University of Groningen

Modulation of microglial activityKannan, Vishnu

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2013

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Kannan, V. (2013). Modulation of microglial activity. Groningen: s.n.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 05-06-2020

MODULATION OF MICROGLIAL ACTIVITY

Vishnu Kannan

Cc11trnk

Ivkd1•,che

Bibliorhcck

Groningcn

lJ

M C G

� TELLING EN behorend bij het proefschrift

MODULATION OF MICROGLIAL ACTIVITY

Van

Vishnu Kannan

1. Histone deacetylases (HDACs) are required to limit the microglial inflammatory

responses and HDAC inhibitor (HDACi) suppressed innate immunity in primary

mouse microglia (this thesis).

2. Broad spectrum HDAC inhibitor Trichostatin (TSA) did not attenuate progression

of EAE. This does not mean that TSA cannot be used in chronic mouse model, but

this effect could be due to increased astrocyte inflammatory response (this thesis).

3. HDAC inhibition resulted in increased expression of purinoreceptor and

neuroprotective property in microglia (this thesis).

4. Atypical orphan chemokine receptor have an important role in the regulation of

cellular migration in microglia as well as in other immune cells (this thesis).

5. Science is nothing, but trained and organized common sense (Thomas Huxley).

6. To me the idea is nothing else than the material world reflected in the human

mind (Lenin Karl Marx).

7. A hundred times every day I remind myself that my inner and outer life depend on

the labors of other men, living and dead, and that I must exert myself in order to

give in the same measure as I have received and am still receiving (Albert Einstein).

8. Live as if you were to die tomorrow and learn as if you were to live forever

(Mahatma Gandhi).

9. Applied science leads to reforms, pure science leads to revolutions (J.J.Thomson).

The research described in this thesis was conducted at the Department of Neuroscience,

Section Medical Physiology, University Medical Center Groningen (UMCG), University

of Groningen (RUG), The Netherlands. This work was supported by the RUG and the

graduate school of Behavioral and Cognitive Neurosciences (BCN). The printing of

thesis was financially supported by RUG, UMCG and BCN.

ISBN: 978-90-367-6179-6

Cover design: Ming-San Ma

Copyright© 2013 V. Kannan.

All rights reserved. No part of this book may be reproduced, stored in a retrieval system,

or transmitted in any form or by any means, without prior permission of the author.

Printing: Off Page, Amsterdam

Page layout: Vishnu Kannan

RIJKSUNIVERSITEIT GRONINGEN

MODULATION OF MICROGLIAL ACTIVITY

Proefschrift

ter verkrijging van het doctoraat in de Medische Wetenschappen

aan de Rijksuniversiteit Groningen op gezag van de

Rector Magnificus, dr. E. Sterken, in het openbaar te verdedigen op

maandag 1 juli 2013 om 14.30 uur

door Vishnu Kannan

geboren op 29 april 1981 te Alappuzha, India

Centrale Medische

Bibliorheek

Groningen G

Promoter:

Copromotor :

Beoordelingscommissie:

Prof. dr. H.W.G.M. Boddeke

Dr. B.J.L. Eggen

Prof. dr. U.L.M. Eisel Prof. dr. L.A.'t Hart Prof. dr. O.C.M. Sibon

TABLE OF CONTENTS

ABBREVIATIONS

CHAPTER 1:

CHAPTER 2:

CHAPTER 3:

CHAPTER 4:

CHAPTERS:

CHAPTER 6:

6-7

General Introduction and aims of the thesis 9-45

Histone deacetylase inhibitors suppress immune activation in 47-69

primary mouse microglia

The effect of histone deacetylase inhibitor trichostatin A on

experimental autoimmune encephalomyelitis.

ATP-dependent neuroprotection in NMDA-treated OHSCs

depends on functional P2X7 expression in microglia.

Inhibition of CXCR3 -mediated chemotaxis by the human

chemokine like protein CCX-CKR

Summarizing discussion

Nederlandse samenvatting

Acknowledgements

71-91

93-110

113-136

139-146

151-153

ABBREVIATIONS

ASC

ATP

BBG

BCA

BzATP

CAMP

CBP

CCR2

CFA

CNS

Cxlrl

DAMPS

DARC

DMSO

DNMTS

EAE

ELISA

ERK 1/2

GR

GPCRs

GNAT

HATS

HBSS

HDACS

HDACi

HMBS

HMGBl

HSPS

hr

IFNy

IFNg-/­

lRF7

IRAKs

I.P

IL-4

IL-6

IL-12

iKK

iNOS

IRAKs

KLF4

Apoptosis-associated spike like protein

Adenosine 5-triphosphate

Brilliant Blue G

Bicinchonicic acid

3' -0-(4- benzoyl) benzoyl adenosine 5' - triphosphate

Cathelicidin-related antimicrobial peptide

CREB-binding protein

Chemokine receptor 2

Complete Freud"s adjuvant

Central nervous system

Cx3c-chemokine receptor 1

Damage associated molecular patterns

Duffy antigen receptor for chemokines

Dimethylsulphoxide

DNA methyltransferases

Experimental Autoimmune Encephalomyelitis

Enzyme linked lmmunosorbent Assay

Extracellular regulated kinases

Glucocorticoid receptor

G-protein coupled receptor

GCNS-related N-acetyltransferases

Histone acetyltransferases

Hank"s balanced salt solution

Histone deacetylases

Histone deacetylase inhibitors

Hydroxy methylbilane synthase

High mobility group Bl

Heat shock proteins

Hour

Interferon gamma

IFN gamma deficient mice

Interferon regulatory factor 7

I L-1 R-associated kinases

lntraperitonially

Interleukin - 4

Interleukin - 6

Interleukin -12

inhibitor kinase

inducible nitric oxide synthase

interleukin -1- receptor associated kinase

Kruppel like transcription factor

LPS Ly6C MeSATP LRR MTT min miRNA MS MMP NT NK NMDA OPCS OHSC PAMPS PCAF PET PFA Pl PI3K Pi3krl-/­PR PLL PTX q RT-PCR ROS RT SAM SC SD SEM SAHA socs SiRNA SIP T

TAB2 TICAM-1 TLRs TRAF6 TSA VPA

Lipopolysaccharide Lymphocyte antigen 6C 2-methylthio-adenosine 5"-triphosphate Leucine rich repeat (3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazoliumbromide minute MicroRNA

Multiple Sclerosis Matrix Metalloproteinase Non-tolerizable Natural Killer N-methyl-D-asparate Oligodendrocyte progenitor cells Organotypic hippocampal slice cultures Pathogen-associated molecular patterns p300-CBP associated factor Positron emission topography Paraformaldehyde Propidium iodide Phosphoinositide 3 kinase PI3 kinase receptor deficient mice Phenol Red Poly-L-Lysine Pertussis toxin Quantitative RT-PCR Reactive Oxygen Species Room temperature S-adenosyl methionine Subcutaneous Standarad Deviation Standarad Error of Mean Suberoylanilide hydroxamic acid Suppressor of cytokine signaling Small interfering RNA Sphingosine-1-phosphate Tolerizable TAKl binding protein TIR containing adaptor molecule Toll like receptors TN FR-associated factor 6 Trichostatin A Valproic acid

CHAPTER 1

General introduction and aims

of the thesis

CHAPTER 1

INTRODUCTION CONTENTS

1. GENERAL ASPECTS OF MICROGLIA 1.1. Origin of microglia 1.2. General functions of microglia

(a) Maintenance of homeostasis (b) Monitoring (c) Phagocytosis

1. 3. Chemokines and their receptors in microglial signaling 1.4. Purine receptors in microglial inflammatory responses 1. 5. Toll like receptors and inflammatory response 1.6. lnflammasomes 1.7. Microglia activity during Experimental autoimmune encephalomyelitis

and multiple sclerosis 1.8. Astrocytes in inflammation and multiple sclerosis 1.9. Epigenetics marks - a general overview

2. EP IGENET ICS IN INFLAMMATION 2.1 Histone modifications and inflammation

(a) Histone acetyltransferases and inflammation (b) Histone deacetylases and inflammation (c) Histone deacetylase inhibitors: overview (d) DNA methylation and inflammation (e) MicroRNAs and inflammation

3. T RANSCRI PT ION FACTORS IN INFLAMMATORY RESPONSES

4. A IMS AND OUTLINE OF THE THESIS

5. REFERENCES

10

11 11 11 11 13 13 14 15 16 19

20

21 22

23 23 23 24 25 26 27

28

30

31

1 GENERAL ASPECTS OF MICROGLIA

1.1. Origin of microglia

General Introduction

Microglia are the primary immune cells of the central nervous system (CNS) and are considered tissue macrophages (Ransohoff and Perry, 2009; Streit, 2002). Microglia

as resident brain myeloid cells were first discovered by Rio-Hortgea (del Rio-Hortega, 1932) and have been shown to make up 5-10% of the total glial cell population in the CNS (Carson, 2002; Greter and Merad, 2013). Research over the past decades has shown that microglia originate from the mesoderm (Alliot et al., 1999; Chan et al., 2007). It is generally assumed that haematopoietic progenitor cells colonize the brain during the embryonic and perinatal stages of development and contribute to the local microglia population. In a later study using chimeric animals it was shown that contribution of blood borne cells to the microglia population in the normal undistributed brain is almost negligible (Ajami et al., 2007). Recently, Ginhouz and co­workers (2010) showed that microglia are derived from embryonic macrophages from the yolk sac, before embryonic day 8 (E8) and give rise to resident macrophages in the CNS. In the same study it was shown that primitive macrophages migrate to the developing neural tube and give rise to microglia. In line with this, other studies have shown that in traumatic brain lesions, using an intravenous injection of colloidal carbon as a cytoplasmic marker for monocytes, carbon­labelled monocytes were the main source of brain macrophages, some of which transformed into microglia during the healing process. In conclusion, these results derived from the normal and altered brain development as well as from experimental lesions, tend to favour the view of the monocytic nature of microglia. In a later study it was showed that in CX3C-chemokine receptor 1 (Cx3crl)-GFP transgenic mice fetal yolk sac monocytes at embryonic day 8.5 (E8.5) migrate and invade the CNS via blood stream, ventricles as well as meninges at El0.5 which emphasize the developmental stage at which seeding of myeloid cells take place in the CNS (Ginhoux et al., 2010; Jung et al., 2000). Collectively these data confirm that adult microglia are derived from primitive myeloid precursors in the CNS (Leavy, 2010).

1.2. General functions of microglia

(a) Maintenance of homeostasis

In the healthy adult brain, distribution of parenchymal microglia is determined by the cytoarchitecture of brain regions, which determines the morphology of microglia within the anatomical region e.g. in cortical grey matter (with bipolar arborised microglia) and callosal white matter (with radially extending processes microglia (Lawson et al., 1990). Studies using two-photon microscopy showed that under physiological conditions microglia have a ramified morphology and are responsible for maintenance of homeostasis and immune surveillance (Gonzalez-Scarano and Baltuch, 1999; Haynes et al., 2006; Nimmerjahn et al., 2005). Several reports suggest that microglia are maintained in this quiescent state via neuron mediated signals which act as so called 'Off' signals. In these studies several interesting findings were reported. First of all, Off signals are constitutively present on neurons which express CX

3C-chemokine

ligand 1 (CX3CL1), CD47, CD200 or CD55 on their membrane surface, respectively (Fig 1.1). On the other hand 'On' signals are inducible and are commonly secreted by damaged neurons which includes purines and glutamate (Gemma et al., 2010). In addition, neurons utilize other signaling

11

• C u I­C < J (._

CHAPTER 1

molecules, including neurotransmitters to act as 'On' and 'Off' signals to maintain microglia in resting state (Biber et al., 2007; Hanisch and Kettenmann, 2007). Furthermore, several studies have shown chemokines and their corresponding receptors (CX3CL1-CX3CR1) as promising candidates for neuron-glia cross talk as well for maintenance of microglia in their resting state (Harrison et al., 1998; Meucci et al., 1998; Nishiyori et al., 1998). Considering the importance of 'Off' signals in maintaining microglia in their resting state, studies using a CXFRl transgenic mouse model have provided evidence that in C\CRl 1· mice, microglia showed enhanced reactivity (Cardona et al., 2006). Another 'Off' signal CD200 (membrane glycoprotein) has been reported to maintain the resting state and mice lacking CD200R showed an accelerated microglial response to injury (Hoek et al., 2000). In addition the same study suggested that CD200·1- mice, resulted in a more rapid onset of EAE. Further reports suggested that CD200 down-regulates the activity of microglia upon ligation with CD200 receptor (CD200R) via activation of an anti-inflammatory signaling pathway (Hatherley and Barclay, 2004).

In response to brain injury or inflammatory stimuli, microglia transform from ramified to an amoeboid shape and express high levels of activation markers and release various cytokines and chemokines (Hanisch and Kettenmann, 2007; Kraft and Harry, 2011; Ransohoff and Brown, 2012; Town et al., 2005). Microglial activation can have both beneficial as well as detrimental effects (Schwartz et al., 2006). Benefical functions of microglia include (a) secretion of cytokines, chemokines as well as soluble mediators which create an environment conductive for repair and regeneration (b) removal of apoptotic cells at the site of lesion (c) recruitment of stem cell population for the induction of neurogenesis. In detail, microgliosis has reported to be beneficial in nitric oxide-dependent excitotoxicity (Turrin and Rivest, 2006) as well as in stroke (Lalancette-Hebert et al., 2007). Earlier studies showed neuroprotective activity of microglia in mouse models of amyotrophic lateral sclerosis (Boillee et al., 2006) and in Alzheimer's disease (El Khoury et al., 2007). On the other hand several reports suggested that microglial

Neuron Resting microglial cell

Fig 1.1: Neuron-glia interaction. In normal adult brain, microglia in steady state condition are maintained via neuron-derived signals (C047, C0200 and C022) and acts on corresponding receptor expressed in microglia (Adapted from Saijo and Glass, 2011).

12

General Introduction

activation in response to neuronal death or neuronal damage can be toxic and destructive (Gao et al., 2003; Huh et al., 2003). Similar to macrophages, in vitro microglia can show two distinct activation patterns, the Ml phenotype (classical activation) which is induced by LPS and IFNy and represents a pro-inflammatory phenotype which is hallmarked by secretion of inflammatory cytokines and neurotoxic activity (Butovsky et al., 2006; Gordon, 2003). On the other hand microglia treated with interleukin-4 (IL-4) or IL-13 display an M2 phenotype (alternative activation), which has an anti-inflammatory effects and promotes tissue repair and secretion of neurotrophic factors (Henkel et al., 2009).

(b) Monitoring

The innate immune system represents the first line of host defense in response to pathogens. Like peripheral immune cells, microglia express receptors for recognition of conserved structures on pathogens, called pathogen-associated molecular patterns (PAMPs). Upon pathogen recognition, pattern recognition receptors (PRRs) trigger pro-inflammatory and anti-microbial processes and elicit an immune response (Peri and Piazza, 2012). These pathogen recognition receptors include Toll like receptors (TLRs), which are transmembrane proteins containing a highly conserved leucine-rich repeat (LRR), a single transmembrane and a cytoplasmic tail (Han and Ulevitch, 2005). In a later study it was shown that TLRs are either localized in plasma membrane to recognize microbial components (Miyake, 2007) or in endocytic compartments recognizing nucleic acids from pathogens (Akira et al., 2012; Kawai and Akira, 2011). To date ten TLRs (TLRl-10) in humans and TLRs (1-14) in mouse have been indentifed, which recognize various PAMPs. One of the well studied TLRs includes TLR4 which selectively recognizes a bacterial cell wall component lipopolysaccharide (LPS) (Beutler et al., 2001; Beutler, 2002).

(c) Phagocytosis

Microglia are the key regulators of brain inflammation and their chronic activation results in neuronal death. Under basal conditions, phagocytosis seems to be performed by ramified microglia (Sierra et al., 2010), in contrast during neurodegeneration where phagocytosis is mediated by amoeboid microglia (Kettenmann, 2007). Microglial phagocytosis can be classified into two categories based on the presence or absence of inflammation (Neumann et al., 2009). Microglia express a variety of phagocytic receptor subtypes: (a) receptors which mediate the removal of microbes including CD14, CD36 and certain TLRs (TLR 1, 2, 4 and 6). It was shown that CR3, a classical microglial phagocytic receptor is implicated in the removal of microbes via the induction of MHC-II molecule (Kaur et al., 2004) (b) receptors recognizing apoptotic cellular material like TREM2 which is highly expressed in microglia under neurodegenerative conditions, which is essential for the clearance of apopotic neurons by microglia (Sessa et al., 2004; Takahashi et al., 2005). Another phagocytic receptor includes CD14, which mediates phagocytosis under both normal and inflammatory conditions (Schlegel et al., 1999) as well as phagocytosis of amyloid 13 (Liu et al., 2005). In line with this, in a mouse model for multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE), blockade of TREM2 at the effector phase of disease resulted in increased disease severity due to the migration of peripheral infiltrates (Piccio et al., 2007). It is also shown that under in vitro conditions, TREM2 mediated signaling enhanced the removal of debris in the absence of inflammation (Takahashi

13

I

CHAPTER 1

et al., 2005). These findings suggest that microglia are the principal cell type involved in

themaintenance of brain homoestasis.

1.3. Chemokines and their receptors in CNS in microglial signaling

Chemokines are small proteins (8-12 kDa) which play an important role in immune cell

trafficking (Moser and Loetscher, 2001; Sallusto and Baggiolini, 2008). Many reports indicated

that microglia and astrocytes are the primary source of chemokines in the CNS. Chemokines

act as key regulators in injury and in response to neuroinflammation (Bertollini et al., 2006;

Charo and Ransohoff, 2006; de Haas et al., 2007; Rostene et al., 2007; Ubogu et al., 2006). Based

on the number and position of conserved cysteine residues in their amino (NH2) terminus,

chemokines are classified into four subfamilies (CC, CXC, CX3C and C) (Fernandez and Lolis,

2002). Chemokines act via chemokine receptors, a family of G-protein coupled receptors

(GPCRs), which initiate the rearrangement of cytoskeleton, triggering cellular migration

(Sanchez-Madrid and del Pozo, 1999). Chemokines have also been divided into two classes

(a) Constitutive chemokines, that are continuously expressed in the CNS (Cartier et al., 2005;

Semple et al., 2010).

(b) Inducible chemokines, which are expressed in response to CNS injury or aninflammatory

trigger (Biber et al., 2002).

Chemokine receptors that are constitutively expressed in CNS include CXCR3, CXCR4, CCR5,

CX3CR1 etc (Biber et al., 2006; Rostene et al., 2007; Tran and Miller, 2003). Additionally, CXCR3

is expressed by activated T cells, natural killer cells (NK), endothelial cells and by cancer cells

(Fulton, 2009; Garcia-Lopez et al., 2001). Furthermore, it was shown that CXCR3 dimerizes with

other chemokine receptors and thereby affects chemokine binding as well as receptor signaling

(Vischer et al., 2011). It was postulated that the expression of CXCR3 as well as its ligand CXCLl0

is induced under inflammatory conditions. This was further confirmed in vitro, suggesting that

CXCLlO induces CXCR3-mediated migration in primary microglial cultures (Biber et al., 2001;

Biber et al., 2002; Rappert et al., 2004) and proliferation in primary astrocytes (Flynn et al.,

2003). Furthermore, CXCR3 has been shown to play a major role in auto-immune diseases like

rheumatoid arthritis, systemic lupus erythematosus and in transplant rejection (Lacotte et al.,

2009). In subsequent studies it was found that under neurodegenerative situations, inducible

chemokines including CXCLlO, CX3CL1 and CCL2 are expressed not only in glial cells but also in

neurons (Baron et al., 2005; Rostasy et al., 2003; Sui et al., 2004).

It has become clear that chemokine ligand binding does not always result in signal

transduction. This is the case for atypical chemokine receptors. Five atypical chemokine orphan

receptors including human Duffy antigen receptor for chemokines (DARC), D6 receptor, CCRL2

and CCX-CKR (Ulvmar et al., 2011) have been categorized as "orphan" chemokine receptors. It

has been suggested that these chemokine receptors sequester chemokines and thus serve as

a sink that neutralizes chemokine gradients (Borroni et al., 2006; Fra et al., 2003; Weber et al.,

2004). It has been reported that these atypical chemokine receptors bind chemokines, followed

by internalization and chemokine degradation (Catusse et al., 2010; Mantovani et al., 2006). The

DARC receptor was identified as a 'multispecific' chemokine receptor on red blood cells that

14

General Introduction

binds CXCL8 and CCL2 (Neote et al., 1993). Recent studies have shown that DARC internalize

chemokines, but cannot efficiently scavenge. In the same study it was showed that in murine

blood vessels, overexpression of DARC caused chemokine-induced leukocyte extravasation

were DARC triggered chemokine activity as well as hypersensitivity reactions (Pruenster et al. ,

2009). In contrast, chemokine receptor D6 has been shown to act as a scavenger of chemokines

and thereby to play a crucial role in the modulation of inflammation (Graham, 2009). It was

shown that transgenic D6 knockout mice displayed excessive inflammatory responses in skin

inflammation models (Jamieson et al., 2005). On the other hand, it was shown that D6 knock

out mice were resistant to the development of EAE through impairment of T cell responses

which resulted in reduced spinal cord inflammation demyelination (Liu et al., 2006).

The orphan chemokine receptor, CCX-CKR is most recently discovered (Gosling et al., 2000),

however little is known about its functionality and biological significance. CCX-CKR is found to be

expressed in heart, intestine, in stromal cells of lymph nodes and thymic epithelial cells (Townson

and Nibbs, 2002). It was found that CCX-CKR binds CC ligands like CCL19, CCL21 and CCL25 (Gosling

et al., 2000). It was found that in vitro, expression of CCX-CKR is modulated by stimulation with

inflammatory cytokines like I L-1J3, TNF-a and interferon-y (I FN-y) (Feng et al., 2009). Increased

expression of CCX-CKR ligands (CCL19) is induced in pulmonary sarcoidosis, which leads to the

development of alveolitis in the lung via the recruitment of CD4+ lymphocytes (Kriegova et al.,

2006). Also there is a high correlation between expression levels of CCX-CKR and the metastasis

of human breast cancer (Feng et al., 2009). In the same study it was shown that CCX-CKR acts as a

regulator of growth and metastasis in human breast cancer. Recent studies in human T cells as well as

in HEK cells have shown that co-expression of CCX-CKR inhibits CXCR3-mediated cellular migration

through the heterodimerisation of these two chemokine receptors, which implies the relevance of

this chemokine receptor in cell migration (Vinet et al., 2012). Collectively these investigations have

shown dimerization of CXCR3/CCX-CKR and its involvement in cell migration and CCX-CKR.

1.4. Purinoreceptors in microglial inflammatory responses

In addition to activation by TLR agonists, microglia become rapidly and efficiently activated by

ATP. Thus ATP, released from dying cells upon CNS injury, evokes a vigorous pro-inflammatory

response in microglia (Franke et al., 2004; Le Feuvre et al., 2002; Wang et al., 2004). It has

been shown that microglia express P2-purinoreceptors including P2X4, P2X7, P2Yl2 and the

physiological importance of these purinoreceptors has been extensively studied (Honda et al.,

2001; Nasu-Tada et al., 2005; Tsuda et al., 2003). It was found that expression of P2X4 receptors is

induced in spinal microglia after nerve injury, suggesting that they are involved in CNS mediated

neuropathic pain in pain models (Tsuda et al., 2003; Tsuda et al., 2008). ATP also signals via P2X

ionotropic and P2Y metabotropic purinoreceptors expressed in microglia and thus caused the

release of inflammatory cytokines like TN Fa (Suzuki et al., 2004). In line with this, it was found

that release of ATP due to neuronal insult acts via microglial P2Yl2 receptors and thereby mediated

microglia activity after cortical lesioning (Davalos et al., 2005; Haynes et al., 2006), which

indicated P2Yl2 as a specialized 'Pattern Recognition Receptor' for danger signaling within the

CNS. It has been suggested that extracellular UDP is a ligand for another crucial purinoreceptor

P2Y6, the activation of this receptor involves a wide range of activities which include microglial

15

I

CHAPTER 1

phagocytosis (Koizumi et al., 2007), host defense mechanism (Zhang et al., 2011), induction of cytokines and chemokines (Douillet et al., 2006), cel lular proliferation and survival (Burnstock, 2002). On the other hand it was shown that motility as well as phagocytosis are dependent on the orgnisation of the actin cytoskeleton (Greenberg, 1995; Mitchison and Cramer, 1996). Indeed activation of G-protein coupled receptors like P2Y12/13 results in membrane ruffling and microglial migration (Honda et al., 2001; Nasu-Tada et al., 2005). P2X7 is another important purinoreceptor that is expressed by microglia, astrocytes and also Schwann cells (Collo et al., 1997; Ferrari et al., 1996; Sim et al., 2004). In later studies it was shown that P2X7 has a crucial role in neuro-glia signaling (Sperlagh et al., 2006; Yu et al., 2008). It was found that stimulation of P2X7 in macrophages/monocytes as well in microg lia results in activation of c-jun kinases 1 and extracellular regulated kinases (ERKl/2) and p38 MAPK activation, ultimately leading to the induction of inflammatory genes (Humphreys et al., 2000; Potucek et al., 2006). It has been shown that inhibition of P2X7 receptors attenuated the microglia inflammatory response in a mouse endotoxemia model (Choi et al., 2007). This was supported by other studies showing that disruption of P2X7Rs by selective antagonists like (oxATP) counteracted inflammation. Thus in P2X7R I deficient mice, extracellular ATP was not capable to initiate the release of IL-l f3 (Solle et al., 2001). It was also shown that P2X7 is involved in the production of chemokines like CXCL12 (Shiratori et al., 2010), TN Fa (Suzuki et al., 2004), production of superoxide and of nitric oxide from microglial cells (Gendron et al., 2003) and release of IL-l f3 from macrophages as well as microglia (Ferrari et al., 1997a; Ferrari et al., 1997b). Furthermore, increasing evidence points to a role of the P2X7 receptor in neurodegenerative disorders like Alzheimers disease (Mclarnon et al., 2006; Parvathenani et al., 2003), MS (Oyanguren-Desez et al., 2011; Sharp et al., 2008) and epilepsy (Engel et al., 2012; Kim et al., 2011). Collectively these investigations suggest that P2X7 signaling plays an important role in microglia activation.

1.5. Toll- l ike receptors and inflammatory responses

Ligand binding and formation of homo - heterodimers among the TLRs and selective use of different adapter molecules are required for the activation of the TLR signaling pathway. It has been shown that all TLRs recruit adaptor protein MyD88 where as TLR3 uses the T IR domain­containing adaptor protein-inducing IFNJ3 (TRIF) as its sole adaptor molecule. In general, TLR signaling originates from the cytoplasmic T IR domain. It was shown that a point mutation in murine TLR4 (mutation of praline at position 712 into a histidine) abolished LPS responsiveness in the host system (Poltorak et al., 1998). After ligand binding, TLR4 complexes with T IR domain­containing adaptor protein (MyD88). The TLR-MyD88 complex further recruits IL-l R-associated kinases (IRAKs) and TNFR-associated factor 6 (TRAF6), resulting in IRAK phosphorylation and thereby dissociates from MyD88 followed by TRAF6 activation and ultimately causes TAKl activation (Cao et al., 1996; Lin et al., 2010; Takeda and Akira, 2004). Activated TAKl, complexed with a signalsome (a multi-protein complex) catalyzes inhibitor kinase (IKK) phosphorylation and its destruction via a proteasome pathway for the activation NF-KB as well as MAPK (ERK, JNK and p38) pathway (Fig 1.2). Genetic studies using MyD88 /- mice have revealed that MyD88 is essential for the synthesis of TNF-a as well as IL-6 by TLR ligands (Kawai et al., 1999). Besides TLRs, MyD88 is also essential for signaling induced by IL-l R and IL-18R (Adachi et al., 1998). On the other hand

16

Cytoplasm

Nuc

TLR1 TLR6

,Lt NF-KB C:

General Introduction

TLR4

( MyD88-dependent pathway ) ( MyD88-independent pathway )

Fig 1.2: TLR mediated signaling pathways. There are two main TLR signal transduction cascades, a MyD88 dependent and a MyD88 independent (Toll/l L-1 receptor domain (TRIF) dependent) pathway. Al l TLRs are MyD88 dependent except for TLR3 which activates the TRIF pathway. Unlike other TLRs, TLR4 binds to two adapter proteins (MyD88 and TRIF) to induce an inflammatory response (Adapted from Takeishi and Kubota, 2009).

an MyD88 independent pathway leads to the activation of adaptor protein TRIF which further complexes with IRF3 resulting in IRF3 phosphorylation by TBK-1 as well as induction of type 1 IFN­inducible genes (Yamamoto and Akira, 2004). Recently it has been shown that MyD88 has an additional role in activating IRF7 (Interferon regulatory Factor 7) which resulted in the induction of IFN-a (Honda et al., 2004). It was shown that TRIF transduces signals from TLR3 and TLR4 and eventual ly results in the activation of NF-KB and IRF pathway to provoke the inflammatory response (Akira et al., 2012). Additional ly, another adaptor molecule cal led TIRAP (Mal) is also recruited to TLR4 for LPS signaling (Horng et al., 2001). It was found that the LPS induction of IFN J3 occurs through an TIRAP pathway irrespective of MyD88 (Imler and Hoffmann, 2003). Using a yeast two-hybrid screen (Oshiumi et al., 2003), a new cytoplasmic factor containing a TIR domain was identified, TIR-containing adaptor molecule TICAM-1. In a later study it was confirmed that TICAM-1 is an essential component in TLR3 pathway to induce IFN-J3 (Tao et al., 2012).

17

• 0 u l­o <J :r L

CHAPTER 1

Inflammation is a physiological process required for pathogen clearance and tissue debris. In order to prevent excessive as wel l as persistent inflammation, TLR signaling needs to be tightly regulated by "negative regulators". These negative regulators come into two main categories (a) signal-specific regulators which suppresses the signal transduction induced by TLRs as wel l as by other pathways. The common signal specific regulators includes phosphoinositide 3-kinase (P l3K), Tol lip which are constitutively expressed, whereas suppressor of cytokine signaling (SOCS)-1 and A20 were induced only upon by TLR signaling and (b) gene specific regulators which include transcriptional repressors that acts to modulate gene expression (Fig 1.3). Normal ly these negative regulators control TLR signaling through three major mechanisms (a) dissociation of adaptor molecules, (b) degradation of signal proteins and (c) transcriptional regulation (Kondo et al . , 2012.,Mansel l et a l ., 2006). It is l ikely that SOCS-1 facilitates polyubiquination of Mal on specific residues, which together with tyrosine phosphorylation of this adaptor protein, eventual ly results in degradation of Mal protein and

CMyD88} ----1

TLR4

, LPS

Inflammatory gene expression

Fig 1.3: Regulation of TLR signal ing. The TLR signaling cascade is extensively regulated in order to limited the extent of the inflammatory response (Adapted from Han and Ulevitch, 2005).

18

General Introduction

thereby acts as negative regulator of cytokines (Takagi et al. , 2004). In addition to research on these major mechanisms, studies on SOCS-1 signaling indicated that SOCS-1 also attenuates the cytokine inflammatory response signaling through the JAK-STAT cascade (Alexander and Hilton, 2004) (Posselt et al. , 2011). It was observed that SOCS-1-deficient macrophages (Socsi -1 ) produce high levels of nitric oxide and pro-inflammatory cytokines in response to TLR4 and TLR9 ligands (Nakagawa et al., 2002). Furthermore it was shown that Socs1 1· mice die (by 3 weeks of birth) due to excessive inflammatory responses however, this can be prevented by crossing to IFNy deficient mice (lfng 1 ) (Alexander et al. , 1999). Collectively these data suggest that SOCS-1 is an essential member of the SOCS family that negatively regulates the TLR responses. Another study showed that in P l3 kinase receptor deficient mice (Pi3kr7-1-) there is high level of interleukin (IL)-12 production in response to TLR induction suggesting that P1 3Ks acts as a negative regulator of interleukin 12 (IL-12) through the inhibition of p38 MAP kinase (Cahill et al., 2012; Han and Ulevitch, 2005). Tollip, (another negative regulator) interacts with TLRs such as TLR2 and TLR4, overexpression of Tollip causes inhibition of NF-KB activation and results in subsequent down regulation of TLR signaling (Han and Ulevitch, 2005). It was shown that zinc finger protein (A20 also known as TNF-alpha induced protein 3) exerts its action by deubiquinating as well as deactivating TRAF6 which in turn down regulates MAPK kinase and NF-KB signaling and prevents the synthesis of inflammatory cytokines through negative feed back inhibition (Foster and Medzhitov, 2009; Gon et al. , 2004). Previous studies of macrophages from A20 deficient mice have shown exaggregated production of pro-inflammatory cytokines in response to TLR ligands (Boone et al., 2004). Besides IL-8, interferon regulator Factor ( IRF3) is also found to be negatively regulated by A20 (Saitoh et al., 2005). Additionally, non-coding RNAs such as miRNA also function as negative regulators of inflammation. Previous studies suggest that miR-155, induced by TLR exhibited positive and negative aspects of inflammation (Ceppi et al., 2009; Huang et al., 2010). In order to suppress TLR activation, miR-155 target MyD88 and TAKl binding protein (TAB2) which inturn suppress NF-KB and JNK activation (O'Connell et al., 2007; Tang et al., 2010). Collectively these findings indicate that TLR-mediated inflammatory responses are extensively controlled by negative regulators.

In addition to negative regulation of TLR signaling, it was shown that several genes induced in response to LPS were not induced or induced to a lesser extent upon restimulation with LPS. These genes were referred to as "tolerizable" (T) genes, which include inflammatory cytokines to prevent excessive inflammation. Genes that were still induced in response to LPS rechallenge were classified as "non-tolerizable" (NT) genes, including antimicrobial genes such as cathelicidin-related antimicrobial peptide (camp), in order to increase the efficiency to counteract host infection (Foster et al., 2007) . In addition to PAMPs, TLRs also recognize endogenous damaged associated molecular patterns molecules (DAMPs) such as High Mobility Group Bl (HMGBl), S l00 proteins and Heat Shock Proteins (HSPs) to promote early innate and adaptive immune responses. Normally these DAMP molecules are either released by dying and necrotic cells or by activated leukocytes (Bianchi, 2007; Chen and Nunez, 2010).

1 .6. lnflammasomes

The Nod-like receptor (NLR) gene family constitutes another group of sensors of PAMPs and danger signals (Martinon, 2010). NLRs, including NLRPl, NLRP3 and NLRC4 oligomerise to form

19

I

CHAPTER 1

multiprotein complexes that are called inflammasomes (Davis et al., 2011). The NLRP3 complex

is the most widely studied inflammasome and its expression by myeloid cells is induced upon

detection of various PAMPs (O'Connor et al., 2003). The human NLR family comprises of 22

genes and the mouse genome contains 34 NLR encoding genes (Ting et al., 2008). To date it

is known that inflammasome activation is involved in diseases such as type 2 diabetes (Masters

et al., 2011), inflammatory bowel disease (Kim, 2011) and atherosclerosis (Duewell et al., 2010).

Recently, it was shown that deposition of amyloid- 13 peptide results in lysosomal damage, which

triggers neuroinflammation by activating NLRP3 in microglia (Halle et al., 2008). The main

downstream event following NLRP3 activation is the activation of 'apoptosis-associated spike

like protein' (ASC) that contains a caspase recruitment domain. Caspase-1 activation by ASC

will result in the processing and cleavage of pro-forms of the cytokines such as IL-1 13, IL-18 and

IL-33 to their active as well as their secreted forms. Of which it was found that IL-113 and IL-18

plays a vital role in the amplication of T Hland T Hl7 cells (Chung et al., 2009; Hata et al., 2004).

Three possible mechanisms lead to activation of NLRP3 activation : (a) ATP-mediated stimulation

of purinoreceptor P2X7, which leads to pannexin-1 formation that allows NLRP3 agonists such

as amyloid-13, bacterial endotoxin, ATP to enter the cytosol and mediate NLRP3 activation

(Kahlenberg and Dubyak, 2004; Kanneganti et al., 2007). (b) Engulfment of NLRP3 agonists,

which after lysosomal recapture results in release of NLRP3 activators. (c) Production of reactive

oxygen species (ROS), results in the activation of caspase-1 which triggers NLRP3 inflammasome

complex formation and results in release of inflammatory cytokines (Martinon, 2010). A recent

study by Heneka an co-workers (Heneka et al., 2012) has shown several interesting findings.

First of all, elevated levels of caspase-1 were observed in human brain with cognitive impairment

as well in Alzheimer's disease suggesting a central role of inflammasome in neurodegenerative

conditions. On the other hand it was shown that NLRP3 gene deficiency mediated a microglial

M2 phenotype and thereby showed a reduced deposition of amyloid 13 in APPl/PSl mice, a model

for Alzheimer's disease. In addition, NLRP3 1 '/APP/presenilin-1 as well as in APP/presenilin-1/

caspl /· mice did not display memory deficits. Understanding the role of inflammasomes in

autommunity is less clear. Activation of caspase-1 is crucial for the production of inflammatory

cytokines like IL-113 and IL-18 during the development of EAE (Furlan et al., 1999). However the

role of NLRP3 inflammasomes, in the mouse EAE model and possibly in MS is still under debate.

Studies by Inoue et al., (2012) showed that progression of EAE is enhanced by the priming of

CD4+ T-helper cells by inflammasomes, which eventually resulted in enhanced migration of

peripheral infiltrates to the CNS. In contrast it was also reported that NLRP3 inflammasomes

are not required for EAE progression (Shaw et al., 2010). In conclusion it has been shown that

inflammasomes are identified as crucial cellular complexes in the identification of pathogen and

danger signals thereby suggesting a potential role for inflammasome activation in immunity and

inflammation. Modulation of the inflammasome pathway might serve as an alternative approach

for new strategies in the treatment of autoimmune disorders.

1 .7. Microg l ia activity during Experimenta l autoimmune encepha lomyel itis and multiple sclerosis

Multiple sclerosis (MS) is a chronic demyelinating autoimmune disorder characterized by

infiltration of Thl and Thl7 cells into the CNS (Dhib-Jalbut, 2007; Lassmann, 1998; Ransohoff,

20

General Introduction

1989). The common pathological features of MS include white matter and grey matter demyelination (Kieseier and Stuve, 2011; Stadelmann et al., 2011), axonal damage, blood-brain barrier disruption and gliosis (Dhib-Jalbut, 2007; Holmoy and Hestvik, 2008). The role of activated microglia in neurodegenerative diseases including MS and experimental autoimmune encephalomyelitis (EAE) are a subject of intensive research. It has been suggested that microglia are effector cells in the development of multiple sclerosis with three vital roles (a) presentation of antigens to T cells (b) proinflammatory cytokine production (c) phagocytosis of myelin and degenerated tissue (Carson, 2002; Deng and Sri ram, 2005; Mack et al., 2003; Nelson et al., 2002). Earlier studies have shown that microglia proliferation and increased lysosomal activity occurs at sites of demyelination in EAE (Matsumoto et al., 1992). In detail, it was shown that progression of EAE and inflammation coincides with microglial activation and migration (Aloisi, 2001; Gehrmann et al., 1995; Kutzelnigg et al., 2005; Ponomarev et al., 2005; Rasmussen et a l . , 2007). This finding was confirmed by other studies where it was found in bone-marrow chimeric mice that depletion of microglia repressed the development of EAE (Heppner et al. , 2005). Other studies on EAE have shown that activation of microglia/macrophages is a pre­requisite disease development (Brown and Sawchenko, 2007; Raivich et al., 1998). Approaches using positron emission topography (PET) have shown increased microglial activation at lesion sites in MS brain (Banati et al., 2000). Studies on neuronal toxicity resulting in synaptic dysfunction have shown the presence of microglial cell activation and infiltrates in the CNS (Marques et a l ., 2006; Zhu et a l ., 2003). In l ine with these studies, detailed analysis of MS brain has shown activated microglia in association with transected axons and dendrites (Peterson et al., 2001) . Although EAE is referred to as a T- Helper cell-mediated autoimmune disease, it seems that many T cell mediated cytokines such as IL-17 and interferon-gamma (IFNy) exert CNS inflammation via microglial activation (Murphy et al., 2010). Another study in MS as well as in aged brain showed that microglia can exist in primed state and that a secondary trigger (peripheral LPS challenge) caused a phenotypic shift towards a sensitized state with high expression levels of surface antigens (Ramaglia et a l . , 2012). These findings point to the principal importance of microglia in creating an environment for regeneration which underlies that inhibition of microglial activation is considered as a therapeutic approach for MS.

1 .8. Astrocytes in inflammation and multiple sclerosis

In addition to microglia, astrocytes play an important role in innate immunity. Astrocytes that unlike microglia, are derived from neuroepithelial cells (Sauvageot and Stiles, 2002; Sun et al., 2003) account for 50% of the cel ls in the CNS (He and Sun, 2007; Herculano-Houzel, 2009). Crucial functions of astrocytes include the maintenance of the blood brain barrier, production of neurotrophic factors, maintenance of extracellular ion and brain homeostasis, scar formation and involvement in neuroimmune responses (Dong and Benveniste, 2001; Matyash and Kettenmann, 2010; Sofroniew and Vinters, 2010). Based on the cellular morphology and anatomical locations, astrocytes are divided into two classes (a) protoplasmic astrocytes located in the grey matter and (b) fibrous astrocytes found in the white matter.

Astrocytes express pattern recognition receptors for the identification of infectious agents and danger signals. It has been postulated that microglia act as initial responders

21

I

CHAPTER 1

of inflammation and subsequently astrocytes propagate the release of pro-inflammatory mediators. This is supported by several studies suggesting that in response to LPS-induced inflammation, activated microglia release pro-inflammatory cytokines which in turn act on astrocytes to induce an secondary inflammatory response (Saijo et al., 2009; Saijo and Glass, 2011). Activated astrocytes release a variety of cytokines (Gorina et al., 2011) which further induce microglial proliferation and evoke inflammatory responses (Ransohoff and Brown, 2012; Saijo et al., 2009; Saijo and Glass, 2011). It has also been shown that astrocytes secrete neurotrophins and anti-inflammatory cytokines (such as IL-10) to limit the brain inflammatory response (Nash et al., 2011). In conclusion it is clear that microglia/astrocyte cross talk is crucial in regulating innate immunity of the brain. Many reports indicate that astrocytes are involved in CNS traumatic injuries with hypertrophy and hyperplasia (Chen and Swanson, 2003; Korn et al., 2007) as well as in neurodegenerative disorders (Garwood et al., 2011). "Reactive astrogliosis" is one of the striking features found in MS lesions as well as in EAE (Bannerman et al., 2007; Holley et al., 2003; Lee et al., 1990). Several studies have shown both protective and deleterious effects of astrocytes on demyelination (De Keyser et al., 2010; Moore et al., 2011; Williams et al., 2007). Hence the role of astrocytes in demyelinating disorders is still not clear. The deleterious effects of astrocytes include (a) possible presentation of antigens to T cells, (b) release of chemokines and pro-inflammatory cytokines at the lesion sites (Ambrosini et al., 2005; Constantinescu et al., 2005). On the other hand protective effects of astrocytes include scar formation, which acts as physical barrier for infiltrating inflammatory cells (Nair et al., 2008), promotion of remyelination through the recruitment and proliferation of oligodendrocyte progenitor cells (OPCs) at the site of injury (Nash et al., 2011), prevention of myelin damage via glutamate uptake (Bailey et al., 2007). Approaches using transgenic GFAP mice revealed that ablation of astrocytes does not prevent the myelin damage whereas microglia-mediated myelin clearance is impaired in a cuprizone induced MS model, suggesting the importance of astrocytes in creating an environment conductive for tissue repair and regeneration (Skripuletz et al., 2012).

1.9. Epigenetics marks - a general overview

The term epigenetics describes "the study of changes in gene function which are mitotically or meiotically heritable but do not entail a change in DNA sequence"(Wu and Morris, 2001). Epigenetic mechanisms comprise of chemical modifications of DNA (methylation), of histones (i.e. acetylation, methylation, phosphorylation, sumoylation and ubiquitination) (Bernstein et al., 2007; Bird, 2002). Additionally, non-coding RNAs are shown to play an important role in gene regulation by either preventing mRNA translation or by targeting mRNAs for degradation. (Andersen and Panning, 2003). Epigenetic mechanisms regulate gene transcription in response to environmental cues and thus play a critical role in adjusting cellular responsivity to physiological and pathological conditions (Bayarsaihan, 2011). Epigenetics has also been shown to have an important role in development, cellular differentiation as well as lineage specification (Bibikova et al., 2008; Chi and Bernstein, 2009; Lunyak and Rosenfeld, 2008). It is also shown that an epigenetic signature is dynamic and can be modified by various environmental factors like nutrition, drugs and mental stress as well as by aging processes (Kubota et al., 2012; Wilson, 2008).

