Utilising NSC sequencing services€¦ · Utilising NSC sequencing services Gregor Gilfillan . Many...
Transcript of Utilising NSC sequencing services€¦ · Utilising NSC sequencing services Gregor Gilfillan . Many...
Many choices: we will help but the more you know the
better
Price?
Paired end?
Read length?
How much sequence do I need?
Indexing / barcoding?
How many reads will I get?
How much DNA do you need?
When will I get my data?
How do I analyze my data?
NGS workflow
Sample prep Sequencing Data analysis
Application specific Technology specific
Technology specific
Application specific
Experiment specific
Technology specific
Topics
1. Technology & services available 2. Making a submission 3. Submission forms & guidelines 4. Sample library preparation 5. QC 6. Sequencing 7. Data analysis 8. Data delivery 9. Prices
1. Services available
System Read length # reads / run Gb / run Roche 454 GS FLX+ / GS FLX Ti
400-1000 bp 1.2 million 0.7
Illumina HiSeq 2000
100 bp 2 billion 600
Pacific Biosciences RS
1000 bp 25 thousand 0.075
Illumina MiSeq
150 bp 7 million 1
Ion Torrent PGM
200 bp 5 million 1
*
*
*
* Available in Q1 2012
2. Making a submission
Project request form / email / telephone
Send samples & submission form
Send samples & submission form QC, Sample prep
QC
Sequencing
Primary analysis: base calling, sequencing QC Optional secondary analysis: genomic alignment
Data delivery
We perform sample prep (Illumina: currently
<20 samples) You perform sample prep (alone or on visit to NSC)
Sample prep
Bioanalyzer: adapter dimers? Qubit: DNA conc. qPCR: Library performance
4. Sample library prep: basic principle
Your DNA / RNA
Modification: mRNA enrichment cDNA production Blunting, adenylation, Ligation Amplification
Technology-specific adapters
Sequencing
Surface binding priming
Sample prep: library types
Single read
Paired end (200-500 bp inserts)
Mate Pair = (“paired end “ in 454 terminology) (2-5 kb inserts, 3-20 kb inserts for 454)
A B A B
A B A B
Sample indexing (a.k.a. multiplexing, barcoding)
6-8 bp nucleotide tag allowing sample indentification
Currently offered:
Technology Library Type Number Indexes Illumina DNA / RNA 12 (24 if > 48 samples) Illumina miRNA 48 454 Amplicon 150 454 DNA/RNA 12
Sample prep protocols – currently 9 varieties:
APPLICATION SAMPLE PREP
DNA Sequencing De novo shotgun genome sequencing gDNA / gDNA Mate-pair Exome capture / custom array resequencing exome capture RAD-tag sequencing custom Metagenomics gDNA / cDNA Amplicon, BAC, forsmid etc. sequencing amplicons Ancient DNA gDNA
Transcriptome Whole transcriptome sequencing mRNA Digital gene expression / tag counting mRNA miRNAs miRNA
Epigenetics Bisulphate sequencing BS DNA Cromatin Immunoprecipitation (ChIP-seq) ChIP MNase nucleosome positioning gDNA DnaseI HS / FAIRE analysis gDNA
3rd party / custom sample prep:
We support and prep: - All Illumina & 454 sample preps - Epicentre Scriptminer miRNA - Nimblegen / Agilent exome capture
We will attempt to sequence all requests, but you must do sample prep / we may consider collaborative projects:
e.g. -RAD-tag sequencing -Custom capture arrays / HALOplex / Raindance -strand-specific mRNA-seq -mRNA amplification -alternative indexing for greater sample numbers
1. Agilent Bioanalyzer: adapter dimers (Amplicon sequencing)
2. Invitrogen Qubit (all samples)
454
X
5. Sample prep QC:
Illumina
1. Agilent Bioanalyzer: adapter dimers
2. Invitrogen Qubit: DNA conc. (Any fluorescence method acceptable – e.g picogreen)
3. qPCR: Library performance (NSC only)
√ X
6. Sequencing: Illumina HiSeq 2000
Read Length Run time 50 bp 3 days 2 x 100 bp (paired end) 9-11 days
50 bp paired end & 100 bp single read are in theory possible, but due to low demand are not offered as standard. Can be run IF user(s) supply sufficient samples to run a full flow cell.
Illumina: 1 flow cell = 8 lanes
Sequencing: 454
Read Length Run time 400-500 bp 10 h (+ 7 h post run analysis) 750-1000 bp 24 h (+ 20 h post run analysis)
1 picotiter plate = 1, ½, ¼, 1/8 and 1/16 possible
IMPORTANT: NSC does not offer sequencing on 1/16 plate
Post run • signal processing • ‘base calling’ including quality filtering
7. Data analysis
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTA + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CC
1. Technology specific
Sequence & Quality scores Image files
Image analysis, base calling, Demultiplexing & QC
2. Application specific
e.g. -Alignment to reference genome -De novo assembly -Tag counting -Peak calling
3. Experiment specific
e.g. -binding site definition -differential expression -gene association
Time Required
Min. 1 week
Another week
Sky’s the limit
Provided as service Possible as collaboration
8. Data delivery
Data formats: will bepresented by Timothy Hughes
Data Delivery (6-12 weeks after submission): • Hard drive (available for purchase from us)* • DVD / memo stick* • Norstore / Titan • FTP
*For sensitive human samples, these are the only currently accepted formats
9. NSC prices
• no fixed price list (dependent on USD & EUR exchange rates for reagent purchase). You will be billed at rate applied when reagents purchased for your project.
• You pay cost price +20% to cover service contracts & reagent wasteage (e.g. kit for 48 samples, only 40 used prior to expiry).
• funded core service – no labour costs
NSC prices: examples
HiSeq 2000 HiSeq 2000 HiSeq 2000 1 x gDNA 48 x miRNA, indexed 3 x ChIPseq, indexed 1 Lane 1 lane 1 lane 100 bp PE 50 bp SR 50 bp SR 14,000 NOK 94,500 NOK 9,500 NOK
(~2000 NOK / sample)
454 GS-FLX+ 5 Mb bacterial genome (1/4 plate, 850 bp reads) Shotgun library: 23,000 NOK 8 kb PE library: 27,000 NOK Combined: 31,000 NOK
454 GS-FLX Ti Sequencing of an amplicon sample 1/1 plate: 85,000 NOK ½ plate: 45,000 NOK ¼ plate: 25,000 NOK 1/8 plate: 13,000 NOK