Utilising NSC sequencing services

Gregor Gilfillan

Many choices: we will help but the more you know the

better

Price?

Paired end?

Read length?

How much sequence do I need?

Indexing / barcoding?

How many reads will I get?

How much DNA do you need?

When will I get my data?

How do I analyze my data?

NGS workflow

Sample prep Sequencing Data analysis

Application specific Technology specific

Technology specific

Application specific

Experiment specific

Technology specific

Topics

1. Technology & services available 2. Making a submission 3. Submission forms & guidelines 4. Sample library preparation 5. QC 6. Sequencing 7. Data analysis 8. Data delivery 9. Prices

1. Services available

System Read length # reads / run Gb / run Roche 454 GS FLX+ / GS FLX Ti

400-1000 bp 1.2 million 0.7

Illumina HiSeq 2000

100 bp 2 billion 600

Pacific Biosciences RS

1000 bp 25 thousand 0.075

Illumina MiSeq

150 bp 7 million 1

Ion Torrent PGM

200 bp 5 million 1

*

*

*

* Available in Q1 2012

First Contact: www.sequencing.uio.no

2. Making a submission

Project request form / email / telephone

Send samples & submission form

Send samples & submission form QC, Sample prep

QC

Sequencing

Primary analysis: base calling, sequencing QC Optional secondary analysis: genomic alignment

Data delivery

We perform sample prep (Illumina: currently

<20 samples) You perform sample prep (alone or on visit to NSC)

Sample prep

Bioanalyzer: adapter dimers? Qubit: DNA conc. qPCR: Library performance

3. Project request & submission forms

Project request & submission forms

Project request & submission forms

Project request & submission forms

4. Sample library prep: basic principle

Your DNA / RNA

Modification: mRNA enrichment cDNA production Blunting, adenylation, Ligation Amplification

Technology-specific adapters

Sequencing

Surface binding priming

Sample prep: library types

Single read

Paired end (200-500 bp inserts)

Mate Pair = (“paired end “ in 454 terminology) (2-5 kb inserts, 3-20 kb inserts for 454)

A B A B

A B A B

Sample indexing (a.k.a. multiplexing, barcoding)

6-8 bp nucleotide tag allowing sample indentification

Currently offered:

Technology Library Type Number Indexes Illumina DNA / RNA 12 (24 if > 48 samples) Illumina miRNA 48 454 Amplicon 150 454 DNA/RNA 12

Sample prep protocols – currently 9 varieties:

APPLICATION SAMPLE PREP

DNA Sequencing De novo shotgun genome sequencing gDNA / gDNA Mate-pair Exome capture / custom array resequencing exome capture RAD-tag sequencing custom Metagenomics gDNA / cDNA Amplicon, BAC, forsmid etc. sequencing amplicons Ancient DNA gDNA

Transcriptome Whole transcriptome sequencing mRNA Digital gene expression / tag counting mRNA miRNAs miRNA

Epigenetics Bisulphate sequencing BS DNA Cromatin Immunoprecipitation (ChIP-seq) ChIP MNase nucleosome positioning gDNA DnaseI HS / FAIRE analysis gDNA

3rd party / custom sample prep:

We support and prep: - All Illumina & 454 sample preps - Epicentre Scriptminer miRNA - Nimblegen / Agilent exome capture

We will attempt to sequence all requests, but you must do sample prep / we may consider collaborative projects:

e.g. -RAD-tag sequencing -Custom capture arrays / HALOplex / Raindance -strand-specific mRNA-seq -mRNA amplification -alternative indexing for greater sample numbers

1. Agilent Bioanalyzer: adapter dimers (Amplicon sequencing)

2. Invitrogen Qubit (all samples)

454

X

5. Sample prep QC:

Illumina

1. Agilent Bioanalyzer: adapter dimers

2. Invitrogen Qubit: DNA conc. (Any fluorescence method acceptable – e.g picogreen)

3. qPCR: Library performance (NSC only)

√ X

6. Sequencing: Illumina HiSeq 2000

Read Length Run time 50 bp 3 days 2 x 100 bp (paired end) 9-11 days

50 bp paired end & 100 bp single read are in theory possible, but due to low demand are not offered as standard. Can be run IF user(s) supply sufficient samples to run a full flow cell.

Illumina: 1 flow cell = 8 lanes

Sequencing: 454

Read Length Run time 400-500 bp 10 h (+ 7 h post run analysis) 750-1000 bp 24 h (+ 20 h post run analysis)

1 picotiter plate = 1, ½, ¼, 1/8 and 1/16 possible

IMPORTANT: NSC does not offer sequencing on 1/16 plate

Post run •  signal processing •  ‘base calling’ including quality filtering

7. Data analysis

@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTA + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CC

1. Technology specific

Sequence & Quality scores Image files

Image analysis, base calling, Demultiplexing & QC

2. Application specific

e.g. -Alignment to reference genome -De novo assembly -Tag counting -Peak calling

3. Experiment specific

e.g. -binding site definition -differential expression -gene association

Time Required

Min. 1 week

Another week

Sky’s the limit

Provided as service Possible as collaboration

8. Data delivery

Data formats: will bepresented by Timothy Hughes

Data Delivery (6-12 weeks after submission): •  Hard drive (available for purchase from us)* •  DVD / memo stick* •  Norstore / Titan •  FTP

*For sensitive human samples, these are the only currently accepted formats

9. NSC prices

•  no fixed price list (dependent on USD & EUR exchange rates for reagent purchase). You will be billed at rate applied when reagents purchased for your project.

•  You pay cost price +20% to cover service contracts & reagent wasteage (e.g. kit for 48 samples, only 40 used prior to expiry).

•  funded core service – no labour costs

NSC prices: examples

HiSeq 2000 HiSeq 2000 HiSeq 2000 1 x gDNA 48 x miRNA, indexed 3 x ChIPseq, indexed 1 Lane 1 lane 1 lane 100 bp PE 50 bp SR 50 bp SR 14,000 NOK 94,500 NOK 9,500 NOK

(~2000 NOK / sample)

454 GS-FLX+ 5 Mb bacterial genome (1/4 plate, 850 bp reads) Shotgun library: 23,000 NOK 8 kb PE library: 27,000 NOK Combined: 31,000 NOK

454 GS-FLX Ti Sequencing of an amplicon sample 1/1 plate: 85,000 NOK ½ plate: 45,000 NOK ¼ plate: 25,000 NOK 1/8 plate: 13,000 NOK

Contacting us:

www. sequencing.uio.no

post@sequencing.uio.no

Contacting us: