-034

dNTPs Invitrogen 10297-018

Biotin dCTP Invitrogen 19518-018

Streptavidin-Alexa 647* Invitrogen S-32357

20X SSC Sigma S6639

Tween 20 (10% solution) Sigma P8942

Shrimp Alkaline Phosphatase USB 70092Y

Exonuclease I USB 70073Z

NOTE

Other fluorescent labels can be attached to the streptavidin.

There are two lasers in the BeadXpress Reader:One excites at 532 nm and has an optical filter that picks up 550–610nm transmitted light. One excites at 635 nm and has an optical filter that picks up 670–770 nm transmitted light.

Table 16 Additional Materials


PCR plates Fisher Scientific 08-408-225

Strip caps ABgene AB0602

PCR quick tubes with caps Phenix Research MPC-425



Materials,Reagents, and

Universal OligoBead Sets,

Illumina-Supplied

This section describes materials and reagents available from Illumina.

Multiplexed assays can be performed by combining individual Universal Oligo Bead Sets, by using a pre-pooled Universal Oligo Bead Set, or by using a combination of the two. For information about combining VeraCode Universal Oligo Bead Sets, see “Kitting the Beads” on page 73.

Illumina supplies 48 distinct VeraCode Universal Bead Sets (individual bead codes). The following materials are included in each set:

Illumina Catalog # VC-301-XXXX, VeraCode Universal Bead Set, Code XXXX

• VeraCode Universal Bead -XXXX (6 tubes)

Illumina supplies two VeraCode Universal Oligo Pooled Bead Sets (48-plex pooled bead codes). The following materials are included in each set:

Illumina Catalog # VC-301-0481, VeraCode Universal Bead Set, Code 0481

• VeraCode Universal Bead Pool (48-Plex) - 0481 (6 tubes)Illumina Catalog # VC-301-0482, VeraCode Universal Bead Set, Code 0482

• VeraCode Universal Bead Pool (48-Plex) - 0482 (6 tubes)

The following materials are required for performing any assay on the BeadXpress Reader, including assays using VeraCode Universal Oligo Bead Sets:




NOTE

For more information about individual and pooled Universal Oligo Bead Sets, see Universal Oligo Bead Sets Individual on page 139 and Universal Oligo Bead Sets Pools on page 145.

Part # 11220990 Rev. A

Designing PCR/ASPE Primers 89

Designing PCR/ASPE Primers

The ASPE method of genotyping requires two sets of primers.

The first set of primers consists of forward and reverse primers to amplify each genomic region containing SNPs of interest in the multiplexed PCR reaction.

The second set of primers consists of the wildtype and variant primers that define each SNP. This second set of primers is used in the multiplexed primer extension reaction.

PCR Primers To design PCR primers:Identify SNPs of interest.Design PCR primer pairs that encompass the SNP's using a multiplex PCR program such as:• The PCR Suite

(Klinische Genetica, Erasmus MC Rotterdam, Netherlands)• Primer3:

http://www2.eur.nl/fgg/kgen/primer/Genomic_Primers.htmlTarget a temperature of 60°C using the nearest neighbor algorithm and a 50% GC content.Keep PCR products as small as possible. • Ideally 100-200 bp• Try to design PCR products so each product can be differentiated on

a gel when multiplexed.Confirm the oligos don't exhibit self annealing or primer-dimer formation.Confirm there is no homology between any two primers in the multiplex mix at the hybridization temperature.Redesign any primers that don't meet the criteria.

ASPE Primers ASPE primers are designed around each SNP in the panel. For each SNP, there is one primer which matches the wildtype sequence, and one primer for each variant of interest. The 3’ end of each primer is the nucleotide location of the SNP. This differs from other genotyping methods in which the primer ends just before the SNP location.

For each SNP site there are two possible primer orientations: primers from the sense strand, or primers from the antisense strand.For each SNP, two primers need to be designed: wildtype and variant. These differ from each other by only a single base at the 3’ end.If there are multiple SNPs within one PCR product, make sure all ASPE primers are from the same strand to keep from making unwanted PCR products (see Figure 31).



Figure 31 Unwanted PCR Products from Poorly-Designed ASPE Primers

Otherwise, the strand used depends only on which one makes a better primer.• Keep the temperature of the primers close to 50°C.• Design both wildtype and variant primers from the same strand.• Use mfold or a similar product to ensure that there is no secondary

structure that could inhibit the ASPE reaction or hybridization.

Part # 11220990 Rev. A

Matching ASPE Primers to VeraCode Capture Sequences 91

Matching ASPE Primers to VeraCode Capture Sequences

Once you’ve designed the ASPE primers, a capture sequence needs to be added to the 5’ end of each primer. The capture sequence is the inverse complement of the capture sequence on the VeraCode bead.

Up to 144 VeraCode bead types are available as part of the Universal Capture Bead product. Each VeraCode bead type has a different capture sequence on its surface. Each of the ASPE primers must be paired to a unique VeraCode bead. For each SNP there will be one bead type for the wildtype allele, and one bead type for each of the variant alleles.

Each complete ASPE primer is between 40 and 50 bases long and is composed of three parts:

5’ (capture sequence) - (genomic sequence) - SNP 3’

For an example of the final ASPE primer construct, see Primers Used for Thrombosis Panel on page 92.

To match ASPE primers to VeraCode capture sequences:Assign each primer to a unique VeraCode.• Use each VeraCode only once.

— The wildtype and variant primers must have different VeraCodes.

Each ASPE primer is made by combining the inverse complement of the VeraCode to the 5' end of the ASPE primer. • Make sure the SNP nucleotide is at the very 3' end of the

combined primer.Check each combined primer for secondary structure using a program such as mFold: http://www.bioinfo.rpi.edu/applications/mfold/.• If there is structure that would persist at the hybridization

temperature, pick another VeraCode for that ASPE oligo.• It may take five or six iterations to get a complete set of ASPE oligos

matched with unique VeraCodes.

Check each combined primer against all other primers to confirm there is no homology (except for the wildtype/variant pairs). • If the SNP portion of a primer is homologous to a different SNP, try

creating the SNP oligo from the other strand (remember to change both the wildtype and the variant oligo).

• If the VeraCode portion is creating the homology, pick another VeraCode.

At the end of this process there will be: • A forward and reverse PCR primer for each gene section containing a

SNP of interest. • A wildtype and variant SNP attached to the inverse complement of a

unique VeraCode.

Primer and OligoGuidelines

All primers can be ordered desalted.


http://www.bioinfo.rpi.edu/applications/mfold/

http://www.bioinfo.rpi.edu/applications/mfold/


Primers Used forThrombosis Panel

The Thrombosis Panel SNPs used in this protocol are: Factor V G1691A, Factor II G20210A, MTHFR 667 C667T, and MTHFR 1298 A1298C.

The VeraCode is the identifier for the oligo on the bead. It is the inverse complement of the capture sequence. The sequence in blue is the capture sequence for the VeraCode used. The nucleotide in orange is the SNP nucleotide.

Table 17 Factor V

PCR forward CGCCTCTGGGCTAATAGGAC

PCR reverse GCCCCATTATTTAGCCAGGA

ASPE Wt VeraCode 5632 TACACAGCGACCGTACCATCGTAGGACAAAATACCTGTATTCCTC

ASPE Var VeraCode 6153 ATCCACAGCCGGGACTTTCGGTAGGACAAAATACCTGTATTCCTT

Table 18 Factor II

PCR forward GAACCAATCCCGTGAAAGAA

PCR reverse CCAGAGAGCTGCCCATGA

ASPE Wt VeraCode 5640 CCCTTTCGGACTGACAACCGGGACAATAAAAGTGACTCTCAGCG

ASPE Var VeraCode 5634 AGTGCCGGTATGATCGCTAACCACAATAAAAGTGACTCTCAGCA

Table 19 MTHFR 667

PCR forward CTTTGAGGCTGACCTGAAGC

PCR reverse CAAAGCGGAAGAATGTGTCA

ASPE Wt VeraCode 6146 TGCAAGATGCGGTTGGACTCCTAGAGAAGGTGTCTGCGGGAGC

ASPE Var VeraCode 6148 ACCTGGTTTAACCGTCGGCAACAGAGAAGGTGTCTGCGGGAGT

Table 20 MTHFR 1298

PCR forward AGGAGCTGCTGAAGATGTGG

PCR reverse CTTTGTGACCATTCCGGTTT

ASPE Wt VeraCode 5664 ACGTAACGCCGGTAACTCAGGTAACAAAGACTTCAAAGACACTTT

ASPE Var VeraCode 6145 GAGGATGCGAATGACACGTTGCAACAAAGACTTCAAAGACACTTG

Part # 11220990 Rev. A

Contamination and Controls 93

Contamination and Controls

The following sections address contamination containment and controls.

ContainingContamination

As the number of PCR reactions increases, the likelihood of PCR cross-contamination also increases. Use the following guidelines to reduce the possibility of cross-contamination.

1. Maintain complete separation of pre- and post-PCR areas, including reagents, materials, and equipment.

2. Perform regular bleaching and UV light treatment to reduce the risk of contamination.

3. Store reagents as single-use aliquots as soon as they are opened. This includes water, which is a common source of contamination.

4. Pulling the strip caps and strip mats off of the plates is another potential source of cross-contamination. It is critical that there is no splashing between the wells. Less than 1 μl of a PCR or ASPE product splashing into a neighboring well can affect your data quality.

5. Clean benches, racks, and pipetter tips with 10% bleach solution before an experiment.

Controls You should include a set of controls in all PCR experiments in order to help identify problems when they occur.

