University of Groningen

Synthetic biology tools for metabolic engineering of the filamentous fungus PenicilliumchrysogenumPolli, Fabiola

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Polli, F. (2017). Synthetic biology tools for metabolic engineering of the filamentous fungus Penicilliumchrysogenum. University of Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 02-05-2022

The research described in this thesis was carried out in the Department of Molecular Microbiology of the Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, The  Netherlands. It was financially supported by the biobased ecologically balanced sustainable industrial chemistry (BE-BASIC) and DSM Sinochem Pharmaceuticals Netherlands B.V. (The Netherlands).

Cover design, layout and printing: Lovebird design. www.lovebird-design.com

ISBN (print): 978-90-367-9934-8ISBN (digital): 978-90-367-9934-8

Copyright © 2017 by F. Polli. All rights reserved. No parts of this book may be reproduced or transmitted in any form or by any means without prior permission of the author.

Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum

PhD thesis

to obtain the degree of PhD at theUniversity of Groningenon the authority of the

Rector Magnificus Prof. E. Sterkenand in accordance with

the decision by the College of Deans.

This thesis will be defended in public on

Friday 23 June 2017 at 09.00 hours

by

Fabiola Polliborn on 24 April 1986

in Frascati, Italy

SupervisorsProf. dr. A.J.M. Driessen Prof. dr. R.A.L. Bovenberg

Assessment Committee Prof. dr. L. Dijkhuizen Prof. dr. D.B. Janssen Prof. dr. A.F.J. Ram

To my parents...

... Ai miei geniitori per essere stati presenti in ogni momento e per aver sempre sostenuto ogni mia scelta...

Grazie!

TABLE OF CONTENTS

Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum 9

Towards a secondary metabolite deficient strain of Penicillium chrysogenum 33

New promoters for strain engineering of Penicillium chrysogenum 55

Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 79

Summary and concluding remarks 99Samenvatting 107

111Acknowledgments 115List of publications 117References 119

CHAPTER 1

CHAPTER 2

CHAPTER 3

CHAPTER 4

CHAPTER 5

Appendix

SYNTHETIC BIOLOGY TOOLS FOR METABOLIC ENGINEERING OF THE FILAMENTOUS FUNGUS PENICILLIUM CHRYSOGENUM

Fabiola Polli

11

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Introduction

ABSTRACT

Since the application of penicillin and other antibiotics, bacterial resis-tance to antibiotics developed hand in hand with their use in combating infectious disease. Therefore, there is an urgent need for novel mole-cules with unique structures to combat resistance towards existing antibiotics and that target new essential biological functions for antimi-crobial therapies. With the recent developments towards an advanced synthetic biology toolbox for filamentous fungi, novel strategies can be applied for the discovery, production and modification of natural prod-ucts into effective antibiotics.

INTRODUCTION

The discovery of penicillin by Alexander Fleming in 1928 generated a first understanding of the wide spread nature of the production of antibiotics and other bioactive compounds by filamentous fungi and encouraged research in this direction. While initial research was focused on natural product discovery and classical strain improvement (CSI), later on, it also became possible using recombinant DNA (rDNA) techniques to express heterologous genes in filamentous fungi for the production of semisyn-thetic antibiotics, such as cephalosporins 1.

One of the most important cell factories in antibiotics production is the filamentous fungus Penicillium chrysogenum. The initial isolate fungus P. notatum, did not produce enough of the antibiotic for mass produc-tion, and this initially slowed down the introduction of penicillins as anti- infectives. Therefore, classical strain improvement (CSI) through radiation and chemical mutation followed by selection, has led to strains that pro-duced increased levels of β-lactams allowing the commercial application of this class of compounds and the exploitation of this fermentative process at industrial scale 2. The CSI resulted in many genomic alterations, such as: amplification of the penicillin biosynthetic gene cluster 3, increased amino acid metabolism 4, proliferation of microbodies that harbor the key enzymes involved in β-lactam synthesis 5, overexpression of various transporters and morphological changes that contribute to the efficiency of large scale fermentation 6. Interestingly, the CSI also resulted in the re-pression and inactivation of other secondary metabolites gene clusters 7, likely to divert nitrogen and carbon sources towards the increased pro-duction of the non-ribosomal peptide precursor of β-lactams, as well as to reduce pigment formation interfering in penicillin product recovery and purification. Recently, Penicillium species have been described that secrete a variety of secondary metabolites 8; 9, but most have not been fully char-acterized or explored for possible pharmaceutical applications 10; 11; 12; 13; 14; 15.

Additionally, a potentially interesting feature of the CSI improved P. chrysogenum strains is that they provide a great platform for the fermentative production of semi synthetic antibiotics, as exemplified by a metabolic engineering project on fermentative production of adi-poyl-cephalosporins 16; 17. This was realized by the introduction of a novel, heterologous enzyme, adipoyl-7-aminodeacetoxy-cephalosporanic acid synthase and the feed of adipate as (β-lactam) side chain precursor, al-lowing the rapid development of a new generation of production strains of adipoyl-cephalosporins 18; 19; 20.

12

1

13Filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Filamentous fungi

© 2002 Nature Publishing Group686 | SEPTEMBER 2002 | VOLUME 3 www.nature.com/reviews/genetics

R E V I EW S

etate, for example, can no longer use acetate — thenatural substrate for acetyl CoA synthetase — as thesole carbon source. Mutants that have regainedenzyme function can then be selected by their abilityto grow on acetate.

fluoroacetate resistance selects for mutants that lackacetyl CoA synthetase activity15,16. The value of thesesystems is that they allow two-way selection for loss-and regain-of-function mutations in the same gene.Mutants that are selected for resistance to fluoroac-

Box 1 | Life cycle of Aspergillus nidulans

The fungal mycelium ofA. nidulans is a web ofbranched filaments(hyphae) of connectedcompartments or cells,which each contain severalnuclei (see centre figure).This mycelium, orhomokaryon, whichdevelops from a singlehaploid spore,differentiates manyidentical asexual sporesknown as conidia orconidiospores (see theasexual cycle in the figure).A. nidulans is homothallic,which means that it is self-fertile, but crosses can beinitiated by hyphal fusionsbetween homokaryonswith genetically differentnuclei (shown by white anddark green nuclei). Theresulting heterokaryons arenot stable, but can beforced to maintain abalanced ratio of thecomponent nuclei byincluding complementingauxotrophic mutations inthe parental nuclei andforcing growth without thecorrespondingsupplements.

A. nidulans can alsoreproduce sexually (see thefigure). In the fruitingbody, which produces thesexual spores, a pair ofnuclei that is destined formeiosis divides insynchrony to form a massof cells known as theascogenous hypha. Thesehyphae are highlybranched and each tip cell becomes an ascus (a specialized cell) in which the two haploid nuclei fuse. The diploid nucleus undergoes meiosis followed by apost-meiotic mitosis, which results in the formation of eight haploid ascospores. The fruiting body, called the cleistothecium, can hold tens of thousandsof ascospores, which are released into the environment when the cleistothecium bursts open.

In addition to an asexual cycle and sexual cycle, a parasexual cycle offers the genetic benefits of meiosis achieved through a mitotic route93. Theparasexual cycle is initiated when haploid nuclei fuse in the vegetative cells of a heterokaryon and continue to divide mitotically. Crossing over mightoccur between homologues and random chromosome loss restores the haploid chromosome number, which is eight in the case of A. nidulans. Theseevents can be used to map gene orders and assign new genes to the eight linkage groups. Many closely related fungi of economic or medical importance,such as A. niger, A. fumigatus, Fusarium oxysporum and Penicillium chrysogenum, have no sexual cycle but are exploited experimentally or geneticallyusing technologies developed for A. nidulans94.

Unstablebut can bemaintained Diploid homokaryon

Heterokaryon

Haploidhomokaryon

Fusion

+ +

Conidiospore

Meiosis

Cleistothecium

Ascus

Ascospore

Ascogenoushypha

Ascospore

Sexual cycle

Asexual cycle

Parasexual cycle

Mitoticnucleardivision

Haploidization

Figure 1. Filamentous fungi A. nidulans life cycle.

In the asexual cycle (orange arrows), from a veg-

etative mycelium (hypha), a spore called conidio-

phore (haploid nuclei) is released. In presence of

favourable conditions the spores germinates and

new mycelium called homokaryon is formed. In

the sexual cycle (pink arrows), in a ascogenous

hypha, sexual spores (haploid nuclei) fuse to-

gether. After meiosis and post-meiotic mitosis

haploid ascospores, eight in the case of A. nidu-

lans, are formed and released from a structure

called cleistothecium. Haploid nuclei carrying

different genetics nuclei (black and white nuclei)

can fuse together and an unstable heterokaryon

is formed. By induction of special conditions in

the parental nuclei, a balanced ratio of nuclei is

ensured and the heterokaryon is maintained. If

like genetics nuclei are combined a parasexual cy-

cle (green arrows) occur. The diploid homokaryon

continue the cycle by mitosis followed by meiosis

and the resulting haploid homokaryon can con-

tinue to develop in the sexual and asexual cycle.

Figure from 26 with permission.

One drawback of the use of P. chrysogenum is the poorly developed genetic toolbox. In recent years, major advancements have been made to increase the efficiency of transformation and gene deletion, as well as of the use of plasmids to express heterologous genes. In this thesis, we will focus on the discovery of novel fungal compounds by deletion of two highly expressed groups of genes involved in secondary metabolites pro-duction and on the application of different synthetic biology techniques currently available for genetic engineering of filamentous ascomycetes, and in particular P. chrysogenum. We will also discuss how these tech-niques can be applied to further develop these organisms as cell factories for secondary metabolite production.

1. FILAMENTOUS FUNGI

Filamentous fungi are eukaryotic organisms and in the taxonomic group of Ascomycota, there is the extensive and important genera that includes Aspergillus, Penicillium, Fusarium, and Claviceps species 21. They can be found in soil, air, fruits and even in extreme environments such as the Antarctic ice core 22; 23. Recently, new Penicillium species were found in marine environments, living in symbiosis with algae Laurencia and with sponges Ircinia fasciculata and Chondrosia reniformis 24; 25.

Filamentous Ascomycota are characterized by vegetative cells called hyphae and by sexual and asexual life cycles (Figure 1) 26. The hyphal cells form compartments, which harbor various organelles, like nuclei, mito-chondria and organelles with specialized functions like peroxisomes, gly-oxysomes and woronin bodies 27.

These special organelles are also generically called microbodies and next to their structural function they play a role in several metabolic pro-cesses including primary carbon and nitrogen metabolism (e.g. fatty ac-ids, methanol, alkanes, d-amino acids and purines), hyphal growth, spore germination and sexual spore formation 28; 29; 30. Microbodies are also in-volved in the production of secondary metabolites 31; 32. In specific fungi like P. chrysogenum and Aspergillus nidulans the final steps of the β-lactam biosynthesis are catalyzed by microbody localized enzymes 33; 34; 35.

Ascomycota are characterized by the presence of a special structure called ascus where fusion of haploid nuclei and meiosis take place during sexual reproduction. However, an asexual cycle can also occur. Specif-ically, from a hyphal tip a single haploid spore called conidiophores is developed. Condiaspores are dispersed by the wind and under suitable

14

1

15Filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Secondary metabolites

conditions will germinate to form new mycelia. Furthermore, a so-called parasexual cycle can be present as observed for the first time in Asper-gillus niger 36. Specifically, such cycle occurs when two homokaryons carrying haploid like nuclei fuse together and the resulting heterokaryon continues to divide first mitotically and then meiotically 37. A new haploid mycelium is formed and a new sexual or asexual cycle can begin again 26. Furthermore, if different nuclei of haploids fuse together, the resulting heterokaryon is unstable and a series of events, like haploidtion and/or somatic crossing-over, occur to ensure the maintenance of the genome 38.

1.1. PENICILLIUM CHRYSOGENUM

Penicillium chrysogenum is a filamentous fungus that belongs to the ge-nus Penicillium 39. In nature, it is a widely distributed mold often found on foods and in indoor environments 40. Under laboratory condition, the majority of this genus menbers reproduce asexually through chains of vegetative spores, called conidiospores, formed on the extension of spe-cialized hyphae, the brush-shaped conidiophores 41. Nevertheless, under very specific conditions, such as oatmeal agar supplemented with biotine, Penicillium species are able to sexually reproduce by induction of mating- type (MAT) loci 42; 43; 44.

P. chrysogenum forms a complex network of branched hypha, has green conidia, and sometimes secretes a yellow pigment 45; 46; 47. It can be used to produce secondary metabolites like roquefortine C 48, secalonic acids 49, meleagrin 50, chrysogine 51, PR-toxin 52, sorrentanone 53, xanthocillin X 54 but is most famous for the production of several natural penicillin, β-lactam antibiotics 55, especially for commercial production of penicillins G and V.

The P. chrysogenum genome contains 13,653 ORF distributed over 32.19 Mb 6. The genome shows significant similarities with genomes of other filamentous fungi. Of the 13,653 predicted proteins, approximately 60% could be attributed to functional protein classes as defined for ge-nome sequences, e.g. related to metabolism, energy, cellular transport and other defined classes.

In recent years, P. chrysogenum has been renamed as P. rubens, but since the fungus is used for commercial purposes, the new name finds only slow acceptance in the field 56.

1.2. SECONDARY METABOLITES

While primary metabolites are essential and directly derived from central metabolism, secondary metabolites are not required for primary meta-bolic processes and growth of the cells 57. Production of secondary me-tabolites often occurs in a late phase of growth and is usually connected to sporulation, colony formation or other forms of cell differentiation 58. For example, in Alternaria alternate and Aspergillus nidulans, linoleic and melanins acid derivatives are required for sporulation 59; 60; 61; 62. During sporulation also toxic metabolites, such as mycotoxins are secreted 63; 64. Furthermore, inhibition of sporulation has been associated with reduced aflatoxins production 65; 66. In some Aspergillus species, the production of secondary metabolites is associated with the regulation of asexual and sexual spore development 67; 68. Additionally, some secondary metabolites appear only after conidiation has been intiated 69; 70. Examples of second-ary metabolites and related functions are shown in Table 1.

Table 1. Some functionally diverse fungal secondary metabolites

Secondary metabolite Fungal producer Function Refer-

ence(s)Butyrolactone I Aspergillus terreus Sporulation induction 71

Cephalosporin Cephalosporium acremonium Antimicrobial activity 72

Cyclosporin Beauveria nivea Immunosuppressant 73

Echinocandin Aspergillus nidulans echinulatus Antifungal 74

Ergotamine Claviceps species Vasoconstrictor 75

Fumagillin Aspergillus fumigatus Antitumor 76

Fusarin C Fusarium moniliforme Mutagen 77

Gliotoxin Aspergillus fumigatus Genotoxicity 78

Integric acid Xylariasp. HIV-1-integrase inhibitory activity 79; 80

Linoleic acid Aspergillus nidulans Spore formation and development 61; 60

Lovastatin Aspergillus terreus Cholesterol-lowering 81

Lysergic acid diethyl amide (LSD)

Claviceps species Hallucinogenic 75

Melanin analogs Alternaria alternata; Cochliobolus heterostrophus; Aspergillus fumigatus

Spore survival and protection; Virulence

62; 82

Meleagrin Penicillium ssp. Antimicrobial activity 50

Mycotoxin Aspergillus spp., Penicillium ssp. Mycotoxicosis activity 66; 83; 84

Patulin Penicillium urticae Antimicrobial activity 85

Penicillin Penicillium ssp. Antimicrobial activity 55; 86

Roquefortine C Penicillium ssp. Antimicrobial activity 87

Siderophor Penicillium ssp. Affects fungal growth 88

Sorbicillinoid Penicillium ssp., Aspergillus parasticus, Tricoderma ssp, Phaeoacremonium ssp

Antimicrobial activity 89; 90; 91

Zearalenone Fusarium graminearum Sporulation induction 92

16

1

17Filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Secondary metabolites

In nature, secondary metabolites may be mediators for communication, growth inhibitors and habitat protectors. Indeed, fungi live in complex ecosystems where they interact with other fungi and organisms, such as bacteria, algae, protozoans and metazoans and plants. Secretion of sec-ondary metabolites with toxic properties provide a potential competitive advance over other organisms 110; 111.

Genes responsible for the production of secondary metabolites are often clustered 112; 113. Most likely, filamentous fungi obtained such gene clusters or parts thereof from bacterial sources through horizontal trans-fer 114; 115. Mutation and natural selection contributed to the diversifica-tion of the compounds produced 116. Examples of mutations that induced diversity were found in the terpene gene cluster 117; 118 and in genes that code for the multi modular NRPS and PKS enzymes 119.

Figure 2. Schematic overview of secondary metabolites and related gene clusters in filamentous

fungi. Penicillium chrysogenum (first, core half circle) and selected secondary metabolites are shown.

Specifically, the Penicillin G, Chrysogine and Roquefortine C (second half circles) produced by penicillin,

chrysogine and melagrine gene clusters, respectively (third half circle). The multi modular enzymes

NRPS present in the respective gene cluster (white gene square) and a minimal NRPS module structure,

which consist of an adenylation (A), thiolation (T) and condensation (C) domains are illustrated.

Historically, the systematic study of fungal metabolites started in 1922 with the identification of more than 200 compounds by Harold Raistrick  57; 93; 94;. However, it was only after the discovery by Alexander Fleming of the first natural antibiotic Penicillin by the fungus P. notatum in 1928 that, extensive research on fungal metabolites began 55. Penicil-lin was widely used to cure wound infections during the second world war however, the early discovery of penicillin-resistant staphylococci strains 95 followed by more antibiotic resistant strains 96 led to a decrease of penicillin use and to a search for alternative antibacterial agents 97.

Further β-lactam compounds were discovered such as Cephalosporin C from a marine fungus, Cephalosporium acremonium 72. Between 1970 and 2010 many new bioactive compounds were isolated and characterized with antibiotic, antitumor, antifungal activity and found use as medicines, hormones or toxins, for human applications 13; 14; 98.

There is a large and complex diversity of secondary metabolites and associated biosynthetic pathways. A method for classification is based on carbon and nitrogen sources, together with precursors derived from primary metabolism such as acetyl-CoA and amino acids that are utilized in the secondary metabolites pathways 99.

Essentially, secondary metabolites can be classified in three main groups: 1. Amino acid derivatives and non-ribosomal peptides (NRP); 2. Fatty acids derived compounds and polyketides; 3. Terpenes and Indole alkaloids 99. In the first group, proteogenic and non-proteogenic amino acids are utilized by large multi domain nonribosomal peptide synthetase (NRPS) enzymes to synthesized non-ribosomal peptides (NRP). Ribo-somes are not involved in the formation of NRP, and these NRPs can have different lengths, be linear or cyclic, and further be modified by accessory enzymes. Examples are peptaibols 100 and cyclosporine 101 as well as a variety of mycotoxins called roquefortines, and analogues like melagrin and glandicolin (Figure 2) 50.

In the second group, acetyl-CoA and malonyl-CoA are utilized by polyketide synthetase (PKS) enzymes to synthesize corresponding polyketides. A few examples are the hypolipidemic agent compactin and lovastatin 102 or the pigments fusarubin and bikaverin 103; 104. The meva-lonate pathway provides isoprene units that are used by terpene cyclases to form terpenoids, the third class of secondary metabolites. They can be linear or cyclic, such as carotenoids and gibberellins 105; 106; 107. The aromatic amino acid tryptophan and dimethlyallyl pyrophosphate are used to pro-duce indole alkaloids and related compounds, that are mainly produced by the fungus Penicillium and the parasitic Claviceps 75; 108; 109.

18

1

19Filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Secondary metabolites gene clusters

Often, gain or loss of function mutations together with mutations that are responsible for specificity or selectivity changes in these mul-tifunctional enzymes, occur at the catalytic residues 120; 121. However, the promiscuity of the PKS enzymes is most likely connected to intragenic rearrangements, and represents the first mechanism for evolution of this group of enzymes 122; 123.

1.3. SECONDARY METABOLITES GENE CLUSTERS

Mostly secondary metabolite gene clusters encompass 10-25 KB 124; 125 and are co-located on a single chromosome, although there are excep-tions. For the biosynthesis of meroterpenoids by A. nidulans two separate gene clusters are needed that are located on different chromosomes 126. Importantly, there is an enormous diversity of biosynthetic gene clusters and these are mostly not common in all fungi.

Fungal secondary metabolites gene clusters are readily recognized by the presence of genes encoding for the key enzyme, which is either a NRPS, PKS, terpene cyclase, or prenyltransferase 127; 128; 129. These are individual classes of enzymes, but each consists of a conserved archi-tecture that can be easily recognized by bioinformatics means. Adjacent genes are responsible for the further tailoring of the primary product, and this may include reactions like oxidation, reduction and methylation. Additional genes are needed for regulation and the secretion of the sec-ondary metabolites.

Multi modular enzymes consist of domains that are responsible for various sub reactions that work in concert. For example, a minimal NRPS module consists of an adenylation (A) domain responsible for amino acid activation, and a thiolation (T) domain also known as peptidyl carrier pro-tein (PCP) that serves as an anchor for the growing peptide chain and a condensation (C) domain that is responsible for transfer and peptide growth (Figure 2) 130; 131. There can be further domains, such as a thioester-ase (TE), methyltransferase (MT) or epimerisation (E) domain. Similarly, PKS enzymes contain a ketoacyl synthase (KS) domain for decarbox-ylation of the extender unit, an acyl carrier protein (ACP) for extender unit loading and an acyltransferase (AT) domain for extender unit selec-tion and transfer. Additionally, domains encoding enoyl reductase (ER), β- ketoacyl reductase (KR), methyltransferase (MT), thioesterase (TE) and dehydratase (DH) activity can be present to further process the polyketide synthesized 132. PKS and NRPS units (modules) can cooperate in so-called

hybrid NRPS-PKS enzymes. A few examples of hybrid NRPS-PKS enzyme products are rapamycin 133, yersiniabactin 134, myxovirescin (also known as antibiotic TA) 135, the cyclic pentapeptide myxochromides S1−3 136 and the antitumor agent epothilone 137; 138.

The availability of fungal genome sequences in combination with mod-ern gene prediction software like SMURF (www.jcvi.org/smurf/) and AntiSMASH (http://antismash.secondarymetabolites.org/) have led to a quick identification of numerous genes and gene clusters, putatively responsible for secondary metabolite production 139; 140. Recently, a sys-tematic deposition and retrieval system on data on biosynthetic gene clusters has been established, i.e., the minimum information about a Biosynthetic Gene cluster (MIBiG) data standard 141. This will prevent re-dundancy and serves as a quick resource to determine if compounds have been described before. Interestingly, a large proportion of the identified gene clusters are not expressed under typical laboratory culture condi-tions 142. For example, the genome of P. chrysogenum encodes ten NRPS, twenty PKS and two hybrid NRPS-PKS genes, but only four NRPS genes are expressed under standard laboratory conditions, the Pc21g21390 ( pcbAB), Pc21g15480 (roqA), Pc21g12630 (chryA) respectively from peni-cillin, roquefortine, chrysogine gene cluster and Pc16g04690 (hcpA) that encodes a fungisporin 6; 51; 127; 143. Three out of these four genes are involved in the production of the mycotoxin roquefortine, the cyclic tetrapeptide fungisporin, and the yellow pigment chrysogenin, which inspired the sci-entific name of this fungus 51. Therefore, classical methods to identify new metabolites and their corresponding biosynthetic genes, such as gene in-activation and comparative metabolic profile analysis are not suitable for the so-called cryptic or silent gene clusters 144. Nevertheless, the devel-opment of new genetic tools now offers novel solutions for the discovery, optimization and production of bioactive molecules as it will be discussed in the next section.

2. GENETIC TOOLS TO STUDY FILAMENTOUS FUNGI

Filamentous fungi have a large impact on human life since they have been widely used for the industrial production of diverse enzymes or metab-olites. However, due to typical filamentous fungal features, such as the multicellular and multinuclear mycelium morphology, and because of the lack of sufficient suitable selection marker and plasmids, genetic engi-neering approaches for filamentous fungi are less efficient compared to

20

1

21Genetic tools to study filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Selection markers

those available for bacteria and yeast 145. Nevertheless, the availability of complete genome sequences 6; 146; 147, and the deletion of proteins involved in non-homologous end joining (NHEJ) pathway have vastly contributed to improve the precise design and generation of genetically modified strains. The generation of new experimental transformation strategies for the specific and unspecific integration of DNA sequences into the ge-nome and the development of several novel CRISPR/Cas genome editing methods have allowed the specific manipulation of gene expression and function in a variety of filamentous fungi. Furthermore, new synthetic biology tools have been exploited for modular assembly of genes and pathways, such as novel promoters and terminators libraries as well as autonomously, stable replicating plasmids, which can be used as a vector for synthetic pathway reconstruction.

The genetic tools currently available for metabolic engineering of Peni-cillium strains are discussed in the following sections.

2.1. METHODS FOR GENETIC TRANSFORMATION

With the understanding that filamentous fungi are a useful resource for novel bioactive compounds such as the penicillins, further research fo-cused on understanding of physiological and genetic aspects of industri-ally important fungi. Initially, this meant the development of methods for highly efficient genetic transformation to facilitate uptake of exogenous DNA and to have more control to direct metabolism and other features of these fungi. In 1973, the first transformation of Neurospora crassa was reported 148, which a decade later was followed by transformation methods for A. nidulans 149; 150; 151. DNA uptake was achieved mainly by using protoplast and Polyethylene glycol/CaCl2. Protoplasts are readily obtained from fungal mycelium by means of enzyme cocktails contain-ing various cell-wall degrading enzymes 152. To increase the DNA delivery, protoplasts were also fused to liposomes, synthetic lipid vesicles that have been shown to enhance transformation efficiency 153. However, not all filamentous fungi show efficient formation and regeneration rates of protoplast 154. Therefore, new types of transformation protocols were in-troduced utilizing lithium acetate (LiAc) treatment 148, electroporation 155 or a biolistic particle delivery system methods (gene gun) 156; 157.

LiAc treatment does not depend on protoplast formation, but on cell permeability induced by Li+ ions thereby, increasing the transformation efficiency 158. Electroporation is based on the application of high voltage

on protoplasts and conidia resulting in 50% of cell death, which influence the transformation efficiency 159. The gene gun method exhibits increased targeted delivery and genetic stability, due to the direct delivery of DNA in the cell by using super-speed tungsten or gold particles. However, the tedious optimization of numerous factors negatively influence the trans-formation efficiency 160.

2.2. SELECTION MARKERS

An important requirement for efficient transformation and transformants selection are specific marker genes. A series of marker genes are available for filamentous fungi. For instance, marker genes niaD (encodes nitrate reductase) and pyrG (encodes orotidine-5-phosphate decarboxylase) have been widely used in transformation of Aspergillus species 161; 162; 163.

However, to use these markers, host strains are required that either have inactive gene variants or lack these genes to allow for selection on nitrate or uracil respectively. Acetamidase encoded by the amdS gene of A. nidulans allows fungi to use acetamide as sole nitrogen source. This gene was used for the first time in transformation of A. nidulans 164 and A. niger 165. Fungi transformed with the amdS and pyrG genes are sensitive to fluoroacetamide and 5-fluoroorotic acid (5-FOA), respectively. Thus, these selection markers can be eliminated by counter selection and the resultant strain can then be used for further transformation. On the other hand, marker selection and counter selection are not straightforward procedures, as often many rounds of sporulation are needed followed by growth on selective medium for strain purification, because of the multi nuclei features of filamentous fungi 36; 166. Further selection markers are based on bacterial antibiotic resistance genes such as ble (phleomycin), hph (hydromycin) and nat (nourseothricin) that are placed under con-trol of a fungal promoter 167; 168; 169. Such dominant selection markers can readily be used but also spontaneous resistance to the drugs may occur, while proper growth conditions need to be used to prevent significant background growth. Therefore, fungal transformation and selection can be laborious, time consuming and with low reproducibility.

The restricted number of selectable marker genes that are available for filamentous fungi hampers multiple gene modifications. This drawback has been addressed using site-directed recombination technology tools such as the yeast FLP/FRT 170, β-rec/six 171 and the bacteriophage Cre-loxP re-combination system 172 or the CRISPR/Cas9 system 173; 174 (See section 2.6).

22

1

23Genetic tools to study filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Specific chromosome editing methods

2.3. CHROMOSOMAL DNA INTEGRATION

To introduce DNA into the fungal genome, homologous or heterologous recombination events are used. Homologous integration may occur via a single or double cross-over event, using DNA fragments carrying the upstream and downstream flanking sequences of the target gene and the selection marker gene. In this way, it is possible to realize gene disruption or deletion events. Often, this process occurs with a very low frequency, compared to heterologous integration, and typically long flanking regions are required (>1000 kbase) 175. To increase the efficiency of homologous integration, Agrobacterium tumefaciens-mediated transformation (AMT) was developed. Specifically, this Gram negative soil bacterium contains a plasmid with a so called T-DNA which is able to introduce desired gene sequences into the host genome. Agrobacterium tumefaciens-mediated transformations (AMT) resulted to be 600 times more efficient than PEG transformation and is therefore used in filamentous fungi for gene over-expression, gene knockouts, gene complementation studies, as well as for generating random genome integrations 176; 177.

Consequently, the need to understand the molecular mechanism of the ATM transformation led to the characterization of the non-homologous end-joining (NHEJ) DNA-repair pathway. A multi-subunit complex, where Ku70, Ku80 protein dimers are involved in the direct ligation of the double stranded break ends of DNA 178.

In a NHEJ deficient strain 179 the efficiency of homologous recombi-nation is markedly increased, up to 100% 180 while shorter homologous flanking regions (~500 bps) can be used 181; 182; 183; 184; 185.

Heterologous recombination in filamentous fungi is relatively efficient and leads to mitotic stability. However, this method has the risks that multiple copies of a specific gene are incorporated while expression is not only affected by the copy number but also influenced by the inte-gration position 186. Multi copy transformants can be obtained by co- transformation of non-selected plasmids carrying the target sequence and a plasmid that harbors the selection marker. This can result in higher levels of expression and mitotic stability 187. The disadvantage is that the copy number cannot be controlled and chromosomal integration occurs at undefined sites 188; 189; 190.

2.4. SPECIFIC CHROMOSOME EDITING METHODS

To study gene and protein functions and interactions, a set of molecu-lar tools and strategies are available 191. For example, mutagenesis is an efficient method to investigate gene function and to observe related phenotypic changes in fungi. Considerable mutant frequencies may be achieved by increasing the target sites for recombination by means of a restriction enzyme mediated integration (REMI) mutagenesis strategy. In the REMI procedure, mutations can be generated by random insertions of DNA fragments into the fungal genome that has been treated with the same restriction enzymes used to generate the exogenous fragments. This technique, which relies on protoplast transformation, was applied for the first time with S. cerevisiae and later used widely for the simultane-ous mutagenesis and tagging of genes in filamentous Ascomycete such as Cochliobolus heterostrophus 192; 193.

A functional equivalent of the REMI procedure is Transposon arrayed gene knockout (TAGKO). The TAGKO technique is based on the use of homologous or engineered heterologous transposons (TE) which are ubiquitous mobile genetic elements that can be easily transferred into heterologous hosts and therefore, do not require a high frequency fungal transformation approach 194; 195.

Specific and targeted DNA modification tools are very useful for the precise editing of the genome. For this purpose, enzymes derived from bacteria and fungi that are able to induce site-specific recombination events can be used. Recombinases, such as CRE/FLP, are able to specif-ically recognize short nucleotide target sequences. With LoxP/FRT this concerns an asymmetric 8 bp spacer flanked by 13 bp inverted repeats and when two of such structures are present, specific recombination events can be induced (Figure 3) 172; 196; 197; 198; 199.

These techniques were successfully used for genetic engineering in yeast, mammals and filamentous fungi, since they can be used to intro-duce insertions, deletions, inversions and translocations at specific sites in the genome 200; 201; 202; 203.

Another strategy to induce specific targeting and modification of de-fined DNA sequences in vivo is by site-specific nucleases. Specifically, these engineered nucleases induced double-strand breaks at a target site location in the genome that is then successively repaired by the nonho-mologous end-joining (NHEJ) or homologous recombination (HR) systems resulting in a specific mutation.

There are four classes of engineered nucleases that are frequently used

24

1

25Genetic tools to study filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

DNA assembly

for this purpose: Meganucleases, Zinc finger nucleases (ZFNs), Transcrip-tion Activator-Like Effector-based Nucleases (TALEN), and the CRISPR/Cas system 174; 204; 205. Meganucleases recognize a stringent DNA sequence (>14bp) thus, they cause less toxicity in cells compared to non-specific nucleases. However, the number of specific meganucleases is limited and their construction to cover all possible sequences is a costly and time-consuming activity 206; 207. Therefore, alternative approaches using zinc finger nucleases (ZFNs) and engineered meganuclease were devel-oped 208. These methods are based on the recognition of specific nucleo-tides by a complex of a zinc finger protein and a nonspecific DNA-cleaving enzyme fused to a FokI sequence-specific recognition endonuclease 209; 210.

Lately, an alternative and readily programmable DNA binding domain was used, the Transcription Activator-like Effector Nucleases (TALENs).

The TAL effector proteins, provides a DNA-binding domain with less strin-gent binding requirements compare to ZFNs but they may also causing off-target mutations. Moreover, ZFNs and TALEN-based approaches can be used to modify defective genes in the genome, which is a so-called gene therapy practice. Examples of in vivo and in vitro gene corrections are the repair of the interleukin-2 receptor common gamma chain ( IL-2Rγ) 211 and the X-linked severe combined immunodeficiency (X-SCID) 212 in mammals.

Although the aforementioned studies with nucleases provide very effi-cient genome editing techniques, a main breakthrough was achieved by a RNA guided double-strand break induction system named CRISPR /Cas9 system (clustered regularly interspaced short palindromic repeats (CRISPR associated). This bacterial based system relies on DNA recognition medi-ated by a single guide RNA (sgRNA) and on nuclease Cas9 that is directed to the target DNA sequence by the sgRNA (Figure 4) 213; 214. In filamentous fungi, the CRISPR/Cas9 system can be carried by an AMA fungal vector and it can lead to nonspecific mutations or to specific gene integration at the genomic locus of interest by the non-homologous end-joining (NHEJ) or by the homologous recombination (HR) systems, respectively. In the latter case, donor DNA is co-transformed with the AMA fungal vector (section 2.5) 174.

