Vascular Endothelial Growth Factor: A Therapeutic …Vascular Endothelial Growth Factor: A...

Vascular Endothelial Growth Factor: A Therapeutic Target for

Tumors of the Ewing’s Sarcoma Family

Surita Dalal,1 Andrea M. Berry,1

Catherine J. Cullinane,2 D. Charles Mangham,5

Robert Grimer,6 Ian J. Lewis,3 Colin Johnston,1,4

Valerie Laurence,3 and Susan A. Burchill1

1Candlelighter’s Children’s Cancer Research Laboratory, Departments of2Pathology and 3Paediatric Oncology, 4Cancer Research UK ClinicalCentre, St. James’s University Hospital, Leeds, United Kingdom and5Department of Musculoskeletal Pathology and 6Royal OrthopaedicHospital, Birmingham, United Kingdom

ABSTRACT

Purpose: We have reported previously that intratu-

moral microvessel density (MVD) is a significant prognostic

indicator of event-free survival in the Ewing’s sarcoma

family of tumors (ESFT). Here, the angiogenic growth factor

expression profile and its relationship with MVD has been

investigated in ESFT.

Experimental Design and Results: Using ESFT model

systems, the potential of these factors as therapeutic targets

has been evaluated. A significant correlation (P = 0.02) was

observed between vascular endothelial growth factor

(VEGF) expression and MVD, consistent with the hypothesis

that VEGF regulates the development of microvessels in

ESFT. There was no correlation between MVD and any of

the other growth factors studied. All six ESFT cell lines

studied produced and secreted VEGF; five of six cell lines

also secreted placental growth factor, one cell line (A673) at

high levels. Tumor conditioned medium induced prolifera-

tion of human umbilical vein endothelial cells. Expression of

VEGF receptors Flt-1 and Flk-1/KDR was heterogeneous

across the cell lines. Both receptor tyrosine kinase inhibitors

SU6668 (targets Flk-1/KDR, platelet-derived growth factor

receptor-B, and fibroblast growth factor receptor 1) and

SU5416 (targets Flk-1/KDR) as well as anti-VEGF agents

rhuMAb-VEGF (bevacizumab) and VEGF Trap delayed s.c.

growth of ESFT in mice compared with untreated groups:

SU6668 (100 mg/kg/d), SU5416 (25 mg/kg/d), rhuMAb-

VEGF (10 mg/kg twice weekly), and VEGF Trap (2.5 or 25

mg/kg twice weekly).

Conclusions: These data suggest that VEGF is the single

most important regulator of angiogenesis in ESFT and may

be exploited for therapeutic advantage.

INTRODUCTION

The Ewing’s sarcoma family of tumors (ESFT) includes

classic Ewing’s sarcoma, extraosseous Ewing’s sarcoma, Askin

tumor, and peripheral primitive neuroectodermal tumors. ESFTs

are small round cell tumors predominantly affecting young

people between ages 10 and 20 years. This family of tumors has

been defined following the identification of nonrandom

chromosome translocations involving rearrangement of the

EWS gene on chromosome 22q12 with a member of the ETS

gene family of transcription factors. These rearrangements

provide a powerful diagnostic tool (1). The site of the primary

tumor, presence or absence of metastatic disease at diagnosis,

and age at diagnosis are important prognostic indicators (2, 3).

At diagnosis, f25% of ESFT patients present with metastatic

disease (4). Although aggressive treatment regimens of multi-

modal therapy have improved relapse-free survival (4–6), the

outcome for these patients remains poor; the 5-year disease-free

survival rates are only 10% to 20% in patients with metastatic

disease. Therefore, there is an urgent need to identify new targets

for the development of novel therapeutic strategies.

Angiogenesis, the neovascularization or formation of new

capillaries from preexisting vessels, is a rate-limiting factor for

the growth and expansion of tumors (7). Tumors of 1 to 2 mm3

obtain oxygen and nutrients by passive diffusion from

neighboring blood vessels. However, to grow beyond this size,

tumors must recruit blood vessels to nourish and oxygenate the

tumor cells (i.e., angiogenesis must occur). Several features of

the microenvironment regulate the formation of the vasculature,

including angiogenic factors such as vascular endothelial growth

factor (VEGF), basic fibroblast growth factor (bFGF), platelet-

derived growth factors (PDGF), and nonangiogenic influences

such as hypoxia, necrosis, and metabolic rate of tumor (8, 9).

The vasculature of normal tissues is reported to closely reflect

the metabolic demand of the normal cells (10), although in

tumors the relationship between vascular density and metabolic

rate is often lost as expression of angiogenic factors is uncoupled

from normal regulatory control (8, 11). Consequently, some

proangiogeneic factors may be constitutively expressed in

tumors at high levels. The angiogenic nature of a tumor is the

sum of positive and negative regulators of angiogenesis, which

may arise from both tumor and normal cells of the cellular

environment. The key regulator and hence most frequently

studied proangiogenic growth factor is VEGF; however,

angiogenesis may also be regulated by other growth factors,

such as placental growth factor (PlGF; ref. 12), bFGF (13), and

PDGF (14), depending on the tumor type.

Assessing microvessel density (MVD) is an established

method for measuring the degree of neovascularization within

a tumor (15). MVD within isolated regions, or so-called

Received 6/21/04; revised 12/9/04; accepted 12/28/04.Grant support: Candlelighter’s Trust, St. James’s University Hospital(Leeds, United Kingdom).The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.Requests for reprints: Surita Dalal, Candlelighter’s Children’s CancerResearch Laboratory, Cancer Research UK Clinical Centre, St. James’sUniversity Hospital, Leeds LS9 7TF, West Yorkshire, UnitedKingdom. Phone: 44-113-2064922/4912; Fax: 44-113-2429886; E-mail:[email protected].

D2005 American Association for Cancer Research.

Vol. 11, 2364–2378, March 15, 2005 Clinical Cancer Research2364

Research. on June 17, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

hotspots, was initially described as a clinically significant

prognostic factor in breast (16) and prostate (17) cancer. In

these tumors, it can aid in the assessment of disease stage,

prediction of metastasis, recurrence, or survival (18, 19). Since

then, the prognostic value of MVD has been evaluated in many

different cancers (10). In ESFT, we have shown previously that

MVD is prognostically significant in these tumors (20).

Inhibition of angiogenesis, by targeting the comparatively

homogenous and genetically stable endothelium, represents

a promising approach to cancer therapy (21). There are currently

>75 agents that target tumor vasculature either directly or

indirectly in clinical trials, including 12 that have entered or

completed phase III trials (22). Unlike the more conventional

chemotherapeutic approaches, little or no acquired drug

resistance has been reported following treatment with inhibitors

of angiogenesis (23). With the recent success of the first

antiangiogenic agent (bevacizumab, Genentech, Inc., San

Francisco, CA) in a phase III randomized trial in metastatic

colorectal cancer, such inhibitors represent promising adjunct

therapy with chemotherapeutic agents or radiotherapy (24).

The primary aim of this study was to examine the

expression profile of the angiogenic growth factors VEGF,

PlGF, bFGF, PDGFA, and PDGFB and the relationship between

their expression and MVD in ESFT. Having identified VEGF as

the single angiogenic growth factor most frequently associated

with expression of MVD, we sought to investigate the effect of

antiangiogenic agents targeting the VEGF pathway in an ESFT

s.c. growth mouse model. Two different classes of antiangio-

genic agents were investigated: anti– tyrosine kinase receptor

agents and inhibitors of VEGF. The receptor tyrosine kinase

inhibitors examined (SU6668 and SU5416) are ATP site-directed

compounds that inhibit growth factor–stimulated receptor

tyrosine phosphorylation of Flk-1/KDR alone (SU5416) or

FGF receptor 1, PDGF receptor (PDGFR)-h, and Flk-1/KDR

(SU6668; refs. 25–27). Two anti-VEGF agents were studied:

rhuMAb-VEGF (bevacizumab), a humanized VEGF neutralizing

antibody, and VEGF Trap, a composite receptor consisting of

portions of the human Flt-1 and Flk-1/KDR extracellular

domains fused to the Fc portion of human IgG1 (28–30).

PATIENTS AND METHODS

Clinical Samples. Tumor material taken at the time of

diagnostic surgery from 34 patients with ESFT was analyzed.

Patients were from St. James’s University Hospital (Leeds, United

Kingdom; n = 14), Stanmore Orthopaedic Hospital (Stanmore,

United Kingdom; n = 4), Royal Marsden Hospital (Sutton, United

Kingdom; n = 3), Addenbrookes Hospital (Cambridge, United

Kingdom; n = 2), Royal Victoria Infirmary (Newcastle upon Tyne,

United Kingdom; n = 1), and Royal Orthopaedic Hospital

(Birmingham, United Kingdom; n = 10).Median age of patients at

diagnosis was 14 years (range, 2-49 years). Diagnosis was made

by conventional pathology, including examination of morphology

and immunohistochemistry; in some cases, this was supported by

G banding for rearrangements of chromosome 22q12 (character-

istic of this tumor group). Tissue was confirmed as diagnostic

tumor by reverse transcription-PCR (RT-PCR) for the EWS-ETS

gene rearrangements (26 of 34) or immunohistochemistry for

MIC-2 (CD99; 8 of 34). Primary tumor volume and presence of

metastases were detected by conventional imaging and examina-

tion of bone marrow by light microscopy. Informed consent was

obtained for the use of tumor material for research at each center.

Ethical approval was obtained from the Leeds Teaching Hospital

Trust Ethics Committee and Trent Multi-Research Ethics

Committee.