1. Negative controls should include non-DNA wells randomly included in PCR plates. For non-DNA wells, use water in place of a genomic sample. If carried through the hybridization, these samples should have very low fluorescent counts. If any of the samples has a high count, the data may be unreliable.

2. Positive controls should include a subset of samples of known genotypes. These controls confirm that the PCR and ASPE reactions are working.

3. A region of the genome with no known SNPs can be amplified in the multiplexed reaction. The ASPE primers would be the wildtype and a SNP that is known to be absent in the population. If this SNP gives any call other than wildtype, the data from the other SNPs in the well may be unreliable.

4. Include replicates in the plate. All replicates should give the same call. The CVs of the technical replicates should be low.

NOTEAutoclaving is not a reliable method of reducing the contamination of DNA.



Two-Plate Protocol for Low-Plex Genotyping

In this protocol, the ASPE and PCR reactions are performed in separate plates. One-fifth of the PCR reaction is used in the ASPE reaction. It is a robust protocol and is useful when new SNP panels are being designed. It is also the better protocol to use if either the ASPE primers or the PCR primers are not high quality.

The optimum concentration of primers for other SNP panels needs to be empirically determined. One way to optimize is to matrix multiple dNTP concentrations and primer concentrations. The optimum primer concentrations may be different for each SNP, but the optimal dNTP concentration must work for all primers.

PCR 1. Confirm concentrations of individual primers using a spectrophotometer and make adjustments as necessary.

2. Make a 10 μM stock solution of all Thrombosis PCR primers. Aliquot as single use and store unused primers at -20°C.

3. Make a stock solution of the nucleotides.The four deoxynucleotides are each at 5 mM in the stock solution. Aliquot as single use and store unused dNTPs at -20°C.

4. Genomic DNA should be between 10–100 ng/μl.

5. Program the thermocycler as follows:

PCR Program95°C 5 min30 cycles• 95°C 30 sec• 58°C 30 sec• 72°C 30 sec4°C Forever

NOTE

This protocol is specifically optimized for four SNPs related to thrombosis. The primer concentrations and PCR program times and temperatures may need to be adjusted for a different SNP panel.

NOTEThe concentrations of the PCR primers are critical to the success of this assay.

Part # 11220990 Rev. A

Two-Plate Protocol for Low-Plex Genotyping 95

6. Make enough master mix for the number of reactions in the experiment plus one or two extra reactions.

7. Transfer 14 μl of the master mix to each well or PCR tube.

8. Add 1 μl DNA (10–100 ng).

9. Place the PCR reactions in the thermocycler and run the PCR program.

Two-Plate ProtocolSAP/EXO

SAP/EXO is a mixture of Shrimp Alkaline Phosphatase and Exonuclease I. The Shrimp Alkaline Phosphatase is used to inactivate any remaining nucleotides from the PCR reaction. The Exonuclease I inactivates any remaining PCR primers.


SAP/EXO Program37°C 45 min99°C 15 min4°C Forever

2. Make enough master mix for the number of wells of PCR plus one or two extra reactions.

3. Centrifuge the PCR reactions for 1 minute.

Table 21 PCR Master Mix

Reagent Initial Concentration

Volume μl/Reaction

Concentration in Reaction

TAQ Buffer 10X 1.5 1X

MgCl 50 mM 0.5 1.67 mM

dNTPs 5 mM 0.6 200 μM

PCR primer mix 10 μM 1 10 pmol each

Water N/A 10.25 N/A

Platinum TAQ 5 units/μl 0.15 0.75 units

Table 22 SAP/EXO Master Mix


Volume μl/Reaction


Shrimp Alkaline Phosphatase

1 unit/μl 2 2 units

Exonuclease I 10 units/μl 0.5 5 units



4. Add 2.5 μl of the SAP/EXO master mix to each PCR reaction.

5. Run the SAP/EXO program.

Two-Plate ProtocolASPE

During the ASPE reaction, multiple rounds of primer extension are performed, during which biotinylated dCTPs are incorporated into extension products. Primers with a match at the 3’ terminus are preferentially extended.

1. Add TE (10 mM Tris pH 7 1 mM EDTA) to each ASPE primer to approximately 100 μM.

2. Confirm the concentrations of the individual primers with a spectrophotometer and adjust as necessary.

3. Make a working stock solution of all the ASPE primers (5 μM). Aliquot as single use and store unused primers at -20°C.

4. Make a 100 μM stock solution of the unlabeled nucleotides (dATP, dGTP, dTTP). Aliquot as single use and store unused primers at -20°C.

5. The biotin dCTP is used neat.

ASPE program96°C 120 sec40 cycles• 94°C 30 sec• 54°C 30 sec• 74°C 60 sec4°C Forever

CAUTIONUse caution when removing strip caps. Contamination between wells will negatively impact your results.

NOTE

This protocol is specifically optimized for the Thrombosis SNP Panel. The primer concentrations and PCR program times and temperatures may need to be adjusted for a different SNP panel.

Part # 11220990 Rev. A

Two-Plate Protocol for Low-Plex Genotyping 97

This procedure can be stopped and stored at the end of the PCR program, the end of the SAP/EXO cycle, or the end of the ASPE program. If the procedure is not completed in one day, store the products at 4°C until used. The ASPE product can be stored for at least 1 week without degradation.

6. Put 17 μl ASPE premix into each well of the new PCR plate.

7. Centrifuge the PCR/SAP/EXO reactions for 1 minute.

8. Add 3 μl of the PCR/SAP/EXO reaction to the ASPE premix.

9. Run the ASPE program.

Hybridization The ASPE primer extension products are hybridized to the VeraCode beads that have been kitted into 96-well polypropylene plates or stripwell plates. If there are fewer than 96 reactions, use a subset of stripwells. Do not cut the stripwells.

The first step is to exchange the EtOH in the wells with hybridization buffer. The ASPE reaction is then added to the beads and hybridized for one hour. The hybridization reaction is then fluorescently labeled.

1. Use streptavidin coupled to a fluorescent label that excites at 532 nm or 635 nm and emits between 550 nm–610 nm or 670 nm–770 nm.

2. Make the hybridization buffer.• 3X SSC• 0.1% TWEEN• sterile filter

3. Remove the kitted VeraCode Beads (in 70% EtOH) from the freezer and allow them to warm up to ambient temperature.

Table 23 ASPE Master Mix


Volume μl/Reaction


TAQ Buffer 10X 2 1X

MgCl 50 mM 0.5 1.58 mM

dATP, dGTP, dTTP 100 μM 1.0 5 μM

Biotin 14-dCTP 400 μM 0.25 5 μM

ASPE primer mix 5 μM 1.0 5 pmol

Water N/A 12.05 N/A

Platinum TAQ 5 units/μl 0.2 1 unit




4. Add 150 μl of the hybridization buffer to the kitted VeraCode beads and mix briefly.

5. Let with plate sit for 1 minute to allow the beads to settle.

6. Use the 8-channel aspiration manifold to carefully aspirate off the buffer/EtOH mix. Be sure to aspirate thoroughly. You may need to perform several aspira-tions until there is no more liquid being aspirated.

7. Centrifuge the ASPE reaction for 1 minute.

8. Add 5 μl of an ASPE reaction to a well of beads with hybridization buffer.

9. Hybridize 1 hour at 45°C with agitation (1000 rpm/setting of 100) in the VeraCode Vortex Incubator.

10. Make enough Streptavidin mix for each well. Assume 50 μl per well.• 3.75 μl Streptavidin-Alexa-647• 1 mL Hybridization buffer

11. Centrifuge the plate of hybridized beads for 2 minutes.

12. Add 50 μl streptavidin mix to each well.

13. Incubate for 15 minutes at ambient temperature while shaking.

14. Make sure to cover the plate with foil, to minimize exposure to light.

15. Uncover and scan the VeraCode Bead Plate. See the BeadXpress Reader System Manual (Illumina part # 11220957) for BeadXpress Reader operation instructions.

NOTE

If there are extra wells that have beads but will not have a hybridization reaction, the beads can be pipetted out for later use, or you can add the SA-hybridization buffer and treat the data as blanks.

CAUTIONUse caution when removing PCR strip caps. Contamination between wells will negatively impact your results.

Part # 11220990 Rev. A

Single-Plate Protocol for Low-Plex Genotyping 99

Single-Plate Protocol for Low-Plex Genotyping

The single-plate protocol is faster than the two-plate protocol, uses fewer reagents, and eliminates transfer from one plate to another. This method may require extensive optimization in order to achieve robust performance.

PCR 1. Confirm concentrations of individual primers using a spectrophotometer and make adjustments as necessary.

2. Make a 2 μM stock solution of all Thrombosis PCR primers. Aliquot as single use and store unused primers at -20°C.

3. Make a stock solution of all four deoxynucleotides (1 mM each). Aliquot as single use and store unused dNTPs at -20°C.

Genomic DNA should be between 10–100 ng/μl.


PCR Program95°C 5 min30 cycles• 95°C 30 sec• 58°C 30 sec• 72°C 30 sec4°C Forever


CAUTIONThe concentrations of the PCR primers are critical to the success of this assay.

NOTE

The optimum concentration of primers for other SNP panels will have to be empirically determined. One way to optimize is to matrix multiple dNTP concentrations and primer concentrations. The optimum primer concentrations may be different for each SNP but the optimal dNTP concentration must work for all primers. For more information, see the Troubleshooting section in this chapter.


NOTEIt is important to limit the amount of PCR product made. This is accomplished by limiting both the primers and the nucleotides in the PCR reaction.