In fungi, only few RNA polymerase III promoters responsible for sgRNA expression have been identified. Therefore, the sgRNA is expressed as a chimeric larger RNA transcript by RNA polymerase II and then later con-verted by ribonuclease cutting on sites engineered in the sgRNA expres-sion construct 25; 215. Moreover, there are several types of Cas nucleases that have been used and probably many more types remain to be dis-covered. Since they can cleave nearly any DNA sequence complementary to the guide RNA, they make gene editing very simple. Therefore, the CRISPR/Cas system was successfully applied in numerous organisms as diverse as humans, plants, parasites 216; 217 and microbes, including several filamentous fungi 173; 174; 204; 218.

2.5. DNA ASSEMBLY

To build genomic libraries or biosynthetic gene clusters, often several smaller DNA elements such as promoters, ORFs and terminator se-quences, have to be carefully assembled together into larger functional gene or biosynthetic gene cluster expression units. This laborious process requires highly efficient, simple and cost-effective assembly strategies.

Figure 3. Schematic representation of the LoxP recognition sequence and recombination reactions.

Panel A. An 8 bp spacer (bold) is flanked by 13 bp inverted repeats. The grey arrows indicate the di-

rection of the sequences. Panel B. Based on the direction of the loxP sequences, site-specific CRE

recombinase can execute three type of reactions. If sequences (grey triangles) are orientated in the

same direction, a segment of DNA is excited and a single recombination site is left behind. With the

reverse mechanism, DNA can also be inserted. Conversely, when recombination sequences have op-

posite orientation an inversion reaction occur. If recombination sites are situated in two separate DNA

molecule, a translocation reaction take place.

26

1

27Genetic tools to study filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

DNA assembly

In this regard, in recent years several methods have been developed to rapidly assemble two or three fragments into a linear gene expression cassette. A common and widely used method is based on restriction enzyme-based assembly. Because of its simplicity, this method is used for more complex assemblies and scar-less systems such as Golden Gate, BioBrick™ and BglBricks 219; 220. The implemented assembly systems show good performance with multiple fragments, but a major drawback is still

incomplete digestion/ligation 221. Nevertheless, these methods have been used for a wide range of applications from plasmid library construction to synthetic metabolic pathway assembly in several organism, including filamentous fungi 222.

The system that ensures the best performance with multiple (>25) long (up to several hundred bps) fragments is based on the use of recombinase or exonuclease in vivo 223; 224. The first in vivo recombination system was used in E. coli to construct a bacterial artificial chromosome (BAC) vec-tor followed by more efficient recombination systems in yeast that were used to construct a yeast artificial chromosome (YAC) vector 225; 226. Only very short homologous sequences (>25 bps) are needed for homologous recombination in S. cerevisie and this can be easily achieved by PCR. In recent years, efficient and accurate in vitro recombinase-based technol-ogies have led to new cloning systems such as In-Fusion, Gateway™ E.G. Clonetech™, and BioCatTM Cold-Fusion. In addition, fusion PCR or over-lap extension PCR (OE-PCR) methods were developed 227.

In recent years even simpler and highly effective cloning methods were developed such as PIPE (polymerase incomplete primer extension) 228, SHA (successive hybridization assembly) 229 and OSCAR (one-step con-struction of Agrobacterium-recombination-ready plasmids 230. These PCR methods are successful in building gene targeting cassettes with large homologous flanking regions (>1 Kb), that can be used for the transfor-mation of filamentous fungi 176; 231.

Another in vitro assembly method based on a PCR reaction is the Gibson isothermal assembly. In this method DNA fragments carrying 20-40 bps overlaps are mixed with exonuclease, DNA polymerase, and DNA ligase and incubated at 50°C for up to one hour, resulting in a unique DNA assembly fragment 232. This powerful cloning method shows a high efficiency when it concerns large (>20 Kb) assemblies 233, but it is costly and recombinase dependent 234 However, the combination of Gibson clon-ing with in vivo recombination in YACs allowed the creation of the first artificial Mycoplasma genitalium genome 232.

Successful applications of the aforementioned modular assembly tools concern the multi modular polyketides (PKS) and non-ribosomal (NRPS) enzymes. In fact, to expand the molecular diversity of the pharmacolog-ically important produced metabolites, a variety of modular combination and modifications have been investigated 235; 236; 237 employing modular assembly techniques.

Figure 4. Schematic representation of the CRISPR/Cas system in filamentous fungi.

Cutting sites are indicated by small scissors. A) A genomic target sequence is cut at the PAM site

by Cas9guided RNA (sgRNA). B) Chimeric sgRNA construct carrying hammerhead (HH) ribozyme,

sgRNA and hepatitis delta virus ribozyme (HDV). C) Left side: AMA1 fungal vector containing Cas9 and

sgRNA genes is transformed into fungus. Site-specific double strain breaks (DSB) are induced by the

Cas9/sgRNA system and repaired by NHEJ resulting in mutation (yellow spot). Right side: Cotransfor-

mation of AMA1 fungal vector and of donor DNA (both in linear or circular form) into fungus. The DSB

are repaired by HR resulting in target integration (orange spot). Figure from 215

28

1

29Genetic tools to study filamentous fungi

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Autonomously replicating plasmids

2.6. PROMOTORS AND TERMINATORS

Important elements of a synthetic biology toolbox are promoters and termi-nators that vary in strength. Many studies aim to improve the level of pro-tein expression 238. This depends on the use of strong promotors. Typically, both endogenous and exogenous promoters have been used for this pur-pose. Specifically, during the past two decades, gene (open-reading-frame, orfs) sequences from higher eukaryotes, such as mammals and plants and even bacteria, have been expressed in Aspergillus and in Trichoderma. For instance, the mammalian chymosin gene has been expressed in A. nidulans, using the A. niger glucoamylase promoter (glaA) 239 or lysozyme 240 and glu-coamylase 241 were expressed in A. niger employing the A. nidulans glycer-aldehyde-3-phosphate dehydrogenase promoter (gpdA). Recently, a set of promoters was tested and characterized on, inducibility, timing and level of expression, using a reporter system that can be used in P. chrysogenum 242.

However, often strong expression is not recommended, especially for the production of bioactive natural products like antibiotics and toxins. Then, the expression of a gene needs to be tightly tuned. One of the pro-moters of the alcohol regulon is the alcohol dehydrogenase alcA which is easily regulated by the presence of alcohols/ketones and lactose/glycerol that induce or repress, product formation respectively. This system was used successfully to express endoglucanase and interferon α2 in A. nidu-lans 243. Another example of a tunable expression system that uses metab-olism-independent promoters is the Tet-on/off. The system was applied for several model fungi like A. niger 244 and A. fumigatus 245. The tetracycline transactivator (tTA) or the reverse tetracycline transactivator (rtTA2s-M2) are controlled by metabolism-independent promoters like xyl (xylose) or gpdA (glyceraldehyde-3-phosphate dehydrogenase) and are able to bind to DNA at specific TetO operator sequences that are usually upstream the promoter of interest. The presence or absence of the antibiotic tetracy-cline or one of its derivatives (e.g. doxycycline) regulates the binding of tTA and rtTA2s-M2 to the TetO sequences. This artificial gene expression system can be envisioned for many applications such as gene therapy and for controlled protein production in microbial production strains 244; 246.

Besides promoters, terminator sequences are other important features in the construction of gene expression systems for homologous and het-erologous proteins expression. Therefore, terminator sequences from sev-eral filamentous fungi have been investigated and used in the construction of expressing cassettes. Selected examples are the A. nidulans trpC 247, the N. crassa arg-2 248 and the A. nidulans AN4594.2 and AN7354.2 242.

2.7. AUTONOMOUSLY REPLICATING PLASMIDS

Many bacteria and yeast species harbour natural plasmids that carry autonomously replicating sequences (ARSs) allowing the replication of the plasmid. These plasmids can be used with an appropriate selection marker to introduce new genes into the host cell with high frequency 249. In contrast, in filamentous fungi, plasmids are almost completely absent. A. nidulans possess an ARSs termed AMA sequence 250 that confers au-tonomous replication of plasmid vectors in several filamentous fungal species 249; 251; 252. However, this type of plasmid was used so far only to a limited extent, because of poor stability and the risk that the plasmid in-tegrates into the genome 165; 187; 252; 253; . Furthermore, to obtain more stable plasmids, centromeric and telemeric sequences were investigated in fila-mentous fungi 254; 255; 256. Linear plasmids containing telomeric sequences were constructed and have been shown to increase the transformation efficiency of the filamentous ascomycete Fusarium oxysporum and Nectria haematococca several thousand fold. However, the autonomous plas-mids were unstable without selection and they were poorly transferred during cell division 257; 258. One potential application of these telomeric sequences was to combine them with centromere sequences (and, or AMA sequences) to construct artificial fungal chromosome vectors, like the well-known yeast artificial chromosomes (YAC) vectors. Such vectors would allow the use of large fragments of DNA in the construction of genomic libraries for biosynthetic gene clusters and redesigned metabolic pathways. However, not many fungal centromere sequences have been identified and characterized so far 259; 260.

Generally, plasmid can be maintained by the use of a selective marker, which has the downside to be costly due to the continuous use of antibi-otic into the medium. Additionally, only a series of marker genes are avail-able for filamentous fungi (section 2.3). Therefore, the design of novel type of mitotic stable plasmids that are marker independent represent one of the future tools in fungal synthetic biology research.

CONCLUDING REMARKS

The battle against multidrug resistant bacteria provokes an urgent need for novel antibiotics based on novel, unique core structures. Filamen-tous fungi fulfil an important role in industrial biotechnology because of their use for the production of a broad range of enzymes and natural

30

1

31

1

Synt

hetic

bio

logy

tool

s fo

r met

abol

ic e

ngin

eerin

g of

the

filam

ento

us

fung

us P

enic

illiu

m c

hrys

ogen

um

Scope of this thesisScope of this thesis

products 238. For about two decades, molecular genetic tools have enabled us to engineer these organisms for production metabolites and enzymes by expressing extra copies of both endogenous and exogenous gene. However, despite their importance only few model fungi have been stud-ied in detailed and only relatively few genetic tools are currently available

For that reason, a challenge for the future is to develop and use more advanced synthetic biology tools for a broader range of fungi. In fact, these tools can be applied to engineer novel filamentous fungal strains for the expression of newly designed biosynthetic pathway, to discover, modify and characterize novel natural products, hopefully including novel structures with antimicrobial-antibiotic activities.

SCOPE OF THIS THESIS

Classical strain improvement (CSI) has had a big impact on the devel-opment of Penicillium chrysogenum as an industrial strain. This involved mostly random mutagenesis and selection. However, as of now new synthetic biology methods have hardly been applied to enhance the industrial potential of this fungus. In this thesis, we aim to expand the set of genetic tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum. Furthermore, we describe the design of an effi-cient host strain that can be used for the identification of novel secondary metabolites and for the production of natural and unnatural compounds.

Chapter 1 describes an introduction to filamentous fungi with the specific emphasis on P. chrysogenum, and gives some insights on the metabolites produced by the secondary metabolism of filamentous fungi and the ge-netics behind these metabolites production. This chapter also describes the genetic toolbox available for engineering ranging from DNA assem-bling and editing methods to promoter parts and autonomously replicat-ing plasmids.

Chapter 2 describes a method for the generation of a secondary metab-olite free strain by deletion of two highly express secondary metabolites gene clusters, chrysogine and roquefortine in a strain of P. chrysogenum that was already cleared from its multiple penicillin gene clusters. The engineered strain shows that the deletion of the chrysogine gene cluster resulted in increased levels of roquefortine metabolite production with-out affecting the expression of the core NRPS enzyme of the roquefortine

gene cluster. Moreover, the secondary metabolite deficient strain pro-duces novel metabolites that have not yet been associated with a specific secondary metabolite gene cluster.

Chapter 3 presents an inventory of possible promoters and their strength for use in P. chrysogenum. This inventory is based on a modular reporter system employing the red fluorophore DsRed under control of a specific Aspergillus and Penicillium promoter, which acts as an internal standard and the green fluorescent protein gene under control of one of the se-lected promoters. These vectors were constructed as synthetic pathways using Golden gate and in vivo homologous recombination in the yeast Saccharomyces cerevisiae, and transferred into P. chrysogenum. Subse-quent strains were analyzed in the Biolector system, which provides a semi high throughput fermentation system that allows on-line monitor-ing of various parameters. The inventory of promoter strengths adds to the synthetic toolbox development.

Chapter 4 describes the refactoring of the penicillin biosynthetic gene cluster in a P. chrysogenum strain lacking this cluster. In addition, the chapter describes an AMA plasmid based expression system that is stably maintained in cells due to the presence of an essential gene. This plasmid acts as a novel platform for metabolic engineering approaches. Herein, the β-lactam pathway which comprises three genes (pcbAB, pcbC and penDE) was reassembled from large DNA fragments using in vivo recom-bination in P. chrysogenum. The pathway was targeted into original pen locus, an alternative chromosomal location and the AMA vector, and pen-icillin production levels were compared. The pathway refactoring is a first step toward the modification of the penicillin biosynthetic gene cluster for the production of alternative β-lactam antibiotics.

Chapter 5 provides a summary and presents future perspectives of the work described in the thesis.

TOWARDS A SECONDARY METABOLITE DEFICIENT STRAIN OF PENICILLIUM CHRYSOGENUM Fabiola Polli1, Annarita Viaggiano1, Oleksander Salo1, Peter Lankhorst2, Rob van der Hoeven2, Roel. A. L. Bovenberg2,3, Arnold J. M. Driessen1

1Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands2DSM Biotechnology Centre, Delft, The Netherlands3Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands

2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

35Introduction

ABSTRACT

Secondary metabolism of the filamentous fungus Penicillium chrysoge-num has been intensively explored to relate specific secondary metabo-lites to their respective biosynthetic gene clusters. We have removed the three main biosynthetic gene clusters that specify the antibiotic penicil-lin, the mycotoxin roquefortine and the yellow pigment chrysogine, in order to generate a secondary metabolite deficient strain. This strain produces increased levels of other secondary metabolites some of which have not been detected before.

1. INTRODUCTION

Microbes produce many metabolites including products that are termed secondary metabolites. These compounds are usually formed at the late stages of cell growth and development 58 and often have an ecological function like defense mechanism(s), for instance by serving as antibiot-ics or pigments, that protect the cell against radiation damage 99. Fungi produce a multitude of low-molecular-mass metabolites of the unique biosynthetic pathways encoded in the gene clusters 261. Such genomic sequences can stretch up to more than 10,000 bases 125 and are usually located on a single chromosome 126. Some of these gene clusters are com-mon to most fungi, but their occurrence can also be limited to a spe-cific subset of species. Secondary metabolites gene cluster are readily identified in fungi as they often include a gene encoding a large multi modular enzymes such as the non-ribosomal peptide synthetases (NRPS) or polyketide synthases (PKS) 127; 129. Often these core genes are sur-rounded by other genes that fulfil specific functions in tailoring the basic chemical scaffold. Therefore, many gene clusters specify a multitude of structurally related compounds. The genome of the filamentous fungus Penicillium chrysogenum contains 10 NRPS, 20 PKS and 2 hybrid NRPS-PKS encoding genes. DNA microarray analysis of an industrial variant of this fungus revealed that only four NRPS genes are expressed under standard laboratory conditions 6. These are the gene clusters responsible for the production of the antibiotic penicillin, the mycotoxin roquefortine, the cyclic hydrophobic tetrapeptide fungisporin, and the yellow pigment chrysogine 51; 127; 143. These compounds dominate in the secondary metab-olome for this particular P. chrysogenum strain 7.

Here, we have constructed a strain that lacks three main secondary metabolite gene clusters, i.e., penicillin, roquefortine and chrysogine. Consequently, the secondary metabolome of this strain is highly reduced, but the removal resulted in the production of compounds that were not observed and characterized before. Our data suggests an altered expres-sion profile of secondary metabolite genes and a redistribution of the nitrogen flux because of the loss of specific secondary metabolite path-ways, contribute to this phenomenon. Furthermore, we propose that the secondary metabolite deficient strain will be an excellent generic host for the production of other secondary metabolites.

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

36 37Materials and methods Chromosomal deletion analysis

2. MATERIALS AND METHODS

2.1. CHEMICALS

HPLC-grade acetonitrile and formic acid were purchased from Biosolve (The Netherlands).

2.2. STRAINS, MEDIA, AND CULTURE CONDITIONS

Escherichia coli DH5α strain, restriction enzymes, DNA polymerase, and T4 DNA ligase used in this study were purchased from New England Biolabs (Beverly, MA, USA). Penicillium chrysogenum DS68530 (∆hdfA, ∆pen-cluster) was kindly provided by DSM Sinochem Pharmaceuticals Netherlands B.V. To obtain mycelium of P. chrysogenum for transformation and DNA isola-tion, fresh (108) conidiospores were inoculated into YGG medium contain-ing (in g/liter): KCl, 10.0; glucose, 20.0; yeast nitrogen base (YNB), 6.66; citric acid, 1.5; K2HPO4, 6.0; and yeast extract, 2.0. After inoculation, cul-tures were incubated for 24 h in a rotary incubator at 200 rpm at 25°C. For analysis and RNA extraction spores were inoculated in secondary metab-olites production (SMP) medium with the following reagents (in g/liter) glucose, 5.0; lactose, 36; urea 4.5; Na2SO4, 2.9; (NH4)2SO4, 1.1; K2HPO4, 4.8; KH2PO4, 5.2; supplemented with 10 ml of a trace element solution containing (in g/l): FeSO4·7H2O, 24.84; MgSO4·7H2O, 0.0125; EDTA, 31.25; C6H6Na2O7, 43.75; ZnSO4·7H2O, 2.5; CaCl2·2H2O, 1.6; MgSO4·H2O, 3.04; H3BO3, 0.0125; CuSO4·5H2O, 0.625; Na2MoO·2H2O, 0.0125; CoSO4·7H2O, 0.625. All chemicals were from Merck. Solution was adjusted to pH 6.5. The mycelium was grown in a shaking incubator at 200 rpm for 168 h at 25°C.

2.3. DELETION CASSETTE CONSTRUCTION

Multisite Gateway Three-Fragment Vector Construction kit (Invitrogen) was used to build the different deletion cassettes as described 262. The upstream regions of Pc21g12570 (chryE) and the downstream regions of Pc21g12640 (chryR) (named 5’FR chy and 3’FR chy, respectively) and the upstream regions of Pc21g15420 (roqT) and the downstream regions of Pc21g15480 (roqA) (named 5’FR roq and 3’FR roq, respectively), were used for targeted genomic integration of the deletion cassette. These regions were synthesized by PCR from P. chrysogenum DS68530 genomic DNA using the

oligonucleotides designed according to the gateway guidelines and listed in Table S1 of Supplementary information. The acetamidase gene (amdS) and the phleomycin resistance gene (ble) were used as selection marker for the deletion of chrysogine and roquefortine gene clusters, respectively. Primer sequences necessary for the amplification of the selection markers in line with the gateway procedure are listed in Table S1 of Supplementary information. The phleomycin resistance cassette was PCR amplified from a pENTRI-phleo plasmid kindly donated by Mr. Jeroen G. Nijland while amdS was synthesized by PCR from the pENTRI221-amdS plasmid.

P. chrysogenum DS68530 in which the 8 copies of the penicillin biosyn-thesis genes have been removed was transformed with 1.5 µg linearized amdS deletion cassette 262. Transformants termed DS68530∆chy, were se-lected on regeneration plates containing 0.1% acetamide supplemented medium as sole nitrogen source to select for the presence of the amdS gene. DS68530∆chy transformants were subsequently transformed with 1.5 µg of the linearized phleo deletion cassette 262, and transformants termed DS68530∆chy∆roq were selected on phleomycin (50 mg/l) plates.

2.4. CHROMOSOMAL DELETION ANALYSIS

For the determination of the integration of the deletion cassette into the selected genomic regions, genomic DNA (gDNA) was isolated after 48 h of growth in YGG medium using a modified yeast genomic DNA iso-lation protocol 263 in which the fungal mycelium is broken in a FastPrep FP120system (Qbiogene, Carlsbad, CA, USA). Diagnostic primers for ge-nomic integration site check are listed in the Table S1 of Supplementary information. To analyse the expression of all the nrps/pks genes in the DS68530∆chy and DS68530∆chy∆roq strains, total RNA of the host strains was isolated after 168 hours of growth in secondary metabolites production medium using Trizol (Invitrogen), with additional DNase treat-ment using the Turbo DNA-free kit (Ambition). Total RNA was measured with the NanoDrop ND-1000 and concentrated to 500 ng per cDNA reac-tion. cDNA was obtained using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 µl. The expression levels were analyzed in tripli-cate with a MiniOpticon system (BioRad). The SensiMix SYBR mix (Bioline, Australia) was used as a master mix for the quantitative PCR (qPCR) with 0.4 µM of primers. The following thermocycler conditions were used: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Subsequently, a melting curve was generated to determine

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

38 39Materials and methods Identification of structural classes of metabolites

the specificity of the qPCR reactions. The γ-actin (Pc20g11630) was used as control for normalization while a negative reverse transcriptase (RT) control was used to determine the gDNA contamination in isolated total RNA. The expression of γ-actin gene in DS68530∆chy∆roq, DS68530∆chy and DS68530 showed Ct values of: 19.98 ± 0.20, 19.27 ± 0.09, 19.7 ± 0.14, 19.96 ± 0.15, demonstrating comparable expression levels in the different strains. Diagnostic primers for qPCR analysis are listed on Table S2 of Supplementary information.

2.5. METABOLOMICS PROFILING

Liquid chromatography–mass spectrometry (LC-MS) was used for mo-lecular analysis. Triplicate shake flasks cultivations were performed with P.  chrysogenum DS68530 and the derived strains. Samples were centri-fuged (14,000 × g for 5 minutes) and the supernatant was filtered using 0.2  µm syringe filters with polypropylene housing (VWR International Ltd.) 60 µL of supernatant was transferred to an auto sampler vial. For separation, the Accella 1250™ HPLC system coupled in-line to an ESI-MS Orbitrap Exactive™ (Thermo Fisher Scientific, San Jose, CA) was used. A scan range between m/z 80 and m/z 1600 in positive ione (4.2 kV spray, 87.5 V capillary and 120 V of tube lens) mode, with capillary tempera-ture set at 325°C was used. Separation was performed on a Shim-Pack XR-ODS™ c18 column (3.0 × 75 mm, 2.2 µM) (Shimadzu, Kyoto, Japan). The elution was performed using a linear gradient. It started with 90% of solvent A (100% water) and 10% solvent C (100% acetonitrile) for 5 min at flow rate of 300 µL/min. The solvent C after 30 minutes reached 60% and increased up to 95% after 35 min. The column was equilibrated again using a washing step of 10 min using solvent C at 90%. Formic acid 2% was continuously used as solvent D in a final concentration of 0.1%. Raw files were processed using SIEVE software (Thermo Fisher Scientific, San Jose, CA). The appearing peak tables were used as target list and each feature was integrated in every individual sample. Later, the Excalibur 2.1 (Thermo Fisher Scientific, San Jose, CA) processing tool was used for a more accurate integration. Peaks were auto integrated using base peak traces in a mass range of 2 ppm and retention time window of 60 seconds.

2.6. IDENTIFICATION OF STRUCTURAL CLASSES OF METABOLITES

The identification of unknown compounds was performed using high res-olution mass spectrometry and 1H-NMR. NMR spectra were recorded on a Bruker Avance III 700 MHz spectrometer with a 3 mm TCI cryoprobe. 250-300K were used as sample ranged temperature. 1D 1H spectra, COSY, TOCSY, HSQC and HMBC spectra were recorded at 300 K with standard Bruker pulse sequences. To perform MS analysis, NMR samples were di-luted 100× in 50/50/0.1 MQ/ACN/FA. The continuous infusion (5 µl/min) has been applied on an Orbitrap (Thermo Scientific) in positive mode at 7500 resolution in profile mode (See Supplementary information).

3. RESULTS

3.1. DELETION CASSETTE ASSEMBLING STRATEGY

P. chrysogenum strain DS68350 is derived from strain Wisconsin 54-1255 through classical stain improvement, and in this strain the highly ampli-fied penicillin biosynthetic gene cluster has been removed genetically 7; 264. This strain also lacks the hdfA gene that is involved in the non-homol-ogous end joining recombination process to facilitate homologous re-combination. Previously, in this strain elevated levels of roquefortine and chrysogine-related compounds were observed which was attributed to a redistribution of the nitrogen flux because of the lack of penicillin production 7. To obtain a secondary metabolite deficient strain, the en-tire gene clusters for roquefortine and chrysogine biosynthesis were deleted from the chromosome. The chrysogine gene cluster (~25.5 Kb) consists of seven genes the NRPS Pc21g12630 (chyA), Pc21g12570 (chyE), Pc21g12590 (chyH), Pc21g12600 (chyC), Pc21g12610 (chyM), Pc21g12620 (chyD), Pc21g12640 (chyR) (unpublished). The roquefortine gene cluster (~23Kb) also consists of seven genes namely the NRPS Pc21g15480 (roqA), Pc21g15470 (roqR), Pc21g15460 (roqM), Pc21g15450 (roqO), Pc21g15440 (roqN), Pc21g15430 (roqD), Pc21g15420 (roqT) 143; 265. Together these gene clusters are responsible for the production of more than 24 secondary me-tabolites. The chrysogine gene cluster was replaced by the amdS selection marker, while the roquefortine gene cluster was replaced by the phleo-mycin selection marker (ble) in order to obtain strain DS68530∆chy∆roq. Deletion plasmids were constructed with the 3’ and 5’ flanking regions

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

40 41Results Transcriptome of secondary metabolite gene analysis

of the chrysogine or roquefortine gene clusters (Figure 1A, B), and used for transformation. Transformants were selected through the selection marker and after purification verified for the correct genomic target inte-gration by PCR analysis (Figure 1, C and D). This yielded the single (∆chy) and double (∆chy∆roq) deletion of the chrysogine and roquefortine gene cluster in the DS68530 strain. Neither the single nor double deletion had any effect on growth or sporulation.

3.2. TRANSCRIPTOME OF SECONDARY METABOLITE GENE ANALYSIS

To further examine the effects of the multiple gene cluster inactivation on the expression of remaining secondary metabolite genes, shaken flask cultures of deletion strains (DS68530∆chy, DS68530∆chy∆roq)

and of the parental strain (DS68530) were analyzed by qRT-PCR after 5 days of growth in SMP medium. Transcriptome data on DS68530∆chy showed that most genes involved in secondary metabolites production remained unaffected in their expression, except for nrps2 (Pc13g14330), nrps4 (Pc16g03850), nrps7 (Pc21g01710), nrps8 (Pc21g10790), pks12 (Pc21g05070) and pks15 (Pc21g12450) genes that were up to ~2 fold up-regulated (Figure 2). With pks18 (Pc22g08170) an up to 6-fold upregu-lation occurred for DS68530∆chy strain. With strain DS68530∆chy∆roq, the expression of 11 genes was altered significantly. Specifically, nrps4 and pks15 were up to 6-fold upregulated. No expression was observed for nrps9 (Pc21g12630) and nrps10 (Pc21g15480) which correspond to the core NRPS genes of the chrysogine and roquefortine gene clusters, which is consistent with the deletion of these genes.

Figure 1. Inactivation of chrysogine and roquefortine gene clusters. (A) Chrysogine inactivation cas-

sette, 5’ and 3’ flanking regions of chrysogine gene cluster were fused to the amdS selection marker

under the control of gpdA promoter of A. nidulans gpdA gene. (B) Roquefortine inactivation cassette, 5’

and 3’ flanking regions of roquefortine gene cluster were fused to the ble selection marker under the

control of IPNS promoter of P. chrysogenum pcbC gene. (C) PCR analysis of chrysogine and roquefort-

ine integration sites. Latin numbers (1 to 8) indicate the oligonucleotides used to generate fragments

used to verify the correct integration of the chrysogine and roquefortine deletion cassette into the

P. chrysogenum genome. Three independent colonies were analyzed (1, 2, 3) and expected fragments

were: ~3.3 and ~2.3 Kb for DS68530∆chy, and ~3.2 and ~2.1 Kb for DS68530∆chy∆roq. ‘ M ’ represents

the Molecular Weight Marker (GeneRuler TM 1Kb DNA Ladder, Fermentas, ).

Figure 2. Quantitative Real Time PCR analysis of the expression of nrps/pks in strains DS68530∆chy

(∆nrps9) and DS68530∆chy∆roq (∆nrps9∆nrps10). Expression was determined after 168 h of fungal

growth. Data is calculated as fold change. The ratio was calculated from the mean values of the expres-

sions levels of the DS68530∆chy and DS68530∆chy∆roq strains relative to that of the DS68530 strain

(WT). The error bars represents the standard error of the mean of two biological samples including

technical duplicates.

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

42 43Results Determination of secondary metabolites

3.3. DETERMINATION OF SECONDARY METABOLITES

To identify the effect of the gene cluster deletion on secondary metabo-lism, the culture media of the strain DS68530∆chy, DS68530∆chy∆roq, and the parental strain DS68530 were analyzed after 7 days of growth by means of LC-MS. The metabolite profiling analysis indicated that strain DS68530∆chy is indeed deficient in the production of the chrysogine related metabolites, while the levels of roquefortine/meleagrine related compounds increased 2 to 140 folds (Table 1, Figure 3). Subsequently, in strain DS68530∆chy∆roq, both chrysogine and roquefortine related metabolites were eliminated (Figure 3). The most notable changes in the resulted metabolite profile were also analyzed with respect to the num-ber of over represented peaks (27-42), as well as four newly emerged compounds (23-26) detected in the culture medium of P. chrysogenum. These are molecules with a m/z [H]+ 232.15, RT 3.45 min; m/z [H]+ 281.15, RT 6.9 min; m/z [H]+ 862.85, RT 11.52 min and m/z [H]+ 346.18, RT 20 min, respectively. To elucidate the structures of the over produced molecules, the mixed fraction (F) of the corresponding peaks (38-40) was collected by means of preparative HPLC at a sufficient quantity to perform NMR and fragmentation MS/MS analysis (Supplementary information). As a result, among others a linear tetrapeptide (40) FVVY m/z [H]+ 527.28 was identified in the fraction. This molecule has been previously reported as one of the variants of the hydrophobic tetrapeptide fungisporin (43) cyclo-FFVV, produced by a non-canonical, tetramodular NRPS HcpA in P. chrysogenum 266. Further, we quantify other known fungisporin related tetrapeptides and their possible degradation products based on the ex-act molecular mass and MS/MS fragmentation analysis. The structure of the next abundant molecule (38) was determined as the linear tripeptide VVF m/z [H]+ 364.22 that represents a degradation product of fungis-porin (Supplementary information). Regarding the possibility for further degradation of the cyclic tetrapeptides, two elevated peaks (33, 34) with identical m/z [H]+ 265.15 where assigned to the dipeptides VF and FV, respectively. The last molecule (39) with a m/z [H]+ 307.16 was collected in a fraction, but remained uncharacterized in this study together with several of the remaining peaks (23-32, 35-37). It is important to stress that the described LC-MS method is not optimal for the detection of the vast majority of the hydrophobic cyclopeptides (43) 266 which are also relatively insoluble. Thus, linear derivatives are more readily detected. Therefore, only the tetrapeptides, that were detected and overproduced in the DS68530∆chy∆roq strain, are shown in Table 1.

Table 1. The secondary metabolite production by the P. chrysogenum DS68530, DS68530∆chy and

DS68530∆chy∆roq strains. After 7 days of fungal growth, the ratio was calculated from the arith-

metic mean values of the concentration of the metabolites detected in the culture broth of each of

the DS68530∆chy and DS68530∆chy∆roq strains compared with calculated values of the parental

DS68530 strain (WT). Abbreviations: m/z [H]+, mass to charge ratio of the protonated metabolites; RT,

retention time; Novel, compounds not detected in DS68530; Unknown, compounds with not known

empirical formula; NA, compounds without structural data.

Ref m/z [H]+

RT (min)

Ratio of the metabolite concentration Empirical

formula Compound∆chy/WT ∆chy∆roq/WT

1 191.08 12.08 0 0 C10H10O2N2 Chrysogine2 250.12 11.04 0 0 C12H15O3N3 Chrysogine B3 294.11 11.02 0 0 C13H15O5N3 Chrysogine C4 207.08 9.58 0 0 C10H10O3N2 N-pyrovoylanthranilamid5 337.15 8.02 0 0 C15H20O5N4 Chrysogine related6 277.08 11.01 0 0 C13H12O5N2 Chrysogine related7 295.11 11.01 0 0 C13H14O6N2 Chrysogine related8 338.13 12.48 0 0 C15H19O6N2 Chrysogine related9 276.1 12.44 0 0 C13H13O4N3 Chrysogine related10 413.15 15.53 0 0 C20H20O6N4 Chrysogine related11 336.11 8.98 0 0 C15H18O6N3 Chrysogine related12 434.18 16.69 2.1 0 C23H23O5N4 Meleagrine13 324.15 5.23 7.4 0 C17H17N5O2 HTD14 322.13 6.23 53 0 C17H15N5O2 DHTD15 404.17 14.68 31.4 0 C22H21N5O3 Glandicoline A16 420.17 15.74 82.1 0 C22H21N5O4 Glandicoline B17 390.19 18.32 26.5 0 C22H23N5O2 Roquefortine C18 392.21 15.88 6.7 0 C22H25N5O2 Roquefortine D19 420.2 19.44 59.7 0 C23H25N5O3 Roquefortine F20 422.18 16.21 60.3 0 C22H23N5O4 Roquefortine M21 440.19 13.27 49.8 0 C22H25N5O5 Roquefortine N22 436.19 16.69 139.1 0 C23H26N5O4 Neoxaline23 232.15 3.45 Novel Unknown NA24 281.15 6.89 Novel Unknown NA25 862.85 11.52 Novel Unknown NA26 346.18 20.00 Novel Unknown NA27 188.09 4.63 176 Unknown NA28 892.84 9.19 336 Unknown NA29 281.15 10.29 28 Unknown NA30 785.79 10.51 42 Unknown NA31 413.14 10.68 17 Unknown NA32 277.12 12.75 250 Unknown NA33 265.15 13.19 906 C14H20N2O3 Dipeptide VF/(FV) 34 265.15 13.50 753 C14H20N2O3 Dipeptide FV/(VF) 35 304.16 14.27 4106 Unknown NA36 279.17 15.78 40 Unknown NA37 543.28 17.28 158 Unknown NA38 364.22 17.74 8 C19H29N3O4 Tripeptide VVF 39 307.16 18.30 143 Unknown NA 40 527.28 18.96 9 C28H38N4O6 Linear tetrapeptide VYFV 41 507.28 19.72 6 C29H38N4O4 Cyclo-tetrapeptide FFVI 42 511.29 22.12 2 C28H38N4O5 Linear tetrapeptide FFVV / VFFV 43 493.28 26.54 1 C28H36N4O4 Cyclo-tetrapeptide FFVV (Fungisporin)

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

44 45Discussion Discussion

4. DISCUSSION

The filamentous fungus Penicillium chrysogenum produces a wide range of natural products such us penicillin, roquefortine and glandicoline which have useful pharmaceuticals properties 143; 267; 268; 269. The genome of P.  chrysogenum contains multiple gene clusters that are responsible for secondary metabolite formation. However, most of these gene clus-ters are low expressed under standard laboratory conditions 6 and their

products remain unknown. Furthermore, several of these gene clusters collected mutations during the classical strain improvement programme and thus do not produce compounds 7. In contrast, the gene clusters specifying penicillin, roquefortine, chrysogine and fungisporin production are highly expressed and thus their removal should result in a strain that is deficient in secondary metabolite formation. Such a strain is of poten-tial interest as it could be used to express other secondary metabolite pathways of interest. Also, removal of highly expressed clusters may re-sult in higher production levels of the metabolites produced by the low expressed gene clusters and may facilitate further identification of novel bioactive molecules in this fungus. Here, we describe a first step towards the generation of a secondary metabolite deficient strain of P. chrysoge-num DS68530 lacking the eight copies of the penicillin biosynthetic gene, as well as the highly expressed chrysogine and roquefortine gene clusters.