Human umbilical vein endothelial cells (HUVEC) were

isolated from human umbilical cords obtained following

cesarean sections conducted at the delivery ward at St. James’s

University Hospital. Ethical approval was obtained from the

Leeds Teaching Hospital Trust Ethics Committee and informed

consent was obtained from each donor. Table 1 contains further

patient information.

Immunohistochemistry. Immunohistochemistry and im-

munofluorescent staining was carried out on serial cryostat

sections (5 Am) of primary tumor taken at diagnosis. Histology

of each tumor was visualized by light microscopy after staining

with H&E. For each method, a serial section was processed

without the addition of primary antibody to test for nonspecific

binding (negative control). Table 2 contains information on the

antibodies, dilutions, and controls used.

For CD31 immunohistochemistry, a three-stage peroxidase

method was used. All incubations were carried out at room

temperature. Sections were fixed in methanol/acetone (50:50) for

2 � 2 minutes, allowed to air dry, and endogenous peroxidase

activity blocked using 0.6% hydrogen peroxide (Sigma, Dorset,

United Kingdom) in methanol for 10 minutes. Sections were

then washed for 10 minutes in running water. Endogenous biotin

or biotin-binding proteins were blocked using the avidin-biotin

blocking kit (Vector Laboratories, Peterborough, United King-

dom) according to manufacturer’s instructions. Nonspecific

antibody binding sites were blocked by incubation with normal

rabbit serum (DAKO Ltd., Cambridgeshire, United Kingdom)

diluted 1:10 in TBS for 5 minutes. The sections were then

incubated with primary antibody for 1 hour (Table 2). After

rinsing twice in PBS, the sections were incubated with secondary

antibody for 30 minutes. After two further washes in PBS,

sections were incubated with avidin-biotin-peroxidase complex

(DAKO). Sections were rinsed twice with PBS. The staining

pattern was developed by incubating sections with 3,3V-diaminobenzidine substrate for 15 minutes; staining was visible

as brown precipitate. Sections were rinsed for 1 minute in

running water and counterstained using hematoxylin.

The saponin method (31) was used for immunohisto-

chemistry detection of VEGF, PlGF, PDGFA, and PDGFB.

Sections were permeabilized, fixed, and endogenous peroxi-

dase blocked in 1% hydrogen peroxide in balanced salt

solution containing Mg2+ and Ca2+ (Life Technologies,

Paisley, United Kingdom) supplemented with 0.1% saponin

(Sigma) and 0.02% sodium azide for 30 minutes. After rinsing

twice with balanced salt solution containing 0.01 mol/L

HEPES (Life Technologies) buffer, endogenous biotin or

biotin-binding proteins were blocked using the avidin-biotin

blocking kit according to manufacturer’s instructions. The

sections were then washed thrice in balanced salt solution

containing 0.1% saponin and incubated with primary antibody

overnight at 4jC (Table 2). Following three washes in

balanced salt solution containing 0.1% saponin, the sections

were incubated with 1% normal serum (same species as

Clinical Cancer Research 2365



secondary) for 15 minutes and then with secondary antibody

for 30 minutes at room temperature. After rinsing twice with

balanced salt solution containing 0.1% saponin, sections were

incubated with avidin-biotin-peroxidase complex for

30 minutes at room temperature. Sections were rinsed twice

with PBS, and the brown precipitate was developed by

incubating sections with 3,3V-diaminobenzidine substrate for

15 minutes. Sections were rinsed for 1 minute in running

water and counterstained using hematoxylin.

bFGF was detected by immunofluorescence. Sections were

fixed in methanol/acetone (50:50) for 2 � 2 minutes and left to

air dry. The sections were then incubated with primary antibody

for 1 hour (Table 2). After rinsing twice in TBS, the sections

were refixed in methanol/acetone (50:50) for 2 � 2 minutes and

Table 1 Details of patient’s samples who were donated for immunohistochemical studies

PatientAge at

diagnosisPrimarytumor site

Metastases atdiagnosis

Time tofirst event

(mo)

Follow-up ortime to death

from diagnosis (mo) Status Fusion type

1 24 Left distal humerus Bone No event 62 Completeremission

EWS-FLI1 type I

2 49 Left ischium Lung 24 30 Deceased EWS-ERG3 26 Left kidney Sacrum, skeletal 9 10 Deceased No amplifiable

mRNA available4 14 Left iliac crest Sacral skip 22 27 Deceased EWS-FLI1 type I5 5 Paraspinal None 33 66 2nd remission EWS-FLI1 type I6 11 Left foot None No event 61 Complete

remissionEWS-FLI1 type II

7 14 Rib None No event 11 Completeremission

EWS-FLI1 type II

8 15 Right pubis None No event 44 Completeremission

EWS-FLI1 type I

9 2 Skull Left humerus No event 74 Completeremission

No amplifiablemRNA available

10 14 Pelvis None 19 24 Deceased EWS-FLI1 type I11 17 12th rib None 13 18 Deceased EWS-FLI1 type II12 13 Pelvis/left iliac fossa Lung 15 23 Deceased EWS-FLI1 type I13 14 Left femur Lung No event 98 Complete

remissionFLI1

14 38 Left thigh None 37 48 Alive with disease No translocationdetected

15 28 Proximal humerus None 18 29 Deceased EWS-FLI1 type II16 2 Left femur None No event 118 Complete

remissionNo translocation

detected17 14 Fibula Lung No event 23 Complete

remissionEWS-FLI1 type I

18 8 Femur Lung 14 19 Deceased EWS-FLI1 type I19 12 Fibula None 17 22 Deceased EWS-FLI1 type I20 15 Buttock Bone and lung No event 15 Alive with disease No amplifiable

mRNA available21 4 Right paravertebra 4th rib, lung 8 12 Deceased EWS-FLI1 type I

and EWS-ERG22 6 Right distal femur Right proximal

tibiaNo event 10 Alive with disease EWS-FLI1 type I

23 17 Fibula Bone 13 18 Deceased EWS-FLI1 type II24 12 Right foot Right inguinal

nodeNo event 110 Complete


25 16 Right proximal femur Lung No event 53 Completeremission

EWS-FLI1 type I

26 12 Talus surface None No event 67 Completeremission

No amplifiablemRNA available

27 14 Right heel Lung No event 52 Completeremission

No translocationdetected

28 12 Ethmoid None No event 102 Completeremission

EWS-FLI1 type I

29 19 Sacroiliac joint Multiple skeletal 13 13 Deceased EWS-FLI1 type II30 15 Chest wall,

rib involvementNone No event 44 Complete

remissionNo translocation

detected31 13 Pelvis Lung 13 13 Deceased EWS-FLI1 type I32 15 Ischiopubic bone None 11 15 Complete


33 18 Distal tibia None No event 47 Completeremission

EWS-FLI1 type I

34 13 Right fibula Lung 47 60 Completeremission

EWS-FLI1 type II

VEGF, MVD, and ESFT2366



again left to air dry. The sections were then incubated with

secondary antibody for 30 minutes. Sections were rinsed twice

with 0.1% Tween 20 (Sigma) in TBS followed by rinsing in

running water for 1 minute. Sections were mounted in faramount

(DAKO) and viewed using a Zeiss Axioplan microscope with

fluorescent filter.

Determination of Microvessel Density. In this study,

CD31 antibodies were used for immunohistochemical staining of

endothelial cells in a tumor section. This was found to be a more

reliable method of detecting small immature vessels than CD34

or von Willebrand factor (data not shown), consistent with

previous studies (32). Following staining with CD31, each

section was scanned on a Zeiss Axioplan microscope at �160

magnification to identify three areas with the greatest MVD. The

vessel count was done at �250 magnification for an overall area

of 0.79 mm2 for each of the three ‘‘hotspots’’ identified. The

mean microvessel count was calculated for each section. MVD

was expressed as the number of microvessels per millimeter

square. Tumor MVD separated into two clear groups: negative/

low MVD (MVD < 100 per mm2) and high MVD (MVD >

100 per mm2).

Cell Culture. HUVEC cells were isolated from human

umbilical cords obtained from the delivery ward at St. James’s

University Hospital (see Clinical Samples). The cords were

collected in cord buffer [137 mmol/L NaCl, 4 mmol/L KCl,

10 mmol/L HEPES-HCl (pH 7.4), 11 mmol/L glucose] and

isolated by an enzymatic technique (33). Once isolated, cells

were grown in M199 medium (Sigma) containing 20% FCS

(SeraLab, Sussex, United Kingdom), penicillin/streptomycin

(100 units/100 mg/mL, Life Technologies), and fungizone

(2.5 Ag/mL, Life Technologies). HUVEC cells at passage 1 were

used for all experiments.

The characterized ESFT cell lines TC-32, RD-ES, and TTC-

466 were grown in RPMI 1640 (Sigma) containing 10% FCS;

medium for TTC-466 was supplemented with 10% conditioned

medium. The ESFTcell line A673, breast cancer cell line MCF-7,

and human foreskin fibroblasts were grown in DMEM (Sigma)

and 10% FCS. ESFT cell lines SK-ES1 and SK-N-MC were

grown in McCoy’s medium (Sigma) plus 15% FCS and DMEM/

F-12 medium (Sigma) plus 10% FCS, respectively. Cell lines

were purchased from the American Type Culture Collection

(Rockville, MD), except for the TC-32 and RD-ES cells (kind

gifts from Dr. J. Toretsky, Division of Pediatrics, University of

Maryland, Baltimore, MD) and TTC-466 cells (kind gift from Dr.