22

General Introduction

Inflammation is a physiological response that under certain conditions is subjectto epigenetic regulation. It was shown that expression of transcription factors (NF-KB, STAT3 FOXP3) which are involved in inflammatory signaling, are regulated by histone acetylation (Medzhitov and Horng, 2009; Yamamoto et al. , 2003) . In conclusion it is of great importance to understand how these epigenetic modifications during inflammatory response are reversible to identify novel therapeutic strategies in the future. A study by (Karberg, 2009) showed that drugs available for epigenetic therapy include histone deacetylase inhibitors (HDACi) and demethylating agents.

2. EPIGENETIC EVENTS I N I N FLAMMATION

2.1. Histone modifications and inflammation

In eukaryotes, DNA is packaged in the nucleus as chromatin and its organization is a key determinant of gene expression levels. The basic unit of chromatin, the nucleosome, is made up of the core histones H2A, H2B, H3 and H4. Chromatin structure and DNA accessibility are regulated by covalent modifications of histone tails protruding from nucleosomes and methylation of cytosines in the DNA sequence, respectively (Jenuwein and Allis, 2001). One such covalent histone tail modification is acetylation that is controlled by histone acetyl transferases (HATs) and is associated with an "open" chromatin confirmation which facilitates transcription of genes (Lee and Workman, 2007) and the activity of histone deacetylases (HDACs) which is associated with a more "closed" chromatin conformation that represses gene expression (Shahbazian and Grunstein, 2007). In studies on chronic obstructive pulmonary disease (Kersul et al . , 2011), airway biopsies and alveolar macrophages (Conran et al . , 2002) increased acetylation of histones at the promoter region of inflammatory genes induced by NF-KB has been observed. In line with this, in another study it was found that histone acetylation in the promoter of CBP/p300 resulted in increased gene expression of pro-inflammatory cytokines (IL-2, IL-8 and IL-12) (Vil lagra et al., 2010). In the same study it was shown that HDACs are involved in the transcription of inflammatory cytokines through their recruitment to gene promoters via repressor complexes and other transcription factors.

(a) Histone acetyltransferases

Histone acetylation is catalyzed by histone acetyl transferases (HATS) and in general HATS and HDACs play a major role in the control of cel l differentiation and their activity is modulated by the signaling pathways like inflammation, metabolism, autophagy etc (Marmorstein, 2001). Broad ly HATs are categorized into two families based on their cel lular localization: Nuclear HATS (type A) and cytoplasmic HATS (type B) . Based on structural and functional differences, type A HATS have been subdivided into five families; three families have been studied extensively which include GNAT (GCNS-related N-acetyltransferases) family and PCAF (p300/ CBP associated factor), the p300/CBP family, which includes p300 and CBP (CREB-binding protein) and the MYST family which includes (TI P60, MOZ, MOF, MORF and HBOl . Two other HAT families include HATs with transcription factor activity (ATF2, TAFl and TF I I IC90) as wel l as the nuclear hormone related HATs (SRC4 and ACTR) (Table 1.1, see page no:25).

It has become clear that the transcriptional and DNA binding activity of NF-KB is regulated by acetylation of specific lysine residues by different HATs (Ghizzoni et al., 2011).

23

I

CHAPTER 1

Table 1: HAT families and their transcription factor related function (Adapted from Marmorstein 2001).

HAT

GCNS/PCAF family

Gens

PCAF

MYST family

as2

Sas3

Esa 1 MOF

Tip60

MOZ

H BOl

TAF1 1 250 family

CBP/p300 family

SRC - 1 or p160

ATF-2

Organism

Yeast to human

human

Yeast

Yeast

Yeast

Fruit Fly

huma n

human

human

Yeast to human

Worm to human

Mice to human

Yeast to human

Function

Transcriptional Co-activator Histone acetyl - lysine binding

Co-activator Inhibits cell cycle regulation

Silencing

Transcriptional Silencing

DNA replication and repair

Dosage compensation in drosophila, Transcriptional regulatory process

H IV Tat interaction

Transcriptional coregulator

Origin Recognition interaction

TSP-associated factor

Globa l coactivator Acetylate non-histone substrates include HMGl, HMG14, HMG-lY

Steroid receptor coactivators

Sequence - specific DNA binding activator

Studies by (Chen et al., 2002) have shown that acetylation of the NF-KB at lysine residues 218, 221 and 310 in the RelA subunit are mediated by the HATs p300 and CBP. Acetylation at Lys 221 resulted in increased binding affinity ofNF-K B forits enhancersequence. Furthermore, increased HAT activity and decreased HDAC activity have been observed in alveolar macrophages with asthma (Cosio et al., 2004; Su et al., 2009) in chronic obstructive lung disease ( Ito et al., 2005; Rajendrasozhan et al., 2009). Taken together these findings demonstrated that a shift in HAT/ HDAC balance towards HAT activity is increased in lung disease which in turn implied that inhibition of HAT activity can be considered as a therapeutic approach in the treatment for such inflammatory diseases (Adcock and Lee, 2006; Bayarsaihan, 2011; Mroz et al., 2007) .

(b) Histone deacetylases and inflammation

Histone deacetylases (HDACs) catalyse the removal of acetyl groups from their substrates, like histone proteins. HDACs not only deacetylate histone tails but also many non-histone substrates such as F -actin, tubulin and P53 (Yao and Yang 2011) . Mammalian HDACs are classified into four classes on the basis of structure, enzymatic function, subcellular localization and distribution. HDACs are involved in many biological processes and their activity is not restricted to histone proteins. Class I HDACs (HDAC 1, 2, 3 & 8) that are zinc dependent enzymes are predominantly localized in the nucleus (Thiagalingam et al., 2003). Class I la HDACs (HDAC 4, 5, 7 and 9) are generally localized in the cytoplasm and can translocate to the nucleus. Class l ib includes (HDAC6 and 10) where HDAClO was found in both the nucleus and in the cytoplasm (Guardiola and Yao, 2002). Class I, I la, lib and IV are referred to as classical HDACs. However, HDAC6 is different from other HDACs since it contains two deacetylase domains and a (-terminal zinc

24

General Introduction

finger. HDAC6 is predominantly a cytoplasmic protein and deacytelates transmembrane

proteins as well as chaperones (Hubbert et al. , 2002; Kovacs et al. , 2005; Li et al., 2012; Tang

et al., 2007). Class I l l includes the sirtuins which require NAD+ as a cofactor for their activity

(Imai et al., 2000). It has been shown that sirtuins play a crucial role in specifically deacetylating

histone H4 lysinel6 (Vaquero et al., 2007). Interestingly, Sirtl has shown to affect the function

of additional proteins like p53 (Cheng et al., 2003; Langley et al., 2002), FoxO (Brunet et al.,

2004; Motta et al., 2004), NFKB (Yeung et al., 2004) and histone Hl (Vaquero et al., 2007).

Class IV contains only HDAC 11, which is expressed in brain, heart as well in muscles and shares

properties of both class I and class II HDACs. Although little is known about its function (Gao et al. , 2002; Liu et al., 2008), recently it has been reported that in antigen presenting cells, HDACll

plays a key role in TLR-induced cytokine expression, especially interleukin 10 (IL-10) (Villagra

et al., 2009). Several studies on inflammatory response in immune cells suggested that HDACs

are involved in the silencing of TLR4-target genes through chromatin remodeling (Foster et al.,

2007). In particularly class I HDACs (HDAC 1) attenuate TLR-induced activity of inflammatory

genes such as IL-12p40 (Lu et al. , 2005), Cox-2 (Deng et al., 2004) as well as in lnterferon-13

(Nusinzon and Horvath, 2006). Further investigation supports the view that HDACl regulates

the transcription factors ATF3 (Gilchrist et al., 2006) and NF-KB (Ashburner et al., 2001).

Furthermore, deacetylation of the RelA p65 subunit of NF-KB by HDAC3 allows the nuclear

export of this transcription factor and turns off the inflammatory response (Greene and Chen, 2004). Additionally, sirtuin 1 (SIRTl ) abolishes NF-KB dependent activity by deacetylation of the

Lys 310 residue in the p65 subunit (Yeung et al., 2004). Thus it appears that acetylation as well as

deacetylation of lysine residues of the p50 and p65 subunits of NF-KB is crucial for their activity.

On the other hand HDAC4 is required for the suppression of inflammation in LPS triggered

mouse macrophages (Ghisletti et al., 2007). Further findings showed that HDAC6 deacetylates molecular chaperone HSP90 which is essential for the maturation as well as signaling of the

anti-inflammatory glucocorticoid receptor (GR)(Kovacs et al., 2005). Collectively these findings

indicate that HDAC activity has a key role in TLR pathway signaling and activity. In view of the

large number of HDAC family members, gene targeting studies of specific HDACs using small

interfering RNA (siRNA) or by gene inactivation, or overexpression studies could to provide a

better insight in the role of specific HDACs in regulating inflammatory responses.

(c) HDAC inhibitors - Overview

A substantial amount of evidence has suggested that selective, small molecule HDAC inhibitors are a therapeutic target for inflammation. Several classes of HDAC inhibitors have been studied

in mouse models for arthritis (Gillespie et al., 2012; Vojinovic and Damjanov, 2011), inflammatory

bowel disease (Edwards and Pender, 2011), graft versus host rejection (Choi and Reddy, 2011)

and septic shock (Halili et al., 2009). Broad spectrum HDAC inhibitors such as trichostatin A

(TSA), suberoylanilide hydroxamic acid (SAHA) and Valproic acid (VPA) are mostly categorized as "pan-HDAC inhibitors". SAHA and Valproic acid are used in clinical trails and employed in

various disorders (Table 1.2, see page no:26) . These HDAC inhibitors are known to modify a

number of histone and non-histone targets, including transcriptional factors, and induce

a broad range of effects in the cells. These findings potentiate the application of such small

molecule inhibitors to understand the molecular mechanisms linking HDAC activity to

25

I

CHAPTER l

Table 2: H DAC inhibitor and its appl ications in mouse motels (Adapted from Wang et a l ., 2009)

Disease model Species I nhibitor Effects Referenes

Endotoxin Human, SAHA Reduced cytokine production, (Brogdon et a l ., 2007) mouse lethal ity in vivo i n mice (Leoni et a l ., 2002)

(Backdah l et a l . , 2009)

Experimental Mouse TSA Decreased demyelination, (Camelo et al . , 2005) Auto- immune leukocyte infi ltration, chemokine encephalomyel itis production in the repals ing

phase of EAE.

Stroke Mouse SAHA, Decreased infract size post- (Kim et a l ., 2007) TSA middle cerebra l artery occlusion

Neurodegenerative Mouse Butyrate Decreased disease progression in (Hockly et a l ., 2003) d iseases SAHA Huntington"s chorea, spinal and (Minamiyama et a l ., 2004)

muscu lar dystrophy, amyotrophic (Petri et a l . , 2006) latera l sclerosis

Arthritis Mouse, FK228, Decreased joint swel l ing, (Nishida et a l ., 2004) rat SAHA, collagen induced models (Lin et a l . , 2007)

MS-275, of arthritis, with decreased (Hori et al., 2003) VPA overa l l leukocyte infi ltration

and THl cytokine production

but increased Foxp3• Treg accu lumation.

Graft-versus-host Mouse SAHA Decreased g raft-versus-host (Reddy et a l ., 2004) disease disease, decreased CD3 (Li et a l ., 2008)

monoclonal-antibody induced cytokine storm during bone marrow conditioning

inflammation. With the development of high throughput screens, selective HDAC inhibitors like MS-275 (Class I HDACs), Tubacin (HDAC6 inhibitor), Cambinol (S IRTlinhibitor) were developed, which provides opportunity to gain insight into the immunosuppressive properties of these inhibitors particular in diseases like cancer (Conte and Altucci, 2012; Khan and La Thangue, 2012) were these inhibitors induce cell cycle arrest, apoptosis and autophagy. These selective HDACi may provide an alternative to pan-HDACinhibitors and indeed their clinical application is not only restricted to diseases like cancer but also to other mouse and human diseases. Collectively these findings suggest that selective HDACi excert multiple interventions against inflammatory disorders. Overall, epigenetic therapy is a rapidly developing area in the field of pharmacology as well as in drug discovery. Besides HATs and HDACs, another epigenetic target are DNA methyltransferases (DNMTs) and micro RNA (miRNA).

(d) DNA methylation and inflammation

Besides histone modifications, several other mechanisms have been identified which influence chromatin conformation and gene expression levels. One such modification is DNA methylation, the addition of a methyl group from the methyl donor S-adenosylmethionine (SAM) to cytosine residues in CpG dinucleotides within the DNA is mediated by a group of enzymes known as DNA methyltransferases (DNMTs). It is known that many genes have CpG rich regions (CpG islands) which are situated at the S'end of the gene and it is observed that

26

General Introduction

most of these islands are not methylated (Herman and Baylin, 2003). It has been shown in eukaryotes that methylated CpG islands in the non-coding regions have a number of cel lular functions with transcriptional repression which includes genomic imprinting, X chromosome inactivation (Bernstein et al., 2007; Jones and Liang, 2009).

Inflammation is a progressive process initiated by the host immune system to eliminate the sources of inflammatory response. The identification of cross talk between DNA methylation and transcription factors is considered as a defense mechanism against the foreign material (Zhao et al., 2012). In detail, changes in the DNA methylation at the promoter region can modulate the activity as wel l as expression of cytokines in the context of an inflammatory response. This is supported by several studies were it was shown that the extent of methylation at CpG promoter sites correlated with the production of IL-10 (Fu et al., 2011), TNF-a (Nakano et al . , 2013; Wilson, 2008), IL-113 (Wessels et al., 2010), IL-2 (Bruniquel and Schwartz, 2003), IL-13 (Ooi et al., 2012). In bronchial epithelial cel ls it was found that hypomethylation of the promoter of TLR2 was associated with an enhanced pro-inflammatory response (Shuto et al., 2006). Also it was shown that DNA methylation and histone modifications are essential for the TNF-a expression (Sul livan et al . , 2007). In addition to this, changes in the methylation level of the SOCS3 gene, an inhibitory factor on cytokine expression, have been shown to modulate the pathogenesis of prostate cancer (Pierconti et a l ., 2011) . This was supported by another study were it was shown that hypomethylation of SOCS3 enhanced the level of IL-6 cytokine which stimulated cancer progression via transcription factor STAT3 (Li et a l ., 2010). Furthermore, it has been observed that DNA methylation suppressed excessive TLR4 responses in intestinal epithelial cel ls and thereby regulated mucosa! inflammation in the gut (Takahashi et al., 2009). Co l lectively these findings indicate that altered DNA methylation patterns in inflammatory disorders as wel l as in cancer may provide biomarkers for early pre-malignant states (Wilson, 2008). Using microarray studies it was shown that maternal infection in mice was associated with changes in DNA methylation patterns of imprinted genes (Bobetsis et a l ., 2010). Summarizing these findings, it is clear that DNA methylation is a reversible epigenetic modification with revelance for the implementation of new therapeutic approaches.

(e) MicroRNA and inflammation

MicroRNAs (miRNAs) are smal l non-coding RNAs that regulate the stability or translation of target transcripts. General ly miRNAs are transcribed by RNA polymerase II as wel l as by RNA polymerase I ll under certain instances. Upon initial processing by Drosha and DGCR8 in the nucleus, pre-miRNA is exported to the cytoplasm were it is cleaved by Dicer resulting in a 18-24 basepair mi RNA duplex. From this miRNA duplex, one of the two RNA strands is loaded into the RNA-induced silencing complex (RISC) and thereby directs the complex and binds to the 3' untranslated region (3'UTR) of specific messenger RNAs resulting in suppressed expression of target protein. This repression may take place due to a variety of mechanisms such as decreased mRNA stability due to uncapping and deadenylation or via inhibition of translation. Upon exposure to inflammatory stimuli, various signals are transduced to the nucleus, which results in the induction as wel l as repression of several genes, which is required for the coordination of inflammatory responses. The inflammatory response also changes miRNA transcript levels, miR-155 and miR-146 were identified as miRNAs which are induced by NF-KB (O'Connel l et a l .,

27

I

CHAPTER 1

2007; Taganov et al., 2006; Thai et al., 2007). It has been shown that miR-146 limits the TLR response by inhibition of T RAF6 (Taganov et al., 2006). Several other miRNAs change in expression duringt inflammation in different cell types. Recently it has been shown that TLR-4 dependent inflammatory responses are regulated at two different levels (a) Transcriptional control modulated by epigenetic modifications and (b) differential expression of miRNAs (El Gazzar and McCall, 2010). Additionally it was shown that miR-124 is expressed in microglia but not in peripheral macrophages/monocytes (Ponomarev et al., 2011). In activated microglia, for instance during EAE, miR-124 expression was downregulated and peripheral administration of miR-124 in EAE mice resulted in deactivation of macrophages and microglia The data indicate that miR-124 can function as a switch between microglia activation and quiescence. In conclusion, epigenetic processes are extensively implicated in the regulation of inflammatory responses, and these include histone modifications, DNA methylation and specific miRNAs.

3. TRANSCRI PTION FACTORS AND INFLAMMATORY RESPONSE

The best characterized transcription factors in TLR4-mediated inflammatory signaling in immune cells include NFKB and interferon regulatory factors ( I RFs). It is well known that inflammatory responses are tightly regulated via NF-KB-dependent transcription of cytokine, chemokine, and cell adhesion molecule genes. The NF-KB transcription factor complex contains four different proteins: p65 (RelA), RelB, c-Rel, pl05/p50 (NF-KBl ) which form homodimeric and heterodimeric complexes. Under basal conditions, NF-KB is retained in an inactive form in the cytoplasm via their interaction with inhibitory proteins (IKB) such as IKBa, IKBj3 and IKBE or with the precursor Rel proteins pl O0 and pl05. In response to inflammatory stimuli such as bacterial product (LPS), inflammatory cytokines including (TNF-a) and interleukin-l j3 ( IL-1 13), these inhibitory proteins are phosphorylated which leads to the translocation of transcription factor complex from cytoplasm to the nucleus where it regulates the transcription of target genes (DiDonato et al., 1996; Karin and Ben-Neriah, 2000; O'Neill and Kaltschmidt, 1997).

Several studies suggest that NF-KB activation in glial cells like microglia, astrocytes and astrocytoma cell lines have shown a central role of NF-KB in regulating the inflammatory response (Barnes and Karin, 1997; Carter et al., 1996; Hu et al., 1999; Makarov, 2000; Moynagh et al., 1993; Nakajima et al., 2006; Rhee and Hwang, 2000; Sparacio et al., 1992; Surh et al., 2001; Takatsuna et al., 2005). Small molecule inhibitors of NF-KB suppressed LPS mediated proinflammatory responses pointing to a crucial role for NF-KB in microglia inflammatory responses (Mattson and Camandola, 2001). Earlier reports showed that RelB deficient mice showed a reduced basal level activity of NF-KB, resulting inadaptive immune system deficiency (Burkly et al., 1995; Weih et al., 1995). Indeed, the induction of inflammatory genes by NF-KB depends on co-activator proteins, transactivators as well as repressors, which regulate the activity of NF-KB at multiple levels. These co-activators have histone-modifying activities which include histone-acetyltransferases such as CBP-p300, PCAF (p300-CBP associated factor) as well as GCN5 that lead to gene expression by its binding to specific promoter sites of their target genes. Additionally in vivo, NF-KB is also present in many developing neurons in their activated state due to the release of neuronal trophic factors. However, NF-KB activation results in the release of anti-apoptotic and anti-oxidant enzymes which in turn promotes neuronal survival (Barger et al., 1995; Bhakar et al.,

28

General Introduction

2002; Guo et al., 1998; Kaltschmidt et al., 1994; Maggirwar et al., 1998; Mattson, 2005). On the otherhand, secretion of inflammatory cytokines can also result in the activation of NF-K B in CNS resident cells which eventually could lead to neuronal degeneration (Mattson, 2005). Several studies showed that transcriptional activity of NF-KB is dependent on the interaction of RelA/ p65 subunit with histone deacetylases such as HDACl, Sirtuin-6 (Ash burner et al., 2001; Kawahara et al., 2009). These findings suggest that regulation of NF-KB mediated gene expression is coordinated through transactivators as well as repressors. In conclusion, NF-KB is shown to be important in inflammatory diseases such as rheumatoid arthritis (Makarov, 2001), MS (Yan and Greer, 2008), inflammatory bowel disease (Atreya et al., 2008) which suggests that the NF-KB pathway could be considered as a target for therapeutic intervention.

Another important regulator of immunity is the interferon-regulatory factor ( IRF) family of transcription factors which encode type I interferons (IFNs) like IFN-a and IFN-� and type I I interferons, IFNy (Taniguchi et al., 2001). I t was proposed that in MS, IFN� was reported to be the first clinically approved therapy (Applebee and Panitch, 2009). Generally type I interferons are produced upon viral infection whereas type I I interferons were produced by activated T cells and natural killer cells (Lengyel, 1982; Pestka et al., 1987; Weissmann and Weber, 1986). The major source of type I interferon (IFNa) in the CNS includes neurons in response to infection (Delhaye et al., 2006) and in EAE both infiltrating macrophages and microglia also express other type I interferon (IFN�)(Teige et al., 2003). In another study it was shown that mice which are deficient for type I IFN signaling display increased EAE severity which implies the relevance of type I IFN pathway in the regulation of CNS inflammation (Prinz et al., 2008; Teige et al., 2003). At present nine IRFs have been identified in humans and in mice (Honda and Taniguchi, 2006; Taniguchi et al., 2001).

However the molecular basis of glial activation is currently a subjectofintensive investigation and debate. Initially, the glial inflammatory response is mediated by TLR as well as Type I IFNs (IFN-a and IFN-�). More importantly, I RF3 has been showed as a crucial transcription factor in non-My088 TR IF pathway of TLR3 and TLR4 response (Grandvaux et al. , 2002; Lin et al., 1998; Sharma et al., 2003). In vitro studies have showed that I RF3 has a crucial role in innate anti-viral immunity in microglia as well as in astrocytes (Suh et al., 2007; Suh et al., 2009). Furthermore, I RF3 is found to be important for neuroprotection elicted upon stimulation with LPS (Marsh et al., 2009). Another interesting observation by Tarassishin and co-workers showed that the microglial phenotype can be reversed by I RF3 gene transfer from pro-inflammatory to an anti­inflammatory state through the activation of the P I3K/AKT pathway (Tarassishin et al., 2011) . Furthermore, it was found that I RF3 is required for the transcription of type I IFNs emphasizing the role of I RF3 in the pathophysiology of various diseases (Tamura et al., 2008). It has been suggested that I RF5 might function has both activator as well as repressor of interferon gene induction. However, the main role of I RF5 is to ensure the production of immediate early inflammatory genes (Barnes et al., 2003). A recent study has pointed to interferon regulatory factor I RF8 as a prominent and constitutively expressed transcriptional factor in microglial cells in response to interferon- y (Ellis et al., 2010). However, these results were supported by another study, indicating that I RF8 is an important transcription factor in the development as well as for the function of microglia (Minten et al., 2012).

It was reported that I RF7 acts as a master regulator of type I IFN signaling (Honda et al. , 2005; Honda et al . , 2006) . From studies in EAE model, it was shown that I RF7 deficient mice are

29

I

CHAPTER 1

more susceptible to EAE than the wild type mice indicating that IRF7 signaling is crucial for the

regulation of inflammatory responses during EAE progression in the CNS (Salem et al . , 2011) .

It was postulated that IRF7 and IRF9 belong to a family of transcription factor with multiple

functions like host defence, and immune cel l development (Khorooshi and Owens, 2010). It

was shown that type I I FN signaling inhibits the expression of matrix metal loproteinase (MMPs)

in microglia as wel l as in astrocytes and thereby prevents the infiltration of leukocytes to the

CNS during EAE (Benveniste and Qin, 2007; Liuzzi et a l., 2004) . Col lectively this information

has led to the conclusion that the IFN family of transcription factor can be subject of intensive

research for the regulation of inflammatory responses as a target for drug discovery.

4. AIMS AND OUTLINE OF THE THESIS

The aim of this PhD project was to investigate the role of glia l cel ls in inflammatory responses

of the central nervous system. In chapter 1 we have provided a comprehensive overview

regarding the modulation of glial activity in response to inflammatory stumuli in vitro and in vivo in neurodegenerative, inflammatory mouse models.

Chapter 2 is focused on the role of histone deacety lases (HDACs) in the inflammatory

response of microglia and astrocytes. The role of Histone deacetylase (HDACs) in modulating

inflammatory responses in glial cel l s is still a subject of intensive research. We were interested

to determine the role of HDACs and HDACi in control ling microglia and astrocyte inflammatory

responses and their implications in the biology of these glial cel ls.

Chapter 3 describes the effect of HDACi (TSA) in Experimental Autoimmune Encephalomyelitis

(EAE) etiology as well as on the inflammatory response of microglia as wel l as peripheral macrophages

in EAE mice. Consequently, it has been proposed that astrocytes might contribute to the inflammatory

responses in EAE . Thus we intended to investigate the effect of TSA on the inflammatory response in

astrocytes in vitro.

Chapter 4 describes the role of purinoreceptor P2X7 in microglia. Additional ly, it was

investigated whether HDACi (VPA) has a role in the regulation of this purinoreceptor to excert

its neuroprotective properties.

Chapter 5 describes the role of chemokine CXCR3 as wel l as CCX-CKR in intracel lular

signaling and migration in various cel l types (T-cel ls, microglia as wel l in transfected HEK 293

T cel ls) . In chapter 5 a novel orphan chemokine receptor signaling mechanism of CCX-CKR in

preventing CXCR3 mediated chemotaxis in different immune cel ls are presented.

Chapter 6 summarizes the results presented in the previous chapters and discussion

these data. In this chapter, the intrinsic as wel l as extrinsic factors essential for microglia l

homoestasis under normal as wel l as in pathological conditions are discussed.

30

Genera l I nt ro ductio n

5. REFERENCES

Adachi 0, Kawai T, Takeda K, Matsumoto M, Tsutsui H, Sakagami M, Nakanishi K, Akira S. 1998. Targeted disruption of the MyD88 gene results in loss of I L-1- and I L-18-mediated function . Immunity 9:143-150.

Adcock IM , Lee KY. 2006. Abnormal h istone acetylase and deacetylase expression and function in lung inflammation . lnflamm Res 55:311-321.

Ajami B, Bennett J L, Krieger C, Tetzlaff W, Rossi FM. 2007. Local self-renewal can susta in CNS m icrogl ia maintenance and function throughout adult life. Nat Neurosci 10:1538-1543.

Akira S, Saitoh T, Kawai T. 2012. Nucleic acids recognition by innate immunity. U irusu 62:39-45.

Alexander WS , H i lton DJ. 2004. The role of suppressors of cytokine signal ing (SOCS) proteins in reg ulation of the immune response. Annu Rev l mmunol 22:503-529.

Alexander WS, Starr R, Fenner JE, Scott CL, Handman E, Sprigg NS, Corbin J E, Cornish AL, Darwiche R, Owczarek CM, Kay TW, Nicola NA, Hertzog PJ, Metcalf D, H i lton DJ. 1999. SOCSl is a critical i n h ibitor of interferon gamma signal ing and prevents the potentia l ly fatal neonatal actions of this cytokine. Cel l 98:597-608.

Al l iot F, Godin I , Pessac B. 1999. Microgl ia derive from progenitors, orig inating from the yolk sac, and which proliferate in the brain . Brain Res Dev Bra in Res 117:145-152.

Aloisi F. 2001. Immune function of microgl ia . G l ia 36:165-179.

Ambrosin i E, Remol i ME, Giacomini E, Rosicarel l i B, Serafini B, Lande R, Aloisi F, Coccia EM. 2005. Astrocytes produce dendritic cell -attracting chemokines in vitro and in mu ltiple sclerosis lesions. J Neuropathol Exp Neurol 64:706-715.

Andersen AA , Panning B. 2003. Epigenetic gene regu lation by noncoding RNAs. Curr Opin Cell Biol 15:281-289.

Applebee A , Pan itch H. 2009. Early stage and long term treatment of multiple sclerosis with interferon -beta . Biolog ics 3:257-271 .

Ash burner BP, Westerheide SD, Ba ldwin AS,Jr. 2001 . The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors H DACl and HDAC2 to negatively regu late gene expression . Mo l Ce l l B io l 21:7065-7077.

Atreya I, Atreya R, Neurath MF. 2008. NF-kappaB in inflammatory bowel disease. J I ntern Med 263:591-596.

Backdah l L, Bushell A, Beck S. 2009. Inflammatory signa l l ing as mediator of epigenetic modulation in tissue­specific chronic inflammation. Int J Biochem Cel l Biol 41:176-184.

Bai ley SL, Schreiner B, McMahon EJ, Mi l ler SD. 2007. CNS myeloid DCs presenting endogenous myel in peptides 'preferential ly' polarize CD4+ T(H)-17 ce l ls in relapsing EAE. Nat lmmunol 8:172-180.

Banati RB, Newcombe J, Gunn RN, Cagnin A, Turkheimer F, Heppner F, Price G, Wegner F, Giovan noni G, Mi l ler DH, Perkin GD, Smith T, Hewson AK, Bydder G, Kreutzberg GW, Jones T, Cuzner ML, Myers R. 2000. The peripheral benzodiazepine binding site in the bra in in mu ltiple sclerosis: quantitative in vivo imaging of microg l ia as a measure of d isease activity. Bra in 123 ( Pt 11) :2321-2337.

Bannerman P, Hahn A, Soul ika A, Gal lo V, Pleasure D. 2007. Astrogl iosis in EAE spinal cord: derivation from radia l g l ia, and relationships to ol igodendrogl ia . G l ia 55:57-64.

Barger SW, Horster D, Furukawa K, Goodman Y, Krieglstein J, Mattson MP. 1995. Tumor necrosis factors alpha and beta protect neurons against amyloid beta-peptide toxicity: evidence for involvement of a kappa B-binding factor and attenuation of peroxide and Ca2+ accumulation. Proc Natl Acad Sci U S A 92:9328-9332.

Barnes BJ, Field AE, Pitha-Rowe PM. 2003. Virus-induced heterodimer formation between I RF-5 and I RF-7 modu lates assembly of the I FNAenhanceosome in vivo and transcriptional activity of I FNA genes. J Biol Chem 278:16630-16641.

Barnes PJ , Karin M. 1997. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336:1066-1071.

Baron P, Bussini S, Card in V, Corbo M, Conti G, Gal imberti D, Scarpini E, Bresol in N, Wharton SB, S haw PJ, Si lani V. 2005. Production of monocyte chemoattractant protein-1 in amyotrophic lateral sclerosis. Muscle Nerve 32:541-544.

Bayarsaihan D. 2011 . Epigenetic mechanisms in inflammation. J Dent Res 90:9-17.

Benveniste EN , Qin H. 2007. Type I interferons as anti- inflammatory mediators. Sci STKE 2007:pe70.

Bernstein BE, Meissner A, Lander ES. 2007. The mammal ian epigenome. Cell 128:669-681 .

31

I

CHAPTER 1

Bertollini C, Ragozzino D, Gross C, Limatola C, Eusebi F. 2006. Fractalkine/CX3CL1 depresses central synaptic transmission in mouse hippocampal slices. Neuropharmacology 51:81 6-821 .

Beutler 8. 2002. TLR4 as the mammalian endotoxin sensor. Curr Top Microbiol lmmunol 270: 109-120.

Beutler 8, Du X, Poltorak A. 2001. Identification of Toll-like receptor 4 (Tlr4) as the sole conduit for LPS signal transduction: genetic and evolutionary studies. J Endotoxin Res 7 :27 7 -280.

Bhakar AL, Tannis LL, Zeindler C, Russo MP, Jobin C, Park DS, MacPherson S, Barker PA. 2002. Constitutive nuclear factor-kappa B activity is required for central neuron survival. J Neurosci 22:8466-8475.

Bianchi ME. 2007. DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol 81 : 1 -5.

Biber K, de Jong EK, van Weering H R, Boddeke HW. 2006. Chemokines and their receptors in central nervous system disease. Curr Drug Targets 7 :29-46.

Biber K, Dijkstra I , Trebst C, De Groot CJ, Ransohoff RM, Boddeke HW. 2002. Functional expression of CXCR3 in cultured mouse and human astrocytes and microglia. Neuroscience 1 12:487-497.

Biber K, Neumann H, Inoue K, Boddeke HW. 2007. Neuronal 'On' and 'Off' signals control microglia. Trends Neurosci 30:596-602.

Biber K, Sauter A, Brouwer N, Copray SC, Boddeke HW. 2001. lschemia-induced neuronal expression of the microglia attracting chemokine Secondary Lymphoid-tissue Chemokine (SLC). Glia 34:121 -133.

Biber K, Zuurman MW, Dijkstra IM, Boddeke HW. 2002. Chemokines in the brain: neuroimmunology and beyond. Curr Opin Pharmacol 2 :63-68.

Bibikova M, Laurent LC, Ren B, Loring J F, Fan JB. 2008. Unraveling epigenetic regulation in embryonic stem cells. Cell Stem Cell 2: 123-134.

Bird A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev l 6:6-21.

Bobetsis YA, Barros SP, Lin DM, Arce RM, OffenbacherS. 2010. Altered gene expression in murine placentas in an infection-induced intrauterine growth restriction model: a microarray analysis. J Reprod lmmunol 85:140-148.

Boil lee S, Yamanaka K, Lobsiger CS, Copeland NG, Jenkins NA, Kassiotis G, Ko I i i as G, Cleveland DW. 2006. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 312:1389-1392.

Boone DL, Turer EE, Lee EG, Ahmad RC, Wheeler MT, Tsui C, Hurley P, Ch ien M, Chai S, Hitotsumatsu 0, McNally E, Pickart C, Ma A. 2004. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat lmmunol 5 : 1052-1060.

Borroni EM, Buracchi C, de la Torre YM, Galliera E, Vecchi A, Bonecchi R, Mantovani A, Locati M. 2006. The chemoattractant decoy receptor D6 as a negative regulator of inflammatory responses. Biochem Soc Trans 34:1014-1017.

Brogdon J L, Xu Y, Szabo SJ, An S, Buxton F, Cohen D, Huang Q. 2007. Histone deacetylase activities are required for innate immune cell control of Thl but not Th2 effector cell function. Blood 109:1123-1130.

Brown DA , Sawchenko PE. 2007. Time course and distribution of inflammatory and neurodegenerative events suggest structural bases for the pathogenesis of experimental autoimmune encephalomyelitis. J Comp Neural 502:236-260.

Brunet A, Sweeney LB, Sturgill J F, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R, Cohen HY, Hu LS, Cheng H L, Jedrychowski MP, Gygi SP, Sinclair DA, Alt FW, Greenberg ME. 2004. Stress-dependent regulation of FOXO transcription factors by the SI Rn deacetylase. Science 303:2011-2015.

Bruniquel D, Schwartz RH. 2003. Selective, stable demethylation of the interleukin-2 gene enhances transcription by an active process. Nat lmmunol 4:235-240.

Burkly L, Hession C, Ogata L, Reilly C, Marconi LA, Olson D, Tizard R, Cate R, Lo D. 1 995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531-536.

Burnstock G. 2002. Purinergic signaling and vascular cell proliferation and death. Arterioscler Thromb Vase Biol 22:364-373.

Butovsky 0, Landa G, Kunis G, Ziv Y, Avidan H, Greenberg N, Schwartz A, Smirnov I, Pollack A, Jung S, Schwartz M. 2006. Induction and blockage of oligodendrogenesis by differently activated microglia in an animal model of multiple sclerosis. J Clin Invest 1 16:905-915.

Camelo S, Iglesias AH, Hwang D, Due B, Ryu H, Smith K, Gray SG, lmitola J, Duran G, Assaf 8, Langley B, Khoury SJ, Stephanopoulos G, De Girolami U, Ratan RR, Ferrante RJ, Dangond F. 2005. Transcriptional therapy with the hi stone deacetylase inhibitor trichostatin A ameliorates experimental autoimmune encephalomyelitis. J Neuroimmunol 164:10-21 .

32

Genera l I ntroduction

Cahi l l CM, Rogers JT, Wal ker WA. 2012. The role of phosphoinositide 3-kinase signal ing in i ntestinal inflammation. J Signal Transduct 2012:358476.

Cao Z, Xiong J, Takeuchi M, Kurama T, Goeddel DV. 1996. TRAF6 is a s ignal transducer for interleukin-1 . Nature 383:443-446.

Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G, Dombrowski 5, Dutta R, Lee JC, Cook DN, Jung 5, Lira SA, Littman DR, Ransohoff RM. 2006. Control of m icrogl ia l neurotoxicity by the fractal kine receptor. Nat Neurosci 9:917-924.

Carson MJ. 2002. Microgl ia as l ia isons between the immune and central nervous systems: functiona l impl ications for mu ltiple sclerosis. G l ia 40:218-231.

Carter BD, Kaltschmidt C, Kaltschmidt B, Offenhauser N, Bohm-Matthaei R, Baeuerle PA, Barde YA. 1996. Selective activation of NF-kappa B by nerve growth factor through the neurotrophin receptor p75. Science 272:542-545.

Cartier L, Hartley 0, Dubois-Dauphin M, Krause KH. 2005. Chemokine receptors in the central nervous system: role in bra in inflammation and neurodegenerative d iseases. Bra in Res Brain Res Rev 48:16-42.

Catusse J, Leick M, Groch M, Clark DJ, Buchner MV, Zirl i k K, Burger M. 2010. Role of the atypical chemoattractant receptor CRAM in regu lating CCL19 induced CCR? responses in B-cell chronic lymphocytic leukemia. Mol Cancer 9:297-4598-9-297.

Ceppi M, Pereira PM, Dunand-Sauthier I, Barras E, Reith W, Santos MA, Pierre P. 2009. MicroRNA-155 modulates the interleukin -1 s ignal ing pathway in activated human monocyte-derived dendritic cel ls. Proc Natl Acad Sci U 5 A 106:2735-2740.

Chan WY, Kohsaka S, Rezaie P. 2007. The origin and cell lineage of microglia: new concepts. Brain Res Rev 53:344-354.

Charo I F , Ransohoff RM. 2006. The many roles of chemokines and chemokine receptors in inflammation. N Engl J Med 354:610-621.

Chen GY, Nunez G. 2010. Sterile inflammation: sensing and reacting to damage. Nat Rev lmmunol 10:826-837.

Chen LF, Mu Y, Greene WC. 2002. Acetylation of Re IA at discrete sites regulates d istinct nuclear functions of NF-kappaB. EMBO J 21 :6539-6548.

Chen Y, Swanson RA. 2003. Astrocytes and bra in injury. J Cereb Blood Flow Metab 23:137-149.

Cheng HL, Mostoslavsky R, Saito 5, Manis JP, Gu Y, Patel P, Bronson R, Appel la E, Alt FW, Chua KF. 2003. Developmenta l defects and p53 hyperacetylation in Sir2 homolog (SIRn)-deftcient mice. Proc Natl Acad Sci U S A 100:10794-10799.

Chi AS, Bernstein BE . 2009. Developmental biology. P luripotent chromatin state. Science 323:220-221.

Choi HB, Ryu JK, Kim SU, McLarnon JG. 2007. Modu lation of the purinergic P2X7 receptor attenuates l ipopolysaccharide-mediated microgl ia l activation and neuronal damage in inflamed bra in . J Neurosci 27:4957-4968.

Choi S , Reddy P. 2011 . HDAC inhibition and graft versus host d isease. Mol Med 17:404-416.

Chung Y, Chang SH, Martinez GJ, Yang XO, Nurieva R, Kang HS, Ma L, Watowich 55, Jetten AM, Tian Q, Dong C. 2009. Critical regulation of early Th17 cel l differentiation by interleukin-1 signaling. Immunity 30:576-587.

Cal lo G, Neid hart 5, Kawashima E, Kosco-Vi lbois M, North RA, Buel l G. 1997. Tissue distribution of the P2X7 receptor. Neuropharmacology 36:1277-1283.

Conran M, Andreakos E, Pantel idis P, Smith C, Beynon HL, Dubois RM, Foxwel l BM. 2002. Nuclear factor­kappaB activation in a lveolar macrophages requires lkappaB kinase-beta, but not nuclear factor­kappaB inducing kinase. Am J Respir Crit Care Med 165:996-1004.

Constantinescu CS, Tani M, Ransohoff RM, Wysocka M, Hi l l i ard B, Fujioka T, Murphy S, Tighe PJ, Das Sarma J, Trinchieri G, Rostam i A. 2005. Astrocytes as antigen-presenting cel ls : expression of I L-12/I L-23. J Neurochem 95:331-340.

Conte M , Altucci L. 2012. Molecular pathways: the complexity of the epigenome in cancer and recent cl inical advances. Clin Cancer Res 18:5526-5534.

Cosio BG, Mann B, Ito K, Jazrawi E, Barnes PJ, Chung KF, Adcock IM. 2004. Histone acetylase and deacetylase activity in alveolar macrophages and blood mononocytes in asthma. Am J Respir Crit Care Med 170:141-147.

Davalos D, Grutzendler J, Yang G, Kim JV, Zuo Y, Jung S, Littman DR, Dustin ML, Gan WB. 2005. ATP mediates rapid m icrogl ia l response to loca l bra in injury in vivo. Nat Neurosci 8:752-758.

Davis BK, Wen H, Ting J P. 201 1 . The inflammasome NLRs in immunity, inflammation, and associated diseases. Annu Rev l mmunol 29:707-735.

33

I

CHAPT E R 1

de Haas AH, van Weering HR, de Jong EK, Boddeke HW, Biber KP. 2007. Neuronal chemokines: versatile messengers in central nervous system cell interaction. Mal Neurobiol 36:137-151 .

De Keyser J, Laureys G, Demol F, Wilczak N, Mostert J, Clinckers R. 2010. Astrocytes as potential targets to suppress inflammatory demyelinating lesions in multiple sclerosis. Neurochem I nt 57:446-450.

Delhaye S, Paul S, Blakqori G, Minet M, Weber F, Staeheli P, Michiels T. 2006. Neurons produce type I interferon during vira l encephalitis. Proc Natl Acad Sci U S A 103:7835-7840.

Deng WG, Zhu Y, Wu KK. 2004. Role of p300 and PCAF in regulating cyclooxygenase-2 promoter activation by inflammatory mediators. Blood 103:2135-2142.

Deng X , Sri ram S. 2005. Role of microglia in multiple sclerosis. Curr Neural Neurosci Rep 5:239-244.

Dhib-Jalbut S. 2007. Pathogenesis of myelin/oligodendrocyte damage in multiple sclerosis. Neurology 68:Sl3-21; discussion S43-54.

Di Donato J, Mercurio F, Rosette C, Wu-Li J, Suyang H, Ghosh S, Karin M. 1996. Mapping of the inducible lkappaB phosphorylation sites that signal its ubiquitination and degradation. Mal Cell Biol 16 : 1295-1304.

Dong Y , Benveniste EN. 2001 . Immune function of astrocytes. Glia 36:180-190.

Douillet CD, Robinson WP,3rd, Milano PM, Boucher RC, Rich PB. 2006. Nucleotides induce IL-6 release from human airway epithelia via P2Y2 and p38 MAPK-dependent pathways. Am J Physiol Lung Cell Mol Physiol 291:L734-46.

Duewell P, Kono H, Rayner KJ, Sirois CM, Vladimer G, Bauernfeind FG, Abela GS, Franchi L, Nunez G, Schnurr M, Espevik T, Lien E, Fitzgerald KA, Rock KL, Moore KJ, Wright SD, Hornung V, Latz E. 2010. NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals. Nature 464:1357-1361.

Edwards AJ, Pender SL. 2011. Histone deacetylase in hibitors and their potential role in inflammatory bowel diseases. Biochem Soc Trans 39:1092-1095.

El Gazzar M, McCall CE. 2010. MicroRNAs distinguish translational from transcriptional silencing during endotoxin tolerance. J Biol Chem 285:20940-20951 .

El Khoury J, Toft M, Hickman SE, Mea ns TK, Terada K, Geula C, Luster AD. 2007. Ccr2 deficiency impairs microglial accumulation and accelerates progression of Alzheimer-like disease. Nat Med 13:432-438.

Ellis SL, Gysbers V, Manders PM, Li W, Hofer MJ, Muller M, Campbell I L . 2010. The cell-specific induction of CXC chemokine ligand 9 mediated by I F N -gamma in microglia of the central nervous system is determined by the myeloid transcription factor PU.1 . J I mmunol 1 85:1864-1 877.

Engel T, Jimenez- Pacheco A, Miras-Portugal MT, Diaz- Hernandez M, Henshall DC. 2012. P2X7 receptor in epilepsy; role in pathophysiology and potential targeting for seizure control. I nt J Physiol Pathophysiol Pharmacol 4:174-1 87.

Feng LY, Ou ZL, Wu FY, Shen ZZ, Shao ZM. 2009. I nvolvement of a novel chemokine decoy receptor CCX-CKR in breast cancer growth, metastasis and patient survival. Clin Cancer Res 15:2962-2970.

Fernandez EJ, Loi is E. 2002. Structure, function, and inhibition of chemokines. Annu Rev Pharmacol Toxicol 42:469-499.