The extracellular metabolome profiles, obtained and analyzed in this study, show that twenty compounds (23-42) are significantly overproduced in the double deletion mutant DS68530∆chy∆roq compare to the parental strain. This includes four novel compounds (23-26) that now for the first time were observed in the spent medium of P. chrysogenum (Figure 3, Table 1). The second largest group of overproduced molecules belongs to fungisporin related tetrapeptides, as well as their degradations products identified by means of NMR and MS analysis as tripeptide VVF and dipeptides VF and FV, respectively. These compounds are likely proteolytic degradation products of fungisporin. Although, we were not able to quantify the production of the vast majority of the highly hydrophobic fungisporin-like cyclic peptides, the metabolome profiles clearly indicate that their linear forms and proteo-lytic tri- and dipeptide derivatives are present at the increased levels in the culture broth of the deletion strains (Figure 3).

To putatively link the novel products to secondary metabolites genes, the expression levels of the core NRPS, PKS and hybrid enzymes were determined by qPCR. In the DS68530∆chy∆roq, the expression levels of two NRPS genes (Pc13g14330 and Pc16g03850) was up-regulated 2 and 6-fold, respectively (Figure 2). Nrps2 (Pc13g14330) shows 97% identity with an HC-toxin synthetase 2 (HTS-2) of Cochliobolus carbonum 270 and it has been reported as one of the two tetrapeptide synthetases present in the genome of P. chrysogenum 266. Previously, we reported the successful overexpression of this low expressed gene using the strong Isopenicillin N synthase pcbC gene promoter. However, regardless an overexpression by up to 500 fold, the product could not be detected (Samol, unpublished data). This supports our earlier conclusion 266, that all the tetrapeptides

Figure 3. Total ion chromatogram of liquid cultures of deletion strains DS68530∆chy,

DS68530∆chy∆roq and host strain DS68350. Cultures were grown for 7 days on SMP medium. The

chrysogine (1-11) and roquefortine (12-22) related compounds eliminated from the secondary metab-

olism of DS68350, as well as the novel (23-26) and over represented (27-42) metabolites produced by

DS68530∆chy∆roq strain are indicated according to the Table 1.

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

46 47Discussion Discussion

overproduced in DS68530∆chy∆roq strain, originate from the second tetramodular nrps5 named HcpA (Pc16g04690). The latter gene was not altered in expression in the analyzed mutants. This NRPS features mi-croheterogeneity in the substrate specificity of its adenylation domains and assembles a set of structurally diverse hydrophobic tetrapeptides, including cyclo-FFVV fungisporin 266. Subsequent degradation of the cyclic peptides leads to the accumulation of the corresponding tri- and dipeptides in the culture medium of P. chrysogenum. Among others, the NRPS4 gene (Pc16g03850) also named PssA belongs to a gene cluster that is potentially involved in extracellular siderophores biosynthesis 6 and participates in the production of coprogen B, under iron starvation conditions (Samol, unpublished data).

Additionally, nine PKS genes (Pc16g11480, Pc21g04840, Pc21g05080, Pc21g12450, Pc21g15160, Pc21g16000, Pc22g08170, Pc22g22850, Pc22g23750) were found to be upregulated. However, for most of these PKS proteins, no function has been defined yet. Pks13 (Pc21g05080) belongs to a gene cluster responsible for sorbicillinoids biosynthesis — a group of structurally diverse yellow pigments that were eliminated from the metabolism of P. chrysogenum due to the mutational impact of the industrial strain improvement 7. Pks17 (Pc21g16000) is a naphthopy-rone synthase involved in the formation of the green conidial pigment in P. chrysogenum and has recently been used successfully as a marker for phenotypic screening of fungal transformants 174. Finally, pks18 (Pc22g08170) has been characterized as 6-methylsalicylic acid synthase (Salo, unpublished data), — a known precursor for patulin biosynthesis in P. chryseofulvum. This mycotoxin, however, is not produced by the P.  chrysogenum due to absence of the crutial isoepoxydon dehydroge-nase (PatN) encoding gene in this fungus.

The multiple secondary metabolite gene cluster deletion reveals an interesting metabolic feature. Deletion of the chrysogine gene cluster results in higher levels of roquefortine related metabolites in the culture broth (Table 1), whereas expression of roqA (nrps10) was not altered. A possible explanation for this phenomenon could be a redirection of cel-lular resources most notably amino acids to enhance roquefortine and, possibly, fungisporin production as evidenced by the higher level of fungisporin derived degradation products in the culture broth. A similar phenomenon was previously observed upon the deletion of the multiple penicillin gene clusters that resulted in higher levels of roquefortine and chrysogine-related metabolites whereas it did not change the expression levels of the respective biosynthetic genes 7. This proposed redirection of

amino acids may also have caused the elevated levels of the four novel metabolites of unknown origin, but this assumption requires the struc-tural characterization of these compounds.

In conclusion, the industrially improved strain of P. chrysogenum that is optimized for the high level fermentative production of penicillin and in which the highly expressed NRP-related gene clusters (chrysogenine, roquefortine and penicillin) have been removed may in the future serve as a host for the heterologous expression of other secondary metabolite pathways. Complete implementation, however, also necessitating the de-letion of the hcpA (Pc16g04690) gene that encodes for the NRPS involved in fungisporin production.

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

48 49Supplementary informationSupplementary information

SUPPLEMENTARY INFORMATION

Table S1. Primer used in this study

Target Sequence ( 5’-> 3’) PurposeP107-5’FR Chy_NotI_Att4 GGGGACAACTTTGTATAGAAAAGTTGGCGGCCGCTGC

AGCAAAGACGACATTCpDon4-1 construction, chrysogine

P123-5’FRchy_ Att1 GGGGACTGCTTTTTTGTACAAACTTGGCAGTGGCTGTCAGAATAG

pDon4-1 construction, chrysogine

P124-3’FRchy_Att2 GGGGACAGCTTTCTTGTACAAAGTGGCATGCACGATGTGGTCATATG

pDon2-3 construction, chrysogine

P114-3’FRChy_MluI_Att3 GGGGACAACTTTGTATAATAAAGTTGACGCGTTTTCTCGACGTCCGATCA

pDon2-3 construction, chrysogine

P115- 5’FRRoq_NotI_Att4 GGGGACAACTTTGTATAGAAAAGTTGGCGGCCGCTTCAAGGGTGAGGATGTTCC

pDon4-1 construction,

P125-5’FRroq_Att1 GGGGACTGCTTTTTTGTACAAACTTGCAGTCCAGCCCAGTTATTG

pDon4-1 construction

P179-3’FRroq_Att2 GGGGACAGCTTTCTTGTACAAAGTGGTGAGCAACGCTTGGAGTC

pDon2-3 construction

P180-3’FR Roq_MluI_Att3 GGGGACAACTTTGTATAATAAAGTTGACGCGTGATGTCGGTGGCTGTCTATG

pDon2-3 construction

P158-amdS_Att1 GGGGACAAGTTTGTACAAAAAAGCAGGCCATATAACTTCGTATAGCATACATTATACGAACGGTAGCTCTGTACAGTGACCGGTGAC

pDON221-amds construction

P159- amdS_Att2 GGGGACCACTTTGTACAAGAAAGCTGGGACTACCGTTCGTATAGCATACATTATACGAAGTTATTGGTATGGGGCCATCCAGAGT

pDON221-amds construction

P160-phleo_ Att1 GGGGACAAGTTTGTACAAAAAAGCAGGCCATATAACTTCGTATAGCATACATTATACGAACGGTACCCCTCGAGGTCGACTACATG

pDON221-phleo construction

P161-phleo_ Att2 GGGGACCACTTTGTACAAGAAAGCTGGGCAGTGGTACCGTTCGTATAGCATACATTATACGAAGTTATGCAAATTAAAGCCTTCGAGCGTC

pDON221-phleo construction

P272-5’FRchy CCATGTCGGGTGTAGATCG 1- Forward integration site check chrysogine

P211- amdS GCTGCCCGTTTACAGAATG 2- Reverse integration site check chrysogine

PP200- amdS CATGCCATGCTACGAAAGAG 3- Forward integration site check chrysogine

P271-3’FRchy GGCTCAAACTTGCGCTTAG 4- Reverse integration site check chrysogine

P270-5’FRroq CAGACGGCTTGCTGAATAAC 5- Forward integration site check melagrine

PRvF-phleo GCAGATGACAATGAGTGAAGA 6- Reverse integration site check melagrine

P202-phleo CTTACATTCACGCCCTCCC 7- Forward integration site check melagrine

P269-3’FRroq ACTGATGCCCTCAACCTGTC 8- Reverse integration site check melagrine

Table S2. Primer used for qRT-PCR

Target Sequence ( 5’-> 3’) GeneNRPS1Fw GCAGACCTGTATCCATCGCAA Pc13g05250NRPS1Rv GGAGGCAAGTGAAGGTGTGTT Pc13g05250NRPS2Fw GCGACAGCCGCCGGAGTAACTATGG Pc13g14330NRPS2Rv GAGAGACGGGGACACGCGTGATG Pc13g14330NRPS3Fw ACGTACGCTCGAGCTGGACT Pc14g00080NRPS3Rv GCCGTCGCGTTGATAATTGG Pc14g00080NRPS4Fw TGGTTGAAAGAGGGCAGTCTC Pc16g03850NRPS4Rv CGCGAACATACACAACACCAC Pc16g03850NRPS5Fw CTTTCCAGAACAGTTGGCTGGT Pc16g04690NRPS5Rv GCTGCATCTTACCCAGGTAATTG Pc16g04690NRPS6Fw CCACCCTTGTTCAGCCGCTGAATTCC Pc16g13930NRPS6Rv GGACGAGGCGAACAACATCGGAC Pc16g13930NRPS7Fw GCTATCTCGGTGGAGGATCTTCTGTCC Pc21g01710NRPS7Rv GTGCTGCTGAGAACACGGGATTGT Pc21g01710NRPS8Fw GTGAGGCAGCTTTGTTCAACACCATT Pc21g10790NRPS8Rv TTCTGCAGCAGGCTGTCGGCCTGAG Pc21g10790NRPS9Fw GAGCCAACTCTGTTGTCTACG Pc21g12630NRPS9Rv CAGGGCAATTTGCCTCATTCTG Pc21g12630NRPS10Fw CTTGGTGGATGCAGCGAAGG Pc21g15480NRPS10Rv CTGTGAGAGAGGCTCTTGAGTA Pc21g15480NRPS11Fw TTCGCGAACATCCGAAGAAGC Pc22g20400NRPS11Rv TCGGGCGAAGACACTGTTCA Pc22g20400S1FwA GCTACAGCCCTGACGCCATGG Pc12g05590S1RvA CTGCGCAGGTCTACATCGGTACC Pc12g05590S2FwA CCGAAGATGCCGGCGACGG Pc13g04470S2RvA CGCTGGTCTGCGATGTGGCC Pc13g04470S3Fw CGAGAGACCAGGATAAGGTTCTTGGC Pc13g08690S3Rv GGTGGTCTGTCACCACTCTTCCC Pc13g08690S4Fw CATGGTCAGCACCCTCAGTGCC Pc16g00370S4Rv CCAGGTCAGGCGTCGTACGC Pc16g00370S5Fw CGGGTGCTGCATAGATGTACTACGC Pc16g03800S5Rv GCTGGCCACGGAAGACAACGC Pc16g03800S6Fw CCTATTCGCGCCCTGATTATGGGC Pc16g04890S6Rv CGAGATTTGTCTTCACAGAACCCACC Pc16g04890S7Fw CACGATTTTAGCAAGTCAACCAGCGCG Pc16g11480S7Rv CTCGCTCTCCCAGAATGTCAAGGC Pc16g11480S8Fw GCCACACTCATCGGCACCACG Pc21g00960S8Rv GCTCCACAGAGCAACCAACCCG Pc21g00960S9Fw GACGTGGCCGGTGATGCCG Pc21g03930S9R GCGATGTTGCGGACGAGGCC Pc21g03930S10FwA CAGCGCCGAGTCCTACAGCC Pc21g03990S10RvA GTGGACCTTGGAGGATGTCTTGC Pc21g03990S11FwA CCTTGACGAATATCCGCACTCCG Pc21g04840S11RvA CAAGCCACAGCTGATGAAGCGC Pc21g04840S12Fw GTCGGAGGCAATTCGGGAAGGC Pc21g05070S12Rv GCAAAGTTCCACCACAATGCCGCG Pc21g05070S13Fw CCGAGGATCTCCGCCAGGC Pc21g05080S13Rv GGTTGTGCAGGTTCCAGGTGCC Pc21g05080S14Fw GCACCACCATCAGCCAAAGCATACC Pc21g12440S14Rv CCGAGGTCCATTGGAACTATGCGC Pc21g12440S15Fw CCAGTTGTCTGCAGCCGGCC Pc21g12450S15Rv GCCCAGATCACCGCCGTACG Pc21g12450S16Fw CAGCCGCGTAGTTTGCCTGGC Pc21g15160S16Rv GCACAGTGTGCTGAGGTTACGGC Pc21g15160S17FwA CTTGTCATCAGCAGCCCAGAGG Pc21g1600017RA CAATTTGCGGTGGCTGAGACGC Pc21g16000S18Fw CGTTCACCCTCTGCATACCCCTC Pc22g08170S18Rv CAGTCAAAGTCCTCCAGGCGATCG Pc22g08170S19Fw CGGTCAACCAGGGATCCAACTGC Pc22g22850S19Rv CTGAAGCGGTCTCTGTGTGGCC Pc22g22850S20FwA CGGTAATGTCCAGCTGGCACTCG Pc22g23750S20RvA CTTCAGGCACTTCTGTACCGGG Pc22g23750p306-γ-actin cDNAFw CTGGCGGTATCCACGTCACC Pc20g11630p307-γ-actin cDNARv AGGCCAGAATGGATCCACCG Pc20g11630

2 2

Tow

ards

a s

econ

dary

met

abol

ite d

efici

ent s

train

of

Peni

cilli

um c

hrys

ogen

um

50 51Supplementary informationSupplementary information

Figure S2. 1H NMR spectrum of fraction F. Sample was dissolved in 200 µl H2O/D2O 80/20 and trans-

fer to a 3 mm NMR tube. The main compound is a tripeptide containing V (2x) and F (1x). The sequence

(VVF) was derived from the COSY (Figure S3) and HMBC (Figure S4) spectrum.

Figure S3. COSY spectrum of Fraction F. The low-field doublet at 8.4 ppm is the amide proton of a

valine (V2), and the high-field doublet at 8.4 ppm is the amide proton of the phenylalanine (F3).

Figure S4. HMBC spectrum of fraction F, carbonyl region only. The amide proton of the phenylal-

anine is coupled to the carbonyl of a valine (V2). The amide proton of the same V2 is coupled to the

carbonyl of V1. At the same time the carbonyl of the phenylalanine (F3) is not coupled to an amide

proton. Derivative sequence is V(1)-V(2)-V(3).

Figure S1. Map of the deletion constructs for chrysogine and roquefortine gene clusters which

were used for deletion. Features: Amp, Ampicillin resistance gene for the selection in E. coli; ori pUC

origin of replication; amdS, A nidulans acetamide gene for the selection of fungal transformants; phleo,

Phleomicin resistance gene for selection of fungal transformants.

2

52 Supplementary information

Figure S5. MS/MS spectrum of the collected fraction F. A linear tripeptide VVF m/z [H]+ 364.22

was identified.

Figure S6. MS/MS spectrum of the collected fraction F. A linear tetrapeptide FVVY m/z [H]+ 527.28

has been identified.

NEW PROMOTERS FOR STRAIN ENGINEERING OF PENICILLIUM CHRYSOGENUM

Published in Fungal Genetics and Biology (2015).

3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

57Introduction

ABSTRACT

Filamentous fungi such as Aspergillus and Penicillium are widely used as hosts for the industrial products such as proteins and secondary metabolites. Although filamentous fungi are versatile in recognizing transcriptional and translational elements present in genes from other filamentous fungal species, only few promoters have been applied and compared in performance so far in Penicillium chrysogenum. Therefore, a set of homologous and heterologous promoters were tested in a re-porter system to obtain a set of potential different strengths. Through in vivo homologous recombination in Saccharomyces cerevisiae, twelve Aspergillus niger and P. chrysogenum promoter–reporter pathways were constructed that drive the expression of green fluorescent protein while concurrent expression of the red fluorescent protein was used as an internal standard and placed under control of the PcPAF promoter. The pathways were integrated into the genome of P. chrysogenum and tested using the BioLector system for fermentation. Reporter gene expression was monitored during growth and classified according to promoter strength and expression profile. A set of novel promoters was obtained that can be used to tune the expression of target genes in future strain engineering programs.

1. INTRODUCTION

Filamentous fungi fulfil an important role in industrial biotechnology be-cause of their long history and widespread use for the production of a broad range of compounds such as antibiotics, metabolites and enzymes 238. Typically, transcriptional and translational signals are functional across a range of filamentous fungal hosts. For example, Aspergillus nidulans was used to express the first heterologous gene encoding for the mammalian protein chymosin under control of the A. niger glucoamylase promoter 239. Over the years, many promoters have been characterized in Aspergillus and in Trichoderma but relatively few examples exist for the β-lactam antibiotics producer Penicillium chrysogenum 271. For instance, the constitutive promoter of the phosphoglycerate kinase gene (pgkA), the phosphate-repressible acid phosphatase (phoA) and promoters that are sensitive to carbon and nitrogen catabolite repression such as the endo-xylanese (xylP) and the isopenicillin-N-synthetase (pcbC) promoter have been used to express the β-glucuronidase (uidA) gene, phleomycin selection marker and penicillin biosynthesis genes 272; 273; 274; 275; 276; 277. The A. nidulans glyceraldehyde-3-phos-phate dehydrogenase gene (gpdA) and the A. niger (1,4)-β-D-arabinox-ylan-arabinofuranohydrolase gene (axhA) promoter regions 259; 278 have been used as heterologous promoters for gene expression in Penicillium. For fur-ther metabolic engineering and improvement of fungal production strains, a larger set of promoters of different strengths and expression profiles is needed. This requires a more systematic analysis of the performance of ho-mologous and heterologous promoters.

An aspect in strain improvement programs is the optimization of the fer-mentation process for yield, speed and maximum productivity. Tradition-ally, microtiter plates (MTP) or shake flasks are used for high-throughput screening applications 279. Since the monitoring of the fermentation per-formance typically occurs at the end of the experiment, important kinetic parameters for biomass and product formation are not measured during the screening. Because of these limitations, online monitoring systems for continuously shaken MTPs were developed 280; 281. This BioLector system allows for the on-line monitoring of fermentation parameters like biomass formation, pH, O2 concentration and fluorescent reporter proteins  282. Since then, it has been widely used to characterize bacterial and yeast fermentations 283 but so far was not applied to fermentations of filamen-tous fungi because of the morphological complexity of these organisms 284.

Here, we have used in vivo homologous recombination in Saccharomy-ces cerevisiae to engineer promoter–reporter pathways, and expressed

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

58 59Materials and methods Promoter pathway construction

these pathways in P. chrysogenum. The performance of the various pro-moters was tested during fermentations using the BioLector system.

2. MATERIALS AND METHODS

2.1. STRAINS, MEDIA, AND CULTURE CONDITIONS

Escherichia coli DH5α, restriction enzymes, DNA polymerase, and T4 DNA li-gase used in this study were purchased from New England Biolabs ( Beverly, MA, USA). S. cerevisiae CEN.PK113-7D 285 and P. chrysogenum DS68530 (∆hdfA ∆Pen-cluster) 264 were used in this study. The latter strain is derived from the industrial strain DS17690 in which the multiple penicillin gene clusters were removed 264 as well as the hfdA gene which encode a homolog of the Ku70 protein involved in non-homologous end-joining and the amdS selec-tion marker used to deleted the β-lactam biosynthetic genes cluster 184. All plasmids containing the promoter, open reading frame and terminator sequences used in the Golden Gate cloning system were kindly provided by DSM Sinochem Pharmaceuticals Netherlands B.V. Yeast was grown on YEP medium containing 2% glucose as described  286. To obtain mycelium of P. chrysogenum for DNA isolation, fresh spores (108 conidiospores immo-bilized on 25 rice grains) were used to inoculate 25 ml of YGG medium con-taining in g/l: KCl, 10.0; glucose, 20.0; yeast nitrogen base (YNB), 6.66; citric acid, 1.5; K2HPO4, 6.0; and yeast extract, 2.0. Cultures were incubated for 24 h in a rotary incubator at 200 rpm at 25°C. For BioLector analysis, this pre-grown mycelium was inoculated in a glucose-limited defined medium for secondary metabolites production containing the following reagents in g/l: glucose, 5.0; lactose, 36; urea 4.5; Na2SO4, 2.9; (NH4)2SO4, 1.1; K2HPO4, 4.8; KH2PO4, 5.2; supplemented with 10  ml of a trace element solution containing (in g/l): FeSO4∙7H2O, 24.84; MgSO4∙7H2O, 0.0125; EDTA, 31.25; C6H6Na2O7, 43.75; ZnSO4∙7H2O, 2.5; CaCl2∙2H2O, 1.6; MgSO4∙H2O, 3.04; H3BO3, 0.0125; CuSO4∙5H2O, 0.625; Na2MoO∙2H2O, 0.0125; CoSO4∙7H2O, 0.625. All chemicals were from Merck. Solution was adjusted to pH 6.5. The mycelium was grown in a shaking incubator at 200 rpm for 168 h at 25°C.

2.2. PROMOTER PATHWAY CONSTRUCTION

E. coli plasmid DNA of promoters, ORFs and terminators listed in  Table 1 were extracted and concentrated to 75 ng/ml with double distilled water.

Golden Gate cloning was performed according to the One-Pot DNA Shuf-fling Method Based on Type IIs Restriction Enzymes 287. Twelve GFP expression cassettes were generated combining six A. niger and six P. chrysogenum promoters to the open reading frame of the green fluo-rescent protein (GFP) venus variant and to the A. nidulans we. The com-plete nucleotide sequences are shown in the Supporting Information S1. A single RFP expression cassette was made by fusion of P. chrysogenum paf gene promoter (Pc24g00380, antifungal protein precursor PcPAF) and A. nidulans AN7354.2 terminator (40S ribosomal subunit protein) to the peroxisome-targeted fluorescent protein (DsRed.SKL, termed red fluores-cent protein RFP) open reading frame (Figure 1) 1; 288. PcPAF was chosen as an internal control as it is well expressed in P. chrysogenum 289.

The amdS gene was used as selection marker for fungal transforma-tion. The downstream region of Pc20g07090 and the upstream region of Pc20g07100 genes (named 5’ IGR and 3’ IGR, respectively) were used for targeted genomic integration of the promoter–reporter pathways. These regions were synthesized by PCR from the pENTRI221-amdS plasmid and from P. chrysogenum DS68530 genomic DNA using the oligonucleotides listed in Supplementary Information S1. E. coli clones with the GFP and RFP expression cassettes, the selection marker amdS, and the 5’ IGR and 3’ IGR regions, were used as PCR templates to generate DNA fragments with recombination linkers of 50 bps for the in vivo recombination in yeast 290. Primer sequences necessary for construction of the cassettes (Figure 1) are listed in the Supplementary Information S2. Co-Transformation of S. cerevisiae CEN.PK1137D with the DNA fragments and acceptor vector pRS417 291 was performed as described 292 using recombination-mediated PCR-directed plasmid construction in vivo to generate the different path-way promoter clones 293. Plasmid DNA was isolated, amplified in E. coli NEB 10 beta (New England Biolabs) and analyzed by restriction analysis. Next, the plasmids were used as PCR templates for the bi-partite target-ing strategy in P. chrysogenum 294; 295. PCR fragments 1 and 2 were gener-ated which each contain part of the amdS gene (Figure 1) (Supplementary Information S2).

The two generated fragments have a 690 bp overlap at the amdS gene that once recombined in the genome will form a functional amdS gene (Figure 1). P chrysogenum DS68530 was transformed with 1.5 μg of each of the bi-partite fragments. Transformants were selected on regeneration plates containing 0.1% acetamide as sole nitrogen source to select for the presence of the amdS gene 262.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

60 61Materials and methods Promoter pathway chromosomal analysis

Table 1. Promoters, reporters and terminators used to build expression cassettes.

Promoter Associated gene Reporter TerminatorAn02g10320 glaA, glucoamylase eGFP Anid_AN4594.2An04g06380 mAspAT, mitochondrial aspartate

aminotransferaseAn04g08190 Ortholog(s) ATPase activityAn07g01960 Putative stearoyl-CoA desaturaseAn11g02040 gndA, 6-phosphogluconate

dehydrogenaseAn16g01830 gpdA, glyceraldehyde-3-phosphate

dehydrogenasePc16g00620 glaA, glucoamylasePc16g11100 proton-transporting ATP synthasePc20g15140 strong similarity to secreted serine proteasePc21g21380 pcbC, isopenicillin N synthasePc21g21390 pcbAB, α-aminoadipyl-cysteinyl-valine synthetasePc22g16370 SHO1, osmosensorPc24g00380 PcPAF, paf, antifungal protein DsRed.SKL

(RFP)Anid_AN7354.2

2.3. PROMOTER PATHWAY CHROMOSOMAL ANALYSIS

For the determination of the integration of the promoter–reporter path-ways into the selected intergenic region and to evaluate the gene copy numbers, genomic DNA (gDNA) was isolated after 48 h of growth in YGG medium using a modified yeast genomic DNA isolation protocol 263 in which the fungal mycelium is broken in a FastPrep FP120 system ( Qbiogene, Carlsbad, CA, USA). Diagnostic primers for genomic integration site check and for gene copy number analysis of GFP, DsRed.SKL, NiaD, and γ- actin (Pc20g11630) are listed in the Supplementary Information S2. Gene copy numbers using gDNA were analyzed in duplicate with a MiniOpticon sys-tem (Bio-Rad). The SensiMix SYBR mix (Bioline, Australia) was used as a master mix for the quantitative PCR (qPCR) with 0.4 μM of primers. The following thermocycler conditions were used: 95 C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Subse-quently, a melting curve was generated to determine the specificity of the qPCR reactions. The efficiency of the primers used for the copy number determination was assessed through the use of serial dilutions of gDNA. The γ-actin reference gene, niaD, GFP and RFP genes showed efficiencies of 98.62% (R2 = 0.9999), 95.23% (R2 = 0.996), 92.39% (R2 = 0.999), 92.47% (R2 = 0.9992), respectively.

Figure 1. Promoter pathway assembling strategy. The pentagon and chevron symbols indicate the

recombination linkers used for in vivo recombination in yeast. Latin letters (A–D) indicate the oligonu-

cleotides used for the overlapping PCR to generate the fragments needed for the bi-partite integration

of the promoter pathways into the P. chrysogenum genome.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

62 63Results Gene copy number analysis

2.4. BIOLECTOR 48 WELLS FERMENTATION WITH ONLINE MONITORING

To follow the performance of the promoter pathways, the BioLector bench top microbioreactor system (M2Plabs, Baesweiler, Germany) was used 281. It performs high-throughput fermentations together with online moni-toring of the most common fermentation parameters (biomass, pH, DO and fluorescent molecules) and runs 48 fermentations simultaneously in 1 ml wells. Pre-grown mycelium (42 h) of the different strains was diluted 8 times in 1 ml of glucose-limited defined medium to yield a cell mass of about 0.25–0.4 g/l. Cells were grown for 168 h in the BioLector at 800 rpm at 25°C. Biomass was measured via scattered light at 620 nm excitation without an emission filter. The fluorescence of GFP and RFP was measured every 30 min with 486/589 nm excitation filter and 510/610 nm emission filter, respectively. All experiments were conducted as duplicates and the mean value was calculated. In experimental repeats, different signal inten-sities were obtained since the sensitivity of the photomultiplier (gain) was adjusted accordingly but relative variations were similar.

3. RESULTS

3.1. PROMOTER PATHWAY ASSEMBLY STRATEGY

To obtain a set of variable promoter strengths and expression profiles to be used for gene expression in the filamentous fungus P. chrysogenum, information about A. niger and P. chrysogenum promoters was collected from literature and from transcriptome data 6; 264. For instance, the pro-moter of the starch-regulated (glaA) gene from A. niger has been used to express several proteins like α-interferon in A. nidulans 243, GFP 296 or bacterial hygromycin phosphotransferase (Hyg) in Ustilago maydis 297. Fila-mentous fungal promoters involved in primary and secondary metabolism were also selected. These include the A. niger glyceraldehyde-3-phos-phate dehydrogenase gene (gpdA) and the isopenicillin N-synthase (pcbC) gene of P. chrysogenum 298; 299. A list of all tested promoters is presented in Table 1. For chromosomal expression, the location of the integration site is important since it may influence gene expression 186. Hence, the P. chrysogenum array data 264 was used to select an intergenic region of about 1 kb between genes Pc20g07090 and Pc20g07100 that both show medium expression levels.

To generate the promoter–reporter pathways, an approach was chosen wherein the selected promoters were used to drive the expression of GFP while the paf promoter was used to drive the expression of RFP to form an internal standard which allows for corrections in growth and biomass differences (Figure 1). The GFP and RFP expression cassettes were gen-erated by using the Golden gate cloning technique and GFP/venus was combined with the aforementioned 12 different promoters (Biobricks of six homologous and six heterologous promoters) and the A. nidulans AN4594.2 terminator (Table 1). RFP, which acts as internal reference was combined with the P. chrysogenum paf promoter and the A. nidulans AN7354.2 terminator. To generate multiple overlapping DNA fragments, the amdS selection marker, GFP and RFP expression cassettes and the in-tergenic regions, 5’ IGR and 3’ IGR for chromosomal targeting, were used in a PCR reaction together with recombination linker oligonucleotides. All fragments were successfully assembled in vivo in S. cerevisiae into the yeast vector pRS417, and the different clones were recovered from yeast and used as template for bi-partite fragment amplification. P. chrysogenum DS68530 was subsequently transformed with the bi-partite fragments using the split marker (amdS) approach and the pathways were success-fully integrated in the chromosomal site between the Pc20g07090 and Pc20g07100 genes 294. All twelve biosynthetic promoter-reporter path-ways were obtained in P. chrysogenum transformants and were verified for correct assembly by PCR analysis (data not shown).

3.2. GENE COPY NUMBER ANALYSIS

In order to determine whether the promoter–reporter pathway integra-tion events were correctly targeted to the intergenic region between Pc20g07090 and Pc20g07100, genomic DNA was isolated from the new P. chrysogenum promoter strains and used in PCR reactions to validate the correct insertion (data not shown). However, in some cases, clonal isolates from a single transformation harboring the same promoter– reporter pathway showed large differences in the RFP fluorescence signal whereas this would not be expected for single copy transformants. To further investigate this phenomenon, isolated gDNA was used to perform quantitative PCR analysis on the GFP and RFP genes to determine their copy number, using the γ-actin and the niaD gene as references for single copy genes 6. For most promoter–reporter pathways, single copy integra-tions were observed at the expected locus, some of the pathways showed

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

64 65Results Promoter-reporter pathway fermentation analysis

increased copy numbers of integration of up to two. However, the ratio of the GFP and RFP gene copy number was always one (Figure 2). This suggests that in individual cases, a double integration of the introduced pathways had occurred. However, since the GFP to RFP ratios remained the same, these transformants were further used for comparison of pro-moter strengths and expression profiles.

Figure 2. Quantification of the copy number of the GFP and RFP genes in  P. chrysogenum trans-

formants bearing a promoter–reporter pathway. Gene copy numbers vary from one to two. Strain

DS68530 was used as a control that does not carry the GFP and RFP genes.

3.3. PROMOTER-REPORTER PATHWAY FERMENTATION ANALYSIS

The BioLector 48 wells fermentation system with online monitoring was used to assess the differences in promoter expression strength of each of the promoter pathways. For ten pathways, two biological replicates (individual transformants) were analyzed as well as two technical rep-licates each. For filamentous fungi, the mycelial biomass is either freely dispersed throughout the medium, or aggregated into clumps. Therefore the correlation between the optical density and biomass concentration

is only linear during the exponential growth phase 300. Biomass devel-opment was followed during 180 h and showed the same trend as the growth curve of a unicellular organism, but as expected differences were observed between the biological replicates due to the aforementioned filamentous fungal growth behaviour as exemplified for the intermedi-ate A.  niger 16g01830 (gpdA) (Figure 3A), and stronger P. chrysogenum 21g21390 (pcbAB) (Figure 3D).