P. Sorenson, British Columbia Children’s Hospital, Vancouver,

British Columbia, Canada). All cells were maintained in a

humidified atmosphere of 5% CO2/95% air at 37jC (Sanyo

Gallenkamp, Loughborough, United Kingdom).

Reverse Transcription-PCR. Total RNA was isolated

from ESFT cell lines using Ultraspec RNA (AMS Biotechnol-

ogy, Oxon, United Kingdom). The quality of isolated RNA was

confirmed by separation of RNA (1 Ag) in 1% agarose gel

containing ethidium bromide (0.5 Ag/mL) in 1� Tris-borate

EDTA and visualized under UV light using a transilluminator.

First-strand cDNAwas synthesized from total RNA (1 Ag) using5 units of murine leukemia virus reverse transcriptase (Pharma-

cia Biotech, St. Albans, United Kingdom) in 1� PCR buffer

[10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, Perkin-Elmer

Applied Biosystems, Warrington, United Kingdom], 1 mmol/L

deoxynucleotide triphosphates (Pharmacia Biotech), 8 mmol/L

MgCl2 (Perkin-Elmer Applied Biosystems), 0.3 Ag random

hexamer primers (Life Technologies), and 8 units of RNA guard

(Pharmacia Biotech). cDNA (10 AL) was then amplified for the

angiogenic growth factors and receptors VEGF, Flt-1, Flk-1/

KDR, bFGF, PDGFA, PDGFB, PDGFR-a, and PDGFR-h(Table 3). The efficiency of amplification was controlled by

amplification for the housekeeping gene b2-microglobulin(Table 3). Amplification was carried out using 1.25 units of

Amplitaq gold (Perkin-Elmer Applied Biosystems) and primer

pairs (40 pmol) for the above growth factors and receptors in

Table 2 Antibodies used for immunohistochemistry and immunofluorescence

Target

Positivecontroltissue

Primaryantibody typeand source Dilution

Secondaryantibody typeand source Dilution

Stainingmethod used

No. tumorsanalyzed

CD31 Wilm’s tumor Mouse anti-humanendothelial cell,

CD31 (DAKO, M0823)

1:10 Biotinylated rabbitanti-mouse IgG(DAKO, E0413)

1:100 Three stage peroxidase 34

bFGF Skin Rabbit anti-human bFGF(Santa Cruz Biotechnology,Santa Cruz, CA, SC-152)

1:300 Goat anti-rabbit AlexaFluor 594 nm

(Molecular Probes, Leiden,the Netherlands, A11012)

1:10,000 Immunofluorescence 33

VEGF Ewing’ssarcoma

Mouse anti-humanVEGF (BD PharMingen,

Oxford, United Kingdom, 55036)

1:50 Biotinylated rabbitanti-mouse IgG(DAKO, E0413)

1:100 Saponin method 30

PDGFA Melanoma Rabbit anti-human PDGFA(Santa Cruz Biotechnology,

SC-128)

1:800 Biotinylated goatanti-rabbit IgG(DAKO, E0432)


PDGFB Melanoma Rabbit anti-human PDGFB(Santa Cruz Biotechnology,

SC-7878)

1:400 Biotinylated goatanti-rabbit IgG(DAKO, E0432)


PlGF Hemangioma Goat anti-human PlGF(Santa Cruz Biotechnology,

SC-1880)

1:80 Biotinylated rabbitanti-goat IgG

(DAKO, E0466)


NOTE. Sufficient material was not available to analyze each tumor for all markers. Conditions for use of antibodies were determinedempirically.




1� PCR buffer (as above), 0.2 mmol/L deoxynucleotide

triphosphates, and 1.6 mmol/L MgCl2. Amplitaq gold was

activated by heating at 94jC for 10 minutes and amplification of

the target cDNA was done by PCR (Table 3). Positive controls

for each target RNA were included (Table 3). Negative controls

included reverse transcriptase–negative controls in which

reverse transcriptase enzyme was replaced with water as well

as water-negative controls containing all components for the RT-

PCR reaction but no target RNA.

RT-PCR products (30 AL) were size separated on a 2%

agarose gel in 1� Tris-borate EDTA. A 50-bp molecular weight

ladder (Life Technologies) was used to estimate product size.

Amplified bands were identified following staining with

ethidium bromide (0.5 Ag/mL) and visualization under UV light

using a transilluminator. The identity of amplified product was

confirmed by direct sequence analysis; excised bands were

extracted from the gel using the QIAquick gel extraction kit

(Qiagen, Crawley, United Kingdom) according to manufacturer’s

instructions and each product (f50 ng DNA) was sequenced

using the ABI PRISM Big Dye Terminator kit (Perkin-Elmer

Applied Biosystems) and the ABI 377 automated sequencer.

Original PCR primers (1.6 pmol per reaction) were used as

forward and reverse sequencing primers.

ELISA. ESFT cells (2 � 105 per well) seeded in

Primaria six-well plates (Fahrenheit, Leeds, United Kingdom)

were left to adhere overnight. On the following day, medium

was removed by aspiration and replaced with fresh medium.

Medium was conditioned by leaving on cells for up to 72 hours

after which medium from duplicate wells was collected on ice,

pooled, and centrifuged at 3,000 � g for 5 minutes to pellet

any cellular fragments. The supernatants were then aliquoted

and stored at �80jC until further analysis. Human VEGF,

PlGF, and bFGF and the biologically active dimeric forms of

the PDGFA and PDGFB chain precursor molecules (PDGFAB

and PDGFBB) were detected using Quantikine ELISA kits

(R&D Systems, Abbingdon, Oxon, United Kingdom) accord-

ing to manufacturer’s instructions. All samples were assayed in

duplicate.

Conditioned Medium Assays. A673 cells (1.5 � 106 per

T-75 Primaria flask) were seeded and left to adhere overnight. On

the following day, medium was aspirated and M199 medium

containing 10% or 20% FCS (medium in which HUVEC cells are

grown) was added. Tumor cell conditioned medium (TCM) was

collected after 24 hours; medium was centrifuged at 3,000� g for

5 minutes to remove any cellular fragments. Importantly, for these

experiments, the growth of the ESFT cell line A673 was

unaffected by culture for up to 72 hours into HUVEC medium

(M199 plus 10% or 20% FCS; data not shown).

HUVEC cells (2 � 103 per well) were seeded in gelatin-

coated (0.2%, Sigma) 96-well plates and left to adhere overnight.

On the following day, cells were rinsed with serum-free medium

and then stimulated with M199 medium containing 10% or 20%

FCS (control) or A673 TCM for 72 hours. All conditions were

carried out in triplicate. During the last 18 hours of the 72-hour

incubation, bromodeoxyuridine (1:750, Biotrack Cell Prolifera-

tion ELISA System, Amersham Pharmacia Biotech, Little

Chalfont, Bedfordshire, United Kingdom) was added to cells

and proliferation was assayed according to manufacturer’s

instructions.

Receptor Tyrosine Kinase Inhibitors. For in vitro

studies looking at viable cell counts, ESFT cells (TC-32, RD-

ES, or TTC-466) were seeded in Primaria six-well plates (2� 105

per well) and left to adhere overnight and medium was replaced.

SU6668 (0.01-10 Amol/L), SU5416 [0.01-10 Amol/L, SUGEN

(now Pfizer), San Francisco, CA], or DMSO (10 AL; vehicle forSU6668 or SU5416) was added to cells. After 24 and 48 hours,

cells were harvested and viable cell number was counted using the

trypan blue exclusion assay. For cell proliferation assays, ESFT

cells TC-32, RD-ES, or TTC-466 were seeded (1 � 103 per well)

in Primaria 96-well plates and treated as above. After 24 and 48

hours, cell proliferation was assayed using the Biotrack Cell

Proliferation ELISA as above. In addition to the vehicle negative

control (DMSO), viable cell number and proliferation were

measured in cells under normal growth conditions.

The effect of SU6668 (100 mg/kg/d) and SU5416 (25 mg/

kg/d) on RD-ES growth was examined in nu/nu mice. Mice

(n = 22 and 20, respectively) were injected s.c. in one flank with

RD-ES cells (2.5 � 106 in 0.2 mL medium). On day 8, following

the development of a palpable tumor, mice were injected daily

with either vehicle alone (DMSO), SU6668 (100 mg/kg),

or SU5416 (25 mg/kg). The effect of SU6668 (100 mg/kg/d)

on A673 growth was also examined in nu/nu mice. As described

above, mice (n = 4) were injected with A673 cells. On day 15,

following the development of a palpable tumor, mice were

injected daily with either vehicle alone (DMSO) or SU6668

(100 mg/kg). Tumors were measured twice weekly by caliper

measurements in two directions, the largest diameter (a) and its

perpendicular (b): tumor size = a � b . Mice were sacrificed when

s.c. tumors reached a size of 1.4 cm2, at the end of the experiment,

or if the mouse showed signs of distress.