6. Transfer 14 μl of the master mix to each well or PCR tube.

7. Add 1 μl DNA (10–100 ng).

8. Place the PCR reactions in the thermocycler and run the PCR program.

Single-PlateProtocol SAP/EXO

SAP/EXO is a mixture of Shrimp Alkaline Phosphatase and Exonuclease I. The Shrimp Alkaline Phosphatase is used to inactivate any remaining nucleotides from the PCR reaction. The Exonuclease I inactivates any remaining PCR primers.


SAP/EXO Program37°C 25 min99°C 15 min4°C Forever

2. Make enough master mix for the number of wells of PCR plus one or two extra reactions.

3. Centrifuge the PCR reaction for 1 minute.

4. Add 2 μl of the SAP/EXO master mix to each PCR reaction.

5. Run the SAP/EXO program.

Table 24 PCR Master Mix


Volume μ/Reaction


TAQ Buffer 10 X 1.5 1X

MgCl 50 mM 0.5 1.6 mM

dNTPs 1 mM 0.6 40 μM

Primer mix 2 μM 1 2 pmol

Water N/A 10.25 N/A

Platinum TAQ 5 units/μl 0.15 0.75 units

Table 25 SAP/EXO Master Mix


Volume μl/Reaction


Shrimp Alkaline Phosphatase

1 unit/μl 1.6 1.6 units

Exonuclease I 10 unit/μl 0.4 4 units

Part # 11220990 Rev. A


Single-PlateProtocol ASPE

During the ASPE reaction, multiple rounds of primer extension are performed, during which biotinylated dCTPs are incorporated into extension products. If a SNP is absent, that primer does not extend, and the fluorescent counts are low in the subsequent hybridization. In the case of a heterozygote, both primers extend. In the single-plate protocol, the ASPE primers are added directly to the PCR reaction following the SAP/EXO step.

1. Add TE (10 mM Tris pH 7.0 1 mM EDTA) to each ASPE primer to approximately 100 μM.

2. Confirm the concentrations of the individual primers with a spectrophotometer and adjust as necessary.

3. Make a 5 μM working stock solution of all of the ASPE primers.

4. Aliquot as single use and store unused primers at -20°C.

5. Make a 100 μM stock solution of the unlabeled nucleotides (dATP, dGTP, dTTP).

6. Aliquot as single use and store unused dNTPs at -20°C.

7. The Biotin is used neat.

ASPE Program96°C 120 sec40 cycles• 94°C 30 sec• 54°C 30 sec• 74°C 60 sec4°C Forever


NOTE

This protocol is specifically optimized for four SNPs related to thrombosis. The primer concentrations and PCR program times and temperatures may need to be adjusted for a different SNP panel.



9. Centrifuge the PCR/SAP/EXO reactions for 1 minute.

10. Add 5 μl of the ASPE premix to each PCR reaction.

11. Run the ASPE program.

Hybridization The ASPE primer extension products are hybridized to the VeraCode beads that have been kitted into 96-well polypropylene plates or stripwell plates. If there are not 96 reactions, a subset of strip wells can be used. Do not cut the stripwells. The first step is to exchange most of the EtOH in the wells with hybridization buffer. The ASPE reaction is then added to the beads and hybridized for 30 minutes. Following the hybridization, the reaction is fluorescently labeled.

1. Use streptavidin coupled to a fluorescent label that excites at 532 nm or 635 nm and emits between 550 nm–610 nm, or 670 nm–770 nm.

2. Make hybridization buffer:• 3X SSC• 0.1% TWEEN• sterile filter

3. Remove the kitted VeraCode Beads (in 70% EtOH) from the freezer and allow to warm up to ambient temperature.

4. Add 150 μl of the hybridization buffer to the kitted VeraCode beads and mix briefly.

5. Let with plate sit for 1 minute to allow the beads to settle.

Table 26 ASPE Master Mix


Volumeμl/Reaction


TAQ Buffer 10X 0.7 1X

MgCl 50 mM 0.125 1.58 mM

dATP, dGTP, dTTP 100 μM 1.0 4.5 μM

Biotin 14-cDTP 400 μM 0.25 4.5 μM

ASPE primer mix 5 μM 1.0 5 pmol

Water N/A 1.73 N/A

Platinum TAQ 5 units/μl 0.2 1 unit


Part # 11220990 Rev. A


6. Use the 8-pin aspiration manifold to carefully aspirate off the buffer/EtOH mix. Be sure to aspirate thoroughly. You may need to perform several aspira-tions until there is no more liquid being aspirated.

7. Centrifuge the ASPE reaction for 1 minute.

8. Add 10 μl of an ASPE reaction to a well of beads.Hybridize 30 minutes at 45°C with agitation (1000 rpm/setting 100) in the VeraCode Vortex Incubator.

9. Make enough Streptavidin mix for each well. Assume 50 μl per well.• 3.75 μl Streptavidin-Alexa-647• 1 mL Hybridization buffer

10. Centrifuge the plate of hybridized beads for 2 minutes.

11. Add 50 μl streptavidin mix to each well.

12. Incubate at ambient temperature 15 minutes.

13. Scan the VeraCode Bead Plate using the BeadXpress Reader.For information about scanning VeraCode Bead Plates using the BeadX-press Reader, see the BeadXpress Reader System Manual (Illumina part # 11220957).

NOTE

If there are extra wells that have beads but will not have a hybridization reaction, the beads can be pipetted out for later use, or you can add the SA-hybridization buffer and treat the data as blanks.




Troubleshooting

Use the information in the following sections to troubleshoot this assay.

OptimizationReaction

Optimization of the primers is necessary when a new SNP panel is being developed or a new lot of primers is used. The quality of primers can vary tremendously from lot to lot depending on the supplier. Poor quality or quantitation will result in low fluorescent counts and miscalls in the data. To avoid this, it is recommended that you set up a small matrixed experiment whenever new lots of primers are used. It is important to use at least 5–10 samples of known genotypes for this experiment in order to generate enough data.

1. Determine the concentration of the individual PCR primers.

2. Make a solution with each PCR primer at 10 μM.

3. For each sample, perform three 2-plate PCR reactions using 1.25 μl primer (12.5 pmoles), 1 μl primer (10 pmoles), and 0.75 μl primer (7.5 pmoles). You must adjust the water for the different volumes.

4. For each PCR reaction, perform a normal SAP/EXO two-plate reaction following the PCR.

5. Determine the concentration of the individual ASPE primers.

6. Make a solution with each ASPE primer at 10 μM.

7. Make dilutions of the ASPE primers to 5 μM, 2.5 μM, 1 μM, and 0.5 μM.

8. Each PCR reaction can be used in four ASPE reactions. For each PCR reaction, perform a two-plate ASPE reaction at each of the ASPE primer concentrations.

9. Perform a normal two-plate protocol hybridization and labeling.At the end of this experiment, there are 12 data points for each SNP in each sample.

Table 27 Optimization Reaction

PCR Primer Concentrations

ASPE Primer Concentrations

12.5 μM PCR5 μM ASPE

10 μM PCR5 μm ASPE


12.5 μM PCR2.5 μM ASPE

10 μM PCR2.5 μm ASPE








Part # 11220990 Rev. A

Troubleshooting 105

The best concentrations for each SNP is the set that gives the largest separation of genotypes, the tightest cluster within a genotype, and the highest fluorescent counts. This is easily visualized using the genoplots in BeadStudio.

AdditionalInformation

1. The one-plate protocol can be used when the oligos are of high quality; i.e., when most of them are full-length. If a substantial portion of the oligos are less than full-length, Illumina recommends using the two-plate protocol, or using purified oligos, especially in the ASPE reaction. The two-plate protocol is advantageous for development because it yields multiple replicates from each ASPE and PCR reaction.PCR reactions can be tested by running an aliquot on an agarose gel. ASPE reactions can also be run on a gel. The results of an ASPE gel is the loss of the PCR bands and the addition of multiple bands between the primers and the upper PCR product. The ASPE reaction does not yield one discrete band for each SNP.

Figure 32 PCR Gel, ASPE Gel

2. Make sure the concentrations of primers and dNTPs are correct. Do not rely on the data from the oligo manufacturer.

3. Evaporation in the PCR and ASPE reactions can lead to poor results. Strip well caps appear to prevent evaporation better than the foil seal.

4. Omitting the SAP/EXO step reduces the yield of ASPE products and leads to poor results.

5. High concentrations of ASPE products in the hybridization inhibit the hybridization and result in low RFUs.

6. Decreasing the hybridization time can lead to low signal and poor results.

7. You can add the Streptavidin directly to the hybridization, thereby eliminating one step. However, when you do this, the background RFUs

CAUTIONWhen you order new oligos, Illumina recommends that you run tests to confirm that they behave similarly to existing oligo stocks. Incorrect concentrations (too high or too low) will affect the efficiency of the PCR and ASPE reactions.



tend to rise slightly. This should only be done when the PCR and ASPE reactions are of the highest quality.

8. Contamination can be a major source of error. Take great care when removing the caps from the PCR and ASPE reactions. Even 1 μl of sample splashing into another well can cause degradation of the calls. Contamination tends to move all calls in a well towards heterozygotes while the fluorescent values remain in the normal range.