Figure 3. Development of biomass (A, D), RFP (B, E) and GFP (C, F) fluorescence in time during

growth of P. chrysogenum harboring the promoter pathways of A. niger 16g01830 (gpdA) (A–C), and

P. chrysogenum 21g21390 (pcbAB) (D–F). Data shown is for two biological replicates (individual trans-

formants) analyzed as two technical replicates. Growth was in the BioLector system, and biomass was

monitored by light scattering at 620 nm.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

66 67Results Discussion

Fluorescence was measured over a period of up to 180 h. An increases in the expression of the internal reference RFP was detected around 20–30 h, when the glucose repression on the PcPAF promoter was re-leased, and increased linearly to 80 h when it reaches a stable plateau (Figure 3B and E). GFP gene expression showed a similar trend for the technical replicates while in some cases differences were noted between the biological replicates per promoter–reporter pathway although trends

were similar (Figure 3C and F). For instance, with the promoter of the Pc21g21390 ( pcbAB) gene that drives the expression of the α-aminoadipyl- cysteinyl-valine synthetase involved in β-lactam formation, the expres-sion increased exponentially after the first 20 h of growth, then became more stable and in the stationary phase declined again (Figure 3F). Sim-ilar trends were observed for other transformants and this likely reflects a complex regulation of the promoters during the shift from glucose to lactose- based growth until the final depletion of sugar after about 80–100 h of fermentation. Based on these observations, we decided not to include the first and the last 40 h of analysis to catalogue the various promoters in order to have most comparable biomass development and reproducible measurements.

Using the RFP signal generated by the PcPAF promoter as a control, profiles of promoter strengths were generated for each of the tested pro-moters during growth (Figure 4). By taking the ratio of the GFP and RFP fluorescence, differences in growth or other variables in the analysis are eliminated. The promoter strength was analyzed in a time window of up to 180 h of fermentation. The results show that the various promoters cover a broad range of GFP/RFP ratios expressed in a log scale from 0 up to 2. There is more noise in the analysis during the first 100 h whereupon signals became more stable. All heterologous promoters were found to be functional in P. chrysogenum.

A box-plot graph of two smaller time windows with an average time of 40 h each was used to further catalogue the differences in the strength of the promoters (Figure 5). In this analysis, the newly investigated Pc20g15140 promoter appears to be the strongest and active in the vari-ous growth phases, while the An02g10320 promoter is the weakest. The An04g08190 promoter shows a similar strength as the highly express-ing Penicillium promoter Pc21g21390 (pcbAB) 4. The Pc22g16370 and Pc21g21380 (pcbC) promoters showed about 2-fold higher transcriptional activity compared to the A. niger gpdA promoter.

4. DISCUSSION

Many efforts have been made to improve the industrial production of pep-tides and proteins with antimicrobial activities 301. One of the approaches that has been used and it showed various successes it is the production of heterologous proteins by filamentous fungi 302; 303. In biotechnology, the main producer of β-lactam antibiotics P. chrysogenum is regarded as safe

Figure 4. Activity of a range of P. chrysogenum (A) and A. niger (B) promoters in time during fermen-

tation in the BioLector system. The promoter activity is expressed as the logarithmic values of the

averaged GFP/RFP fluorescence ratios of two technical replicates. For Pc20g15140 and Pc22g16370,

only one biological sample is shown.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

68 69Discussion Discussion

by the United States Food and Drug Administration and the existence of a well-established technology for large-scale fermentation makes this mold an interesting platform for recombinant antifungal protein produc-tion 275; 304. However, gene expression is a multifaceted process and the factual protein production depends on many aspects in this chain such

as transcription, translation, folding and degradation and often also ex-cretion. The most controllable aspect of gene expression is transcription, i.e., the production of mRNA. One of the prerequisites to build a gene expression system is the availability of suitable promoters.

Here, we have analyzed six constitutive promoters from A. niger, namely An02g10320, An04g06380, An04g08190, An07g01960, and An11g02040, An16g01830 and four from P. chrysogenum, Pc16g00620, Pc16g11100, Pc20g15140, and Pc22g16370. For benchmarking, we added to this set, two P. chrysogenum promoters that drive the expression of genes involved in penicillin production, Pc21g21380 (pcbC) and Pc21g21390 (pcbAB) 305. For each promoter, a reporter-expression system was constructed in which the GFP/venus gene was placed under control of one of the se-lected promoters. For comparison and internal calibration; we also in-tegrated into the same expression cassette the gene encoding the RFP protein with the microbody targeting sequence, SKL, under control of the PcPAF promoter. This allowed us to use the GFP/RFP expression ratio as a measure of the strength of the tested promoter. By rationing, poten-tial interferences by variations in growth are eliminated which is one of the main difficulties with growth of filamentous fungi. However, this also allowed us to deal with variable gene copy numbers. Although most con-structs were integrated by single recombination events into the genomic intergenic region between Pc20g07090 and Pc20g07100 genes, a couple of constructs showed a double integration as confirmed by gene copy number analysis. This was unexpected as the strain used for transforma-tion, P. chrysogenum DS68530, lacks the hdfA gene involved in the non-ho-mologous end joining recombination system (NHEJ) 306 and thus only the targeted integration event should occur with high efficiency 184; 307. It is not clear how such double integrations may have occurred. Possibly, in the ∆hdfA strain still some random integration occurs. Alternatively, the marker AmdS may have stimulate multicopy integration due to the way of selecting. The presence of a multicopy marker might have a growth advantage of a stronger phenotype under selection conditions.

For the internal control the red fluorescent protein RFP, a promoter of one of the most intensively studied antifungal peptides, PAF from P.  Chrysogenum was used 289. This protein is produced in high amounts and has severe effects on target organisms such as growth inhibition, in-terference with cellular metabolism and promoting oxidative stress and apoptosis 308; 309. Significant sequence homology (42%) of PAF is detected with the antifungal protein sequence of AFP from Aspergillus giganteus 310. While the afp gene and it expression were studied in great detail also

Figure 5. Ranking of the strength of 12 promoters (including biological replicates) during the time

window of growth in the BioLector system from 40 to 80 h (A) and 80 to 120 h (B). The promoter

activity is expressed as the logarithmic values of the averaged GFP/RFP fluorescence ratios of at least

two technical replicates.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

70 71Discussion Discussion

the expression of the paf gene has been studied 276; 311. The paf promoter contains a TATAA box, four PACC motifs and two CCAAT consensus se-quences for the binding of a HAPlike complex 312; 313. The paf transcription and protein yield is maximum during the growth phase after 70–90 h of cultivation 276. Its expression is regulated by carbon and nitrogen catabo-lite repression 276. In the paf 5′-upstream region, four putative CREA and two GATA factor binding sites are present which might play a role in gene repression in the presence of glucose and nitrogen, respectively 314.

In this work we used conditions that are relevant for industrial produc-tion of β-lactams as a medium containing only small amounts of glucose while lactose was the key carbon source. Thus, the expression of the RFP protein occurred once the glucose was depleted from the medium. This meant that during the early stages, RFP is low expressed resulting in the peak in the GFP/RFP ratio in the first 20 h of the fermentation (Figure 4), but a stable expression signal that increased with growth was obtained during the time window 20–100 h, followed by a plateau accordingly with literature studies 311; 314. An analogous behavior was observed for the pcbAB and pcbC promoters that are also glucose repressed. Most pro-moters showed a similar expression trend over time with characteristic features. The fluorescence levels increased in time consistent with the increase in biomass. However, there are two phases related to metabolic changes, i.e., the depletion of glucose followed by the consumption and exhaustion of the lactose (Figure 3). As discussed above, the depletion of glucose has a strong effect on the RFP expression and hence on the GFP/RFP ratio, but to a much lesser extent affected the expression of most tested promoters although a small bump is observed in the GFP expression. Also the depletion of lactose caused with the majority of the promoters a small decline in expression followed by a recovery phase (Figure 4). Because of these phenomena and for classification purposes, we analyzed the promoter activity in smaller time windows. The first and last windows, i.e., 0–40 and 120–160 h are less reliable because of the glucose repressing effect on the RFP expression and the death phase, re-spectively. Therefore, these periods were not included in the analysis. In the period of 40–120 h, a much more stable classification was obtained although small differences in the time dependent expression profile re-sulted in slight alterations in the ranking of the different promoters. Nev-ertheless, the promoter belonging to Pc20g15140, which is a secretory protein belonging to the cerato-platanin family of phytotoxins, appeared the strongest under the conditions tested within the indicated time win-dows, while the promoter of An02g10320 was always the weakest. These

strengths covered a dynamic range of 12-fold. However, it should be em-phasized that in this analysis the promoters of only well and medium expressed genes were included, while it was not the objective to reach the widest dynamic range and weak promoters were not included in the analysis. Importantly, the promoters could be benched marked against the well-known AngpdA, PcpcbAB and PcpcbC promoters.

Summarizing, we demonstrated the application of the BioLector fer-mentation system, for promoter strength analysis in the filamentous fungus P. chrysogenum and we provide a set of Aspergillus and Penicillium promoters that now can be used for developing a more versatile synthetic biology toolbox for P. chrysogenum and other filamentous fungi 315.

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

72 73Supplementary informationSupplementary information

SUPPLEMENTARY INFORMATION

Table S1. Nucleotide sequences of the biobricks used in this study

Biobricks Primer sequence (5’->3’) Short description

An02g10320 GGTCTCGGTGCTCCGGTTGTTGAGACTAGCCTGGCCAACCATATAGAGTTGAGT CATAATAACCTTGTCCGTTGTGCTTCCGAGCGGGTCTAGAAGCGGGGGAGAGGAT GAGACAAGGTTCATGATGAGGTGGTTACTGCTGGAGAACCGGAAAAGAACGCCAG GAGCACACCACTCCGGCGACAGGATCTCCAATGAGGCATCTGCTTCGTTTTCGTGGGG GTCCTGGATGTGTTTCTCGGTGAGGGAAGACGACAATCGCGGATCCTAACTTAGTA GTGGGGGTTTAGTCCAGGGTCTAGCTTGACCCCGCTGCTTCCCATTTATGCCAC GTCTTCTCCCTCCTCTCTCGCTTGCTTTCCTTTCCCTTCATCTTCCCATCTTCTCAC TATCTATCTTCAGTTATATTGTTTCCGAATAACTTACTTCTTCTTCCCCAACAACTTCCTC GTTAACCGTCCGGTACGACTCACAATGAGGCCGCGCACGCAGGATCAGACTCCG GGTCTTTTCGCTATGGGTTCAGATGGGTCAAGGTATCGTACAATAGTATAACAGT CACTGCTCGCGCATGACAGGTGTTCGGCTCGTGCTTCTGTTCCTTTCCTTCT G GT T TG G AC AG G AG CG CG GTCGT TC TG AG AT TATAC TGTC A A A AC T T GATCTAGATAATACTAGCGAAAGGACATGCGTGGCACTGATTGTCCCCTACTATTT GACCTACAGAAGACGAGAGGGATCTCGCATCCCTCTCTGTTGCTGACAGTTTC CAGACCTTTGCAATTACCCTCGACCTGAGTGTATCACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

An04g06380 GGTCTCGGTGCCTACCGAGGATATCAAGAACGTAGTTAGCAGAAGGGGAATG GAGTCAATGCTGCAGATTTATATACAAGTAGTAGTTGATGGTGAGATGATGG GAAGTGGTGACTAGCAAGTGGTAGGGGGGTGTAGATTAATTACCCCAACTCCTC GTGAGGGGAAGGCCAACCTCAGCCCATCCATGGATTTTCCCTCGATACTAAAA GAGTTCACCGGGGAGAGCGGGACGGGCTCATCATTTGTGGTGCGATCTGTCAAT GAGGGAATCCACGCTCCGTGATGATGACATTTGACATCTCATGTTAATCAGATAG TAGTCAATCAGTTAGGACTTAGTAGAGATATATACAATTCTATTCAAGATGCCATT GAATAAATAATATACTACGATGGAGTTGCATCCAAGGGATAATATGTGCAGCCT GCTTCTTGCTTCCTGCTTCCTGCTTCCTGCAGCTGCCAGCCATGCCATGCAAAC CAGCCAAACAAGCAAAAAGTCACCTGCTGGCAATGCGGAGGGCGTGGCCAATC CGATGCCTCCCGCGTTTCTCCCCGGAAACTCCCTACAGGACTAACTCGACTAGTC CAAAGGCAGTTCCAGTGACTCAAAAAATAAAATAACTATCGCCGACCTCGTCTATC CCGCTCGTCTACTCCCCCGATTCCAGCCTTCATTCAAGTACTTCTTGCCAGCTC CCTTGGCCCCGGCCTTTTCTTCTGATCATCTCCTCCCTGGTCTATTGGAGT GCTTGCTCATTTCCTCCTCTTCTTTCTTCTCTTCCCTGTTTTCCATCCCACCGT CAAAATGGGAGACC

Promoter used for eGFP expression

An04g08190 GGTCTCGGTGCAAGGGAGGGACCCGTAGAGACAAGACAAGAATGTTTTT TTCTCTCCTTTTTGTGACGACACGAGGGAAAAAAGGAATTGAACGGAAGGGATC GGTTCATACAAGTGTAAAATACACACACGACTACGGAATAATCCCATCAGATGCAG CAATGGGTTATCTGAAGGGGAAGGAGATGTGTGAGTGAATGAGAGAGTAAGC CAATGCTCCATCGCGGACCAGCACGGTCAGGTGAAGACCCTGAAACCATTGGCT GTACCAGTAGTAACTCCCCTGGTTACCCCCATCCCGAGTGATCCCGAAGGGTGTG TATGTGTGTATGTGTACACAGTATGTGTAAGGAAGTGTGGTAAGTGTGTATGTGCG GTGGAATGCCCACTGCTTTCCCGGGGGAAGGAAAAAGGATGATGAGCCAAAAAC GAGGCGCCAAACACGGTGTAAGGGAAAAAGAAGGGAAAGGATAAACTAGGGA TAACGGATGATACCAAAGACAGACACAAACAGGAAAAACAGGAACAATACAATA CAAACAAACGGTGCCAAAACACCAAACAAAAAAGTAGGTAGGGCTTTTTTTTCT GGTCCCAACAAAGCGCACTAACACCCGACGGGGGGGCTGGGTGGGAAAAGGG CAAAAAACCGCGAAAATTTAGCGGGAGAGTATTTATGTCCCGGGGGGCCTTCT GTTGTCACTTTTCCTCCAGCTTTTTCCTCCAGAAAAGTTCTCCTTCCTTCTTTC CCTTCCCAATCCCATCATTTTCTAGAGAAACTCCTCTCTCAGAACCACCACACAC CGTCAAAATGGGAGACC

Promoter used for eGFP expression

Biobricks Primer sequence (5’->3’) Short description

An07g01960 GGTCTCGGTGCAGTGGTGCTACTCCGAGCAGGCAATACTTTGATGCGGAAAAG GAAACCGTCCCGCAATCCCAATCGGGATGGATAGCCACAGTCAAGCCACCCGAG CAATGACACCAGCCACACAGAGCGATCAAGGGGCAAAAAACGTTGGGGATTCAAC GAATGGTTGAACTGTTCTGATTGGTGGTCCGCTCCCGACCTTACCCAAAGCGG CAGCTTCTGGCCGAGCAGCGCCATCGAATCAGAGGGAGCCCAACAAGCTTAGTTG GAGGAACAGGCGGCGCTGTATGGTTGGAGATACTCCGGCCATTTGCCATCGCG GATACACTCTGCCATCCGGACACCTTCCAGACGTGCCTGGATAATACTGTGGTAG TAGTCCCCTTCCTCACGCTCCCTTTCTTGTGTCTGTTGAACCGTCGGCCACTTTGG GACCTCGGGATCTCATGATTACTTCACTGATCTACCAGTGAACTTGCCGTCAGGCCAC CCTTCTTAACTTATTCCATGCGGGTGTCCTCATAGTCGCATCATTATCATTGATTGTC CGCCTTGCTTTTCCCCAACCATCATCCGCCGGTGGACCCTGGTAGAGTTCAACT GCCTCCGAATTTTCCCTCCTTCACTGGCTCAGATCTGCCGCTTACTTCTTCGG CCTTTCGATTGCATTCCCCACCCTTTTTCTCCGTCTATTTTTTATCGCTCGCCTC CGGCTCTTATCTTTAAACCCACCCTCTCCCGCACGCATCCTTCTCCTCCTCATC CGAACCATACTGCAGGGGTCGACAATACACACGAACACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

An11g02040 GGTCTCGGTGCTCTTGCGTTACGGGCGTATTTTGCTGCGGCCGGTGGTGCCCCTC CATGCCCCGCCATCTTTCAAAGCTCCTGGCGACGCCGTCATCTCCGAACATTCTC CCCCCAAAGGAATCAATTGGCAATTGGAGTCTAGTAAAGTGGTGTTTGTCATCAGTA AGGAGTTGGTGAAACTACAATCTTCCATCATGAAGAGAAGGGATATTTTTGGG GTTGTATTTTACGATGAAGGTACTGGAAATGGTGGGGGTTTTTATAGCAGTAG ACAGTCAGTCAGTAAGTAGTATGCTTGTTGTATTACCCAAACCAGATCAATC CAAAGAAAGCCTGACAGACAGCCATCAATAGATACTACTTCGTACTATAGTTAC CCACCTAACCATATTACTCAAAAAGCATCTATCTATCCGCGGGCTTCCATGCATGTC CCGGTAGCAAACTCCTCCCACCGGTGTAGTACTCTTTGGTTAGTAGTCTTGTTCACCG GAGGACTCTGCTCCTCTCCTGCTCAGGTGCTGCCCCGCCCTCCGTCCCACCATGAC GGAAGAGATGCTCCGTAAGCCGTCCAGTTGCAACGAATCCTGCTCTGACATCTTC GAACGCCTTCTCCCTTTCGCTCGCTTCTCTGCCTCTTTCCTCTCTTCCCTTTCCTTC CCCTCCAAACTAAACCTTCCTCCTTTTCTCCATCATCCTCTAGGCAGTTG GTTCTTCCTGACTGTACATATATCCACCACCTCCCCCCTCTATTCTTCCACCTCTTC CATATCTCCTTCTCCAGAGTTCATACCCCCCACACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

Pc16g00620 GGTCTCGGTGCAACTCTCTGGAAATGAAGGCAGCCCCGAAGTTTTGGGATACTAG CGATCCTAGGCACTGCACCAGTCTTGAAGAGGGTCATCTCTCCGGAGATTAGTC CATCTGTGGCATTGTTTATACTTTCACACCTCCAGAACAACATGGAAGTCAAG GAATGTGGTATCAGACTCACAACCAAGAGATTTCTCACCAAAGCGCTAGTTCCAAG GCAGGTCTAGCGTGCTGACGATGGGGATAATTTAGCCGGCTAATTGGTGGACATC CGCCACCACCCCAGATTAAACGGTGGAGATGACAGGGGGCGGAGATTCAACGGGA TTAAATATCGGAGATGAAGACTCGGCATCTGCTTGAGGCAGTTAGTGCTTGATGCA ACTTGTGGTCGGTCGAAGCGATTGGCATGGTGATCAACGATCGGATAATAAGACCTCCCATGTG CCTCGGGGGATATTCGATCCGCCTGCTGAAGAGAGTAATGATGGACCTGATACTTG CAGAATCTGAACTGAAGCCCTTGACTAGCGCTGGAACTAAATTTCAAGCTAACGGT GATGCAGCAGAAGGATGACGATCTTTTCCTAACGGATTTCTCCGCAGACCCCCGAG CGCATTCTGCAATACCATGCACCTTTCATGCACCTTTCATGCAAGTTCCATG CAACTCCCACACATGTGCATTAATATGCCTTAGCTCTCTCGAATGAACTTTCACGT GGCTTAAGTCCCCTCACCTGCACCCATATAAAAGCCAAGTTCTTCCCCCACGATGA CACCAACCCCAACTCACCTTCCACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

Pc16g11100 GGTCTCGGTGCACCGCGGACTGCAAATATTAATTACCCAATGGCACTCAGCG CCTGTGGTTTAATTCATTAATGTTGAAGCTTGAGGTCATAGTGTGTATAGCCCTG GAGCTACCGAGTGGAAACGATACAGGACAGGTTACAGCAAATGGACGGACAAC CGACTTGAATATATCAGCTACTCTCATAATGATGATCGAGTGCCGCACCTCTTC GCCAGGTGTTGAAAATACGTTTGTTCCATGGATGTATCAAATCAACGGAATGC CCAGCTGTATACCGCAGATACCGATGTGTTTGAGGCGGTTCTTTGCATACCTAAT CATGGGATGTTGTCAAAATAAACGCTAGTCATGTGACAGCAAGCGCTTATCAA TCTGCACCGGACTAATGTTCTTCCGCCGCATTTGTTAGGTTTAACAGCACTA AAGAAGATGGCATCGTACTCGACCAAATAATGTATGAGATACATGAGAGACTA GAGGGTTATAGTAGTTCTAATTGAATCGGATGATATAATACAAATCTAGGATCT CAACCCTTTTAAGTACGGAAACCTTGGACACAAGCGCCGTAGCCGCTTATCGATC TATATCGGACTAACGTTCTTCCACCAGCATGCTCCTGCATCACGTGCTCTCTG GCCATCGAACCGAGCAAATCCTCACCGCCATGGTTGTCACCGCCTTCCCAAGC CAGATCTCTCCCCACGTGATCTTGTCATCCCGATCCTCCGAAGTCGAACGCTTC CAAACTCACCCGAACCGTTTTCACCCCTTCAATCGAACCATACCTCCCACATCAC CGTCAAAATGGGAGACC

Promoter used for eGFP expression

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

74 75Supplementary information Supplementary information

Biobricks Primer sequence (5’->3’) Short description

Pc20g15140 GGTCTCGGTGCTACTTGAGCAACATCATACGTCAACTAATTGGCACTCT TACTTTATATCTGATATGTGGTCATTGCACTAAGTAATATAATTGTCCTCGTCTAT TCAACAAGCATGTCTCCGTGGCGCAATTGGTTAGCGCGTCTGACTGTTAATCAG GAGGTTGGAAGTTCGAGCCTTCCCGGGGACGTTTCTTTTTTTCCCTTCTTTTTTTC TACTCATTAGACAGCTACTTTGTCCTTTTCTTTTTTTCTTTTGGTTTATTGAGGT CAGCTTATTGATATAATATTACATTGTGATTCAAACTCAGACGAAAATAAAATGT GGCTATGGTTATGTCCGCTCGGAGTATTTCGATGCAACCTCGGATGCAGTTGC CCTATACCGTCGCATAGCGGGAGTCGCGCTGTTCTGTGGGTCGACCATGTAATGTA ATGCTTCTGCAGATCTCGTGGAAATGGCAGCCAAGATATACCATGTCTCAGCCTG CCTGCATGCTTCCTCGTGGACCCCACAATAGTCCTCGGCCTTATTGCACCGGTTTCT GGAGGGGTATCTATTATGGGAGTATCGGCTGACGATGGGCCTGGTATGAAGG CATCCTATTTGGGCCGTGTCACCTGTGAGTCTAAGACCTTCTTCTAAGACCTGCAA CAAACGCAGCCTGCCAGTAAAGGGAAATAGAACAATATTAGACGGAAGCCTGTT GAATGGAGATATATAAACCTCGCCGGGGAGGGGACAAAACGTATACAACTAGCAAC CAAAATATTCCACACTCTCTCAAAGTATCATCAATTCCACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

Pc21g21390 GGTCTCGGTGCCTTACTGGATGGGGCCGCTGGAGCCAGTGTAAAATTAGTAAC CGTATCTCGAAGTCGGAGGGTCTTTGGTGGTCTGAGATTTCAGTCGGTCCGCAC CGTGGCATTTGCAGACGGTGCGATCAGGCCAATCGTTGATGCTCGGGCAGAG CAACACTCCCCCGCTCGAAGACTAGTAAGTACTTATCATTACCGTGCCAGAAAAC GGGGCCATAGATACCCAAGTAACACCGTCGAGTCAATCGGGCTCGTGGGCCCAG CCAAGCCACGAGAGAGTAGGCAACGTGCACTCAACGACGGCGATGTTCCAAGG TAAACCGGCACGTAGAAAATGTCCGGACCACCTTGGCTCTCGTTGCAGCGTGTT GAATCTTCAGCCACCGTAAGTCGATAGCATCCGGTTAGAGTGCAACGTGGGTCT GTCTCATTCTTCTCGGTTCTTGGCACCAGAATCGGGCGTAGTTTGCCCACTGC CAAGTCGCGGGGCCGCTTGGCTGTCCCTGTGGTGGGATTTCCCGATGCAACATG CAGATACATGTAGTCGACAGTTGACAGAGCCAATGGCATCGGATCTGCCCTAGAC CGTGCTAGACGAAAGTCTCCATCTTGTCTGCGGGCAGTGCTTCAGTCGCCCAGAT TCTCGATGGAGATTGGCCAGGTCAGCCATATATACCCTGCAATGGCAGACCAATG CAGCAGGCCCAGTATAAGGAATTCCCCTCGAGCTTGTCTGTGATTGCGTTTTTTCTA ACACTTGTTGTTGCATCCGATCCGTCCCTACCAATTATTGGTCCACCGTCAAAATGG GAGACC

Promoter used for eGFP expression

Pc22g16370 GGTCTCGGTGCATGGTATTTTGGCCGATTTAAGGTATCAAGAAGATCGCCTCTCATA ATATGGCCTATGGAATACTACCTCAGGTAGCTACCTAAGACACAAAGCGGAGGT GACTAACCGGATATTTATAGATTTCCAGATCGAGTTCATTTTCATTGTTTATGTTTA GAGAATGAGGAAAAGTAAATAGACTAATGTAAACAGTTAGAATCATTCTCCAAT TATTTATTCTATTCTCAAACCGATCAAGTCCAAGCAATTTCCATTGAAATTTCCTTA ATTTCCAAAGAGAATCGAGACAGTCGATTTCCAGGGGGCCCGGACTCCACTGCG TATCTGCCACTTTTCCTCCTTTTTATCTTTCCCTCTCTCTCCTCCTCTCTTTCAAACT GTC A ATC T TATCC AC TC T T T TAT TC T T T TC T T T T TAT TG AT TG AT TC T GTCTCTTGTTTCTTTTTCCAGCCTGGTGCTGTCTTTTTCTCTCGCAAGGAGAT TCTTTTCTTTTGACTCCCAACCTCTTACCATCCCCACGGATTGTCTCTGAAC CCACTCCGGTTTTAGGTACTGTAATCCTATTATCTTTCTATGTCTTTCTTTTATATC GCTCTATTTCATTGCCACATGCAGTCACACCTGTCGTTCCCACACTAACTAACCG CAGTCACTCCTTCCCGTCCGCCTCGTTCAGGACCCGGCAATCAACAACTCTTATATA CAAGCGCATCGCTCATCACCCATCGCCATTCCCTCTTTTTCTTCGATTATTTCATAC CAATTCCATTCCACAGCCTAACCCAATCCGCACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

Pc21g21380 GGTCTCGGTGCGTCGACTACATGTATCTGCATGTTGCATCGGGAAATCCCACCA CAGGGACAGCCAAGCGGCCCCGCGACTTGGCAGTGGGCAAACTACGCCCGATTCT GGTGCCAAGAACCGAGAAGAATGAGACAGACCCACGTTGCACTCTAACCGGAT GCTATCGACTTACGGTGGCTGAAGATTCAACACGCTGCAACGAGAGCCAAGGTG GTCCGGACATTTTCTACGTGCCGGTTTACCTTGGAACATCGCCGTCGTTGAGT GCACGTTGCCTACTCTCTCGTGGCTTGGCTGGGCCCACGAGCCCGATTGACTC GACGGTGTTACTTGGGTATCTATGGCCCCGTTTTCTGGCACGGTAATGATAAG TACTTACTAGTCATCGAGCGGGGGAGTGTTGCTCTGCCCGAGCACAACGATTGG CCTGATCGCACCGTCTGCAAATGCCACGGTGCGGACCGACTGAAATCTCAGAC CACCAAAGACCCTCCGACTTCGAGATACGGTTACTAATTTTACACTGGCTCCAG CGGCCCCATCCAGTAAGCATCTGGGCTGCAAGCGTATAATGTCTCCAGGTTGTCT CAGCATAAACACCCCGCCCCCGCTCAGGCACACAGGAAGAGAGCTCAGGTC GTTTCCATTGCGTCCATACTCTTCACTCATTGTCATCTGCAGGAGAACTTCCCCT GTCCCTTTGCCAAGCCCTCTCTTCGTCGTTGTCCACGCCTTCAAGTTTTCACCAT TATTTTCACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

Biobricks Primer sequence (5’->3’) Short description

An16g01830 GGTCTCGGTGCTAAGAATGGGGAAGGCGAAGGTACCGCCTTTGGGGTCCAG CCACGCGACTCCAACATGGAGGGGCACTGGACTAACATTATTCCAGCACCGGGAT CACGGGCCGAAAGCGGCAAGGCCGCGCACTGCCCCTCTTTTTGGGTGAAAGAGCT GGCAGTAACTTAACTGTACTTTCTGGAGTGAATAATACTACTACTATGAAAGACCG CGATGGGCCGATAGTAGTAGTTACTTCCATTACATCATCTCATCCGCCCGGTTCCTC GCCTCCGCGGCAGTCTACGGGTAGGATCGTAGCAAAAACCCGGGGGATAGAC CCGTCGTCCCGAGCTGGAGTTCCGTATAACCTAGGTAGAAGGTATCAATTGAAC CCGAACAACTGGCAAAACATTCTCGAGATCGTAGGAGTGAGTACCCGGCGTGAT GGAGGGGGAGCACGCTCATTGGTCCGTACGGCAGCTGCCGAGGGGGAGCAG GAGATCCAAATATCGTGAGTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGACT GCTGGGGAACTGGGGAGCGGCGCAAGCCGGGAATCCCAGCTGACAATTGAC CCATCCTCATGCCGTGGCAGAGCTTGAGGTAGCTTTTGCCCCGTCTGTCTC CCCGGTGTGCGCATTCGACTGGGCGCGGCATCTGTGCCTCCTCCAGGAGCG GAGGACCCAGTAGTAAGTAGGCCTGACCTGGTCGTTGCGTCAGTCCAGAGGTTC CCTCCCCTACCCTTTTTCTACTTCCCCTCCCCCGCCGCTCAACTTTTCTTTC CCTTTTACTTTCTCTCTCTCTTCCTCTTCATCCATCCTCTCTTCATCACTTC CCTCTTCCCTTCATCCAATTCATCTTCCAAGTGACTCTTCCTCCCCATCTGTCCCTC CATCTTTCCCATCATCATCTCCCCTCCCAGCTCCTCCCCTCCTCTCATCTCCTCAC GAAGCTTGACTAACCATTACCCCGCCACATAGACACACCGTCAAAATGGGAGACC

Promoter used for eGFP expression

eGFP GGTCTCGaatgAGCAAGGGTGAAGAACTCTTCACTGGTGTTGTTCCCATTCTTGTT GAGCTTGACGGTGATGTCAACGGCCACAAGTTCTCCGTCAGCGGTGAGGGC GAGGGTGATGCCACCTACGGCAAGTTGACTCTCAAGCTGATCTGCACCACTGG CAAGCTTCCTGTTCCTTGGCCCACCCTCGTCACCACCCTCGGATACGGTCTGCAGT GCTTCGCTCGTTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCAT GCCCGAGGGCTACGTGCAGGAGCGCACCATCTTCTTCAAGGATGACGGCAAC TACAAGACCCGTGCCGAGGTCAAGTTCGAGGGTGACACCCTCGTCAACCGCATT GAGCTGAAGGGTATCGACTTCAAGGAAGATGGCAACATCCTTGGCCACAAGCTG GAATACAACTACAACTCTCACAACGTCTACATCACCGCCGACAAGCAGAAGAACGG CATCAAGGCCAACTTCAAGATCCGCCACAACATTGAGGATGGTGGTGTGCAGCTG GCGGACCACTACCAGCAGAACACCCCCATCGGTGATGGACCTGTGTTGCTCCCCG ACAACCACTACCTGTCCTACCAGTCTGCTCTCTCCAAGGACCCCAACGAGAAGC GTGACCACATGGTCCTCCTCGAGTTCGTCACTGCTGCTGGTATCACCCACGGAATG GATGAGCTGTACAAAtaaaGGAGACC

eGFP enhanced Green Fluorescent Protein (Venus)(Aequorea victoria)

Anid_AN4594 terminator sequence

GGTCTCGtaaaAATAGTTCATATTCCACTCTGGAAGGAGGGAAATGAACTGGC GCCCGCATCAACCCTTAGCTGGGTTCATGACGGTGTGGTTGTCGATGGGCTTG CAGAAGATCTAGCAACGCTGGGTCGACTTCGATACCCGTTAAAAACAGTCATA AAAATGGAAGAGTTGCAAAGCGTATACTATATATAGCTCCTATCGCTTTCGTATTGT GACTTAACTATTGTAGAGCCTGGTAGAGAAGAGTAGAACACTTGACCGCAT TATATCTGGTATTCTACAAAGCCAGTGCACCCTCGGCTAACAGAcctcGGAGACC

Used as terminator for eGFP (A.nidulans terminator, possible ribosomal proteins S10a)