Table 3 Primer sequences, PCR cycle characteristics, and positive controls used for amplification of angiogenic growth factors and their receptors andthe housekeeping gene b2-microglobulin

Target Forward sequence Reverse sequence

VEGF TCGGGCCTCCGAAACCATG CCTGGTGAGAGATCTGGTTCFlt-1 GTCACAGAAGAGGATGAAGGTGTCTA CACAGTCCGGCACGTAGGTGATTFlk-1/KDR ACCGGCTGAAGCTAGGTAAGCC TGCTGTCCAAGCGCCGTTTCPlGF CTCCTAAAGATCCGTTCTGG GGTAATAAATACACGAGCCGbFGF AAGGAAGATGGAAGATTACTGGCTT CCGGTAAGTATTGTAGTTATTAGATTCCAAPDGFA TCACGGGGTCCACGCCACTAA TGCGGCTCATCCTCACCTCACPDGFB CTCTGCTGCTACCTGCGTCTG GCGTTGGTGCGGTCTATGAGGPDGFR-a AACTGATCCCGAGACTCCTG CCGCACCTCTACAACAAAATGPDGFR-h ACCATTCCATGCCGAGTAACA CAGGTGTAGGTCCCCGAGTCTh2-Microglobulin CTCGCGCTACTCTCTCTTTCT TGTCGGATTGATGAAACCCAG




Anti–Vascular Endothelial Growth Factor Agents. The

effect of rhuMAb-VEGF (bevacizumab; 10 mg/kg twice weekly)

and VEGF Trap (2.5 or 25 mg/kg twice weekly, Regeneron

Pharmaceuticals, NY) on RD-ES or A673 growth was examined

in nu/nu mice. Mice [rhuMAb-VEGF n = 5-8 (RD-ES) and n = 5

(A673) per group; VEGF Trap n = 5 (RD-ES) and n = 3 (A673)

per group] were injected s.c. in one flank with RD-ES or A673

cells (5 � 106 in 0.2 mL medium); cell numbers injected

s.c. were doubled compared with that in previous experiments to

increase the frequency of tumor take. On day 15, following

the development of a palpable tumor, mice were injected twice

weekly with either rhuMAb-VEGF (10 mg/kg)/control vehicle

(0.9% NaCl) or VEGF Trap (2.5 or 25 mg/kg)/control vehicle (Fc

control protein). Both rhuMAb-VEGF and VEGF Trap were

given for up to 4weeks. Tumor size wasmeasured twice weekly as

above and mice were sacrificed when tumors reached a size of 1.4

cm2, at the end of the experiment, or if the mouse showed signs of

distress. All procedures with mice were done as per United

Kingdom guidelines and carried out under a project license issued

by the Home Office (London, United Kingdom).

Histologic Analysis. Tumors removed from mice were

divided into two, half of which was fixed in zinc fixative

(BD Biosciences, Oxford, United Kingdom) and embedded in

paraffin and the other half was embedded in OCT compound and

frozen. Histology of tumors was examined by light microscopy

following staining of tumor sections (4 Am) with H&E.

Statistical Analyses. Associations between MVD and

expression of angiogenic factors were evaluated using Fisher’s

exact test. A two-stage regression approach was used for

analyzing data from the in vivo model system with receptor

tyrosine kinase inhibitors and anti-VEGF agents. Here, data

consisted of repeated tumor growthmeasurements on eachmouse.

A linear regression was fitted to each mouse-specific growth

curve. The slope coefficients estimate the average growth rate of

tumor in each mouse and these were then used as the dependent

variable in an analysis of covariance comparing treatments with

and without the starting tumor size as a covariate. P < 0.05 was

considered significant for all studies.

RESULTS

Microvessel Density and Its Relationship with Angio-

genic Growth Factors in Ewing’s Sarcoma Family of

Tumors. Microvessels were readily detected in ESFT following

immunohistochemistry for the endothelial cell marker CD31 and

examination by light microscopy (Fig. 1). The frequency of MVD

identified two distinct tumor groups, those with a MVD > 100 per

mm2 (high MVD) and those with a MVD < 100 per mm2 (low

MVD). Of the 34 samples analyzed, 8 (24%) had high MVD.

VEGF was expressed at high levels in 18 of 30 (60%;

Fig. 2A) of the tumors examined; the remaining 12 tumors were

negative (40%; Fig. 2B). There was no gradation of VEGF

expression across the tumor group. In contrast, PDGFA or

PDGFB was heterogeneous with no negative tumors. Expression

of PDGFA and PDGFB was low (Fig. 2C and F), intermediate

(Fig. 2D and G), or high (Fig. 2E andH). For statistical analyses,

expression was classified as either strongly positive [homoge-

neous staining across all tumor; 18 of 28 (64%) PDGFA and 13 of

28 (46%) PDGFB] or focally positive [10 of 28 (36%) PDGFA

and 15 of 28 (54%) PDGFB]. PlGF and bFGF expression was

also heterogeneous; PlGF expression was either absent [11 of 28

(39%); data not shown], focally positive [9 of 28 (32%); Fig. 2I],

or strongly positive across the whole tumor [8 of 28 (29%);

Fig. 2J]. Expression of bFGF was either negative [6 of 33 (18%);

data not shown], low positive [10 of 33 (30%); data not shown],

intermediate positive [3 of 33 (9%); Fig. 2M], or strongly positive

[14 of 33 (43%); Fig. 2N]. For statistical analyses, staining with

PlGF and bFGF was classed as negative or positive. For all

growth factors investigated, levels of expression were not

dependent on site of primary tumor (data not shown).

Expression of VEGF correlated with MVD (P = 0.02; 7 of

7 tumors with high MVD and 11 of 23 tumors with low MVD

were positive for VEGF). This suggests that VEGF may be an

important regulator of MVD in ESFT. There was no correlation

between MVD and expression of bFGF (P = 0.14; 5 of

8 tumors with high MVD and 22 of 25 tumors with low MVD

were positive for bFGF), PlGF (P = 0.42; 6 of 8 tumors with

high MVD and 11 of 20 tumors with low MVD were positive

for PlGF), PDGFA (P = 0.67; 4 of 7 tumors with high MVD

and 14 of 21 tumors with low MVD were positive for

PDGFA), or PDGFB (P = 0.40; 2 of 7 tumors with high MVD

and 11 of 21 tumors with low MVD were positive for

PDGFB).

Angiogenic Growth Factors and Receptor Expression

in Ewing’s Sarcoma Family of Tumor Cell Lines. The

angiogenic profile of ESFT cell lines was examined by RT-PCR

for the angiogenic growth factors VEGF and PlGF and receptors

Flt-1 and Flk-1/KDR, bFGF, PDGFA, PDGFB, PDGFR-a, and

PDGFR-h (Fig. 3). The VEGF primers annealed to exons 1 and

8, thus amplifying all five isoforms of VEGF (VEGF121,

VEGF145, VEGF165, VEGF189 and VEGF206). However, only

Table 3 Primer sequences, PCR cycle characteristics, and positive controls used for amplification of angiogenic growth factors and their receptors andthe housekeeping gene b2-microglobulin (Cont’d)

PCR cycle characteristics Positive control Reference

40 cycles of 30 s at 94jC, 30 s at 60jC, 1 min at 72jC; final cycle of 7 min at 72jC MCF-7 (34)35 cycles of 1 min at 94jC, 1 min at 62jC, 1 min at 72jC; final cycle of 10 min at 72jC HUVEC (35)35 cycles of 1 min at 94jC, 1 min at 60jC, 1 min at 72jC; final cycle of 10 min at 72jC HUVEC (36)35 cycles of 1 min at 94jC, 1 min at 55jC, 3 min at 72jC; final cycle of 10 min at 72jC HUVEC (37)

35 cycles of 30 s at 95jC, 30 s at 52jC, 45 s at 72jC; final cycle of 5 min at 72jC HUVEC (38)35 cycles 1 min at 94jC, 1 min at 62jC, 1 min at 72jC; final cycle of 10 min at 72jC HUVEC (39)

As above HUVEC (39)35 cycles of 30 s at 94jC, 30 s at 55jC, 1 min at 72jC; final cycle of 7 min at 72jC Human foreskin fibroblasts (40)

As above Human foreskin fibroblasts (40)33 cycles of 30 s at 94jC, 1 min at 60jC, 1 min at 74jC; final cycle of 7 min at 74jC — (38)




three bands were identified by RT-PCR in the ESFT cell lines.

Two of the three bands were successfully sequenced and

identified as VEGF121 (516 bp) and VEGF165 (648 bp). The

size of the third band (588 bp) indicated that it may represent

VEGF145; however, this could not be confirmed by sequence

analysis and hence may represent a VEGF121/VEGF165 hetero-

duplex (41). Neither VEGF189 (720 bp) nor VEGF206 (771 bp)

were detected in any of the ESFT cell lines. The PlGF primers

used amplified two isoforms of PlGF [PlGF-1 (184 bp) and

PlGF-2 (248 bp)], both of which were expressed by all six ESFT

cell lines. However, the VEGF receptors Flt-1 (417 bp) and Flk-

1/KDR (403 bp) were differentially expressed. Expression of the

ligands PDGFA (409 bp) and PDGFB (317 bp) was cell

line dependent, whereas PDGFR-a (565 bp) and PDGFR-h(437 bp) receptors were detected in all the cell lines studied

(Fig. 3). bFGF (92 bp) was detected in all six cell lines; previous

studies by our group have shown expression of FGF receptors

1 to 4 in the same six ESFT cell lines (38).

Vascular Endothelial Growth Factor and Placental

Growth Factor Are Secreted by Ewing’s Sarcoma Family

of Tumor Cells. Specific ELISAs for VEGF, PlGF, bFGF,

PDGFAB, and PDGFBB were done to measure the secretion of

the above factors in conditioned medium obtained from all six

ESFT cell lines. Only VEGF and PlGF were detected in TCM

from ESFT cell lines (Fig. 4A and B , respectively). The

concentration of VEGF and PlGF in TCM increased with time,

consistent with continual secretion by ESFT cells (data not

shown). The A673 cell line secreted high levels of both VEGF

and PlGF, which were comparable with levels reported in other

tumor types (42, 43). Other cell lines also secreted high levels of

VEGF but lower levels of PlGF (RD-ES and TTC-466).