Part # 11220990 Rev. A

Chapter 6

Carboxyl Beads Example Protocols



112 One-Step Carbodiimide Coupling of Amine-Terminated Oligos to Carboxyl VeraCode Beads

114 Two-Step Protein Immobilization to Carboxyl VeraCode Beads

117 Quantitation and Manual Bead Kitting

120 Multiplex Cytokine Reagent Preparation

121 Multiplex Cytokine Protein Assay

124 Troubleshooting


108 CHAPTER 6Carboxyl Beads Example Protocols

Introduction

Cytokines are low-molecular-weight, hormone-like polypeptides which are secreted in the course of immunologic and inflammatory responses. They are important regulators of cell-mediated and humoral immune responses, and their expression has been associated with a wide variety of immune disorders. Cytokines function on a variety of cell types, having both stimulatory and inhibitory effects on proliferation, differentiation, and maturation.

The enzyme-linked immunosorbent assay (ELISA) is the most commonly-reported method for the quantitation of secreted cytokines. However, the ELISA assay only measures a single cytokine level in any biological system. It requires more reagents, technician time, and larger sample volumes. In addition, it provides only partial information relevant to the response on a systematic level.

The use of multiplexed technology over conventional assay methods has advantages including:

simultaneous analyte detectionreduction of sample and reagent volumeshigh throughput of test results

This chapter describes a multiplexed cytokine assay using VeraCode beads based on the sandwich format. This assay provides detection of multiple cytokines from a single sample. A capture antibody is covalently bound to the carboxyl VeraCode bead surface. Samples are then incubated, and the antibody-bound VeraCode beads capture the analyte from solution. A conjugated secondary antibody (i.e., biotin) is added. This biotinylated detection antibody binds to the analyte and completes the “sandwich.” The complex is then incubated with a Streptavidin:Phycoerythrin label. The VeraCode beads are then ready to be scanned in the BeadXpress reader.

NOTEThese protocols are example protocols using carboxyl beads. Optimization of other specific assays is required.

Part # 11220990 Rev. A



The following sections include information about the equipment, materials, and reagents you will need in order to perform VeraCode Assays using Universal Oligo Bead Sets on the BeadXpress Reader.

CarboxylEquipment,

User-Supplied

Tube vortexerMicrotiter plate centrifuge with g-force range of 8–3000 xg.Spectrofluorometer (optional)

Gemini XS or XPS (Molecular Devices)8-channel precision pipettes (10 μl and 200 μl)

Optional: single-channel precision pipettes (10 μl and 200 μl)Stopwatch/timerCap mat applicator, Corning PN 3081Vacuum flask assembly (flask, stopper, tubing, and vacuum source)Vacuum regulator, Qiagen catalog # 19530

96-well thermocycler with heated lidPlate shaker

Labline Instruments, Melrose Park, Illinois

CarboxylEquipment,

Illumina-Supplied


• BeadXpress Reader (110V or 220V)• Reagent carrier• Reagent and waste bottles• USB Cable, Type A-B, 1.0 Meter• Detachable AC Line Cord, 2.0.1• PC workstation with monitor• BeadXpress Reader System Manual• VeraCode Assay Guide• BeadXpress Reader System CD• BeadXpress Starter Kit (110V or 220V)Illumina Catalog # VC-120-1000, BeadXpress Starter Kit 110V or Illumina Catalog # VC-120-1001, BeadXpress Starter Kit 220V

included with:Illumina Catalog # VC-101-1000, BeadXpress Reader System, 110V orIllumina Catalog # VC-101-1001, BeadXpress Reader System, 220V

• VeraCode Bead Kitting System

• VeraCode Vortex Incubator (110V or 220V)• 8-pin vacuum manifold



Materials andReagents, User-

Supplied

GeneralSafety glassesProtective glovesLab coats

Quantitation and Kitting1 X Phosphate Buffered Saline (1X PBS)1 X Phosphate Buffered Saline + 1% Bovine Serum Albumin (PBS/BSA)1 X Phosphate Buffered Saline + 0.05% Tween 20 (PBST)Wide-orifice pipette tips for Rainin Multichannel LTS Rainin HR-250W Reagent Reservoirs• 25 mL divided Matrix #8096• 50 mL Corning #4870

One-Step Carbodiimide Coupling of Amine-Terminated Oligos to Carboxyl VeraCode Beads

EDC (freshly-made solution; 50 mg/mL in 0.1 M MES, pH 4.5; Pierce Cat # 22980)5' Amine-terminated oligonucleotides (1 uM synthesis is recommended)0.1 M MES, pH 4.5

Two-Step Protein Immobilization to Carboxyl VeraCode Beads

0.1 M MES, pH 4.5Sulfo-NHS (freshly-made solution; 50 mg/mL in 0.1 M MES, pH 4.5; Pierce Cat # 24510)EDC (freshly-made solution; 50 mg/mL in 0.1 M MES, pH 4.5; Pierce Cat # 22980)PBS-Tween 20 (0.2%)PBS-BSA (1%) (Stored at 4ºC)PBS-BSA (1%)-Proclin 300 (Stored at 4ºC)BSA (Stock solution used to make 1% PBS-BSA) Sigma BSA 98% (# A7030-10g)1 M NaCl in ultra-pure water

Multiplex Cytokine Protein Assay10x biotinylated detection antibody pool (stored at 4ºC)Multiplex high standard pool (stored at -80ºC)Multiplex cytokine standard beads (stored at 4ºC)Streptavidin Phycoerythrin (stored at 4ºC; 1 mg/mL)Cytokine Standards Diluent (CSD)Cytokine Reagent Diluent (CRD)

Part # 11220990 Rev. A


PBS/T/BSA (PBS pH 7.4, 0/1% BSA-Fraction V, 0.05% Tween 20, Pro-clin 300)

Wash BufferPBS/T (PBS pH 7.4 and 0.05% Tween 20)

Materials,Reagents, andCarboxyl BeadSets, Illumina-

Supplied

Illumina Catalog # VC-311-XXXX, VeraCode Carboxyl Bead Sets




NOTEFor ordering information for VeraCode Carboxyl Bead Sets, see Appendix C, Carboxyl Bead Sets.



One-Step Carbodiimide Coupling of Amine-Terminated Oligos to Carboxyl VeraCode Beads

Materials/Reagents Carboxyl VeraCode beadsEDC5' Amine-terminated oligonucleotides0.1M MES, pH 4.5

AdditionalEquipment

RockerVortexerPlate shakerMicrocentrifuge

Procedure 1. Bring the EDC to ambient temperature prior to use (~15–30 minutes).

2. Resuspend the amine-terminated oligo to 1 mM in water.

3. Wash the carboxyl VeraCode beads (1 tube) 2x with 0.1 M MES, pH 4.5.

4. Remove the supernatant and resuspend in 50 μl 0.1M MES, pH 4.5.

5. Vortex to mix.

6. Prepare a dilution of 1 μM oligo in deionized water.

7. Add 20 μl of the diluted oligo to the microbeads and mix by vortexing.

8. Prepare a fresh solution of 50 mg/mL EDC in 0.1 M MES, pH 4.5.

9. Add 20 μl of fresh 50 mg/mL EDC solution to microbeads and mix by vortexing.

10. Incubate at ambient temperature for 30 minutes in the VeraCode Vortex Incubator with the speed set at 100 rpm.

11. Prepare a second fresh solution of 50 mg/mL EDC in 0.1 M MES, pH 4.5.

12. Add 20 μl of fresh 50 mg/mL EDC.

13. Incubate at ambient temperature for 30 minutes in the VeraCode Vortex Incubator with the speed set at 100 rpm.

14. Centrifuge the tube to pellet the beads, and remove the supernatant.

NOTEEDC should be white in color. If it is not white, use new EDC. Purchase the smallest available quantity of EDC to avoid oxidation.

NOTESerial titration of 100 μM oligonucleotide is recommended to achieve optimal performance.

Part # 11220990 Rev. A

One-Step Carbodiimide Coupling of Amine-Terminated Oligos to Carboxyl VeraCode Beads 113

15. Add 1.0 mL of 0.02% Tween 20 in deionized water.

16. Vortex (or centrifuge) and let the microbeads settle.

17. Remove the supernatant.

18. Repeat the Tween wash 2x (3x total).

19. Add 1.0 mL of 0.1% SDS in deionized water.

20. Vortex (or centrifuge) and let the microbeads settle.

21. Remove the supernatant.

22. Repeat the SDS wash 2x (3x total).

23. [Optional] Incubate 1 hour with 1M NaCl in water.

24. Wash 3x with EtOH.

25. Store it at -20ºC in EtOH.



Two-Step Protein Immobilization to Carboxyl VeraCode Beads

Materials/Reagents VeraCode Vortex IncubatorCarboxyl VeraCode beads (1 tube)0.1M MES, pH 4.5Sulfo-NHS (freshly-made solution; 50 mg/mL in 0.1 M MES, pH 4.5; Pierce Cat # 24510)EDC (freshly-made solution; 50 mg/mL in 0.1 M MES, pH 4.5; Pierce Cat # 22980)PBS-Tween 20 (0.2%)PBS-BSA (1%) (Stored at 4ºC)PBS-BSA (1%) Proclin 300 (Stored at 4ºC)BSA (Stock solution used to make 1% PBS-BSA) Sigma BSA 98% (# A7030-10g)1M NaCl in ultra-pure water

Preparation Perform the following steps to prepare for the antibody immobilization procedure.

1. Bring the carboxyl beads to ambient temperature (15-30 minutes).

2. Determine the batch size for immobilization.See Table 28 to determine the total volume based on the amount of beads.

Table 28 Antibody Immobilization, Total Volume

# VeraCode Tubes

# VeraCode Beads/Tube

Capture Antibody (μg/mL) Total Volume (μl)

1 24667 100 300

2 49334 100 300

3 74001 100 500

4 98668 100 500

5 123335 100 1000

6 148002 100 1000

NOTEThis concentration is used as a starting point. Illumina recommends that you optimize antibody concentration based on the requirements of your assay.

