Using genome sequence data to predict resource competition within the zebrafish gut microbiota...
-
Upload
nickolas-holland -
Category
Documents
-
view
216 -
download
0
Transcript of Using genome sequence data to predict resource competition within the zebrafish gut microbiota...
![Page 1: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/1.jpg)
FROM GENOMES TO RESOURCE
COMPETITORSUsing genome sequence data to predict
resource competition within the zebrafish gut microbiota
Alexandra Weston, University of OregonMentor: Zac StephensKaren Guillemin, PI
![Page 2: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/2.jpg)
You are not just a bunch of Human Cells!
EcosystemMicrobiota
Gut Microbiota: disease states
altered gut microbiota
composition
Micah Lidberg
![Page 3: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/3.jpg)
Gut Community Assembly Intestines sterile
before birth What factors affect
community assembly? Microbial traits
○ Motility○ Adhesion
Host interactions○ Host immune response
Microbial Competition○ Locale in gut○ Resources
Micah Lidberg
![Page 4: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/4.jpg)
My Question
Can we use genome data to predict microbial competition within the gut?Resource Competition
My specific hypothesis blah blah blah
![Page 5: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/5.jpg)
My strategy for testin gthe hypothesis Gather predictions from models of other
fiolks Create in vivo conditions to compare in
silico anaylisis with in vivo measurrents Ask whether in silico reflect in vivo If yes .. If no …
![Page 6: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/6.jpg)
in silico Predictions
enzyme reactants products
Metabolic Model
Sequenced Genome
CTTCCTTTATGGTGAACTTTATCGTGGACGATCTTGAGCAAGCCCTACTTCAAGTCACGCAGGGTGGC
![Page 7: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/7.jpg)
in silico Predictions
Seed Set
thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose
non-seedseed
![Page 8: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/8.jpg)
thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose
Imidazole acetaldehydeGlucoseSulfuric acidL-ValineL-myo-Inositol 1-phosphateN-5-phosphoribosyl-anthranilateAmmoniumButyryl-CoA
in silico Predictions
Program compares seed sets of two microbes
thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose
Imidazole acetaldehydeGlucoseSulfuric acidL-ValineL-myo-Inositol 1-phosphateN-5-phosphoribosyl-anthranilateAmmoniumButyryl-CoA
Seed Overlap:Number of
compounds that exist in both seed sets
PredictionHigh seed
overlapMore
competition
![Page 9: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/9.jpg)
The Zebrafish as a Model Organism
In Vivo Testing
• Guillemin lab: collection of commensal zebrafish gut microbes
• 66 strains• 21 genomes
• germ-free zebrafish
![Page 10: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/10.jpg)
Experiment overview
In Vivo Testing
Dissect guts and plate out to determine the colonization by each strain
Germ-free
![Page 11: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/11.jpg)
Bacterial strains
Microbacterium, ZOR0019
Kocuria, ZOR0020
Ensifer, ZNC0028
Bosea, ZNC0032
Bosea, ZNC0037
Chitinibacter, ZOR0017
Variovorax, ZNC0006
Delftia, ZNC0008
Exiquobacterium, ZWU0009
Carnobacterium, ZWU0011
Aeromonas, ZOR0001
Aeromonas, ZOR0002
Pseudomonas, ZWU0006
Vibrio, ZWU0020
Shewanella, ZOR0012
Acinetobacter, ZOR0008
Plesiomonas, ZOR0011
Enterobacter/Lecleria, ZOR0014
Comamonas, ZNC0007
Choosing Competitions
Seed Set Analysis
Monoassociations
19 Strains
11 Strains
Competitions (Seed overlap)
12 X 1912 X 812 X WU6
12 X11 12 X 14 14 X 19 12 X WU20 12 X 1 12 X 2
135-184 185-230 230-278
11 X 2 14 X 8 14 X 1 14 X 2 1 X 2 WU20 X1
![Page 12: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/12.jpg)
Expected Outcomes Analysis: Competitive Index (CI)
9/1 = 9(competition)
5/5 = 1(no competition)
High Competitive Exclusion
Low Competitive Exclusion
![Page 13: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/13.jpg)
Competitive Index per Competition
Results
135-184 185-230 230-278
![Page 14: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/14.jpg)
Two Models of Competitive Exclusion
Highly stereotyped
Highly Variable
Analysis: Competitive Index (CI)
CI =(9/1)=9
CI= (1/9) = 0.11
Analysis: Power CI
|log(CI)|
Allows us to normalize the two different scenarios
Power CI=|log(9/1)| =
0.95
Power CI= |log(1/9)| =
0.95
Normalize to monoassociation ability
ms1= mean CFU/gut in mono-colonization for strain 1
ms2= mean CFU/gut in mono-colonization for strain 1
![Page 15: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/15.jpg)
Power Competitive Index vs. Seed Overlap
Results
![Page 16: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/16.jpg)
Conclusion
Is this a good method for predicting in vivo competition?A great deal of fish-to-fish variationNot the best r2
It’s a start, but it doesn’t tell the whole story of community assembly.
![Page 17: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/17.jpg)
Future Directions
Another possibility: bacteria inhabit discrete locales with different environments
![Page 18: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/18.jpg)
Acknowledgements Guillemin Lab
Karen Guillemin Zac Stephens Jennifer Hampton Annah Rolig Chris Wreden Erika Mittge Rose Sockol
Bohannan Lab Adam Burns Robert Steury
Elhanan Borenstein (UW)
SPUR Peter O’Day
Funding NICHD R25 Summer
Research Program (NIH-1R25HD070817)
Karen’s NIH grant
![Page 19: Using genome sequence data to predict resource competition within the zebrafish gut microbiota Alexandra Weston, University of Oregon Mentor: Zac Stephens.](https://reader030.fdocuments.net/reader030/viewer/2022032804/56649e565503460f94b4d989/html5/thumbnails/19.jpg)
Questions?