Because ESFT are thought to arise in several different neurally

derived cells, consistent with the multiple sites of ESFT, it is

not possible to determine whether the levels of VEGF are high

in tumor cells compared with those in the normal cell of origin

as is the case for some tumors (44, 45). However, these data

imply that VEGF and PlGF are the major proangiogenic factors

secreted by ESFT cell lines, whereas bFGF and PDGF isoforms

may remain cell associated or sequestered in the extracellular

matrix.

TCM (24 hours) containing either 10% or 20% FCS

enhanced the proliferation of HUVEC compared with control

cells (Fig. 4C). The enhanced proliferation of HUVEC is

consistent with the hypothesis that VEGF and PlGF secreted by

ESFT cells may play a major role in modulating angiogenesis

in these tumors. Both receptor tyrosine kinase inhibitors

SU6668 and SU5416 had no significant effect on viable cell

number or proliferation of TC-32, RD-ES, or TTC-466 cells

in vitro after 24 or 48 hours, suggesting that there is no VEGF

autocrine or paracrine survival loop in ESFT cells (data not

shown).

Growth Inhibition of Ewing’s Sarcoma Family of

Tumors with Receptor Tyrosine Kinase Inhibitors and

Anti–Vascular Endothelial Growth Factor Agents In vivo.

S.c. injection of nu/nu mice with the ESFT cells RD-ES and

A673 resulted in rapid tumor growth in all injected mice; after

V40 days, 100% of the mice had tumors of 1.4 cm2 and were

sacrificed according to experimental protocol. However, the rate

of tumor growth was significantly reduced in mice treated with

both receptor tyrosine kinase inhibitors SU6668 (100 mg/kg/d)

and SU5416 (25 mg/kg/d; RD-ES only) compared with control

mice treated with vehicle alone (DMSO; P = 0.001 for all;

Fig. 5A and B).

Growth was also significantly inhibited in mice with RD-ES

tumors following treatment with the anti-VEGF agent rhuMAb-

VEGF (10 mg/kg twice weekly) compared with control mice

treated twice weekly with control vehicle alone (0.9% NaCl;

P = 0.001; Fig. 6A). In contrast, although some delay in tumor

growth was observed following treatment of mice with A673

tumors, this failed to reach significance (P = 0.08; Fig. 6B). This

may in part be explained by the delayed A673 tumor growth in one

control mouse. AsVEGFTrap inhibits VEGF andmay also inhibit

PlGF (30, 46), we investigated the effect of this agent on the

growth of two ESFT tumors (RD-ES and A673) with different

VEGF and PlGF profiles (Fig. 4A and B). Both high (25 mg/kg

twice weekly) and low (2.5 mg/kg twice weekly) doses of VEGF

Trap significantly inhibited growth of RD-ES tumors compared

with that of control mice treated with vehicle alone (Fc control

protein; P = 0.001 and 0.001, respectively; Fig. 7A), whereas only

high-dose VEGF Trap inhibited A673 tumor growth (P = 0.005;

Fig. 7B).

In comparison with control tumors, large areas of

geographic necrosis were observed throughout RD-ES tumors

treated with both receptor tyrosine kinase inhibitors and anti-

VEGF agents (Fig. 8A-C , F, G , and J-L). Similar effects were

also observed throughout A673 tumors following treatment with

Fig. 1 CD31 expression in ESFT. Sections were stained by immunohistochemistry using CD31 antibody, MVD was calculated and tumors wereseparated into two groups: low MVD and high MVD. A, negative control, CD31 antibody omitted; B, ESFTwith low MVD; C, ESFTwith high MVD.All original magnification, �200. Asterisks, blood vessels.




the receptor tyrosine kinase inhibitor SU6668 and anti-VEGF

agent rhuMAb-VEGF (Fig. 8D , E, H , and I). However, in

contrast to RD-ES tumors, enhanced necrosis was only observed

in mice with A673 tumors treated with the high-dose VEGF Trap

(25 mg/kg; Fig. 8O) and not low dose (2.5 mg/kg; Fig. 8N)

when compared with corresponding control tumors (Fig. 8M). In

all groups that responded to treatment, tumors were generally less

vascular and cellular but more vacuolated compared with those in

control groups. Toxicity was observed in vivo with both receptor

tyrosine kinase inhibitors SU6668 and SU5416, which on

postmortem were found deposited in the bowel. No toxicity

was observed with VEGF targeting agents.

DISCUSSION

The results from the present investigation show a significant

positive correlation between VEGF and MVD in ESFT. These

results, coupled with in vitro observations of TCM-induced

endothelial cell proliferation and in vivo inhibition of ESFT

growth following treatment with receptor tyrosine kinase

inhibitors and anti-VEGF agents, suggest that VEGF may be

a major regulator of angiogenesis in this tumor group.

In primary human ESFT, the expression of the proangio-

genic growth factor VEGF positively correlated with MVD,

consistent with the hypothesis that VEGF may regulate the

formation of microvessels in these tumors. PDGFA, PDGFB,

PlGF, and bFGF were also expressed by some ESFT,

demonstrating that these tumors can produce several different

proangiogenic factors; however, their expression did not

correlate with MVD. Consistent with our observations, down-

regulation of VEGF expression following treatment of mice with

the tumor suppressor adenovirus type 5 E1A gene resulted in

a decrease in MVD and s.c. ESFT growth (47). In breast cancer,

the number of different proangiogenic factors expressed has been

reported to increase as the tumors progress (48). Whether the

profile of proangiogenic growth factors in ESFT also correlates

with progression remains to be seen. To date, the prognostic

Fig. 2 Angiogenic growth factor expression in ESFT. VEGF immunohistochemistry: example of a (A) positive tumor and (B) a negative tumor.PDGFA immunohistochemistry: (C) low, (D) intermediate, and (E) high levels. PDGFB immunohistochemistry: (F) low, (G) intermediate, and (H)high levels. PlGF immunohistochemistry: (I) PlGF hotspots within tumor and (J) majority of tumor PlGF positive. Negative controls: (K) negativecontrol primary antibody omitted goat anti-rabbit secondary and (L) negative control primary antibody omitted rabbit anti-goat secondary. All originalmagnification, �200. bFGF immunofluorescence: (M) intermediate and (N) high bFGF positivity. Original magnification, �400.




importance of circulating levels and/or tumor expression

of angiogenic factors, such as VEGF and bFGF, in pediatric

malignancies, soft tissue sarcomas, and malignant bone tumors

have only included analysis on a limited number of peripheral

primitive neuroectodermal tumors or Ewing’s sarcoma (49–55).

Of these studies, some suggest that serum VEGF may be used to

monitor therapeutic response in children with solid malignancies

(52). However, in agreement with others (49, 50), we have not

found this to be a consistent or reliable marker primarily due to

the release of VEGF from activated platelets (data not shown).

We are currently conducting a prospective clinical outcome study

through the United Kingdom Children’s Cancer Study Group

(study no. BS 2002 02) to evaluate the prognostic significance of

angiogenic factors in ESFT using a multivariate analysis.

All the ESFT cell lines studied produce and secrete VEGF,

providing a useful model to investigate its potential role in this

tumor group. These results are consistent with other studies that

have also shown high levels of VEGF secretion by ESFT cell

lines in vitro (47, 56). Recent reports suggest that the

overexpression of VEGF by ESFT cells may in part be regulated

by the insulin-like growth factor/insulin-like growth factor

receptor-I autocrine loop and/or the synergistic activation of the

VEGF promoter following interaction of EWS-ETS fusion

proteins with transcription factor Sp1 (55, 56). In addition to

VEGF secretion, we have also shown that ESFT cells express

VEGF receptors Flt-1 and Flk-1/KDR, suggesting that VEGF

may function both as a paracrine and as an autocrine factor

in these tumors. Indeed, stimulation of HUVEC proliferation

by ESFT TCM was observed, thus supporting the hypothesis

that VEGF has a paracrine role in regulating the formation of

new vasculature in these tumors. However, we found no

evidence to suggest VEGF has an autocrine growth effect (data

not shown) as has been described for other tumor types

(43, 57, 58). All the ESFT cell lines express predominantly

VEGF121 and VEGF165 mRNA. The secretion of these isoforms

suggests that ESFT are capable of inducing vascularization by

recruiting distal blood vessels as well as expanding the capillary

bed within the tumor (59).

In addition to VEGF, PlGF was also produced and

secreted by ESFT cell lines. Recent reports indicate that PlGF

may play an important role in angiogenesis by increasing

endothelial cell survival and enhancing their response to VEGF

as well as increasing vessel density, size, and permeability

(60–63). Additionally, PlGF may also modulate VEGF activity

by forming functional heterodimers with VEGF (63–65).

Following activation of Flt-1 by PlGF, reports suggest that

Fig. 3 RT-PCR of angiogenicgrowth factors and their recep-tors expressed in ESFT celllines. Representative exampleof RT-PCR showing expressionof VEGF, PlGF, Flt-1, Flk-1/KDR, bFGF, PDGFA, PDGFB,PDGFR-a, PDGFR-h. Ampli-fication of the housekeepinggene b2 -microglobulin wasused to confirm the quality ofRNA for amplification by RT-PCR.




Flt-1 can amplify VEGF signaling by intermolecular trans-

phosphorylation of Flk-1/KDR (63). Together, both VEGF and

PlGF may also recruit bone marrow–derived endothelial cells,

a process that has been shown to potentiate the neovascula-

rization of tumors including ESFT (12, 66, 67).