Part # 11220990 Rev. A

Two-Step Protein Immobilization to Carboxyl VeraCode Beads 115

3. Wash the beads 3x with 1.0 mL of 0.1 M MES, pH 4.5. A wash consists of the following steps:a. Add 1.0 mL of buffer.b. Allow beads to settle for approximately 30 seconds or

pulse centrifuge.c. Gently remove the buffer with a 1.0 mL pipette without disturbing

the beads.

4. Make Sulfo-NHS in 0.1 M MES pH 4.5. The final concentration is 50 mg/mL. Use Table 29 as a guide.

5. Mix briefly by vortexing.

6. Make EDC in 0.1 M MES, pH 4.5. The final concentration is 50 mg/mL. Use Table 30 as a guide.

7. Incubate at ambient temperature for 1 hour in the VeraCode Vortex Incubator with the speed set at 100 rpm to activate the beads.

NOTEVacuum aspiration wash can be used instead of manual pipetting. Be careful not to disturb the bead pellets when aspirating.

Table 29 Dilution of Sulfo-NHS

Number of Tubes mg Sulfo-NHS vol 0.1M MES

1 30 600

5 150 3000

10 300 6000

Table 30 Dilution of EDC

Number of Tubes mg EDC vol 0.1M MES

1 30 600

5 150 3000

10 300 6000

NOTE

Make sure that the tubes are mixing properly, especially if you are using a VariMixer or a rocker mixer at this step. Many rocker mixers do not achieve a sufficient angle to allow mixing. Vortex briefly and invert manually to facilitate mixing.



8. Pulse centrifuge the beads to ensure that they are settled at the bottom and that none remain in the cap.

9. Remove supernatant.

10. Wash 2x with 1.0 mL 0.1 M MES, pH 4.5.

AntibodyImmobilization

Procedure

1. Add antibody solution (100 μg/mL in 0.1 M MES, pH 4.5) to the carboxyl beads (see Table 28).

2. Vortex briefly.

3. Incubate at ambient temperature for 1 hour in the VeraCode Vortex Incubator with the speed set at 100 rpm.

4. Pulse centrifuge the beads to ensure that they are settled at the bottom and that none remain in the cap.

5. Wash 2x with PBST (0.2%).

6. Wash 2x 1M NaCL in water.

7. Incubate at ambient temperature for 1 hour in the VeraCode Vortex Incubator with the speed set at 100 rpm.

8. Wash 2x PBS/BSA (1%).

9. Incubate PBS/BSA (1%) at ambient temperature for 1 hour in the VeraCode Vortex Incubator with the speed set at 100 rpm.

10. Wash 2x PBS/BSA (1%).

11. Store at 4ºC in PBS/BSA (1%) with ProClin.

12. Store at 4ºC in 1.0 mL PBS/BSA/Proclin 300 (1%)

13. Continue to Pooling of Individual Immobilized VeraCode Beads.

NOTE Make sure all tubes are mixing well.

NOTE

This incubation is performed to remove non-specifically bound capture antibody which may occur during the immobilization procedure. If you have tested sufficiently, you may eliminate this step.

Part # 11220990 Rev. A

Quantitation and Manual Bead Kitting 117

Quantitation and Manual Bead Kitting

Materials/Reagents Buffers1 X Phosphate Buffered Saline (1X PBS)1 X Phosphate Buffered Saline + 1% Bovine Serum Albumin (PBS/BSA)1 X Phosphate Buffered Saline + 0.05% Tween 20 (PBST)

AdditionalEquipment

Wide-orifice pipette tips for Rainin Multichannel LTS Rainin HR-250W Reagent Reservoirs• 25 mL divided Matrix #8096• 50 mL Corning #4870

ManualQuantitation

Procedure forCarboxyl Beads

Use the following protocol for manual quantitation of carboxyl beads after immobilization of protein. The beads are counted using a conventional light or inverted microscope (<10X objective).

1. Vortex bead stock(s) in 2.0 mL screw-cap tubes for 30 seconds.

2. Place 1.0 mL of 1X PBST (0.05%) in duplicate tube(s).

3. Using a P200 pipette with a wide orifice tip set to deliver 50 μl, place 1.0 mL of buffer in duplicate tube(s) (PBS/BSA or PBST).

4. Hold the stock bead tube on an angle (~45 degrees).

5. Place the pipette tip about halfway inside stock tube.

6. Aspirate up and down 10x. Look for good mixing of beads.

7. On the tenth time, remove 50 μl of stock beads.

8. Transfer beads and buffer to 1.0 mL of buffer (PBS/1% BSA or PBST).The dilution factor is now 1:20.

9. Vortex diluted beads for 30 seconds.

10. Set the P200 pipette to 50 μl (200 μl wide-bore tips).

11. Repeat the aspiration steps 5 and 6.

12. Place 50 μl on microscope slide; repeat three times (3 x 50 μl spots per slide).

13. Count the beads per 50 μl spot using a light microscope.

14. Calculate the average number of beads per 50 μl spot.

15. To make a multiplex beadpool, pool individual beads to equal numbers per mL (i.e., approximately 20,000 of each bead type per mL).

16. Calculate the total number of beads, assuming a dilution factor of 400.

Manual KittingProcedures for

Carboxyl Beads

There are two manual kitting protocols for carboxyl beads:Individual Microwell Kitting ProtocolMultichannel Kitting Protocol



Individual Microwell Kitting Protocol

Use this individual microwell kitting protocol to deliver beads to individual microwells using a standard pipette.

1. Place 1.2 mL of PBS/BSA in 2.0 mL screw-cap tube.

2. Using a 200 μl wide-bore tip, add the desired volume of stock beads (calculated above) to yield 30 of each bead type per 50 μl of final volume.

3. Hold tube on an angle (~45 degrees).

4. Place pipette tip (wide-bore) about halfway inside tube.

5. Aspirate up and down 10x (look for good resuspension of beads).


7. Place 50 μl of beads in a well.

8. Repeat steps 5 through 7 for each well.

Multichannel Kitting Protocol

Use this multichannel kitting protocol to deliver beads to individual microwells using an 8-channel multichannel pipette.

1. Add desired volume of stock beads to yield 30 beads per 50 μl volume in 6.0 mL buffer.

2. Vortex the diluted beads for 15 seconds.

3. Place the beads in multichannel reservoir.

4. Aspirate up and down 10x.


NOTEThese methods are not as accurate as using the VeraCode Bead Kitting System.

NOTEThis will kit two columns or 16 wells. Repeat this process for each two columns needed.

NOTEMixing is important to ensure that an equal number of beads are delivered to each well.

NOTEThis will kit six columns. Repeat this process for each six columns needed.

Part # 11220990 Rev. A

Quantitation and Manual Bead Kitting 119

6. Place 50 μL of beads in the first column of a microtiter plate.

7. Repeat steps 4 through 6 for each column.

Pooling of Individual Immobilized VeraCode Beads

1. Spin individual tubes of immobilized VeraCode beads.

2. Set a P200 to deliver 150 μL with a wide-bore tip.

3. Remove the pellet of beads and combine in to a single tube by doing the following:a. Place the tip of the pipette just above the pellet.b. Aspirate up into the pipette tip so that you can see beads in the tip.c. Quickly remove the tip from the tube.d. Pipette beads into a multiplex tube.e. Repeat 2x (or as needed to remove beads) per tube of

VeraCode beads.f. Visually inspect the tube to ensure that all beads have

been removed.g. Remove the excess liquid from the multiplex pool tube as needed to

end up with 1 mL of volume.

NOTEMixing is important to ensure that an equal number of beads are delivered to each well.

NOTERemember to record the VeraCodes of the beads used to make up the multiplex pool.



Multiplex Cytokine Reagent Preparation

Use this protocol as a guide. However, make sure to optimize your reagents (detection antibody, streptavidin, etc.) for your specific assay requirements.

Prepare MultiplexDetectionAntibody

Follow the manufacturer’s recommendations to determine the initial detection antibody concentration. Once concentrations are achieved, you can prepare a 10x detection pool.

Dilute 10x detection antibody in CRD based on the table below.

*Final volumes assume a 10% overage.

PrepareStreptavidin

PhycoerythrinConjugate

Dilute Streptavidin Phycoerythrin in label buffer to a final concentration of 6.4 μg/mL. Shield the solution from light.

*Final volumes assume a 10% overage.

Prepare PBS To prepare 1 L 1X PBS, pH 7.4 from 10x concentrate:Add 100 mL 10x PBS to 900 mLs deionized water.

Total # Wells* μl 10x Detection Antibody μl Reagent Diluent

96 600.0 5400.0

48 300.0 2700.0

24 150.0 1350.0

12 75.0 675.0

NOTEThis is a starting concentration. Optimization for your particular assay may be required.

Total # Wells*μl Streptavidin:Phycoerythrin

(1mg/mL)μl 1X Wash Buffer

96 38.4 5961.6

48 19.2 2980.8

24 9.6 1490.4

12 4.8 745.2

Part # 11220990 Rev. A

Multiplex Cytokine Protein Assay 121

Multiplex Cytokine Protein Assay

Materials/Reagents Reagents10x biotinylated detection antibody pool (stored at 4ºC)Multiplex high standard pool (stored at -80ºC)Multiplex cytokine standard beads (stored at 4ºC)Streptavidin Phycoerythrin (stored at 4ºC; 1 mg/mL)

BuffersCytokine Standards Diluent (CSD)Cytokine Reagent Diluent (CRD)

PBS/T/BSA (PBS pH 7.4, 0/1% BSA-Fraction V, 0.05% Tween 20, Pro-clin 300)

Wash BufferPBS/T (PBS pH 7.4 and 0.05% Tween 20)

Preparation Allow CSD, CRD, and Multiplex Bead Pool to warm to ambient temperature (at least 15 minutes).