3 3

New

pro

mot

ers

for s

train

eng

inee

ring

of

Peni

cilli

um c

hrys

ogen

um

76 77Supplementary informationSupplementary information

Biobricks Primer sequence (5’->3’) Short description

Pc24g00380 Pc Paf.pro

GGTCTCGGTGCACTTTTTTGGTCCTGATTGAAAATGGTAGCGTGGTCTAGGA GAGGTGAAGGAAGATCTAGCACTGCTTGATAACGGGTGCAATTGTCCAGTA AAGAAAGGCGTGCCTATCGTGCGATTGAAACAGAGAGCGGATGATATGTGGCG GATCTCCCAGTACAAGGCATGTTACATCTCTCCCCTAGTCGTAATTGCAAGGAT CAAACGTTGGGTCAATGGAATTCAGAGAGCTTTTCGTACGAAGTGCGTAATGTAC GTAGCATTTTATGGTAGCATGCAAAGCACATTTTGCTGCAACCCCAATTTAATGC GGTCCTGCTCAATAATTGATCTGCACTAAGGCCTTGGCGATGGGGCCAGAAAAG GGTTGTTCAGTGGTGTGTACTCCGTAATGGTCAAGCCGATTTCGAGAATGACCG TAGTGTTCATTCATCAGTGCGATATTAAATCAGTTAGCTACTCTATCTGAAAGCTA ATAAATTTCTTTACCACTAACAATACTCTTCTCTGACTGAAAGTACCTTTTC CACTCCCCTCATACTTCATGTTTTAAGCTCAACCGTAGGAAAGCCTGTATATCT TAAAAGATTTGGATTTACTCTTCCAGCGCTTACTGTCTGCTCTTTCGGCCGAGC GAACCTTGGCAGTATGATCGGACTATGTACTTTGTTACACAAAAGGAGAAGCGGG GCTGCCACTGAGGACAACCCCTGTTCAAGGGCTAGCATCCCGCTGTAAGCCCAC CCATCCCACCTTGAAGTATGCAACTTTTGACCGCCTAGACCATGTGAGCTTAT GTTACTGAAATACTACCCGCGAATCATTTCCTAATTTGCTTTGGCTCGAATCCAC CCCAGCCCTACGTAACACAACCGGGAGCTGCCTTACAGCTTGGCTGTATCACAG TATCACATAGATACATACATAGTATAGTGCCTTTGCCTTTTCGACCTATAAGCATCCG CCATATGCTAAACCTTCTCATATACCAACATTTTGGATTTGGAGATCATTTCCTAGT GAAACAACTTTATCAAATGCAATGCAGCCATCGTCCTTTGCAGATCCGAGTGGC CCAGTCACCGTGTCAACGTGTCAGCCGTTTTCTCTGCTTTTTAGGAAATGATTAC CACTAGGTAAGCCCAAAAATATCTTCCTGGTAAACAAGTAGTGCATCTTACCCCG GAGGCTGAAGCAGGTAAGGGATTTTGGAGAGAGCCCACCCGTAAGAATATACCAG CCAAGAGGTCCAGTATCCTGAAGTATGTGAGGCATTAATGTCATTGGAGAAGTCAT GCAATCCATAAGCTGCCACCCCCAAGATGACTGCATTGGACCTGAGCATTGTATGT GTCACCTTTCACACAGAGCTCATGATCTGGTTTATAAAGGCGGCTTCATGACCCT CAATTCCATATAGTATCACTCCCATCACAGCATTTCGATATCTTCAACCACTTTA ACCTTCTCCAGAGGATCATCATCTCAACACCGTCAAAATGGGAGACC

P.chrysoge-num promoter sequence Pc24g00380 antifungal protein precursor paf

DsRed GGTCTCGaatgGCCTCCAGCGAAGATGTCATCAAGGAGTTCATGCGCTTCAAG GTCCGCATGGAAGGATCCGTCAACGGCCACGAGTTCGAGATTGAGGGTGAGGGT GAGGGCCGCCCCTACGAAGGCACCCAGACTGCCAAGCTCAAGGTCACCAAGG GTGGTCCTCTCCCCTTCGCTTGGGATATCCTGTCTCCTCAGTTCCAGTACGGCTC CAAGGTCTACGTCAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTTTCTTTC CCCGAGGGTTTCAAGTGGGAGCGTGTCATGAACTTCGAGGATGGTGGTGTTGT GACCGTTACTCAGGACAGCAGCTTGCAGGATGGCTCTTTCATCTACAAGGT CAAGTTCATTGGTGTCAACTTCCCCTCCGACGGCCCTGTCATGCAGAAGAAGAC CATGGGCTGGGAAGCGTCGACTGAGCGTCTGTACCCCCGTGACGGTGTTCT CAAGGGTGAGATCCACAAGGCTCTCAAGCTCAAGGACGGTGGTCACTACCTTGTT GAGTTCAAGTCCATCTACATGGCCAAGAAGCCTGTGCAGCTGCCCGGATACTAC TACGTGGACTCCAAGCTTGACATCACCTCCCACAACGAAGACTACACCATTGTT GAGCAGTACGAGCGTGCTGAGGGCCGCCACCACCTCTTCCTGACCCACGGAATG GATGAGCTGTACAAGTCGAAACTAtaaaGGAGACC

RFP (Red Fluorescent Protein) from Discosoma species with a 12 aa

‘SKL’ tag for peroxisomal targeting. Codon pair optimized for ex-pression in filamentous fungi

Anid_AN7354.ter

GGTCTCGtaaaTAAATGGTTTGCGTTGCGATTGACTGAAACGAAAAAAAGCGAAAAT GATTCTGGGAATGAATTGATAAAGCGCGGGCTCTGCGGTACGGTTACGGTTGCG GTCGCGGACGAATGGACTGGGCTGAGCTGGGCTGGAGGAAGTCCATCGAACAAG GACAAGGGGTGGAATATGGCACGGGTCGATTTTGTTATACATACCCTACCATC CATCTATCCATTTAAATACCAAATGAGTTGTTGAATGGATTCGCGGTCTTCTCG GTTTATTTTTGCTTGCTTGCGTGCTTAAGGGATAGTGTGcctcGGAGACC

Used as terminator for DsRed (A.nidulans terminator from possible ribosomal proteins L32)

Table S2. Oligonucleotide sequences used in this study

Oligo Primer sequence (5’->3’) Purpose5-5 IGR AAGCGACTTCCAATCGCTTTGCATATCCAGTACCACAC-

CCACAGGCGTTTCTAGGCTAAGGTCCGTTATCForward for 5’ IGR cassette

a-5 IGR AAAGCAAAGGAAGGAGAGAACAGAGGAGTACTTGTAC-GTTCGATGGGCAAGACTAAATCGGCTACTAGGC

Reverse for 5’ IGR cassette

d-3 IGR AACGTTGTCCAGGTTTGTATCCACGTGTGTCCGTTCCG-CCAATATTCCGCGATAGGTCTTCGGAGATAGAAG

Forward for 3’ IGR cassette

3-3 IGR ACTTAGTATGGTCTGTTGGAAAGGATTGTGGCTTCG-CATACAGGCTTTCTGATTCTCGTCGGAAGTACG

Reverse for 3’ IGR cassette

b-Amds CGGATCGATGTACACAACCGACTGCACCCAAACGAACA-CAAATCTTAGCAAAGCAGGCTCCTGGATCC

Forward for amdS cassette

c-Amds CAACAGGAGGCGGATGGATATACTGTGGTCTGGAAGAT-GCCGGAAAGCGTGTACCGCTCGTACCATGG

Reverse for amdS cassette

A ACCTAGGCTAAGGTCCGTTATC Forward overlap GFP fragment

B AGGGCATCAAGCTCACTAAC Reverse overlap GFP fragment

C TCCGCCTCTTCACCAAATCC Forward overlap DsRed.SKL fragment

D GATTCTCGTCGGAAGTACGGC Reverse overlap DsRed.SKL fragment

5 IGR fw GGATCCGGTCGCTAATATCG Forward integration site check, overlap GFP fragment

GFP rv GGTGTCACCCTCGAACTTG Reverse integration site check, overlap GFP fragment

DsRed.SKL fw GCTTCAAGGTCCGCATGGAAGG Forward integration site check, overlap DsRed.SKL fragment

3 IGR rv CTACCTCGTGGGATAGTCAG Reverse integration site check, overlap DsRed.SKL fragment

γ actin gDNA fw TTCTTGGCCTCGAGTCTGGCGG Forward for copy number

γ actin gDNA rv GTGATCTCCTTCTGCATACGGTCG Reverse for copy number

eGFP fw CCACCTACGGCAAGTTGAC Forward for copy number

eGFP rv GGTGTCACCCTCGAACTTG Reverse for copy number

Ds Red-Skl fw ATAAAGGCGGCTTCATGACC Forward for copy number

Ds Red-Skl rv AGTCTGGGTGCCTTCGTAG Reverse for copy number

NiaD fw TGATGGCTCCTCCAGGATG Forward for copy number

NiaD rv CGGGTGGATGGAAAGAGTC Reverse for copy number

PENICILLIN BIOSYNTHESIS PATHWAY RECONSTRUCTION IN PENICILLIUM CHRYSOGENUM

1Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands2DSM Biotechnology Centre, Delft, The Netherlands3Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands

Fabiola Polli1, Jan A. K. W. Kiel1,

Remon Boer 2,3, Roel. A. L. Bovenberg2,3, Arnold J. M. Driessen1

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4

81

ABSTRACT

During the last decade, major improvements have been made towards the development of a genetic toolbox for P chrysogenum. In this study we have reprogrammed penicillin biosynthesis in P. chrysogenum by re-locating the penicillin biosynthetic pathway to a different genomic loca-tion and by expressing this pathway from an extrachromosomal vector, to enable future pathway remodeling.

Introduction

1. INTRODUCTION

The filamentous fungus Penicillium chrysogenum is used for the indus-trial production of penicillin and cephalosporin β-lactam antibiotics. Due to their excellent therapeutic effectiveness, limited toxicity and affordable pricing, β-lactams are broadly used around the world 316. Fermentation of penicillin G is the basis for the production of semi- synthetic β- lactams, like ampicillin and amoxicillin. In the past, classical mutagenesis has been the main methodology for strain improvement but recent developments of recombinant DNA techniques in filamen-tous fungi have provided the means to engineer fungal strains in a more rational manner 204; 218; 317. For instance, by genetic engineering com-pounds such as pravastatins and cephalosporins could be efficiently produced by P.  chrysogenum strains and this capability demonstrated that P. chrysogenum is an excellent platform for the production of vari-ous classes of natural products 16; 17; 315.

Successful genetic and metabolic engineering depends on the devel-opment of an efficient biosynthetic pathway which takes various aspects into account, like the required enzymes, their expression level, regulation and activity, but also product export, energetic and co-factor require-ments and potential side activities. Biosynthetic pathways can be further optimized by different strategies, by using heterologous enzymes from different sources, by changing the order of the genes arranged in a gene cluster, the use of different promoter elements, or the location of ge-nomic integration. Gene expression, for example, is strongly influenced by chromosomal location 318; 319. As an alternative to genomic integration, extrachromosomal autonomous replicating plasmids can be used. For instance, the fungal AMA plasmids carry autonomously replicating se-quences (ARSs) 250 that allow replication of the plasmid and maintenance at high copy numbers in filamentous fungi 249. Additionally, plasmids can be easily manipulated and isolated without interfering with the chromo-some of the host.

One of the key enabling technologies for metabolic engineering is the efficient reconstruction of biosynthetic pathways using modular DNA el-ements. In recent years, effective in vitro assembling methods have been developed 224; 232; 320; 321. However, when such pathway constructs cannot be further amplified in vitro, in vivo assembly methods can be used. For instance, refactoring of the M. genitalium genome involved in vivo assem-bling in Saccharomyces cerevisiae 223. Sofar, such methods have not been investigated in P. chrysogenum.

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

82 83Materials and methods Penicillin pathway reconstruction into the chromosome

As a first step towards the construction of complex biosynthetic path-ways in P. chrysogenum, we have examined the penicillin biosynthesis pathway. Through an in vivo assembly technique, this pathway was re- introduced into its original chromosomal locus as well as into an ectopic chromosomal position. In addition, the pathway was assembled into an AMA plasmid to realize extra-chromosomal plasmid-based expression. The performance of the penicillin biosynthesis pathway in these different genetic arrangements was assessed as a first step towards complex met-abolic pathway engineering in P. chrysogenum.

2. MATERIALS AND METHODS

2.1. STRAINS, MEDIA, AND CULTURE CONDITIONS

Escherichia coli strain DH5α, restriction enzymes, Phusion High-Fidelity DNA Polymerases, and T4 DNA ligase used in this study were purchased from Thermo Scientific. P. chrysogenum DS54466 (eight copy Pen-cluster), DS47274 (single copy Pen-cluster derivative of DS54466) and DS68530 (∆hdfA, ∆ku70, ∆Pen-cluster derivative of DS54466) 322 were kindly pro-vided by DSM-Sinochem Pharmaceuticals, The Netherlands. To obtain mycelium of P. chrysogenum for DNA isolation, fresh spores were inoc-ulated into YGG medium containing (in g/liter): KCl, 10.0; glucose, 20.0; yeast nitrogen base (YNB), 6.66; citric acid, 1.5; K2HPO4, 6.0; and yeast extract, 2.0. After inoculation, cultures were incubated for 24 h in a rotary incubator at 200 rpm at 25°C. For shake flask analysis spores were inocu-lated in a penicillin production medium (PPM) with the following reagents (in g/liter) glucose, 5.0; lactose, 75; urea 4.0; Na2SO4, 4.0; CH3COONH4, 5.0; K2HPO4, 2.12; KH2PO4, 5.1; supplemented with phenylacetic acid (PAA), 2.5 (g/l) and 10 ml of a trace element solution (in g/l): FeSO4·7H2O, 24.84; MgSO4·7H2O, 0.0125; EDTA, 31.25; C6H6Na2O7, 43.75; ZnSO4·7H2O, 2.5; CaCl2·2H2O, 1.6; MgSO4·H2O, 3.04; H3BO3, 0.0125; CuSO4·5H2O, 0.625; Na2MoO·2H2O, 0.0125; CoSO4·7H2O, 0.625. The solution was adjusted to pH 6.5. The mycelium was grown in a shaking incubator at 200 rpm for 7  days at 25°C. The bioassay analysis was performed using penicil-lin production medium +PAA with the addition of 0.6% agar. Micrococcus luteus was used as indicator strain for penicillin formation and grown in 2YT medium (Bactotrypton, 16 g/l; yeast extract 10 g/l; NaCI, 5 g/l). 2YT medium enriched with 0.6% agar was used to make a top agar layer.

2.2. PENICILLIN PATHWAY RECONSTRUCTION INTO THE CHROMOSOME

In vivo penicillin gene cluster reconstruction into P. chrysogenum DS68530 chromosome was done using two different chromosomal integration sites. The flanking sequences to the penicillin gene cluster (3’ from the penDE gene and 3’ from the pcbAB gene), representing the original locus, and the region between genes Pc20g07090 and Pc20g07100 were used as homologous flanking regions to target the reassembled β-lactam biosynthetic pathway (penDE-pcbC-pcbAB) together with the amdS gene for transformant selection.

Plasmid pDon221-Amds was used to amplify a sequence containing the Kanamycin (Kan) resistance gene for selection in E. coli and ori pUC origin of replication. The PCR product was phosphorylated and then self-ligated to construct the plasmid backbone, herein after named pFP. Oligonu-cleotides P056 (PacI, HindIII SacII, SbfI, AclI) and P057 (AatII, NheI, NotI) containing rare restriction sites, were used for amplification and to for a multiple cloning site in pFP.

Chromosomal DNA from P. chrysogenum DS17690 was used as tem-plate for the amplification of penicillin gene cluster genes. Primer P038 and P039 were used in the PCR reaction to amplify a DNA fragment con-taining the pcbC (Pc21g21380) and penDE (Pc21g21370) genes. The prod-uct of was subsequently cloned into the plasmid backbone using AatII and PacI restriction sites generating the pFP_pcbCpenDE plasmid.

The chromosomal regions upstream of Pc21g21370 (penDE) and down-stream of Pc21g21390 (pcbAB) (named 5’OFR and 3’OFR, respectively) and the downstream region of Pc20g07090 and upstream region of Pc20g07100 (named 5’IGR and 3’IGR, respectively) were used for the tar-geted genomic integration of the fragments. The 5’ OFR, and 5’ IGR regions were generated using primers combination P034/P035 and P338/P339 and cloned into pFP_pcbCpenDE creating pFP_pcbCpenDE_5’OFR and pFP_pcbCpenDE_5’IGR, respectively. The DNA fragment pcbCpenDE_5’ flanking region was recovered from pFP using the PacI and AatII sites and hereafter referred to as Fragment 1.

The pcbAB (Pc21g21390) gene was amplified using oligo P040 and P041 and cloned into TOPO® blunt-end cloning vector according to the man-ufacturer’s protocol (Invitrogen). Restriction enzymes PacI and NotI were used to cut pcbAB gene from pFP, henceforth called Fragment 2. The ter-minator sequence of pcbAB gene was amplified using primers P053 and P054 containing NotI and HindIII restriction sites, respectively. The PCR product was then cloned into pFP originating pFP_Tacvs.

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

84 85Materials and methods pDSM-JAK-108, AMA1 vector construction

The acetamidase gene (amdS) from A. nidulans was used as selection marker for fungal transformation. The amdS gene sequence was PCR am-plified from pDon221-Amds using primers P055 and P043 and cloned into pFP_Tacvs using HindIII and SacII restriction enzymes in order to create pFP_Tacvs_amds. The act terminator was PCR amplified from pDSM-JAK-108 using primers P044 and P045 and inserted into pFP_Tacvs_amds by di-gestion with SacII and SbfI resulting in pFP_Tacvs_amds_Tact. The 3’ OFR and 3’ IGR regions were generated using primers combination P048/P058 and P340/P341 cloned using SbfI and AclI into pFP_Tacvs_amds_Tact gen-erating pFP_Tacvs_amds_Tact_3’OFR and pFP_Tacvs_amds_Tact_3’IGR, correspondingly. The DNA fragment Tacvs_amds_Tact_3’ flanking region was recovered from pFP using NotI and AclI sites and hereafter referred to as Fragment 3. Primer sequences used cloning are listed in the Table S1 of Supplementary information.

The three generated fragments have a 750 bp overlap at the PpcbC (overlap 1) and at the TpcbAB (overlap 2) genes that, once recombined in the genome, will form a functional penicillin gene cluster that can be selected on acetamide plates (Figure 2). P. chrysogenum DS68530 was transformed with 1.5 μg of linearized Fragment 1 and 3 and with dou-ble amount of linearized Fragment 2, for both chromosomal fragment variants. Transformants were selected on 0.1% acetamide regeneration plates to select for the presence of the amdS gene 262.

2.3. P. CHRYSOGENUM TIF35 DELETION CASSETTE CONSTRUCTION

Multisite Gateway Three-Fragment Vector Construction kit (Invitrogen) was used to build the P. chrysogenum tif35 deletion cassettes as de-scribed 262. The upstream and downstream regions of Pc22g19890 (tif35) gene were used for targeted genomic integration of the deletion cassette. These regions were amplified by PCR from P. chrysogenum DS54465 ge-nomic DNA using the oligonucleotides designed according to the gateway guidelines and listed in Table S1 of Supplementary information. The re-sulting 5’ sequence was recombined into pDONR P4-P1R yielding plasmid pDSM-JAK-102 while the 3’ sequence was cloned into pDONR P2R-P3, resulting in pDSM-JAK-121 plasmid. The pENTR221-niaDF1 amdS-niaDF2, a derivative of pDon221 with niaDF1–Panid_gpdA-Anid_amdS-niaDF2 cassette was kindly donated by Dr. Jan A. K. W. Kiel. The acetamidase gene (amdS) was used as selection marker for the deletion of tif35 gene.

The pDSM-JAK-102, pENTR221-niaDF1-amdS-niaDF2 and pDSM-JAK-121 plasmids were recombined with vector pDEST R4-R3 generating the pDSM-JAK-122 plasmid.

2.4. PDSM-JAK-108, AMA1 VECTOR CONSTRUCTION

To complement the deletion of the chromosomal tif35 gene, pDSM-JAK-108 vector, carrying an additional copy of tif35, was constructed as follow. The promoter of the Aspergillus nidulans AN0465 gene was PCR amplified us-ing primers DSM-JAK-201 and DSM-JAK-202 using A. nidulans FGSC A4 (ATCC38163) genomic DNA as template. The AN0465 PCR product was digested with Asp718i and BamHI and inserted in pBBK-001 323 also di-gested with the same restriction enzymes. The resulting plasmid was named pDSM-JAK-201.

The terminator of the A. nidulans act (AN6542) gene was amplified us-ing plasmid DSM-JAK- 203 and DSM-JAK- 204 containing MluI and SmaI restriction sites, respectively. The PCR product was then cloned into pDSM-JAK-201 originating pDSM-JAK-202.

The DNA fragment P AN0465_DsRed.SKL_Tact was recovered from pDSM-JAK-202 using the HpaI and KpnI sites and cloned into pAMPF21*, a derivative of the E. coli shuttle vector with AMA1 region pAMPF21 324, digested with HindIII (blunted by Klenow treatment) and KpnI resulting pDSM-JAK-107 plasmid.

Chromosomal DNA from P. chrysogenum DS54465 was used as tem-plate for the amplification of Pc22g19890 (tif35) gene was amplified using oligo DSM-JAK-111 and DSM-JAK-112. The PCR product was subse-quently digested with NotI and BamHI and cloned into the plasmid back-bone pDSM-JAK-107 using NotI and BglII restriction sites generating the E. coli/P. chrysogenum pDSM-JAK-108 shuttle vector.

2.5. PENICILLIN PATHWAY RECONSTRUCTION ON PFP-PEN-108 VECTOR

For the in vivo reconstruction of the penicillin biosynthetic pathway into a stable AMA1 plasmid, pFP-phleo-122 and pDSM-JAK-108 were used. The first plasmid creates a chromosomal deletion of the essential Pc22g19890 (tif35) gene in P. chrysogenum while, the second vector complements the

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

86 87Materials and methods Chromosomal analysis

absence of this essential gene by carrying an extra copy of the tif35 gene (Figure 1 of Supplementary information). This set up allows for stable maintenance of pDSM-JAK-108 as backbone for pathway reconstruction by in vivo recombination of the DNA fragments.

Plasmids providing “Fragment 1”, “2” and “3” were designed as de-scribed above. The promoter of the ribosomal protein S8 (AN0465) and the terminator of the γ-actin gene (AN652) from Aspergillus nidulans, (named 5’JAK and 3’JAK, correspondingly) were used for targeted inte-gration of the penicillin gene cluster into the pDSM-JAK-108 vector.

The 5’JAK region was generated using primers P036/P037 and ligated into pFP_pcbCpenDE resulting in pFP_pcbCpenDE_5’JAK. The DNA se-quence corresponding to pcbCpenDE_5’JAK was recovered from pFP us-ing PacI and AatII sites and used as Fragment 1. The previously descripted Tact terminator region was used as the 3’JAK integration site. The DNA fragment Tacvs_amds_Tact was recovered from pFP using NotI and SbfI sites and used as Fragment 3.

The plasmid pFP-phleo-122 to delete tif35 was created as follow: the promoter of the 6-phospho-gluconate dehydrogenase (gndA) gene was PCR amplified using primers P352 and P353 from the P. chrysogenum

Figure 1. Generation of the stable pFP-Pen-108 transformants carrying the reconstructed penicil-

lin gene cluster. P. chrysogenum was cotransformed with a deletion cassette for the Pc22g19890 (tif35)

essential gene, the DNA fragment 1 (pcbCpenDE_5’JAK), 2 (pcbAB gene) and 3 (Tacvs_amds_3’ JAK) for

the penicillin pathway reconstruction and pDSM-JAK-108 that will function as platform for the path-

way reconstruction. After transformation the ble gene will have replaced the tif35 essential gene in the

P. chromosome genome while a complementing copy of tif35 will be present on plasmid pPF-Pen-108,

together with the amdS marker and the penicillin cluster genes.

An11g02040 promoter pathway strain 242. The gndA PCR product was digested with XhoI and NcoI and inserted in pDON221-phleo, digested with the same restriction enzymes. The resulting plasmid was used as template for amplification of the gndA-phleo gene with primers P356 and P357. The amdS gene of pDSM-JAK-122, localized between the up and downstream region sequence of Pc22g19890 (tif35), was replaced by the gndA-phleo genes using restriction enzymes NotI and PmlI. The plasmid was designated pFP-phleo-122 (Figure 1 of Supplementary information). The deletion cassette for tif35 was extracted from pFP using ApaI, puri-fied using GenElute™ Gel Extraction Kit (Sigma Aldrich) and used during co-transformation. Oligonucleotides used in this work are listed in the Table S1 of Supplementary information. P. chrysogenum DS68530 was transformed using ten times more linearized DNA of the target chro-mosomal transformations 262. Specifically, “Fragment 1”, “2” and “3” plus tif35 deletion cassette and pDSM-JAK-108 were used as DNA “cocktail” for the transformation, yielding transformants putatively containing the pFP-Pen-108 vector and tif35 chromosomal deletion. Transformants were selected on phleomycin (50 mg/l) and 0.1% acetamide regeneration plates to select for the presence of the ble and amdS genes, respectively 262.

2.6. CHROMOSOMAL ANALYSIS

For the determination of the correct assembling and integration of the penicillin biosynthetic pathway into the selected regions, total DNA was isolated from the transformants after 48 h of growth in YGG medium using a modified yeast genomic DNA isolation protocol 263 in which the fungal mycelium is homogenized in a FastPrep FP120system (Qbiogene, Carlsbad, CA, USA ). Diagnostic primers for genomic integration site used are listed in the Table S1 of Supplementary information.

2.7. BIOASSAY OF PENICILLIN PRODUCTION

After transformation, P. chrysogenum transformants were grown on penicil-lin production medium (PPM) agar plates supplemented with phenylacetic acid (PAA), 2.5 (g/l) at 25°C for 3 days. Micrococcus luteus was grown over-night at 30°C in 2YT medium and the next day diluted to OD600 of 0.01 in 2YT supplemented with 0.6% agar. An overlay of 2 ml was added on each PPM+PAA plates around the colonies and after solidification the plates

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

88 89Materials and methods Penicillin gene cluster reassembling strategy

were incubated overnight at 30°C. As controls, single and zero Pen-cluster strains DS47274 and DS68530 were used. The putative penicillin restored transformants were in a next step selected on Phleomycin (50 mg/l) and 0.1% acetamide plate as sole nitrogen source.

2.8. DETERMINATION OF METABOLITE PRODUCTION

Production of penicillin G and consumption of PAA was assessed by LC/MS using culture supernatants. P. chrysogenum control strains and the vari-ous transformants were grow in triplicates and after 3, 5, 7 days of growth, samples were collected from the cultures and centrifuged (14,000 × g for 5 minutes). Supernatant fractions were filtered using 0.2 µm syringe filters with polypropylene Housing (VWR International Ltd.) and 60 µL of filtrate were transferred to an auto sampler vial. For separation, Accella 1250™ HPLC system coupled in-line to an ES-MS Orbitrap Exactive™

(Thermo Fisher Scientific, San Jose, CA) was used. A scan range between m/z 80 and m/z 1600 in positive ione (4.2 kV spray, 87.5 V capillary and 120 V of tube lens) mode, with capillary temperature set at 325°C was used. Separation was performed on a Shim-Pack XR-ODS™ c18 column (3.0 × 75 mm, 2.2 µM) (Shimadzu, Kyoto, Japan). A linear gradient was used for the elution. It started with 100% water (solvent A) and 100% Acetonitrile (solvent C) in a ratio of 90% and 10%, respectively for 5 min at a flow rate of 300 µL/min. The solvent C increased up to 95% after 35 min. The column was equilibrated again using a washing step of 10 min using 90% of solvent C. Formic acid (2%) was continuously used as solvent D in a final concentration of 0.1%. Raw files were processed using SIEVE software (Thermo Fisher Scientific, San Jose, CA). The appearing peak ta-bles were used as target list and each feature was integrated in every individual sample. Later, the Excalibur 2.1 (Thermo Fisher Scientific, San Jose, CA) processing tool was used for a more accurate integration. Peaks were auto integrated using base peak traces in a mass range of 10 ppm and retention time window of 60 seconds.

3. RESULTS

3.1. PENICILLIN GENE CLUSTER REASSEMBLING STRATEGY

The P. chrysogenum penicillin pathway contains the genes pcbAB, pcbC and penDE which form a single cluster located on chromosome I 6. PcbAB and pcbC genes are expressed in opposite directions from a 1.16-kb bidirec-tional promoter region 325; 326; 327. The penDE gene is expressed from a sepa-rate promoter, 328; 329 In addition to these genes also a CoA ligase encoding phl gene is required for penicillin biosynthesis. However, the phl genes are not clustered with the other biosynthetic genes, but spread over the Penicillium genome and are therefore not included in this study 330; 331.

To obtain a set of fragments for reconstruction of the penicillin gene cluster in P. chrysogenum, regular and TOPO® blunt-end cloning meth-ods were used. The pcbC and penDE genes were amplified together as a unique DNA fragment that was subsequently ligated with 5’ FR resulting in Fragment ‘1’. The pcbAB gene, due to its considerable length was cloned

Figure 2. Penicillin pathway assembling strategy. The dashed line rounded rectangles indicate the se-

quences that were used as overlapping DNA fragments (overlap 1 and 2). Numbers (1 to 8) indicate the

position of the oligonucleotides used to verify the correct assembling of the fragments and appropriate

targeting of the penicillin pathway integration.

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

90 91Results Determination of penicillin

by the blunt-end method and used as independent Fragment ‘2’. The bi-directional pcbAB-pcbC promoter sequence was used as overlapping DNA fragment (overlap 1) for the chromosomal and pDSM-JAK-108 vector tar-geted integration of fragments 1 and 2 (Figure 2). The terminator region of pcbAB was inserted upstream of the amdS gene to create a second recombination site (overlap 2). The terminator region of the γ-actin gene was used as terminator sequence for the acetamidase gene (amdS) and as integration region (3’JAK). The correct plasmid assemblies were verified by DNA sequencing (data not shown). For chromosomal integration, we chose the original penicillin gene cluster locus and the intergenic region between genes Pc20g07090 and Pc20g07100 that we previously used to integrate heterologous pathways in P. chrysogenum 242. These constructs were transformed to the P. chrysogenum DS68530 strain (∆hdfA, ∆pen clus-ter) that lacks the hdfA gene involved in the non-homologous end-joining recombination process and that is devoid of the penicillin gene cluster.

For the generation of the stable pFP-Pen-108 transformants carrying the reconstructed penicillin gene cluster, the multi copy pDSM-JAK-108 vector was combined together with the pFP-phleo-122 plasmid (Figure 1). The deletion plasmid pFP-phleo-122 was designed to create a deletion of P. chrysogenum tif35 gene (Pc22g19890) that encodes the translation initiation factor 3 subunit g (eIF3g) 332. Therefore, up and downstream re-gions of Pc22g19890 were used for the targeted genomic replacement of tif35 with the phleomycin resistance gene (ble). The E. coli/P. chrysoge-num pDSM-JAK-108 shuttle vector contains the fungal replication AMA1 sequence 190; 249 and the DsRed.SKL expression cassette that allows for plasmid selection based on fluorescence 242. This plasmid was used to complement the deletion of the chromosomal tif35 gene by carrying an additional copy of tif35 (Figure 1 of Supplementary information). For plasmid integration, the 5” upstream region of the DsRed.SKL cassette and its 3” terminator sequence were used as plasmid integration sites. Consequently, when the pathway is correctly integrated into the plasmid, fungal cells can be screened for the absence of DsRed fluorescence. Addi-tionally, correct pathway reassembling can be assessed by the growth of the cells on acetamide and phleomycin regeneration medium. To prevent the re-occurrence of homology between the fragments and chromosomal regions, the pcbC promoter normally used to express the phleo gene was substituted with the An11g02040 (gndA) promoter.

Figure 3. Characterization of the reconstructed penicillin pathways transformants from P. chrysoge-

num. DNA obtained by various PCR reactions was resolved on 0.8% agarose gel showing the results

obtained with (A) Original penicillin locus transformants, (B) intergenic locus transformants and (C)

pFP-Pen-108 transformants. Numbers 3 to 6 indicate the oligonucleotides used to verify the overlap-

ping recombination sites (O1 and O2) between the fragments and correspond to the positions indicated

in Figure 2 yielding the expected PCR products of 1 kb. Numbers 1, 2, 7 and 8 indicate the primers used

to confirm by PCR the integration of the penicillin gene cluster into P. chrysogenum genome and into the

pFP-Pen-108 vector. The predicted PCR products were: ~1.3 and ~1.6Kb for (A); ~1.4 and ~2.3 Kb for (B)

and ~1.7 and ~1 Kb for (C). Extra bands were present due to non-specific amplification.

3.2. DETERMINATION OF PENICILLIN

In order to confirm the restored penicillin production, liquid cultures of transformed strains and of the host strain grown for 3, 5 and 7 days and the culture broth was analyzed by HPLC-MS. Introduction of the β-lactam

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

92 93Results Discussion

biosynthetic pathway (penDE-pcbC-pcbAB) into the original penicillin gene cluster locus or into the intergenic region between genes Pc20g07090 and Pc20g07100 resulted in levels of penicillin G production (Figure 4) and PAA consumption (data not shown) that approached the levels found

Figure 5. Bioassay for detection

of Penicillin G. Bottom view of

Penicillin production medium

(PPM) agar plate supplemented

with PAA. Micrococcus luteus was

used as indicator microorganism.

The plates show bioactivity assay

results obtained for DS47274 (sin-

gle pen cluster) and P. chrysogenum

pFP-Pen-108 strains (A). Penicillin

G production has created zones

of growth inhibition of Micrococ-

cus luteus. Latin numbers indi-

cates the different pFP-Pen-108

transformants.

Figure 4. Penicillin G production by the reconstructed penicillin pathways P. chrysogenum strain. The

DS68350 strains with a restored penicillin biosynthetic gene cluster in the original locus (O) and the in-

tergenic locus (I) were grown on PPM medium supplemented with phenylacetic acid (PAA), 2.5 (g/l) and

the penicillin production levels were determined after 5 (black bars) and 7 (gray bars) day. Control strain

used are DS68530 (zero pen cluster), DS47274 (single pen cluster) and DS54466 (eight pen clusters).

for the single penicillin cluster copy strain DS47274.Small growth differ-ences were taken into account by correcting the Penicillin production lev-els with dry weight measurements.

For the pFP-Pen-108 transformants, the penicillin G production was detected only by bioactivity assay. Micrococcus luteus was grown one day in 2YT medium and used as indicator to make a top 2YT agar layer on the surface of a penicillin bioactivity assay plate. P. chrysogenum DS47274 (single pen cluster) strains was used as positive control. Penicillin G pro-duction was detected by the presence of zones of growth inhibition of the bacterium, Micrococcus luteus (Figure 5).

4. DISCUSSION

Classical strain improvement cycles using extensive mutagenesis has been a main strategy in improving β-lactam production in industrial applica-tions. Genetic engineering on the other hand has been used to redirect the β-lactam biosynthetic pathway for high value products such as ceph-alosporins and pravastatin. Genetic engineering has therefor great poten-tial to further increase the penicillin productivity, in particular since new tools for genome editing have become available such as the CRISPR/Cas9 system and methods to reconstruct pathways using modular cloning strat-egies. Chromosomal expression of genes is locus–dependent, and so far, the performance of the penicillin biosynthetic gene cluster has only been assessed for its original chromosomal gene locus. Here, we assessed the potential of synthetic pathway reconstruction by re-locating the penicillin biosynthetic pathway into a different chromosomal locus. For synthetic pathway reconstruction several in vitro methods have been developed as fast, cheap and efficient ways to deal with large DNA sequences 224. How-ever, such fragments can also be efficiently fused together by the in vivo homologous recombination system 223; 290; 333. Thus, we used the in vivo re-combination system in P. chrysogenum for pathway reconstruction into two different chromosomal integration sides. In this study we reassembled the penicillin biosynthesis pathway genes (pcbAB, pcbC, penDE, 22 Kb) together with a fungal selection marker. By the use of different flanking regions, these constructs were targeted to the original penicillin gene cluster locus and the intergenic region between Pc20g07090 and Pc20g07100 genes that was used previously for heterologous pathway integration to assess promoter strength in P. chrysogenum 242. The resultant strains were exam-ined for penicillin production in shaking flask cultures and the respective

Peni

cilli

n bi

osyn

thes

is pa

thw

ay re

cons

truct

ion

in P

enic

illiu

m c

hrys

ogen

um

4 4

94 95Discussion

yields were comparable to those observed for the single penicillin cluster copy strain DS47274. This shows that the in vivo reconstruction of the cluster was successful and opens the way to engineer this cluster for the improved production of β-lactam antibiotics.

Reconstructing large gene clusters through chromosomal integration can also be laborious 334, while the chromosomal integration is less versa-tile. To bypass this problem, we tested also a mitotically maintained AMA plasmid that can be used as vector for future stable expression of synthetic pathways in fungi. The AMA plasmid contains the autonomously replicating sequences (ARS) AMA1 from A. nidulans that allows the replication of the plasmid and its transformation at high frequency in fungi 249; 335. However, these plasmids are mitotically unstable and selection markers are gener-ally needed for maintenance, resulting in a continuous use of antibiotics. Moreover, in filamentous fungi only few markers are available representing a limiting factor in plasmid design. To overcome this issue, a deletion of the chromosomal essential gene tif35 was performed while simultaneously an extra copy of the gene was added into pDSM-JAK-108, AMA1 vector, ensuring its maintenance. We used an in vivo reassembling strategy to engineer the plasmid expression of the penicillin biosynthetic gene cluster in P. chrysoge-num. For the pFP-Pen-108 based penicillin production, production could only be demonstrated in a bioactivity assay. A clear halo (Figure 5) was ob-served around the colonies of pFP-Pen-108 transformants, but its size was somewhat smaller than that of the positive control DS47274 (one penicillin cluster copy). However, this assay could only be used to asses penicillin production but not its quantification. Since only few rounds of purifications were performed on the pFP-Pen-108 transformants, heterogeneity in the multicellular and multinuclear mycelium of this filamentous fungus could be the reason for the apparently low penicillin G detection. Therefore, these strains need further purification before an accurate quantitative statement can be made on their performance. A further possible explanation for the low performance in shake flask fermentation could be the use of the stan-dard growth conditions for the large (33 Kb) pFP-Pen-108 vector. However, this needs to be assessed by further gene expression analysis. Specifically, transcript levels of penicillin genes (pcbAB, pcbC and penDE) must be deter-mined and correlated to relative protein levels.

Summarizing, this study shows that the in vivo reassembly of large DNA fragments can be used successfully for biosynthetic pathway re-construction in P. chrysogenum. Furthermore, we provide an AMA1 stable plasmid strategy as a novel technology for facile gene and pathway ex-pression in P. chrysogenum.

Supplementary information

SUPPLEMENTARY INFORMATION

Table S1. Primer used in this study

Target Sequence ( 5’-> 3’) PurposeP056 TTACAGTTAATTAACAAGCTTCCGCGGCCTGCAGGAACGTTT

GCCATCCAGCTGATATCCpFP costruction

P057 TTACATGACGTCGCTAGCTTGCGGCCGCTTAGCGGTAATACGGTTATCCAC

pFP costruction

P038 TGAAGTGACGTCTCCCTACTATCCCTCGATAGC pcbC-penDE amplificationP039 GTGGAGTTAATTAAGACGGATCGGATGCAACAAC pcbC-penDE amplificationP040 GTGGAGTTAATTAAGTTGCAGCCCAGATGCTTAC pcbAB amplificationP041 TTACTTGCGGCCGCTCGGCAACGAGAGGTATG pcbAB amplificationP053 TTACATGCGGCCGCTGGCGACACCTTTAGTTAGCC TpcbAB amplificationP054 CTGGATCAAGCTTCTCGGCAACGAGAGGTATG TpcbAB amplificationP055 GGACATAAGCTTGGCCGCTCTAGAACTAGTG amdS amplificationP043 TGAATACCGCGGCGTAGCATGGCATGGTCAC amdS amplificationP044 CTTGATCCGCGGTGGGGTGCTTCTAAGGTATG Tact amplification/ 3’JAKP045 CTCATACCTGCAGGAAGCTAACGCAGGGTTTG Tact amplification/

3’JAK/8-AMAP034 TGAAGTGCTAGCCAACGCCTTCTTGAACGTC 5’OFR amplificationP035 TGAATAGACGTCAGCGCCTCATCACCCATTCTC 5’OFR amplificationP338 GTAGTGCTAGCTCTAGGCTAAGGTCCGTTATC 5’IGR amplificationP339 TGAAGTGACGTCGACTAAATCGGCTACTAGGC 5’IGR amplificationP036 TGAAGTGCTAGCTTCAGCAGAGCGCAGATAC 5’JAK amplificationP037 TTAAGAGACGTCGCGCTTGGCGTAATCATGG 5’JAK amplificationP048 TGACGTCCTGCAGGTCGGTCACGGACGTAAGAG 3’OFR amplificationP058 GGATCAACGTTAGCTGCAGAGACTGCGATAGAC 3’OFR amplificationP340 GACGTCCTGCAGGTGATAGGTCTTCGGAGATAGAAG 3’IGR amplificationP341 GGACATGGAACGTTGATTCTCGTCGGAAGTACG 3’IGR amplificationP352 CATTGCTCGAGAGTGCTCTTGCGTTACGG gndA amplificationP353 GCGTTCCATGGCATTTTGACGGTGTGGGG gndA amplificationP356 CATTGGCGGCCGCAAAGCAGGCCATATAACTTCG gndA-phleo amplificationP357 CAGGTGCACGTGAGTGGTACCGTTCGTATAGC gndA-phleo amplificationDSM-JAK-103a GGGGACAACTTTGTATAGAAAAGTTGAGCATATTCTTTCACTG

TTGCAGATCTGCpDSM-JAK-102 (pDONR P4-P1R) construction

DSM-JAK-104a GGGGACTGCTTTTTTGTACAAACTTGCTATCCCATCCAGATGAGTGCTTCG

pDSM-JAK-102 (pDONR P4-P1R) construction

DSM-JAK-107 GGGGACAGCTTTCTTGTACAAAGTGGAT GGGAAACTAACCACGTGCTTGTACG

pDSM-JAK-121 (pDONR P2R-P3) construction

DSM-JAK-123 GGGGACAACTTTGTATAATAAAGTTGTGGGCCC TCACCCTGTCTCGACTTCCTTGTC

pDSM-JAK-121 (pDONR P2R-P3) construction

DSM-JAK-201 AGAGGTACCGAGTTATAGACGGTCCGGCATAGG AN0465 amplificationDSM-JAK-202 AGAGGATCCGTTTGCTGTCTATGTGGGGGACTG AN0465 amplificationDSM-JAK-203 GGGGTGCTTCTAAGGTATGAGTCGCAA act (AN6542) amplificationDSM-JAK-204 AGAACGCGTTAACGCAGGGTTTGAGAACTCCGATC act (AN6542) amplificationDSM-JAK-111 AGAGGATCCGAGGAAGACGTGATCAGAGTAAGC tif35 amplificationDSM-JAK-112 GAAAGCGGCCGCGGTACCGTGCTTGGGATG TTCCATGGTAGC tif35 amplificationP283 CCTGCAGATGACAATGAGTG 3- Overlap 1 amplificationP284 CTGGCGTTCAGGGATGTAG 4- Overlap 1 amplificationP285 CGGACGATGGAAGTGATGG 5- Overlap 2 amplificationP286 TGGCCAGTGGCTTATTACTC 6- Overlap 2 amplificationP334 GGCGGAGAAGGTACGAAAC 1- OFRP335 TGTCATGCGGTTTGACGAG 2-OFRP336 CAGGCAAGCGAAATTCGAAG 8-OFRP337 GTTATCGGACGGAGACTCAG 7-OFR/IGR/AMAP365 GGTTCGCGGGCTAAAGTATC 1-IGRP371 CAACCGACTCCGTCTTCAC 2-IGR/AMAP368 GAATAGACGGCCGGTTTAGGG 8-IGRP370 AAATGCCTGAGGCCAGTTTG 1-AMA

4

96 Supplementary information

Figure S1. (A) Map of the deletion construct for P. chrysogenum tif35 gene (Pc22g1890) used for de-

letion. (B) Map of for P. chrysogenum tif35 gene (Pc22g1890) complementation. Features construct

A: Amp, Ampicillin resistances genes for the selection in E. coli; gndA, promoter of the 6-phospho-

gluconate dehydrogenase (gndA) gene from A. nidulans; phleo, Phleomicin resistance gene for selec-

tion of fungal transformants. Features construct B: Cam, Chloramphenicol resistances genes for the

selection in E. coli; AMA1, fungal replication AMA1 sequence; Pan0465, ribosomal protein S8 (AN0465)

promoter from A. nidulans; Tact, terminator of γ-actin gene (AN652) from A. nidulans.

SUMMARY AND CONCLUDING REMARKS

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5

101Summary

SUMMARY

Current industrial production processes of penicillin antibiotics by P. chrysogenum are based on classical strain improvement (CSI) programs that lasted several decades and that resulted in strains with the desired fermentation features and high levels of penicillin production 9; 336. During this process, most mutations occurred untargeted, and statistically no specificity could be found in the distribution of mutations over genomic regions or biochemical functional groups 7. However, some mutations and chromosome alterations that occurred could be directly linked to the high performance of these strains, like the tandem amplification of the penicil-lin gene cluster 3 and the inactivation of genes involved in the expression of other secondary metabolite gene clusters 7. Furthermore, the selection of improved strains also included a selection against the production of coloured metabolites in the fermentations such as the sorbicillinoids 7. Additionally, the general transcription network for secondary metabolism, the Velvet complex was hit by mutations causing the down- regulation of many secondary metabolism genes. Other mutations improved the fermentation characteristics of this filamentous fungi by altering its morphology, increasing the amino acid metabolism 4 and increasing the proliferation of microbody 5, organelles in which key enzymes of the pen-icillin biosynthetic pathway reside 337. The CSI-improved P. chrysogenum strains were shown to be an interesting platform for the production of other β-lactam antibiotics 16; 18; 19; 20; 264 and possibly even for other type of secondary metabolites, like polyketides 315.

The antibiotic penicillin has provided major improvements in care of in-fectious disease 338. Furthermore, it raised interest towards natural com-pounds in general and has led to the discovery of many other antibiotics from a range of sources 339; 340. However, the extensive and immoderate use of antibiotics also has led to the development of antimicrobial resis-tance (AMR) 341 thus providing a strong urge to identify novel antibiot-ics based on unique chemical scaffolds. In this respect, large screening programs have been developed to identify novel natural products with antibiotics activity. Genome sequencing and bioinformatics now allows to perform such screens genome wide 139; 140, resulting in the discovery that the majority of secondary metabolite gene clusters in typical fungal genomes are not transcribed under laboratory conditions and possibly encode unknown molecules with unique bioactivities 6; 142. To exploit the wealth of genomic information, a powerful genetic toolbox is required to clone the corresponding large gene clusters, modulate their expression

Summary

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5 5

102 103Summary

and eventually use this information to assemble novel biosynthetic path-ways. For this approach, however, the genetic toolbox available for the fungus P. chrysogenum is rather limited. Although transcriptional and translational elements are functional across a range of filamentous fungal hosts, only few promoters have been applied in P. chrysogenum and com-pared in performance. Furthermore, DNA manipulation is a key element for further metabolic engineering and improvement of fungal production strains. Recently, the CRISPR/Cas9 DNA system for genome engineering method was developed for P. chrysogenum 174. However, other strategies and methods for pathway reconstruction using large pieces of DNA still need to be developed and exploited. This includes the use of the autono-mously replicating plasmids carrying (ARSs) sequences 250 that are poorly developed for filamentous fungi due to their low stability and high risk of chromosome integration 165; 187; 249; 252; 253.

Chapter 1 gives an overview of the molecular biology of filamentous fungi and focusses on secondary metabolites produced by the filamen-tous fungus P. chrysogenum with an emphasis on nonribosomal peptide synthetase (NRPS) and polyketide synthase (PKS) derived natural prod-ucts and their genetics. It also discusses the classical strain improvement (CSI) program and the genetic toolbox available for the engineering of this fungus that is further expanded in the following chapters of the thesis.

Chapter 2 describes the impact of the deletion of two highly ex-pressed secondary metabolites gene clusters that specify the metabolites chrysogine and roquefortine in a strain of P chrysogenum that is already devoid of the penicillin biosynthetic gene cluster. A method is described for the deletion of the aforementioned large gene cluster (>20Kb) in the genome of P. chrysogenum using Gateway cloning for the construction of the large deletion cassettes. The resultant secondary metabolite deficient strain was further analyzed by metabolite and gene expression profiling. The DS68530∆chy strain in which the chrysogine gene cluster was re-moved, showed higher levels of produced roquefortine-related metab-olites whereas the expression of this gene cluster remained unaltered. Additionally, in this strain, fungisporin derived degradation products were detected in the culture broth, while also expression of the fungisporine NRPS gene was unaltered. Earlier studies have shown that the deletion of the multy-copy penicillin gene clusters resulted in the complete loss of penicillin production that was accompanied with the simultaneous high level production of roquefortine and chrysogine-related metabolites 7. It was suggested that in this strain, a redistribution of amino acids into alter-native secondary metabolites occurred, a phenomenon that also appears

apparent in the strain in which additionally the chrysogine cluster was re-moved. This effect was even further exuberated in the DS68530∆chy∆roq strain which shows the accumulation of a range of fungisporin-derived metabolites, likely degradation products of the original NRPS products. In this strain that lacks the three highest expressed NRPS gene clusters also novel compounds were detected. However, this awaits further structural characterization to link these compounds to one or more of the secondary metabolite gene clusters that are still expressed in this strain. Because of the accumulation of the fungisporin derived metabolites it will be neces-sary to also delete the corresponding NRPS gene in order to generate a secondary metabolite deficient strain that in the future can be used as a generic production platform for secondary metabolites.

Chapter 3 presents a study that classifies a range of homologous and heterologous promoters in terms of expression strength. Specifically, a set of six constitutive promoters from A. niger, and four from P. chrysogenum were tested in combination with two terminators derived from A. nidulans. Additionally, two P. chrysogenum promoters were tested that drive the expression of pcbC and pcbAB genes involved in penicillin production, and these were used for benchmarking 305. A modular promoter–reporter sys-tem was constructed using the Golden gate cloning technique and in vivo homologous recombination in the yeast, Saccharomyces cerevisiae. The promoters were used to drive the expression of green fluorescent GFP protein while microbody targeted red fluorescent protein RFP was used as an internal standard. The synthetic pathways were transferred into P. chrysogenum and growth was performed in the BioLector fermentation system, which is a semi high throughput fermentation system that allows on-line monitoring of fermentation parameters like biomass formation, pH, O2 concentration and fluorescence of the reporter proteins 282. We focused only on high and medium expressed genes employing growth conditions relevant for industrial production of β-lactams. The data pro-vides a catalog of promoter strengths with a promoter of a secretory pro-tein belonging to the cerato-platanin family of phytotoxins, Pc20g15140, being the strongest while the An02g10320 promoter of glucoamylase was the weakest in this analysis. With this catalog of different promoter strength, it will be possible to better tune the expression of target genes in future strain engineering programs.

A strategy to combine and use such new promoter is illustrate in Chap-ter 4. It describes the refactoring of the penicillin biosynthetic gene cluster (pcbAB, pcbC, penDE) in a P. chrysogenum strain lacking this cluster. This in-cluded the restoration of the pathway into its original locus as well as into

Summary

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5 5

104 105Summary

the intergenic region between Pc20g07090 and Pc20g07100 genes that was also used in Chapter 3 for the promoter pathway genome integration. The pathway was constructed from three modules and integrated in the genome using the in vivo recombination of overlapping DNA fragments in P. chrysogenum. In addition, based on the efficiency of AMA plasmids reported in previous studies, a mitotically stable AMA plasmid system was developed as new platform for pathway refactoring and expression. This strategy was based on the maintenance of an AMA replicating plas-mid by complementation of an essential gene function. Specifically, this method relies on the simultaneous use of a deletion cassette for an es-sential gene, in our case Pc22g19890 encoding for the tif35 gene involved in the expression of the translation initiation factor 3 subunit g (eIF3g) 332 and an AMA plasmid carrying a complementing copy of the essential gene. Transformation of the aforementioned deletion cassette and AMA plas-mid results in the inactivation of the essential gene whose function is complemented by the plasmid-encoded gene. This results in stable main-tenance of the plasmid (J. Kiel, personal communications). The penicillin biosynthetic pathway encoded on three DNA fragments was assembled in vivo by Penicillium into the AMA plasmid. In our design, the AmdS selec-tion marker was used in one of the fragments to select for the presence of the assembled pathway in the AMA plasmid. For plasmid maintenance, there is no need to use this marker. With the refactored pathways, the chromosomal targeting resulted in similar penicillin G production levels compared to the single copy strain DS47274, showing a successful in vivo assembly of the pathway from the distinct DNA fragments. On the other hand, with the AMA approach, penicillin G production was evident only from the bioassay analysis, whereas very low levels were found in the culture broth using LC-MS. This low performance is unexpected but could be related to several issues. First, the regular fermentation condition was perhaps not optimal for the expression of the large (33Kb) AMA plasmid. In fact, the use of a lower growth temperature or different pH 342 could improve the pcbAB, pcbC and penDE expression and therefore, the pen-icillin production. Second, filamentous fungal strains exhibit a multinu-clear morphology and since only few rounds of selection were performed on AMA::PEN cluster transformants this could have affected the clonal purification and subsequently the performance of the AMA::PEN cluster containing strain. Therefore, future analysis should focus on the nuclear composition, growth and expression conditions of the strain.

Taken together, the presented pathway refactoring is a first step to-ward the rapid implementation of novel pathways into P. chrysogenum

and shows that the in vivo assembly of pathways from DNA fragments can be effectively employed. Furthermore, the acquired knowledge on functional new promoters and terminators can be combined with the in vivo recombination, to construct new synthetic metabolic pathways in Penicilium. Additionally, a further optimized secondary metabolites defi-cient strain can be used as natural cell factory and they could provide new natural products.

Concluding, the novel strategies can be in applied for more efficient discovery, production and modification of natural products that can be used to treat/combat multi drug resistant bacterial infections.

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5

107Samenvatting

SAMENVATTING

De huidige productie processen van op penicilline gebaseerde antibio-tica door P. chrysogenum zijn gebaseerd op klassieke stamverbeterings-programma’s welke tientallen jaren hebben geduurd. Deze programma’s hebben geresulteerd in stammen met de gewenste fermentatie eigen-schappen en hoge penicilline concentraties 9; 336. Tijdens dit proces von-den de meeste mutaties ongericht plaats. Statistisch gezien kan er geen specificiteit worden ontdekt in de distibutie van de mutaties over de ver-schillende genomische regio’s of functionele groepen 7. Desalniettemin kunnen sommige mutaties en chromosomale modificaties direct worden gelinkt aan de hoge productiecapaciteit van deze stammen, zoals de mul-tiplicatie van het penicilline gencluster 3 en de inactivatie van genen be-trokken bij de expressie van andere secundaire metabolieten 7. De selectie van verbeterde stammen vond ook plaats op basis van gekleurde metabo-lieten, zoals sorbicillines 7 en daarnaast vond er een mutatie plaats in het algemene transcriptie netwerk voor secundaire metabolieten, het Velvet complex, waardoor de expressie van vele secundaire metabolieten is ver-laagd. Andere mutaties verbeterden de fermentatie karakteristieken van P. chrysogenum, doordat de morfologie en het aminozuur metabolisme zijn aangepast 4 en de verhoogde ontwikkeling van peroxisomen 5, waarin zich enkele belangrijke enzymen van het penicilline gencluster bevinden  337. De verbeterde P. chrysogenum productiestammen vormen een interessant platform voor de productie van andere β-lactam antibiotica 16; 18; 19; 20; 264 en mogelijk zelfs voor de productie van andere typen secundaire metabolie-ten zoals polyketides 315.

Penicilline heeft voor grote verbeteringen in de behandeling van in-fectieziekten gezorgd 338. Daarnaast heeft penicilline er voor gezorgd dat er interesse kwam voor natuurlijke verbindingen en in het algemeen heeft dat geleid tot de ontdekking van vele andere antibiotica uit ver-schillende bronnen 339; 340. Desalniettemin, heeft het extensieve gebruik van antibiotica geleid tot de ontwikkeling van resistentie van micro- organismen 341. Hierdoor is er een drang ontstaan voor de ontwikkeling van nieuwe antibiotica met unieke eigenschappen. Dit heeft geleid tot grote programma’s om nieuwe natuurlijke producten met antibiotische activiteit te ontdekken. Het ontrafelen van de DNA sequentie en bioin-formatica geeft ons nu de kans om grote onderzoeken over het gehele genoom te doen 139; 140, dit heeft geleid tot de ontdekking dat het grootste deel van de genclusters welke coderen voor secundaire metabolieten in schimmels niet tot expressie komen onder laboratorium condities. Deze

Samenvatting

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5 5

108 109Samenvatting

genclusters coderen mogelijk voor onbekende moleculen met unieke (actieve) eigenschappen  6; 142. Om de grote hoeveelheid aan informatie goed te kunnen gebruiken is er een goede genetische ‘gereedschapskist’ nodig om de lange genetische clusters tot expressie te kunnen bren-gen en de informatie te kunnen gebruiken om nieuwe biosynthetische clusters te kunnen samenstellen. De ‘gereedschapkist’ om dit te kunnen doen in P. chrysogenum is relatief beperkt. Ondanks dat er transcriptie en translatie elementen zijn voor andere filamenteuze schimmels, zijn er maar enkele toegepast in P. chrysogenum. Daarnaast speelt DNA mo-dificatie een belangrijke rol in verdere engineering en verbetering van schimmels voor de productie van secundaire metabolieten. Recentelijk is het CRISPR/Cas9 DNA modificatie systeem ontwikkeld voor toepas-sing in P. chrysogenum 174. Ondanks dat zullen er echter ook nog andere mogelijkheden moeten worden ontwikkeld voor de reconstructie van metabolische routes met grote stukken DNA, inclusief het gebruik van autonoom replicerende plasmides 250, wellke slecht zijn ontwikkeld voor filamenteuze schimmels vanwege hun lage stabiliteit en de hoge kans op integratie in het genoom 165; 187; 249; 252; 253.

Hoofdstuk 1 geeft een inzicht in de moleculaire biologie van filamen-teuze schimmels en op de productie van secundaire metabolieten door P.  chrysogenum. Het hoofdstuk is gefocust op Non Ribosomale Peptide Synthetases (NRPS) en Polyketide Synthases (PKS) afgeleide producten en hun genetica. Ook wordt het klassieke stamverbeteringsprogramma en de genetische ‘gereedschapkist’ beschikbaar voor de modificatie van deze fila-menteuze schimmel en uitgebreid in de volgende hoofdstukken besproken.

Hoofdstuk 2 beschrijf de impact van de deletie van twee hoog tot expressie komende secundaire metaboliet genclusters welke coderen voor chrysogenine en roquefortine in een stam van P. chrysogenum welke geen penicilline gencluster meer heeft. Daarnaast wordt er een methode beschreven voor de verwijdering van het eerder genoemde penicilline gencluster (>20Kb) uit het genoom van P. chrysogenum door middel van Gateway klonering voor de constructie van grote deletie cassettes. De resulterende metabolieten arme stam is verder geanalyseerd door mid-del van metabolieten en genexpressie profilering. De DS68530∆chy stam waarin het chrysogine gencluster is verwijderd, produceert meer roque-fortine gerelateerde metabolieten, terwijl de expressie van dit genclus-ter hetzelfde blijft. Daarnaast zijn er fungisporine degradatie producten gedetecteerd in het medium, terwijl ook de expressie van het fungispo-rine NRPS eiwit is veranderd. Eerdere studies hebben aangetoond dat de verwijdering van alle kopieën van het penicilline gencluster resulteerde

in het volledige verlies van de penicilline productie, terwijl er grote hoe-veelheden roquefortine en chrysogine gerelateerde metabolieten werden geproduceerd 7. Een suggestie is dat er in deze stam een herverdeling van aminozuren in alternatieve secundaire metabolieten plaatsvindt, een fenomeen dat ook lijkt plaats te vinden in de stam waarin het chrysogine cluster is verwijderd. Het effect wordt vergroot in de DS68530∆chy∆roq stam waarin de opbouw van fungisporine gerelateerde metabolieten, waarschijnlijk degradatie producten, verder toeneemt. In deze stam, welke de drie hoogst tot expressie gebrachte NRPS genclusters mist, zijn ook nieuwe moleculen ontdekt. Deze moleculen zullen verder moeten worden onderzocht om ze aan één of meerdere secundaire metaboliet genclusters te kunnen koppelen. Vanwege de opbouw van fungisporine gerelateerde producten, zal het ook nodig zijn om het corresponderende NRPS gen uit te schakelen om een secundaire metaboliet arme stam te creëren, welke in de toekomst kan worden gebruikt als een productie platform voor gewenste secundaire metabolieten.

Hoofdstuk 3 is een studie welke homologe en heterologe promoters classificeert naar expressieniveau. Een set van zes constitutieve promo-toren uit A. niger en vier uit P. chrysogenum zijn getest in combinatie met twee terminatoren uit A. nidulans. Daarbovenop zijn de twee promoters uit P. chrysogenum welke verantwoordelijk zijn voor de expressie van pcbC en pcbAB getest en gebruikt als referentie 305. Er is een modulair promoter- reporter systeem gemaakt door gebruik te maken van de Golden gate klonerings techniek en door middel van in vivo homologe recombinatie in Saccharomyces cerrevisiae. De promoters zijn gebruikt om Green Flu-orescent Protein (GFP) tot expressie te brengen, terwijl Red Fluorescent Protein (RFP) gericht tegen microbodies werd gebruikt als interne stan-daard. Deze synthetische routes zijn geïntroduceerd in P. chrysogenum en de groei is beoordeeld in een BioLector fermentatiesysteem. Dit sys-teem kan worden gebruikt om op grote schaal fermentatie experimen-ten te doen, waarbij fermentatieparameters zoals de ontwikkeling van biomassa, pH, O2 concentratie en fluorescentie van reporter-eiwitten 282 online kunnen worden gemonitord. Gedurende deze studie is er gefo-cust op gemiddeld en hoog tot expressie komende genen tijdens groei condities welke relevant zijn voor de industriële productie van β-lactam antibiotica. De data levert een catalogus op van verschillende promoter sterktes, waarin een promoter van een secretie eiwit welke behoort tot de cerato-platanine familie van phytotoxines, Pc20g15140, het sterkste is, terwijl de An02g10320 promoter van glucoamylase het zwakst is gedu-rende deze analyse. Deze catalogus van verschillende promoter sterktes

Samenvatting

Sum

mar

y

and

conc

ludi

ng re

mar

ks

5 5

110 111Samenvatting

maakt het mogelijk om de expressie van genen beter te aan te passen aan de gebruikte condities in toekomstige stamverbeterings-programma’s.

In hoofdstuk 4 wordt een strategie beschreven om één van deze nieuwe promoters te combineren en te gebruiken. Het hoofdstuk be-schrijft de herintroductie van het penicilline gencluster (pcbAB, pcbC en PenDE) in een P. chrysogenum stam waar dit gencluster niet aanwezig is. Het cluster is geïntroduceerd op de originele locatie als ook in de inter-genetische regio tussen Pc20g07090 en Pc20g07100, welke ook is ge-bruikt in hoofdstuk 3 voor het introduceren van de promoter-reporter genomische integraties. Het gencluster is opgebouwd uit drie modules en geïntegreerd in het genoom door gebruik te maken van in vivo recom-binatie van overlappende DNA fragmenten in P. chrysogenum. Daarnaast is, gebaseerd op de efficiëntie van AMA plasmides aangetoond in eerdere studies, een mitotisch stabiel AMA plasmide systeem ontwikkeld als een nieuw platform voor de herintroductie en expressie van metabolische rou-tes. Deze methode is gebaseerd op het behoudt van een AMA replicerend plasmide door de complementatie van een essentiële genfunctie. In dit geval is de methode gebaseerd op het gelijktijdig gebruik van een deletie-cassette voor een essentieel gen (in dit geval Pc22g19890 coderend voor het tif35 gen welke is betrokken bij de expressie van de translatie initiatie factor subunit g (elF3g) 332 en een AMA plasmide welke een complemen-terende kopie van het essentiële gen bevat. Transformatie van de eerder genoemde deletiecassette en het AMA plasmide resulteert in de inactiva-tie van het essentiële gen waarvan de functie wordt gecomplementeerd door het gen gecodeerd op het AMA plasmide. Dit heeft tot gevolg dat het plasmide stabiel behouden blijft in P. chrysogenum (J. Kiel, personal communication). Het penicilline gencluster gecodeerd op drie verschil-lende DNA fragmenten is geassembleerd in vivo door Penicillium op het AMA plasmide. In ons ontwerp is de AmdS selectie marker gebruikt in één van de fragmenten om te kunnen selecteren op de aanwezigheid van het gencluster op het AMA plasmide en deze marker is niet nodig om het AMA plasmide in P. chrysogenum te kunnen behouden. Door herintroductie van het penicilline gencluster op chromosomale locaties zijn de penicilline G productieniveaus vergelijkbaar met het productieniveau van de stam met één enkele kopie van het gencluster (DS47274), wat aantoont dat de in vivo herintroductie van het gencluster succesvol is. Wanneer het penicil-line gencluster geherintroduceerd wordt op het AMA plasmide, is penicil-line G productie alleen maar aantoonbaar door middel van een bioassay. Uit LC-MS analyse blijkt dat de penicilline G concentraties in het medium erg laag zijn. Deze lage productie is onverwacht, maar kan verschillende

oorzaken hebben. De reguliere fermentatie condities zijn misschien niet optimaal voor de expressie van het grote (33 Kb) AMA plasmide. Het kan goed mogelijk zijn dat het gebruik van een lagere incubatie temperatuur en een andere pH 342 de expressie van pcbAB, pcbC en penDE verbetert en daarmee de productie van penicilline G. Ten tweede hebben filamenteuze schimmels een multi kern morfologie en aangezien er maar enkele rondes van selectie zijn uitgevoerd op AMA::PEN cluster transformanten, kan het mogelijk zijn dat de zuivering van de verschillende transformanten niet optimaal is. Verdere analyse van deze stammen zal moeten focussen op de kernsamenstelling, groei en expressie condities van deze stam.

Samengevat is de gepresenteerde herintroductie van metabolische rou-tes een eerste stap richting de implementatie van nieuwe metabolische routes in P. chrysogenum en er is aangetoond dat metabolische routes in vivo kunnen worden samengesteld uit verschillende DNA fragmenten. De opgedane kennis van functionele nieuwe promoters en terminators kan worden gecombineerd met in vivo recombinatie om nieuwe metabolische routes samen te stellen in Penicillium. Daarnaast kan de verder geopti-maliseerde secundaire metabolietenarme stam worden gebruikt als een natuurlijk platform voor de productie van secundaire metabolieten, als ook een bron van mogelijk nieuwe natuurlijke producten.

In conclusie kunnen de nieuwe strategieën worden toegepast voor ef-ficiëntere ontdekking, productie en modificatie van natuurlijke produc-ten welke kunnen worden gebruikt om resistente bacteriële infecties te behandelen.

APPENDIX

App

endi

x

A

115Acknowledgments

ACKNOWLEDGMENTS

Firstly, I would like to express my sincere gratitude to my mentor Prof.  dr.  Arnold J.M. Driessen for the opportunities he gave me: the pursuit first my master thesis and then a PhD position. Thank you for giving me the space to develop my own ideas and for your valuable support, motivation, and immense knowledge. Your guidance helped me throughout the thesis, from the start in the laboratory to the final writing phases of this thesis.

My sincere thanks also go to Prof. dr. Roel A.L. Bovenberg for the produc-tive conversations, suggestions, and assistance. Thank you for teaching me to plan efficiently and to examine problems in fine detail. Your pa-tience and smile were a great encouragement!

A special thank you to the members of the reading committee: Prof. dr. D.B. Janssen, Prof. dr L. Dijkhuizen, and Prof. dr. Arthur Ram who took the time to assess my thesis.

My heartfelt appreciation goes also to the co-authors of the papers in-cluded in this thesis for the valuable insights and contributions.

I am grateful to all the people in DSM that were involved in the Amoxi-green project for sharing their knowledge, experiences and ideas.

Next, I would like to thank Stefan for being a very good supervisor and friend. Thank you for taking your time to translate the thesis summary into Dutch.

Also, my dear paranimfen, Marten and Reto. Nothing can replace your friendship and support through all these years. Thank you for standing next to me on this important day of my life.

I would also like to thank the members of the Molmic group for making the lab a pleasant working environment. Bea, Manon and Anmara thanks for helping me in various ways.

A special thanks goes to my dear fellow PENmates for all the valuable feedback and discussions during the project meetings.

App

endi

x

A

117List of publications

I must express my very profound gratitude to my parents for providing me with unfailing support and continuous encouragement along the way. And to the rest of my family, thank you for always being there for me like nobody else can.

And finally last, but by no means least, to all my friends here and back home. Many thanks for all the fun we had together and for providing the support and love that I need!

Fabiola

LIST OF PUBLICATIONS

Polli, F., Meijrink, B., Bovenberg, R.A.L., Driessen, A.J.M., 2015. New pro-moters for strain engineering of Penicillium chrysogenum. Fungal Genet Biol. S1087-1845(15)30051-7.