Ferrari D, Chiozzi 1-l, Falzoni S, Dal Susino M, Melchiorri L, Baricordi OR, Di Virgilio F. 1997a. Extracellular ATP triggers I L-1 beta release by activating the purinergic P2Z receptor of human macrophages. J lmmunol 159:1451-1458.

Ferrari D, Chiozzi P, Falzoni S, Hanau S, Di Virgilio F. 1997b. Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin. J Exp Med 185:579-582.

Ferrari D, Villalba M, Chiozzi P, Falzoni S, Ricciardi-Castagnoli P, Di Virgilio F. 1996. Mouse microglial cells express a plasma membrane pore gated by extracel lular ATP. J l mmunol 156:1531-1539.

F lynn G, Maru S, Loughlin J, Romero IA, Male D. 2003. Regulation of chemokine receptor expression in human microglia and astrocytes. J Neuroimmunol 136:84-93.

Foster SL, Hargreaves DC, Medzhitov R. 2007. Gene-specific control of inflammation by TLR-induced chromatin modifications. Nature 447:972-978.

Foster SL, Medzhitov R. 2009. Gene-specific control of the TLR-induced inflammatory response. Clin l mmunol 130:7-15.

Fra AM, Locati M, Otero K, Sironi M, Signorelli P, Massardi ML, Gobbi M, Vecchi A, Sozzani S, Mantovani A. 2003. Cutting edge: scavenging of inflammatory CC chemokines by the promiscuous putatively silent chemokine receptor D6. J lm munol 170:2279-2282.

Franke H, Gunther A, GroscheJ, Schmidt R, RossnerS, Reinhardt R, Faber-Zuschratter H, Schneider D, Illes P. 2004. P2X7 receptor expression after ischemia in the cerebral cortex of rats. J Neuropathol Exp Neurol 63:686-699.

34

General Introduction

Fu LH, Ma CL, Cong B, Li SJ, Chen HY, ZhangJG.2011 . Hypomethylation of proximal CpG motifofinterleukin-10

I promoter regulates its expression in human rheumatoid arthritis. Acta Pharmacol Sin 32:137 3-1380.

Fulton AM. 2009. The chemokine receptors CXCR4 and CXCR3 in cancer. Curr Oncol Rep 1 1 : 125-131 .

Furlan R, Martino G, Galbiati F, Poliani PL, Smiroldo S, Bergami A, Desina G, Comi G, Flavell R, Su MS, Adorini L. 1999. Caspase-1 regulates the inflammatory process leading to autoimmune demyelination. J lmmunol 1 63:2403-2409.

Gao HM, Liu B, Zhang W, Hong JS. 2003. Critical role of microglial NADPH oxidase-derived free radicals in the in vitro MPTP model of Parkinson's disease. FASEB J 1 7 : 1954-1956.

Gao L, Cueto MA, Asselbergs F, Atadja P. 2002. Cloning and functional characterization of H DACll, a novel member of the human histone deacetylase family. J Biol Chem 27 7 :25748-25755.

Garcia-Lopez MA, Sanchez-Madrid F, Rodriguez-Frade JM, Mellado M, Acevedo A, Garcia Ml, Albar JP, Martinez C, Marazuela M. 2001. CXCR3 chemokine receptor distribution in normal and inflamed tissues: expression on activated lymphocytes, endothelial cells, and dendritic cells. Lab Invest 81 :409-418.

Garwood CJ, Pooler AM, Atherton J, Hanger DP, Noble W. 201 1 . Astrocytes are important mediators of Abeta-induced neurotoxicity and tau phosphorylation in primary culture. Cell Death Dis 2:el67.

Gehrmann J, Matsumoto Y, Kreutzberg GW. 1995. Microglia : intrinsic immuneffector cell of the brain. Brain Res Brain Res Rev 20:269-287.

Gemma C, Bachstetter AD, Bickford PC. 2010. Neuron-Microglia Dialogue and Hippocampal Neurogenesis in the Aged Bra in. Aging Dis 1 :232-244.

Gendron FP, Chalimoniuk M, Strosznajder J, Shen S, Gonzalez FA, Weisman GA, Sun GY. 2003. P2X7 nucleotide receptor activation enhances I FN gamma-induced type II nitric oxide synthase activity in BV-2 microglial cells. J Neurochem 87 :344-352.

Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Willson TM, Rosenfeld MG, Glass CK. 2007. Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARgamma. Mol Cell 25:57-70.

Ghizzoni M, Ha isma HJ, Maarsingh H, Dekker FJ. 201 1 . Histone acetyltransferases are crucial regulators in N F-kappaB mediated inflammation. Drug Discov Today l6:504-5ll .

Gilchrist M , Thorsson V, Li B, Rust AG, Korb M, Roach JC, Kennedy K, Hai T, Bolouri H , Aderem A . 2006. Systems biology approaches identify ATF3 as a negative regulator ofToll-like receptor 4. Nature 441:1 73-1 7 8.

Gillespie J, Savic S, Wong C, Hempshall A, Inman M, Emery P, Grigg R, McDermott MF. 2012. Histone deacetylases a re dysregulated in rheumatoid arthritis and a novel histone deacetylase 3-selective inhibitor reduces interleukin-6 production by peripheral blood mononuclea r cells from rheumatoid arthritis patients. Arthritis Rheum 64:41 8-422.

Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, Mehler MF, Conway SJ, Ng LG, Stanley ER, Samokhvalov IM, Merad M. 2010. Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science 330:841-845.

Gon Y, Asai Y, Hashimoto S, Mizumura K, Jibiki I, Machine T, Ra C, Horie T. 2004. A20 inhibits toll-like receptor 2-and 4-mediated interleukin-8 synthesis in airway epithelial cells. Am J Respir Cell Mol Biol 31 :330-336.

Gonzalez-Scarano F , Baltuch G. 1999. Microglia as mediators of inflammatory and degenerative d iseases. Annu Rev Neurosci 22:219-240.

Gordon S. 2003. Alternative activation of macrophages. Nat Rev lmmunol 3:23-35.

Gorina R, Font- N ieves M, Marquez- Kisinousky L, Santalucia T, Planas AM. 201 1 . Astrocyte TLR4 activation induces a proinflammatory environment through the interplay between MyD88-dependent N FkappaB signaling, MAPK, and Jakl/Statl pathways. Glia 59:242-255.

Gosling J, Dairaghi DJ, Wang Y, Hanley M, Talbot D, Miao Z, Schall TJ. 2000. Cutting edge: identification of a novel chemokine receptor that binds dendritic cell- and T cell-active chemokines including ELC, SLC, and TECK. J lmmunol 1 64:2851-2856.

Graham GJ. 2009. D6 and the atypical chemokine receptor family: novel regulators of immune and inflammatory processes. Eur J lmmunol 39:342-351.

Grandvaux N, Servant MJ, tenOever B, Sen GC, Balachandran S, Barber GN, Lin R, Hiscott J. 2002. Transcriptional profiling of interferon regulatory factor 3 target genes: di rect involvement in the regulation of interferon-stimulated genes. J Virol 7 6:5532-5539.

Greenberg S. 1995. Signal transduction of phagocytosis. Trends Cell Biol 5:93-99.

35

CHAPTER 1

Greene WC , Chen LF. 2004. Regulation of NF-kappa B action by reversible acetylation. Nova rtis found Symp 259:208-17; discussion 218-25.

Greter M, Merad M. 2013. Regulation of microglia development and homeostasis. Glia 61: 121-127.

Guardiola A R , Yao TP. 2002. Molecular cloning and characterization of a novel hi stone deacetylase H DAClO. J Biol Chem 277:3350-3356.

Guo Q, Robinson N, Mattson MP. 1998. Secreted beta-amyloid precursor protein counteracts the proapoptotic action of mutant presenilin-1 by activation of N F- kappa B and stabilization of calcium homeostasis. J Biol Chem 273:12341-12351.

Hali Ii MA, Andrews MR, Sweet MJ, Fairlie DP. 2009. Histone deacetylase inhibitors in inflam matory disease. Curr Top Med Chem 9:309-319.

Halle A, Hornung V, Petzold GC, Stewart CR, Monks BG, Reinheckel T, Fitzgerald KA, Latz E, Moore KJ, Golen bock DT. 2008. The NALP3 inflammasome is involved in the innate immune response to a myloid­beta. Nat l mmunol 9:857-865.

Han J, Ulevitch RJ. 2005. Limiting inflammatory responses during activation of innate immunity. Nat lmmunol 6: 1198-1205.

Hanisch U K , Kettenmann H. 2007. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat Neurosci 10: 1387-1394.

Harrison J K, Jiang Y, Chen S, Xia Y, Maciejewski D, McNamara RK, Streit WJ, Salafranca MN, Adhikari S, Thompson DA, Botti P, Bacon KB, Feng L. 1998. Role for neuronally derived fractalkine in mediating interactions between neurons and CX3CR1-expressing microglia. Proc Natl Acad Sci U S A 95:10896-10901.

Hata H, Yoshimoto T, Hayashi N, Hada T, Nakanishi K. 2004. I L-1 8 together with anti-CD3 antibody induces human Thl cells to produce Thl- and Th2-cytokines and I L-8. Int l mmunol 16:1733-1739.

Hockly E, Richan VM, Woodman B, Smith DL, Zhou X, Rosa E, Sathasivam K, Ghazi-Noori S, Mahal A, Lowden PA, Steffan JS, Marsh JL, Thompson LM, Lewis CM, Marks PA, Bates GP. 2003. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington's disease. Proc Natl Acad Sci U S A 100:2041-2046.

Hatherley D , Ba rclay AN. 2004. The CD200 and CD200 receptor cell surface proteins interact through their N-terminal immunoglobulin-like domains. Eur J l mmunol 34:1 688-1694.

Haynes SE, Hollopeter G, Yang G, Kurpius D, Dailey M E, Gan WB, Julius D. 2006. The P2Y12 receptor regulates microglial activation by extracellular nucleotides. Nat Neurosci 9:1512-1519.

He F, Sun YE. 2007. Glial cells more than support cells? Int J Biochem Cell Biol 39:661-665.

Heneka MT, Kum mer MP, Stutz A, Delekate A, Schwartz S, Vieira-Saecker A, Griep A, Axt D, Remus A, Tzeng TC, Gel pi E, Halle A, Korte M, Latz E, Golen bock DT. 2012. N LRP3 is activated in Alzheimer's disease and contributes to pathology in APP/PSl mice. Nature .

Henkel JS, Beers DR, Zhao W, Appel SH. 2009. Microglia in ALS: the good, the bad, and the resting. J Neuroimmune Pharmacol 4:389-398.

Heppner FL, Greter M, Marino D, Falsig J, Raivich G, Hovelmeyer N, Waisman A, Rulicke T, Prinz M, Priller J, Becher B, Aguzzi A. 2005. Experimental autoimmune encephalomyelitis repressed by microglial paralysis. Nat Med 1 1 :146-152.

Herculano-Houzel S. 2009. The human brain in numbers: a linearly scaled-up primate brain. Front Hum Neurosci 3:31.

Herman JG, Baylin SB. 2003. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042-2054.

Hori S, Nomura T, Sakaguchi S. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science299:1057-1061.

Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, Blom B, Homola ME, Streit WJ, Brown MH, Barclay AN, Sedgwick JD. 2000. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 290:1768-1771.

Holley JE, Gveric D, Newcombe J, Cuzner ML, Gutowski NJ. 2003. Astrocyte characterization in the multiple sclerosis glial scar. Neuropathol Appl Neurobiol 29:434-444.

Holmoy T, Hestvik AL. 2008. Multiple sclerosis: im munopathogenesis and controversies in defining the cause. Curr Opin Infect Dis 21 :271 -278.

36

Genera l I ntroduction

Honda K, Taniguchi T. 2006. I RFs: master regulators of s ignal l ing by Tol l - l i ke receptors and cytosolic pattern-

I recognition receptors. Nat Rev lmmunol 6:644-658.

Honda K, Yanai H, Mizutan i T, Negishi H, Sh imada N, Suzuki N, Ohba Y, Takaoka A, Yeh WC, Tan iguchi T. 2004. Role of a transductiona l -transcriptional processor complex involving My088 and I RF-7 in Tol l ­l i ke receptor signa l ing . Proc Natl Acad Sci U S A 101 :15416-15421.

Honda K, Yanai H, Takaoka A, Taniguchi T. 2005. Regu lation of the type I I FN induction: a current view. Int lmmunol 17:1367-1378.

Honda S, Sasaki Y, Ohsawa K, Ima i Y, Nakamura Y, Inoue K, Kohsaka S. 2001 . Extracel lu lar ATP or ADP induce chemotaxis of cu ltured microgl ia through Gi/o-coupled P2Y receptors. J Neurosci 21:1975-1982.

Horng T, Barton GM, Medzhitov R. 2001 . TIRAP: an adapter molecule in the Toll s ignal ing pathway. Nat l mmunol 2:835-841.

Hu S, Chao CC, Ehrl ich LC, Sheng WS, Sutton RL, Rockswold GL, Peterson PK. 1999. I nhibition of m icrogl ia l cel l RANTES production by I L-10 and TGF-beta . J Leukoc Biol 65 :815-821 .

Huang RS, Hu GQ, Lin B, Lin -ZV, Sun CC. 2010. MicroRNA-155 silencing enhances inflammatory response and l ipid uptake in oxidized low-density l ipoprotein-stimulated human THP-1 macrophages. J lnvestig Med 58:961-967.

Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, N ixon A, Yoshida M, Wang XF, Yao TP. 2002. H DAC6 is a microtubule-associated deacetylase. Nature 417:455-458.

Huh Y, Jung JW, Park e, Ryu JR, Sh in CY, Kim WK, Ryu JH . 2003. Microgl ia l activation and tyrosine hydroxylase immunoreactivity in the substantia nigra l region fol lowing transient focal ischemia in rats. N eurosci Lett 349:63-67.

Humphreys BO, Rice J, Kertesy SB, Dubyak GR . 2000. Stress-activated protein kinase/JNK activation and apoptotic induction by the macrophage P2X7 nucleotide receptor. J Biol Chem 275:26792-26798.

Ima i S, Armstrong CM, Kaeberlein M, Guarente L. 2000. Transcriptional si lencing and longevity protein S ir2 is an NAO-dependent h istone deacetylase. Nature 403:795-800.

Imler J L , Hoffmann JA. 2003. Toll signa l ing: the TIReless quest for specificity. Nat lmmunol 4:105-106.

Ito K, Ito M, Ell iott WM, Cosio B, Caramori G, Kon OM, Barczyk A, Hayashi S, Adcock IM, Hogg JC, Barnes PJ. 2005. Decreased histone deacetylase activity in chronic obstructive pulmonary disease. N Engl J Med 352:1967-1976.

Jamieson T, Cook ON, N ibbs RJ, Rot A, N ixon C, McLean P, Alcami A, Lira SA, Wiekowski M, Graham GJ. 2005. The chemokine receptor D6 l imits the inflammatory response in vivo. Nat l mmunol 6:403-411 .

Jenuwein T , Al l is CD. 2001 . Translating the h istone code. Science 293:1074-1080.

Jones PA , Liang G. 2009. Reth inking how DNA methylation patterns a re maintained. Nat Rev Genet 10:805-811 .

Jung S, Aliberti J , Graemmel P, Sunsh ine MJ, Kreutzberg GW, Sher A, Littman DR. 2000. Ana lysis of fracta lk ine receptor CX(3)CR1 function by targeted deletion and g reen fluorescent protein reporter gene insertion . Mol Cell Biol 20:4106-4114.

Kah lenberg JM , Dubyak GR. 2004. Mechanisms of caspase-1 activation by P2X7 receptor-mediated K+ release. Am J Physiol Cell Physiol 286:Cll00-8.

Kaltschmidt C, Kaltschmidt B, Neumann H, Wekerle H, Baeuerle PA. 1994. Constitutive NF-kappa B activity in neurons. Mol Cel l Biol 14:3981-3992.

Kanneganti TD, Lamkanfi M, Kim YG, Chen G, Park JH, Franchi L, Vandenabeele P, Nunez G. 2007. Pannexin-1 -mediated recognition of bacteria l molecules activates the cryopyrin inflammasome independent of Tol l - l ike receptor s ignal ing. Immun ity 26:433-443.

Karberg S. 2009. Switch ing on epigenetic therapy. Cel l 139:1029-1031.

Karin M, Ben-Neriah Y. 2000. Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev lmmunol 18:621-663.

Kaur C, Too H F, Ling EA. 2004. Phagocytosis of Escherichia coli by amoeboid microgl ia l cel ls in the developing bra in . Acta Neuropathol 107:204-208.

Kawahara TL, Michish ita E, Adler AS, Dam ian M, Berber E, Lin M, McCord RA, Ongaigui KC, Boxer LO, Chang HY, Chua KF. 2009. S I RT6 l inks histone H3 lysine 9 deacetylation to NF-kappaB-dependent gene expression and organismal l ife span . Cel l 136:62-74.

Kawai T, Adachi 0, Ogawa T, Takeda K, Akira S. 1999. Unresponsiveness of MyD88-deficient m ice to endotoxin . lmmunity l l :115-122.

Kawai T , Akira S . 2011 . Tol l - l i ke receptors and their crossta l k with other innate receptors in infection and immunity. Immunity 34:637-650.

37

C HA PTER 1

Kersul AL, Iglesias A, Rios A, Noguera A, Forteza A, Serra E, Agusti A, Cosio BG. 201 1 . Molecular mechanisms of inflammation during exacerbations of chronic obstructive pulmonary disease. Arch Bronconeumol 47 : 1 76-183.

Kettenmann H. 2007. Neuroscience: the brain's garbage men. Nature 446:987-989.

Kim HJ, Rowe M, Ren M, Hong JS, Chen PS, Chuang DM. 2007. Histone deacetylase inhibitors exhibit anti­inflammatory and neuroprotective effects in a rat permanent ischemic model of stroke: multiple mechanisms of action. J Pharmacol Exp Ther 321:892-901.

Khan 0, La Thangue NB. 2012. H DAC inhibitors in cancer biology: emerging mechanisms and clinical applications. lmmunol Cell Biol 90:85-94.

Khorooshi R, Owens T. 2010. Injury-induced type I I FN signaling regulates inflammatory responses in the central nervous system. J lmmunol 1 85:1258-1264.

Kieseier BC , Stuve 0. 201 1 . A critical appraisal of treatment decisions in multiple sclerosis--old versus new. Nat Rev Neurol 7 :255-262.

Kim JE, Ryu HJ, Yeo SI, Kang TC. 2011 . P2X7 receptor differentially modulates astroglial apoptosis and clasmatodendrosis in the rat brain following status epilepticus. Hippocampus 21 : 13 18-1333.

Kim JM. 201 1 . Inflammatory bowel diseases and inflammasome. Korean J Gastroenterol 58:300-310.

Koizumi S, Shigemoto-Mogami Y, Nasu-Tada K, Shinozaki Y, Ohsawa K, Tsuda M, Joshi BV, Jacobson KA, Kohsaka S, Inoue K. 2007. UDP acting at P2Y 6 receptors is a mediator of microglial phagocytosis. Nature 446:1091-1095.

Kondo T, Kawai T, Akira S. 2012 . Dissecting negative regulation of Toll-like receptor signaling. Trends lmmunol 33:449-458.

Korn T, Rao M, Magnus T. 2007. Autoimmune modulation of astrocyte-mediated homeostasis. Neuromolecular Med 9: 1- 16.

Kovacs JJ, Murphy PJ, Gaillard S, Zhao X, Wu JT, Nicchitta CV, Yoshida M, Toft DO, Pratt WB, Yao TP. 2005. H DAC6 regulates Hsp90 acetylation and chaperone-dependent activation of glucocorticoid receptor. Mal Cell 1 8:601 -607.

Kraft AD, Harry GJ. 201 1 . Features of microglia and neuroinflammation relevant to environmental exposure and neurotoxicity. lnt J Environ Res Public Health 8:2980-3018.

Kriegova E, Tsyrulnyk A, Arakelyan A, Mrazek F, Ordeltova M, Petzmann S, Zatloukal J, Kolek V, du Bois RM, Popper H, Petrek M. 2006. Expression of CCX CKR in pulmonary sarcoidosis. lnflamm Res 55:441 -445.

Kubota T, Miyake K, Hirasawa T. 2012. Epigenetic understanding of gene-environment interactions in psychiatric disorders: a new concept of clinical genetics. Clin Epigenetics 4:1-7083-4-1 .

Kutzelnigg A, Lucchinetti CF, Stadelmann C, Bruck W, Rauschka H, Bergmann M, Schmidbauer M, Parisi JE, Lassmann H. 2005. Cortical demyelination and diffuse white matter injury in multiple sclerosis. Brain 128:2705-27 12.

Lacotte S, Brun S, Muller S, Du mortier H . 2009. CXCR3, inflammation, and autoimmune diseases. Ann N Y Acad Sci 1 173:310-317.

Lalancette-Hebert M, Gowing G, Simard A, Weng YC, Kriz J. 2007. Selective a blation of proliferating microglial cells exacerbates ischemic injury in the brain. J Neurosci 27 :2596-2605.

Langley E, Pearson M, Faretta M, Bauer UM, Frye RA, Minucci S, Pelicci PG, Kouzarides T. 2002. H uman SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence. EMBO J 21 :2383-2396.

Lassmann H. 1998. Neuropathology in multiple sclerosis: new concepts. Mult Seier 4:93-98.

Lawson LJ, Perry VH, Dri P, Gordon S. 1990. Heterogeneity in the distribution and morphology of microglia in the normal adu lt mouse brain. Neuroscience 39:151-1 70.

Le Feuvre RA, Brough D, lwakura Y, Takeda K, Rothwell NJ. 2002. Priming of macrophages with lipopolysaccharide potentiates P2X7-mediated cell death via a caspase-1-dependent mechanism, independently of cytokine production. J Biol Chem 27 7 :3210-3218.

Leavy 0. 2010. Neuroimmunology: The origins of microglial cells. Nat Rev Neurosci 1 1 : 787.

Lee KK , Workman JL. 2007. Histone acetyltransferase complexes: one size doesn't fit all. Nat Rev Mal Cell Biol 8:284-295.

Lee SC, Moore GR, Golenwsky G, Raine CS. 7990. Multiple sclerosis: a role for astroglia in active demyelination suggested by class II MHC expression and ultrastructural study. J Neuropathol Exp Neurol 49:122-136.

Leoni F, Zaliani A, Bertolini G, Porro G, Pagani P, Pozzi P, Dona G, Fossati G, Sozzani S, Azam T, Bufler P, Fantuzzi G, Goncharov I, Kim SH, Pomerantz BJ, Reznikov LL, Siegmund B, Dinarello CA, Mascagni P. 2002. The

38

General Introd uction

antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc Natl Acad Sci U S A 99:2995-3000.

Lengyel P. 1982. Biochemistry of interferons and their actions. Annu Rev Biochem 51 :251 -282.

Li N, Zhao D, Kirschbaum M, Zhang C, Lin CL, Todorov I, Kandeel F, Forman S, Zeng D. 2008. HDAC inhibitor reduces cytokine storm and facilitates induction of chimerism that reverses lupus in a nti-CD3 conditioning regimen. Proc Natl Acad Sci U S A 105:4796-4801.

Li Y, de Haar C, Chen M, Deuring J, Gerrits MM, Smits R, Xia B, Kuipers EJ, van der Woude CJ. 2010. Disease­related expression of the I L6/STAT3/SOCS3 signalling pathway in ulcerative colitis and ulcerative colitis-related carcinogenesis. Gut 59:227 -235.

Li Y, Shin D, Kwon SH. 2012. Histone deacetylase 6 plays a role as a distinct regulator of diverse cellular processes. FEBS J .

Lin T, Chen H, Koustova E, Sail ha mer EA, Li Y, Shults C, Liu B, Rhee P, Kirkpatrick J, Alam HB. 2007. Histone deacetylase as therapeutic target in a rodent model of hemorrhagic shock: effect of different resuscitation strategies on lung and liver. Surgery 141 :7 84-7 94.

Lin R, Heylbroeck C, Pitha PM, Hiscott J. 1998. Virus-dependent phosphorylation of the I RF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mal Cell Biol 1 8:2986-2996.

Lin SC, Lo YC, Wu H. 2010. Helica l assembly in the MyD88- I RAK4- I RAK2 complex in TLR/ I L-l R signalling. Nature 465:885-890.

Liu H, Hu Q, Kaufman A, D'Ercole AJ, Ye P. 2008. Developmental expression of hi stone deacetylase 11 in the murine brain. J Neurosci Res 86:537-543.

Liu L, Graham GJ, Damodaran A, Hu T, Lira SA, Sasse M, Canasto-Chibuque C, Cook DN, Ransohoff RM. 2006. Cutting edge: the silent chemokine receptor D6 is required for generating T cell responses that mediate experimental autoimmune encephalomyelitis. J lmmunol 1 7 7 : 1 7 -21 .

Liu Y, Walter S, Stagi M, Cherny D, Letiembre M, Schulz-Schaeffer W, Heine H, Penke B, Neumann H, Fassbender K. 2005. LPS receptor (CD14): a receptor for phagocytosis of Alzheimer's amyloid peptide. Brain 128:1 7 78-1 7 89.

Liuzzi GM, Latronica T, Fasano A, Carlone G, Riccio P. 2004. Interferon-beta inhibits the expression of metalloproteinases in rat glial cell cultures: implications for multiple sclerosis pathogenesis and treatment. Mult Seier 10:290-297.

Lu J, Sun H, Wang X, Liu C, Xu X, Li F, Huang B. 2005. lnterleukin-12 p40 promoter activity is regulated by the reversible acetylation mediated by H DACl a nd p300. Cytokine 31 :46-5 1 .

Lunyak VV, Rosenfeld MG. 2008. Epigenetic regulation of stem cell fate. Hum Mal Genet 1 7 : R28-36.

Mack CL, Vanderlugt-Castaneda CL, Neville KL, Miller SD. 2003. Microglia are activated to become competent antigen presenting and effector cells in the inflammatory environment of the Theiler's virus model of multiple sclerosis. J Neuroimmunol 144:68-79.

Maggirwar SB, Sarmiere PD, Dewhurst S, Freeman RS. 1998. Nerve growth factor-dependent activation of NF-kappaB contributes to survival of sympathetic neurons. J Neurosci 1 8:10356-10365.

Makarov 55. 2001 . N F- kappa B in rheumatoid arthritis: a pivotal regulator of inflammation, hyperplasia, and tissue destruction. Arthritis Res 3:200-206.

Makarov 55. 2000. N F- kappaB as a therapeutic target in chronic inflammation: recent advances. M al Med Today 6:441-448.

Mansell A, Smith R, Doyle SL, Gray P, Fenner JE, Crack PJ, Nicholson SE, Hilton DJ, O'Neill LA, Hertzog PJ. 2006. Suppressor of cytokine signa ling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat lmmunol 7 : 148-155.

Mantovani A, Bonecchi R, Locati M. 2006. Tuning inflammation and immunity by chemokine sequestration: decoys and more. Nat Rev lmmunol 6:907-918.

Marmorstein R. 2001 . Structure of histone acetyltransferases. J Mal Biol 3 1 1 :433-444.

Marques KB, Santos LM, Oliveira AL . 2006. Spinal motoneuron synaptic plasticity during the course of an animal model of multiple sclerosis. Eur J Neurosci 24:3053-3062.

Marsh B, Stevens SL, Packard AE, Gopalan B, Hunter B, Leung PY, Harrington CA, Stenzel- Poore M P. 2009. Systemic lipopolysaccharide protects the brain from ischemic injury by reprogramming the response of the brain to stroke: a critical role for I RF3. J Neurosci 29:9839-9849.

39

I

CHAPTER 1

Martinon F. 2010. Signaling by ROS drives inflammasome activation. Eur J lmmunol 40:61 6-619.

Masters SL , Latz E, O'Neill LA . 201 1 . The inflammasome in atherosclerosis and type 2 diabetes. Sci Transl Med 3:8lpsl 7.

Matsumoto Y, Ohmori K, Fujiwara M. 1992. Microglial and astroglial reactions to inflammatory lesions of experimental autoimmune encephalomyelitis in the rat central nervous system. J Neuroimmunol 37:23-33.

Mattson MP. 2005. NF-kappa B in the survival and plasticity of neurons. Neurochem Res 30:883-893.

Mattson M P , Camandola S. 2001 . N F-kappaB in neuronal plasticity and neurodegenerative disorders. J Clin Invest 107 :247-254.

Matyash V, Kettenmann H. 2010. Heterogeneity in astrocyte morphology and physiology. Brain Res Rev 63:2-10.

McLarnon JG, Ryu JK, Walker DG, Choi HB. 2006. Upregulated expression of purinergic P2X(7) receptor in Alzheimer disease and amyloid -beta peptide-treated microglia and in peptide-injected rat hippocampus. J N europathol Exp Neurol 65:1090-1097.

Medzhitov R, Horng T. 2009. Transcriptional control of the inflammatory response. Nat Rev lmmunol 9:692-703.

Meucci 0, Fatatis A, Simen AA, Bushell TJ, Gray PW, Miller RJ. 1 998. Chemokines regulate hippocampal neuronal signaling and gpl20 neurotoxicity. Proc Natl Acad Sci U S A 95:14500-14505.

Minamiyama M, Katsuno M, Adachi H, Waza M, Sang C, Kobayashi Y, Tanaka F, Doyu M, lnukai A, Sobue G. 2004. Sodium butyrate ameliorates phenotypic expression in a transgenic mouse model of spinal and bulbar muscular atrophy. Hum Mal Genet 13: 1 183-1 192.

Minten C, Terry R, Deffrasnes C, King NJ, Campbell IL . 2012. IFN regulatory factor 8 is a key constitutive determinant of the morphological and molecular properties of microglia in the CNS. PLoS One 7 :e49851 .

Mitchison TJ , Cramer LP. 1996. Actin-based cell motility and cell locomotion. Cell 84:371-379.

Miyake K . 2007. I nnate immune sensing of pathogens and danger signals by cell surface Toll-like receptors. Semin lmmunol 1 9:3-10.

Moore CS, Abdulla h SL, Brown A, Arulpragasam A, Crocker SJ. 201 1 . How factors secreted from astrocytes impact myelin repair. J Neurosci Res 89:13-21 .

Moser B , Loetscher P. 2001 . Lymphocyte traffic control by chemokines. Nat lmmunol 2:123-128.

Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M, Guarente L. 2004. Mammalian S IRTI represses forkhead transcription factors. Cell 116:551 -563.

Moynagh PN, Williams DC, O'Neill LA. 1993. l nterleukin-1 activates transcription factor NF kappa B in glial cells. Biochem J 294 ( Pt 2):343-347.

Mroz RM, Noparlik J, Chyczewska E, Braszko JJ, Holownia A. 2007. Molecular basis of chronic inflammation in lung diseases: new therapeutic approach. J Physiol Pharmacol 58 Suppl 5:453-460.

Murphy AC, Lalor SJ, Lynch MA, Mills KH. 2010. I nfiltration of Thl and Thl 7 cells and activation of microglia in the CNS during the course of experimental autoimmune encephalomyelitis. Brain Behav lmmun 24:641-651 .

Nair A , Frederick TJ, Miller SD. 2008. Astrocytes i n multiple sclerosis: a product o f their environment. Cell Mal Life Sci 65:2702-2720.

Nakagawa R, Naka T, Tsutsui H, Fujimoto M, Kimura A, Abe T, Seki E, Sato S, Takeuchi 0, Takeda K, Akira S, Yamanishi K, Kawase I , Na kanishi K, Kishimoto T. 2002. SOCS-1 participates in negative regulation of LPS responses. Immunity 1 7 :67 7 -687.

Nakajima K, Matsushita Y, Tohyama Y, Kohsaka S, Kurihara T. 2006. Differential suppression of endotoxin­inducible inflammatory cytokines by nuclear factor kappa B (N FkappaB) inhibitor in rat microglia . Neurosci Lett 401 : 199-202.

Nakano K, Whitaker JW, Boyle DL, Wang W, Firestein GS. 2013. DNA methylome signature in rheumatoid arthritis. Ann Rheum Dis 72 :110-117.

Nash B, Thomson CE, Linington C, Arthur AT, McClure JD, McBride MW, Barnett SC. 201 1 . Functional duality of astrocytes in myelination. J Neurosci 31: 13028-13038.

Nasu-Tada K, Koizumi S, I noue K. 2005. I nvolvement of betal integrin in microglial chemotaxis and proliferation on fi bronectin: different regulations by ADP through PKA . Glia 52:98-107.

Nelson PT, Soma LA, Lavi E. 2002. Microglia in diseases of the central nervous system. Ann Med 34:491-500.

Neote K, Darbonne W, Ogez J, Horuk R, Schall TJ. 1993. Identification of a promiscuous inflammatory peptide receptor on the surface of red blood cells. J Biol Chem 268:12247-12249.

40

General I nt ro duction

Neumann H, Kotter MR, Franklin RJ. 2009. Debris clearance by microglia: an essential link b etween

I degeneration and regeneration. Brain 132:288-295.

N im merja hn A, Kirchhoff F, Helmchen F. 2005. Resting microglial cells are h ighly dynamic surveillants of brain parenchyma in vivo. Science 308:1314-131 8.

N ish ida K, Komiyama T, Miyazawa S, Shen ZN, Furumatsu T, Doi H, Yoshida A, Yamana J, Yamamura M, Ninomiya Y, Inoue H, Asahara H. 2004. Histone deacetylase inhibitor suppression of autoantibody­mediated arthritis in m ice via regulation of pl6 INK4a and p2l(WAF1/Cipl) expression. Arthritis Rheum 50:3365-337 6.

Nishiyori A, Minami M, Ohtani Y, Takami S, Yamamoto J, Kawaguchi N, Kume T, Aka ike A, Satoh M. 1998. Localization of fractal kine and CX3CR1 m RNAs in rat brain: does fractal kine play a role in signaling from neuron to microglia? FEBS Lett 429:167 -1 72.

Nusinzon I , Horvath CM. 2006. Positive and negative regulation of the innate antiviral response and beta interferon gene expression by deacetylation. Mal Cell Biol 26:3106-31 13.

O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. 2007. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 1 04:1604-1609.

O'Connor W,Jr, Ha rton JA, Zhu X, Linh off MW, Ting J P. 2003. Cutting edge: CIAS1/cryopyrin/PYPAF1/NALP3/ CATERPI LLER 1 .1 is an inducible inflammatory mediator with NF-kappa B suppressive properties. J l mmunol 1 7 1 :6329-6333.

O'Neill LA, Kaltschmidt C. 1997. N F-kappa B: a crucial transcription factor for glial and neuronal cell function. Trends Neurosci 20:252-258.

Ooi AT, Ram S, Kuo A, Gilbert JL, Yan W, Pellegrini M, N ickerson DW, Chatila TA, Gomperts BN . 2012. Identification of an interleukin 13- induced epigenetic signature in allergic a i rway inflammation. Am J Transl Res 4:219-228.

Oyanguren-Desez 0, Rodriguez-Antiguedad A, Villoslada P, Domercq M, Alberdi E, Matute C. 201 1 . Gain-of­function of P2X7 receptor gene variants in multiple sclerosis. Cell Calcium 50:468-472.

Parvathenani LK, Tertyshnikova S, Greco CR, Roberts SB, Robertson B, Posmantur R. 2003. P2X7 mediates superoxide production in primary microglia and is up-regulated in a transgenic mouse model of Alzheimer's d isease. J Biol Chem 278: 13309-1331 7.

Peri F, Piazza M. 2012 . Therapeutic targeting of innate immunity with Toll-l ike receptor 4 (TLR4) antagonists. Biotechnol Adv 30:251-260.

Pestka S, Langer JA, Zoon KC, Samuel CE. 1987. Interferons and their actions. Annu Rev Biochem 56:727-7 7 7.

Peterson JW, B o L , Mork S, Chang A , Trapp BD. 2001 . Transected neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions. Ann Neurol 50:389-400.

Petri S, Kiaei M, Kipiani K, Chen J, Calingasan NY, Crow JP, Beal MF. 2006. Additive neuroprotective effects of a h istone deacetylase inh ibitor and a catalytic antioxidant in a transgenic mouse model of a myotroph ic lateral sclerosis. Neurobiol Dis 22:40-49.

Piccio L, Buonsanti C, Mariani M, Cella M, Gilfillan S, Cross AH, Colonna M, Panina- Bordignon P. 2007. Blockade of TREM-2 exacerbates experimental autoimmune encephalomyelitis. Eur J l mmunol 37 : 1290-1301 .

Pierconti F, Martini M, Pinto F, Cenci T, Capodimonti S, Calarco A, Bassi PF, Larocca LM. 201 1 . Epigenetic silencing ofSOCS3 identifies a subset of prostate cancer with an aggressive behavior. Prostate 7 1 :318-325.

Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, Bi rdwell D, Alejos E, Silva M, Gala nos C, Freudenberg M, Ricciardi-Castagnoli P, Layton B, Beutler B. 1998. Defective LPS signaling in C3H/HeJ and C57 BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085-2088.

Ponomarev ED, Shriver LP, Maresz K, Dittel BN. 2005. Microglial cell activation and proliferation precedes the onset of CNS autoimmunity. J Neurosci Res 81:374-389.

Ponomarev E D, Veremeyko T, Barteneva N, Krichevsky AM, Weiner HL . 201 1 . MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.l pathway. Nat Med 1 7 :64-7 0.

Posse It G, Schwarz H, Dusch I A, Horejs-Hoeck J. 201 1 . Suppressor of cytokine signaling 2 is a feedback inhibitor of TLR-induced activation in human monocyte-derived dendritic cells. J lmmunol 1 87 :2875-2884.

Potucek YD, Crain JM, Watters JJ. 2006. Purinergic receptors modulate MAP kinases and transcription factors that control microglial inflammatory gene expression. Neurochem Int 49:204-214.

41

C HAPTER 1

Prinz M, Schmidt H, Mildner A, Knobeloch KP, Hanisch UK, Raasch J, Merkler D, Detje C, Gutcher I, Mages J, Lang R, Martin R, Gold R, Becher B, Bruck W, Kalinke U. 2008. Distinct and nonredundant in vivo functions of IFNAR on myeloid cells limit autoimmunity in the central nervous system. Immunity 28:675-686.

Pruenster M, Mudde L, Bombosi P, Dimitrova S, Zsak M, Middleton J, Richmond A, Graham GJ, Segerer S, Nibbs RJ, Rot A. 2009. The Duffy antigen receptor for chemokines transports chemokines and supports their promigratory activity. Nat lmmunol 10:101-108.

Raivich G, Jones LL, Kloss CU, Werner A, Neumann H, Kreutzberg GW. 1998. I mmune surveillance in the injured nervous system: T-lymphocytes invade the axotomized mouse facial motor nucleus and aggregate around sites of neuronal degeneration. J N eurosci 1 8:5804-581 6.

Rajendrasozhan S, Yao H, Rahman I . 2009. Current perspectives on role of chromatin modifications and deacetylases in lung inflammation in COPD. COPD 6:291-297.

Ra mag Ii a V, Hughes TR, Donev RM, Ruseva MM, Wu X, Huitinga I, Baas F, Neal JW, Morgan BP. 2012. C3-dependent mechanism of microglial priming relevant to multiple sclerosis. Proc Natl Acad Sci U S A 109:965-970.

Ransohoff RM. 1989. Multiple sclerosis: new concepts of pathogenesis, diagnosis, and treatment. Compr Ther 15:39-44.

Ransohoff RM , Brown MA. 2012. Innate immunity in the central nervous system. J Clin Invest 122: 1 164-1 1 71.

Ransohoff RM , Perry VH. 2009. Microglial physiology: unique stimuli, specialized responses. Annu Rev l mmunol 2 7 :119-145.

Rappert A, Bechmann I, Pivneva T, Mahlo J, Biber K, Nolte C, Kovac AD, Gerard C, Boddeke HW, Nitsch R, Kettenmann H. 2004. CXCR3-dependent microglial recruitment is essential for dendrite loss after brain lesion. J Neurosci 24:8500-8509.

Rasmussen S, Wang Y, Kivisakk P, Bronson RT, Meyer M, l mitola J, Khoury SJ. 2007. Persistent activation of microglia is associated with neuronal dysfunction of callosal projecting pathways and multiple sclerosis-like lesions in relapsing- -remitting experimental autoimmune encephalomyelitis. Brain 130:2816-2829.

Reddy P, Sun Y, Toubai T, Duran-Struuck R, Clouthier SG, Weisiger E, Maeda Y, Tawara I , Krijanovski 0, Gatza E, Liu C, Malter C, Mascagni P, Dinarello CA, Ferrara JL. 2008. Histone deacetylase inhibition modulates indoleamine 2,3-dioxygenase-dependent DC functions and regulates experimental graft-versus-host disease in mice. J Clin Invest 1 1 8 :2562-2573.

Rhee SH, Hwang D. 2000. Murine TOLL-like receptor 4 confers lipopolysaccharide responsiveness as determined by activation of NF kappa B and expression of the inducible cyclooxygenase. J Biol Chem 275:34035-34040.

Rostasy K, Egles C, Chauhan A, Kneissl M, Bahrani P, Yiannoutsos C, H unter DD, Nath A, Hedreen JC, Navia BA. 2003. SDF-lalpha is expressed in astrocytes and neurons in the A IDS dementia complex: an in vivo and in vitro study. J Neuropathol Exp Neurol 62:61 7-626.

Rostene W, Kitabgi P, Parsadaniantz SM. 2007. Chemokines: a new class of neuromodulator? Nat Rev Neurosci 8:895-903.

Saijo K, Glass CK. 2011. Microglial cel l origin and phenotypes in health and disease. Nat Rev lmmunol 11:7 75-787.

Saijo K, Winner B, Carson CT, Collier JG, Boyer L, Rosenfeld MG, Gage FH, Glass CK. 2009. A Nurrl/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell 137:47-59.

Saitoh T, Yamamoto M, Miyagishi M, Taira K, Na kanishi M, Fujita T, Akira S, Yamamoto N, Yamaoka S. 2005. A20 is a negative regulator of I F N regulatory factor 3 signaling. J lmmunol 1 74: 1507-1512.

Salem M, Many JT, Lobner M, Khorooshi R, Owens T. 2011. Interferon regulatory factor-7 modulates experimental autoimmune encephalomyelitis in mice. J Neuroinflammation 8: 181 -2094-8-181.

Sallusto F, Baggiolini M. 2008. Chemokines and leukocyte traffic. Nat lmmunol 9:949-952.

Sanchez-Madrid F, del Pozo MA. 1999. Leukocyte polarization in cell migration and immune interactions. EMBO J 18 :501 -511.

Sauvageot CM , Stiles CD. 2002. Molecular mechanisms controlling cortical gliogenesis. Curr Opin Neurobiol 12 :244-249.

Schlegel RA, Krahling S, Callahan M K, Williamson P. 1999. CD14 is a component of multiple recognition systems used by macrophages to phagocytose apoptotic lymphocytes. Cell Death Differ 6:583-592.

Schwartz M, Butovsky 0, Bruck W, Hanisch UK . 2006. Microglial phenotype: is the commitment reversible? Trends Neurosci 29:68-74.

42

General Introduction

Semple BD, Kossmann T, Morganti -Kossmann MC. 2010. Role of chemokines in CNS health and pathology: a focus on the CCL2/CCR2 and CXCL8/CXCR2 networks. J Cereb Blood Flow Metab 30:4S9-473.

SessaG, Podini P, MarianiM, MeroniA, Spreafico R, Sinigaglia F, Colonna M, Panina P, MeldolesiJ.2004. Distribution and signaling of TREM2/DAP12, the receptor system mutated in human polycystic lipomembraneous osteodysplasia with sci erasing leukoencephalopathy dementia. Eur J Neurosci 20:2617-2628.

Shahbazian MD, Grunstein M. 2007. Functions of site-specific histone acetylation and deacetylation . Annu Rev Biochem 76:75-100.

Sharma S, tenOever BR, Grandvaux N, Zhou GP, Lin R, Hiscott J . 2003. Triggering the interferon antiviral response through an I KK-related pathway. Science 300:1148-1151.

SharpAJ, Polak PE, SimoniniV, LinSX, Richardson JC, Bongarzone ER, Feinstein DL.2008. P2x7 deficiency suppresses development of experimental autoimmune encephalomyelitis. J Neuroinflammation 5:33-2094-5-33.

ShawPJ, Lukens JR, BurnsS, Chi H, McGarg i l l MA, KannegantiTD.2010. Cutting edge: critical rolefor PYCARD/ ASC in the development of experimental autoimmune encepha lomyelitis. J lmmunol 184:4610-4614.

Shiratori M, Tozaki -Sa itoh H, Yosh itake M, Tsuda M, Inoue K. 2010. P2X7 receptor activation induces CXCL2 production in microglia through NFAT and PKC/MAPK pathways. J Neurochem 114:810-819.

Shuto T, Furuta T, Oba M, Xu H, Li JD, Cheung J, Gruenert DC, Uehara A, Su ico MA, Okiyoneda T, Kai H. 2006. Promoter hypomethylation of Tol l - l ike receptor-2 gene is associated with increased proinflammatory response toward bacterial peptidoglycan in cystic fibrosis bronchial epithelial cells. FAS EB J 20:782-784.