Prepare the Cytokine Standard Curve in Cytokine Standards Diluent

1. Thaw high multiplex standard (100 μg/mL) on ice.

2. Thaw controls on ice.

3. Prepare diluted standard curve in CSD (Figure 33).

CAUTION Be careful not to use CRD in this step.



Figure 33 Multiplex Cytokine Protein Assay

4. Kit the beads. See Chapter 4 for bead kitting procedures.

5. Allow multiplex standards to equilibrate on ice until kitting is complete.

Procedure 1. Add 50 μl of diluted cytokine standards in CSD to the wells.

2. Add 50 μl of controls to the wells.

3. Add 50 μl CSD to the wells designated “0” controls.

4. Seal the plate with a mylar seal.

5. Incubate the plate on the plate rocker for 1 hour at ambient temperature with the speed set at 600 rpm.

6. Prepare the multiplex detection antibody pool according to the instructions in Prepare Multiplex Detection Antibody on page 120.

7. Mix by rocking on the VariMixer at medium speed at ambient temperature.

8. Remove the cytokine plate from the plate rocker.

9. Centrifuge the plate at 1500 rpm for 5 seconds.

10. Remove the mylar seal.

11. Add 150 μl of wash buffer to the wells.


13. Aspirate the wells with the 8-channel aspirator.

CAUTION Be careful not to cross-contaminate the wells.

Part # 11220990 Rev. A

Multiplex Cytokine Protein Assay 123

14. Wash 3x with wash buffer (for a total of 4 additions of wash buffer).

15. After the washes, aspirate the wash buffer from the plate.

16. Add 50 μl of 1X detection antibody in CRD to the wells.

17. Incubate the plate for 1 hour at ambient temperature on the plate rocker with the speed set at 600 rpm.

18. Prepare the Streptavidin Phycoerythrin as described in Prepare Streptavidin Phycoerythrin Conjugate on page 120.

19. Mix the Streptavidin Phycoerythrin by rocking it at ambient temperature until it is dissolved, and shield from light.



22. Aspirate wells with 8-channel aspirator.


24. Add 50 μl of Streptavidin Phycoerythrin (6.4 μg/mL in PBST).

25. Cover the plate with foil or otherwise shield it from light.

26. Incubate the plate for 30 minutes at ambient temperature on the plate rocker with the speed set to 600 rpm.



29. Aspirate wells with 8-channel aspirator.


31. After the final wash, aspirate the wash buffer (PBST) from the beads.

32. Resuspend the beads in 75 μl of wash buffer.

33. Place the plate in the BeadXpress Reader.

34. Scan the plate using the Scan Settings File supplied by Illumina (set at 0.75 green PMT, which is the recommended starting point).

For information about scanning VeraCode Bead Plates with the BeadXpress Reader, see the BeadXpress Reader System Manual (Illumina part # 11220957).

NOTE Note that the antibody is diluted in CRD, not CSD.

NOTEIt is usually sufficient to rock the Streptavidin Phycoerythrin for the balance of the 60 minute incubation above.



Troubleshooting

Use the following troubleshooting guidelines to help you successfully resolve potential issues you may face when performing the assays in this chapter.

High Background Table 31 includes possible causes and resolutions for situations in which there is high background.

No Signal Table 32 includes possible causes and solutions for situations in which there is no signal.

Table 31 High Background

Possible Cause Solution

Insufficient washing Increase number or volume of washes

Insufficient blockingIncrease blocking time during the immobilization stepRecheck blocking buffer calculations

Incubation times too long Reduce Incubation times

Buffer contamination, interfering substances

Make fresh buffers

Run additional controls

Label concentration too high Check dilution; titrate label concentration

Detection antibody concentration too high

Check dilution; titrate detection antibody concentration

Table 32 No Signal


Reagent preparation incorrect or incorrect order

Repeat assay

Review protocol

Check calculations and make new reagents

Suspected performance issues Run T&C beads

Standard has gone bad: signal seen in sample (unknown wells)

Use new standard

Use proper handling of standard

Not enough secondary antibody used

Check calculations and titer concentration

Not enough label used Check calculations and titer concentration

Part # 11220990 Rev. A

Troubleshooting 125

Too Much Signal Table 33 includes possible causes and solutions for situations in which there is too much signal.

Low or FlatStandard Curve

Table 34 includes possible causes and solutions for situations in which there is a low or flat standard curve.

Capture antibody did not bind to VeraCode beads

Run labeled anti-species assay

Buffer contamination Make fresh buffers

Table 32 No Signal (Continued)


Table 33 Too Much Signal


Insufficient washing orwash step skipped

Review protocol

Repeat assay

Label concentration too high Check dilution; titrate label concentration


Table 34 Low or Flat Standard Curve


Label concentration limiting Increase label concentration

Incorrect procedure Review assay guide and repeat

Detection antibody limiting Check dilution; titer concentration

Standards are bad Insure proper handling; repeat assay with new standards

Capture antibody did not bind to VeraCode beads

Run labeled anti-species assay; titer antibody during immobilization



Poor Replicates Table 35 includes possible causes and solutions for situations in which there are poor replicates.

PoorReproducibility

(Assay-to-Assay)

Table 36 includes possible causes and solutions for situations in which there is poor reproducibility.

Table 35 Poor Replicates


Insufficient washing

Review assay guide

Increase number and volume of washes

Insufficient mixing Vary mixing speeds


Capture antibody did not bind to VeraCode beads or uneven coating

Run labeled anti-species assay; titer antibody during immobilization

Ensure proper mixing during immobilization

Reagent evaporation Make sure plate is sealed properly during incubations

Table 36 Poor Reproducibility


Insufficient washing

Review assay guide

Increase number and volume of washes

Variations in protocol Use same protocol run to run

Improper dilutions Check dilutions

Buffer contaminationMake new dilutions

Make fresh buffers

Part # 11220990 Rev. A

Troubleshooting 127

No Signal inSamples, Standard

Curve Fine

Table 37 includes possible causes and solutions for situations in which there is no signal in samples, but the standard curve is fine.

Sample Values tooHigh, Standard

Curve Fine

Table 38 includes possible causes and solutions for situations in which sample values are too high, but the standard curve is fine.

Table 37 No Signal in Samples, Standard Curve Fine


No cytokine in sample Use internal controls

Sample matrix interference

Repeat experiment

Dilute samples (1:2) in appropriate diluent

Table 38 Sample Values too High, Standard Curve Fine


Samples contain high levels of cytokine

Dilute samples and re-run



Part # 11220990 Rev. A

Appendix A

GoldenGate Assay Controls


130 Viewing the Control Graphs

131 VeraCode Bead Types and IllumiCode Sequence IDs

132 Control Oligo Diagrams


130 APPENDIX AGoldenGate Assay Controls

IntroductionThis appendix describes the GoldenGate control oligos, including the VeraCode Sequence IDs used, and their expected outcomes and how to view them. Control oligo diagrams are included with descriptions of allele-specific extension, PCR uniformity, extension gap, gender, first hybridization controls, second hybridization controls, and contamination detection controls. These control oligos (with the exception of second hybridization controls) are designed to human genomic DNA sequences.

Viewing the Control GraphsTo view control graphs using the BeadStudio Genotyping Module:

In the BeadStudio Genotyping Module, go to:Analysis | View Controls Dashboard.

For more information about control graphs, see the BeadStudio Genotyping Module User Guide (Illumina part # 11207066).

Part # 11220990 Rev. A

VeraCode Bead Types and IllumiCode Sequence IDs 131

VeraCode Bead Types and IllumiCode Sequence IDsTable 39 lists VeraCode Bead Types and IllumiCode Sequence IDs along with a description and expected outcome for each.

Table 39 VeraCode Bead Types and IllumiCode Sequence IDs

VeraCode Bead Type

IllumiCode Sequence ID Description Expected Outcome

0010 329 AA mismatch U3 match

0520 1611 CC mismatch U5 match

0257 1142 GG mismatch U3 match

0008 279 GT mismatch U5 match

1025 1742 High AT (31% GC) U3 match

4352 4824 High GC (62% GC) U5 match

1028 1878 Gender control set 1 XX = U3 matchXY = U3 and U5 match

2048 2911 Gender control set 2 XX = U3 matchXY = U3 and U5 match

0034 658 15-base-pair gap U3 and U5 match

0128 962 First hybridization controls, 42/57 Tm U5 match

0260 1209 First hybridization controls, 57/72 Tm U5 match

0001 44 Second hybridization controls U3 match




0016 501 Second hybridization controls U3 and U5 match

0136 0003 Second hybridization controls U3 and U5 match



Control Oligo Diagrams

The following diagrams illustrate the oligo controls for the used codes.

Allele-SpecificExtension Controls

The allele-specific extension controls test the extension efficiency of properly matched versus mismatched allele-specific oligos (ASO). These controls test for A-A, C-C, G-G, and G-T mismatches corresponding with VeraCode Sequence IDs 0010, 0520, 0257, and 0008, respectively. Sequence IDs 0010 and 0257 should be predominately Cy3, and Sequence IDs 0008 and 0520 should be predominately Cy5.

Figure 34 ASE Controls

PCR Uniformity The PCR uniformity controls are used to test the PCR amplification efficiency for high AT and high GC regions of DNA. VeraCode Sequence ID 1025 checks amplification efficiency for high AT (31%GC) and should result in Cy3 signal. VeraCode Sequence ID 4352 amplifies over a high GC (62% GC) region and should result in Cy5 signal.

Figure 35 PCR Uniformity Controls

Part # 11220990 Rev. A

Control Oligo Diagrams 133

Gender Controls VeraCode Sequence IDs 1028 and 2048 are used to verify the sex of DNA samples. For both VeraCode Sequence IDs, females are indicated by Cy3 homozygotes and males as heterozygotes.

Figure 36 Gender Controls

Extension GapControl (U3 & U5

Match)

The extension gap control (VeraCode Sequence ID 0034) tests the efficiency of extending 15 bases from the 3' end of the allele-specific oligo to the 5' end of the locus-specific oligo. Both Cy3 and Cy5 signal should be detected in this control.

Figure 37 Extension Gap Control (U3 & U5 Match)

Set 1

Set 2

IllumiCode Sequence ID1878

U3

UT7r

X-Chromosome Specific


U5

UT7r

Y-Chromosome Specific

Set 1IllumiCodeSequence ID1878


U3

UT7r

X-Chromosome Specific


U5

UT7r

Y-Chromosome Specific

Set 2IllumiCodeSequence ID2911



First HybridizationControls

The first hybridization controls test the specificity of annealing ASOs with different Tm to the same DNA locus. Both VeraCode Sequence ID 0128 and 0260 should result in a Cy5 match.

Figure 38 First Hybridization Controls

SecondHybridization

Controls

The second hybridization controls test the hybridization of single-stranded assay products to VeraCode Sequences on the array beads. VeraCode Sequence IDs 0001 and 0005 should result in Cy3 signal only, Sequence IDs 0256 and 0544 should result in only Cy5 signal, and Sequence IDs 0016 and 0136 should not have signal contributed by either Cy3 or Cy5.

Part # 11220990 Rev. A

Control Oligo Diagrams 135

ContaminationDetection Controls

These PCR contamination detection controls are divided into four types; only a single type is added to each oligo pool (OPA) tube. When a single OPA is run, it is expected that only a single contamination control type should have high signal. Should two or more contamination control types have high signal, then significant contamination may have occurred.

Figures 39 through 41 provide graphic representations of these controls under three BeadStation process conditions:

Figure 39 represents a contamination-free environmentFigure 40 represents a contaminated environment without UDG treatmentFigure 41 represents a contaminated environment with UDG treatment

Figure 39 Contamination-Free Environment



Figure 40 Contaminated Environment without UDG Treatment

Figure 41 Contaminated Environment with UDG Treatment

Part # 11220990 Rev. A

Appendix B

Carboxyl Bead Sets


138 BeadCodes for VeraCode Carboxyl BeadSets


138 APPENDIX BCarboxyl Bead Sets

Introduction

Illumina supplies 10 distinct VeraCode Carboxyl Bead Sets. Sets A through I contain five tubes of Carboxyl Beads, each with its own distinct BeadCodes. The exception is set J, which contains only three tubes of Carboxyl Beads.

You can perform multiplexed assays by combining individual tubes of VeraCode Carboxyl Beads post-coupling to reach the desired level of multiplexing. Each tube of VeraCode Carboxyl Beads is sufficient to analyze 6 x 96 samples.

BeadCodes for VeraCode Carboxyl BeadSets

Table 40 lists catalog numbers, descriptions, and BeadCodes for Illumina’s Carboxyl BeadSets.

Table 40 VeraCode Carboxyl Bead Sets

Illumina Catalog # VeraCode Carboxyl Bead Set BeadCodes

VC-311-8193 A 8193, 8195, 8196, 8197, 8198

VC-311-8199 B 8199, 8201, 8202, 8204, 8205

VC-311-8208 C 8208, 8209, 8210, 8211, 8212

VC-311-8214 D 8214, 8216, 8217, 8220, 8225

VC-311-8226 E 8226, 8228, 8229, 8232, 8234

VC-311-8240 F 8240, 8241, 8244, 8256, 8257

VC-311-8258 G 8258, 8259, 8260, 8262, 8264

VC-311-8265 H 8265, 8268, 8272, 8274, 8280

VC-311-8288 I 8288, 8289, 8292, 8304, 8321

VC-311-8322 J 8322, 8324, 8325

Part # 11220990 Rev. A

Appendix C

Universal Oligo Bead Sets Individual


140 BeadCodes for Individual VeraCode Universal Oligo BeadSets


140 APPENDIX CUniversal Oligo Bead Sets Individual

Introduction

Each VeraCode Universal Bead Set contains one type of VeraCode bead split into six tubes (each VeraCode Universal Oligo Bead Set is suitable for 6 x 96 samples). Each VeraCode Universal Oligo Bead Set is unique from one another, as each set contains VeraCode beads with different VeraCode Bead Codes and unique Illumicodes (DNA oligo capture sequences). Each tube of VeraCode Universal Oligo Beads can be pooled with other VeraCode Universal Oligo Beads (with different VeraCode Bead Codes and Illumicodes) to create a multiplexed assay. Alternatively, VeraCode Universal Bead Sets can also be combined with a VeraCode Universal Bead Set Pools, which come as pre-pooled 48-plex bead sets.

BeadCodes for Individual VeraCode Universal Oligo BeadSets

Table 41 lists catalog numbers, descriptions, bead codes, IllumiCodes, and probe sequences for Illumina’s Individual Universal Oligo Bead Sets.

Table 41 VeraCode Bead Codes for Individual Universal Oligo Bead Sets

Illumina Catalog Number

Description VeraCode BeadCode IllumiCode Probe Sequence

VC-301-5440VeraCode

Universal Bead Set, Code 5440

5440 42 TTCGTAACCCGTGCGAAGTGCC

VC-301-5632VeraCode


5632 103 ACGATGGTACGGTCGCTGTGTA

VC-301-5634VeraCode


5634 208 GGTTAGCGATCATACCGGCACT

VC-301-5640VeraCode


5640 620 CCCGGTTGTCAGTCCGAAAGGG

VC-301-5664VeraCode


5664 648 ACCTGAGTTACCGGCGTTACGT

VC-301-5760VeraCode


5760 691 GCTGGATTGTCCGCACTCAAGT

VC-301-6144VeraCode


6144 692 TATGCTTCGCCGCAGGACCACT

VC-301-6145VeraCode


6145 751 GCAACGTGTCATTCGCATCCTC

Part # 11220990 Rev. A

BeadCodes for Individual VeraCode Universal Oligo BeadSets 141

VC-301-6146VeraCode


6146 844 AGGAGTCCAACCGCATCTTGCA

VC-301-6147VeraCode


6147 974 CTCGGAACCTACTGCCGGATCA

VC-301-6148VeraCode


6148 1041 GTTGCCGACGGTTAAACCAGGT

VC-301-6150VeraCode


6150 1051 CGGTTAGCGAGTAATAGTGCCC

VC-301-6152VeraCode


6152 1093 ACACTGGCAACGGTTTCTGCGT

VC-301-6153VeraCode


6153 1170 ACCGAAAGTCCCGGCTGTGGAT

VC-301-6156VeraCode


6156 1191 CTATCAGGGTCGCCATGTGTCA

VC-301-6160VeraCode


6160 1219 CCTCTTGTCGGAAGTCCACACG

VC-301-6162VeraCode


6162 1307 ACGCCAGACTCCGGTCCAAGTT

VC-301-6168VeraCode


6168 1432 TAGGCGTTGGACCCTACCATCA

VC-301-6176VeraCode


6176 1700 CACCGAACGGCAATGATCTGGT

VC-301-6177VeraCode


6177 1761 TGGCCGTACATCACTAACCGAC

VC-301-6180VeraCode


6180 2022 GACTGCAACCCGGCTCTGTCTA

VC-301-6192VeraCode


6192 2174 GCGAACGGTCCTGTATTGCAGT

Table 41 VeraCode Bead Codes for Individual Universal Oligo Bead Sets (Continued)





