Bio-Computational Study of a Prostate Cancer Cell Line Using

Morphometric Analysis of the Nucleus and Nucleolus

The morphology of nuclear and cellular structures reflects tissue phenotype during normal development and in the disease states. The present gold standard of diagnosis of prostate cancer is characterization of 4um tissue biopsy sections using the

standard staining techniques for prostate clinical histology and pathology, hematoxylin/eosin and Feulgen. The purpose of this experiment is to use nuclear and nuceloli area, volume, and position information to provide insight on how the morphology

of nuclear and cellular structures reflect the cellular phenotypes of a prostate cancer cell line, PC3, when in the epithelial (EPI) and induced epithelial-to-mesenchymal (EMT) states. This may further assist in the early detection and differential

diagnosis of prostate cancer, especially in the early metastic phase. We will explore the extension of research on semi- automated machine classification of prostate cancer states. This will include 3 dimensional morphometric characteristics of whole

nuclei, nucleoli position information as well as nuclei/nuceloli relationships via simple fluorescent stains for DNA, RNA and nuclear envelope antibody staining. The images collected from these stains are then converted and analyzed by software

programs including Farsight, custom ImageJ plugins and the Statistics Online Computational Resource (SOCR). This analysis will lead to algorithms for the morphometric analysis of the collected imagery. 3D confocal microscopy will be compared

to standard fluorescent wide-field microscopy using segmentation and image analysis of characteristics such as size, number of nucleoli and distance to the perimeter of the nuclear envelope. Currently, imagery and statistics for 3D nuclear volume,

curvature, and fractal dimension have been collected for matched EPI and EMT cell cultures, with additional data on nucleoli expected. Preliminary analysis has shown differences between the two conditions, and more data will be collected to discern

the additional morphometric characteristics of the nuclei and nucleoli to increase the statistical power of the patterns shown to date.

Abstract

Brian Athey, Ivo Dinov, Ken Pienta, Walter Meixner, Alex Ade, Alex Kalinin, Ari Allyn-Feuer, Gordon Fon,

and John Mathew

Department of Computational Medicine and Bioinformatics, University of Michigan Medical School

Objectives

Conclusions So Far

Results in Progress

Methods

The next major goal in the experiment will be to develop

fluorescent probes to correlate gene expression levels and gene

locations in nuclear heterochromatin or euchromatin

compartments to further characterize expression differences

between the two cell lines.

Example of FISH Probe Design

Section of Intron 4 (Provided by Galaxy and UCSC Genome

Browser)

Probes by Bio-Search Technologies Stellaris:

actaattgttggtgctatctag

tttgaccaggctatttaaactt

gagtgtcagcatgttaaacatt

gctcactgcagccttgaactcctagactcaagccatcttcccacccagtagggctacggatgtacactaccatgc

ccagctgatttttttttaatttttgttttaattttttgtagagacaaaggggtcttgctatgttcccaggctggtgtctaac

tcctggccttaagtgatcctcccaacgtggcctcccaaagtgctggtattacaggtgtgagccactgcaactgac

ctatgtggttcttttgataggagagactaattgttggtgctatctagcacacactgtgtgtagacatcttgttaaat

agaaaatagatttatgggtatgactatgaagagtctaattccccaaaccacacacacaactctatctacgtttgac

caggctatttaaacttaactgcagagtgtcagcatgttaaacattgatttacataaaatgatagctgcccacttt

cttgtaaatgttataaaaactgtagagattaactaaaaaatgcacacagaagtttgctttcagttccacaagggtag

tttatttttgttataaaaacagtattccccactttcttagataccagatctctgcccagattttacccagtttcatcttgct

gctctctaatctcctatgtatgtaatatactttgaccatttaaatatgtattaagaca

Long Term GoalIntroduction

The objective of this experiment is to show that the

morphology of nuclear and cellular structures can be used to

make predictions of the type of prostate cancer, specifically

the differences in Epthelial PC3 cells and PC3 having

undergone the epithelial-to-mesenchymal transition. This

will expand on the work already done (1) but will consist of

using 3D imagery which may provide better results. The

hypothesis for this experiment is that there would be a

difference in morphology of the nucleus and nucleolus.

These differences could be used as another bio-marker in

combination with the Gleason scoring system, the present

standard diagnostic test in prostate biopsies.

• Use of simple fluorescent stains for DNA, RNA, and

Nuclear envelope antibody staining

• Analyzing of acquired images using Farsight, custom,

ImageJ plugins and the Statistics Online

Computational Resource (SOCR)

• Use of segmentation and image analysis of nuclear

characteristics to compare 3D confocal and two-

photon microscopy to standard fluorescent wide-field

microscopy.

From left to right: DAPI prolong Gold, Anti-

Fibrillarin, Ethidium Bromide

From left to right: DAPI, Nuclear Mask from

DAPI Channel, Image J Plugin to segment

connected and isolated nuclear masks

Results from plugin Segmentation

DAPI and FibrillarinNUP-98 and Fibrillarin

PC3 EMT from bottom left to top right:

Ethidium, DAPI, Fibrillarin

PC3 EMI from bottom left to top right: Ethidium,

DAPI, Fibrillarin

In the early 1970’s Dr. Donald F. Gleason and his lab used

stained sections of carcinoma cells to create a histologic

pattern arrangement of these cells, this became the basis of

the Gleason grading system. The score from the Gleason

gradient can give information on the tumor size and its

pathologic stage. This can be used to help to make a

prediction tumor aggressiveness and assist in prognosis

and treatment options.of the pathological stage. The search

for additional biomarkers to detect earlier changes in

tissue, and particularly early cellular changes, has

continued. One avenue which has shown promise has been

detecting morphometric changes in nuclear structure from

the Epi to EMT state of PC3 cells using 2-dimesional

microscopy (1). The morphometric measurements from

these images could be used to provide information to

doctors about the possibility of future metastatic disease.

(1) Verdone, J. E., Parsana, P., Veltri, R. W. and Pienta, K. J. (2015), “Epithelial–

mesenchymal transition in prostate cancer is associated with quantifiable changes in

nuclear structure.” Prostate, 75: 218–224. doi: 10.1002/pros.22908

Humphrey, Peter A. “Gleason Grading and prognostic factors in carcinoma of the

prostate.” Modern Pathology 17 (2004): 292-306. Web. 17 April 2015.

References

Currently the analysis of the PC3 Epi vs. MSC

nuclear/nucleolus images are not yet completed.

The initial results support the hypothesis: that

there is a statistical difference in the nucleolus

and nucleus.