Weber, S.S., Polli, F., Boer, R., Bovenberg, R.A.L., Driessen, A.J.M., 2012. Increased penicillin production in Penicillium chrysogenum production strains via balanced overexpression of Isopenicillin N Acyltransferase. Appl. Environ. Microbiol. 78, 7107–7113.

Polli, F., Viaggiano, A., Salo,O., Lankhorst, P., van der Hoeven, R., Bovenberg, R.A.L., Driessen, A.J.M., Towards a secondary metabolite deficient strain of Penicillium chrysogenum. MANUSCRIPT IN PREPARATION

Polli, F., Zwahlen, R.D., Crismaru, G.C., Lankhorst, P., van der Hoeven, R., Bovenberg, R.A.L., Driessen, A.J.M., An engineered two component Nonri-bosomal peptide synthetase (NRPS) producing a novel peptide-like com-pound in P. chrysogenum, using non-native NRPS inter-communicating linkers. MANUSCRIPT IN PREPARATION

App

endi

x

A

119References

REFERENCES1. Veiga, T. et al. Metabolic engineering of β-oxidation in

Penicillium chrysogenum for improved semi-synthetic cephalosporin biosynthesis. Metab. Eng. 14, 437–448 (2012).

2. Alberti, F., Foster, G. D. & Bailey, A. M. Natural prod-ucts from filamentous fungi and production by het-erologous expression. Appl. Microbiol. Biotechnol. 101, 493–500 (2017).

3. Theilgaard, H., van Den Berg, M., Mulder, C., Bovenberg, R. & Nielsen, J. Quantitative analysis of Penicillium chrysogenum Wis54-1255 transformants overexpress-ing the penicillin biosynthetic genes. Biotechnol. Bioeng. 72, 379–88 (2001).

4. Nijland, J. G. et al. Nonlinear biosynthetic gene cluster dose effect on penicillin production by Penicillium chrysogenum. Appl. Environ. Microbiol. 76, 7109–15 (2010).

5. Kiel, J. A. K. W., van der Klei, I. J., van den Berg, M. A., Bovenberg, R. A. L. & Veenhuis, M. Overproduction of a single protein, Pc-Pex11p, results in 2-fold enhanced penicillin production by Penicillium chrysogenum. Fun-gal Genet. Biol. 42, 154–164 (2005).

6. van den Berg, M. a et al. Genome sequencing and analy-sis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26, 1161–1168 (2008).

7. Salo, O. V. et al. Genomic mutational analysis of the impact of the classical strain improvement program on β–lactam producing Penicillium chrysogenum. BMC Genomics 16, 937 (2015).

8. Borel, J. F. History of the discovery of cyclosporin and of its early pharmacological development. Wien. Klin. Wochenschr. 114, 433–7 (2002).

9. Weber, S. S., Bovenberg, R. a L. & Driessen, A. J. M. Biosynthetic concepts for the production of β-lactam antibiotics in Penicillium chrysogenum. Biotechnol. J. 7, 225–36 (2012).

10. Büttel, Z. et al. Unlocking the potential of fungi: the QuantFung project. Fungal Biol. Biotechnol. 2, 6 (2015).

11. García-Rico, R. O., Chávez, R., Fierro, F. & Martín, J. F. Effect of a heterotrimeric G protein α subunit on co-nidia germination, stress response, and roquefortine C production in Penicillium roqueforti. Int. Microbiol. 12, 123–129 (2009).

12. Laich, F., Fierro, F., Cardoza, R. E. & Martin, J. F. Organi-zation of the gene cluster for biosynthesis of penicillin in Penicillium nalgiovense and antibiotic production in cured dry sausages. Appl. Environ. Microbiol. 65, 1236–40 (1999).

13. Newman, D. J., Cragg, G. M. & Snader, K. M. The influ-ence of natural products upon drug discovery (Antiq-uity to late 1999). Nat. Prod. Rep. 17, 215–234 (2000).

14. Newman, D. J. & Cragg, G. M. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod. 75, 311–35 (2012).

15. Regueira, T. B. et al. Molecular basis for mycophenolic acid biosynthesis in Penicillium brevicompactum. Appl. Environ. Microbiol. 77, 3035–43 (2011).

16. Cantwell, C., Beckmann, R., Whiteman, P., Queener, S. W. & Abraham, E. P. Isolation of deacetoxycepha-losporin C from fermentation broths of Penicillium chrysogenum transformants: construction of a new

fungal biosynthetic pathway. Proc. Biol. Sci. 248, 283–9 (1992).

17. Harris, D. M. et al. Engineering of Penicillium chrysoge-num for fermentative production of a novel carbam-oylated cephem antibiotic precursor. Metab. Eng. 11, 125–137 (2009).

18. Crawford, L. et al. Production of Cephalosporin In-termediates by Feeding Adipic Acid to Recombinant Penicillium chrysogenum Strains Expressing Ring Ex-pansion Activity. Bio/Technology 13, 58–62 (1995).

19. Robin, J., Jakobsen, M., Beyer, M., Noorman, H. & Niel-sen, J. Physiological characterisation of Penicillium chrysogenum strains expressing the expandase gene from Streptomyces clavuligerus during batch cultiva-tions. Growth and adipoyl-7-aminodeacetoxycephalo-sporanic acid production. Appl. Microbiol. Biotechnol. 57, 357–362 (2001).

20. Robin, J., Bonneau, S., Schipper, D., Noorman, H. & Nielsen, J. Influence of the adipate and dissolved oxy-gen concentrations on the β-lactam production during continuous cultivations of a Penicillium chrysogenum strain expressing the expandase gene from Streptomy-ces clavuligerus. Metab. Eng. 5, 42–48 (2003).

21. Taylor, J. W. Making the Deuteromycota redundant: a practical integration of mitosporic and meiosporic fungi. Can. J. Bot. (2011).

22. Henk, D. A. et al. Speciation despite globally overlap-ping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fun-gus. Mol. Ecol. 20, 4288–301 (2011).

23. Foreman, C. M. et al. When a habitat freezes solid: mi-croorganisms over-winter within the ice column of a coastal Antarctic lake. FEMS Microbiol. Ecol. 76, 401–12 (2011).

24. Bringmann, G. et al. Sorbicillactone A: a structurally unprecedented bioactive novel-type alkaloid from a sponge-derived fungus. Prog. Mol. Subcell. Biol. 37, 231–53 (2003).

25. Gao, Y. & Zhao, Y. Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRIS-PR-mediated genome editing. J. Integr. Plant Biol. 56, 343–349 (2014).

26. Casselton, L. & Zolan, M. The art and design of genetic screens: filamentous fungi. Nat. Rev. Genet. 3, 683–697 (2002).

27. Griffin, D. Fungal physiology. (1996).

28. Boisnard, S., Zickler, D., Picard, M. & Berteaux-Lecel-lier, V. Overexpression of a human and a fungal ABC transporter similarly suppresses the differentiation defects of a fungal peroxisomal mutant but introduces pleiotropic cellular effects. Mol. Microbiol. 49, 1287–96 (2003).

29. Carson, D. B. & Cooney, J. J. Microbodies in fungi: a review. J. Ind. Microbiol. 6, 1–18 (1990).

30. Maxwell, D. P., Armentrout, V. N. & Graves, L. B. Mi-crobodies in Plant Pathogenic Fungi. Annu. Rev. Phyto-pathol. 15, 119–134 (1977).

31. Gutiérrez-Correa, M., Ludeña, Y., Ramage, G. & Villena, G. K. Recent advances on filamentous fungal biofilms for industrial uses. Appl. Biochem. Biotechnol. 167, 1235–53 (2012).

App

endi

x

A A

References120 121References

32. Meyer, V. Genetic engineering of filamentous fungi- progress, obstacles and future trends. Biotechnol. Adv. 26, 177–85 (2008).

33. Müller, W. H. et al. Localization of the pathway of the penicillin biosynthesis in Penicillium chrysogenum. EMBO J. 10, 489–95 (1991).

34. Müller, W. H. et al. Involvement of microbodies in penicil-lin biosynthesis. Biochim. Biophys. Acta 1116, 210–3 (1992).

35. Opaliński, Ł., Kiel, J. A. K. W., Homan, T. G., Veenhuis, M. & Van Der Klei, I. J. Penicillium chrysogenum Pex14/17p  — a novel component of the peroxisomal membrane that is important for penicillin production. FEBS J. 277, 3203–3218 (2010).

36. Pontecorvo, G. The Parasexual Cycle in Fungi. Annu. Rev. Microbiol. 10, 393–400 (1956).

37. Pontecorvo, G. & Kafer, E. Genetic analysis based on mitotic recombination. Adv.Genetics 9, 71–104 (1958).

38. Strømnæs, Ø. & Garber, E. D. Heterocaryosis and the Parasexual Cycle in Aspergillus Fumigatus. Genetics 48, 653–662 (1963).

39. Samson, R. A., Hadlok, R. & Stolk, A. C. A taxonomic study of the Penicillium chrysogenum series. Antonie Van Leeuwenhoek 43, 169–175 (1977).

40. Scott, J., Untereiner, W. A., Wong, B., Straus, N. A. & Malloch, D. Genotypic variation in Penicillium chysoge-num from indoor environments. Mycologia 96, 1095–1105 (2004).

41. Dyer, P. S. & O’Gorman, C. M. A fungal sexual revolu-tion: Aspergillus and Penicillium show the way. Curr. Opin. Microbiol. 14, 649–654 (2011).

42. Böhm, J. et al. Sexual reproduction and mating- type-mediated strain development in the penicillin- producing fungus Penicillium chrysogenum. Proc. Natl. Acad. Sci. U. S. A. 110, 1476–81 (2013).

43. Ropars, J. et al. Induction of sexual reproduction and genetic diversity in the cheese fungus Penicillium roqueforti. Evol. Appl. 7, 433–441 (2014).

44. Woo, P. C. Y. et al. Genomic and experimental evidence for a potential sexual cycle in the pathogenic thermal dimorphic fungus Penicillium marneffei. FEBS Lett. 580, 3409–3416 (2006).

45. Cram, D. & Tishler, M. Mold metabolites. I. Isolation of several compounds from clinical penicillin. J. Am. Chem. Soc. (1948).

46. Cram, D. Mold metabolites. II. The structure of sor-bicillin, a pigment produced by the mold Penicillium notatum. J. Am. Chem. Soc. (1948).

47. Moyer, J., Stodola, H., Wachtel, L. & Coghill, D. Pe-nitrinic acid, a new pigment from Penicillium notatum. J. Biol. Chem. 159, 67–70 (1945).

48. Wagener, R. E., Davis, N. D. & Diener, U. L. Penitrem A and Roquefortine Production by Penicillium commune. Appl. Environ. Microbiol. 39, 882–7 (1980).

49. Steyn, P. S. The isolation, structure and absolute con-figuration of secalonic acid D, the toxic metabolite of Penicillium oxalicum. Tetrahedron 26, 51–57 (1970).

50. Overy, D. P., Nielsen, K. F. & Smedsgaard, J. Roque-fortine/Oxaline Biosynthesis Pathway Metabolites in Penicillium ser. Corymbifera: In Planta Production and Implications for Competitive Fitness. J. Chem. Ecol. 31, 2373–2390 (2005).

51. Hikino, H., Nabetani, S. & Takemoto, T. Structure and biosynthesis of chrysogine, a metabolite of Penicillium chrysogenum. Yakugaku Zasshi 93, 619–23 (1973).

52. Wei, R., Schnoes, H. K., Hart, P. A. & Strong, F. M. The structure of PR toxin, a mycotoxin from Penicillium roqueforti. Tetrahedron 31, 109–114 (1975).

53. Miller, R. F. & Huang, S. Isolation and Structure of Sorrentanone : A New Tetrasubstituted Quinone. J. Antibiot. (Tokyo). 48, 520–521 (1995).

54. Vesonder, R. F. Xanthocillin, A Metabolite of Eupenicillium Egyptiacum NRRL 1022. J. Nat. Prod. 42, 232–233 (1979).

55. Fleming, A. On the Antibacterial Action of Cultures of a Penicillium, with Special Reference to their Use in the Isolation of B. influenzæ. British journal of experimental pathology 10, 226 (1929).

56. Houbraken, J., Frisvad, J. C. & Samson, R. A. Fleming’s penicillin producing strain is not Penicillium chrysoge-num but P. rubens. IMA Fungus 2, 87–95 (2011).

57. Turner, W. Fungal metabolites. (Academic Press., 1971).

58. Calvo, A. M., Wilson, R. A., Bok, J. W. & Keller, N. P. Re-lationship between Secondary Metabolism and Fungal Development. Microbiol. Mol. Biol. Rev. 66, 447–459, (2002).

59. Calvo, A. M., Gardner, H. W. & Keller, N. P. Genetic connection between fatty acid metabolism and sporulation in Aspergillus nidulans. J. Biol. Chem. 276, 25766–74 (2001).

60. Champe, S. P. & el-Zayat, A. A. Isolation of a sexual sporulation hormone from Aspergillus nidulans. J. Bac-teriol. 171, 3982–8 (1989).

61. Champe, S. P., Rao, P. & Chang, A. An endogenous in-ducer of sexual development in Aspergillus nidulans. J. Gen. Microbiol. 133, 1383–7 (1987).

62. Kawamura, C., Tsujimoto, T. & Tsuge, T. Targeted dis-ruption of a melanin biosynthesis gene affects conidial development and UV tolerance in the Japanese pear pathotype of Alternaria alternata. Mol. Plant. Microbe. Interact. 12, 59–63 (1999).

63. Hicks, J. K., Yu, J. H., Keller, N. P. & Adams, T. H. Aspergil-lus sporulation and mycotoxin production both require inactivation of the FadA G alpha protein- dependent signaling pathway. EMBO J. 16, 4916–23 (1997).

64. Trail, F., Mahanti, N. & Linz, J. Molecular biology of af-latoxin biosynthesis. Microbiology 141, 755–765 (1995).

65. Guzmán-de-Peña, D. & Ruiz-Herrera, J. Relationship be-tween aflatoxin biosynthesis and sporulation in Asper-gillus parasiticus. Fungal Genet. Biol. 21, 198–205 (1997).

66. Reiss, J. Development of Aspergillus parasiticus and formation of aflatoxin B1 under the influence of con-idiogenesis affecting compounds. Arch. Microbiol. 133, 236–8 (1982).

67. Alspaugh, J. A., Perfect, J. R. & Heitman, J. Cryptococcus neoformans mating and virulence are regulated by the G-protein alpha subunit GPA1 and cAMP. Genes Dev. 11, 3206–17 (1997).

68. Calvo, A. M., Hinze, L. L., Gardner, H. W. & Keller, N. P. Sporogenic effect of polyunsaturated fatty acids on de-velopment of Aspergillus spp. Appl. Environ. Microbiol. 65, 3668–73 (1999).

69. Bird, B. A., Remaley, A. T. & Campbell, I. M. Breviana-mides A and B Are Formed Only After Conidiation Has

Begun in Solid Cultures of Penicillium brevicompactum. Appl. Environ. Microbiol. 42, 521–5 (1981).

70. Sim, S. C. Characterization of genes in the sterigmato-cystin gene cluster and their role in fitness of Aspergil-lus nidulans. (Texas A&M University, 2001).

71. Schimmel, T. G., Coffman, A. D. & Parsons, S. J. Effect of butyrolactone I on the producing fungus, Aspergillus terreus. Appl. Environ. Microbiol. 64, 3707–3712 (1998).

72. Abraham, E. P. & Newton, G. G. The structure of cephalesporin C. Biochem. J. 79, 377–393 (1961).

73. Lawen, A., Dittmann, J., Schmidt, B., Riesner, D. & Kleinkauf, H. Enzymatic biosynthesis of cyclosporin A and analogues. Biochimie 74, 511–6 (1992).

74. Nyfeler, R. & Keller-Schierlein, W. Metabolites of microorganisms. 143. Echinocandin B, a novel poly-peptide-antibiotic from Aspergillus nidulans var. echi-nulatus: isolation and structural components. Helv. Chim. Acta 57, 2459–77 (1974).

75. Schardl, C. L., Panaccione, D. G. & Tudzynski, P. Ergot alkaloids--biology and molecular biology. Alkaloids. Chem. Biol. 63, 45–86 (2006).

76. Chu, M. et al. Structure of Sch 528647: A New Antitu-mor Antibiotic Related to Fumagillin. J. Antibiot. (Tokyo). 54, 1096–1099 (2001).

77. Gelderblom, W. C. & Snyman, S. D. Mutagenicity of potentially carcinogenic mycotoxins produced byFu-sarium moniliforme. Mycotoxin Res. 7, 46–52 (1991).

78. Nieminen, S. M., Mäki-Paakkanen, J., Hirvonen, M.-R., Roponen, M. & von Wright, A. Genotoxicity of gliotoxin, a secondary metabolite of Aspergillus fumigatus, in a battery of short-term test systems. Mutat. Res. 520, 161–70 (2002).

79. Singh, S. B. et al. Structure and absolute stereochem-istry of HIV-1 integrase inhibitor integric acid. A novel eremophilane sesquiterpenoid produced by a Xylaria sp. Tetrahedron Lett. 40, 8775–8779 (1999).

80. Singh, S. B., Felock, P. & Hazuda, D. J. Chemical and enzymatic modifications of integric acid and HIV-1 in-tegrase inhibitory activity. Bioorg. Med. Chem. Lett. 10, 235–8 (2000).

81. Kennedy, J. et al. Modulation of polyketide synthase activity by accessory proteins during lovastatin bio-synthesis. Science 284, 1368–72 (1999).

82. Tsai, H. F., Chang, Y. C., Washburn, R. G., Wheeler, M. H. & Kwon-Chung, K. J. The developmentally regulated alb1 gene of Aspergillus fumigatus: its role in modula-tion of conidial morphology and virulence. J. Bacteriol. 180, 3031–8 (1998).

83. Dorner, J. W., Cole, R. J. & Diener, U. L. The relationship of Aspergillus flavus and Aspergillus parasiticus with reference to production of aflatoxins and cyclopiazonic acid. Mycopathologia 87, 13–15 (1984).

84. Land, C. J., Hult, K., Fuchs, R., Hagelberg, S. & Lund-ström, H. Tremorgenic mycotoxins from Aspergillus fumigatus as a possible occupational health problem in sawmills. Appl. Environ. Microbiol. 53, 787–790 (1987).

85. Sekiguchi, J. & Gaucher, G. M. Conidiogenesis and sec-ondary metabolism in Penicillium urticae. Appl. Environ. Microbiol. 33, 147–58 (1977).

86. Raper, K. B., Alexander, D. F. & Coghill, R. D. Penicillin: II. Natural Variation and Penicillin Production in Penicillium notatum and Allied Species. J. Bacteriol. 48, 639–59 (1944).

87. Kopp-Holtwiesche, B. & Rehm, H. J. Antimicrobial ac-tion of roquefortine. J. Environ. Pathol. Toxicol. Oncol. 10, 41–4 (1981).

88. Boukhalfa, H. & Crumbliss, A. L. Chemical aspects of siderophore mediated iron transport. Biometals 15, 325–39 (2002).

89. Cram, D. J. Mold metabolites; the structure of sor-bicillin, a pigment produced by the mold Penicillium notatum. J. Am. Chem. Soc. 70, 4240–3 (1948).

90. Abe, N., Yamamoto, K. & Hirota, A. Novel fungal me-tabolites, demethylsorbicillin and oxosorbicillinol, isolated from Trichoderma sp. USF-2690. Biosci. Bio-technol. Biochem. 64, 620–2 (2000).

91. Abe, N., Arakawa, T., Yamamoto, K. & Hirota, A. Biosyn-thesis of bisorbicillinoid in Trichoderma sp. USF-2690; evidence for the biosynthetic pathway, via sorbicilli-nol, of sorbicillin, bisorbicillinol, bisorbibutenolide, and bisorbicillinolide. Biosci. Biotechnol. Biochem. 66, 2090–9 (2002).

92. Wolf, J. C. & Mirocha, C. J. Regulation of sexual repro-duction in Gibberella zeae (Fusarium roxeum ‘gram-inearum’) by F-2 (Zearalenone). Can. J. Microbiol. 19, 725–34 (1973).

93. Cole, R., Schweikert, M. & Jarvis, B. Handbook of sec-ondary fungal metabolites, 3-volume set. (2003).

94. Raistrick, H. A region of biosynthesis. Proc. R. Soc. Lon-don. Ser. B, Biol. Sci. 136, 481–508, 4 pl (1950).

95. Rammelkamp, C. H. & Maxon, T. Resistance of Staph-ylococcus aureus to the Action of Penicillin. Exp. Biol. Med. 51, 386–389 (1942).

96. Finland, M. Emergence of antibiotic-resistant bacteria. N. Engl. J. Med. 253, 909–22; contd (1955).

97. Kong, K. F., Schneper, L. & Mathee, K. Beta-lactam anti-biotics: From antibiosis to resistance and bacteriology. Apmis 118, 1–36 (2010).

98. Keller, N. P., Turner, G. & Bennett, J. W. Fungal second-ary metabolism - from biochemistry to genomics. Nat. Rev. Microbiol. 3, 937–47 (2005).

99. Demain, A. L. & Fang, A. The natural functions of sec-ondary metabolites. Adv. Biochem. Eng. Biotechnol. 69, 1–39 (2000).

100. Wei, X., Yang, F. & Straney, D. C. Multiple non-ribo-somal peptide synthetase genes determine peptaibol synthesis in Trichoderma virens. Can. J. Microbiol. 51, 423–9 (2005).

101. Haq, I. U. & Elsas, J. D. Van. Biosynthesis and Molecu-lar Genetics of Fungal Secondary Metabolites, Volume 2. Biosynthesis and Molecular Genetics of Fungal Secondary Metabolites 2, (Springer, 2015).

102. Campbell, C. D. & Vederas, J. C. Biosynthesis of lovasta-tin and related metabolites formed by fungal iterative PKS enzymes. Biopolymers 93, 755–63 (2010).

103. Ammar, M. S., Gerber, N. N. & McDaniel, L. E. New an-tibiotic pigments related to fusarubin from Fusarium solani (Mart.) Sacc. I. Fermentation, isolation, and anti-microbial activities. J. Antibiot. (Tokyo). 32, 679–84 (1979).

104. Limón, M. C., Rodríguez-Ortiz, R. & Avalos, J. Bikaverin production and applications. Applied Microbiology and Biotechnology 87, 21–29 (2010).

105. Avalos, J. et al. Carotenoids. In Martín JM , García-Estrada C, Zeilinger S (eds) Biosynthesis and Molecular Genetics

App

endi

x

A A

References122 123References

of Fungal Secondary Metabolites. (Springer New York, 2014). doi:10.1007/978-1-4939-1191-2

106. Avalos, J. & Carmen Limón, M. Biological roles of fungal carotenoids. Curr. Genet. 61, 309–324 (2015).

107. Studt, L. & Tudzynski, B. in 209–238 (Springer New York, 2014). doi:10.1007/978-1-4939-1191-2_10

108. Hulvová, H., Galuszka, P., Frébortová, J. & Frébort, I. Parasitic fungus Claviceps as a source for biotechno-logical production of ergot alkaloids. Biotechnol. Adv. 31, 79–89 (2013).

109. Wallwey, C., Li, S.-M. & Keller, U. Ergot alkaloids: structure diversity, biosynthetic gene clusters and functional proof of biosynthetic genes. Nat. Prod. Rep. 28, 496–510 (2011).

110. Goh, E.-B. et al. Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of anti-biotics. Proc. Natl. Acad. Sci. U. S. A. 99, 17025–30 (2002).

111. Losada, L., Ajayi, O., Frisvad, J. C., Yu, J. & Nierman, W. C. Effect of competition on the production and activity of secondary metabolites in Aspergillus species. Med. Mycol. 47, S88–S96 (2009).

112. Fox, E. M. & Howlett, B. J. Secondary metabolism: reg-ulation and role in fungal biology. Curr. Opin. Microbiol. 11, 481–7 (2008).

113. Richards, T. A., Leonard, G., Soanes, D. M. & Talbot, N. J. Gene transfer into the fungi. Fungal Biol. Rev. 25, 98–110 (2011).

114. Ingolia, T. D. & Queener, S. W. Betalactam biosynthetic genes. Med. Res. Rev. 9, 245–264 (1989).

115. Liras, P., Rodríguez-García, A. & Martín, J. F. Evolution of the clusters of genes for beta-lactam antibiotics: a model for evolutive combinatorial assembly of new beta-lactams. Int. Microbiol. 1, 271–8 (1998).

116. Olson, M. V. When less is more: gene loss as an engine of evolutionary change. Am. J. Hum. Genet. 64, 18–23 (1999).

117. Yoshikuni, Y., Ferrin, T. E. & Keasling, J. D. Designed divergent evolution of enzyme function. Nature 440, 1078–82 (2006).

118. Phillips, D. R., Rasbery, J. M., Bartel, B. & Matsuda, S. P. Biosynthetic diversity in plant triterpene cyclization. Curr. Opin. Plant Biol. 9, 305–14 (2006).

119. Fischbach, M. A. & Walsh, C. T. Assembly-line enzymol-ogy for polyketide and nonribosomal Peptide antibiot-ics: logic, machinery, and mechanisms. Chem. Rev. 106, 3468–96 (2006).

120. Crawford, J. M. & Townsend, C. A. New insights into the formation of fungal aromatic polyketides. Nat. Rev. Microbiol. 8, 879–89 (2010).

121. Wu, K., Chung, L., Revill, W. P., Katz, L. & Reeves, C. D. The FK520 gene cluster of Streptomyces hygroscop-icus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251, 81–90 (2000).

122. Fischbach, M. A., Walsh, C. T. & Clardy, J. The evolu-tion of gene collectives: How natural selection drives chemical innovation. Proc. Natl. Acad. Sci. U. S. A. 105, 4601–8 (2008).

123. Jenke-Kodama, H., Börner, T. & Dittmann, E. Natural biocombinatorics in the polyketide synthase genes of the actinobacterium Streptomyces avermitilis. PLoS Comput. Biol. 2, e132 (2006).

124. Medema, M. H. et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite bio-synthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, W339–W346 (2011).

125. Trail, F. et al. Physical and transcriptional map of an aflatoxin gene cluster in Aspergillus parasiticus and functional disruption of a gene involved early in the aflatoxin pathway. Appl. Environ. Microbiol. 61, 2665–2673 (1995).

126. Lo, H.-C. et al. Two separate gene clusters encode the biosynthetic pathway for the meroterpenoids austinol and dehydroaustinol in Aspergillus nidulans. J. Am. Chem. Soc. 134, 4709–20 (2012).

127. Ali, H. et al. A branched biosynthetic pathway is involved in production of roquefortine and related compounds in Penicillium chrysogenum. PLoS One 8, e65328 (2013).

128. Lin, H.-C. et al. The fumagillin biosynthetic gene cluster in Aspergillus fumigatus encodes a cryptic terpene cyclase involved in the formation of β-trans-bergamo-tene. J. Am. Chem. Soc. 135, 4616–9 (2013).

129. Winter, J. M. et al. Identification and characterization of the chaetoviridin and chaetomugilin gene cluster in Chaetomium globosum reveal dual functions of an iter-ative highly-reducing polyketide synthase. J. Am. Chem. Soc. 134, 17900–3 (2012).

130. Strieker, M., Tanović, A. & Marahiel, M. A. Nonribo-somal peptide synthetases: structures and dynamics. Curr. Opin. Struct. Biol. 20, 234–40 (2010).

131. Walsh, C. T. et al. Tailoring enzymes that modify nonribo-somal peptides during and after chain elongation on NRPS assembly lines. Curr. Opin. Chem. Biol. 5, 525–534 (2001).

132. Cane, D. E. Introduction: Polyketide and Nonribosomal Polypeptide Biosynthesis. From Collie to Coli. Chem. Rev. 97, 2463–2464 (1997).

133. Aparicio, J. F. et al. Organization of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscop-icus: analysis of the enzymatic domains in the modular polyketide synthase. Gene 169, 9–16 (1996).

134. Gehring, A. M., Mori, I., Perry, R. D. & Walsh, C. T. The nonribosomal peptide synthetase HMWP2 forms a thiazoline ring during biogenesis of yersiniabactin, an iron-chelating virulence factor of Yersinia pestis. Bio-chemistry 37, 11637–11650 (1998).

135. Paitan, Y., Alon, G., Orr, E., Ron, E. Z. & Rosenberg, E. The first gene in the biosynthesis of the polyketide an-tibiotic TA of Myxococcus xanthus codes for a unique PKS module coupled to a peptide synthetase. J. Mol. Biol. 286, 465–74 (1999).

136. Wenzel, S. C. et al. Structure and biosynthesis of myxo-chromides S1-3 in Stigmatella aurantiaca: evidence for an iterative bacterial type I polyketide synthase and for module skipping in nonribosomal peptide biosynthesis. Chembiochem 6, 375–85 (2005).

137. Höfle, G. et al. Epothilone A and B—Novel 16-Mem-bered Macrolides with Cytotoxic Activity: Isolation, Crystal Structure, and Conformation in Solution. An-gew. Chemie Int. Ed. English 35, 1567–1569 (1996).

138. Molnár, I. et al. The biosynthetic gene cluster for the microtubule-stabilizing agents epothilones A and B from Sorangium cellulosum So ce90. Chem. Biol. 7, 97–109 (2000).

139. Khaldi, N. et al. SMURF: Genomic mapping of fungal secondary metabolite clusters. Fungal Genet. Biol. 47, 736–41 (2010).

140. Weber, T. et al. antiSMASH 3.0 – a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, W237-43 (2015).

141. Medema, M. H. et al. Minimum Information about a Bio-synthetic Gene cluster. Nat. Chem. Biol. 11, 625–631 (2015).

142. Brakhage, A. A. & Schroeckh, V. Fungal secondary me-tabolites - strategies to activate silent gene clusters. Fungal Genet. Biol. 48, 15–22 (2011).

143. Ries, M. I. et al. Novel key metabolites reveal further branching of the roquefortine/meleagrin biosynthetic pathway. J. Biol. Chem. 288, 37289–95 (2013).

144. Chiang, Y.-M. et al. Molecular genetic mining of the Aspergillus secondary metabolome: discovery of the emericellamide biosynthetic pathway. Chem. Biol. 15, 527–32 (2008).

145. Jiang, D. et al. Molecular tools for functional genomics in filamentous fungi: Recent advances and new strate-gies. Biotechnology Advances 31, 1562–1574 (2013).

146. Chakrabortti, A., Li, J. & Liang, Z.-X. Complete Genome Sequence of the Filamentous Fungus Aspergillus west-erdijkiae Reveals the Putative Biosynthetic Gene Cluster of Ochratoxin A. Genome Announc. 4, e00982-16 (2016).

147. Galagan, J. E. et al. The genome sequence of the filamentous fungus Neurospora crassa. Nature 422, 859–868 (2003).

148. Dhawale, S. S., Paietta, J. V & Marzluf, G. A. A new, rapid and efficient transformation procedure for Neu-rospora. Curr. Genet. 8, 77–9 (1984).

149. Ballance, D. J., Buxton, F. P. & Turner, G. Transformation of Aspergillus nidulans by the orotidine-5’-phosphate decarboxylase gene of Neurospora crassa. Biochem. Biophys. Res. Commun. 112, 284–9 (1983).

150. Tilburn, J. et al. Transformation by integration in Asper-gillus nidulans. Gene 26, 205–21 (1983).

151. Yelton, M. M., Hamer, J. E. & Timberlake, W. E. Trans-formation of Aspergillus nidulans by using a trpC plas-mid. Proc. Natl. Acad. Sci. U. S. A. 81, 1470–4 (1984).

152. Sánchez, O., Navarro, R. E. & Aguirre, J. Increased transformation frequency and tagging of develop-mental genes in Aspergillus nidulans by restriction enzyme-mediated integration (REMI). Mol. Gen. Genet. 258, 89–94 (1998).

153. Kamoun, S. Molecular genetics of pathogenic oomy-cetes. Eukaryot. Cell 2, 191–9 (2003).

154. Liu, Z. & Friesen, T. L. Polyethylene glycol (PEG)-medi-ated transformation in filamentous fungal pathogens. Methods Mol. Biol. 835, 365–75 (2012).

155. Chakraborty, B. N., Patterson, N. A. & Kapoor, M. An electroporation-based system for high-efficiency transformation of germinated conidia of filamentous fungi. Can. J. Microbiol. 37, 858–63 (1991).

156. Barcellos, F. G. et al. Genetic analysis of Aspergillus nid-ulans unstable transformants obtained by the biolistic process. Can. J. Microbiol. 44, 1137–41 (1998).

157. Klein, T. M., Wolf, E. D., Wu, R. & Sanford, J. C. High- velocity microprojectiles for delivering nucleic acids into living cells. Nature 327, 70–73 (1987).

158. Olmedo-Monfil, V., Cortés-Penagos, C. & Herrera-Es-trella, A. Three decades of fungal transformation: key concepts and applications. Methods Mol. Biol. 267, 297–313 (2004).

159. Kawai, S., Hashimoto, W. & Murata, K. Transformation of Saccharomyces cerevisiae and other fungi: methods and possible underlying mechanism. Bioeng. Bugs 1, 395–403 (2010).

160. Herzog, R. W., Daniell, H., Singh, N. K. & Lemke, P. A. A comparative study on the transformation of As-pergillus nidulans by microprojectile bombardment of conidia and a more conventional procedure using protoplasts treated with polyethyleneglycol. Appl. Mi-crobiol. Biotechnol. 45, 333–337 (1996).

161. Daboussi, M. J. et al. Transformation of seven species of filamentous fungi using the nitrate reductase gene of Aspergillus nidulans. Curr. Genet. 15, 453–456 (1989).

162. D’Enfert, C. Selection of multiple disruption events in Aspergillus fumigatus using the orotidine-5’-decarbox-ylase gene, pyrG, as a unique transformation marker. Curr. Genet. 30, 76–82 (1996).

163. Whitehead, M. P. et al. Transformation of a nitrate reduc-tase deficient mutant of Penicillium chrysogenum with the corresponding Aspergillus niger and A. nidulans niaD genes. Mol. Gen. Genet. MGG 216, 408–411 (1989).

164. Kelly, J. M. & Hynes, M. J. Multiple copies of the amdS gene of Aspergillus nidulans cause titration of trans- acting regulatory proteins. Curr. Genet. 12, 21–31 (1987).

165. Kelly, J. M. & Hynes, M. J. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. EMBO J. 4, 475–9 (1985).

166. Pontecorvo, G. & Sermonti, G. Parasexual Recombina-tion in Penicillium chrysogenum. J. Gen. Microbiol. 11, 94–104 (1954).

167. Austin, B., Hall, R. M. & Tyler, B. M. Optimized vectors and selection for transformation of Neurospora crassa and Aspergillus nidulans to bleomycin and phleomycin resistance. Gene 93, 157–162 (1990).

168. Krügel, H., Fiedler, G., Smith, C. & Baumberg, S. Se-quence and transcriptional analysis of the nourseo-thricin acetyltransferase-encoding gene nat1 from Streptomyces noursei. Gene 127, 127–131 (1993).

169. Punt, P. J., Oliver, R. P., Dingemanse, M. A., Pouwels, P. H. & van den Hondel, C. A. M. J. J. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 56, 117–124 (1987).

170. Abremski, K. & Hoess, R. Bacteriophage P1 site-specific recombination. Purification and properties of the Cre re-combinase protein. J. Biol. Chem. 259, 1509–1514 (1984).

171. Hartmann, T. et al. Validation of a self-excising marker in the human pathogen Aspergillus fumigatus by em-ploying the beta-rec/six site-specific recombination system. Appl. Environ. Microbiol. 76, 6313–7 (2010).

172. Kopke, K., Hoff, B. & Kück, U. Application of the Sac-charomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construc-tion of knockout strains devoid of heterologous genes. Appl. Environ. Microbiol. 76, 4664–74 (2010).

173. Liu, R., Chen, L., Jiang, Y., Zhou, Z. & Zou, G. Efficient ge-nome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 1, 15007 (2015).

174. Pohl, C., Kiel, J. A. K. W., Driessen, A. J. M., Bovenberg, R. A. L. & Nygård, Y. CRISPR/Cas9 Based Genome Editing of Penicillium chrysogenum. ACS Synth. Biol. 5, 754–764 (2016).

175. Chaveroche, M. K., Ghigo, J. M. & d’Enfert, C. A rapid method for efficient gene replacement in the

App

endi

x

A A

References124 125References

filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28, E97 (2000).

176. Michielse, C. B., Arentshorst, M., Ram, A. F. J. & Van Den Hondel, C. A. M. J. J. Agrobacterium-mediated transformation leads to improved gene replacement efficiency in Aspergillus awamori. Fungal Genet. Biol. 42, 9–19 (2005).

177. de Groot, M. J., Bundock, P., Hooykaas, P. J. & Beijer-sbergen, A. G. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839–842 (1998).

178. Critchlow, S. E. & Jackson, S. P. DNA end-joining: from yeast to man. Trends Biochem. Sci. 23, 394–398 (1998).

179. Arentshorst, M., Ram, A. F. J. & Meyer, V. Using non-ho-mologous end-joining-deficient strains for functional gene analyses in filamentous fungi. Methods Mol. Biol. 835, 133–150 (2012).

180. Carvalho, N. D. S. P., Arentshorst, M., Jin Kwon, M., Meyer, V. & Ram, A. F. J. Expanding the ku70 toolbox for filamentous fungi: establishment of complementation vectors and recipient strains for advanced gene analy-ses. Appl. Microbiol. Biotechnol. 87, 1463–1473 (2010).

181. Krappmann, S., Sasse, C. & Braus, G. H. Gene tar-geting in Aspergillus fumigatus by homologous recombination is facilitated in a nonhomologous end-joining-deficient genetic background. Eukaryot. Cell 5, 212–215 (2006).

182. Nayak, T. et al. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172, 1557–1566 (2006).

183. Ninomiya, Y., Suzuki, K., Ishii, C. & Inoue, H. Highly efficient gene replacements in Neurospora strains de-ficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. U. S. A. 101, 12248–12253 (2004).

184. Snoek, I. S. I. et al. Construction of an hdfA Penicillium chrysogenum strain impaired in non-homologous end-joining and analysis of its potential for functional analysis studies. Fungal Genet. Biol. 46, 418–426 (2009).

185. Takahashi, T., Masuda, T. & Koyama, Y. Enhanced gene targeting frequency in ku70 and ku80 disruption mu-tants of Aspergillus sojae and Aspergillus oryzae. Mol. Genet. Genomics 275, 460–470 (2006).

186. Bryant, J. A., Sellars, L. E., Busby, S. J. W. & Lee, D. J. Chromosome position effects on gene expression in Escherichia coli K-12. Nucleic Acids Res. 42, 11383–11392 (2014).

187. Wernars, K. et al. Gene amplification in Aspergillus nid-ulans by transformation with vectors containing the amdS gene. Curr. Genet. 9, 361–368 (1985).

188. Jeenes, D. J., Mackenzie, D. a, Roberts, I. N. & Archer, D. B. Heterologous protein production by filamentous fungi. Biotechnol. Genet. Eng. Rev. 9, 327–367 (1991).

189. Punt, P. J., Zegers, N. D., Busscher, M., Pouwels, P. H. & van den Hondel, C. A. Intracellular and extracellular production of proteins in Aspergillus under the control of expression signals of the highly expressed Aspergil-lus nidulans gpdA gene. J. Biotechnol. 17, 19–33 (1991).

190. Ruiz-Díez, B. Strategies for the transformation of fila-mentous fungi. J. Appl. Microbiol. 92, 189–95 (2002).

191. Mishra, N. C. & Tatum, E. L. Non-Mendelian inheritance of DNA-induced inositol independence in Neurospora. Proc. Natl. Acad. Sci. U. S. A. 70, 3875–9 (1973).

192. Lu, S. et al. Tagged mutations at the Tox1 locus of Co-chliobolus heterostrophus by restriction enzyme-me-diated integration. Proc. Natl. Acad. Sci. U. S. A. 91, 12649–53 (1994).

193. Weld, R. J., Plummer, K. M., Carpenter, M. & Ridgway, H. J. Approaches to functional genomics in filamentous fungi. Cell Res. 16, 31–44 (2006).

194. Daboussi, M.-J. & Capy, P. Transposable elements in filamentous fungi. Annu. Rev. Microbiol. 57, 275–299 (2003).

195. Hamer, L. et al. Gene discovery and gene function assignment in filamentous fungi. Proc. Natl. Acad. Sci. U. S. A. 98, 5110–5115 (2001).

196. Argos, P. et al. The integrase family of site-specific re-combinases: regional similarities and global diversity. EMBO J. 5, 433–40 (1986).

197. Hoess, R., Wierzbicki, A. & Abremski, K. Isolation and characterization of intermediates in site-specific re-combination. Proc. Natl. Acad. Sci. U. S. A. 84, 6840–4 (1987).

198. Mack, A., Sauer, B., Abremski, K. & Hoess, R. Stoichi-ometry of the cre recombinase bound to the lox recom-bining site. Nucleic Acids Res. 20, 4451–4455 (1992).

199. Sternberg, N. & Hamilton, D. Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites. J. Mol. Biol. 150, 467–486 (1981).

200. Bloemendal, S. et al. Tools for advanced and targeted genetic manipulation of the β-lactam antibiotic pro-ducer Acremonium chrysogenum. J. Biotechnol. 169, 51–62 (2014).

201. Fukushige, S. & Sauer, B. Genomic targeting with a positive-selection lox integration vector allows highly reproducible gene expression in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 89, 7905–9 (1992).

202. Sauer, B. & Henderson, N. Targeted insertion of ex-ogenous DNA into the eukaryotic genome by the Cre recombinase. New Biol. 2, 441–9 (1990).

203. Kilby, N. J., Snaith, M. R. & Murray, J. A. H. Site-specific recombinases: tools for genome engineering. Trends Genet. 9, 413–421 (1993).

204. Matsu-ura, T., Baek, M., Kwon, J. & Hong, C. Efficient gene editing in Neurospora crassa with CRISPR tech-nology. Fungal Biol. Biotechnol. 2, 4 (2015).

205. Tan, W. S., Carlson, D. F., Walton, M. W., Fahrenkrug, S. C. & Hackett, P. B. Precision Editing of Large Animal Genomes. Adv. Genet. 80, 37–97 (2012).

206. Smith, J. et al. A combinatorial approach to create artificial homing endonucleases cleaving chosen se-quences. Nucleic Acids Res. 34, e149 (2006).

207. de Souza, N. Primer: genome editing with engineered nucleases. Nat. Methods 9, 27–27 (2011).

208. Baker, M. Gene-editing nucleases. Nat. Methods 9, 23–26 (2012).

209. Carroll, D. Genome engineering with zinc-finger nucle-ases. Genetics 188, 773–782 (2011).

210. Pabo, C., Peisach, E. & Grant, R. Design and Selection of Novel Cyc2His2 Zinc Finger Proteins. Annu Rev Biochem 70, 313–340 (2001).

211. Lombardo, A. et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective

and robust tool for ATMT based gene deletion construc-tion in fungi. Fungal Genet. Biol. 48, 677–684 (2011).

231. Bundock, P. & Hooykaas, P. J. J. Integration of Agro-bacterium tumefaciens T-DNA in the Saccharomyces cerevisiae Genome by illegitimate recombination. Source Proc. Natl. Acad. Sci. United States Am. Genet. 93, 15272–15275 (1996).

232. Gibson, D. G. et al. Creation of a Bacterial Cell Con-trolled by a Chemically Synthesized Genome. Science 329, 52–56 (2010).

233. Merryman, C. & Gibson, D. G. Methods and applica-tions for assembling large DNA constructs. Metab. Eng. 14, 196–204 (2012).

234. Engler, C., Kandzia, R. & Marillonnet, S. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3, e3647 (2008).

235. Cane, D. E., Walsh, C. T. & Khosla, C. Harnessing the biosynthetic code: combinations, permutations, and mutations. Science 282, (1998).

236. Patten, P. A., Howard, R. J. & Stemmer, W. P. Applica-tions of DNA shuffling to pharmaceuticals and vaccines. Curr. Opin. Biotechnol. 8, 724–733 (1997).

237. Stemmer, W. P. C., Crameri, A., Raillard, S.-A. & Bermu-dez, E. DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature 391, 288–291 (1998).

238. Saunders, G., Picknett, T. M., Tuite, M. F. & Ward, M. Heterologous gene expression in filamentous fungi. Trends Biotechnol. 7, 283–287 (1989).

239. Cullen, D. et al. Controlled expression and secretion of bovine chymosin in Aspergillus nidulan. 5, 1–8 (1987).

240. Archer, D., Roberts, I. & MacKenzie, D. Heterologous protein secretion from Aspergillus niger in phos-phate-buffered batch culture. Appl. Microbiol. Biotech-nol. 34, (1990).

241. Gwynne, D. I. et al. Current use and continued devel-opment of an expression system derived from the eth-anol utilization regulon of Aspergillus nidulans. Found. Biotech. Ind. Ferment. Res. (1989).

242. Polli, F., Meijrink, B., Bovenberg, R. A. L. & Driessen, A. J. M. New promoters for strain engineering of Penicillium chrysogenum. Fungal Genet. Biol. (2015).

doi:10.1016/j.fgb.2015.12.003

243. Gwynne, D. I., Buxton, F. P., Williams, S. a., Garven, S. & Wayne Davies, R. Genetically Engineered Secretion of Active Human Interferon and a Bacterial Endoglu-canase from Aspergillus Nidulans. Bio/Technology 5, 713–719 (1987).

244. Meyer, V. et al. Fungal gene expression on demand: an inducible, tunable, and metabolism-independent expression system for Aspergillus niger. Appl. Environ. Microbiol. 77, 2975–83 (2011).

245. Vogt, K., Bhabhra, R., Rhodes, J. C. & Askew, D. S. Doxy-cycline-regulated gene expression in the opportunistic fungal pathogen Aspergillus fumigatus. BMC Microbiol. 5, 1 (2005).

246. Gossen, M. et al. Transcriptional activation by tetracy-clines in mammalian cells. Science 268, 1766–9 (1995).

247. Gritz, L. & Davies, J. Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phospho-transferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 25, 179–88 (1983).

lentiviral vector delivery. Nat. Biotechnol. 25, 1298–306 (2007).

212. Dupuy, A. et al. Targeted gene therapy of xeroderma pigmentosum cells using meganuclease and TALEN™. PLoS One 8, e78678 (2013).

213. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–23 (2013).

214. Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823–6 (2013).

215. Nødvig, C. S., Nielsen, J. B., Kogle, M. E. & Mortensen, U. H. A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One 10, e0133085 (2015).

216. Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A. & Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. MBio 6, e02097-14 (2015).

217. Zhang, C. et al. Efficient editing of malaria parasite genome using the CRISPR/Cas9 system. MBio 5, e01414-14 (2014).

218. Katayama, T. et al. Development of a genome editing technique using the CRISPR/Cas9 system in the indus-trial filamentous fungus Aspergillus oryzae. Biotechnol. Lett. 38, 637–42 (2016).

219. Anderson, J. C. et al. BglBricks: A flexible standard for biological part assembly. J. Biol. Eng. 4, 1 (2010).

220. Ellis, T., Adie, T. & Baldwin, G. S. DNA assembly for synthetic biology: from parts to pathways and beyond. Integr. Biol. (Camb). 3, 109–18 (2011).

221. You, C., Zhang, X.-Z. & Zhang, Y.-H. P. Simple cloning via direct transformation of PCR product (DNA Mul-timer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol. 78, 1593–5 (2012).

222. Hihlal, E., Braumann, I., van den Berg, M. & Kempken, F. Suitability of Vader for transposon-mediated muta-genesis in Aspergillus niger. Appl. Environ. Microbiol. 77, 2332–6 (2011).

223. Gibson, D. G. et al. One-step assembly in yeast of 25 overlapping DNA fragments to form a complete syn-thetic Mycoplasma genitalium genome. Proc. Natl. Acad. Sci. U. S. A. 105, 20404–9 (2008).

224. Gibson, D. G. et al. Enzymatic assembly of DNA mole-cules up to several hundred kilobases. Nat. Methods 6, 343–5 (2009).

225. Clarke, L. & Carbon, J. Isolation of a yeast centromere and construction of functional small circular chromo-somes. Nature 287, 504–509 (1980).

226. Takken, F. L. W. et al. A one-step method to convert vectors into binary vectors suited for Agrobacterium- mediated transformation. Curr. Genet. 45, 242–8 (2004).

227. Szewczyk, E. et al. Fusion PCR and gene targeting in Aspergillus nidulans. Nat. Protoc. 1, 3111–20 (2006).

228. Klock, H. E., Koesema, E. J., Knuth, M. W. & Lesley, S. A. Combining the polymerase incomplete primer ex-tension method for cloning and mutagenesis with mi-croscreening to accelerate structural genomics efforts. Proteins Struct. Funct. Genet. 71, 982–994 (2008).

229. Jiang, X. et al. In vitro assembly of multiple DNA fragments using successive hybridization. PLoS One 7, e30267 (2012).

230. Paz, Z. et al. One Step Construction of Agrobacterium- Recombination-ready-plasmids (OSCAR), an efficient

App

endi

x

A A

References126 127References

266. Ali, H. et al. A Non-Canonical NRPS Is Involved in the Synthesis of Fungisporin and Related Hydrophobic Cyclic Tetrapeptides in Penicillium chrysogenum. PLoS One 9, e98212 (2014).

267. Clark, B., Capon, R. J., Lacey, E., Tennant, S. & Gill, J. H. Roquefortine E, a diketopiperazine from an Australian iso-late of Gymnoascus reessii. J. Nat. Prod. 68, 1661–4 (2005).

268. Hendrickson, L. et al. Lovastatin biosynthesis in As-pergillus terreus: Characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthase gene. Chem. Biol. 6, 429–439 (1999).

269. Ferreira Koolen, H. H. et al. An antimicrobial diketo-piperazine alkaloid and co-metabolites from an endo-phytic strain of Gliocladium isolated from Strychnos cf. toxifera. B3 - Nat. Prod. Res. 26, 2013–2019 (2012).

270. Walton, J. D. HC-toxin. Phytochemistry 67, 1406–1413 (2006).

271. Hondel, C. Van den & Punt, P. Heterologous gene ex-pression in filamentous fungi. More gene Manip. fungi 396–428

272. Feng, B., Friedlin, E. & Marzluf, G. A. A reporter gene analysis of penicillin biosynthesis gene expression in Penicillium chrysogenum and its regulation by nitro-gen and glucose catabolite repression. Appl. Environ. Microbiol. 60, 4432–4439 (1994).

273. Haas, H., Redl, B., Friedlin, E. & Stöffler, G. Isolation and analysis of the Penicillium chrysogenum phoA gene encoding a secreted phosphate-repressible acid phosphatase. Gene 113, 129–133 (1992).

274. Hoskins, I. C. & Roberts, C. F. Expression of the 3-phosphoglycerate kinase gene (pgkA) of Penicilllum chrysogenum. MGG Mol. Gen. Genet. 243, 270–276 (1994).

275. Graessle, S. et al. Regulated system for heterologous gene expression in Penicillium chrysogenum. Appl. Environ. Microbiol. 63, 753–6 (1997).

276. Marx, F. et al. Cloning, structural organization and reg-ulation of expression of the Penicillium chrysogenum paf gene encoding an abundantly secreted protein with antifungal activity. Gene 167, 167–171 (1995).

277. Weber, S. S., Polli, F., Boer, R., Bovenberg, R. a L. & Driessen, A. J. M. Increased penicillin production in penicillium chrysogenum production strains via bal-anced overexpression of isopenicillin n acyltransferase. Appl. Environ. Microbiol. 78, 7107–7113 (2012).

278. Kolar, M., Punt, P. J., van den Hondel, C. A. M. J. J. & Schwab, H. Transformation of Penicillium chrysoge-num using dominant selection markers and expres-sion of an Escherichia coli lacZ fusion gene. Gene 62, 127–134 (1988).

279. Hevekerl, A., Kuenz, A. & Vorlop, K.-D. Filamentous fungi in microtiter plates-an easy way to optimize itaconic acid production with Aspergillus terreus. Appl. Microbiol. Biotechnol. 98, 6983–9 (2014).

280. Funke, M. et al. Microfluidic biolector-microfluidic bio-process control in microtiter plates. Biotechnol. Bioeng. 107, 497–505 (2010).

281. Samorski, M., Müller-Newen, G. & Büchs, J. Quasi-con-tinuous combined scattered light and fluorescence mea-surements: a novel measurement technique for shaken microtiter plates. Biotechnol. Bioeng. 92, 61–8 (2005).

282. Kensy, F., Engelbrecht, C. & Büchs, J. Scale-up from microtiter plate to laboratory fermenter: evaluation by online monitoring techniques of growth and protein

248. Allgaier, S., Weiland, N., Hamad, I. & Kempken, F. Ex-pression of ribonuclease A and ribonuclease N1 in the filamentous fungus Neurospora crassa. Appl. Microbiol. Biotechnol. 85, 1041–1049 (2010).

249. Gems, D., Johnstone, I. L. & Clutterbuck, A. J. An au-tonomously replicating plasmid transforms Aspergillus nidulans at high frequency. Gene 98, 61–67 (1991).

250. Stinchcomb, D., Struhl, K. & Davis, R. Yeast Chromo-somal Replicator. Nature (1979).

251. Aleksenko, A. & Clutterbuck, A. J. Autonomous Plasmid Replication in Aspergillus nidulans:AMA1 and MATE Elements. Fungal Genet. Biol. 21, 373–387 (1997).

252. Fierro, F., Laich, F., García-Rico, R. O. & Martín, J. F. High efficiency transformation of Penicillium nalgiovense with integrative and autonomously replicating plas-mids. Int. J. Food Microbiol. 90, 237–248 (2004).

253. Durrens, P., Green, P. M., Arst, H. N. & Scazzocchio, C. Heterologous insertion of transforming DNA and gen-eration of new deletions associated with transforma-tion in Aspergillus nidulans. MGG Mol. Gen. Genet. 203, 544–549 (1986).

254. Schechtman, M. G. Characterization of telomere DNA from Neurospora crassa. Gene 88, 159–165 (1990).

255. Smith, K. M., Galazka, J. M., Phatale, P. A., Connolly, L. R. & Freitag, M. Centromeres of filamentous fungi. Chromosome Research 20, 635–656 (2012).

256. Wu, C. et al. Characterization of chromosome ends in the filamentous fungus Neurospora crassa. Genetics 181, 1129–45 (2009).

257. Kistler, H. C. & Benny, U. Autonomously replicating plasmids and chromosome rearrangement during transformation of Nectria haematococca. Gene 117, 81–89 (1992).

258. Powell, W. A. & Kistler, H. C. In vivo rearrangement of foreign DNA by fusarium oxysporum produces linear self-replicating plasmids. J. Bacteriol. 172, 3163–3171 (1990).

259. Vinetsky, Y. P. et al. Regulatory activity of heterologous gene-activator xlnR of Aspergillus niger in Penicillium canescens. Biochem. Biokhimii͡a 74, 882–7 (2009).

260. Doelle, H. W., Rokem, S. & Berovic, M. (Marin). Bio-technology- Vol III -Genetic engineering of fungal cells. ( EOLSS Publishers, developed under the auspices of the UNESCO, 2009).

261. Keller, N. P. & Hohn, T. M. Metabolic pathway gene clusters in filamentous fungi. Fungal Genet. Biol. 21, 17–29 (1997).

262. Kovalchuk, A., Weber, S. S., Nijland, J. G., Bovenberg, R. A. L. & Driessen, A. J. M. Fungal ABC transporter dele-tion and localization analysis. Methods Mol. Biol. 835, 1–16 (2012).

263. Harju, S., Fedosyuk, H. & Peterson, K. R. Rapid isolation of yeast genomic DNA: Bust n’ Grab. BMC Biotechnol. 4, 8 (2004).

264. Harris, D. M. et al. Exploring and dissecting ge-nome-wide gene expression responses of Penicillium chrysogenum to phenylacetic acid consumption and penicillinG production. BMC Genomics 10, 75 (2009).

265. García-Estrada, C. et al. A single cluster of coregulated genes encodes the biosynthesis of the mycotoxins roquefortine C and meleagrin in Penicillium chrysoge-num. Chem. Biol. 18, 1499–1512 (2011)

299. Nijland, J. G., Kovalchuk, A., van den Berg, M. a, Boven-berg, R. a L. & Driessen, A. J. M. Expression of the transporter encoded by the cefT gene of Acremonium chrysogenum increases cephalosporin production in Penicillium chrysogenum. Fungal Genet. Biol. 45, 1415–21 (2008).

300. Gibbs, P. A., Seviour, R. J. & Schmid, F. Growth of fila-mentous fungi in submerged culture: problems and pos-sible solutions. Crit. Rev. Biotechnol. 20, 17–48 (2000).

301. Döbeli, H. et al. Recombinant Fusion Proteins for the Industrial Production of Disulfide Bridge Containing Peptides: Purification, Oxidation without Concatamer Formation, and Selective Cleavage. Protein Expr. Purif. 12, 404–414 (1998).

302. Nevalainen, K. M. H., Te’o, V. S. J. & Bergquist, P. L. Heterologous protein expression in filamentous fungi. Trends Biotechnol. 23, 468–74 (2005).

303. Su, X., Schmitz, G., Zhang, M., Mackie, R. I. & Cann, I. K. O. Heterologous Gene Expression in Filamentous Fungi. Adv. Appl. Microbiol. 81, 1–61 (2012).

304. Bourdichon, F. et al. Food fermentations: Microor-ganisms with technological beneficial use. Int. J. Food Microbiol. 154, 87–97 (2012).

305. Gutiérrez, S., Fierro, F., Casqueiro, J. & Martín, J. F. Gene organization and plasticity of the beta-lactam genes in different filamentous fungi. Antonie Van Leeuwenhoek 75, 81–94 (1999).

306. Takata, M. et al. Homologous recombination and non-homologous end-joining pathways of DNA dou-ble-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J. 17, 5497–5508 (1998).

307. Goins, C. L., Gerik, K. J. & Lodge, J. K. Improvements to gene deletion in the fungal pathogen Cryptococ-cus neoformans: absence of Ku proteins increases homologous recombination, and co-transformation of independent DNA molecules allows rapid complemen-tation of deletion phenotypes. Fungal Genet. Biol. 43, 531–44 (2006).

308. Leiter, É. et al. Antifungal protein PAF severely affects the integrity of the plasma membrane of Aspergillus nidulans and induces an apoptosis-like phenotype. An-timicrob. Agents Chemother. 49, 2445–2453 (2005).

309. Kaiserer, L. et al. Characterization of the Penicillium chrysogenum antifungal protein PAF. Arch. Microbiol. 180, 204–10 (2003).

310. Wnendt, S., Felske-Zech, H., Henze, P. P. C., Ulbrich, N. & Stahl, U. Characterization of the gene encoding alpha- sarcin, a ribosome-inactivating protein secreted by As-pergillus giganteus. Gene 124, 239–244 (1993).

311. Meyer, V., Wedde, M. & Stahl, U. Transcriptional regula-tion of the Antifungal Protein in Aspergillus giganteus. Mol. Genet. Genomics 266, 747–757 (2002).

312. Ballance, D. J. Sequences important for gene expres-sion in filamentous fungi. Yeast 2, 229–236 (1986).

313. Brakhage, A. A. et al. HAP-Like CCAAT-Binding Com-plexes in Filamentous Fungi: Implications for Biotech-nology. Fungal Genet. Biol. 27, 243–252 (1999).

314. Marx, F. Small, basic antifungal proteins secreted from filamentous ascomycetes: a comparative study regarding expression, structure, function and po-tential application. Appl. Microbiol. Biotechnol. 65, 133–142 (2004).

expression in Escherichia coli and Hansenula polymor-pha fermentations. Microb. Cell Fact. 8, 68 (2009).

283. Gorochowski, T. E., van den Berg, E., Kerkman, R., Roubos, J. A. & Bovenberg, R. A. L. Using Synthetic Biological Parts and Microbioreactors to Explore the Protein Expression Characteristics of Escherichia coli. ACS Synth. Biol. 3, 129–139 (2014).

284. Papagianni, M. Fungal morphology and metabolite pro-duction in submerged mycelial processes. Biotechnol. Adv. 22, 189–259 (2004).

285. Nijkamp, J. F. et al. De novo sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces cerevisiae CEN.PK113-7D, a model for modern industrial biotechnology. Microb. Cell Fact. 11, 36 (2012).

286. Bussey, H., Sherman, D. & Somers, J. M. Action of yeast killer factor: a resistant mutant with sensitive sphero-plasts. J. Bacteriol. 113, 1193–7 (1973).

287. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4, e5553 (2009).

288. Herrero, S., Takeshita, N. & Fischer, R. The Aspergillus nidulans CENP-E kinesin motor KipA interacts with the fungal homologue of the centromere-associated protein CENP-H at the kinetochore. Mol. Microbiol. 80, 981–94 (2011).

289. Batta, G. et al. Functional aspects of the solution struc-ture and dynamics of PAF - a highly-stable antifungal protein from Penicillium  chrysogenum. FEBS J. 276, 2875–2890 (2009).

290. Raymond, C. K., Pownder, T. A. & Sexson, S. L. General method for plasmid construction using homologous recombination. Biotechniques 26, 134–141 (1999).

291. Sikorski, R. S. & Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipula-tion of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27 (1989).

292. Gietz, R. D. & Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 31–4 (2007).

293. Oldenburg, K. R., Vo, K. T., Michaelis, S. & Paddon, C. Re-combination-mediated PCR-directed plasmid construc-tion in vivo in yeast. Nucleic Acids Res. 25, 451–452 (1997).

294. de Boer, P. et al. Highly efficient gene targeting in Pen-icillium chrysogenum using the bi-partite approach in ∆lig4 or ∆ku70 mutants. Fungal Genet. Biol. 47, 839–846 (2010).

295. Nielsen, M. L., De Jongh, W. A., Meijer, S. L., Nielsen, J. & Mortensen, U. H. Transient marker system for it-erative gene targeting of a prototrophic fungus. Appl. Environ. Microbiol. 73, 7240–7245 (2007).

296. Ganzlin, M. & Rinas, U. In-depth analysis of the Aspergil-lus niger glucoamylase (glaA) promoter performance us-ing high-throughput screening and controlled bioreactor cultivation techniques. J. Biotechnol. 135, 266–271 (2008).

297. Smith, T. L. et al. The promoter of the glucoamylase-en-coding gene of Aspergillus niger functions in Ustilago maydis. Gene 88, 259–262 (1990).

298. Menne, S., Walz, M. & Kück, U. Expression studies with the bidirectional pcbAB-pcbC promoter region from Acremonium chrysogenum using reporter gene fusions. Appl. Microbiol. Biotechnol. 42, 57–66 (1994).

A

References128

phenylacetyl-CoA ligase gene of Penicillium chrysoge-num encoding an aryl-capping enzyme that supplies phenylacetic acid to the isopenicillin N-acyltransferase. Biochem. J. 395, 147–55 (2006).

332. Phan, L. et al. Identification of a translation initiation factor 3 (eIF3) core complex, conserved in yeast and mammals, that interacts with eIF5. Mol. Cell. Biol. 18, 4935–46 (1998).

333. Prado, F. & Aguilera, A. New in-vivo cloning methods by homologous recombination in yeast. Curr. Genet. 25, 180–3 (1994).

334. Bird, D. & Bradshaw, R. Gene targeting is locus depen-dent in the filamentous fungus Aspergillus nidulans. Mol. Gen. Genet. 255, 219–25 (1997).

335. Kurtz, M. B., Cortelyou, M. W., Miller, S. M., Lai, M. & Kirsch, D. R. Development of autonomously replicating plasmids for Candida albicans. Mol. Cell. Biol. 7, 209–17 (1987).

336. Elander, R. P. Industrial production of beta-lactam an-tibiotics. Appl. Microbiol. Biotechnol. 61, 385–92 (2003).

337. Meijer, W. H. et al. Peroxisomes are required for effi-cient penicillin biosynthesis in Penicillium chrysoge-num. Appl. Environ. Microbiol. 76, 5702–9 (2010).

338. Kardos, N. & Demain, A. L. Penicillin: The medicine with the greatest impact on therapeutic outcomes. Ap-plied Microbiology and Biotechnology 92, 677–687 (2011).

339. Coates, A. R., Halls, G. & Hu, Y. Novel classes of antibi-otics or more of the same? British Journal of Pharmacol-ogy 163, 184–194 (2011).

340. Waksman, S. A. Streptomycin: background, isolation, properties, and utilization. Science 118, 259–66 (1953).

341. Spellberg, B. et al. The Epidemic of Antibiotic-Resistant Infections: A Call to Action for the Medical Community from the Infectious Diseases Society of America. Clin. Infect. Dis. 46, 155–164 (2008).

342. Wang, L., Ridgway, D., Gu, T. & Moo-Young, M. Biopro-cessing strategies to improve heterologous protein production in filamentous fungal fermentations. Bio-technology Advances 23, 115–129 (2005).

315. McLean, K. J. et al. Single-step fermentative production of the cholesterol-lowering drug pravastatin via repro-gramming of Penicillium chrysogenum. Proc. Natl. Acad. Sci. U. S. A. 112, 2847–52 (2015).

316. Van Boeckel, T. P. et al. Global antibiotic consumption 2000 to 2010: an analysis of national pharmaceutical sales data. Lancet Infect. Dis. 14, 742–750 (2014).

317. Gutiérrez, S., Casqueiro, J. & Martín, J. F. Filamentous fungi as cellular factories: Biodiversity of secondary metabolites. Rev. Iberoam. Micol. 17, S54-60 (2000).

318. Chiou, C.-H., Miller, M., Wilson, D. L., Trail, F. & Linz, J. E. Chromosomal location plays a role in regulation of aflatoxin gene expression in Aspergillus parasiticus. Appl. Environ. Microbiol. 68, 306–15 (2002).

319. Palmer, J. M. & Keller, N. P. Secondary metabolism in fungi: does chromosomal location matter? Curr. Opin. Microbiol. 13, 431–436 (2010).

320. Dillon, P. J. & Rosen, C. A. A rapid method for the construction of synthetic genes using the polymerase chain reaction. Biotechniques 9, 298, 300 (1990).

321. Weber, E., Engler, C., Gruetzner, R., Werner, S. & Marillonnet, S. A Modular Cloning System for Stan-dardized Assembly of Multigene Constructs. PLoS One 6, e16765 (2011).

322. Harris, D. M. et al. Enzymic analysis of NADPH metabolism in beta-lactam-producing Penicillium chrysogenum: presence of a mitochondrial NADPH dehydrogenase. Metab. Eng. 8, 91–101 (2006).

323. Kiel, J. A. K. W. et al. Matching the proteome to the genome: the microbody of penicillin-producing Pen-icillium chrysogenum cells. Funct. Integr. Genomics 9, 167–84 (2009).

324. Fierro, F., Kosalková, K., Gutiérrez, S. & Martín, J. F. Autonomously replicating plasmids carrying theAMA1 region inPenicillium chrysogenum. Curr. Genet. 29, 482–489 (1996).

325. Barredo, J. L., Cantoral, J. M., Alvarez, E., Díez, B. & Martín, J. F. Cloning, sequence analysis and transcrip-tional study of the isopenicillin N synthase of Penicil-lium chrysogenum AS-P-78. Mol. Gen. Genet. 216, 91–8 (1989).

326. Díez, B. et al. The cluster of penicillin biosynthetic genes. Identification and characterization of the pcbAB gene encoding the alpha-aminoadipyl-cysteinyl-valine synthetase and linkage to the pcbC and penDE genes. J. Biol. Chem. 265, 16358–65 (1990).

327. MacCabe, A. P. et al. Delta-(L-alpha-aminoadipyl)- L-cysteinyl-D-valine synthetase from Aspergillus nid-ulans. Molecular characterization of the acvA gene encoding the first enzyme of the penicillin biosynthetic pathway. J. Biol. Chem. 266, 12646–54 (1991).

328. Barredo, J. L. et al. Cloning and characterization of the acyl-coenzyme A: 6-aminopenicillanic-acid-acyl-transferase gene of Penicillium chrysogenum. Gene 83, 291–300 (1989).

329. Martin, J., Gutiérrez, S. & Demain, A. β-Lactams. Fungal 91–127 (1997).

330. Koetsier, M. J., Jekel, P. a, van den Berg, M. a, Bovenberg, R. a L. & Janssen, D. B. Characterization of a pheny-lacetate-CoA ligase from Penicillium chrysogenum. Biochem. J. 417, 467–76 (2009).

331. Lamas-Maceiras, M., Vaca, I., Rodríguez, E., Casqueiro, J. & Martín, J. F. Amplification and disruption of the