VC-301-6208VeraCode


6208 2296 GGTCAACCAGCTTGATACGCCC

VC-301-6210VeraCode


6210 2321 CTTGTAGGAGCTGCGGAAGACT

VC-301-6216VeraCode


6216 2326 CCACATGCTCTCGGTGTCGAAT

VC-301-6240VeraCode


6240 2717 ATTCGGATCGCCCTTCCTGCAA

VC-301-6272VeraCode


6272 3041 GCGACGTGGACTGCTTCAAACG

VC-301-6273VeraCode


6273 3155 GAGGGAACGTGAATGCTGCTCT

VC-301-6276VeraCode


6276 3285 GTCGGAGTAATTGTGCCCACCA

VC-301-6288VeraCode


6288 3293 GTACTCGCAGTCCCAGTGGCAT

VC-301-6336VeraCode


6336 3375 TTCGTGCTGGCTGAGAGCGTAA

VC-301-6400VeraCode


6400 3465 TAGCGCCTATCTGCCAGGGACT

VC-301-6402VeraCode


6402 3518 TCTGACTGGGAGATTCCGATGC

VC-301-6408VeraCode


6408 3534 TGAGCGCCTTCCCAACTGAGGA

VC-301-6432VeraCode


6432 3569 AACCGGAGCCCAAGTTGCTGTC

VC-301-6528VeraCode


6528 3592 TCCGGTCTTGCATGAAGAGGAG




Part # 11220990 Rev. A

BeadCodes for Individual VeraCode Universal Oligo BeadSets 143

VC-301-6656VeraCode


6656 3871 GATGCGACGACGACTATTCCTGT

VC-301-6657VeraCode


6657 4068 GAGACGACAACTTTCTCGCAACC

VC-301-6660VeraCode


6660 4229 CAAGTGATTCGCCCCGGTTAATC

VC-301-6672VeraCode


6672 4247 GTGCGAAATTCATTCCGACCGCT

VC-301-6720VeraCode


6720 5211 TTACGAACCGATGAGCACCTAGTA

VC-301-6912VeraCode


6912 5384 AATCCGTACTTGTTGCCATCCGTA

VC-301-7168VeraCode


7168 5389 GCCCATCCACTATTTCGGAGGTAA

VC-301-7170VeraCode


7170 5537 TAATACGCCAGATGGTTGGTGCAT

VC-301-7176VeraCode


7176 5650 TATTGCACCACCGCTACTGAGAAT

VC-301-7200VeraCode


7200 5801 GGATATGTCACCTACTGCAACGGA

VC-301-7296VeraCode


7296 5915 GTGGCATCATACCATAAACGCTCG

VC-301-7680VeraCode


7680 6136 GTTACAATCCCTGGTTCCGTATGC






Part # 11220990 Rev. A

Appendix D

Universal Oligo Bead Sets Pools


146 BeadCodes for Pooled VeraCode Universal Oligo BeadSets


146 APPENDIX DUniversal Oligo Bead Sets Pools

Introduction

Each VeraCode Universal Bead Set Pool contains a pool of 48 types of VeraCode Beads split into six tubes (each VeraCode Universal Oligo Bead Set Pool is suitable for 6 x 96 samples). The 48 different types of VeraCode Beads in each VeraCode Universal Bead Set Pool are unique from one another, as each bead has a different VeraCode Bead Code and unique Illumicode (DNA oligo capture sequence). As such, each VeraCode Universal Bead Set Pool is suitable for conducting 48-plex assays. However, each tube of VeraCode Universal Oligo Bead Set Pool can be pooled with additional VeraCode Universal Oligo Beads (with different VeraCode Bead Codes and Illumicodes) to create higher multiplexed assays.

BeadCodes for Pooled VeraCode Universal Oligo BeadSets

Table 42 lists catalog numbers, descriptions, bead codes, IllumiCodes, and probe sequences for Illumina’s Pooled Universal Oligo Bead Sets.

Table 42 VeraCode Bead Codes for Pooled Universal Oligo Bead Sets



VC-301-0481VeraCode

Universal Bead Set, Pool 0481

3072 140 CGGATGCAATCGGTATCGGGAA

3073 205 CATGGACGAACTCACGCGGCTT

3074 453 GCGATTGAAGTGCGGACCAATG

3075 623 GTCGCGCTTATGAATCGGATGC

3076 636 AGCCGTATCGGTTACCATGCCG

3078 1020 GTACGACCTTTATTCGCCAGGC

3080 1055 GAGGACGATCTACCTTCCGCCG

3081 1182 TTGCCCAGTACCCGGACTAGCT

3084 1229 CCCACCGGAATTGTAGTGCGGT

3088 1321 ACGTCGTACAGGGATTCCGTCA

3090 1337 AGCACTGGAACCGCATTCTGGG

3096 1339 TCTGCTAATCCCGCCAAAGTGC

3104 1343 CCAGAAGGCTCGACATGGTTGA

3105 1678 GAATCGTGGTACTGGTCAACCG

Part # 11220990 Rev. A

BeadCodes for Pooled VeraCode Universal Oligo BeadSets 147

3108 1823 AAACTACCCGTGCTCTGGTCCA

3120 1984 AGCTTGGCCTCGGTCATCAGCA

3136 2027 TCGTTGACCACCCACTCGTAGG

3138 2099 GTGCCCTTACCCTGCGTGAATA

3144 2149 TAGCCCACCGAAGAGTTGATGC

3168 2425 GTCACCCGGATTAAGACAGGCT

3200 2536 ACGTCGCTTCTAGGTGGACAGT

3201 2952 ATAAGCACGTTCCCAGTGAGCC

3204 3042 GCGGCGATCTAAGGAGAGTTCC

3216 3043 GTCGTTCCGCACAGCCCAGTAG

3264 3069 ACGCCTCGTGGTGTGGAGATAA

3328 3075 TGGATCACCCATCTGTCGCGTA

3330 3085 GCAACTGGTCCTTCAGGCGAGA

3336 3136 CTAGGCTTCACAGATCGGCACG

3360 3348 AAGGACCTCAGTGGATAGCGTG

3456 3479 CACGCACTGGAGAGTATATGGC

3584 3523 CACAGCGGCTTGGCTTCAACAT

3585 3648 GTCGTTCCACTGGCTGGCAAAC

3588 3697 CATGTGACCGTACTAACCGCTGA

3600 3736 GCCGACAATTACCCGTTGCTAGA

3648 3922 CAGTTGCCGTCGTGTCATTGAGA

3840 3931 GATGCTCGTTCGTTGAAGTCCAG

4098 4010 GCCATTCCAACGGTGCAAAGGTT

4099 4104 GCATGGTCTTACAATCGGTAGGC

4101 4144 CCATAGAGCTTAGACCCGATCCA

4102 4211 CGACTGAACGGCATCTGACATCA

4104 4268 GGATTACCATGTACGTGTGGAGC

Table 42 VeraCode Bead Codes for Pooled Universal Oligo Bead Sets (Continued)





4105 4307 GGTGAGGTCCATACTCTTCGCAT

4106 4334 CGCAGATGAATCACGGAGGCTTT

4107 5669 CCAGACGGACCAGGGTGATATAAT

4108 5683 TTGACCCTAAACAATTCGTGCCTG

4110 5715 CTAAGCGGATATGTTGGAAGCACG

4113 5716 ATATCTGTCGGTAGAAAGCCTGGA

4114 5910 GGCCCTTTGAGTAGTATGAGCGTA

VC-301-0482 VeraCode Universal Bead Set, Pool 0482 1 44 ATCTGTACGAACGTAGCCGCAG

2 137 CTACCGAATCTACGGATCGCCA

4 237 CCTGGTAACGAGACGACTGGGT

5 278 TTCTCGAATCTAGCGCCCTAGC

8 279 GTTGCACCGCAGATCGTAGGCT

10 329 GGCTAAGTTACGGGCTACGCAT

16 501 CGTAACGTCTTCCGATCCCAGG

17 526 TTGCCCTACGCTAAAGGGTCCG

20 590 CTTACACCAACGAAGCCGTCGT

32 592 GCACTCTTCGCGCTGACAGTAA

34 658 GTCACTTTCGGGCTAGGAACGT

40 662 CCAAGAGAGCGACGGGCTGTTT

64 737 GAGCACTCTAAGCGCGGTCAAT

65 858 AACGGTGCTTTGTCGGGTCAAC

68 910 CAAGACCCGTCGTTCTGTGGAC

80 912 CCCTCTCACGAAGATTGAGCGC

128 962 GTTTGGAAGCCGGTTCCGCAAG

130 975 CTACGCCGTTGTAACACCTCGG

136 1003 CCTCGAACTGTTGAGCGCGGAG




Part # 11220990 Rev. A

BeadCodes for Pooled VeraCode Universal Oligo BeadSets 149

160 1070 GAGCTTTGGTGCGTTCCGACAA

256 1112 AGACTCTTCACGAATGTCCCGC

257 1142 GCGTCTATTGGATGCGGCACAT

260 1209 TGGCGAGCTAGTTGCTAACGTC

272 1235 CGCACGGATAGCTCTGACGGTT

320 1251 CCTGTTCGGGCACTAAGACTCC

512 1306 CGATATTCGTAGCCGGGATCAC

514 1365 AATCGCGTCCAGATACGTCCCT

520 1611 CAATTTGCGACCCCTGAACAGC

544 1632 TAGACAGACCCGGCACTGTGTA

640 1696 CTTGTACGGCTCAGTTACAGCG

1024 1716 GCGAACTTCGAGGAATCATGCC

1025 1742 AGGCTTTAGGGTGCGGTCACAT

1028 1878 TGGTAGGACGCAGAGCTATGCC

1040 1968 TGACGAAGACTAGGGTTCCTCG

1088 1992 GCGAAACTTCGGACTCCTGAAC

1280 2832 GCTCGACAATGAGTGGTGACCT

2048 2911 CTCCTTTACCTGGCGAGGACAC

2050 2908 AGCAACGACTGGCCTCTTGACC

2056 3008 GGCGCTTCGATAAATGAGGCTC

2080 3137 TCTTCCACGACACCTGGATGGA

2176 3433 TTACGGCCCAAGTGTCAGGAGA

2560 3511 CCCCGGATCACAACTGCATGTT

4096 3802 CCCAACGACACGGCTAAGTATGT

4097 3845 CTATCTCACCGACCAAATAGGCG

4100 3864 GGTTTGTGTGCGGATCTCAACGA

4112 3885 CGAGATCGCTTGTACTCCCGTTA






4160 4254 GAGCTAATTCGTCCCCACACTGA

4352 4824 CTTACACACGAACGTATCGGAATC




Part # 11220990 Rev. A

VeraCodeTM Assay Guide - SNP Genetics€¦ · VeraCode Assay Guide 1 Chapter 1 Overview Topics...

Documents

Transcript of VeraCodeTM Assay Guide - SNP Genetics€¦ · VeraCode Assay Guide 1 Chapter 1 Overview Topics...