Sierra A, Encinas JM, Deudero JJ, Chancey JH, Enikolopov G, Overstreet-Wadiche LS, Tsirka SE, Maletic­Savatic M. 2010. Microglia shape adu lt h ippocampa l neurogenesis through apoptosis-coupled phagocytosis. Cel l Stem Cel l 7:483-495.

Sim JA, Young MT, Sung HY, North RA, Surprenant A. 2004. Reanalysis of P2X7 receptor expression in rodent bra in . J Neurosci 24:6307-6314.

Skripu letz T, Hackstette D, Bauer K, Gudi V, Pul R, Voss E, Berger K, Kipp M, Baumgartner W, Stangel M. 2012. Astrocytes regu late myel in clearance through recru itment of microgl ia during cuprizone- induced demyel ination . Bra in .

Sofroniew MV , Vinters HV. 2010. Astrocytes: biology and pathology. Acta Neuropathol 119:7-35.

Sol le M, Labasi J, Perregaux DG, Stam E, Petrushova N, Kol ler BH, Griffiths RJ, Gabel CA. 2001 . Altered cytokine production in mice lacking P2X(7) receptors. J Biol Chem 276:125-132.

Sparacio SM, Zhang Y, Vilcek J, Benveniste EN. 1992. Cytokine regulation of interleukin-6 gene expression in astrocytes involves activation of an NF-kappa B-l ike nuclear protein. J Neuroimmunol 39:231-242.

Sperlagh B, Vizi ES, Wirkner K, I l les P. 2006. P2X7 receptors in the nervous system . Prag Neurobiol 78:327-346.

Stadelmann C, Wegner C, Bruck W. 2011 . I nflammation, demyel ination, and degeneration - recent i nsights from MS pathology. Biochim Biophys Acta 1812:275-282.

Streit WJ. 2002. Microglia as neuroprotective, immunocompetent cel l s of the CNS. G l ia 40:133-139.

Su RC, Becker AB, Kozyrskyj AL, Hayglass KT. 2009. Altered epigenetic regu lation and increasing severity of bronchial hyperresponsiveness in atopic asthmatic chi ldren. J Al lergy Cl in lmmunol 124:1116-1118.

Suh HS, Zhao ML, Choi N, Belbin TJ, Brosnan CF, Lee SC. 2009. TLR3 and TLR4 are innate antivi ra l i mmune receptors in human microgl ia : role of I RF3 in modulating antiviral and inflammatory response in the CNS. Virology 392:246-259.

Suh HS, Zhao ML, Rivieccio M, Choi S, Connolly E, Zhao Y, Takikawa 0, Brosnan CF, Lee SC. 2007. Astrocyte indoleamine 2,3-dioxygenase is induced by the TLR3 l igand poly(l:C): mechanism of induction a nd role in antivira l response. J Virol 81:9838-9850.

Sui Y, Potula R, Dhi l lon N, Pinson D, Li S, Nath A, Anderson C, Turchan J, Kelson D, Narayan 0, Buch S. 2004. Neuronal apoptosis is mediated by CXCLl0 overexpression in s imian human immunodeficiency virus encephal itis. Am J Pathol 164:1557-1566.

Su l l ivan KE, Reddy AB, Dietzmann K, Suriano AR, Kocieda VP, Stewart M, Bhatia M. 2007. Epigenetic regu lation of tumor necrosis factor a lpha. Mal Cell Biol 27:5147-5160.

Sun YE, Martinowich K, Ge W. 2003. Making and repa iring the mammal ian brain --s ignal ing toward neurogenesis a nd g l iogenesis. Semin Cel l Dev Biol 14:161-168.

Surh YJ, Chun KS, Cha HH, Han SS, Keum YS, Park KK, Lee SS. 2001 . Molecu lar mechanisms underlying chemopreventive activities of anti - inflammatory phytochemicals: down-regu lation of COX-2 and iNOS through suppression of NF- kappa B activation. Mutat Res 480-481:243-268.

43

I

CHAPTE R 1

Suzuki T, H ide I, ldo K, Kohsaka S, I noue K, Nakata Y. 2004. Production and release of neuroprotective tumor necrosis factor by P2X7 receptor-activated microg l ia . J Neurosci 24:1-7.

Taganov KD, Boldin MP, Chang KJ, Baltimore D. 2006. NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 103:12481-12486.

Takagi H, Sanada T, Minoda Y, Yoshimura A. 2004. Regu lation of cytokine and tol l - l i ke receptor s ignal ing by SOCS family genes. Ni hon Rinsho 62:2189-2196.

Takahashi K, Rochford CD, Neumann H. 2005. Clearance of apoptotic neurons without inflammation by microgl ia l triggering receptor expressed on myeloid cel ls-2 . J Exp Med 201 :647-657.

Takahashi K, Sugi Y, Hosono A, Kaminogawa S. 2009. Epigenetic regu lation of TLR4 gene expression in intestinal epithel ia l cel ls for the maintenance of intestina l homeostasis. J l mmunol 183:6522-6529.

Takatsuna H, Morita S, Nagatsu T, Sawada M, Umezawa K. 2005. Inh ibition of inflammatorycytokine secretion from mouse microg lia cel ls by DHMEQ, an NF- kappaB inh ibitor. Biomed Pharmacother 59:318-322.

Takeda K , Aki ra S. 2004. TLR signa l ing pathways. Semin lmmunol 16:3-9.

Takeish i Y , Kubota I. 2009. Role of Tol l - l ike receptor mediated signa l ing pathway in ischemic heart . Front Biosci 14:2553-2558.

Tamura T, Yanai H, Savitsky D, Taniguchi T. 2008. The IRF family transcription factors in immunity and oncogenesis. Annu Rev lmmunol 26:535-584.

Tang B, Xiao B, Liu Z, Li N, Zhu ED, Li BS, Xie QH, Zhuang Y, Zou QM, Mao XH. 2010. identification of MyD88 as a novel target of miR-155, involved in negative regu lation ofHel icobacter pylori - induced inflammation. FEBS Lett 584:1481-1486.

Tang X, Gao JS, Guan YJ, Mclane KE, Yuan ZL, Ramratnam B, Chin YE. 2007. Acetylation-dependent signal transduction for type I interferon receptor. Cel l 131 :93-105.

Taniguchi T, Ogasawara K, Takaoka A, Tanaka N. 2001 . I RF fami ly of transcription factors as regulators of host defense. Annu Rev lmmunol 19:623-655.

Tao S, Zhu L, Lee P, Lee WM, Knox K, Chen J, Di YP, Chen Y. 2012. Negative control ofTLR3 signal ing byTICAMl down-regu lation. Am J Respir Cel l Mol Biol 46:660-667.

Tarassishin L, Suh HS, Lee SC. 2011 . I nterferon regulatory factor3 plays an anti-inflammatory role in microg l ia by activating the Pl3K/Akt pathway. J Neuroinfl ammation 8:187-2094-8-187.

Teige I, Treschow A, Teige A, Mattsson R, Navikas V, Leanderson T, Holmdahl R, l ssazadeh-Navikas S. 2003. I FN-beta gene deletion leads to augmented and chronic demyel inating experimenta l autoimmune encepha lomyel itis. J lmmunol 170:4776-4784.

Thai TH, Ca lado DP, Casola S, Ansel KM, Xiao C, Xue Y, Murphy A, Frendewey D, Va lenzuela D, Kutok JL, Schmidt-Supprian M, Rajewsky N, Yancopoulos G, Rao A, Rajewsky K. 2007. Regu lation of the germinal center response by microRNA-155. Science 316:604-608.

Thiaga l ingam S, Cheng KH, Lee HJ, Mineva N, Thiaga l ingam A, Ponte JF. 2003. H istone deacetylases: unique p layers in shaping the epigenetic h istone code. Ann N Y Acad Sci 983:84-100.

Ting JP, Lovering RC, Alnemri ES, Bertin J, Boss JM, Davis BK, Flavel l RA, G i rard in SE, Godzik A, Harton JA, Hoffman HM, Hugot JP, l nohara N, Mackenzie A, Ma ltais LJ, Nunez G, Ogura Y, Otten LA, Phi lpott D, Reed JC, Reith W, SchreiberS, Steimle V, Ward PA. 2008. The N LR gene fami ly: a standard nomenclature. Immunity 28:285-287.

Town T, N ikolic V, Tan J. 2005. The m icrogl ia l "activation" continuum: from innate to adaptive responses. J Neuroinflammation 2:24.

Townson J R, N ibbs RJ. 2002. Characterization of mouse CCX-CKR, a receptor for the lymphocyte-attracting chemokines TECK/mCCL25, SLC/mCCL21 and Ml P-3beta/mCCL19: com parison to human CCX-CKR. Eur J l m munol 32:1230-1241.

Tran PB , Mi l ler RJ. 2003. Chemokine receptors: s ignposts to brain development and d isease. Nat Rev Neurosci 4:444-455.

Tsuda M, Shigemoto-Mogami Y, Koizumi S, Mizokosh i A, Kohsaka S, Sa lter MW, Inoue K. 2003a. P2X4 receptors induced in spinal microglia gate tacti le a l lodynia after nerve injury. Nature 424:778-783.

Tsuda M, Sh igemoto-Mogami Y, Koizumi S, Mizokosh i A, Kohsaka S, Sa lter MW, Inoue K. 2003b. P2X4 receptors induced in spinal microglia gate tacti le a l lodynia after nerve injury. Nature 424:778-783.

Tsuda M, Tozaki-Saitoh H, Masuda T, Toyomitsu E, Tezuka T, Yamamoto T, Inoue K. 2008. Lyn tyrosine kinase is required for P2X(4) receptor upregulation and neuropathic pain after peripheral nerve injury. Gl ia 56:50-58.

44

Genera l Introduction

Turrin NP, Rivest S. 2006. Molecular and cel lular immune mediators of neuroprotection. Mol Neurobiol 34:221-242.

Ubogu EE, Cossoy MB, Ransohoff RM. 2006. The expression and function of chemokines involved in CNS inflammation. Trends Pharmacol Sc i 27:48-55.

U lvmar MH, Hub E, Rot A. 2011 . Atypical chemokine receptors. Exp Cel l Res 317:556-568.

Vaquero A, Sternglanz R, Reinberg D. 2007. NAD+-dependent deacetylation of H4 lysine 16 by c lass I l l HDACs. Oncogene 26:5505-5520.

Vi l lagra A, Cheng F, Wang HW, Suarez I , Glozak M, Maurin M, Nguyen D, Wright KL, Atadja PW, Bha l la K, Pin i l l a- lbarz J, Seto E, Sotomayor EM. 2009. The h istone deacetylase H DACll regulates the expression of interleukin 10 and immune tolerance. Nat lmmunol 10:92-100.

Vi l lagra A, Sotomayor EM, Seto E. 2010. Histone deacetylases and the immunological network: impl ications in cancer and infl ammation. Oncogene 29:157-173.

Vinet J, van Zwam M, Dijkstra IM, Brouwer N, van Weering HR, Watts A, Meijer M, Fokkens MR, Kannan V, Verzijl D, Vischer H F, Smit MJ, Leu rs R, Biber K, Boddeke HW. 2012. I nh ibition of CXCR3-Mediated Chemotaxis by the Human Chemokine Receptor- l ike Protein CCX-CKR. Br J Pharmacol .

Vischer HF, Watts AO, N ijmeijerS, Leu rs R. 2011 . G protein-coupled receptors: wa lking hand-in-hand, ta lking hand- in-hand? Br J Pharmacol 163:246-260.

Vojinovic J , Damjanov N. 2011 . HDAC inhibition in rheumatoid arthritis and juveni le idiopathic arthritis. Mol Med 17:397-403.

Wang L, de Zoeten EF, Greene Ml, Hancock WW. 2009. lmmunomodulatory effects of deacetylase inh ib itors: therapeutic targeting of FOXOP3+ regu latory T cel ls . Nat Rev Drug Discov 8:969-981.

Wang X, Arcuino G, Takano T, Lin J, Peng WG, Wan P, Li P, Xu Q, Liu QS, Goldman SA, Nedergaard M. 2004. P2X7 receptor inh ibition improves recovery after spina l cord injury. Nat Med 10:821-827.

Weber M, Blair E, S impson CV, O'Hara M, Blackburn PE, Rot A, Graham GJ, N ibbs RJ. 2004. The chemokine receptor D6 constitutively traffics to and from the cel l su rface to internal ize and degrade chemokines. Mol Biol Cel l 15:2492-2508.

Weih F, Carrasco D, Durham SK, Barton DS, Rizzo CA, Ryseck RP, Lira SA, Bravo R. 1995. Multiorgan inflammation and hematopoietic abnormal ities in m ice with a targeted disruption of RelB, a m ember of the NF-kappa B/Rel family. Cel l 80:331-340.

Weissmann C , Weber H. 1986. The interferon genes. Prog Nucleic Acid Res Mol Biol 33:251-300.

Wessels I, Fleischer D, Rink L, Uciechowski P. 2010. Changes in chromatin structure and methylation of the human interleukin-l beta gene during monopoiesis. lmmunology 130:410-417.

Wil l iams A, Piaton G, Lubetzki C. 2007. Astrocytes- -friends or foes in mu lt iple sclerosis? Gl ia 55:1300-1312.

Wilson AG. 2008. Epigenetic regu lation of gene expression in the inflammatory response and relevance to common diseases. J Periodontol 79:1514-1519.

Wu C, Morris JR . 2001 . Genes, genetics, and epigenetics: a correspondence. Science 293:1103-1105.

Yamamoto M, Akira S. 2004. Tl R domain--contain ing adaptors regu late TLR-mediated signal ing pathways. Ni hon Rinsho 62:2197-2203.

Yamamoto Y, Verma U N, Prajapati S, Kwak YT, Gaynor RB. 2003. Histone H3 phosphorylation by I KK-a l pha is critical for cytokine-induced gene expression . Nature 423:655-659.

Yan J , Greer JM. 2008. NF-kappa B, a potential therapeutic target for the treatment of multiple sclerosis. CNS Neural Disord Drug Targets 7:536-557.

Yeung F, Hoberg JE, Ramsey CS, Kel ler MD, Jones DR, Frye RA, Mayo MW. 2004. Modulation of NF-kappaB­dependent transcription and cel l survival by the S IRTI deacetylase. EMBO J 23:2369-2380.

Yu Y, Ugawa S, Ueda T, Ishida Y, I noue K, Kyaw Nyunt A, U memura A, Mase M, Yamada K, Shimada S. 2008. Cel lu lar loca l ization of P2X7 receptor mRNA in the rat bra in . Bra in Res 1194:45-55.

Zhang Z, Wang z, Ren H, Yue M, Huang K, Gu H, Liu M, Du B, Qian M. 2011 . P2Y(6) agonist u ridine 5' -di phosphate promotes host defense aga inst bacterial infection via monocyte chemoattractant protein-1 -mediated monocytes/macrophages recruitment. J lmmunol 186:5376-5387.

Zhao M, Liang GP, Tang MN, Luo SY, Zhang J, Cheng WJ, Chan TM, Lu QJ. 2012. Total g lucosides of paeony induces regulatory CD4(+)CD25(+) T cel l s by increasing Foxp3 demethylation in lupus CD4(+) T cel l s . Cl in lmmunol 143:180-187.

Zhu B, Luo L, Moore GR, Paty DW, Cynader MS. 2003. Dendritic and synaptic pathology in experimental autoimmune encephalomyel itis. Am J Pathol 162 :1639-1650.

45

• C L I­C <

J l

.

C HAPTE R 2

H iston e deacety la se i n h i b itors

su ppress i m m u n e act ivation

i n p ri m a ry mou se m icrog l ia

Vishnu Kannan1, N ieske Brouwer1,

Uwe-Karsten Hanisch2, Tommy Regen2,

Bart J .L . Eggen1.*,#, Hendrikus W.G.M. Boddeke1-*·#

1Department of Neuroscience, section Medical Physiology, Un iversity of Groningen, University Medica l Center Groningen,

Groningen, The Netherlands 2l nstitute of Neuropathology, University of Gottingen, Gottingen, Germany

·Equal contributors

#Corresponding authors: Anton ius Deusinglaan 1 9713 AV Groni ngen, The Netherlands

Avai lable as Epub ahead of pri nt

J .Neurosci.Res.2013. docl0.1002/jnr.23221

CHAPTER 2

1. A BSTRACT

2. INT RODUCT ION

3. MAT ERIALS AND MET HODS 3.1. Animals 3.2. Chemicals 3. 3. Primary microglial cultures 3.4. Primary Astrocyte cultures 3. 5. Acute microglia isolation 3.6. Quantitative RT-PCR 3.7. lmmunoblotting 3.8. Microglial Viability: MTT assay 3.9. Flow cytometry 3.10. Enzyme linked immunosorbent assay (ELISA) 3.11. Chemotaxis 3.12. Statistical Analysis

4. RESULTS 4.1. Endogenous and LPS/IFNy- induced HDAC and cytokine expression

in microglia and astrocytes 4.2. HDACi suppressed LPS-induced cytokine expression in microglia. 4. 3. HDACi inhibited LPS-induced cytokine secretion, cell surface marker

expression and induction of an M2 phenotype.

5. DISCUSSION

6. REFERENCES

48

HDACi inhibit microglia immune activation

1 . ABSTRACT

Neuroinflammation is required for tissue clearance and repair after infections or insults. To prevent excessive damage, it is crucial to limit the extent of neuroinflammation and thereby the activation of its principal effector cell, microglia. The two main major innate immune cell types in the CNS are astrocytes and microglia. Histone deacetylases (HDACs) have been implicated in regulating the innate inflammatory response, and here we addressed their role in pure astrocyte and microglia cultures. Endogenous HDAC expression levels were determined in microglia and astrocytes, and after treatment with lipopolysaccharide (LPS) or LPS and interferon y (IFNy). Since the relative expression level of HDACs was reduced in LPS or LPS/IFNy (with the exception of HDACl and 7) stimulated astrocytes and increased in microglia after LPS treatment both in primary cultures and in microglia acutely isolated from LPS-treated mice, we focused on the inflammatory response in microglia. Primary microglia cultures were treated with LPS in the presence or absence of HDAC inhibitors (HDACi). Expression and release of inflammatory cytokines was determined by quantitative RT-PCR, flow cytometry and EL ISA. HDACi strongly suppressed LPS-induced cytokine expression and release by microglia. Furthermore, expression of Ml- and M2-associated activation markers was suppressed and also the migratory behavior of microglia was attenuated. Our findings strongly suggest that HDACi suppresses innate immune activation in microglia.

49

I

CHAPTER 2

2. INTRODUCTION

Microglia and astrocytes are the innate immune cells of the central nervous system and are responsible for maintenance of the homeostasis and immune surveillance (Aloisi, 2001;

Colton, 2009; Kim and de Vellis, 2005; Nimmerjahn et al., 2005). In response to very early stages of brain injury or diseases, microglia transform from a ramified to an amoeboid shape and can evoke an inflammatory response (Gonzalez-Scarano and Baltuch, 1999; Hanisch and Kettenmann, 2007). Since neuroinflammation causes considerable bystander damage (Kraft and Harry, 2011) it is considered beneficial to limit microglial activation and thus to regulate the inflammatory response. Besides microglia, astrocytes also contribute to neuroinflammation (Dong and Benveniste, 2001). Previous studies reported that microglia are initial sensors to LPS mediated inflammatory response and astrocytes enhance the inflammatory response via production of neurotoxic factors (Saijo et al., 2009; Saijo and Glass, 2011). HDACs and HDACi have been reported to modulate innate immune activity (Shuttleworth et al., 2010). HDACs deacetylate lysine residues on target proteins which include, but are not limited to, histones and histone deacetylation is generally associated reduced gene expression (Shahbazian and Grunstein, 2007).

Mammalian HDACs are classified into four classes: class I (HDAC 1, 2, 3 and 8), class II (HDAC 4, 5, 6, 9 and 10), class I ll includes the sirtuins (Sirt 1-7) (Liu and Casaccia, 2010; Thiagalingam et al., 2003) and class IV only contains HDAC 11, a negative regulator of interleukin 10 (IL-10) in antigen­presenting cells (Villagra et al., 2009). Well characterized broad spectrum HDACi trichostatin A (TSA) and suberoylanilide hydroxamic acid (SAHA) target class I and II HDACs and are reported to result in global hyperacetylation of histones (Thurn et al., 2011). Several studies have implicated HDACs and broad spectrum HDACi in the inflammatory responses of various cell types including macrophages, glial cells and dendritic cells with different results. In some cell types, HDACs act as negative regulators of inflammatory responses where in other cell types pro-inflammatory effects have been reported (Aung et al., 2006; Bode et al., 2007; Choo et al., 2010; Faraco et al., 2009; Han and Lee, 2009; Huuskonen et al., 2004; Suuronen et al., 2003; Suuronen et al., 2006). Here we focused on the effect of LPS on HDAC expression in microglia and astrocytes and HDACi on the inflammatory response of primary mouse microglia in response to LPS and LPS/IFNy-induced activation.

3. MATERIALS AND METHODS

3.1 . Animals

All animal experiments were carried out in accordance with the regulations of the Animal Welfare Committee (DEC) of the University of Groningen, The Netherlands (License number 5913C and 5785C).

3.2. Chemicals

LPS (Cat # L4391), TSA (Cat # T l 952) and Licodaine hydrochloride (Cat # L5647) were purchased from Sigma-Aldrich (Zwijndrecht, The Netherlands). SAHA (Cat # 10009929) was purchased from Cayman Chemical (USA) Anti-acetyl histone H3 (Cat # 06-599) and anti-histone H3 (Cat # 07-690) were purchased from Millipore (Amsterdam, The Netherlands) and a fluorescent labeled secondary antibody, donkey anti-rabbit ( IR Dye 800) was purchased from (LI-COR Biosciences, Cambridge, United Kingdom), Percoll (Cat # 17-0891-0) was purchased from GE Healthcare.

so

HDACi inhibit microglia immune activation

3.3. Primary microglial cultures

Primary microglia cultures were prepared from brains of wild type C57BL/6 mice at postnatal day 1 as described previously (Biber et al., 2001; de Jong et al., 2005) with the fol lowing modifications. Briefly, after removal of the meninges and brainstem, brains were triturated with medium A (HBSS with 0.6% glucose, 15 mM HEPES buffer and 1% penicillin/streptomycin). To the minced brains, 2.5 % trypsin (Gibco) was added followed by incubation at 37°C for 20 min. The enzymatic reaction was stopped after 20 min by adding trypsin inhibitor medium, followed by a gentle dissociation to obtain a single cell suspension . DMEM supplemented with 10% FCS was added and the cell suspension was centrifuged at 960 rpm at 12°C for 12 min . The supernatant was removed and cells were seeded in 75 cm2 flasks in DMEM supplemented with 10% FCS. Cultures were maintained for 3 weeks with 0.01% primocin in 5% CO

2 at 37°C. After 3

weeks, microglial cells were harvested from the astrocytic layer by orbital shaking and seeded in new cell culture plates. The purity of microglia was routinely tested by staining for cell­specific markers (CDl lb, F 4/80), revealing that cultures consisted >95% of microglia.

3.4. Primary Astrocyte cu ltures

Primary astrocyte cultures were obtained from mixed glial cultures of C57BL/6 post natal brain as described previously (Sher et al., 2011) with following modifications. After 2 weeks, cultures were placed overnight in an orbital shaker (150 rpm, 37°C). The next day non-adherent glial cells were removed and the astrocyte layer removed by mild trypsinization and reseeded in DMEM supplemented with 10% FCS to obtain 98% pure astrocyte cultures.

3.5. Acute microglia isolation

Mice received an intraperitonial injection with saline or LPS (lmg/kg) and after 4 hr or 6 hr, mice were anesthetized, transcardially perfused with saline and sacrificed. Brains were prepared and kept in ice-cold medium A (HBSS with 0.6% glucose, 15 mM HEPES) and cut into small pieces using a surgical blade followed by mechanical dissociation using a tissue homogenizer to obtain a single cell suspension. Microglia were isolated as described previously in (de Haas et a l ., 2008) with the following modifications. The cell suspension was filtered through 70 µm cell strainer (Cat # 352350, BD Falcon™) followed by cell pelleting at 220 ref (10 min, 4°C). The cell pellet was resuspended in 25 ml 25% Percoll solution, overlayed with 8 ml PBS and centrifuged at 950 g for 20 min. The pellet was resuspended in medium A (without Phenol Red) and blocked with 1% CD16/32 (Cat # 14-0161, eBiosciences) for 10 min on ice. For cell sorting, CNS mononuclear cells were stained with CDl lb-PE (Cat # 12-0112-82, eBioscience) and CD45-FITC (Cat #11-0451-82, eBioscience) and isolated using a MoFlo™ XDP Beckman Coulter sorter and lysed in RNA lysis buffer (Qiagen RNeasy Micro Kit).

3.6. Quantitative RT-PCR

Microglia were stimulated with LPS (100 ng/ml) for 4 hr, either in the presence or absence of TSA or SAHA, with a 2 hr preincubation of the respective HDACi. Total RNA was isolated using Qiagen RNeasy Micro Kit according to the manufacturer 's instructions. RNA was transcribed to cDNA using Random Hexamers (Fermentas) in a thermal cycler (BIORAD), using M-MuLV Reverse Transcriptase and Ribolock RNAse inhibitor (Fermentas). Quantitative PCR

51

I

CHAPTER 2

reactions were carried out using a SYBR supermix (BIORAD) on an ABl7900HT device (Applied

Biosystems) with different sets of Q-PCR primers (see Table 1). For each gene, measurements

were performed in triplicates in three independent experiments. Q-PCR primers were designed

in PRIMER EXPRESS 2.0 and all generated PCR fragments were cloned and sequenced ensuring

specific gene amplification. HMBS was used as an internal standard to calculate relative gene

expression levels with the 2 McT method (Livak and Schmittgen, 2001) .

Table 1 : List o f qPCR primers

Gene Accession number Forward primer (5'-3') Reverse primer (5'-3')

HDACl NM_008228.2 GGACACGCCAAGTGTGTGG GAGCAACATTCCGGATGGTG

HDAC2 NM_008229.2 CAACAGATCGCGTGATGACC CCCTTTCCAGCACCAATATCC

HDAC3 NM_Ol0411 .2 GACGTGCATCGTGCTCCAGT ACATTCCCCATGTCCTCGAAT

HDAC4 NM_207225.l TTACAGACTCCGCATGCAGC GCGATGCCATTCTCAGTGCT

HDACS NM_ 001077696.l ACGCCTCCCTCCTACAAATTG TTAAGTTGGGTTCCGAGGCC

HDAC6 NM_001130416.l AGCTTACTTTGCTGCGACCG CGCAAACTGCGCCAGTATTT

HDAC7 NM_Ol9572.2 TGCCGAGACCCTTGGAGATT GTTAGGGCCATGCTCGCTG

HDAC8 NM_027382.3 GGGTGGCATCATGCAAAGAA CAAATTTCCGTCGCAATCGT

HDAC9 NM_024124.3 AGGTGGCAGAATCCTCGGTC TCATTTTCGGTCACATTCCCA

HDACl0 NM_l99198.2 TGGAAGAGGAATCCATACGC GCCTTCGAGAAAGGACCCAG

HDACll NM_l44919.2 CCGGTCATCTTTCTTCCCAA GCTTCCCTGCCATGATGGT

Sirtl NM_019812.2 TTTGCAACAGCATCTTGCCT GGCACCGAGGAACTACCTGAT

Sirt2 NM_022432.4 CCTCATCAGCAAGGCACCAC CATCATCATGCCCAGGAAGG

I L-lf3 NM-008361 ATCTTTGAAGAAGAGCCCATCC TGTAGTGCAGTTGTCTAATGGG

I L-6 NM-031168 CCTCTCTGCAAGAGACTTCCATCCA GGCCGTGGTTGTCACCAGCA

TNF-a NM-013693 TCTTCTGTCTACTGAACTTCGG AAGATGATCTGAGTGTGAGGG

iNOS NM-010927 AAGGCCACATCGGATTTCAC GATGGACCCCAAGCAATACTT

I L-10 NM_010548 AAGGGTTACTTGGGTTGCCA TTTCTGGGCCATGCTTCTCT

TGF-f3 NM-011577 GAACCAAGGAGACGGAATACAG GGAGTTTGTTATCTTTGCTGTCAC

HMBS NM_001110251.l CCGAGCCAAGGACCAGGATA CTCCTTCCAGGTGCCTCAGA

3.7. lmmunoblotting Nuclear proteins were isolated from both control and TSA-treated cells as described (Holling

et al., 2007). After treatment with TSA, cells were washed twice with PBS and lysed (10 min on

ice) in cold cell lysis buffer (5 mM PIPES, 85 mM KCI, 0.5% Nonidet P40, pH 8.0) supplemented

with protease inhibitors (Cat # 11836153001, Roche Applied Science, Germany). Cell lysates were

centrifuged at 5000 rpm for 5 min at 4°C and the pellet was resuspended in nuclear lysis buffer

(50 mM Tris- HCI, 10 mM EDTA, pH 8.1) supplemented with protease inhibitors, followed by

centrifugation at 15, 700 ref for 5 min at 4°C. After sonication (3 x 15 sec), protein content as

determined using a Bradford assay. A sample aliquot was mixed with Laemmli buffer and boiled

for 5 min at 95°C and proteins were resolved on 15% SDS-PAGE gels. Subsequently, proteins

were transferred onto nitrocellulose membranes equilibrated with transfer buffer (25 mM Tris,

150 mM glycine, 10% v/v methanol) in a semi-dry blotter (BIORAD) at 3 mA/cm2 for 1 hr. After

52

HDACi inhibit microglia immune activation

transfer, the membrane was blocked in Odyssey blocking buffer (OBB; diluted 1:2 in PBS) for 1 hr at room temperature (rt), followed by overnight incubation at 4°C with rabbit anti -acetyl H3 antibody (1:1000 in blocking buffer). After primary antibody incubation, membranes were washed in PBS, 0.2% Tween-20, incubated with a secondary fluorescence-conjugated ( IR Dye 680 LI-COR) donkey anti-rabbit antibody (1:8000 in PBS, 1 hr at rt). After washing (PBS, 0.2% Tween-20) the blots were scanned in a LI -COR Odyssey infrared imaging system.

3.8. Microglia viabil ity: MTT assay

Microglia viability was determined using an MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide) assay as described in (Wang et al., 2010) . Microglia were seeded (1. 5 x 104 cells/9.5 cm2) and treated with TSA (30 nM) for 6 hr and 12 hr, SAHA (0.1 and 1 µM) or DMSO for 12 hr. Subsequently, MTT (0. 5 mg/ml) was added and after 2 hr, cells were lysed in DMSO and the reaction product was measured at 570 nm (with a background correction at 630 nm) in a microplate reader (Biotech instruments, µ quant).

3.9. Flow cytometry

Microglial cells were seeded at a density of 2 x 104 cells/25 cm2• After 24 hr, cells were treated

with LPS (100 ng/ml) and IFNy (50 ng/ml) for 12 hr. If present, TSA was added 2 hr prior to LPS and INFy. For flow cytometric analysis, cells were harvested using 4 mg/ml lidocaine (van der Putten et al., 2009), and resuspended in ice-cold PBS containing 1% of anti-mouse CD16/32 (eBiosciences) to block Fe receptors. After 20 min, cel ls were stained with surface markers: FITC­hamster anti-mouse CD40 (Cat # 1-0402-81, eBioscience), F ITC-rat anti-mouse CD86 (Cat # 11-0862-81, eBioscience), 20 min on ice. After staining, cells were collected, resuspended in PBS and analyzed in a BO™ LSR II multi-laser flow cytometer. FlowJo software was used for data analysis.

3.10. Enzyme l inked immunosorbent assay (ELISA)

Microglia were seeded at a density of 3 x 104 in 24-well plates. After 24 hr, cells were stimulated with LPS (100 ng/ml, 10 hr), TSA (30 nM, 11 hr) or both. Supernatants were col lected and analyzed by ELISA according to the manufacturer 's instruction (TN Fa: Biolegend, IL-12p40: eBiosciences and IL-6 and Rantes: R&D Systems).

3.1 1 . Chemotaxis

Cell migration of microglia was monitored in a 48-well chemotaxis microchamber (NeuroProbe) as described (Dijkstra et al., 2004). Microglia were stimulated with LPS (100 ng/ml, 6hr), TSA (30 nM, 8 hr) or both. Adenosine 5-triphosphate (ATP, 50 µM in DMEM) or plain DMEM were added to the lower well of the chamber. The upper and lower chambers were separated by a polyvinylpyrrolidone-free polycarbonate filter (8 µm pore size). The bottom side of the filter was coated with poly-L-lysine. 1. 5 x 104 cells microglial cells were added to the upper chamber and incubated at 37°C for 2 hr. After incubation, the filter was fixed with Fast Green in 100% methanol (2 mg/I, Diff-Quick Fix, Dade Behring, Dudingen, Fribourg, Switzerland) and stained twice, first with stain solution 1 (1.22 g/1 eosin G in phosphatase buffer pH 6.6 (Diff-Quick 1) followed by stain solution 2 (1.1 g/1 thiazine dye in phosphate buffer pH 6.6) . Migrated, adherent cells on the filter were counted with a scored eyepiece (3 fields, 1 mm2 per well).

53

I

CHAPTER 2

3.12. Statistical Analysis

Statistical analyses were carried out using Graph Pad Prism 5.00 software (Graph Pad Software). p -values < 0.05 were considered as statistically significant.

4. RESULTS

4.1 . Endogenous and LPS/IFNy-induced HDAC and cytokine expression in microg lia and astrocytes.

HDACs have been reported to regulate the inflammatory response of mixed glial cultures (Faraco et al., 2009), bone marrow-derived macrophages (Aung et al., 2006; Bode et al. , 2007) and primary astrocytes (Beurel, 2011) . To investigate the role of HDACs in modulating inflammatory responses in primary mouse microglia and astrocytes, the endogenous expression levels of HDACs in these glial cells was determined by quantitative RT- PCR. Most HDACs were endogenously expressed by astrocytes and microglia with the exception of HDAC6, 7 and 1 1 which were only detected i n astrocytes, HDAC3 and 8 which were more abundant i n astrocytes and Sirtl which was more abundantly expressed by microglia (Fig. 1). The effect of LPS as an inflammatory stimulus on HDAC mRNA expression in microglia and astrocytes was determined. In primary microglia cultures, LPS stimulation led to a transient induction of most HDACs and generally H DAC expression peaked 4 hr after LPS stimulation followed by a decrease in expression

C 0

30 ns

-� 20 � C. X (I)

(I) C (I)

O') 1 0 (I) -�

0

■ microglia * ■ astrocytes

2 3 4 5 6 7 8 9 1 0 1 1 2

HDAC subtypes -r

sirtu in subtypes

Figure 1: Endogenous expression of HDAC 1-11, sirtuin 1 and 2 in primary mouse microglia and astrocytes. Quantitative RT-PCR ana lysis of HDAC 1 -11 , sirtuin 1 and 2. Endogenous histone deacetylase (HDAC) and s irtu in mRNA expression levels, normalized to hydroxymethylbila ne synthase (HMBS), were determined using quantitative real time PCR. Relative expression levels a re depicted with the standard error of mean (SEM). A representative expression profile obtained in one of th ree independent experiments is shown. *: p < 0.01, **: p < 0.05, ns: not significant.

54

HDACi inh ibit m icrog l ia i mm u ne activation

generally below expression levels in unstimulated cells. (Fig. 2A) . To determine if this increase

in HDAC expression also occurred in vivo, mice were challenged with LPS (i.p. injection) a nd

4 a nd 6 hr later, microglia were acutely isolated. Expression levels of inflammatory cytokines

IL-6 a nd TNFa. were significantly induced indicating microglia activation by i.p. LPS injection.

The expression of HDACs, representative for different subclasses, was determined. H DACl a nd

6 were induced 4 hr after LPS injection and HDAC2 was induced 6 hr after LPS injection . Like

in primary microglia, a reduction in HDACll expression was observed. Sirtl expression was not

affected by i.p. LPS injection (Fig. 28).

A) microglia (in vitro) 3 ..

2 3 4

□ 0 □ 4 8 ■ 12 ■ 24

hr LPS

B) microglia (in vivo) 300

IL-6 TNFa □ o 1;1 4 ■ 6

hr LPS

5

4

3

2

0

5 6 7 8

HDAC subtypes

2 6

HDAC subtypes

9

1 1

1 0 1 1

sirt1

2 �

sirtuin subtypes

Figure 2: HDAC expression is transiently induced in primary microglia and acutely isolated m icroglia after LPS stimulation. HDAC mRNA levels were determined using quantitative real time PCR in A) p rimary microglia stimulated with LPS (100 ng/ml) and B) acutely isolated microgl ia from i .p. LPS (1 mg/kg) injected mice at the indicated time points after LPS treatment using quantitative RT-PCR. Mean expression levels are depicted with the SEM and gene expression levels were normal ized to hydroxymethylbi lane synthase (HMBS). *: p < 0.01, **: p < 0.05, ns: not significant. A representative expression profi le obta ined in one of three independent experiments/mice is shown.

55

I

CHAPTER 2

In astrocytes, LPS treatment resulted in a significant reduction in HDAC gene expression levels, with the exception of HDAC9 (Fig. 3A). As IFNy has been reported to facilitate the LPS responsiveness of astrocytes, the effect of a combined LPS/IFNy stimulus on HDAC expression in astrocytes was determined. Again, the expression of most HDACs was reduced after LPS/IFNy stimulation, with the exception of HDACl and 7, which were transiently induced 12 hr after stimulation (Fig. 3B).

A) astrocytes (LPS)

§-1 !;l g C Ql Ol C

"C O 0 LL 2 3 4 5 6

HDAC subtypes B) astrocytes (LPS+ IFNy)

1/) 2

C. 5 (/) C

g .!: 1 Ql

"Cl 0 LL

0 2 3 4 5 6 7

HDAC subtypes □ o □ 4 m a 12 ■ 24

hr

8

8

9 1 0 1 1 1 2 �

sirtuin subtypes

9 10 1 1 1 2 -r-

sirtuin subtypes

Figure 3: HDAC expression in primary astrocytes after LPS and LPS/IFNy stimulation. H DAC mRNA levels were determined in primary astrocytes stimulated with A) LPS (100 ng/ml) or B) LPS/I FNy (SO ng/ml) for the indicated time points using quantitative RT- PCR. Mean gene expression levels were normalized to hydroxymethylbilane synthase (HMBS) and are depicted as mean with the SEM. *: p < 0.01, **: p < 0.05. A representative expression profile obtained in one of three independent experiments is shown.

To determine the inflammatory response of microglia and astrocytes, transcripts levels of several cytokines after LPS stimulation were determined in both cell types using quantitative PCR. In microglia, 4 hr LPS stimulation resulted in a significant increase in IL-6, tumor necrosis factor (TNF-a), IL-1�, nitric oxide synthase (iNOS), IL-10 and TGF-� expression. IL-1�, IL-10 and TGF-� expression levels peaked around 8 hr of LPS treatment (Fig. 4A). In astrocytes, also a significant increase in TNFa, IL-1� and iNOS gene expression was observed in response to LPS (Fig. 4B). However, the

56

HDACi i nh ibit m icroglia immune act ivation

overa l l level of induction was much lower and genera l ly later than in microglia (compare TNF-a, I L-1� and iNOS expression levels in astrocytes and microgl ia, Fig. 4, panels A and B) . Col lectively these data indicate that the inflammatory response in microgl ia is much more pronounced than in astrocytes after LPS stimulation, an observation in l ine with previous observations (Saijo et a l ., 2009). Since LPS had a much more prominent effect on HDAC expression and inflammatory gene expression in microg lia than in astrocytes, subsequent experiments concerning the regulatory role of H DACs and HDACi in the innate inflammatory response were focused on microg l ia.

A) 20000 IL-6 100 TNF-a 250 IL-113 ••

B)

.§l 16000

-� 12000 g ; 8000 g> � 4000

80

60

40

:e 0 ...._ ___________ __

o 4 8 12 24 hr O 4 8 12 24 hr 3000 iNOS 50 IL-10

ji 2500 f bl 2000

.§ 1500 C:

� 1000 <1l

.c

:e 500

20

: 15 ·c:

g 10 C:

0 4 8 12 24 hr

TNF-a

40

30

20

0 4 8 12 24 hr

1 00 IL-113

80

60

40

20

200

1 50

1 00

50

o ..___. ___ ___,Iii __ 0 4 8 12 24 hr

3 TGF-13

2

0 4 8 12 24 hr

iNOS 20

1 5

1 0

5

o o �-----0 4 8 1 2 24 hr o 4 8 1 2 24 hr 0 4 8 1 2 24 hr

Figure 4: LPS stimulation resulted in increased cytokine gene expression in microglia and astrocytes. A) Cytokine mRNA levels of interleukin ( IL)-6, Tumor necrosis factor alpha (TNF-a.), I L-lf3, inducible nitric oxide synthase (iNOS), I L-10 and Transforming growth factor (TGF)f3 were determined i n primary microglia stimulated with LPS for the ind icated time points using quantitative RT-PCR. Expression levels were normal ized to HMBS, mean expression levels are depicted with the SEM. * : p < 0.01, **: p <0.001 . A representative expression profi le obtained in one of three independent experiments is shown. B) Cytokine mRNA levels were determined in primary astrocytes stimulated with LPS for the indicated time points using quantitative RT-PCR. Expression levels were normal ized to HMBS, mean expression levels a re depicted with the SEM. *: p < 0.01, **: p <0.05. A representative expression profile obta ined in one of three independent experiments is shown.

57

I

CHAPTER 2

4.2. HDACi suppressed LPS-induced cytokine expression in microgl ia.

The role of HDACs and H DACi in microglia, the i n nate immune cells of the central nervous system, is largely unknown. Here, we determined whether broad spectrum H DACi affected the LPS-induced i nflammatory response in primary mouse microglia. First, we determined the effect ofTSA and SAHA on histone H3 acetylation as a measure for HDAC inhibition. Microglia were treated with 30 nM TSA, a dose previously used in bone-marrow derived macrophages (Hal i l i et a l ., 2010) and 1 µM SAHA as was used in mixed g l ial cultures (Faraco et a l ., 2009) for 6 hr and H3 acetylation was determined using western blotting (Fig. SA and 6A). A clear increase i n H3 acetylation was observed with either inhibitor.

A)

• + 30 nM TSA

- acetyl H3

1---1 total H3

C) 1 6000 IL-6

5000 i5.

4000 � C 3000 .,

2000 .c 1 000 u

LJ.. 4 4

� 50000 iNOS 1 l 40000

� 30000

i 20000

-5 10000

� 4 4

6

2500 TNF-u

2000

1500

1000

500

0

6

80 IL-10

60

40

20

6

B) 120

� 1 00

8 80 0

� 60

40 ·;; � 20

0 6 12 hr TSA (30 nM)

800 IL-1/l

600

400

200

4 4 4 4 8 8 LPS {hr)

6 1 0 1 0 TSA(hr)

4 TGF-ll

4 4 4 4 LPS (hr) 6 - 6 - 6 TSA (hr)

Figure 5: TSA inhibited LPS-induced inflammatory gene expression in microglia. A) Trichostatin A (TSA) induced hyperacetylation of h istone H3. Nuclear extracts were prepared from primary microglia treated with TSA (30 nM, 6 hr) and western analyzed with the antibodies indicated. Acetyl histone (H3) levels after TSA treatment were quantified in three independent experiments (*, p < 0.001) and depicted as relative acetylation levels with the SEM. a representative western blot is shown. B) The effect of TSA (30 nM, 6 and 12 hr) on microglia viabi l ity was determined using an (3-(4,S-dimethylthiazol-2-yl)-2,5-d iphenyltetrazoliumbromide) MTT assay. The percentage of surviving cel ls in three independent experiments with the SEM is depicted. C) Effect ofTSA on LPS-induced gene expression. Primary mouse microglia were stimu lated with LPS (100 ng/ml, 4 hr) and/or TSA (30 nM, 6 hr) as indicated. When present, TSA was added 2 hr prior to LPS. Transcript levels of the indicated genes were determined using quantitative RT-PCR and normal ized to HMBS as an interna l standard. Data represent relative mean expression levels with the SEM (* p < 0.001) . A representative expression profile obtained in one of three independent experiments is shown.

58

HDACi inhibit microg l ia immune activation

To determine possible toxic effects of these HDACi, microglia were treated with TSA (30 nM, 6 and 12 hr) or SAHA (0.1 µM and 1 µM, 12 hr) and tested for cell viability. Six hr after TSA treatment, 80% of the cells were viable and 65% were still viable after 12 hr (Fig. SB). When microglia were treated with SAHA for 12 hr, 90% and 86% of the cells were viable when exposed to 0.1 µM or 1 µM SAHA, respectively (Fig. 6B). In subsequent experiments, 30 nM TSA and 1 µM TSA were used.