ESFT cells also synthesize and express bFGF, PDGFA,

and PDGFB, although the protein products of these growth

factors seem to remain cell-associated or sequestered in the

extracellular matrix and hence were not detected by the

ELISA assay. These results suggest that they may not have a

direct effect on endothelial cell proliferation. However,

recently, bFGF and PDGFB have been shown to promote

angiogenesis in tumors by enhancing VEGF and/or VEGFR

expression (68–70). Thus, we cannot currently exclude a

juxtacrine or intracrine role for these factors in enhancing

VEGF-dependent angiogenesis. ESFT cell lines also express

mRNA for all four FGF receptors (38) and both PDGFR-a

and PDGFR-h receptors; whether these growth factors and

their receptors have autocrine or paracrine roles in regulating

angiogenesis or the survival and proliferation of ESFT is

currently being investigated.

Recent clinical studies in metastatic colorectal cancer have

shown that bevacizumab in combination with cytotoxic therapy

has positive effects on patient survival (24). This proof of

principal study has restimulated interest in the exploitation of

VEGF as a target for antitumor growth strategies. Because

VEGF expression correlates with MVD in ESFT and high levels

Fig. 4 VEGF and PlGF secretion by ESFT cell lines. ELISAs wereused to quantify levels of VEGF and PlGF in conditioned mediumobtained from ESFT cell lines at 72 hours. Columns, mean concentrationof (A) VEGF and (B) PlGF (pg/mL) normalized for 2 � 106 cells; bars,SD. C, increased HUVEC proliferation observed after stimulation withTCM. Both 10% and 20% FCS-containing medium, corresponding tonormal growth conditions for the ESFT cell line A673 and HUVEC,respectively (see Patients and Methods), were used for tumorconditioning. Proliferation was assessed after 72-hour stimulation with24-hour TCM by measuring incorporation of bromodeoxyuridine.Columns, mean (n = 3); bars, SD.

Fig. 5 Effect of receptor tyrosine kinase inhibitors on growth of ESFTin vivo . Subcutaneous injection of nu/nu mice with RD-ES andA673 cells resulted in rapid tumor growth in all injected mice.On day 8 (RD-ES) or day 15 (A673), mice were injected withSU6668 (100 mg/kg/d), SU5416 (25 mg/kg/d; RD-ES only), or controlvehicle alone (DMSO). Tumor growth was significantly inhibited inmice with (A) RD-ES tumors after treatment with SU6668 or SU5416and (B) A673 tumors after treatment with SU6668 when comparedwith tumors in corresponding control mice treated with vehiclealone (DMSO). Points, mean tumor size; bars, SE. **, P = 0.001.




of this factor were detected in ESFT cell conditioned medium,

we have investigated the effects of two different antiangiogenic

strategies that disrupt the VEGF pathway on s.c. growth of

ESFT in mice. These included the receptor tyrosine kinase

inhibitors SU6668 (inhibits FGF receptor 1, PDGFR-h, and

Flk-1/KDR) and SU5416 (inhibits Flk-1/KDR; refs. 25–27) and

the VEGF targeting agents rhuMAb-VEGF (bevacizumab; refs.

28, 29) and VEGF Trap (30). In contrast to the VEGF targeting

agents that mainly inhibit secreted VEGF [rhuMAb-VEGF

inhibiting human (tumor-derived) VEGF; VEGF Trap inhibiting

human (tumor-derived) and host (murine-derived) VEGF (also

PlGF)], the receptor tyrosine kinase inhibitors are also capable

of targeting angiogenic growth factor receptors expressed by

host cells (25–27). Compounds, such as SU6668, may also play

a role in inhibiting the FGF-induced and/or PDGF-induced

recruitment and proliferation of angiogenesis, promoting host-

derived stromal cells, such as fibroblasts and pericytes, which

are known to express VEGF (70–73).

Consistent with previous reports in other tumor types, both

class of agents reduced the vascularity and growth of ESFT in

nude mice (25–28, 30, 74, 75). Interestingly, as observed in mice

with RD-ES tumors, the degree of inhibition induced by SU5416

(Flk-1/KDR inhibitor) was similar to that observed for SU6668

(inhibitor of Flk-1/KDR, FGF receptor 1, and PDGFR-h),implying that the VEGF signaling pathway is the key regulator

of angiogenesis in ESFT, consistent with the profile of angiogenic

factors we observed in the primary ESFT. Results also suggest that

in ESFT the influence of FGF and PDGF signaling pathways on

stromal cell recruitment, as discussed above, are minimal. These

receptor tyrosine kinase inhibitors have, however, been removed

recently from clinical trials following unacceptable toxicity when

given in combination with chemotherapeutic agents (76).

Delay in tumor growth was observed in mice with RD-ES

and A673 tumors after treatment with rhuMAb-VEGF and

VEGF Trap. However, in rhuMAb-VEGF-treated mice, this

delay was only significant in mice with RD-ES but not A673

tumors. The lack of a significant effect in A673 tumors may

reflect the delayed growth in one of the control mice.

Alternatively, as rhuMAb-VEGF only inhibits human VEGF,

significant inhibition of A673 tumor growth may require the

neutralization of both human and murine VEGF (77). Unlike

rhuMAb-VEGF, VEGF Trap is capable of inhibiting both

Fig. 6 Effect of anti-VEGF agent rhuMAb-VEGF on growth of ESFTin vivo . Subcutaneous injection of nu/nu mice with RD-ES or A673 cellsresulted in rapid tumor growth and development of palpable tumors. Onday 15, mice were injected with rhuMAb-VEGF (y; 10 mg/kg twiceweekly) or control ( w ; 0.9% NaCl twice weekly). Tumor growth wassignificantly inhibited in mice with RD-ES (A) but not A673 tumors (B)after treatment with rhuMAb-VEGF when compared with growth oftumors in corresponding control mice. Points, mean tumor size; bars, SE.**, P = 0.001.

Fig. 7 Effect of anti-VEGF agent VEGF Trap on growth of ESFTin vivo . Subcutaneous injection of nu/nu mice with RD-ES or A673 cellsresulted in rapid tumor growth and development of palpable tumors. Onday 15, mice were injected with VEGF Trap [2.5 (y) or 25 (n) mg/kgtwice weekly) or control (w ; Fc control protein twice weekly). Tumorgrowth was inhibited in mice with RD-ES tumors after treatment withboth high and low doses of VEGF Trap when compared with growth oftumors in corresponding control mice (A). In contrast, A673 tumorgrowth was only inhibited with high-dose VEGF Trap (B). Points, meantumor size; bars, SE. *, P = 0.005; **, P = 0.001.




Fig. 8 Comparative histology by H&E of tumors treated with or without receptor tyrosine kinase inhibitors and anti-VEGF agents. Representativeexamples of RD-ES tumors treated with (A) SU6668 and SU5416 control, (B) SU6668 (100 mg/kg/d), and (C) SU5416 (25 mg/kg/d); A673tumors treated with (D) SU6668 control and (E) SU6668 (100 mg/kg/d); RD-ES tumors treated with (F) rhuMAb-VEGF control and (G)rhuMAb-VEGF (10 mg/kg twice weekly); A673 tumors treated with (H) rhuMAb-VEGF control and (I) rhuMAb-VEGF (10 mg/kg twice weekly);RD-ES tumors treated with (J) VEGF Trap control, (K) VEGF Trap (2.5 mg/kg twice weekly), and (L) VEGF Trap (25 mg/kg twice weekly); andA673 tumors treated with (M) VEGF Trap control, (N) VEGF Trap (2.5 mg/kg twice weekly), and (O) VEGF Trap (25 mg/kg twice weekly).Large areas of geographic necrosis (arrows) were observed in RD-ES tumors treated with SU6668, SU5416, rhuMAb-VEGF, and VEGF Trapwhen compared with histology of corresponding control tumors. Similarly, large areas of geographic necrosis were also observed in A673 tumorstreated with SU6668 and rhuMAb-VEGF. However, in contrast to RD-ES tumors, enhanced necrosis was only observed following treatment ofA673 tumors with high-dose VEGF Trap (25 mg/kg twice weekly; O) when compared with histology of control tumors (M). Originalmagnification, �100 (A-C) and �40 (D-O).




human-derived and mouse-derived VEGF, thus making it a more

effective agent in experimental mouse models (30, 46, 77).

Additionally, as VEGF Trap is a composite decoy receptor

consisting of both Flt-1 and Flk-1/KDR extracellular domains,

this agent may also bind PlGF (46, 72). To evaluate the potential

importance of PlGF in ESFT, we investigated the efficacy of

this agent using cell lines with different VEGF and PlGF

profiles (RD-ES, VEGFhighPlGFlow; A673, VEGFhighPlGFhigh).

Compared with RD-ES tumors, A673 tumors were rapidly

growing with large areas of necrosis and high vascularity and

did not respond to low doses of VEGF Trap. As PlGF has a

higher affinity for Flt-1 than VEGF, this may reflect the reduced

availability of VEGF Trap for sequestering VEGF (60).

Alternatively, consistent with the hypothesis that PlGF enhances

VEGF-induced neovascularization in comparison with VEGF

alone, higher concentrations of VEGF Trap may be required to

inhibit the synergistic effects of these growth factors when both

are highly expressed within tumors. Thus, inhibition of both

growth factors may be critical for delaying growth of tumors in

which these factors are both overexpressed. These hypotheses

may also in part explain the lack of significant growth delay

observed following treatment of A673 tumors with rhuMAb-

VEGF. We are currently investigating these hypotheses.