To address whether TSA and SAHA altered the inflammatory response triggered by LPS in microglia, cells were treated with HDACi, which were added2 hr prior to LPS (4 hrof LPS stimulation). The expression levels of inflammatory genes were determined using real time RT-PCR (Figs. 5 and 6,

A)

+ 1 11M SAHA

acetyl H3 total H3

C) 111 6000 IL-6

1 5000

-� 4000

� 3000 C

t 2000

£ 1000 :!2

4 4 6

80 iNOS

1

C

t

60

40

20

- 4 4

- 6 6

800

600

400

200

1 0

B)

0

�

·;; fi

TNF-u

4 4 6

IL-10

4 4

- 6 • 6

120

100

80

60

40

20

0 0 1 1 1•M SAHA (12 hr)

1200 IL-1f3

1000

800

600

400

200

4 4 8 8 LPS (hr) - 6 10 - 6 - 10 SAHA(hr)

3 TGF-P

- 4 4 LPS (hr) 6 SAHA(hrl

Figure 6: SAHA inhibited LPS-induced inflammatory gene expression in microglia. A) Suberoylanilide hydroxamic acid (SAHA) induced hyperacetylation of h istone H3. Nuclear extracts were prepared from primary microglia treated with SAHA (1 µM, 6 hr) and western analyzed with the antibodies indicated . Acetyl H3 levels after SAHA treatment were qua ntified in three independent experiments (*, p < 0.001) and depicted as relative acetylation levels with the SEM; a representative western blot is shown. B) The effect of SAHA (0.1 µM and 1 µM, 12 hr) on microglia viability was determined using an MTT assay. The mean percentage of surviving cells in a representative (1 of 3) experiment with the SEM is depicted. C) Effect of SAHA on LPS- induced gene expression. Primary mouse microglia were stimulated with LPS (100 ng/ml, 4 hr) and/or SAHA (1 µM, 6 hr) as indicated . When present, SAHA was added 2 hr prior to LPS. Transcript levels of the indicated genes were determined using quantitative RT- PCR and normalized to HMBS as an i nternal standard . Data represent relative mean expression levels with the SEM (* p< 0.001) and a representative expression profile obtained in one of three independent experiments is shown.

59

• C u I­C < J l

CHAPTER 2

panel C). LPS treatment resulted in significant induction of IL-6, TNF-a, IL-113 and iNOS. Pretreatment with either TSA or SAHA resulted in a significant attenuation of LPS-induced expression of TNF-a, IL-6 and iNOS, whereas TSA and SAHA alone did not affect transcript levels. IL-113 transcript levels after 4 hr of LPS were not affected by HDACi, an observation which is in agreement with previous results obtained in bone marrow macrophages (Han and Lee, 2009; Leoni et al., 2002). However, we observed that when a longer LPS stimulus (8 hr) was used, TSA and SAHA treatment resulted in an attenuated IL-113 response (Fig. SC and 6C). HDACi also suppressed LPS-induced anti-inflammatory cytokine TGFl3 and IL-10 expression (Fig. SC and 6C). Together, our results show that pre-treatment of microglia with H DACi TSA or SAHA resulted in reduced transcriptional activation of both pro- and anti-inflammatory cytokines in response to LPS. Since the effect of TSA and SAHA on microglia was very similar and as these HDACi are both structurally and functionally very similar (Dokmanovic et al., 2007), in subsequent functional experiments only TSA was used.

4.3. HDACi inh ibited LPS-induced cytokine secretion, cel l surface marker expression and induction of an M2 phenotype.

To determine whether the effects of HDACi on cytokine mRNA expression levels also resulted in reduced cytokine secretion, the release of cytokines and chemokines IL-6, TNF-a, IL-12 p40 and RANT ES was investigated. Microglia were stimulated with LPS in the presence or absence of TSA. Microglia supernatants were collected after stimulation and cytokine levels were determined using ELISA. LPS stimulation resulted in a significant release of all cytokines tested and TSA significantly suppressed the release of these cytokines in response to LPS (Fig. 7) . TSA alone had no effect on cytokine secretion.

1 600 IL-6 8000 TNF-a

1 200 6000

� 800 4000

400 2000

0 0 1 0 1 0 1 0 1 0 LPS (hr)

1 1 - 1 1 1 1 1 1 TSA (hr)

300 IL-12p40 1 0000 RANTES (CCL5)

8000

200

� 6000

4000 1 00

2000

0 0 - 1 0 1 0 1 0 1 0 LPS (hr)

1 1 1 1 1 1 - 1 1 TSA(hr)

Figure 7: TSA inhibited LPS-induced cytokine secretion by microglia. Primary mouse microglia were stimulated with LPS (100 ng/ml, 10 hr) and/or TSA (30 nM, 11 hr) as indicated. When present, TSA was added 1 hr prior to LPS. Supernatants were collected and cytokine levels were determined using ELISA. Mean cytokine levels of three independent experiments with the SEM are depicted (* p <0.05, ** p <0.005).

60

HOACi i nhibit microglia immune activation

To determine if HOACi also affected other parameters important for microglial function, cell surface marker expression and chemotaxis were determined. In order to fully activate microglia, a combined stimulation with LPS and IFNy was used (Mander and Brown, 2005). First, it was determined whether TSA inhibited LPS/IFNy-induced expression of inflammatory cytokines TNFa and IL-6. A combined stimulation with LPS and IFNy resulted in an increased induction of TNFa and IL-6 compared to LPS alone, and was significantly reduced by TSA (suppl. Fig. 1 at the end of this chapter). Next, we determined whether TSA also reduced the expression of cell surface markers induced by a combined treatment with LPS and I FNy (12 hr). The expression of activation markers C086 and C040 was determined using flow cytometric analysis. LPS/IFNy stimulation resulted in increased cell surface expression of CD86 and CD40 and TSA treatment suppressed the LPS/IFNy-induced expression of these markers. TSA alone had no effect on CD86 and CD40 cell surface levels (Fig. 8A). These data

A)

B)

CD86

100 - control 100 - TSA

!!l 80 - LPS/IFNy 80 C: - TSA+LPS/IFNy

60 60 .!:::!

40 40

20 20

0 H f 101 Hr 1 cr 10"

fluorescence intensity

250 Arginase-1 2500 Fizz1

1 200 2000

-� 150 1 500

.s 100 1000

ti 50 500 :S! J2

CD40

Hf

fluorescence intensity

4 1 0 - - - - 4 10 LPS (hr) 4 4 10 10 - - 4 4 10 10 - - IL--4 (hr)

- 5 11 - 5 - 11 - - - 5 11 - 5 - 11 - - TSA (hr)

Figure 8: TSA suppressed LPS/IFNy-induced expression of cel l surface activation markers and the induction of an M2 activation state by IL-4 in microglia. A) Primary microgl ia were stimulated with LPS (100 ng/ml) in combination with I FNy (50 ng/ml) for 12 hr. When present, TSA (30 nM) was added 2 hr prior to LPS/I FNy. Mean fluorescence intensity of cel l surface markers CD86 and CD40, relative to the normal ized events, is depicted with the treatments indicated. B) Primary microglia were stimulated with interleukin ( I L)-4 (40 ng/ml), LPS (100 ng/ml) and/or TSA (30 nM) as indicated. When present, TSA was added 1 hr prior to I L-4 or LPS). Transcript levels of the indicated genes were determined using quantitative RT-PCR and normal ized to HMBS as an interna l standard. Data represent relative mean expression levels with the SEM (* p <0.001) A representative expression profi le obta ined in one of three i ndependent experiments is shown. Fizzl expression was only detected after I L-4 stimu lation.

61

• ex UJ l­a. <( I u

CHAPTER 2

strongly suggest that TSA attenuated the activation of microglia in response to LPS/IFNy. It has been reported that macrophages, when treated with anti-inflammatory cytokines, differentiate towards an M2. phenotype, which is correlated with tissue support functions (Mullican et al., 2011). We treated microglial cultures with IL-4 (4 and 10 hr) in the presence and absence of TSA and determined the expression levels of M2. markers. IL-4stimulation resulted in significant induction of the Arginase-1 and Fizzl transcripts. TSA treatment only resulted in a slight induction of the Arginase-1 gene. Surprisingly, we observed that TSA treatment completely abolished the induction of these markers in response to IL-4 which implied that HDACi suppressed the induction of an M2. phenotype by IL-4 (Fig. 8B).

In response to inflammatory stimuli, microglia undergo rapid changes in their migratory properties (Nimmerjahn et al., 2005). We investigated the effect of TSA on LPS-induced migration of microglial cells towards ATP, a chemoattractant for microglia. Compared to unstimulated cells, LPS-treated cells showed enhanced migration towards ATP. This enhanced migration was significantly reduced by TSA (Fig. 9). Summarizing, these data indicate that HDACi TSA suppressed LPS-induced microglia chemotaxis and LPS/IFNy-induced cell surface expression of activation markers CD86 and CD40.

75 .

-c 50

.E

Q) 25

0

D DMEM ■ ATP

.I .1

8

l

6

- • I

.I

6 LPS (hr) 8 TSA (hr)

Figure 9: TSA inhibited LPS-induced microglia chemotaxis. Microglia chemotaxis was determined in a Boyden chamber with ATP (SO µM) as a chemoattractant . Microglia were stimulated with LPS (100 ng/ml, 6 hr) and TSA (30 nM, added 2 hr prior to LPS) and placed in a Boyden chamber. The number of migrated cells towards DMEM or ATP are depicted, a representative experiment (one out of three is depicted), * p <0.05.

5. DISCUSSION

Neuroinflammation is an innate mechanism to eliminate pathogens and debris as well as to promote tissue repair (Block and Hong, 2005; Gonzalez-Scarano and Baltuch, 1999). However, excessive inflammation is detrimental to the surrounding tissue, and appropriate suppression of neuroinflammation may have therapeutic relevance for neurodegenerative diseases. It has been reported recently that pharmacological inhibition of HDAC activity modulates inflammation and immune cell activation (Shuttleworth et al., 2010). Several in vitro studies have suggested a stimulating effect of HDACi in response to inflammatory stimuli in macrophages (Aung et al., 2006),

62

HDACi inh ib it microglia immune activation

mouse microglia cell lines (Huuskonen et al., 2004) and primary rat microglia (Suuronen et al., 2003, Suuronen et al., 2006). On the other hand, suppressive effects of HDACi on inflammatory responses have been reported in primary mouse dendritic cells (Bode et al., 2007), macrophages (Han and Lee, 2009), human rheumatoid arthritis synovial fibroblasts (Choo et al., 2010), in a mouse endotoxemia model (Li et al., 2009) and in mixed CNS glia (Faraco et al., 2009). Studies in primary astrocytes showed that HDACs promote inflammatory tolerance in response to repeated exposure to LPS (Beu rel, 2011).

Our data provide evidence that most HDACs are endogenously expressed in astrocytes and microglia (Fig 1). However, in response to LPS, microglia and astrocytes displayed a very different response, where expression of HDACs transiently increased in microglia after LPS stimulation, a reduction in HDAC levels was observed in astrocytes (Fig 2 and 3). This transient increase in HDAC expression might be required to limit the microglia inflammatory response, as HDACs have been reported to modulate TLR mediated signaling (Shakespear et al., 2011) and to inhibit NF-KB signaling (Ash burner et al., 2001). Remarkably, after 12-24 hr of LPS stimulation, expression levels of most HDACs decreased below expression levels observed in untreated microglia. This might be caused by negative regulation by HDACs of their own expression, as has been observed in macrophages (Aung et al., 2006). Our data suggest that HDACs are required for the activation of microglia by LPS, as HDACi inhibit LPS-mediated activation. In activated microglia, HDACs might to have an anti-inflammatory function; their expression is increased by LPS and HDACs are reported to be important to limit the inflammatory response (Aung et al. , 2006; Shakespear et al., 2011) possibly leading to microglia deactivation (Fig. 10).When astrocytes were stimulated with a combination of LPS and IFNy, leading to more pronounced activation (Chung and Benveniste, 1990), HDAC expression levels generally decreased, with the exception of HDACl and HDAC7 which were transiently induced 12 hr after LPS stimulation.

ramified microglia

HDACi . (TSA/SAHA)

1

activation (LPS)

inflammatory cytokines

A T2

�HDA0

s I 2

activated , microglia ,

Figure 10: Proposed model for regulation of microglia activation by HDACs and HDACi. When exposed to LPS, microglia become activated, leading to increased expression of inflammatory cytokines and H DACs (1). This response is HDAC-dependent as HDACi inhibit LPS-mediated microglia activation. In activated microglia, HDACs suppress cytokine and HDAC gene expression (2) possibly leading to microglia deactivation (3).

63

• C lJ I­C

J l

CHAPT ER 2

In mice that received an i.p. LPS injection, an increased expression of HDACs 1, 2 and 6, reduced HDACll levels and no effect on Sirtl expression was observed. Largely, these in vivo data mimic the in vitro observations, but it is possible that the differences observed are caused by differences in microglia maturation, microglia cultures are prepared from PO-P3 mice, where 8 week old mice were used. Additionally, the means of microglial activation is very different; in culture, microglia are directly exposed to LPS where an i.p. injection results in an peripheral inflammatory response that indirectly leads to microglia activation in the CNS (Chen et al., 2012). Summarizing, these data suggest that modulatory effects of HDACi on the innate immune response might be more prominent in microglia than in astrocytes. However, in view of the low basal expression levels of HDAC 6, 7, 8, 9 10 and l l in microglia and 6, 9 and 10 in astrocytes (Fig.1), the physiological importance of changes in gene expression levels of these HDACs is not yet clear. As HDACs are enzymes and microglia clearly contain HDAC activity (as is exemplified by the increase in H3 acetylation levels by TSA and SAHA), relatively small changes in mRNA levels still can have significant effects (Aung et al., 2006). The level of cytokine induction in astrocytes in response to LPS was much lower than in microglia and occurred later, supporting the notion that the initial innate immune response is primarily mediated by microglia (Ransohoff and Brown, 2012; Saijo et al., 2009).

HDACi attenuate the LPS-induced inflammatory response in microglia with respect to functional responses, including chemotaxis and cytokine secretion. We observed that HDACi suppressed LPS-induced proinflammatory cytokines (Fig. SC and 6C). Interestingly, HDACi also suppressed the expression of anti-inflammatory cytokines, such as IL-10 and TGFf3 (Fig. SC and 6C). A similar effect was observed in mouse macrophages where treatment with HDAC inhibitor LAQ824 resulted in reduced IL-10 expression (Wang et al., 2011). Subsequently, we carried out ELISA measurements to determine the effect of HDACi on the LPS-induced secretion of cytokines from microglia. TSA significantly inhibited the secretion of pro-inflammatory cytokines (Fig. 7). However, at the same time-point, we did not observe secretion of anti­inflammatory cytokines, which might be caused by the fact that anti-inflammatory cytokine gene expression lags behind with respect to pro-inflammatory cytokine expression in microglia (Fig. 4A). To further explore the role of HDACi on microglia activation, we investigated the effect of HDACi on LPS/IFNy-induced microglial activation markers. We observed that TSA suppressed the LPS/IFNy-mediated induction of the microglial activation markers CD86 and CD40 (Fig. 8B). We also investigated whether the expression of Ml and M2 activation markers in microglia was affected by HDACi. LPS-induced expression of Ml markers, including IL-1 f3, IL-6 and TNF-a, was clearly suppressed in microglia. Also the expression of the M2 markers A rg 1 and Fizzl , induced in IL-4-treated microglia, was significantly suppressed after pretreatment with TSA (Fig. 8). This shows that small molecule HDAC inhibitors suppress the expression of both pro- and anti-inflammatory activation markers in microglia.

Basal motility of microglia is important for immune surveillance and microglia actively migrate to sites of injury and inflammation Kim and de Vellis, 2005; Colton, 2009; Davalos et al., 2005; Miller and Stella, 2009; Nimmerjahn et al., 2005). As expected, treatment with LPS increased microglial migration towards AT P in a chemotaxis assay. TSA clearly inhibited this chemotactic activity in microglia (Fig. 9), which implies that TSA reduced microglial cell migration in response to an LPS challenge, suggesting that besides histones, TSA also acts on

64

HDACi inhibit microglia immune activation

non-histone proteins, such as tubulin, which in turn may affect the migration of microglia (Yao

and Yang, 2011). The data presented here show that HDACi suppressed microglial activation

with regard to cytokine transcript levels and cytokine secretion, the expression of Ml and M2 activation markers as well as cellular migration.

65

I

CHAPTER 2

6. REFERENCES

Aloisi F. 2001 . Immune function of microglia . Glia 36: 165-179.

Aung HT, Schroder K, Himes SR, Brion K, van Zuylen W, Trieu A, Suzuki H, Hayashizaki Y, Hume DA, Sweet MJ, Ravasi T. 2006. LPS regulates proinflammatory gene expression in macrophages by altering histone deacetylase expression. FAS EB J 20: 1315-1327.

Ashburner BP, Westerheide SD, Baldwin AS Jr. 2001 . The p65 (RelA) subunit of N F-kappa B interacts with the histone deacetylase (H DAC) corepressors HDACl and HDAC2 to negatively regulate gene expression. Mal Cell Biol. 21 :7065-7077.

Beu rel E. 201 1 . HDAC6 regulates LPS-tolerance in astrocytes. PLoS One 6:e25804.

Biber K, Sauter A, Brouwer N, Copray SC, Boddeke HW. 2001 . lschemia -induced neuronal expression of the microglia attracting chemokine Secondary Lymphoid-tissue Chemokine (SLC). Glia 34:121-133.

Block ML, Hong JS. 2005. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prag Neurobiol 76:77-98.

Bode KA, Schroder K, Hume DA, Ravasi T, Heeg K, Sweet MJ, Dalpke AH . 2007. Hi stone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflam matory gene expression by impairing transcription factor recruitment. Immunology 122:596-606.

Chen Z, Jalabi W, Shpargel KB, Farabaugh KT, Dutta R, Yin X, Kidd GJ, Bergmann CC, Stohl man SA, Trapp BD. 2012. Lipopolysaccharide-induced microglial activation and neuroprotection against experimental brain injury is independent of hematogenous TLR4. 32: 1 1706-1 17 15

Choo QY, Ho PC, Tanaka Y, Lin HS. 2010. Histone deacetylase inhibitors MS-275 and SAHA induced growth arrest and suppressed lipopolysaccharide-stimulated NF-kappa B p65 nuclear accumulation in human rheumatoid arthritis synovial fibroblastic Ell cells. Rheumatology (Oxford) 49:1447-1460.

Chung IY, Benveniste EN. 7990. Tumor necrosis factor-alpha production by astrocytes. Induction by lipopolysaccharide, 1990 I FN -gamma, and I L-1 beta. J lmmunol 1 5:2999-3007.

Colton CA . 2009. Heterogeneity of microglial activation in the innate immune response in the brain. J Neuroimmune Pharmacol 4:399-418.

Davalos D, Grutzendler J, Yang G, Kim JV, Zuo Y, Jung S, Littman DR, Dustin ML, Gan WB. 2005. ATP mediates rapid microglial response to local brain injury in vivo. Nat Neurosci 8:752-758.

de Haas AH, Boddeke HW, Biber K. 2008. Region-specific expression of immunoregulatory proteins on microglia in the healthy CNS. Glia 56:888-894.

de Jong EK, Dijkstra IM, Hensens M, Brouwer N, van Amerongen M, Liem RS, Boddeke HW, Biber K. 2005. Vesicle-mediated transport and release of CCL21 in endangered neurons: a possible explanation for microglia activation remote from a primary lesion. J Neurosci 25:7548-7557.

Dijkstra IM, Hulshof S, van der Valk P, Boddeke HW, Biber K. 2004. Cutting edge: activity of human adult microglia in response to CC chemokine ligand 21 . J lmmunol 172:2744-2747.

Dokmanovic M, Clarke C, Marks PA. 2007. Histone deacetylase inhibitors: overview and perspectives. Mal Cancer Res 5:981 -989.

Dong Y, Benveniste EN. 2001 . Immune function of astrocytes. Glia 36:1 80-190.

Faraco G, Pittelli M, Cavone L, Fossati S, Porcu M, Mascagni P, Fossati G, Moroni F, Chiarugi A . 2009. Histone deacetylase (H DAC) inhibitors reduce the glial inflammatory response in vitro and in vivo. Neurobiol Dis 36:269-279.

Gonzalez-Scarano F, Baltuch G. 7999. Microglia as mediators of inflammatory and degenerative diseases. Annu Rev Neurosci 22:219-240.

Halili MA, Andrews MR, Labzin LI, Schroder K, Matthias G, Cao C, Lovelace E, Reid RC, Le GT, Hume DA, Irvine KM, Matthias P, Fairlie DP, Sweet MJ. 2010. Differential effects of selective H DAC inhibitors on macrophage inflammatory responses to the Toll-like receptor 4 agonist LPS. J Leukoc Biol 87: 1 103-1 1 14.

Han SB, Lee JK. 2009. Anti-inflammatory effect of Trichostatin-A on murine bone marrow-derived macrophages. Arch Pharm Res 32:613-624.

Hanisch U K, Kettenmann H . 2007. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat Neurosci 10:1387-1394.

Holling TM, Bergevoet MW, Wilson L, Van Eggermond MC, Schooten E, Steenbergen RD, Snijders PJ, Jager MJ, Van den Elsen PJ. 2007. A role for EZH2 in silencing of I FN -gamma inducible MHC2TA transcription in uveal melanoma. J lmmunol 179:5317-5325.

66

H DACi i n h i bit m icrogl ia i m mune a ctivation

Huuskonen J, Suuronen T, Nuutinen T, Kyrylenko S, Salminen A . 2004. Regulation of microglial i nfla mmatory response by sodium butyrate and short-chain fatty acids. Br J Pharmacol 141:874-880.

Kim SU, de Vellis J. 2005. Microglia in health and disease. J Neurosci Res 81 :302-313.

Kraft AD, Harry GJ. 201 1 . Features of microglia and neuroinflammation relevant to environmental exposure and neurotoxicity. lnt J Environ Res Public Health 8:2980-3018.

Leoni F, Zal iani A, Bertolin i G, Porro G, Pagani P, Pozzi P, Dona G, Fossati G, Sozzani S, Azam T, Butler P, Fantuzzi G, Goncharov I , Kim SH, Pomerantz BJ, Reznikov LL, Siegmund B, Dina rel lo CA, Mascagni P. 2002. The antitumor histone deacetylase inhibitor suberoylani l ide hydroxamic acid exhibits a ntiinflam matory properties via suppression of cytokines. Proc Natl Acad Sci U S A 99:2995-3000.

Li Y, Liu B, Zhao H, Sail ha mer EA, Fukudome EY, Zhang X, Kheirbek T, F inkelstein RA, Velma hos GC, deMoya M, Hales CA, Alam H B. 2009. Protective effect of suberoylan i l ide hydroxamic acid against LPS-induced septic shock in rodents. Shock 32:51 7-523.

Liu J, Casaccia P. 2010. Epigenetic regulation of oligodendrocyte identity. Trends Neurosci 33:193-201 .

Livak KJ, Schmittgen TD. 2001 . Analysis of relative gene expression data using real-time quantitative PCR a nd the 2(-Delta Delta C(T)) Method. Methods 25:402-408.

Mander P, Brown GC. 2005. Activation of microglial NADPH oxidase is synergistic with glial iNOS expression in inducing neuronal death: a dual-key mechanism of inflammatory neurodeg eneration. J Neuroinflammation 2:20.

Mi l ler AM , Stel la N. 2009. Microglial cel l migration stimulated by ATP and C5a i nvolve distinct molecular mechan isms: quantification of migration by a novel near-infrared method. Glia 57 :875-883.

Mullican SE, Gaddis CA, Alenghat T, Na ir MG, Giacomin PR, Everett LJ, Feng D, Steger DJ, Schug J, Artis D, Lazar MA. 2011 . H istone deacetylase 3 is an epigenomic brake in macrophage alternative activation. Genes Dev 25:2480-2488.

N immerjahn A, Kirchhoff F, Helmchen F. 2005. Resting microglial cells are highly dynamic surveillants of bra in parenchyma in vivo. Science 308:1314-1318.

Ransohoff RM , Brown MA. 2012. I nnate immunity in the central nervous system. J Clin I nvest 122 : 1 1 64-117 1 .

Saijo K , Glass CK. 2011. Microgl ial cell origin a n d phenotypes in health a n d disease. N a t Rev lmmu nol 1 1 : 7 75-7 87.

Saijo K, Winner B, Carson CT, Collier JG, Boyer L, Rosenfeld MG, Gage FH, Glass CK. 2009. A Nurrl/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation- induced death . Cell 137 :47-59.

Shahbazian MD, Grunstein M. 2007. Functions of site-specific histone acetylation and deacetylation . Annu Rev Biochem 7 6:75-100.

Shakespear MR, Halili MA, Irvine KM, Fairlie DP, Sweet MJ. 201 1 . Histone deacetylases as regulators of inflammation and immunity. Trends lmmunol. 32:335-343

Sher F, Boddeke E, Copray S. 201 1 . Ezh2 expression in astrocytes induces their dedifferentiation toward neural stem cells. Cell Reprogram 13: 1 -6.

Shuttleworth SJ, Ba iley SG, Townsend PA. 2010. H istone Deacetylase inhibitors: new promise in the treatment of immune and inflammatory diseases. Curr Drug Targets 1 1 :1430-1438.

Suuronen T, Huuskonen J, Pihlaja R, Kyrylenko S, Salminen A. 2003. Regulation of microglial inflammatory response by histone deacetylase inhibitors. J Neurochem 87 :407-416.

Suuronen T, Huuskonen J, Nuutinen T, Salminen A. 2006. Characterization of the pro-infla mmatory signaling induced by protein acetylation in m icroglia. Neurochem Int 49:610-618.

Thiagal ingam S, Cheng KH, Lee HJ, Mineva N, Thiagalingam A, Ponte J F. 2003. H i stone deacetylases: unique players in shaping the epigenetic histone code. Ann N Y Acad Sci 983:84-100.

Thurn KT, Thomas S, Moore A, Munster PN. 2011 . Rational therapeutic combinations with hi stone deacetylase inh ibitors for the treatment of cancer. Future Oncol 7 :263-283.

van der Putten C, Zuiderwijk-Sick EA, van Straalen L, de Geus ED, Boven LA, Kondova I , IJzerman AP, Bajra movic JJ. 2009. Differential expression of adenosine A3 receptors controls adenosine A2A receptor-mediated inh ibition of TLR responses in microglia. J lmmunol 1 82:7603-7 612.

Villagra A, Cheng F, Wang HW, Suarez I , Glozak M, Maurin M, Nguyen D, Wright KL, Atadja PW, Bhalla K, Pin illa - lbarz J, Seto E, Sotomayor EM. 2009. The histone deacetylase HDACll regulates the expression of interleukin 1 0 and immune tolerance. Nat lmmunol 1 0:92-100.

67

I

C HAPTER 2

Wang H, Cheng F, Woan K, Sahakian E, Meri no 0, Rock-Klotz J, Vicente-Suarez I, P in i l la - lbarz J, Wright KL, Seto E, Bhal la K, Vi l lagra A, Sotomayor EM. 201 1 . H istone deacetylase i nhibitor LAQ824 augments i nflammatory responses in macrophages through transcriptional regu lation of I L-10. J lmmunol 186:3986-3996.

Wang J, Du JR, Wang Y, Kuang X, Wang CY. 2010. z-l igusti l ide attenuates l i popolysaccharide- induced proinflammatory response via i nh ib it ing NF-kappaB pathway i n primary rat microgl ia . Acta Pharmacol S in 31:791-797.

Yao YL, Yang WM. 201 1 . Beyond h i stone and deacetylase: an overview of cytoplasmic h istone deacetylases and their nonhistone substrates. J Biomed Biotechnol :146493.

68

H DACi inh ibit m icrog l ia immune activation

SUPPLEMENTARY FIGURE

2000 I L-6 1 000 TNF-a en

1 600 800 �

1 200 600 en

.E 800 400 *

400 200 (.)

"C **

0 0 - 4 4 4 4 - 4 4 4 4 LPS (hr)

4 4 4 4 IFNy (hr)

6 - 6 - 6 6 - 6 - 6 TSA (hr)

Suppl Figure 1: TSA suppressed LPS/IFNy induced pro-inflammatory cytokine. Primary mouse m icrogl ia were treated with LPS (100 ng/ml) or LPS in combination with interferon y ( I FN)y (SO ng/ml) for 4 hrs. When present, TSA (30 nM) was added 2 h r prior to LPS and I F Ny. Transcript l evels of the indicated genes were determined using quantitative RT-PCR and normal ized to HMBS as an internal standard . Data represent relative mean expression levels with the SEM (* p <0.005, ** p <0.001). A representative expression profi le obtained in one of three independent experiments is shown.

69

I

CHAPTER 3

The effect of histone deacetylase

inhibitor trichostatin A

on experimental autoimmune

encephalomyelitis

Vishnu Kanna n, I l ia Vainchtein, Bart J .L . Eggen,

Hendrikus W.G .M. Boddeke

Department of Neuroscience, Section Medical Physiology,

University of Groningen, University Medical Center Groningen,

G roningen, The Netherlands

Manuscript in preparation

CHAPTER 3

1. ABSTRACT

2. INTRODUCTION

3. MATERIALS AND METHODS

3.1. Experimental animals

3.2. Chemicals and Reagents

3.3. EAE induction

3.4. HDAC inhibitor

3.5. Acute isolation of microglia/macrophage and cell sorting

3.6. Quantitative RT-PCR

3.7. Isolation of peripheral monocytes from mouse blood

3.8. Boyden chamber assay

3.9. Primary mouse astrocyte cultures

3.10. Statistical analysis

4. RESU LTS

4.1. Effect of TSA on mouse macrophage migration 4.2. Effect of Trichostatin A on EAE onset and progression

4.3. Mononuclear cell populations in the central nervous system

of control, EAE and EAE/TSA mice

4.4. Effect of TSA on the inflammatory cytokine gene expression in

brain microglia and peripheral macrophages in the brain of EAE mice

4.5. HDACi potentiated LPS/IFNy-induced cytokine gene expression

in primary astrocytes.

5. DISCUSSION

6. REFERENCES

72

HDACi in MS (EAE) model

1 . ABSTRACT

Multiple sclerosis is a chronic autoimmune disorder accompanied by local inflammation and

demyelination of the central nervous system. One of the common animal models of multiple

sclerosis is experimental autoimmune encephalomyelitis (EAE) which is characterized by T cell

infiltration and pronounced inflammation. One primary cause of inflammation in EAE is the

extensive infiltration of macrophages in the CNS. Acetylation is an important post translational

modification regulating chromatin structure and transcriptional activity. Histone deacetylases

(HDAC) catalyze the removal of acetyl groups from their substrates where histone acetylases

catalyze the opposite reaction. Generally, HDACs have been implicated in the modulation

of inflammatory responses in immune cells. In recent years, HDAC inhibitors have emerged

as potent anti-inflammatory and immunomodulatory experimental compounds that have

beneficial effects in autoimmune as well as in inflammatory diseases.

Since neuroinflammation is a major determinant of MS pathology, it is necessary to reduce the

inflammatory response. In this project, we intended to investigate the effect of a broad spectrum

HDACi, Trichostatin A (TSA) as a therapeutic agent in the attenuation of EAE progression.

73

• 0 u l­o <

]

CHAPTER 3

2. INTRODUCTION

Multiple sclerosis is a chronic autoimmune disorder accompanied by local inflammation and demyelination of the central nervous system (Bruck, 2005; Hemmer et al., 2002; Hemmer

et al., 2006; Lassmann, 1998; Ransohoff, 1989; Watzlawik et al., 2010). One of the common animal models of multiple sclerosis is experimental autoimmune encephalomyelitis (EAE) which is characterized by T cell infiltration and pronounced inflammation. One primary cause of inflammation in EAE is the extensive infiltration of macrophages in the CNS (Bruck, 2005). EAE can be elicited in animals by immunization with myelin antigens such as myelin-oligodendrocyte glycoprotein (MOG) (Fritz et al., 1990; Whitham et al., 1991) which triggers activation of CD4 + T helper (Th-1 or Th-17 cells) that subsequently results in the recruitment of peripheral monocytes and proliferation of resident brain macrophages (microglia) (Hickey 1991). Accumulation of activated microglia/macrophages is a pathological hallmark of active MS lesions (Minagar et al., 2002; Raivich and Banati, 2004). Previous studies show that macrophage depletion either using silica dust (Brosnan et al., 1981) or liposomes containing dichloromethylene diphosphonate (Huitinga et al., 1990) attenuated the clinical symptoms of EAE.

The current therapy, particularly for the relapsing remitting form of MS has strongly improved as novel drugs are introduced. Clearly MS is associated with extensive inflammation featuring proinflammatory cytokines and chemokines, including IL-1� (Shaftel et al., 2007), TNFa. (Haji et al., 2012), CXCLl0 (Fife et al. 2001), CCL2 (Semple et al., 2010) and many others. Indeed anti-inflammatory agents including interferon- � and corticosteroids are applied in MS therapy. Also Glatiramer acetate (Copaxone), a neuroprotective and anti-inflammatory drug suppresses MS-related inflammation (Scorisa et al., 2011). Monoclonal antibodies like Natalizumab (Tysabri), targeted against alpha- 4 integrin, (Pol man and Killestein, 2006; Yednock et al., 1992) and Rituximab (MabThera, Rituxan) (He et al. , 2011; Taupin, 2011), targeted against B cells, efficiently suppresses relapsing phases of MS. Fingolimod (FTY720), another recently introduced MS drug blocks the G protein coupled sphingosine 1-phosphate receptor (Sl P) and prevents the recircu lation and trafficking of T cells to the CNS and reduces the relapsing forms of multiple sclerosis. Also, inhibition of the chemokine receptor (CCR2) also has shown to suppress the clinical signs of MS (Fife et al., 2000; lzikson et al., 2000).

Acetylation is an important post translational modification of histones and non-histone proteins like transcription factors such as p53, GATA-1, erythroid kruppel like transcription factor (KLF4) (Polevoda et al., 2002). Histone deacetylases (H DAC) catalyze the removal of acetyl groups from their substrates where histone acetyl transferases catalyze the opposite reaction. Recently H DACs have been implicated in the modulation of inflammatory responses in immune cells (Roger et al., 2011). It has been shown that H DAC inhibitors exhibit immunosuppressive activity in mouse models for endotoxemia (Li and Alam, 2011) and rheumatoid arthritis (Choo et al., 2008; Chung et al., 2003) as well as in neurodegenerative conditions like Huntington's disease (Gardian et al., 2005), amyotrophic lateral sclerosis (Chuang et al., 2009), stroke (Ren et al., 2004) and MS (Camelo et al., 2005; Dasgupta et al., 2003).

Previous in vitro studies with primary microglial cultures showed that T SA dampened immune activation by suppressing pro- and anti-inflammatory cytokines in response to an inflammatory stimulus with lipopolysaccharide (Kannan et al., 2013). Since neuroinflammation

74

HDACi in MS (EAE) model ------ ---- ------- ---

is a major determinant of MS pathology (Huizinga et al. , 2012; Nataf, 2009) it is necessary to reduce the inflammatory response. In this study the effect of HDAC inhibitor (TSA) on the induction and progression of EAE as well as the inflammatory response of microglia and macrophages during EAE was determined.

3. MATERIALS AN D METHODS

3.1. Experimental animals

Young adult (10-11 week old) C57BL/6 female mice were obtained from Harlan, The Netherlands. Mice were housed in standard makrolon cages and maintained under a 12:12 hr light-dark cycle regime and received food and water ad libitum. Animals were subjected to an experiment after 1 week of acclimation. All animal experiments were carried out in accordance with the regulations of the Animal Welfare Committee (DEC) of the University of Groningen, The Netherlands (License number DEC: 6278C).

3.2. Chemicals and Reagents

EAE induction kits (Cat # EK-0114) were obtained from Hooke's laboratories, USA. TSA (Cat # T8552) was purchased from Sigma-Aldrich. Percoll (Cat # 17-0891-0) was purchased from GE Healthcare, HBSS (Cat # H15-010) and HEPES (Cat # 511-001) from Gibco (Breda, The Netherlands), CDl lS microbead kit (Cat # 130-096-354) from MACS Miltenyi Biotec and RPMI 1640 (Cat # 130-096-354) from GIBCO lnvitrogen.

3.3. EAE induction

For EAE induction, mice were immunized by subcutaneous (s.c.) injection of myelin peptide MOG35 55 (200 µg) emulsified in complete Freund's adjuvant (CFA). In addition, 500 ng of pertussis toxin was administrated intraperitonially (i.p.) on the same day of immunization. Within 24 hr of immunisation, a second i.p. injection with pertussis toxin was administrated. Mice were checked daily for weight loss and scored for EAE. Individual animals were scored using the fol lowing scale: (0) no obvious change, (1) limp tail, (2) limp tail and impaired righting reflex, (3) limp tail and partial paralysis of hind legs, (4) limp tail and complete paralysis of hind legs, (5) moribund, (6) death.

3.4. HDAC inhibitor

On the fifth day after MOG immunization, one group mice (n=8) received daily i.p. injections with TSA (7.5 mg/kg) in 10% DMSO. The EAE control animals (n=8) were injected with 10% DMSO. Both groups received i.p. injections for 9 consecutive days. Both vehicle and TSA treated EAE mice were sacrificed on two consecutive days. Healthy control mice (n=4) were injected with vehicle (10% DMSO).

3.5. Acute isolation of microglia/macrophages and cell sorting

After perfusion, brains and spinal cords were isolated and placed in ice cold medium A (HBSS supplemented with 0.6% glucose & 15 mM HEPES). Both brain and spinal cord tissue was cut into small pieces using a surgical blade. The minced tissues were subjected to mechanical dissociation

75

• C u I­C

J l

CHAPTER 3

using tissue homogenizer to obtain a single cell suspension. All the steps were performed at 4°C. Microglia were isolated as described previously (de Haas et al., 2008) with following modifications. The single cell suspension was filtered using 70 µm cell strainer (Falcon, Franklin Lakes, NJ) and cells were pelleted by centrifugation at 220 ref for 10 min at 4°C (Ace 9, Brake 9). The supernatant was removed and the pellet was resuspended in percoll with myelin gradient buffer. PBS was layered on top of a percoll solution followed by centrifugation at 950 ref, 4°C for 20 min (Ace 4, Brake 0). After centrifugation, myelin was carefully removed followed by resuspending the cell pellet in medium A without phenol red (PR) and processed for cell sorting.

Cells were (FC gamma I ll Receptor) blocked with 1% CD16/32 (Cat # 14 - 0161, eBiosciences) for 10 min on ice. For cell sorting and immuno phenotyping the CNS and spinal cord mononuclear cells were stained for expression of CDllb using an antibody coupled to Brilliant violet (Cat # 101235, Biolegend), CD45 coupled to FITC (Cat # 11-0451-82, eBiosciences) and Ly6C coupled to APC (Cat # 128015, Biolegend) for 20 min. Cells were washed with medium A without phenol red, pelleted by centrifugation at 1200 rpm for 2 min at 4°C (Ace 4, Brake 4) and resuspended in 150 µI of medium A without phenol red for cell sorting. In order to differentiate live and dead cells, propidium iodide (Pl) was used included at the time of sorting. Cells were analyzed in MoFlo™ XDP - Beckman Coulter. Microglial populations were characterized as CD1lb"i9", CD4510w and macrophages were identified as CDl lb 10w, CD45high (Mildner et al., 2007; Saederup et al., 2010). Monocyte subsets were further discriminated on the basis of expression of Ly-6C as negative, low or intermediate as well as high as described in (Auffray et al., 2009; Mildner et al., 2009) in sorted cells using Kaluza software.

3.6. Quantitative RT-PCR

RNA from microglia and macrophages was isolated using the Qiagen RNeasy Micro Kit according to the manufacturer's instructions. cDNA was synthesized using Random Hexamers (Fermentas), M-MuLV Reverse Transcriptase and Ribolock RNAse inhibitor (Fermentas). Quantitative PCRs were carried out using SYBR supermix (BIORAD) on ABl7900HT device (Applied Biosystems) with HMBS an internal control as reference gene (see table 1 for primer sequences). Relative gene expression levels were analyzed using the 2 Met method (Livak and Schmittgen, 2001).

Table 1: Primer sequence for qPCR genes

Gene Accession (NCBI symbol) number Forward primer (5"-3") Reverse primer (5"-3")

Lgals3 NM-010705 CAGGATTGTTCTAGATTTCAGGAG TGTTGTTCTCATTGAAGCGG

Lamp2 NM-001017959 GGACAGTATTCTACAGCTCAAGAC ACACTAGAATAAGTACTCCTCCCA

CXCLl0 NM-021274 GGGTCTGAGTGGGACTCAAGGGAT GGCCCTCATTCTCACTGGCCC

I L-lP NM-008361 A TCTTTGAAGAAGAGCCCATCC TGTAGTGCAGTTGTCTAATGGG

I L-6 NM-031 168 CCTCTCTGCAAGAGACTTCCATCCA GGCCGTGGTTGTCACCAGCA

TNF-a NM-013693 TCTTCTGTCTACTGAACTTCGG AAGATGATCTGAGTGTGAGGG

iNOS NM-010927 AAGGCCACATCGGATTTCAC GATGGACCCCAAGCAATACTT

I L-10 NM_010548 AAGGGTTACTTGGGTTGCCA TTTCTGGGCCATGCTTCTCT

TGF-P NM-011577 GAACCAAGGAGACGGAATACAG GGAGTTTGTTATCTTTGCTGTCAC

HMBS NM_001110251 .l CCGAGCCAAGGACCAGGATA CTCCTTCCAGGTGCCTCAGA

76

H DACi in MS (EAE) model

3.7. Isolation of peripheral monocytes from mouse blood

Monocytes were isolated from heparinized peripheral mouse blood using a mouse MACS Miltenyi Biotec CDllS Microbead kit according to the manufacturer's instruction. Isolated monocytes were maintained in RPMI 1640 supplemented with 10% heat inactivated fetal bovine serum. After 2 days, the medium was replaced to remove non-adherent cells. Monocytes were cultured for two weeks in the presence of macrophage colony stimulating factor (50 ng/ml) to induce differentiation into mature macrophages (Vogt and Nathan, 2011).

3.8. Boyden migration assay

Mouse macrophages were treated with TSA (50 ng/ml) for 1 hr and migration towards ATP was assessed in an 48 well chemotaxis microchamber (Neuroprobe, AP48, Gaithersburg, MD, USA) as described in (Green et al., 2012; Maa et al., 2010) with following modifications. Primary mouse macrophages (lxl04/per well) in plain RPMI were placed in the upper chamber and the chemoattractant solution ATP (100 µM), C5a (10 ng/ml) and CCL2 (50 ng/ml) was placed in the lower chamber. The upper and lower chambers were separated by a polyvinylpyrrolidone - free polycarbonate filter (5 µm pore size) coated with poly-L-lysine at the bottom side of the filter. After 5 hr of incubation at 37°C in 5% CO

2, the filter was fixed with Fast Green in 100% methanol

(2 mg/I, Diff-Quick Fix, Dade Behring, Dudingen, Fribourg, Switzerland), and stained twice, first with stain solution 1 (1.22 g/I eosin G in phosphatase buffer pH 6.6 (Diff-Quick 1) for 5 min followed by stain solution 2 (1.1 g/I th iazine dye in phosphate buffer pH 6.6) 3 min. Migrated, adherent cells on the filter were counted double-blind with a scored eyepiece (3 fields, 1 mm2 per well) and represented as percentages of control migration ± SEM.

3.9. Primary mouse astrocyte cultures

Astrocytes were prepared from mixed glial cultures obtained from P1-P

3 postnatal brains of

C57BL/6 mice has previously described in (Sher et al ., 2011) with following modifications. After 2 weeks, mixed glial cultures were placed in an orbital shaker at 150 rpm for 1hr at 37°C and primary microglial cells were separated from these mixed glial cells. On next day, astrocytes were detached from these underlying microglia using mild trypinisation method and replated in new tissue culture plates.

3.9.1. Quantitative RT-PCR

Astrocytes were stimulated with LPS (100 ng/ml) in combination with IFNy (50 ng/ml) for 4 hr in the presence as well as in the absence of HDACi (TSA) at two different concentrations (30 nM). Total RNA was isolated using Qiagen RNeasy Micro Kit according to the manufacturer's instructions. RNA was transcribed to cDNA using Random Hexamers (Fermentas) in a thermal cycler (BIORAD), using M-MuLV Reverse Transcriptase and Ribolock RNAse inh ibitor (Fermentas). Quantitative PCR reactions were carried out using a SYBR supermix (BIORAD) on an ABl7900HT device (Applied Biosystems) with different sets of Q-PCR primers. HMBS was used as an internal standard to calculate relative gene expression levels with the 2 -McT method (Livak and Schmittgen, 2001).

77

I

CHAPTER 3

Statistical Analysis

Statistical analyses were carried out using GraphPad Prism 5.00 software (Graph Pad Software). p-values < 0.05 were considered as statistically significant.