In summary, results from our studies show that expression

of VEGF alone correlates with MVD, suggesting that it may be

the single most important regulator of neovascularization in

ESFT. Moreover, the significant inhibition of ESFT growth in

the s.c. mouse model following treatment with Flk-1/KDR

receptor tyrosine kinase inhibitors and anti-VEGF agents

strongly supports the further evaluation of antiangiogenic

agents for the development of new therapeutic strategies in

ESFT.

ACKNOWLEDGMENTSWe thank Genentech, Regeneron Pharmaceuticals, and SUGEN for

supplying the agents used in this study; all centers mentioned in this study

for supplying tumors and helping with data collection; Carolyn Douglas

(United Kingdom Children’s Cancer Study Group) for assistance with

data collection; the staff at the delivery ward at St. James’s University

Hospital for the umbilical cords; Paul Berry for technical assistance with

the in vitro studies of SU6668 and SU5416; Samantha Brownhill for

analysis of EWS-ETS fusion transcript status in tumors; and the staff at

Biological Resources, Clare Hall, Cancer Research UK (London) for

technical assistance.

REFERENCES

1. Delattre O, Zucman J, Melot T, et al. The Ewing family of tumours—a subgroup of small-round-cell tumors defined by specific chimerictranscripts. N Engl J Med 1994;331:294–9.

2. Nesbit ME Jr, Gehan EA, Burgert EO Jr, et al. Multimodal therapy forthe management of primary, nonmetastatic Ewing’s sarcoma of bone: along-term follow-up of the First Intergroup Study. J Clin Oncol1990;8:1664–74.

3. Cotterill SJ, Ahrens S, Paulussen M, et al. Prognostic factors inEwing’s tumor of bone: analysis of 975 patients from the EuropeanIntergroup Cooperative Ewing’s Sarcoma Study Group. J Clin Oncol2000;18:3108–14.

4. Lewis I, Burchill S, Souhami R. Ewing’s sarcoma and the Ewing familyof tumours. In: Souhami RL, Tannock I, Hohenberger P, Horiot J-C,editors. Oxford textbook of oncology. Oxford: Oxford University Press;2002. p. 2539–51.

5. Paulussen M, Ahrens S, Burdach S, et al. Primary metastatic (stage IV)Ewing tumor: survival analysis of 171 patients from the EICESS studies.European Intergroup Cooperative Ewing Sarcoma Studies. Ann Oncol1998;9:275–81.

6. Shankar AG, Pinkerton CR, Atra A, et al. Local therapy and otherfactors influencing site of relapse in patients with localised Ewing’ssarcoma. United Kingdom Children’s Cancer Study Group (UKCCSG).Eur J Cancer 1999;35:1698–704.

7. Folkman J. What is the evidence that tumors are angiogenesisdependent? J Natl Cancer Inst 1990;82:4–6.

8. Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases.Nature 2000;407:249–57.

9. Giordano FJ, Johnson RS. Angiogenesis: the role of the microenvi-ronment in flipping the switch. Curr Opin Genet Dev 2001;11:35–40.

10. Hlatky L, Hahnfeldt P, Folkman J. Clinical application ofantiangiogenic therapy: microvessel density, what it does and doesn’ttell us. J Natl Cancer Inst 2002;94:883–93.

11. Talks KL, Harris AL. Current status of antiangiogenic factors. Br JHaematol 2000;109:477–89.

12. Luttun A, Tjwa M, Moons L, et al. Revascularization of ischaemictissues by PlGF treatment, and inhibition of tumour angiogenesis,arthritis and atherosclerosis by anti-Flt-1. Nat Med 2002;8:831–40.

13. Compagni A, Wilgenbus P, Impagnatiello M-A. Fibroblast growthfactors are required for efficient tumour angiogenesis. Cancer Res2000;60:7163–9.

14. Risau W, Drexler H, Mironov V, et al. CH. Platelet-derived growthfactor is angiogenic in vivo . Growth Factors 1992;7:261–6.

15. Vermeulen PB, Gasparini G, Fox SB, et al. Second internationalconsensus on the methodology and criteria of evaluation ofangiogenesis quantification in solid human tumours. Eur J Cancer2002;38:1564–79.

16. Weidner N, Semple JP, Welch WR, Folkman J. Tumor angiogenesisand metastasis—correlation in invasive breast carcinoma. N Engl J Med1991;324:1–8.

17. Weidner N, Carroll PR, Flax J, Blumenfeld W, Folkman J. Tumorangiogenesis correlates with metastasis in invasive prostate carcinoma.Am J Pathol 1993;143:401–9.

18. Borre M, Offersen BV, Nerstrom B, Overgaard J. Microvesseldensity predicts survival in prostate cancer patients subjected to watchfulwaiting. Br J Cancer 1998;78:940–4.

19. de Jong JS, van Diest PJ, Baak JP. Hot spot microvessel density andthe mitotic activity index are strong additional prognostic indicators ininvasive breast cancer. Histopathology 2000;36:306–12.

20. Simpson A, Grimer R, Mangham C, Cullinane C, Lewis I,Burchill SA. MVD predicts disease-free and overall survival in tumoursof the Ewing’s sarcoma family (ESFT). Br J Cancer 2002;86:S95.

21. Folkman J, Hahnfeldt P, Hlatky L. Cancer: looking outside thegenome. Nat Rev Mol Cell Biol 2000;1:76–9.

22. Scappaticci FA. Mechanisms and future directions for angiogenesis-based cancer therapies. J Clin Oncol 2002;20:3906–27.

23. Boehm T, Folkman J, Browder T, O’Reilly MS. Antiangiogenictherapy of experimental cancer does not induce acquired drug resistance.Nature 1997;390:404–7.

24. Hurwitz H, Fehrenbacher L, Cartwright T, et al. Bevacizumab(a monoclonal antibody to vascular endothelial growth factor) prolongssurvival in first-line colorectal cancer (CRC): results of a phase III trial ofbevacizumab in combination with bolus IFL (irinotecan, 5-fluorouracil,leucovorin) as first-line therapy in subjects with metastatic CRC. ProcAm Soc Clin Oncol 2003;22:3646.

25. Fong TA, Shawver LK, Sun L, et al. G. SU5416 is a potent andselective inhibitor of the vascular endothelial growth factor receptor(Flk-1/KDR) that inhibits tyrosine kinase catalysis, tumor vascular-ization, and growth of multiple tumor types. Cancer Res 1999;59:99–106.

26. Laird AD, Vajkoczy P, Shawver LK, et al. SU6668 is a potentantiangiogenic and antitumor agent that induces regression of establishedtumors. Cancer Res 2000;60:4152–60.




27. Laird AD, Christensen JG, Li G, et al. SU6668 inhibits Flk-1/KDRand PDGFRh in vivo , resulting in rapid apoptosis of tumor vasculatureand tumor regression in mice. FASEB J 2002;16:681–90.

28. Kim KJ, Li B, Winer J, et al. Inhibition of vascular endothelialgrowth factor-induced angiogenesis suppresses tumour growth in vivo .Nature 1993;362:841–4.

29. Borgstrom P, Hillan KJ, Sriramarao P, Ferrara N. Completeinhibition of angiogenesis and growth of microtumors by anti-vascularendothelial growth factor neutralizing antibody: novel concepts ofangiostatic therapy from intravital videomicroscopy. Cancer Res1996;56:4032–9.

30. Holash J, Davis S, Papadopoulos N, et al. VEGF-Trap: a VEGFblocker with potent antitumor effects. Proc Natl Acad Sci U S A 2002;99:11393–8.

31. Andersson J, Abrams J, Bjork L, et al. Concomitant in vivoproduction of 19 different cytokines in human tonsils. Immunology1994;83:16–24.

32. Giatromanolaki A, Koukourakis MI, Theodossiou D, et al.Comparative evaluation of angiogenesis assessment with anti-factor-VIIIand anti-CD31 immunostaining in non-small cell lung cancer. ClinCancer Res 1997;3:2485–92.

33. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of humanendothelial cells derived from umbilical veins. Identification bymorphologic and immunologic criteria. J Clin Invest 1973;52:2745–56.

34. Rossler J, Breit S, Havers W, Schweigerer L. Vascular endothelialgrowth factor expression in human neuroblastoma: up-regulation byhypoxia. Int J Cancer 1999;81:113–7.

35. Meister B, Grunebach F, Bautz F, et al. Expression of vascularendothelial growth factor (VEGF) and its receptors in humanneuroblastoma. Eur J Cancer 1999;35:445–9.

36. Von Marschall Z, Cramer T, Hocker M, et al. De novo expressionof vascular endothelial growth factor in human pancreatic cancer:evidence for an autocrine mitogenic loop. Gastroenterology 2000;119:1358–72.

37. Maglione D, Guerriero V, Viglietto G, et al. Two alternative mRNAscoding for the angiogenic growth factor (PlGF), are transcribed from asingle gene of chromosome 14. Oncogene 1993;8:925–31.

38. Sturla L-M, Westwood G, Selby PJ, Lewis IJ, Burchill SA. Inductionof cell death by basic fibroblast growth factor in Ewing’s sarcoma.Cancer Res 2000;60:6160–70.

39. Ren G, Fuse N, Abe T, Tamai M. mRNA expression of proto-oncogenes and platelet-derived growth factor in proliferative vitreoretinaldiseases. Jpn J Ophthalmol 2000;44:308–11.

40. Kim WJ, Mohan RR, Mohan RR, Wilson SE. Effect of PDGF,IL-1a, and BMP2/4 on corneal fibroblast chemotaxis: expression of theplatelet-derived growth factor system in the cornea. Invest OphthalmolVis Sci 1999;40:1364–72.

41. Eckhart L, Ban J, Ballaun C, Weninger W, Tschachler EJ. Reversetranscription-polymerase chain reaction products of alternatively splicedmRNAs form DNA heteroduplexes and heteroduplex complexes. J BiolChem 1999;274:2613–5.

42. Lacal PM, Failla CM, Pagani E, et al. Human melanoma cells secreteand respond to placenta growth factor and vascular endothelial growthfactor. J Invest Dermatol 200;115:1000–7.

43. Masood R, Cai J, Zheng T, Smith DL, Hinton DR, Gill PS.Vascular endothelial growth factor (VEGF) is an autocrine growthfactor for VEGF receptor-positive human tumours. Blood 2001;98:1904–13.

44. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascularpermeability factor/vascular endothelial growth factor, microvascularhyperpermeability, and angiogenesis. Am J Pathol 1995;146:1029–39.

45. Brown LF, Detmar M, Claffey K, et al. Vascular permeability factor/vascular endothelial growth factor: a multifunctional angiogeniccytokine. EXS 1997;79:233–69.

46. Kim ES, Serur A, Huang J, et al. Potent VEGF blockade causesregression of coopted vessels in a model of neuroblastoma. Proc NatlAcad Sci U S A 2002;99:11399–404.

47. Zhou Z, Zhou RR, Guan H, Bucana CD, Kleinerman ES. E1A genetherapy inhibits angiogenesis in a Ewing’s sarcoma animal model. MolCancer Ther 2003;2:1313–9.

48. Relf M, LeJeune S, Scott PA, et al. Expression of the angiogenicfactors vascular endothelial cell growth factor, acidic and basicfibroblast growth factor, tumor growth factor h-1, platelet-derivedendothelial cell growth factor, placenta growth factor, and pleiotrophinin human primary breast cancer and its relation to angiogenesis.Cancer Res 1997;57:963–9.

49. Kuhnen C, Lehnhardt M, Tolnay E, Muehlberger T, Vogt PM,Muller K-M. Patterns of expression and secretion of vascular endothelialgrowth factor in malignant soft-tissue tumours. J Cancer Res Clin Oncol2000;126:219–25.

50. Holzer G, Obermair A, Koschat M, Preyer O, Kotz R, Trieb K.Concentration of vascular endothelial growth factor in the serum ofpatients with malignant bone tumour. Med Pediatr Oncol 2001;36:601–4.

51. Huber H, Eggert A, Janss AJ, et al. Angiogenic profile of childhoodprimitive neuroectodermal brain tumours/medulloblastomas. Eur JCancer 2001;37:2064–72.

52. Pavlakovic H, Von Schutz V, Rossler J, Koscielniak E, Havers W,Schweigerer L. Quantification of angiogenesis stimulators in childrenwith solid malignancies. Int J Cancer 2001;92:756–60.

53. Yudoh K, Kanamori M, Ohmori K, Yasuda T, Aoki M, Kimura T.Concentration of vascular endothelial growth factor in tumour tissueas a prognostic factor of soft tissue sarcomas. Br J Cancer 2001;84:610–5.

54. Rutkowski P, Kaminska J, Kowalska M, Ruka W, Steffen J.Cytokine and cytokine receptor serum levels in adult bone sarcomapatients: correlations with local tumor extent and prognosis. J Surg Oncol2003;84:151–9.

55. Fuchs B, Inwards CY, Janknecht R. Vascular endothelial growthfactor expression is up-regulated by EWS-ETS oncoproteins and Sp1 andmay represent an independent predictor of survival in Ewing’s sarcoma.Clin Cancer Res 2004;10:1344–53.

56. Strammiello R, Benini S, Manara MC, et al. Impact of IGF-I/IGF-IRcircuit on the angiogenetic properties of Ewing’s sarcoma cells. HormMetab Res 2003;35:675–84.

57. Soker S, Kaefer M, Johnson M, Klagsbrun M, Atala A, FreemanMR.Vascular endothelial growth factor-mediated autocrine stimulation ofprostate tumour cells coincides with progression to a malignantphenotype. Am J Pathol 2001;159:651–9.

58. Tian X, Song S, Wu J, Meng L, Dong Z, Shou C. Vascularendothelial growth factor: acting as an autocrine growth factor for humangastric adenocarcinoma cell MGC803. Biochem Biophys Res Commun2001;286:505–12.

59. Grunstein J, Masbad JJ, Hickey R, Giordano F, Johnson RS. Isoformsof vascular endothelial growth factor act in a coordinate fashion to recruitand expand tumour vasculature. Mol Cell Biol 2000;20:7282–91.

60. Park JE, Chen HH, Winer J, Houck KA, Ferrara N. Placenta growthfactor. Potentiation of vascular endothelial growth factor bioactivity,in vitro and in vivo , and high affinity binding to Flt-1 but not to Flk-1/KDR. J Biol Chem 1994;269:25646–54.

61. Adini A, Kornaga T, Firoozbakht F, Benjamin LE. Placental growthfactor is a survival factor for tumor endothelial cells and macrophages.Cancer Res 2002;62:2749–52.

62. Odorisio T, Schietroma C, Zaccaria ML, et al. Mice overexpressingplacenta growth factor exhibit increased vascularization and vesselpermeability. J Cell Sci 2002;115:2559–67.

63. Autiero M, Waltenberger J, Communi D, et al. Role of PlGF in theintra- and intermolecular cross talk between the VEGF receptors Flt1 andFlk1. Nat Med 2003;9:936–43.

64. Cao Y, Chen H, Zhou L, et al. Heterodimers of placenta growth factor/vascular endothelial growth factor. J Biol Chem 1996;271:3154–62.

65. Cao Y, Linden P, Shima D, Browne F, Folkman J. In vivo angiogenicactivity and hypoxia induction of heterodimers of placenta growth factor/vascular endothelial growth factor. J Clin Invest 1996;98:2507–11.




66. Lyden D, Hattori K, Dias S, et al. Impaired recruitment of bonemarrow-derived endothelial and hematopoietic precursor cells blockstumor angiogenesis and growth. Nat Med 2001;7:1194–201.

67. Bolontrade MF, Zhou RR, Kleinerman ES. Vasculogenesis plays arole in the growth of Ewing’s sarcoma in vivo . Clin Cancer Res2002;8:3622–7.

68. Pepper MS, Mandriota SJ. Regulation of vascular endothelial growthfactor receptor-2 (Flk-1) expression in vascular endothelial cells. ExpCell Res 1998;241:414–25.

69. Seghezzi G, Patel S, Ren CJ, et al. Fibroblast growth factor-2(FGF-2) induces vascular endothelial growth factor (VEGF) expressionin the endothelial cells of forming capillaries: an autocrine mechanismcontributing to angiogenesis. J Cell Biol 1998;141:1659–73.

70. Guo P, Hu B, Gu W, et al. Platelet-derived growth factor-B enhancesglioma angiogenesis by stimulating vascular endothelial growth factorexpression in tumor endothelia and by promoting pericyte recruitment.Am J Pathol 2003;162:1083–93.

71. Benjamin LE, Hemo I, Keshet E. A plasticity window for bloodvessel remodelling is defined by pericyte coverage of the preformedendothelial network and is regulated by PDGF-B and VEGF.Development 1998;125:1591–8.

72. Nomura M, Yamagishi S, Harada S, et al. Possible participation ofautocrine and paracrine vascular endothelial growth factors in hypoxia-induced proliferation of endothelial cells and pericytes. J Biol Chem1995;270:28316–24.

73. Fukumura D, Xavier R, Sugiura T, et al. Tumor induction of VEGFpromoter activity in stromal cells. Cell 1998;94:715–25.

74. Fox WD, Higgins B, Maiese KM, et al. Antibody to vascularendothelial growth factor slows growth of an androgen-independentxenograft model of prostate cancer. Clin Cancer Res 2002;8:3226–31.

75. Huang J, Frischer JS, Serur A, et al. Regression of establishedtumors and metastases by potent vascular endothelial growth factorblockade. Proc Natl Acad Sci U S A 2003;100:7785–90.

76. Marx GM, Steer CB, Harper P, Pavlakis N, Rixe O, KhayatD. Unexpected serious toxicity with chemotherapy and antiangio-genic combinations: time to take stock! J Clin Oncol 2002;20:1446–8.

77. Gerber HP, Kowalski J, Sherman D, Eberhard DA, Ferrara N.Complete inhibition of rhabdomyosarcoma xenograft growth andneovascularization requires blockade of both tumor and host vascularendothelial growth factor. Cancer Res 2000;60:6253–8.




2005;11:2364-2378. Clin Cancer Res Surita Dalal, Andrea M. Berry, Catherine J. Cullinane, et al. for Tumors of the Ewing's Sarcoma FamilyVascular Endothelial Growth Factor: A Therapeutic Target

Updated version

http://clincancerres.aacrjournals.org/content/11/6/2364

Access the most recent version of this article at:

Cited articles

http://clincancerres.aacrjournals.org/content/11/6/2364.full#ref-list-1

This article cites 71 articles, 30 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/11/6/2364.full#related-urls

This article has been cited by 8 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/11/6/2364To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/content/11/6/2364.full#ref-list-1

http://clincancerres.aacrjournals.org/content/11/6/2364.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Vascular Endothelial Growth Factor: A Therapeutic …Vascular Endothelial Growth Factor: A...

Documents

Transcript of Vascular Endothelial Growth Factor: A Therapeutic …Vascular Endothelial Growth Factor: A...