4. RESULTS

4.1 . Effect ofTSA on mouse macrophage migration

Since macrophage infiltration is an important pathological hallmark of MS (Ajami et al., 201 1; Juedes and Ruddle, 2001; Prendergast and Anderton, 2009) we decided to investigate the in vitro

migration of mouse macrophages after treatment with TSA. Isolated mouse macrophages showed pronounced migration towards the chemoattractants AT P, CSa and CCL2. We previously observed that TSA treatment did not affect the basal migratory activity of microglia (Chapter 2, Figure 9) . In line with this observation, we found that TSA did not affect the mouse macrophage chemotactic response to AT P, CSa and CCL2. These data suggested that H DAC inhibitor TSA did not influence the migration property of mouse macrophages {Figure 1) .

400 ■ Control ■ TSA

l 300

� 200 .E

1 00

RPMI ATP C5a CCL2

Figure 1: Effect of TSA on primary mouse macrophage migration. Primary mouse macrophage migration was determined in a Boyden chamber with ATP (100 µM), CSa (10 ng/ml) and CCL2 (SO ng/ml) as chemoattractants. Mouse macrophages were pretreated with TSA (SO ng/ml) for 1 hr and placed in a Boyden chamber. Control macrophages were incubated with vehicle. The number of cells m igrated towards RPMI or chemoattractants is shown, a representative experiment (one out of three) with the standard error of mean is depicted. Migration to RPMI is set at 100%.

4.2. Effect of Trichostatin A on EAE onset and progression

Previous work of Camelo and coworkers (2005) showed that TSA reduced the neurological impairment of EAE. Here in our study we administrated TSA (7.5 mg/kg/day i.p.) to EAE mice at the pre-clinical stage (from the 5th day after MOG injection) for consecutive 9 days. We observed that TSA did not have a significant effect on the onset of EAE (Figure 2A) .

78

+ w

3

2.5

2

1 .5

0.5

0

�Vehicle �TSA

H DACi i n MS (EAE) model

1 2 3 4 5 6 7 8 9 1 01 1 1 21 3141 51 617 18 19 day after immunisation

Figure 2a: Effect of TSA on EAE onset. c57BL/6 mice were subcutaneously immunized with MOG35

_55

emulsified in complete Freud's adjuvant and a lso received an intraperitonial injection ( i .p .) with pertussis toxin (PTX). After24 hr, pertussis toxin was i .p. injected a second time. Next, the m ice received i.p i njections with TSA (7.5 mg/kg/daily) or 10% DMSO (Vehicle) five days after the MOG injection for 9 subsequent days. The mean EAE score with the standard error of the mean is depicted.

In order to investigate the effect of TSA on EAE progression, the mice were scored dai ly as

described in (Kaneko et a l ., 2006). No significant effect of TSA on EAE progression was observed

(Figure 2B). Both EAE mice and EAE/TSA mice were terminated on two consecutive days and the

average clin ica l score of both groups was determined two days prior to the termination (day 16) and

on the day of termination (day 18). No significant d ifference in average EAE scores between these

groups was observed at either time point (Figure 2C). (Suppl. Figure 1 at the end of this chapter).

3.0 -e-Vehicle

w 2.5 -e-TSA

w 0

2.0 0 (.) � 1 .5

(.) :� + 1 .0

C 0.5

0.0 0 2 3 4 5 6

Davs after EAE onset

Figure 2b: Effect of TSA on EAE progression. c57BL/6 mice were subcutaneously immunized with MOG35-55 emulsified in complete Freud's adjuvant and also received an intraperitonial i njection ( i .p.) with pertussis toxin (PTX). After 24 hr, pertussis toxin was i .p. injected a second time. Next, the mice received i .p. injections with TSA (7.5 mg/kg/daily) or 10% DMSO (Vehicle) five days after the MOG injection for 9 subsequent days . The mean EAE score with the standard error of the mean is depicted.

79

I

CHAPTER 3

3 ■ Vehicle ■ TSA

2.5

8 2

� 1 .5 Q) C> � 1

0 .5

day 1 6 termination day

Figu re 2c: Effect of TSA on EAE score. Data represent the average EAE score of the Vehicle and TSA mice two days prior to termination (day 16) or at the day of termination (day 18). The average EAE score with the standard error of the mean is depicted.

4.3. Mononuclear cell populations in the central nervous system of control, EAE and EAE/TSA mice

Mononuclear cells from the brains of control, EAE and EAE/TSA mice were isolated and analyzed

using cell sorting (MoFlo™ XDP). Resting microglial cells were characterized as CDllb+ CD4510w

in control mice (Figure 3, panel 1, Gate A) as previously shown (De Haas et al., 2007). U pon

progression of EAE, a gradual increase in the infiltrated macrophage population (Figure 3, panel 2, Gate B) was observed which coincided with increasing EAE scores. The process of

mononuclear cell infiltration was first observed at the onset of EAE. In addition to macrophages,

lymphocytic infiltration is known to be crucial for disease severity (Almolda et al., 2011). A clear

increase in infiltration of lymphocytes was seen at the peak of EAE (Figure 3, panel 4, Gate C) which is in agreement with previous findings (Ponomarev et al ., 2011). Next we compared the

level of Ly-6C in these peripheral macrophages as described previously (Mildner et al., 2007). We discriminated monocyte subsets as Ly-6cne9 (Figure 3 panel 2, 3, 4, 5 Gate E), Ly-6C10w or Ly-6Cnt

(Figure 3, panel 2, 3, 4, 5, Gate F) and Ly-6Chi (Figure 3, panel 2, 3, 4, 5, Gate G). During the peak

of EAE (score 4), level of Ly-6C in peripheral macrophages was higher (Figure 3, panel 4, Gate G)

when compared to macrophages from mice with lower EAE scores (score 0.75) (Figure 3, panel 2, Gate G) which is in agreement with the previous findings of reported by (Mildner et al., 2009).

During the course of EAE, number of microglia and macrophages is reported to increase in

MS lesions (Benveniste, 1997). Therefore we decided to quantify the percentage of microglia,

macrophages and T cells in EAE mice (-/+) TSA. No major differences in the percentage of

microglia, peripheral macrophages as well as in T cells of control as well as in TSA treated EAE

mice were observed, however the percentage of microglia was relatively higher in TSA treated

EAE mice compared to control EAE mice in brain. In contrast, we observed that in spinal cord,

the percentage of microglia and microglia were relatively lower in EAE mice treated with TSA

in comparison to that Vehicle treated EAE mice. This difference in the brain as well as in spinal

cord for both microglia and macrophages is unclear (Figure 4).

80

(1 )

(2)

(3)

(4)

(5)

10

BOO

600 u

!8400

200 A

10' 10' 10' 1 ' 10' Ly-8C

vu E 10

BO 0

0

00-

00-

0

F) G

10' 101 102 Ly-6C

G

H DACi in MS (EAE) model

Control mouse

1 1 ' 1 .

10' 10'

10' 1

EAE + Vehicle (Score 0.75)

EAE + TSA (Score 0. 75)

EAE + Vehicle (Score 4)

EAE + TSA (Score 4)

Figure 3: Flow cytometric analysis of population in central nervous system {CNS) resident microglia, peripheral infiltrates and T cells: GATE A represents conb• microglia, GATE B represents co45• macrophage and GATE C represents leukocytes. Ly-6C marker was used to discriminate subs ets of the macrophage population. GATE A was further ana lyzed for Ly-6C expression and showed that microgl ia a re Ly-6C"eg (GATE D). The macrophage population (GATE B) were further discriminated as Ly-6cne9 (GATE E), Ly-6C 10w or Ly-6c10t (GATE F) and Ly-6ch1 (GATE G) expression level .

81

• ex u. f-0. <( I \...,

CHAPTER 3

800000

600000 Cl)

�.!: O m 'o..o 400000 ,_ Q) Q) .c .o-E .!: C:

.!: Cl)

= a> Q) (.) (.)•-.... E o_ t... O Q) ,_ .oc E O ::, 0 C:

200000

0

250000

200000

1 50000

1 00000

50000

■ EAE + Vehicle ■ EAE + TSA

Microglia Macrophage

■ Brain ■Spinal Cord

Microglia Macrophages

Q)

C:

�"E � 8 - iii 0 C: ,_ ·5. _8 rn E C:

200000 ■ EAE + Vehicle ■ EAE + TSA

160000

120000

80000

40000

0 Microglia Macrophage

Figure 4: The effect of TSA on the number of microglia and macrophages in EAE mice. The number of microglia and macrophages in the CNS, spinal cord in control and EAE mice treated with vehicle or TSA is depicted, error bars represents the SEM (* P < 0.001).

4.4. Effect of TSA on the inflammatory cytokine gene expression in brain microglia

and peripheral macrophages in the brain of EAE mice

To investigate whether TSA attenuate the extent of inflammatory responses in EAE, RNA was isolated from sorted cell populations of EAE mice (+/-) TSA and gene expression levels were determined (Table 1). However no significant suppression ofTNFa or IL-10 was observed in microglia isolated from EAE mice treated with TSA. In contrast, a significant reduction in TGF-� expression was observed in microglia of EAE mice treated with TSA in comparison to that of EAE mice treated with vehicle (Figure

SA). On the otherhand we observed an significant upregulation of TNFa in peripheral macrophages migrated to the brain in TSA treated EAE mice with respect to that to control EAE mice (Figure SB).

Chemokine (CXCLlO) has been reported to be required for the migration of peripheral infiltrates to the CNS (Fife et al., 2001 ; Muzio et al., 2010). We observed that CXCLlO expression levels were significantly reduced in microglia from TSA treated EAE mice (Figure SA), whereas no reduction was observed in peripheral macrophages of EAE mice on treatment with TSA (Figure

SB). Previous data showed that clearance of apoptotic cells and debris by phagocytic microglia/ macrophages was essential for tissue repair and for creating a pro-regenerative environment

82

H DACi in MS (EAE) model

with in the CNS (Neumann et al., 2009). Therefore we decided to determine the expression levels of Gal-3 (LGALS3), wh ich is typically expressed on phagocytic cells, and LAMP2, an endocytic marker. We found that LGALS3 expression was significantly induced in microglia in response to TSA treatment (Figure SA), other the other hand no significant change was observed in peripheral macrophages from TSA treated mice (Figure 58). Next, expression level of endocytic marker (LAMP2) was found to be significantly induced in peripheral macrophages in response to TSA treatment (Figure 58) whereas in microglia no difference in LAMP2 expression after TSA treatment was observed (Figure SA). Collectively from the RT-PCR data we concluded that TSA administration did not result in a significant suppression of inflammatory genes, phagocytic markers or endocytic markers in microglia and peripheral macrophages in the brain of EAE mice.

w 200 Q)

a 1 60 ·5 "' C 1 20 � .s Cl> 80 0) C

-5 40 "O 0 u.. 0

• EAE + Vehicle ■ EAE + TSA

ns

TNFa IL-1 0 TGF� Lgals3 LAMP2 CXCL 1 0

Figure SA: The effect of TSA o n inflammatory gene expression i n microgl ia. (A) m RNA expression levels of inflammatory cytokines in microglia isolated from bra in tissue of EAE m ice treated with Vehicle (n=S) or TSA (n=S). Mean expression levels are depicted with the SEM and gene expression levels were normal ized to hydroxymethylb i lane synthase (HMBS). *: p < 0.01, n . s : not sign ificant. A representative expression profile obta ined in one of three independent experiments is shown.

2 ■ EAE + Vehicle ■ EAE + TSA

:g- 1 .5 "' C

� £ Cl) 0)

fij 0.5 .c 0 "O

� 0 TNFa IL-1 0 TGF(.1 Lgals3 Lamp2 CXCL 1 0

Figure SB: The effect of TSA o n inflammatory gene expression in peripheral macrophages i n the brain. mRNA expression levels of inflammatory cytokines in infi ltrated macrophages in the bra in of EAE mice treated with Vehicle or TSA. Mean expression levels are depicted with the SEM and gene expression levels were normal ized to HMBS. *: p < 0.01, n .s: not sign ificant.

83

I

CHAPTER 3

4.5. HDACi potentiated LPS/IFNy-induced cytokine gene expression in primary astrocytes

HDACs are reported to regulate the inflammatory response of primary astrocytes (Beurel,

2011). We recently investigated the role of HDACs in modulating the inflammatory responses

in primary murine microglia as well as in astrocytes (Kannan et al., 2013). In order to investigate

whether TSA altered the inflammatory response triggered by LPS/IFNy in primary astrocytes.

Primary astrocytes were pre-incubated with TSA at (30 nM) for 2 hr prior to LPS/I FNy stimulation

for 4 hr and the levels of inflammatory gene expression were determined using quantitative

RT-PCR. LPS/IFNy stimulation resulted in significant induction of inflammatory genes (IL-1�,

IL-6, TNF-a, iNOS). Interestingly in TSA at 30nM, we observed an potentiation of all this

cytokine, but IL-6 transcript alone showed an suppressive effect on treatment with TSA after

stimulation with LPS/IFNy (Figure 6A). On the otherhand we also observed potentiation of

anti-inflammatory cytokine like TGF� as well on pre-incubation with TSA at 30 nM followed by

stimulation with LPS/IFNy.

3000 II)

15.. ·5 2000 II) C

� .!:

g> 1 000 Ill .c u -c 0 LL

IL-1 13

0 _.__ ___ .________..__ - 4 - 4 - 4 - 4

- 6 6

1 2000 iNOS II)

15.. 9000 ·5 II)

� .!: 6000

3000

- 4 - 4 - 4 - 4

- 6 6

4000

3000

2000

1 000

20

1 5

1 0

5

IL-6

- 4 - 4 - 4 - 4

6 6

TGFl3

4 4 LPS (hr) 4 4 IFNy (hr)

6 6 TSA (hr)

TNFa 400

300

200

1 00

O - 4 4 - 4 - 4

6 6

Figure 6: Trichostatin A (TSA) potentiated the pro-inflammatory response in primary astrocytes. (A) Primary astrocytes were stimulated with LPS (100 ng/ml) in combination with I FNy (50 ng/m l) for 4 hr. When present, TSA (30 nM) was added 2 hr prior to LPS/I FNy. Expression leve ls were normal ized to HMBS, mean expression levels a re depicted with the SEM (* p � 0.01). A representative expression profi le obtained in one of three independent experiments is shown.

84

HDACi in MS (EAE) model

S. DISCUSSION

In recent years, HDAC inhibitors have emerged as potent anti-inflammatory and immune modulatory compounds that have beneficial effects in autoimmune as wel l as in inflammatory diseases (Faraco et al . , 2011; Gray and Dangond, 2006; Kazantsev and Thompson, 2008) . In particular the pan-HDAC inhibitor, suberoylanilide hydroxamic acid (SAHA) is cl inical ly approved and considered to have possible therapeutic relevance (Shein and Shohami, 2011). TSA has beneficial effects in a mouse model of col lagen antibody-induced arthritis (Nasu et al . , 2008), in an al lergic airway disease model (Royce et al . , 2012) and in an animal model for hypoxic-ischaemic brain injury (Fleiss et al . , 2012). HDAC inhibitors results in hyperacetylation of nucleosomal histones as wel l as cytosolic proteins and thereby regulate gene expression and different cel lular processes (Kim et al., 2007; Tsaprouni et al . , 2011). In particular HDACi have been reported to exhibit protective properties in neurons (Langley et al., 2005; Leng and Chuang, 2006). A previous study of (Kannan et al., 2013) showed that HDAC inhibitors suppressed the expression of pro & anti-inflammatory cytokines in primary microglial cultures in response to LPS stimulation. Col lectively, these investigations demonstrated that HDACi act as an immunomodulatory agent in in vitro as wel l as in in vivo.

The role of HDACi in MS is slowly elucidated. MS is an autoimmune disorder characterized by cortical demyelination, blood-barrier leakage, axonal damage, glial scar formation etc(Lassmann, 1998; Lassmann, 2009). In addition to inflammatory cytokine expression, it was shown that migration of blood-borne myelomonocytic cel ls to the CNS are part of MS pathology (Aja mi et al., 2011). Therefore we performed in vitro cel l migration assay in mouse macrophages. However, no significant suppression of migratory property in macrophages treated with TSA in comparison to that of control group towards the chemoattractants (Figure 1) was observed suggesting that although TSA target on non-histone proteins like tubulin. Still TSA mediated tubulin acetylation didn't result a significant suppression of in vitro macrophages migration. Next we investigated the effect of broad spectrum HDAC inhibitor (TSA) in the pathogenesis of EAE. We observed that in vivo administration of TSA did not affect the onset (Figure 2a), progression (Figure 2b) as wel l as the etiology of EAE (Figure 2c). This might be due to the effect that TSA might have a poor penetration of blood-brain barrier (Hancock et al., 2012) or might be due to another glial cel l type like astrocytes on EAE progression. Col lectively our results suggest that TSA did not affect the onset as wel l as the progression of EAE. However we observed that, a total number of each mouse with EAE score treated with TSA is relatively less in number in comparison to that of EAE mouse injected with Vehicle (Suppl Figure 1). Therefore future experiments will have to establish with large cohort of mice to have an deeper understanding of the effect of TSA on EAE etiology. Increased infiltration of peripheral macrophages in the CNS has been reported to be an important parameter involved in the appearance of clinical symptoms in EAE (King et al., 2009). Therefore we decided to use Ly6C as a marker to discriminate between the subtypes of peripheral infiltrating monocytes as wel l as the CNS resident microglia in EAE mice treated with vehicle and with TSA. We observed that Ly6C high monocyte subsets invading the CNS during early EAE (Figure 3, panel 2, Gate G) is relatively lower in comparison to mice with peak EAE score (Figure 3, panel 4, Gate G) suggesting that monocyte subset expressing a high level of Ly6C is crucial for the disease severity in EAE (Mildner et al., 2009). Further, the percentage of microglia, macrophages as well as T cel ls

85

• 0 u l­o

J \..

CHAPTER 3

in the CNS and spinal cord of EAE mice +/- TSA were determined. An increase in numbers of microglia in EAE mice injected with TSA was observed, which could be due to the influence of TSA on microglial proliferation under in vivo condition (Figure 3, Panel 3 and 5, Gate A).

Further, we determined the inflammatory responses of microglia and macrophages acutely isolated from control as well as EAE mice with or without TSA. From RT-q PCR we found that TSA treatment did not result in a significant suppression of inflammatory gene expression of pro-inflammatory cytokine like (TNF-a) in microglia (Figure SA). On the other hand we observed an induction of this cytokine in peripheral macrophages which infiltrated to the brain in TSA treated EAE mice (Figure SB). Expression level of phagocytic marker (LGALS3) on the other hand was seems to be induced in microglia of TSA treated EAE mice in comparison to that of macrophages treated with TSA, suggesting an increased phagocytic capa bility of microglia in EAE mice after TSA administration. Collectively, our results suggest that in vivo TSA administration did not attenuate the inflammatory response of microglia as well as in peripheral macrophages in TSA EAE treated mice. Besides microglia, astrocytes are other major glial cells in the CNS involved in immune function and also play an important role in the maintenance of CNS homeostasis (Nedergaard et al., 2003; Ransom et al., 2003). In line with this it was shown that astrocytes are key players to evoke a CNS inflammatory response in trauma stroke (Farina et al., 2007), Alzheimer's disease (Olabarria et al., 2011) as well as in demyelinating disorders (Nair et al., 2008; Yang et al., 2012). These observations were further confirmed by additional lines of evidence suggesting that "reactive astrogliosis" is a prominent feature occurring in MS as well as in EAE (Bannerman et al., 2007; Guo et al., 2011). Next, we used in vitro primary astrocytes to determine the effect of HDACi on the inflammatory response in these cells. We observed that 30 nM TSA further increased the expression of the IL-1�, TN Fa and iNOS genes and TGF� in response to LPS/IFNy stimulation (Figure 6A and 6B). In contrast, the expression of IL-6 gene alone found to be suppressed in response to pretreatment with TSA followed by stimulation with LPS/IFNy and this disprepancies of IL-6 with other inflammatory cytokines may be due to differences in the biology of different cytokine. Interestingly, we showed that a similar dose of TSA suppressed inflammatory cytokines expression in microglia in response to LPS/IFNy (Chapter 2, Suppl Figure 1). These data suggest that it might be possible that the TSA administration in the EAE mice resulted in an increased inflammatory profile of astrocytes which could have contributed to the observed inability of TSA to attenuate EAE progression.

86

H DACi in MS (EAE) model

6. REFERENCES

Aja mi B, Bennett JL, Krieger C, McNagny KM, Rossi FM. 2011. Infi ltrating monocytes trigger EAE progression, but do not contribute to the resident microg l ia pool. Nat Neurosci 14:1142-1149.

Almolda B, Gonzalez B, Castel lano B. 2011. Antigen presentation in EAE: role of microgl ia, macrophages and dendritic cel ls . Front Biosci 16:1157-1171.

AuffrayC, Sieweke MH, Geissmann F. 2009. Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu Rev lmmunol 27:669-692.

Bannerman P, Hahn A, Soul ika A, Gal lo V, Pleasure D. 2007. Astrogl iosis in EAE spinal cord : derivation from radia l g l ia, and relationships to ol igodendroglia. G l ia 55:57-64.

Beu rel E. 2011. HDAC6 regulates LPS-tolerance in astrocytes. PLoS One 6:e25804.

Benveniste EN. 1997. Role of macrophages/microglia in multiple sclerosis and experimental a l lergic encepha lomyelitis. J Mol Med (Berl) 75:165-173.

Brosnan CF, Bornstein MB, Bloom BR . 1981. The effects of macrophage depletion on the cl in ical and pathologic expression of experimental a l lergic encephalomyelitis. J lmmunol 126:614-620.

Bruck W. 2005. The pathology of multiple sclerosis is the result of focal inflammatory demyelination with axonal damage. J Neurol 252 Suppl 5:v3-9.

Camelo S, Ig lesias AH, Hwang D, Due B, Ryu H, Smith K, Gray SG, lmitola J, Duran G, Assaf B, Lang ley B, Khoury SJ, Stephanopoulos G, De Girolami U, Ratan RR, Ferrante RJ, Dangond F. 2005. Transcriptional therapy with the histone deacetylase inh ibitor trichostatin A amel iorates experimental autoimmune encephalomyel itis. J Neuroimmunol 164:10-21.

Choo QY, Ho PC, Lin HS. 2008. H istone deacetylase inhibitors: new hope for rheumatoid arthritis? Curr Pharm Des 14:803-820.

Chuang OM, Leng Y, Mari nova Z, Kim HJ, Chiu CT. 2009. Multiple roles of HDAC inh ibition in neurodegenerative conditions. Trends Neurosci 32:591-601.

Chung YL, Lee MY, Wang AJ, Yao LF. 2003. A therapeutic strategy uses histone deacetylase inhibitors to modulate the expression of genes involved in the pathogenesis of rheumatoid arthritis. Mol Ther 8:707-717.

de Haas AH, Boddeke HW, Biber K. 2008. Region-specific expression of immunoregulatory proteins on microgl ia in the healthy CNS. Gl ia 56:888-894.

Dasgupta S, Zhou Y, Jana M, Banik NL , Pahan K. 2003. Sodium phenylacetate inh ibits adoptive transfer of experimental a l lergic encephalomyel itis in SJL/J mice at multiple steps. J lmmunol 170:3874-3882.

Faraco G, Cavone L, Chiarugi A. 2011. The therapeutic potential of HDAC inhibitors in the treatment of multiple sclerosis. Mol Med 17:442-447.

Farina C, Aloisi F, Mein! E. 2007. Astrocytes are active players in cerebral innate immunity. Trends lmmunol 28:138-145.

Fife BT, Huffnagle GB, Kuziel WA, Karpus WJ. 2000. CC chemokine receptor 2 is critical for induction of experimenta l autoimmune encephalomyel itis. J Exp Med 192:899-905.

Fife BT, Kennedy KJ, Paniagua MC, Lukacs NW, Kunkel SL, Luster AD, Karpus WJ. 2001 . CXCLl0 ( IFN-gamma­inducible protein-10) control of encepha l itogenic CD4+ T cel l accumulation in the central nervous system during experimental autoimmune encepha lomyelitis. J lmmunol 166:7617-7624.

Fleiss B, N i lsson MK, Blomgren K, Mal lard C. 2012. Neuroprotection by the h istone deacetylase inh ibitor trichostatin A in a model of l ipopolysaccharide-sensitised neonatal hypoxic-ischaemic bra in injury. J Neuroinflammation 9:70-2094-9-70.

Fritz RB, Skeen MJ, Chou CH, Zamvil SS. 1990. Local ization of an encephal itogenic epitope for the SJL mouse in the N -terminal region of myel in basic protein. J Neuroimmunol 26:239-243.

Gardian G, Browne SE, Choi DK, Klivenyi P, Gregorio J, Kubi lus J K, Ryu H, Lang ley B, Ratan RR, Ferrante RJ, Beal MF. 2005. Neuroprotective effects of phenyl butyrate in the N171-82Q transgenic mouse model of Huntington's disease. J Biol Chem 280:556-563.

Gray SG, Dangond F. 2006. Rationale for the use of histone deacetylase inhibitors as a dua l therapeutic modal ity in mu ltiple sclerosis. Epigenetics 1:67-75.

Guo F, Maeda Y, Ma J, Delgado M, Sohn J, Miers L, Ko EM, Bannerman P, Xu J, Wang Y, Zhou C, Takebayashi H, Pleasure D. 2011. Macrogl ial plasticity and the origins of reactive astrogl ia in experimental autoimmune encephalomyelitis. J Neurosci 31:11914-11928.

87

■ C IJ f­c < J l

CHAPTER 3

Green TD, ParkJ, Yin Q, Fang S, Crews AL, Jones SL, Adler KB. 2012. Directed migration of mouse macrophages in vitro involves myristoylated alanine-rich C-kinase substrate (MARCKS) protein. J Leukoc Biol .

Hancock WW, Akimova T, Beier UH, Liu Y, Wang L. 2012. H DAC inhibitor therapy in autoimmunity and transplantation. Ann Rheum Dis 7 1 Suppl 2: i46-54.

H aji N, Mandolesi G, Gentile A, Sacchetti L, Fresegna D, Rossi S, Musel la A, Sepman H, Motta C, Studer V, De Chiara V, Bernardi G, Strata P, Centonze D. 2012. TN F-alpha-mediated anxiety in a mouse model of multiple sclerosis. Exp Neurol 237:296-303.

He D, Z hou H, Han W, Zhang S. 201 1 . Rituximab for relapsing-remitting multiple sclerosis. Cochrane Database Syst Rev (12) :CD009130.

Hemmer 8, Archelos JJ, Hartung H P. 2002. New concepts in the immunopathogenesis of multiple sclerosis. N at Rev Neurosci 3:291 -301 .

H emmer B, Nessler S, Zhou D, Kieseier 8, Hartung H P. 2006. lmmunopathogenesis and immunotherapy of multiple sclerosis. Nat Clin Pract Neurol 2 :201-211.

H ickey WF. 1991. Migration of hematogenous cells through the blood-brain barrier and the initiation of CNS inflammation. Bra in Pathol l :97 -105.

Hu itinga I, van Rooijen N, de Groot CJ, U itdehaag BM, Dijkstra CD. 1990. Suppression of experimental allergic encephalomyelitis in Lewis rats after elimination of macrophages. J Exp Med 1 72 : 1025-1033.

Huizinga R, van der Star BJ, Kipp M, Jong R, Gerritsen W, Clarner T, Puentes F, Dijkstra CD, van der Valk P, Amor S. 2012. Phagocytosis of neuronal debris by microglia is associated with neuronal damage in multiple sclerosis. Glia 60:422-431.

lzikson L, Klein RS, Charo I F, Weiner H L, Luster AD. 2000. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J Exp Med 192:1075-1080.

Juedes AE, Ruddle NH. 2001. Resident and infiltrating central nervous system APCs regulate the emergence and resolution of experimental autoimmune encephalomyelitis. J lmmunol 1 66:5168-51 75.

Kannan V, Brouwer N, Hanisch U K, Reggen, Eggen BJ, Boddeke HW. 2013. Histone deacetylase inhibitors suppress immune activation in primary mouse microglia. Jour.Neurosci Res (In press).

King I L, Dickendesher TL, Segal BM. 2009. Circulating Ly-6C+ myeloid precursors migrate to the CNS and play a pathogenic role during autoimmune demyelinating disease. Blood 1 13:3190-3197.

Kaneko S, Wang J, Kaneko M, Yiu G, Hurrell JM, Chitnis T, Khoury SJ, He Z. 2006. Protecting axonal degeneration by increasing nicotinamide adenine dinucleotide levels in experimental autoimmune encephalomyelitis models. J Neurosci 26:97 94-9804.

Kazantsev AG, Thompson LM. 2008. Therapeutic application of histone deacetylase inhibitors for central nervous system disorders. Nat Rev Drug Discov 7 :854-868.

Kim HJ, Rowe M, Ren M, Hong JS, Chen PS, Chuang DM. 2007. Histone deacetylase inhibitors exhibit anti­inflammatory and neuroprotective effects in a rat permanent ischemic model of stroke: multiple mechanisms of action. J Pharmacol Exp Ther 321 :892-901.

Langley B, Gensert JM, Beal MF, Ratan RR. 2005. Remodeling chromatin and stress resistance in the central nervous system: hi stone deacetylase inhibitors as novel and broadly effective neuroprotective agents. Curr Drug Targets CNS Neural Disord 4:41 -50.

Lassmann H. 2009. Clinical and pathological topics of multiple sclerosis. Rinsho Shinkeigaku 49:715-7 1 8.

Lassmann H. 1998. Neuropathology in multiple sclerosis: new concepts. Mult Seier 4:93-98.

Leng Y, Chuang DM. 2006. Endogenous alpha-synuclein is induced by valproic acid through histone deacetylase inh ibition and participates in neuroprotection against glutamate-induced excitotoxicity. J Neurosci 26:7502-7512.

Li Y, Alam H B. 2011. Modulation of acetylation: creating a pro-survival and anti- inflammatory phenotype in lethal hemorrhagic and septic shock. J Biomed Biotechnol 2011:523481.

Livak KJ , Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the2(- Delta Delta C(T)) Method. Methods 25:402-408.

Maa MC, Chang MY, Hsieh MY, Chen YJ, Yang CJ, Chen ZC, Li YK, Yen CK, Wu RR, Leu TH. 2010. Butyrate reduced lipopolysaccharide-mediated macrophage migration by suppression of Src enhancement and focal adhesion kinase activity. J Nutr Biochem 21 :1 1 86-1192.

Mildner A, Mack M, Schmidt H, Bruck W, Djukic M, Zabel MD, Hille A, Priller J, Prinz M. 2009. CCR2+Ly-6Chi monocytes are crucial for the effector phase of autoimmunity in the central nervous system. Brain 1 32:2487-2500.

88

H DACi in MS (EAE) model

Mildner A, Schmidt H, Nitsche M, Merkl er D, Hanisch UK, Mack M, Heikenwalder M, Bruck W, Priller J, Prinz M. 2007. Microglia in the adult brain arise from Ly-6ChiCCR2+ monocytes only under defined host conditions. Nat N eurosci 1 0: 1544-1553.

Minagar A, Shapsha k P, Fujimura R, Ownby R, Heyes M, Eisdorfer C. 2002. The role of macrophage/microglia and astrocytes in the pathogenesis of three neurologic disorders: H IV-associated dementia, Alzheimer disease, and multiple sclerosis. J Neural Sci 202:13-23.

Muzio L, Cavasinni F, Marinaro C, Bergamaschi A, Bergami A, Porcheri C, Cerri F, Dina G, Quattrini A, Cami G, Furlan R, Martino G. 2010. Cxcll0 enhances blood cells migration in the sub-ventricular zone of mice affected by experimental autoimmune encephalomyelitis. Mol Cell Neurosci 43:268-280.

Nair A, Frederick TJ, Miller SD. 2008. Astrocytes in multiple sclerosis: a product of their environment. Cell Mol Life Sci 65:2702-2720.

Neumann H, Kotter MR, Franklin RJ. 2009. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain 132:288-295.

Nasu Y, Nishida K, Miyazawa S, Komiyama T, Kadota Y, Abe N, Yoshida A, Hirohata S, Ohtsuka A, Ozaki T. 2008. Trichostatin A, a histone deacetylase inhibitor, suppresses synovial inflammation and subsequent cartilage destruction in a collagen antibody-induced arthritis mouse model. Osteoarthritis Cartilage 16 : 723-732.

Nataf S. 2009. Neuroinflam mation responses and neurodegeneration in multiple sclerosis. Rev Neural (Paris) 165: 1023-1028.

Nedergaard M, Ransom B, Goldman SA. 2003. Newrolesforastrocytes: redefining the functional architecture of the brain. Trends Neurosci 26:523-530.

Olabarria M, Noristani HN, Verkhratsky A, Rodriguez JJ. 201 1 . Age-dependent decrease in glutamine synthetase expression in the hippocampal astroglia of the triple transgenic Alzheimer's disease mouse model: mechanism for deficient glutamatergic transmission? Mal Neurodegener 6:55-1326-6-55.

Pelman CH, Killestein J. 2006. Anti-myelin antibodies in multiple sclerosis: clinically useful? J Neural Neurosurg Psychiatry 7 7 :7 12.

Ponomarev ED, Shriver LP, Maresz K, Dittel BN. 2005. Microglial cell activation and proliferation precedes the onset of CNS a utoimmunity. J Neurosci Res 81 :374-389.

Polevoda B, Sherman F. 2002. The diversity of acetylated proteins. Genome Biol 3:reviews0006.

Ponomarev ED, Veremeyko T, Barteneva N, Krichevsky AM, Weiner H L . 2011. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.l pathway. Nat Med 1 7 :64-70.

Prendergast CT , Anderton SM. 2009. Immune cell entry to central nervous system --current understanding and prospective therapeutic targets. Endocr Metab Immune Disord Drug Targets 9:315-327.

Raivich G, Banati R. 2004. Brain microglia and blood-derived macrophages: molecular profiles and functional roles in multiple sclerosis and animal models of autoimmune demyelinating disease. Brain Res Brain Res Rev 46:261 -281 .

Ransohoff RM. 1989. Multiple sclerosis: new concepts of pathogenesis, diagnosis, and treatment. Com pr Ther 15:39-44.

Ransom B, Behar T, Nedergaard M. 2003. New roles for astrocytes (stars at last). Trends Neurosci 26:520-522.

Ren M, Leng Y, Jeong M, Leeds PR, Chuang DM. 2004. Valproic acid reduces brain damage induced by transient focal cerebral ischemia in rats: potential roles of histone deacetylase inhibition and heat shock protein induction. J Neurochem 89:1358-1367.

Roger T, Lugrin J, Le Roy D, Goy G, Mombelli M, Koessler T, Ding XC, Chanson AL, Reymond MK, Miconnet I, Schrenzel J, Francois P, Calandra T. 201 1 . Histone deacetylase inhibitors impair innate immune responses to Toll-like receptor agonists and to infection. Blood 1 1 7 : 1205-121 7.

Royce SG, Dang W, Yuan G, Tran J, E I-Osta A, Karagiannis TC, Tang ML. 2012. Effects of the histone deacetylase inhibitor, trichostatin A, in a chronic allergic airways disease model in mice. Arch lmmunol Ther Exp (Warsz) 60:295-306.

Sher F, Boddeke E, Copray S. 201 1 . Ezh2 expression in astrocytes induces their dedifferentiation toward neural stem cells. Cell Reprogram 13: 1-6.

Saederup N, Cardona AE, Croft K, Mizutani M, Cotleur AC, Tsou CL, Ransohoff RM, Charo I F. 2010. Selective chemokine receptor usage by central nervous system myeloid cells in CCR2-red fluorescent protein knock-in mice. PLoS One 5:el3693.

89

• C u I­C < ] l

CHAPTER 3

Semple BD, Kossmann T, Morganti- Kossmann MC. 2010. Role of chemokines in CNS health and pathology: a focus on the CCL2/CCR2 and CXCL8/CXCR2 networks. J Cereb Blood Flow Metab 30:459-473.

Scorisa JM, Freria CM, Victoria SC, Barbizan R, Zanon RG, Oliveira AL. 201 1 . Glatiramer acetate treatment increases sta bility of spinal synapses and down regulates MHC I during the course of EAE. I nt J Biol Sci 7 : 1 188 -1202.

Shaftel 55, Carlson TJ, Olschowka JA, Kyrkanides S, Matousek SB, O'Banion MK. 2007. Chronic interleukin­l beta expression in mouse brain leads to leukocyte infiltration and neutrophil-independent blood brain barrier permeability without overt neurodegeneration. J Neurosci 27 :9301-9309.

Shein NA , Shohami E. 201 1 . Histone deacetylase inhibitors as therapeutic agents for acute central nervous system injuries. Mal Med 1 7 :448-456.

Taupin P. 201 1 . Antibodies against CD20 (rituximab) for treating multiple sclerosis: US20100233121 . Expert Opin Ther Pat 21 :lll-1 14.

Tsaprouni LG, Ito K, Powell JJ, Adcock IM, Punchard N. 201 1 . Differential patterns of histone acetylation in inflammatory bowel diseases. J l nflamm (Land) 8:1 .

Vogt G , N athan C. 201 1 . In vitro differentiation of huma n macrophages with enhanced a ntimycobacterial activity. J Clin I nvest 121 :3889-3901 .

Watzlawik J , Warrington AE, Rodriguez M. 2010. Importance ofoligodendrocyte protection, BBB breakdown and inflammation for remyelination. Expert Rev Neurother 1 0:441 -457.

Whitham RH, Jones RE, Hashim GA, Hoy CM, Wang RY, Vandenbark AA, Offner H. 1991 . Location of a new encephalitogenic epitope (residues43to 64) in proteolipid protein that induces relapsing experimental autoimmune encephalomyelitis in PL/J and (SJ L x PL)Fl mice. J lmmunol 147:3803-3808.

Yednock TA, Cannon C, Fritz LC, Sanchez-Madrid F, Steinman L, Karin N. 1992. Prevention of experimental autoimmune encephalomyelitis by antibodies against alpha 4 beta 1 integrin. Nature 356:63-66.

Yang J F, Tao HQ, Liu YM, Zhan XX, Liu Y, Wa ng XY, Wang JH, Mu LL, Yang LL, Gao ZM, Kong QF, Wang GY, Han J H, Sun B, Li HL. 2012. Characterization of the interaction between astrocytes and encephalitogenic lymphocytes during the development of experimental autoimmune encephalitomyelitis (EAE) in mice. Clin Exp lmmunol 1 70:254-265.

90

SUPPLEMENTARY MATERIALS

4

■ EAE + Vehicle ■ EAE + TSA

0 0.75 1 1 .5 2.5 3 4

Score

H DACi in MS (EAE) model

Supplementary S1 : Effect of TSA on EAE score on individual mice. Mice with EAE were i njected intraperitonia l ly ( i .p) with TSA (7.5 mg/kg da ily) or 10% DMSO on the 5 day of MOG injection for subsequent 9 days. The data depict the number of mice with a particular EAE score.

91

I

C HAPTER 4

ATP-dependent neuroprotection

in NMDA-treated OHSCs depends

on functional P2X7 expression

in microglia

Annette Heinrich1, Chu-Hsin Shieh1, Vishnu Kannan2,

Nieske Brouwer, Hendrikus W.G.M. Boddeke2, Knut Biber ,:

1Department of Psychiatry and Psychotherapy, Section of Molecu lar

Psychiatry, U niversity of Frei burg, F rei burg, G ermany 2Department of Neuroscience, Section Medical Physiology, U n ivers ity

Med ical Center Groningen (UMCG), Rijksuniversiteit Gron ingen (RUG),

Gron ingen, The Netherlands

* Corresponding author:

Hauptstrasse 5, 79104 Frei burg; Tel +49 761 270-66580 / Fax -69170;

knut.biber@un ikli n ik-freiburg.de

Manuscript in preparation

CHAPTER 4

1. ABSTRACT

2. INTRODUCTION

3. MATERIALS AND METHODS 3.1. Animals 3.2. Organotypic hippocampal slice cultures (OHSCs) 3.3. Acute isolation of microglia from adult mouse brain 3.4. Treatment of OHSCs and induction of excitotoxicity 3.5. Cryosectioning of adult mouse brain: immunofluorescent staining

of sections and OHSCs 3.6. mRNA isolation and quantitative PCR 3.7. Western blot

4. RESULTS 4.1. ATP is neuroprotective depending on the presence of microglia 4.2. P2X7 receptor activation is mediating the effect of ATP 4.3. Long term treatment with valproic acid is neuroprotective 4.4. Valproic acid treatment enhances expression of P2X7 receptor

5. DISCUSSION

6. REFERENCES

94

HDACi and P2X7 expression in microglia

1 . ABSTRACT

We have recently provided evidence for a neuroprotective function of ramified microglia in Organotypic hippocampal slice cultures (OHSC) subjected to NMDA-induced neurotoxicity. We here investigated the mechanism underlying this neuroprotective property of microglia. I t is shown here that the purinergic receptor P2X7 in microglia is involved in protective function of these cells. This assumption is based on the following findings: i) high concentrations of ATP were neuroprotective in NMDA-induced excitotoxicity, but only when microglia where present in the O HSC. ii) Specific P2X7 agonists or antagonists induced or blocked neuroprotection, respectively and also these effects where dependent on the presence of microglia in the system. iii) Slices from P2X7 deficient animals showed similar neuronal death in response to NMDA as microglia free slices, and ATP (or specific P2X7 agonists) did not have an influence on neuronal survival . iv) Specific staining for P2X7 was only found in microglia and v) up-regulation of P2X7 expression in microglia by VPA treatment enhanced the neuroprotective capacity of these cells. Taken together these results clearly show that P2X7 is crucial for microglia to exert their neuroprotective role.

--------- - - -- ---95

I

CHAPTER 4

2. INTRODUCTION

Microglia are the brain's first-line of defence in case of injury, infection or other inflammatory events (see for review: Streit, 2002; Biber et al., 2007; Ransohoff and Perry,

2010; Kettenmann et al., 2011). Introduced by Pfo del Rfo Hortega in the 1920's and 1930's, microglia have originally been divided into "resting" and "activated" cells mainly based on morphological characteristics (see for excellent review on the history of microglia research: Kettenmann et al., 2011). While ramified microglia are characterized morphologically by a small soma and long processes with numerous branches and were suggested to be inactive or "resting" cells, so called "activated" microglia are determined by reduced cell complexity and an amoeboid cell shape with macrophage-like properties (Kettenmann et al, 2011). Whereas much in known about morphologically activated microglia the function of resting microglia is by far less understood, which is likely due to the fact microglia can not be cultured in a quiescent and ramified state (Harry and Kraft, 2008).

By in vivo 2-photon microscopy it was revealed that ramified microglia cells are highly motile and actively scan their surrounding with their processes (Nimmerjahn, 2005) and thus are not "resting" at all. This landmark paper was the starting point of a variety of studies that concerned the function of ramified microglia. Today it is becoming increasingly clear that ramified microglia are involved in several regulatory and developmental processes like developmental synaptic pruning (Paolicelli et al., 2011), phagocytosis of apoptotic cells during adult hippocampal neurogenesis (Sierra et al., 2010), as well as modulation of neuronal activity and neuronal circuitry (Tremblay et al., 2010; Wake et al. , 2010) (see for excellent review: Tremblay et al., 2012). Recently, we described a neuroprotective function of ramified microglia in organotypic hippocampal slice cultures (OHSC) (Vinet et al., 2012). Using an excitotoxicity­model in OHSC we could show that the survival of neurons upon NMDA treatment was dependent on the presence of ramified microglia in the tissue (Vinet et al., 2012). How microglia enables neurons to survive excitotoxicity is yet not understood.

It is well known that numerous microglia functions are controlled by ATP (see for review: Inoue, 2008). Adenosine triphosphate (ATP) is a critical signalling molecule used widespread all over the body for cell-cell communication purposes (Khakh and Burnstock, 2009; Burnstock, 2012). Mainly synthesized in mitochondria the intracellular concentration of ATP is as high as 10 mM and it is released under non-pathological conditions in response to several kinds of stimuli (Sperlagh and Illes, 2007). Moreover, ATP is also considered as a danger signal since high extracellular concentrations can be reached upon pathological events including cellular damage (Sperlagh and Illes, 2007; Inoue, 2008). Microglia express a variety of different ATP receptors (P2 Purinergic receptors). Accordingly, different microglia functions, such as chemotaxis, membrane ruffling, processes elongation and phagocytosis are controlled by P2 purinergic receptor activation (Inoue, 2008). The present study examined the role of ATP signalling in the neuroprotective properties of ramified microglia cells in organotypic hippocampal slice cultures using NMDA-induced excitotoxicity. It is shown here that functional P2X7 receptor expression in microglia is crucial for the neuroprotective property of these cells. Knocking out P2X7 blunts microglia neuroprotective function, whereas an up-regulation of P2X7 in microglia by epigenetic manipulation enhances the neuroprotective effect of these cells.

96

HDACi and P2X7 expression in microglia

3. MATERIALS AND METHODS

3.1 . Animals

All animal experiments have been conducted in accordance with the guidelines of the German Animal Protection Act and have been approved by the local Regional Commission of Freiburg. Animals were house and handled according to the guidelines of the local central animal facility of the Medical Faculty of Frei burg. C57BL/6 mice served as wild type controls and were purchased regularly from Charles River to avoid genetic drift due to inbreeding. For the VPA experiments C57Bl/6NCrl mice were housed and handled in accordance with the guidelines of the central animal laboratory facility of Groningen. These animal experiments have been approved by the Dutch animal experimental committee. Animals were treated for three or eight consecutive days with 300 mg per kg bodyweight twice a day by intra peritoneal injection. The animals were sacrificed, the microglia was isolated and the microglial mRNA was extracted. P2X7· 1· mice (strain B6.129P2-P2rxrmicab /J) were a kind gift from Dr. Francois Rassend ren (I NS ERM, Montpellier, France) and have been described before (Solle et al., 2001) .

3.2. Organotypic hippocampal sl ice cultures (OHSCs)

OHSCs were prepared from newborn mice as previously described (Vinet et al., 2012). Briefly, animals were decapitated, the brain was removed, and hippocampi were isolated in ice cold Hank's Balanced Salt Solution supplemented with 15 mM HEPES and 0.5% glucose. The hippocampi were cut transversely by a tissue chopper (Mclllwain) in slices of 375 µm thickness. Six slices were transferred to Millicell cell culture inserts (0.4 µm pore size; Millipore) and cultured according to the interface method (Stoppini et al., 1991) in 6-well plates containing 1.2 ml culture medium (0.5x MEM, 25% BME, 25% horse serum, 2 mM glutamax, 0.65% glucose; pH 7.2) at 35°C, humidified atmosphere, 5% CO2 •

To deplete microglia from O HSCs the slice cultures were placed immediately after preparation either on culture medium containing clodronate encapsulated in liposomes (van Rooijen et al., 1994) or on culture medium containing 100 µg / ml clodronate disodium salt (Kreutz et al., 2008). 24 hours after preparation, the cultures were washed briefly with prewarmed phosphate buffered saline and the cell culture inserts were placed on fresh culture medium.

3.3. Acute isolation of microgl ia from adult mouse brain

The acute isolation of microglia from adult mouse brain has been performed as described in detail before (de Haas et al., 2007). Briefly, the whole blood from the animal was removed by transcardial perfusion and the brain was dissected out of the skull. The cerebellum was removed and the cerebrum was mechanically minced into small pieces using scalpels. The tissue was further triturated using a homogenizer and by using fire-polished Pasteur-pipettes to reach a single cell suspension. Microglia was isolated from this suspension by density gradient centrifugation using percoll solutions. Purity of the isolated microglia was determined by flow cytometry (de Haas et al., 2008) and was usually >95%.

3.4. Treatment of OHSCs and induction of excitotoxicity

Before treatment the cultures were kept for at least 7 days in vitro to allow the tissue and especially the microglia cells to recover from the slicing procedure (Hailer et al., 1996). In

97

■ Cl LI I­Cl

] l

CHAPTER 4

advance of excitotoxic insults OHSCs were treated for 30 min with adenosine 5'-triphosphate

(ATP) at different concentrations (1, 10, 100, or 500 µM) to activate P2 receptors. To selectively

activate either P2X7 or P2X4 receptors OHSCs were treated for 30 min with 500 µM 3' -O-(4-

benzoyl)benzoyl adenosine 5'-triphosphate (BzATP),or with 100 µM 2-Methylthio-adenosine

5'-triphosphate (MeSATP), respectively; to inhibit either P2X4 or P2X7 receptors 50 µM or 3 µM

Brilliant Blue G (BBG), respectively, were used or lO µM A438079, a selective inhibitor of the P2X7

receptor. Treatments with 0.5 or 1 mM valproic acid (VPA) were either for 30 min or 3 days and

treatment with 200 nM trichostatin A or sodium butyrate (1 or 2.5 mM) was for 3 days.

Excitotoxicity was induced by treatment for 4 hours with 10 or 25 µM N-methyl-D-aspartic

acid (NMDA). Afterwards the medium was changed and the cultures were kept for further 24

hours at 35°C before fixation. To analyze the amount of cell death, the cellular marker propidium

iodide (1.5 µg / ml) was used during the NMDA challenge until fixation. For fixation the OHSCs

were briefly washed with prewarmed PBS and treated with 4% paraformaldehyde in PBS (w/v)

for 2 hours at 4°C. The paraformaldehyde was removed and the slices were washed 3 times for

10 min with cold PBS.

3.5. Cryosectioning of adult mouse brain; immunofluorescent staining of sections and OHSCs

To stain adult mouse brain tissue, the animals were sacrificed and the whole blood was removed

by transcardial perfusion. The brain was fixed overnight in 4% paraformaldehyde in PBS (w/v),

dehydrated in 30% sucrose in PBS (w/v), embedded with Tissue-Tek (Sakura), frozen on dry-ice

and stored at -80°C. Coronal sections with 40 µm thickness were prepared with a cryostat.

Sections were stained free-floating for immunofluorescent imaging.

Staining of OHSCs or cryosections of adult mouse brain for fluorescent imaging was performed

as previously described (van Weering et al., 2010). Briefly, the tissue was blocked and permeabilized

by incubation for 2 hours with 5% normal goat serum in PBS with 0.3% triton-Xl00. Incubation

with the primary antibody (mouse anti-NeuN, 1:1000, Millipore; rabbit anti- lbal, 1:1000, Wako­

Chemicals; rat anti-P2RX7, 1 :100, antibodies-online) in PBS with 0.3% triton-Xl00 and 1% normal

goat serum was overnight at 4°C. After 3 washing steps for 10 min with cold PBS, the slices were

incubated with the secondary antibody (donkey anti-mouse Alexa 488, 1:1000; donkey anti-rabbit

Alexa 647, 1:1000; donkey anti-rat Alexa 594, 1:1000; goat anti-rabbit Alexa 488, 1:1000; all lnvitrogen)

in PBS with 0.3% triton-Xl00 and 1% normal goat serum overnight at 4°C. After 3 washing steps for

10 min with cold PBS the slices were mounted on slides using Mowiol supplemented with Dabco.

3.6. mRNA isolation and quantitative PCR

Total RNA was extracted from OHSCs by the single step method introduced by Chomczynski

and Sacchi (Chomczynski and Sacchi, 1987). Total mRNA was transcribed into cDNA using

random hexamer primer and the M-MLV reverse transcriptase (Promega) as recommended by

the manufacturer. Expression of the genes P2X7, CDllb, f3-actin, GAPDH, or Sl2 (Table 1) was

determined on 96-well plates by quantitative real time PCR using the iQ SYBR green Supermix

(Biorad) according to the instructions of the supplier. Samples were analyzed using a ClO00

Thermal Cycler (Biorad).

98

HDACi and P2X7 expression in microgl ia

Table 1: Primers used for quantitative rea l time PCR

Gene Accession number Primer sequence (5' -> 3')

P2X7-R NM_Ol1027.2 FORWARD AAGCTGTACCAGCGGAAAGA

REVERSE AGAATGAGTTCCCCTGCAAA

CDll b NM_001082960.1 FORWARD CGGTGGCAGTGTGAAGCTCTTCTC

REVERSE GGCGCCTATGATCCGCTGGCT

GAPDH NM_008084 FORWARD TGTCCGTCGTGGATCTGAC

REVERSE CCTGCTTCACCACCTTCTTG

�-actin NM_007393.3 FORWARD CTAAGGCCAACCGTGAAAAG

REVERSE ACCAGAGGCATACAGGGACA

Sl2 NM_0l1295.6 FORWARD GCCCTCATCCACGATGGCCT

REVERSE ACAGATGGGCTTGGCGCTTGT

3.7. Western blot

To analyze protein contents in OHSCs, the tissue was harvested in lysis buffer (42 mM Tris/HCI, pH 6.8; 1.3% SOS; 6.5% glycerine; 100 µM Na3VO ), sheared using a 1-mL syringe and needle with 26G, cel l debris was pelleted by centrifugation for 20 min at 15.000 g, 4°C. The protein concentration was determined from the supernatant by OD measurement at 570 nm using the bicinchonicin acid (BCA) assay (Pierce). 25 µg per sample were electrophoresed by SOS-PAGE and the proteins were transferred to a PVFD membrane by semi-dry transfer. P2X7-receptor protein was labelled using the rabbit anti-P2X7 receptor antibody ATTO-550 (1:500, Alomone Labs). Actin protein was labelled using the rabbit anti-actin antibody (1:5000, Sigma). Secondary antibody was the horseradish-peroxidase conjugated anti-rabbit lgG (1:25000, GE Healthcare). Proteins were detected by enhanced chemiluminescence using the Fusion image acquisition system (SL 3500, Peqlab). The amount of protein was quantified by densitometric analysis of the bands using the NIH Image J software.

4. RESULTS

4.1. ATP is neuroprotective depending on the presence of microg l ia

Excitotoxicity induced by NMDA treatment leads to severe neuronal cel l death in organotypic hippocamapal slice cultures in a concentration-dependent manner, as was shown recently (Vinet et al . , 2012). In the absence of microglia, the cel l death was much more pronounced indicating an important role of microglia in neuronal survival . To examine the putative involvement of microglial purine receptors, OHSCs were treated for 30 min with different concentrations of ATP prior to the chal lenge with 10 or 25 µM NMDA. Whereas ATP concentrations from 1 to 100 µM did not have an effect on neuronal survival, pre-treatment with 500 µM ATP significantly reduced NMDA-induced neuronal death as can be appreciated by reduced propidium iodine (Pl) staining in the neuronal layers (Fig lA). The quantification of the Pl staining revealed that at both NMDA concentrations 500 µM ATP reduced neuronal cell loss by approximately 50% (Fig. 18).

In the absence of microglia, neuronal cel l death was much more pronounced with 47.7 ± 3.3% cel l death upon chal lenge with 10 µM NMDA and 67.3 ± 3.8% at 25 µM NMDA (Fig. lA and B),

99

• IX

u

CHAPTER 4

(A)

(B) 100

80

- with microglia c:::::i depleted

?f?. 60 .s

40

a: 20

0 ..L.a---...-L...1.11----�L..LI--..JU.......La-....U--i..-..L

ATP in µM - - 1 10 1 00 500 - 1 1 0 100 500 NMDA in µM -- 1 0 25

Figure 1: Effect of ATP treatment on NMDA-excitotoxicity in OHSCs. A) After 10 days in culture, hippocampal slice cultures were treated with concentrations of O (control), 10 and 25 µM NMDA in the presence (upper panels) or absence of microglia (lower panels). O HSCs where stained neuronal nuclear marker N euN (green fl uorescence) and treatment with NMDA induced neuronal loss in the slice as determined by propidium iodide uptake (Pl; red signal). B) The quantification of the Pl signal revealed significant neuroprotection by 500 µM ATP in microglia containing slices only. Data in B are shown as mean ± SD from at least 3 independent experiments with n=6 slices per experiment. *p < 0.005.

confirming earlier findings (Vinet et al., 2012). I nterestingly, in the absence of microglia ATP pre-treatment did not have any neuroprotective effect, suggesting a purine receptor mediated mechanism that is vital for the neuroprotective function of microglia.

4.2. P2X7 receptor activation is mediating the effect of ATP

Microglia express a variety of P2 receptors that control different microglia functions (I noue, 2008; Pocock and Kettenmann, 2007) among the generally found P2 purinergic receptors in microglia is P2X7. Our results that only high concentrations have neuroprotective effects implicate the involvement of P2X7 receptors, since P2X7 receptors are only activated at high concentrations of 100-1000 µM ATP (Abbracchio et al., 2008; Pocock and Kettenmann, 2007). To examine this

100

HDACi and P2X7 expression in microglia

hypothesis, OHSCs were treated with the P2X7 receptor agonist BzATP and antagonist BBG prior to the NMDA chal lenge. Activation of P2X7 by BzATP significantly reduced neurotoxicity induced by 10 or25 µM NMDA by22.2% and28.9%, respectively, a similareffect asseenwithS00 µMATP (Fig2A). Co­treatment with 3 µM of the P2X7 receptor antagonist BBG completely blocked the neuroprotective effects of ATP as well as of BzATP (Fig 2A). Moreover, in slice cultures prepared from P2X7 receptor deficient mice (P2x,1·) the NMDA-induced neuronal death was much more pronounced with 74.8 ± 4.1% (Fig. 2B) compared to wild type OHSCs with 38.6 ± 4.9% (Fig. 1B) and neuronal surviva l was not reduced by either ATP or BzATP treatment (Fig. 2B). To confirm the expression of P2X7 receptors in microglia, cryosections from adult mouse brain were immunofluorescently stained. P2X7 receptor co-stained with the microglial marker lbal, the astrocytic marker GFAP, or the neuronal marker NeuN. In adult wild type mouse brain, P2X7 receptor was detected only in structures co-labelled for lbal (Fig. 2C). No specific fluorescent signal for P2X7 in microglia was obtained from cryosections prepared from adult P2X,1· mice (Fig. 20). Similar results were obtained from immunofluorescent staining of OHSCs prepared from wild type or P2X7-I- mice (not shown).

(A) 50

40

.E 30

Lo 10

- car ol c:::::i3 II� 3BG

ATP in 11M - - 5• ' - - 500 -BzATP in 1,1M - - - 500 -- - 500 NMDA in 1,1M - --10- --25-

(C)

Cellular marker P2X7 IEV,•

.,._. ... ..._.

Gfl\l '

, _ . ----0 •

�Puf-J

I o I I

Overlay

(8) 100 - P2X7-ko

80 * .E 60

i 40

20

CTRL - 500 1,1M 500 1,1M ATP BzATP

25 11M NMDA (D)

Cellular marker P2X7 lb1\ I

t--1 l'-1 ,-1

C�f\P

._ t-1 ,.-,,

Overlay

Figure 2: Role of P2X7 in ATP-dependent neuroprotection. A) Activation of P2X7 by BzATP significantly reduced neurotoxicity induced by 10 or 25 µM NMDA by 22.2% and 28.9%, respectively, a similar effect as seen with 500 µM ATP. Co-treatment with 3 µM of the P2X7 receptor antagonist BBG completely blocked the neuroprotective �ffects of ATP as well as of BzATP. B) In s l ice cultures prepared from P2X7 receptor deficient mice (P2X7 ) the NMDA-induced neuronal death was not reduced by either ATP or BzATP treatment. C and D) lmmunofluorescent staining revealed specific staining for P2X7 receptors in microglia, but not in astrocytes or neurons. Data in A and B are shown as mean ± SD from at least 3 independent experiments with n=6 slices per experiment. *p < 0.005. Scale bars indicate 20 µm.

101

■ � L1J l­a. <( I u

CHAPTE R 4

4.3. Long term treatment with valproic acid is neuroprotective

Treatment of OHSCs with va lproic acid (VPA) for a short-term period of 30 min in advance of the

chal lenge with 25 µM NMDA did not i nduce any effect on neu rona l su rvival (data not shown).

I n contrast, t reatment for a long -term period of 3 days prior to NMDA treatment ma rked ly

reduced neu rotoxicity in concentration -dependent manner. 500 µM VPA decreased Pl u ptake to

22.7 ± 3.3% compared with s l ice cu ltu res chal lenged with 25 µM NMDA o nly showing 38.7 ± 3.2%

cel l death. Treatment with 1 000 µM VPA d imin ished the ce l l death to 13.7 ± 2 .7% (Fig . 3A). This

(A)

(C)

7

60

?F- 50 £ a, 40 � Cll

§- 30

100

80 #. .E: Q) 60

40 a: 20

- undepleted c=i depleted

CTRL ------ 500 µM 1 000 µM (VPA)

25 µM NMDA

- P2X7-ko

CTRL --- 500 µM 1000 µM (VPA) 25 µM NMDA

(B) - untreated

50 c=i 3 µM BBG

40

.5 30 Q) � Cll

g- 20 a:

1 0

CTRL -- 500 µM 1 000 µM (VPA)

25 µM NMDA

Figure 3: Effects of the neuroprotective drug VPA on NMDA-induced excitotoxicity in OHSCs. A) Treatment of OHSCs with 500 µM and l mM VPA for 3 days prior to NMDA treatment markedly reduced neurotoxicity in concentration-dependent manner. 500 µM VPA decreased Pl uptake to 22. 7 ± 3.3% compared with slice cultures cha l lenged with 25 µM NMDA only showing 38 . 7 ± 3.2% cel l death . Treatment with 7000 µM VPA diminished the cell death to 13 . 7 ± 2 . 7%. This strong neuroprotective effect was completely lost u pon depl etion of microglia with 60.4 ± 4.1%, 59.9 ± 3.5%, and 59.4 ± 3.6% Pl u ptake in OHSCs cha l lenged with 25 µM NMDA alone, or combined with 3 days pre-treatment with 500 µM or 7000 µM VPA, respectively. B) Neuroprotection induced by 3 days treatment with VPA was diminished by treatment of OHSCs with the P2X7 receptor antagonist BBG for 30 min in advance of the NMDA cha l lenge and C) in OHSC from P2X7-/- animals VPA treatment did not cause any neuroprotection. Data are shown as mean ± SD from at least 3 independent experiments with n=6 slices per experiment. *p < 0.005.

102

HDACi and P2X7 expression in microglia

strong neuroprotective effect was completely lost upon depletion of microglia with 60.4 ± 4.1%, 59.9 ± 3.5%, and 59.4 ± 3.6% Pl uptake in OHSCs chal lenged with 25 µM NMDA alone, or combined with 3 days pre-treatment with 500 µM or 1000 µM VPA, respectively (Fig. 3A). As the P2X7 receptor is mediating neuroprotection upon increased ATP-levels, it was tested whether this receptor might be also involved in the effect of VPA. Indeed, neuroprotection induced by 3 days treatment with VPA was diminished by treatment of OHSCs with the P2X7 receptor antagonist BBG for 30 min in advance of the NMDA chal lenge. As shown in Figure 3B, OHSCs challenged with 25 µM NMDA and co-treated with 3 µM BBG and 500 µM or 1000 µM VPA exhibited 32.8 ± 1.9% and 32.1 ± 2.3% Pl uptake, respectively (Fig. 38). Similar results were obtained when OHSCs were treated with 10 µM of the specific P2X7 receptor antagonist A438079 (data not shown). Moreover, in OHSC from P2X7-/- animals VPA treatment did not cause any neuroprotection (Fig. 3C). These results show the crucial involvement of P2X7 in the neuroprotective effect of VPA.

4.4. Valproic acid treatment enhances expression of P2X7 receptor

To investigate the mechanism by which VPA improves neuronal survival in NMDA-chal lenged OHSCs, the expression of the P2X7 receptor was examined by immunofluorescent imaging in VPA treated slice cultures. Treatment for 3 days with 500 µM or 1000 µM VPA increased the signal intensity for P2X7 (red) in lbal-labelled microglia (green) in OHSCs (Fig. 4A). Western blot analysis of OHSCs that were treated for 3 days with 500 µM or 1000 µM VPA showed similar findings, as VPA treatment significantly increased P2X7 protein expression (Fig. 4B). Moreover, levels of P2X7 mRNA in OHSCs upon VPA treatment were determined by qPCR. 3 days treatment with 500 µM VPA increased the relative expression level of P2X7 receptor 1. 3-fold (±0.1), while treatment with 1000 µM VPA enhanced the expression 1.9-fold (±0.2) (Fig. 4C). In microglia­depleted OHSCs, expression of P2X7 mRNA was reduced by 83% compared to undepleted OHSCs and VPA treatment did not significantly change P2X7 mRNA expression in OHSC without microglia (Fig. 4C). Moreover, we investigated the potential effect of VPA treatment on microglial P2X7 receptor mRNA in vivo. Herefore, wild type mice were treated with 300 mg VPA per kg body weight, injected intraperitoneally twice a day for 3 days or 8 days. The animals were sacrificed and the microglia cel ls were isolated from the brain to extract the mRNA. qPCR analysis of microglial mRNA revealed the upregulation of P2X7 receptor in VPA treated animals. Treatment for 3 days or for 8 days increased the mRNA level 1.48-fold (±0.05) and 1.47-fold (±0.03), respectively (Fig. 4D).

1 03

II UJ f­a. <( I u

CHAPTER 4

(A)

Untreated lh. 1 1 I '. >'. ,

,. __ , I> - i

500 µM VPA H, • 1 r i'�' X ,

• - • .... -...

1 000 µM VPA

(C)

C 0 .iii

Q)

Q) -�

t t l , : ! 1 • 1x

' .

►-t • • �➔

2.5 ■ Undepleted ■ depleted

2

1 . 5 ..

0 .5

0 CTRL 500 µM 1 000 µM

(B)

CTRL 500 µM 1 000 µM (VPA)

350

Q) 300

250 C:

� 200

"'C 1 50

-� 1 00

50 C:

0 KO 500 µM 1 000 µM VPA

(D)

1 .8

C 1 .6 'iii 1 .4

1 .2

"C

0.8 "C

0.6 .!::! 0.4

0.2 C

0 CTRL 3d 8d VPA

Figure 4: Effect ofVPA treatment on microgl ial P2X7 receptor expression in vitro and in vivo. A) Treatment for 3 days with 500 µM or 1000 µM VPA increased the s ignal intensity for P2X7 immunofluorescence (red) in lbal- label led microg l ia (green) in OHSCs. B) Western blot ana lysis of OHSCs that were treated for 3 days with 500 µM or 1000 µM VPA showed simi l a r fi ndings, as VPA treatment significantly increased P2X7 protein expression compared to CDl lb protein. C) P2X7 mRNA expression levels i n OHSCs were significantly increased upon VPA treatment by 3 days treatment with 500 µM VPA (1.3-fold ±0.l) and lmM VPA (1.9-fold ±0.2). This effect on P2X7 mRNA was absent in microg l ia-depleted OHSCs. D) In vivo treatment of mice with 300 mg VPA per kg body weight per day for 3 and 8 days caused a significant up-regulation of P2X7 mRNA expression in microglia rapidly iso lated from the bra ins of these animals. Data a re shown as mean ± SD from at least 3 independent experiments. *p < 0.005.

104

HDACi and P2X7 expression in microglia

5. DISCUSSION

We have recently provided evidence for a neuroprotective function of ramified microglia in OHSC subjected to NMDA-induced neurotoxicity. Treatment of slice cultures with different concentrations of NMDA induced concentration-dependently neuronal cell death with neurons in the hippocampal CAl region being most susceptible to excitotoxicity and neurons in the dentate gyrus being most protected. Importantly, the depletion of microglia in slice cultures strongly enhanced neuronal cell death in response to NMDA-treatment (van Weering et al., 2011; Vinet et al., 2012). Addition of primary mouse microglia on top of depleted slice cultures induced the re population of the slice with microglia. The cells distributed themselves throughout the depth of the tissue, adopted a ramified morphology and regained their neuroprotective function (Vinet et al., 2012). Thus, without the presence of microglia in the slices neuronal cell loss was significantly enhanced in all regions after NMDA-challenge. Moreover, the differences in neuronal sensitivity towards the NMDA challenge were almost completely abolished, suggesting that the presence of microglia strongly influenced the sensitivity of neurons towards toxic insults. Intriguingly, morphological activation of microglia was not required for these cells to exert their neuroprotective effect, showing for the first time that ramified microglia have neuroprotective functions (see for summary: Vinet et al. , 2012, see also commentary on this work by Howe and Barres, 2012). The mechanism behind this neuroprotective property of microglia, however, remained to be established. An impressive amount of studies has shown beyond any doubt that ATP is a crucial extracellular messenger in and outside of the CNS (Brake and Julius, 1996). Intracellular ATP concentrations can reach up to l OmM whereas the extracellular concentration of ATP is low but can rise dramatically up to micromolar ranges under conditions of intense cellular stimulation, tissue damage and inflammation. These properties have made ATP an evolutionary early signal with multiple functions in physiology and pathology. Nearly all cells are able to release and to respond to ATP, making ATP one of the most abundant signals used by mammalian cells. In the CNS, extracellular ATP functions as a neuromodulator or neurotransmitter on its own (Abbrachio et al., 2009). ATP is stored in synaptic vesicles that are released in an activity dependent manner. In addition, ATP is also released from glial cells (astrocytes, oligodendrocytes and microglia) through a variety of different pathways (Fields and Stevens, 2000).

Besides its role in physiology, a number of pathophysiological functions have been attributed to ATP. Leakage of ATP from damaged cells serves as a chemotactic and activating signal for surrounding immune cells. Since ATP is massively released from injured or dying cells, it is moreover regarded as a so-called damage-associated molecular pattern (DAMP) (di Virgilio, 2005; 2007; di Virgilio et al., 2009). ATP exerts its effects via a large group of purinergic P2 receptors that are subdivided into two families. P2X receptors are classical cationic ligand­operated channels that upon ATP binding are permeable for Na+, K+ and Ca2+. There are currently 7 members of this family (P2Xl-7) known. P2Y receptors are seven-transmembrane receptors that signal via heterotrimeric G-proteins. P2Yl, 2, 4, 6 and 11 couple to G/G

11 and activate the PLC/I P3

pathway, whereas P2Yl2, 13 and 14 are coupled to G i/0 proteins and inhibit adenylate cyclase activity

(Filippov et al., 2004). It is generally assumed that all mammalian cells express at least one P2 receptor, but most cells express several P2 receptors. More than 10 years ago, it was recognised

105

• 0 u l­a <I :r l.

CHAPTER 4

that microglia respond to AT P with chemotaxis or cytokine release. Since then, numerous papers have been published concerning the role of P2 receptors in microglia (Inoue, 2008; Oshawa and Kohsaka, 2011). At least 4 different P2 receptors (P2Y6, P2Yl2, P2X4 and P2X7) are mainly found in microglia (Inoue, 2008; Oshawa and Kohsaka, 2011) and control various important aspects of microglia function. The elongation of processes, the first morphological reaction of microglia to tissue injury, is controlled by P2Yl2 (Haynes et al., 2006), whereas the subsequent migratory response is controlled P2X4 by and/or P2Yl2 (Oshawa and Kohsaka, 2011). For the phagocytosis of neuronal debris microglia utilize P2Y6 another P2 receptor subtype (Koizumi et al., 2007). Apart from these basal functions, microglial P2 receptors have been reported to control the activity of various kinases, cell proliferation and the release of numerous cytokines, chemokine's and neurotrophic factors making extracellular ATP an important signal to control microglia function (Inoue, 2002; Franke et al., 2007, Inoue, 2008; Kettenmann et al., 2011). The fourth P2 receptor mainly found in microglia is P2X7, which is atypical among the P2 receptors because besides the non-specific cation channel P2X7, its activation also opens a non-selective pore that allows the passage of molecules up to 900 kDa (North 2002). These features may allow a massive influx of Ca2+ ions and subsequently cell death, which is why P2X7 has originally been regarded as a "cell death receptor". It has moreover been recognized that P2X7 is essential for the release of various pro-inflammatory cytokines from microglia (Inoue, 2002; Franke et al., 2007). The expression of P2X7 is usually up-regulated in brain diseases, like AD, MS, ALS, peripheral nerve damage, stroke, which is why this receptor has gained interest as a potential therapeutic target. In addition, numerous trophic roles of P2X7 in microglia have been published, indicating that the activity of this receptor is vital for proper functioning of these cells (Mon if et al., 2009; Adinolfi et al., 2010) . Subsequently, protective properties of P2X7, for example in focal cerebral ischemia (Yanagisawa et al., 2008), in pilocarpine-induced seizures (Kim et al., 2011) and in vitro (Suzuki et al., 2004) have been published. The presented data corroborate the idea that P2X7 in microglia is related to the protective function of these cells. This assumption is based on the following findings: i) high concentrations of ATP were neuroprotective in NMDA-induced excitotoxicity, but only when microglia where present in the OHSC. ii) Specific P2X7 agonists or antagonists induced or blocked neuroprotection, respectively and also these effects were dependent on the presence of microglia in the system. iii) Slices from P2X7 deficient animals showed similar neuronal death in response to NMDA as microglia free slices, and ATP (or specific P2X7 agonists) did not have an influence on neuronal survival. iv) Specific staining for P2X7 was only found in microglia and v) up-regulation of P2X7 expression in microglia by VPA treatment enhanced the neuroprotective capacity of these cells. Taken together, these results clearly show that P2X7 is crucial for microglia to exert their neuroprotective role.

These results are in agreement with the report by Suzuki and coworkers, who reported neuroprotection by activation of microglial P2X7 receptors in a neuron-glia coculture system. Stimulation of P2X7 led to production and release of TN Fa, which reduced glutamate-induced neuronal death (Suzuki et al., 2004). Whether or not P2X7-dependent release of cytokines from microglia is also responsible for their neuroprotective effect in O HSCs remains to be established. We found that VPA enhanced expression of the P2X7 receptor. Since VPA is an efficient HDAC inhibitor it would be reasonable to assume that the effect of VPA is mediated by HDAC inhibition. However, another HDAC inhibitor, sodium butyrate did not affect P2X7. Since VPA has also been

106

HDACi and P2X7 expression in microglia

reported to enhance DNA demethylation (Ou et al., 2007) it could well be that demethylation of

the P2rX7 promoter underlies the effect of VPA. Indeed it has been reported that demethylation

of CpG islands of exon 1 of the P2X7 receptor gene is shown to suppress gene expression (Zhou

et al., 2009). Future experiments will have to establish to what extent DNA methylation of the

P2X7 gene is involved in the effect of VPA that was observed in this study.

Another mechanism by which microglia might be implicated in neuroprotection from

excitotoxicity involves the famous chemokine fractalkine (CX3CL1) and its receptor CX3CR1. In

the CNS microglia are the cells expressing the fractalkine receptor while neurons produce and

release the ligand CX3CL1 (Harrison et al., 1998). In a set of studies the group of Cristina Limatola

examined the role of fractal kine in glutamate-induced neurotoxicity. Upon glutamate treatment

the release of fractal kine was detected in primary neuronal cultures. When primary microglia

cultures were treated with fractalkine, the conditioned medium from these cultures protected

primary hippocampal neuronal cultures from glutamate induced excitotoxicity. The implicated

mechanism involves the release of fractalkine from glutamate-treated neurons acting on

microglia via CX3CR1. Fractalkine-stimulated microglia release adenosine acting on neuronal

adenosine Al- receptors. Thereby the open probability of neuronal AMPA-receptor channels

might be reduced and thus the threshold of excitotoxicity to occur is increased (Lauro et a I., 2008;

Lauro et al., 2010; Limatola et al., 2005; Ragozzino et al., 2006). These findings were corroborated

in an animal model for permanent focal cerebral ischemia in which intracerebroventricularly

injected fractalkine reduced the infarct size and ameliorated persistently the performance of

rats in neurological tests. As these effects were abolished in Al receptor knock-out mice, this

study also confirms the involvement of the adenosine receptor (Cipriani et al., 2011). Thus there

are various ways of microglia to exert a neuroprotective function and our data add P2X7 into the

list of beneficial receptors. However, this may only be one aspect of P2X7 biology in the brain.

Indeed, there are some few reports showing that an inhibition of P2X7 signalling ameliorates

brain diseases. It was for example shown in OHSC that LPS and ATP strongly enhance IL-l f3

release from microglia, thereby increasing excitotoxicity (Bernardino et al., 2008). Similarly, in

microglia neuronal co-cultures P2X7 stimulation caused neuronal death (Sakper et al., 2006).

The deficiency or blockade of P2X7 suppressed EAE development in mice, although it was not

clear whether P2X7 in microglia or other cells was responsible here (Matute et al., 2007; Sharp et

al., 2008). In a mouse model of Alzheimer ' s disease, it was recently found that microglial P2X7

expression is accompanied by neuronal damage (Lee et al., 2011). The role of P2X7 in microglia

may therefore not be solely being beneficial and more research is thus required to understand

the function of microglial P2X7 in brain disease.

Taken together we provide here compelling evidence for a neuroprotective function of P2X7

in microglia. Our data add up to the concept that ATP is crucially involved in neuron-microglia

signalling and furthermore offer a potential mechanism how ramified microglia exerts their

beneficial role in NMDA-induced neuronal death. Given the fact that also numerous detrimental

effects of microglia P2X7 in brain disease models have been published, it is suggested here that

P2X7 may be a key element for the double-edged function of microglia in the brain. A deeper

understanding of the control of microglial P2X7 expression and function is therefore required

before conclusions concerning P2X7 as drug target can be drawn.

10 7

• 0 u f-0 < J L

CHAPTER 4

6. REFERENCES

Abbracch io MP, Burnstock G, Verkhratsky A, Zimmermann H. 2009. Purinergic s igna l l ing in the nervous system: an overview. Trends Neurosci 32:19-29.

Adinolfi E, Ciri l lo M, Waltersdorf R, Falzoni S, Chiozzi P, Pel legatti P, Cal legari MG, Sandona D, Markwa rdt F, Schmalzing G, Di Virgi l io F. 2010. Trophic activity of a natura l ly occu rring truncated isoform of the P2X7 receptor. FASEB J 24:3393-3404.

Bird A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev 1 6:6-21 .

Bernardino L, Ba losso S, Ravizza T, Marchi N, Ku G, Randle JC, Malva JO, Vezzan i A. 2008. I nfla mmatory events in h ippocampal s l ice cultu res prime neuronal susceptibi l ity to excitotoxic injury: a crucial role of P2X7 receptor-mediated I L-1 beta release. J Neurochem 1 06:271-280.

Brake AJ , Jul ius D. 1996. S igna l ing by extracel lu lar nucleotides. Annu Rev Cell Dev Biol 12:519-541 .

Biber K, Neumann H, I noue K, Boddeke HW. 2007. Neuronal 'On' and 'Off' s igna ls control microgl ia . Trends Neurosci 30:596-602.

Bogda novic 0, Veenstra GJ. 2009. DNA methylation and methyl -CpG binding proteins: developmental requirements and fu nction. Chromosoma 118:549-565.

Benn SC , Woolf CJ. 2004. Adult neuron survival strategies--slamming on the brakes. Nat Rev Neurosci 5:686-700.

Chestnut BA, Chang Q, Price A, Lesuisse C, Wong M, Martin LJ. 2011 . Epigenetic regu lation of motor neuron cell death through DNA methylation. J Neurosci 31 :1 6619-16636.

Castro LM, Gal lant M, N i les LP. 2005. Novel targets for va lproic acid : up-regulation of melatonin receptors and neurotrophic factors in C6 g l ioma cel ls . J Neurochem 95:1227-1236.

Chomczynski P, Sacchi N. 1987. S ingle-step method of RNA isolation by acid guanid in ium thiocyanate­phenol -chloroform extraction. Anal Biochem 162:156-159.

Cu rradi M, Izzo A, Badaracco G, Landsberger N. 2002. Molecular mechanisms of gene s i lencing mediated by DNA methylation . Mol Cel l Biol 22:3157-3173.

Cipriani R, Villa P, Chece G, Lauro C, Pa lad in i A, Micotti E, Perego C, De S imoni MG, Fredholm BB, Eusebi F, Limatola C. 2011 . CX3CL 1 is neuroprotective in permanent focal cerebral ischemia in rodents. J Neurosci 31:16327-16335.

Dulac C. 2010. Brain function a nd chromati n p lasticity. Nature 465:728-735.

de Haas AH, Boddeke HW, Biber K. 2008. Region-specific expression of i m munoregulatory proteins on microglia in the hea lthy CNS. Gl ia 56:888-894.

de H aas AH, Boddeke HW, Brouwer N, Biber K. 2007. Optimized isolation enables ex vivo a na lysis of m icrog l ia from various centra l nervous system regions. G l ia 55:1374-1384.

Detich N, Bovenzi V, Szyf M. 2003. Va lproate induces repl ication-independent active DNA demethylation. J B io l Chem 278:27586-27592.

Dong E, Chen Y, Gavin DP, Grayson DR, Guidotti A. 201 0. Valproate i nduces D NA demethylation in nuclear extracts from adult mouse bra in . Epigenetics 5:730-735.

Di Virgi l io F. 2007. Pu rinergic s ignal l ing in the immune system. A brief update. Purinergic Signal 3:1-3.

Di Virgi l io F. 2005. Purinergic mecha nism in the immune system: A sig na l of danger for dendritic cel ls . Purinergic Signal 1 :205-209.

Di Virgi l io F, Boeynaems JM, Robson SC. 2009. Extrace l lu lar nucleotides as negative modulators of immun ity. Curr Opin Pharmacol 9:507-513.

Frank MG, Baratta MV, Sprunger DB, Watkins LR, Maier SF. 2007. Microglia serve as a neuroimmune substrate for stress-induced potentiation of CNS pro-inflammatory cytokine responses. Brain Behav Im mun 21:47-59.

Hai ler NP, Jarhu lt JD, Nitsch R. 1996. Rest ing microg lial cel ls in vitro: ana lysis of morphology and ad hesion molecule expression in organotypic h ippocampal s l ice cultures. Gl ia 18 :319-331 .

Ha rry GJ , Kraft AD. 2008. Neuroinfla mmation and microg lia: considerations and approaches for neurotoxicity assessment. Expert Opin Drug Metab Toxicol 4:1265-1277.

F i l ippov AK, Fernandez- Fernandez JM, Marsh SJ, S imon J, Barnard EA, Brown DA. 2004. Activation a nd i nh ibition of neuronal G protein-gated inwa rdly rectifying K(+) channels by P2Y nucleotide receptors. Mal Pharmacol 66:468-477.

Fukumoto T, Morinobu S, Okamoto Y, Kagaya A, Yamawaki S. 2001 . Chronic l ithium treatment increases the expression of bra in-derived neurotrophic factor in the rat brain. Psychopharmacology (Berl) 158:1 00-106.

108

H DACi a nd P2X7 expression in m icrog l i a

Fields RD, Stevens B. 2000. ATP: an extracel lu lar s ignal ing molecu le between neurons and g l ia . Trends Neurosci 23:625-633.

Haynes SE, Hol lopeter G, Yang G, Kurpius D, Dai ley ME, Gan WB, Jul ius D. 2006. The P2Yl2 receptor regu lates m icrogl ia l activation by extracel lu lar nucleotides. Nat Neurosci 9:1512-1519.

Howe ML, Barres BA. 2012. A novel role for m icrogl ia in min imizing excitotoxicity. BMC Biol 10:7-7007-10-7.

Inoue K . 2008. Purinergic systems in microg l ia . Cel l Mol Life Sci 65:3074-3080.

Inoue K. 2002. Microg l ia l activation by purines and pyrimid ines. G l ia 40:156-163.

Kettenmann H, Han isch UK, Noda M, Verkhratsky A. 2011 . Physiology of microg l ia . Physiol Rev 91:461-553.

Khakh BS , Burnstock G. 2009. The double life of ATP. Sci Am 301:84-90, 92 .

Kim JE, Kang TC. 2011 . The P2X7 receptor-pannexin-1 complex decreases muscarinic acetylcholine receptor­mediated seizure susceptibi l ity in mice. J Cl in I nvest 121 :2037-2047.

Koizum i S, Shigemoto-Mogami Y, Nasu-Tada K, Shinozaki Y, Ohsawa K, Tsuda M, Joshi BV, Jacobson KA, Kohsaka S, Inoue K. 2007. UDP acting at P2Y6 receptors is a mediator of microgl ia l phagocytosis . Nature 446:1091-1095.

Kreutz S, Koch M, Bottger C, Ghadban C, Korf HW, Dehghani F. 2009. 2-Arachidonoylglycerol el icits neuroprotective effects on excitotoxical ly lesioned dentate gyrus granule cel l s via abnormal­cannabidiol -sensitive receptors on m icrogl ia l cel ls . G l ia 57:286-294.

Ladd-Acosta C, Pevsner J, Sabunciyan S, Yolken RH, Webster MJ, Dinkins T, Ca l l inan PA, Fan JB, Potash JB, Feinberg AP. 2007. DNA methylation signatures within the human bra in . Am J Hum Genet 81:1304-1315.

Lauro C, Di Angelantonio S, Ciprian i R, Sobrero F, Antoni l l i L, Brusadin V, Ragozzino D, Limatola C. 2008. Activity of adenosine receptors type 1 I s required for CX3CL1-mediated neuroprotection and neuromodulation in h ippocampal neurons. J lmmunol 180:7590-7596.

Lee HG, Won SM, Gwag BJ, Lee YB. 2011. Microglial P2X(7) receptor expression is accompanied by neuronal damage in the cerebral cortex of the APPswe/PSldE9 mouse model of Alzheimer's disease. Exp Mol Med 43:7-14.

Limatola C, Lauro C, Cata lano M, Ciotti MT, Bertol l in i C, Di Angelantonio S, Ragozzino D, Eusebi F. 2005. Chemokine CX3CL1 protects rat h ippocampal neurons against g lutamate-mediated excitotoxicity. J Neuroimmunol 166:19-28.

Matute C, Torre I , Perez-Cerda F, Perez-Samartin A, Alberd i E, Etxebarria E, Arranz AM, Ravid R, Rodriguez­Antiguedad A, Sanchez-Gomez M, Domercq M. 2007. P2X(7) receptor blockade prevents ATP excitotoxicity in ol igodendrocytes and amel iorates experimental autoimmune encephalomyelitis. J Neurosci 27:9525-9533.

Monif M, Reid CA, Powel l KL, Smart ML, Wi l l iams DA. 2009. The P2X7 receptor d rives m icrog l ia l activation and proliferation: a trophic role for P2X7R pore. J Neurosci 29:3781-3791.

Nimmerjahn A, Kirchhoff F, H el mchen F. 2005. Resting microgl ia l cel l s are h igh ly dynamic survei l lants of bra in parenchyma in vivo. Science 308:1314-1318.

North RA. 2002. Molecu lar physiology of P2X receptors. Physiol Rev 82:1013-1067.

Ou JN, Torrisani J, Unterberger A, Provencal N, Shik imi K, Karimi M, Ekstrom TJ, Szyf M. 2007. H istone deacetylase inhibitor Trichostatin A induces global and gene-specific DNA demethylation in human cancer ce l l l ines. Biochem Pharmacol 73:1297-1307.

Ohsawa K, Kohsaka S. 2011 . Dynamic motil ity of microgl ia : purinergic modulation of microgl ia l movement in the normal and pathological bra in . G l ia 59:1793-1799.

Paolice l l i RC, Balasco G, Pagani F, Maggi L, Sciann i M, Panzanel l i P, Giustetto M, Ferreira TA, Guiducci E, Dumas L, Ragozzino D, Gross CT. 2011 . Synaptic pruni ng by m icrogl ia is necessary for norma l bra in development. Science 333:1456-1458.

Pocock JM, Kettenmann H. 2007. Neurotransmitter receptors on microg l ia . Trends Neurosci 30:527-535.

Ragozzino D, Di Angelantonio S, Trettel F, Bertol l in i C, Maggi L, Gross C, Charo I F, Limatola C, Eusebi F. 2006. Chemokine fracta l kine/CX3CL1 negatively modulates active glutamatergic synapses in rat h ippocampal neurons. J Neurosci 26:10488-10498.

Ransohoff RM, Perry VH. 2009. Microgl ia l physiology: unique stimuli , specia l ized responses. Annu Rev lmmunol 27:119-145.

Sinn DI, Kim SJ, Chu K, Jung KH, Lee ST, Song EC, Kim JM, Park DK, Kun Lee S, Kim M, Roh JK. 2007. Va lproic acid-med iated neuroprotection in intracerebra l hemorrhage via h istone deacetylase inh ibition and transcriptional activation. Neurobiol D is 26:464-472.

109

• C LJ f­c < J l

CHAPTE R 4

Sharp AJ, Polak PE, Simonini V, Lin SX, Richardson JC, Bongarzone ER, Feinstein DL. 2008. P2x7 deficiency suppresses development of experimental autoimmune encephalomyelitis. J Neuroinflammation 5:33-2094-5-33.

Sierra A, Encinas JM, Deudero JJ, Chancey J H, Enikolopov G, Overstreet-Wadiche LS, Tsirka SE, Maletic­Savatic M. 2010. Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell 7 :483-495.

Skaper SD, Facci L, Culbert AA, Evans NA, Chessell I, Davis JB, Richardson JC. 2006. P2X(7) receptors on microglial cells mediate injury to cortical neurons in vitro. Glia 54:234-242.

Solle M, Labasi J, Perregaux DG, Stam E, Petrushova N, Koller BH, Griffiths RJ, Gabel CA . 2001. Altered cytokine production in mice lacking P2X(7) receptors. J Biol Chem 276:125-132.

Sperlagh B, Illes P. 2007. Purinergic modulation of microglial cell activation. Purinergic Signal 3:1 1 7-127.

Streit WJ. 2002. Microglia as neuroprotective, immunocompetent cells of the CNS. Glia 40:133-139.

Suzuki T, Hide I, Ida K, Kohsaka S, Inoue K, Nakata Y. 2004a. Production and release of neuroprotective tumor necrosis factor by P2X7 receptor-activated microglia. J Neurosci 24:1-7.

Suzuki T, Hide I, ldo K, Kohsaka S, Inoue K, Nakata Y. 2004b. Production and release of neuroprotective tumor necrosis factor by P2X7 receptor-activated microglia. J Neurosci 24:1 -7.

Tremblay ME, Lowery RL, Majewska AK. 2010. Microglial interactions with synapses are modulated by visual experience. PLoS Biol 8:e1000527.

Tremblay ME, Stevens B, Sierra A, Wake H, Bessis A, Nimmerjahn A. 2011 . The role of microglia in the healthy brain. J Neurosci 31 : 16064-16069.

Tremblay ME, Zettel ML, Ison JR, Allen PD, Majewska AK. 2012. Effects of aging and sensory loss on glial cells in mouse visual and auditory cortices. Glia 60:541-558.

Tsuda M, Ueno H, Kataoka A, Tozaki-Saitoh H, Inoue K. 2008. Activation of dorsal horn microglia contributes to diabetes-induced tactile allodynia via extracellular signal-regulated protein kinase signaling. Glia 56:378-386.

Van Rooijen N, Sanders A . 1994. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J lmmunol Methods 1 74:83-93.

van Weering H R, Boddeke HW, Vinet J, Brouwer N, de Haas AH, van Rooijen N, Thomsen AR, Biber KP. 201 1 . CXCL10/CXCR3 signaling in glia cells differentially affects NMDA-induced cell death in CA and DG neurons of the mouse hippocampus. Hippocampus 21 :220-232.

Vinet J, Weering H R, Heinrich A, Kalin RE, Wegner A, Brouwer N, Heppner FL, Rooijen N, Boddeke HW, Biber K. 2012. Neuroprotective function for ramified microglia in hippocampal excitotoxicity. J Neuroinflammation 9:27 -2094-9-27.

Volante C, Apolloni S, Ska per SD, Burnstock G. 2012. P2X7 receptors: channels, pores and more. CNS Neural Disord Drug Targets 1 1 : 705-721 .

Wake H, Moorhouse AJ, Jinno S, Kohsaka S, Na bekura J. 2009. Resting microglia directly monitor the functional state of synapses in vivo and determine the fate of ischemic terminals. J Neurosci 29:3974-3980.

Yanagisawa D, Kitamura Y, Takata K, Hide I, Nakata Y, Taniguchi T. 2008. Possible involvement of P2X7 receptor activation in microglial neuroprotection against focal cerebral ischemia in rats. Biol Pharm Bull 31: 1 121 -1130.

Zhu WG, Otterson GA . 2003. The interaction of hi stone deacetylase inhibitors and DNA methyltransferase inhibitors in the treatment of human cancer cells. Curr Med Chem Anticancer Agents 3:18 7 -199.

Zhou L, Luo L, Qi X, Li X, Gorodeski G I . 2009. Regulation of P2X(7) gene transcription. Purinergic Signal 5:409-426.

1 1 0

C HAPTE R S

Inhibition of CXCR3-mediated

chemotaxis by the human chemokine

receptor-like protein CCX-CKR

J Vinet1A*, M van Zwam1• 5·, I M Dijkstra1, N Brouwer1,

H R J van Weering1, A Watts2, M Meijer1, M R Fokkens1,

V Kannan 1, D Verzijl2, H F Vischer2, M J Smit2, R Leurs2,

K Biber3 and H W G M Boddeke1

1 Department of Neuroscience, Section Medica l Physiology, Un iversity Medical Center Groningen, University of Groningen, The Netherlands 2 Leiden/Amsterdam Center for Drug Research, Division of Medicina l

Chemistry, Facu lty of Science, Vrije Universiteit, Amsterdam, The Netherlands

3 Department of Psych iatry and Psychotherapy, Section of Molecular Psychiatry, University of Freiburg, Freiburg, Germany

4 Department of Neurosciences, metabol ic and biomedica l sciences, University of Modena and Reggio Emi l ia, Modena, Italy

5 Department of Laboratory Medicine, Laboratory of C l in ica l Chemistry, Radboud Un iversity N ijmegen Medica l Centre,

N ijmegen, The Netherlands

*: both authors contributed equa l ly to the present study

Corresponding a uthor: H.W.G.M. Boddeke: Department of Neuroscience, Section Medica l

Physiology, University Medica l Center Groningen, Antoni us Deusinglaan 1, room 3215-825, 9713AV Groningen, The Nether lands. Tel:

+31 50 3632701; Fax: +31 50 3632751; emai l : h.w.q.m.boddeke@umcg.l

Publ ished in Br J Pharmacol 2013;168(6) :1375-87

CHAPTER 5

1. BACKG ROUND AND PURPOSE

2. INT RODUCT ION

3. METHODS 3.1. Chemicals 3.2. Cel l Cultures 3.3. T cell isolation and activation 3.4. Plasmids 3.5. Generation of stable HEK293 cell lines 3.6. Cell transfection 3.7. Flow cytometry 3.8. Chemotaxis assay 3.9. Reverse Transcription and Quantitative Real-time

Polymerase Chain Reaction (QPCR) 3.10. lmmunocytochemistry 3.11. Ligand binding experiments 3.12. CXCR3 ELISA measurements 3.13. FRET experiments

4. RESULTS 4.1. CCX-CKR co-expression inhibits chemotactic signaling

of various chemokine receptors 4.2. Expression of hCCX-CKR does not affect expression of CXCR3 4.3. Effect of CCX-CKR on CXCR3-mediated chemotaxis 4.4. hCCX-CKR heteromerizes with hCXCR3 but not with hCCR5 4.5. Presence of hCCX-CKR affects binding properties of hCXCR3 4.6. CXCR3 and CCX-CKR expression in human T-cells 4.7. Effect of hCCX-CKR expression on CXCR3 mediated migration in human T cells

5. D ISCUSSION

6. CONCLUSION

7. REFERENCES

114

CCX-CKR inhibits CXCR3-mediated chemotaxis

1. Background and purpose: Induction of cellular migration is the primary effect of chemokine receptor activation. However, several chemokine receptor-like proteins bind chemokines without subsequent induction of intracellular signaling and chemotaxis. It has been suggested that they act as chemokine scavengers that may control local chemokine levels and contribute to the function of chemokine's during inflammation. This has been verified for the chemokine­like receptor proteins D6 and DARC as well as CCX-CKR. Here, we provide evidence for an additional biological function of hCCX-CKR.

Experimental approach: We used transfection strategies in HEK293 and human T cells.

Key results: Co-expression of hCCX-CKR completely inhibits hCXCR3-induced chemotaxis. We found that hCCX-CKR forms complexes with hCXCR3, suggesting a relationship between CCX-CKR heteromerization and inhibition of chemotaxis. Moreover, negative binding cooperativity induced by ligands both for hCXCR3 and hCCX-CKR was observed in cells expressing both receptors. This negative cooperativity may also explain the hCCX-CKR-induced inhibition of chemotaxis.

Conclusions and Implications: These findings suggest that hCCX-CKR prevents hCXCR3-induced chemotaxis by heteromerization thus representing a novel mechanism of regulation of immune cell m igration.

Keywords: chemokine receptors, T cells, heteromerization

115

• 0 u l­o <l :::r L

CHAPTER S

2. I NTRODUCTIO N

C hemokine's, small proteins that regulate cell migration, play important roles in the immune system, angiogenesis, hematopoiesis, cell differentiation and development (Horuk, 2001;

Rossi and Zlotnik, 2000). Chemokine's and their receptors have been classified into four different subgroups based on the presence and position of conserved cysteine residues i.e.: CXC, CC, C and CX3C (Murphy et al., 2000). Chemokine receptors are G-protein coupled receptors (GPCRs) that signal via Gi proteins to various signaling pathways (Sanchez-Madrid and del Pozo, 1999; Thelen, 2001). In addition, atypical chemokine receptors represent a subfamily of chemokine binding proteins that do not signal along classic GPCR-mediated pathways but efficiently internalize their cognate ligands and act as chemokine scavengers (Hansell et al., 2006). In addition to DARC and D6, CCX-CKR belongs to this family of proteins and scavenges its ligands CCL21, CCL19, CCL25 and CXCL13 (Comerford et al., 2006; Gosling et al., 2000; Townson and Nibbs, 2002). CCX-CKR is widely expressed in several tissues, including the brain and is expressed in many immune cells such as microglia, dendritic cells and T cells together with other chemokine receptors (Brouwer et al., 2004; Gosling et al., 2000; Murphy, 2002; Townson and Nibbs, 2002; Zuurman et al., 2003). It is well known that chemokine receptors like other GPCRs can, when co-expressed, form heteromers that exhibit altered intracellular signaling properties (Rios et al., 2001; Rodriguez­Frade et al., 1999; Springael et al, 2005; Springael et al, 2006). Since CCX-CKR is found co­expressed with other chemokine receptors, we investigated whether co-expression of CCX-CKR might change the signaling of other chemokine receptors in addition to its function as scavenger.

3. METHODS

3.1. Chemicals

Media, sera, and reagents used for cell culture were purchased from PAA Laboratories. All other chemicals were from Sigma-Aldrich, unless mentioned otherwise.

3.2. Cel l Cultu res

Human Embryonic Kidney (HEK)293 cells and HEK293T (gift from Dr. S. Carra, Dept. cell biology, UMCG, Groningen, Netherlands) were cultured in growth medium (Dulbecco's Modified Eagle's Medium (DMEM), supplemented with 10% heat-inactivated fetal calf serum (FCS), 1% Pen/Strep (lnvitrogen) and 1% Sodium Pyruvate) and kept in a humidified atmosphere (5% CO2) at 37°C.

3.3. T cel l isolation and activation

Peripheral blood mononuclear cells were isolated from heparinized blood taken from healthy donors using a Ficoll (GE Healthcare) gradient centrifugation for 15 min at 1000g without brake. T cells were isolated by co-incubating the mononuclear cells with 2-(2-aminoethyl) isothiourea dihydrobromide (AET)-treated sheep red blood cells (Boom) for l 5 min on ice. Erythrocyte rosettes were separated from the mononuclear cells by Ficoll gradient centrifugation for 15 min at 1000g without brake. Subsequently, the sheep red blood cells were lysed using Gey's lysis buffer (7.0 g/I NH4CI, 0.37 g/l KCI, 0.3g/l Na2HPO4.12H2O, 0.024g/l KHlO4, l .0 g/I glucose, 10.0 mg/I phenol red, 8.4 mg/I MgCl2.6Hp, 7.0 mg/I MgSO JHp, 6.8 mg/I CaCl2 and 45 mg/I NaHCO3), yielding a population of 92.5 ± 4.6% CD3· T cells. Freshly isolated T cells were used directly for further experiments or

116

CCX-CKR inhibits CXCR3-mediated chemotaxis

resuspended in growth medium (RPMI 1640 (lnvitrogen), supplemented with 5% FCS (lnvitrogen), 100 U/ml penicillin, 100 µg/ml streptomycin) and kept in a humidified atmosphere (5% CO

2) at 37°C.

T cells were activated by stimulating them with 2µg/ml phytohemagglutinin (PHA; Biotrading) for 24h and with 25 /ml IL-2 (Peprotech) for another 3-5 days.

3.4. Plasmids

The following constructs were used for generating stable cell lines: pcDNA3.l plasmid containing the full length sequence of human CXCR3 (hCXCR3; kind gift of C. Tensen and B. Moser (Hensbergen et al., 2001); pcDNA3.l containing full length human CCX-CKR (hCCXCKR; kindly provided by R. Nibbs (Townson and Nibbs, 2002); pREP9 containing full length CX3CR1 (kindly provided by P.M. Murphy (Combadiere et al., 1995). The following constructs were used for FRET experiments: hCXCR3, hCCX-CKR, GABAB-Rl and hCCR5 coupled both to Venus or CFP. pcDNA3.l ( + )-GABAB-Rl (kindly provided by B. van Lith (Molecular Pharmacology & DMPK, Schering-Plough Research Institute, Oss, The Netherlands) was used as negative control. hCCR5 (Missouri S&T cDNA Resource Center (www.cdna.org) served also as negative control. All four constructs were subcloned using primers described in Table 1. hCXCR3 and hCCX-CKR were inserted into pECFP-Nl and pVenus-Nl vector using EcoRI and Smal as restriction enzymes. hCCR5 was inserted using Hindl l l and Smal while h GABAB-Rl was inserted using EcoRI and Sal l . h GABAB-Rl subcloning was done in presence of 10% glycerol. The pVenus-Nl vector was generated using the pECFP-Nl (Clonetech) as backbone. ECFP was cut out of the pECFP-Nl plasmid using Agel and Nat l . Venus was cut out of the pcDNA3.l CFP-EPAC-Venus construct using Xhol. Venus was subcloned and inserted into the pECFP-Nl (after deletion of ECFP) using Agel and Natl . The following constructs were used for transient transfection followed by chemotaxis assays to verify whether hCCX-CKR is affecting other chemokine receptors: hCCR2, hCCR4, hCCRS, hCCR6, hCCR7, hCCR9, hCCRlO and hCXCR4. These constructs have been purchased from: Missouri S&T cDNA Resource Center (www.cdna.org) .

Tablel: Primers used for cloning for FRET constructs

Gene of i nterest Forward primer

CXCR3 AAAGAATTCTAATGGTCCTTGAGGTGAGTGACC CCXCKR AAAGAATTCTAATGGCTTTGGAACAGAACCAGTC GABAB-Rl AAAGAATTCTGATGTTGCTGCTGCTGTTACTGGCG CCRS AAAAAAGCTTATGGATTATCAAGTGTCAAGTCCAAT

Reverse primer

AAACCCGGGCCAAGCCCGAGTAGGAGGCCTC AAACCCGGGCAATGCTAAAAGTACTGGTTGGCTCT AAAAGTCGACTGCTTATAAAGCAAATGCACTCGACTCC AAACCCGGGCCAAGCCCACAGATATTTCCTGCTC

Venus AAAACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCT AAAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCGA

3.5. Generation of stable HEK293 cel l l ines

Cells were transfected with either hCXCR3, hCCX-CKR or both constructs using FugeneR (Roche Molecular Biochemicals) according to the manufacturer's instructions. Stable polyclonal transfected cells were selected using 500 µg/ml G-418 (Omnilabo) for approximately 2 weeks. Hereafter, monoclonal cell lines were generated and maintained for maximum 15 passages.

1 1 7

IE Q u.

<I I l.

CHAPTER S

3.6. Cell transfection

HEK293 and HEK293T cells were transfected using calcium/phosphate method. Briefly, cells were

kept in DMEM without additives and where left with DNA-precipitates for Sh. After transfection,

cells were rinsed with DMEM and put back in growth medium. Mock transfections were done

using empty plasmids. For radioligand binding experiments, HEK293T cells were transiently

transfected with 1 µg receptor-encoding plasmid DNA using 25-kDa linear polyethyleneimine

(Polysciences, Eppelheim, Germany) as described previously (Verzijl et al., 2008). The total

amount of transfected DNA was adjusted to 5 µg with the empty vector pcDEF3. hCCX-CKR

was silenced in freshly isolated T cells using pLKO.1 -puro vectors containing DNA encoding

for CCX-CKR short hairpin silencing RNA (shRNA) (MISSION® shRNA NM_l6557; Sigma­

Aldrich). Five vectors for hCCX-CKR silencing were used for each different T cell donor. Plasmid

containing GFP-encoding DNA (pmaxGFP; Lonza) was used as positive control for transfection

and the pLKO.1-puro vector containing DNA encoding for non-targeting shRNA (MISSION®

shRNA SHC002; Sigma-Aldrich) was used as negative control. T cells were transfected using

the Amaxa nucleofector kit for human T cells (Lonza) according to manufacturer's instructions.

Briefly, 2x106 to Sx106 T cells were resuspended in specific nucleofector solution and mixed with

2�Lg vector DNA. Subsequently, the cells were nucleofected using the T cell-specific program

V-24 and transferred into growth medium. hCCX-CKR was overexpressed in PHA/IL-2-treated

T cells using the same method. T cells were resuspended in specific nucleofactor solution,

mixed with Sµg of hCCX-CKR plasmid DNA or pmaxGFP, and nucleofected by using the T cel l

specific program T-20. Transfection efficiency and hCCX-CKR expression were assessed by flow

cytometry 24h (overexpression) or 48h (silencing) post-nucleofection.

3.7. Flow cytometry

Expression of surface molecules by human Tcells wasdetermined using flowcytometry. Cells were

incubated with predetermined optimal dilutions of primary antibody diluted in PBS containing

0.5% BSA and 0.01% sodium azide for lOmin at RT. Primary antibodies were phycoerythrine

(PE)-conjugated anti-CXCR3 (clone 49801; R&D systems), fluorescein isothiocyanate (FITC)­

conjugated anti-CD3 (clone UCHTl; eBioscience), PE-CyS-conjugated anti-CD4 (clone RPA-T4;

eBioscience), allophycocyanin (APC)-conjugated anti-CDS (clone RPA-T8; eBioscience),

APC-conjugated anti-CD44 (clone IM-7; eBioscience), PE-CyS-conjugated anti-CD62L (clone

DREG-56; eBioscience) and polyclonal goat-anti-CCX-CKR (CCRll; Capralogics). hCCX-CKR was

detected using PE-conjugated anti-goat lgG (Jackson Laboratories) as a secondary antibody.

lsotype-matched primary antibodies of irrelevant specificity served as negative controls .

20.000-30.000 events were measured using a FACSCalibur flow cytometer (BD Biosciences)

and analyzed by WinMDI software.

3.8. Chemotaxis assay

Cell migration in response to chemokine's was assessed using a 48-well chemotaxis

microchamber (NeuroProbe). lOµM chemokine stock solutions (containing recombinant human

CCL4, CCL13, CCL17, CCL20, CCL21, CCL25, CCL27, CXCL 9, CXCLl0 or CXCL12; R&D) (Table 2) were

prepared in sterile PBS and further diluted in serum-free DMEM for use in the assay. Serum-free

1 18

CCX-CKR inhibits CXCR3-mediated chemotaxis

DMEM without chemokine's served as control. 27µ1 of the chemoattractant solution or control medium was applied to the lower well of the chamber. Upper and lower chamber were separated by a polyvinylpyrrolidone-free polycarbonate filter (5µm pore size for T cells and 8µm pore size for HEK293/HEK293T cells). In the upper wells of the chamber, 50 µI cell suspension containing 5xl04 cells was applied. The chamber was incubated in a humidified atmosphere (5% CO) at 37°C for 2 h. Determinations were done in hexaplicate for each group. After incubation the filter was washed, fixed in methanol and stained with toluidine blue. Migrated cells per group were counted by a double-blinded person with a scored eyepiece (3 fields (lmm2) per well).

3.9. Reverse Transcription and Quantitative Real-time Polymerase Chain Reaction (QPCR)

T-cells were lysed in guanidinium isothiocyanate/mercaptoethanol buffer and total RNA was extracted according to Chomczynski and Sacchi (1987) with slight modifications. One µg of total RNA was transcribed into cDNA as described (Biber et al., 1997). Primers used for RT-PCR are described in Table 1. Real-time PCR, using an iCyclerR (Bio-rad) and iQ SYBR Green supermixR (Bio-rad), was performed on 4ng cDNA from T-cells. Primers (See Table 1) for Q-PCR, yielding PCR products of approximately 100 base pairs long, were designed by "Primer Designer" (Scientific and Educational Software, Version 3.0). PCR reactions with primers for hCCX-CKR and hCXCR3 were run in parallel with primers for the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hypoxanthine guanine phosphoribosyl transferase (HPRTI). All primers were purchased from Genset. Melt-curve analysis was performed immediately following amplification in order to check primer specificity. For analysis, the comparative Ct method was used. In each experiment samples were run in duplicate. Results are the averaged data of three independent experiments and are given as mean ± S.E.M.

3.10. lmmunocytochemistry

HEK293 cells were plated on poly-L-lysine (PLL) coated glass coverslips and fixed in 4% paraformaldehyde (PFA) solution. Cells were pre-incubated in PBS containing 10% FCS and 0,3% Triton-Xl00 for 30 min at room temperature. Incubation with primary antibodies against hCXCR3 (R&D, 1:100) and hCCX-CKR (Capralogics, 1:400) was performed O/N at 4°C. The next day, cells were incubated with secondary antibodies conjugated with fluorescent labels (Jackson lmmuno Research) for 2h at room temperatu re. Cells were washed, stained with Hoechst nuclear dye and finally mounted in Vectashield Mounting Media (Vector). Stained cells were analyzed with a Zeiss Axioskop 2 microscope and confocal fluorescence microscopy (see FRET section).

3.11 . Ligand binding experiments

The CXCR3 antagonist VUF10085 was first described in literature as AMG 487 (Johnson et al., 2007) and resynthesized in our department. [125 I)-CXCLl0 and Na125 I were purchased from PerkinElmer Life and Analytical Sciences (Boston, MA). CCL19 was purchased from Peprotech (Rocky Hill, NJ) and labeled with Na125 I using iodogen pre-coated tubes (Thermo Fischer Scientific, Waltham, MA) according to the manufacturer's instructions. 24 hours post-transfection, HEK293T cells were transferred to poly-L-lysine (Sigma-Aldrich, St. Louis, MO) coated 48 well plates. The next day, cells were incubated for four hours at 4°C with 0.5-1 nM [125I ]-CCL19 or 50-100 pM [125I)-CXCLl0 in binding buffer (50mM HEPES, lO0mM NaCl, lmM CaCl2, 5mM MgCl2, pH 7.4, 0.5% BSA) containing

119

• 0 u l­o <l J L

CHAPTER S

unlabeled displacer. After incubation, cells were washed three times with ice-cold wash buffer (50 mM HEPES, 0.5 M NaCl, 1 mM caq, 5 mM MgCl2, pH 7.4) and subsequently lysed. Cell lysates were counted in a Wallac Compugamma counter (PerkinElmer, Boston, MA). For ligand binding co­operativity assays, percentages of CXCR3-specific [125 I ]-CXCLl0, [125I ] -CXCLll and CCX-CKR-specific [125 I ]-CCL19 binding were calculated by normalizing data to binding in the absence of unlabeled displacer (100%) and binding in the presence of 10 µM VUF10085, 100 nM CXCLl l and 100 nM CCL19, respectively (0%). For homologous radioligand displacement curves, CXCR3-specific [125 I ] ­CXCLl0, [125 I ]-CXCLl l and CCX-CKR-specific [125 I ]-CCL19 binding were calculated by normalizing data to radioligand binding in the absence of unlabeled displacer (100%) and in the presence of 10 µM VUF10085, 100 nM CXCLl l and 100 nM CCL19, respectively (0%), in cells expressing only CXCR3 ([125 I ] -CXCLl0 and [125 I ] -CXCLl l ) or only CCX-CKR ( [125 I ] -CCL19).

3.12. CXCR3 ELISA measurements

Cells were plated in 48 well plates, fixed 30min with 4% PFA in PBS 48h after plating and washed two times with T BS. For the permeabilized samples, cells were incubated 30min with 0.5% NP- 40 (Roche) in TBS after fixation. Samples were blocked for 4h at RT with 1% fat free milk in 0.lM NaHCO3 pH 8.6. Primary antibody (R&D MAB160) was diluted 1:1000 in 0.1% BSA in T BS and incubated O/N at 4°C and washed three times with T BS. Secondary antibody (Bio-Rad 170-6516 goat anti-mouse/HRP) was diluted 1:2500 in 1% fat free milk in 0.lM NaHCO pH 8.6 and incubated 3 h at RT. OPD substrate solution (2.2mM Ophenylenediamine (Sigma P-1526), 35mM citric acid, 66mM Na2HPO4, 0.015% Hp2, pH 5.6) was added. The reaction was stopped by addition of l M H2SO4 and the absorbance at 490nm was measured with a Wallac Victor plate reader.

3.13. FRET experiments

HEK 293T cells were transfected with plasmids encoding Venus- or CFP-tagged versions of hCXCR3, hCCX-CKR or both. For control experiments Venus-tagged versions of hGABAB-Rl and hCCRS were used. Imaging of the expression of the various fusion proteins was performed on a Leica AOBS_ TCS SP2 confocal laser scanning microscope using an 63x NA 1.4 oil -immersion objective (Leica Microsystems) and the 458nm line of an AR/Kr laser. The microscope was set-up and corrections were applied according to Van Rheenen et al. (2004). FRET efficiency was determined using the method by Jalink and Van Rheenen (2009). Shortly, images were corrected by subtracting the background and correcting for bleedtrough by using CFP- and Venus-transfected cells followed by correction of intensity. Values were measured by scaling all samples to the same level of the hCXCR3-CFP/hCXCR3-Venus homomer followed by measuring the intensity at different ROl's at the membrane.

4. RESULTS

4.1. CCX-CKR co-expression inhibits chemotactic signaling of various chemokine receptors

In order to investigate if co-expression of hCCX-CKR influences the signa'ling of other chemokine receptors that don't share ligands with CCX-CKR, chemotaxis experiments were performed. We observed that the migration of HEK293 cells transfected with the chemokine receptors hCCR6, hCCRlO, hCXCR3 or hCXCR4 was significantly reduced when hCCX-CKR was co-expressed (Table 2). Co-expression together with hCCR2 and hCCR4 showed weak, non-

120

CCX-CKR inhibits CXCR3-mediated chemotaxis

consistent reduction in the chemotactic response. Chemotaxis toward receptor hCCRS was not inhibited by the presence ofhCCX-CKR. Finally, hCCR7 and hCCR9 were also investigated, which both share common ligands with CCX-CKR. The chemotactic response of these receptors was also blunted when co-expressed with CCX-CKR (Table 2). In order to analyze the effects of co-expression in more detail, we generated HEK293 cells stably co-expressing CCX-CKR and CXCR3, an important receptor for immune cell trafficking.

Table 2: Chemokine receptors tested for chemotaxis inh ibition by hCCX-CKR.

% of migration Receptor Ligand (lnM) (control is set to 100% ) n p value

CCR2 CCL13 125 ± 13 3 0.069 CCR2+CCX-CKR 92 ± 6 CCR4 CCL17 139 ± 5 3 0.069 CCR4+CCX-CKR 111 ± 11 CCR5 CCL4 143 ± 13 3 0.15 CCRS+CCX-CKR 121 ± 6 CCR6 CCL20 135 ± 10 3 0.02 CCR6+CCX-CKR 96 ± 9 CCR? CCL21 125 ± 15 3 0.023 CCR7+CCX-CKR 75 ± 9 CCR9 CCL25 168 ± 15 3 < 0.001 CCR9+CCX-CKR 94 ± 5 CCRl0 CCL27 158 ± 15 3 0.003 CCRl0+CCX-CKR 84 ± 11 CXCR3 CXCLl0 148 ± 9 3 < 0.001 CXCR3+CCX-CKR 82 ± 7 CXCR4 CXCL12 154 ± 16 3 0.009 CXCR4+CCX-CKR 83 ± 10

HEK293T cells were either transfected with a chemokine receptor a lone or with a combination of a chemokine receptor and CCX-CKR. Cells were then subjected to a chemotaxis experiment us ing the chemokine specific for the transfected receptor d i l uted in medium at a concentration of lnM. Control migration was done in presence of medium a lone. In all control experiments, between 25 to 45 cel l s m igrated toward the med ium. Using these numbers, control migration was set to 100%. Data represent the mean and SEM of 3 independent experiments. ANOVA was performed to i l lustrate statistical differences in migration. p<0.05 i nd icates that the chemotaxis mediated by the chemokine receptor toward its l igand was inh ibited by the presence of CCX-CKR.

4.2. Expression of hCCX-CKR does not affect expression of CXCR3

First the presence of chemokine receptors expression was examined by immunocytochemistry. Non­transfected HEK293 cells did not show staining for hCXCR3 (green signal) (Fig. lA) and hCCX-CKR (red signal) (Fig 18). Staining for hCXCR3 was observed in both hCXCR3-transfected (Fig 10) and double transfected HEK293 cells (Fig 1H) and hCCX-CKR expression was observed in hCCX-CKR-transfected (Fig. l F) and double transfected HEK293 cells (Fig 1H). Omission of primary antibodies generated no signal (Fig. lC, E, G). These findings were also confirmed at mRNA level (see supplementary Fig.1 ; Supplementary Table 2) at the end of the chapter. To exclude the possibility that the presence of

121

II

u

CHAPTER S

hCCX-CKR might hamper the normal expression of hCXCR3, expression levels of hCXCR3 in these cells were further investigated by ELISA measurements (Fig. 11). We show that comparable levels of hCXCR3 expression were found in hCXCR3-transfected cells and hCXCR3+hCCX-CKR-transfected cells. Although there is a decrease in hCXCR3 expression in presence of hCCX-CKR, which is probably due to the CMV promoter driving the protein machinery to its limit, it is not sufficient to explain the complete inhibition of chemotaxis toward CXCLlO that we observed. Thus the co-expression of hCCX-CKR did not affect protein expression of hCXCR3 in HEK293 cells.

1 5

j 1 0

!:! 0 5

- intlcl cells C) permoablllzedcells

MOCK hCXCRJ hCXCRJ• hCCX-CKR hCCX•CKR

Figure 1: Expression of hCCX-CKR does not influence expression of hCXCR3. lmm unocytochemical stainings revealed that non-transfected H EK293 cells did not express hCXCR3 (A) nor hCCX-CKR (B), whereas positive labeling was observed in hCXCR3 (D), hCCX-CKR (F), and hCXCR3/hCCX-CKR (H) stably transfected H EK293 cells. Cells stained in the absence of primary antibodies or in presence of an isotype control antibody with irrelevant specificity were devoid of signals (C, E, G). The magnification used in panels A-H was 40X. ( I) ELISA experiments showed no influence of hCCX-CKR co-expression on hCXCR3 protein levels when compared to single hCXCR3 expressing cells. No hCXCR3 protein expression was found in mock- or hCCX-CKR-transfected cells. Data represent the means ± S .E .M of three independent experiments. Statistical significance against mock transfected cells was tested by means of multiple comparison ANOVA and Tu key's post hoc analysis. Asterisks indicate p s 0.05.

122

CCX-CKR inhibits CXCR3-mediated chemotaxis

4.3. Effect of CCX-CKR on CXCR3-mediated chemotaxis

Having confirmed the expression levels of our stable cell l ines, we tested the effect of hCCX-CKR expression on hCXCR3-mediated migration. Whereas HEK293 cells expressing hCXCR3 cells displayed typical chemotaxis responses to CXCL 9 and CXCLl0, HEK293 cells expressing both hCXCR3 and hCCX-CKR failed to migrate in response to these two chemokines at al l concentrations tested (Fig 2A and B). The lack of migration in double-transfected cells could have been due to an artifact as a result of the transfection procedure. To exclude this possibility, we transfected hCXCR3-expressing HEK293 cells with another chemokine receptor subtype, hCX3CR1 (also known as fractalkine receptor), and examined migration in response to CXCLl0 as well as to the CX3CR1 l igand CX3CL1. After transfection, these HEK293 cells responded significantly to both CXCLl0 and CX3CL1 (Fig. 2C) with no difference compared to single transfected cells (data not shown).

A

:g 150

0 � � 100-

.2' E

i -------Lf---�� - 4

50 -'-,--;,',-�--�----.--' Conlrol -10 .9

Log [CXCL10] (M) -8

B

-� ! E

o hCXCR3 o hCXCR3+hCCX-CKR

� ' -· ! ..

5;0'-,---,,,,_�--�--..... Control ·10 .9

log (CXCL9] (Ml ·8

C 300 • CXCLl0 o CX3CL1

250

�

! 200

� 150 .S! !

f .!? E 100

so,.....,_-,,,._----,-----r---.,.-, Control ·10 .9

log (chomoklno( (M) ·8

Figure 2: Expression of CCX-CKR impairs CXCR3-dependent migration. HEK293 expressi ng stab le hCXCR3 migrated towards various concentration of CXCLl0 whereas migration of HEK293 expressing hCXCR3 + hCCX-CKR was abol ished (A). The same migratory behavior was observed with various concentrat ions of CXCL9, another CXCR3 l igand (8) . HEK293 stably expressing hCXCR3 + hCX3CRl show migratory behaviou r toward various concentration of CXCLl0 or CX3CL1 (C) . Data represent the means ± S .E .M of th ree independent experiments. Statistical s ignificance was tested by means of mu lti ple comparison ANOVA and Tu key's post hoc ana lysis. Asterisks ind icate p :S 0.05.

4.4. hCCX-CKR heteromerizes with hCXCR3 but not with hCCRS

To investigate whether hCCX-CKR might form heteromers with hCXCR3 we performed FRET experiments in HEK293T cel ls. Co-transfection of hCXCR3-CFP and hCXCR3-Venus revealed high level of FRET efficiency, which was set to 100%, indicating that CXCR3 per se shows homomerization (Fig. 3A). When the hCCX-CKR-CFP construct was co-expressed with hCXCR3-Venus, a strong FRET signal was observed (75 ± 2.81%); Fig 3A, indicating heteromerization of hCCX-CKR with hCXCR3. On the contrary, when hCCX-CKR was co-expressed with CCRS or a completely unrelated transmembrane receptor (hGABA

81 -CFP) no FRET signal was observed

(0 ± 3.92 %; Fig. 3A 8). These data indicate that hCCX-CKR is able to heteromerize with hCXCR3 but not with CCRS or GABAbl and thus inhibition of hCXCR3-mediated chemotaxis probably occurs through a di rect interaction between both receptors.

123

• � I u

CHAPTER 5

(A)

CFP

VENUS

CXCR3 - CFP/ CCXCKR • CFP/ CCXCKR - CFP/ CXCR3 - Venus CXCR3 -Venus GABAB - Venus

CXCR3/CXCR3 CCXCKR/CXCR3 CCXCKR/GABAB1

(B)

CFP

VENUS

FRET Elf

CCRS - CFP/ CCXCKR - CFP/ CCXCKR - CFP/ CCRS - Venus CXCR3 • Venus CCRS - Venus

Figure 3: hCCX-CKR forms heteromers with hCXCR3 but not with hCCRS. (A) HEK293T cells transfected with both hCXCR3-CFP and hCXCR3-Venus constructs showed high FRET efficiency, indicating that both proteins a re forming abundant homomeric complexes. When transfected with hCXCR3-CFP and hCCX-CKR­Venus, H E K293T also displayed a relatively strong FRET signal, demonstrating that both proteins are interact and form heteromers. HEK293T cells tra nsfected with hGABABRl-CFP and hCCX-CKR-Venus failed to show any FRET signal indicating that these receptors do not interact with each other. (B) FRET experiments were performed after co-expression of hCCRS and hCCX-CKR. Strong FRET signals were found for hCXCR3 and hCCRS homomers. Whereas the heteromer hCXCR3/hCCX-CKR showed a strong FRET signal, no signal was observed after co-expression of contructs containing hCCX-CKR-venus and hCCRS-CFP. FRET efficiencyis expressed in % and was scaled on the signal of hCXCR3-CFP and hCXCR3-Venus homomers.

4.5. Presence of hCCX-CKR affects binding properties of hCXCR3

Using homologous radioligand displacement assays, we determined the affinities of CXCLl0, CXCLll for hCXCR3 and the affinity of CCL19 for hCCX-CKR in cells expressing the receptors alone or co­expressing CXCR3 and CCX-CKR (Fig. 4). Binding affinities of CXCLl0 and CXCLll for hCXCR3 (pK; of 9.7 ± 0.1 and 9.2 ± 0.1, respectively) were not significantly affected by the presence of hCCX-CKR (pK; of 10.0 ± 0.3 and 9.4 ± 0.1, respectively). However, total binding of (125 I]-CXCLl0 was decreased by 47% on co-expression of hCCX-CKR, whereas total binding of (125 I]-CXCLll was decreased by 20% (4Fig. 4A, B). Similarly, the binding affinity of CCL19 for hCCX-CKR (pK; of 8.7 ± 0.1) was not significantly affected by the presence of hCXCR3 (pK

i of 8.9 ± 0.3). Total [125 I] -CCL19 binding was decreased by

65% on co-expression of CCX-CKR with CXCR3 (Fig. 4C).As negative ligand binding co-operativity has been observed for chemokine receptor heterodimers (Sohy et al., 2007 ; Springael et al., 2006),

124

(A)

120

1 00

o - 80 .,.. Cl .J C

� 'g 60 c, ns ,::, u � :E ::... u 40 § � � � 20

CXCL 10 (Log 10

M)

(C)

CXCL 19 (Log 10

M)

CCX-CKR inh ibits CXCR3-mediated chemotaxis

(B)

-12 -11 -10 -9 CXCL 11 (Log

10 M)

-8 -7

Figure 4: hCXCR3 and hCCX-CKR co-expression decreases the number of chemokine binding sites, but not chemokine affinities. Homologous displacement cu rves were obta ined for [125I]-CXCLl0 (A), [125 I ] ­CXCLll (B ) and [125 I] -CCL19 (C) in cel ls expressing hCXCR3 alone (A and B , empty symbols), hCCX-CKR alone (C, empty symbols) or cel ls co-expressing hCXCR3 and hCCX-CKR (A-C, fi l led symbols) . Data were normal ized to specific bind ing in cel ls expressing CXCR3 or CCX-CKR a lone. Data are given as averages ± SEM of specific binding from three independent experiments performed in trip l icate.

we investigated whether this allosteric ligand interactions also occur within the CXCR3-CCX-CKR

heterodimer (Figure 5). Next, [125I]-CXCLlO, [125 1 ]-CXCLll and [125I]-CCL19 equilibrium binding was

performed in HEK293T cells expressing hCXCR3 alone, hCCX-CKR alone or co-expressing hCXCR3

and hCCX-CKR , in the absence or presence of lOO nM of the unlabeled chemokine receptor ligands

CXCL9, CXCLlO, CXCLll (CXCR3) and CCL19, CCL21, CCL25 and CXCL13 (CCX-CKR). Whereas in hCXCR3

expressing cells [125I]-CXCLlO binding was displaced only by the CXCR3 chemokines, CXCL9, CXCLlO

and CXCLll (Fig. SA), in cells co-expressing hCXCR3and hCCX-CKR, negative [1251 ]-CXCLlO binding

cooperativity was found for CCL19, CCL21 and CCL25, but not CXCL13 (Fig. SB). CXCLlO did not

decrease [125 1 ]-CXCLlO binding in cells co-expressing hCXCR3 and hCCX-CKR (Fig. SB). [125I]-CXCLll was

125

■ 0: u.

<( I l..

CHAPTER S

displaced by CXCLl0 and CXCLll in cells expressing hCXCR3 (Fig. SC). On co-expression of hCCX-CKR

with CXCR3, CCL19 also significantly decreased [125I]-CXCLll binding (Fig. SD). Conversely, in cells

expressing hCCX-CKR (Fig. SE), the binding of [125I]-CCL19 was only displaced by CCL19 and CCL21,

whereas in cells expressing hCXCR3+hCCX-CKR (Fig. SF) a negative cooperative effect of CXCLll, but

not CXCL 9 or CXCLl0, was observed.

(A)

(C)

(E)

120

100

20

120

100

� f 80 c., ]5

H 60

'8 � 40

20

(8)

(D)

120

20

(F)

120

10

g ! so =:".g 60 � -:rl

1 : 40 m -

20

Figure 5: Negative l igand binding cooperativity occurs in cells expressing both hCCX-CKR and hCXCR3. [125 I ] -CXCLl0 (A- B), [125 I ] -CXCLll (C-D) a nd [125 I ] -CCL19 (E-F) equilibrium binding was performed with HEK293T cells expressing hCXCR3 a lone (A and C), hCCX-CKR alone (E) or both hCXCR3 and hCCX-CKR (B, D, F), in the a bsence or presence of u nlabeled chemokines (100 nM) as indicated. Data are given as averages ± SEM of normalized specific binding from 2-5 independent experiments performed in triplicate. Statistical significance against vehicle samples was tested by means of multiple comparison ANOVA and Tukey's post hoc analysis. Asterisks indicate p s 0.05.

126

CCX-CKR inhibits CXCR3-mediated chemotaxis

4.6. CXCR3 and CCX-CKR expression in human T-cel l s

Because CXCR3 and CCX-CKR are among the chemokine receptors present in T cells (Gosling et al., 2000; Loetscher et al., 1996; Thomsen et al., 2003), the inhibition of hCXCR3-medited migration by hCCX-CKR could be of relevance for the migratory behavior of T cells. Therefore, expression of hCCX-CKR and hCXCR3 mRNA as well as protein was investigated in freshly isolated T cells and T cells activated by phytohemagglutinin (PHA) and interleukin-2 (IL-2) treatment (Fig. 6A). RT-PCR and Q PCR analysis showed that both mRNAs were present in freshly isolated T cells (Fig. 6B). Whereas PHA/IL-2 treatment did not significantly influence hCXCR3 mRNA expression, a profound down-regulation of hCCX-CKR mRNA expression was observed (Fig. 6B). hCCX-CKR and hCXCR3 protein expression was investigated by flow cytometry analysis. It is shown (Fig. 6C) that 54.4 % of the freshly isolated T cells

(A)

' I .,-. ,.,,.� I cu •• \.

� -�-Foward scatter

Foward scatter

(C) ,:; lsotype control

(8)

GAPDH (346bp)

CXCR3 (544bp)

CCX-CKR (344bp)

Freshly PHA/IL-2 Neg MM isolated treated control ------

- -

---

(D)

1 ,0

0,8

� § (.) gi Op .E e � � <O <t: 0,4 {j �

I E 0,2 e!

0,0 Freshly PHA/IL-2 isolated treated

200......--------------, • PHA/IL-2 treated

�:; lsotype control c::i Freshly isolated (54.4%) □PHA/IL-2 treated (43 2%)

c Freshly isolated (18.3%) □ PHA/IL-2 treated (50.3%) I 1so

8

o Freshly isolated � ..

J!l C ::, 0

(.)

CCX-CKR CXCR3

'15 � j 100 0, -� :E 50

/ "i

<y+-f Control -10 -9

log[CXCL 10](M) -8

Figure 6: Expression of hCCX-CKR in freshly isolated and in activated T cells. (A) Freshly isolated T cells and PHA/I L-2-activated T cel ls were sorted by FACS. (B) RT- PCR analysis show that freshly isolated T cells express both hCXCR3 and hCCX-CKR m RNA. Activated T cells d isplay similar levels of hCXCR3 mRNA as freshly isolated T cel ls but levels of hCCX-CKR mRNA were considerably lower. *= p<0.0S. (C) FACS ana lysis revealed that 54.4% and 18.3% of freshly isolated T cel ls expressed hCCX-CKR and hCXCR3, respectively. hCCX-CKR expression dropped to 43.2% in activated T cel ls whereas a major up-regulation (50.3%) of hCXCR3 expressing-T cells was observed following activation. (D) Chemotaxis experiments show that freshly isolated T cel ls fa i led to migrate toward CXCLl0 whereas PHA/I L-2-activated T cells demonstrated a prominent migratory behaviour toward the chemokine. *= p<0.05 compared to control .

127

• 0: u. l­o. <l I l..

CHAPTER S

expressed hCCX-CKR. This percentage dropped to 43.2% positive cells in PHA/IL-2 treated cells (Fig. 6C). In contrast a clear increase in expression of hCXCR3 expression was found after PHA/IL-2 treatment, from 18.3 to more that 50.3% CXCR3 positive cells after PHA/ IL-2 treatment was observed (Fig. 6C). Thus, the treatment with PHA/IL-2 induced a small down regulation of hCCX-CKR and an upregulation of hCXCR3 expression in human T cells. Similar data were obtained in primary mouse microglia and primary mouse macrophages (supplementary Fig. 2 at the end of the chapter). Indeed, QPCR analysis indicated the presence of both CCX-CKR and CXCR3 receptors mRNA in these cells. Moreover, treatment with a combination of SOng/ml INF and l OOng/ml LPS in the case of primary macrophages and with lOOng/ml LPS in the case of microglia provoked a pronounced downregulation of CCX-CKR mRNA in both cell types (supplementary Fig. 2 A-B at the end of the chapter). Upregulation of CXCR3 after activation was observed only in primary microglia (supplementary Fig. 2A at the end of the chapter).

4.7. Effect of hCCX-CKR expression on CXCR3 mediated migration in human T cel ls

Next, chemotaxis of freshly isolated and PHA/IL-2 treated T-cells in response to CXCLl O was examined. Whereas freshly isolated T-cells did not show migration in response to CXCLl O at all concentrations tested, significant migration was observed in PHA/I L-2 treated T-cells, with a peak migratory response at lnM CXCLl O (Fig. 6D). Thus, similar to HEK293 cells, down regulation of hCCX-CKR was correlated to the migration of human T cells towards CXCR3 ligands. However, since the treatment with PHA/IL-2 caused a robust up-regulation of CXCR3 and does most likely induce various other cellular reactions that could account for the observed change in migratory behavior, we aimed at modifying CCX-CKR levels in freshly isolated and PHA/IL-2 treated T cells. We therefore transfected freshly isolated T cells with ShRNA for CCX-CKR to mimick the down-regulation observed after treatment with PHA/IL-2. This treatment indeed caused a clear down regulation of hCCX-CKR (Fig. 7A). Whereas the negative control ShRNA did not affect the chemotactic response of T cells to 1 nM CXCLlO, treatment with the Sh RNA targeting hCCX-CKR clearly enhanced the migration of T cells to CXCLl O (Fig. 7B) . In addition, hCCX-CKR was over­expressed in PHA/IL-2 treated T cells as demonstrated by flow cytometry (Fig. 7C). Whereas a significant migration in response to CXCLl O was observed in GFP-transfected cells (control transfection), no migratory response was observed in PHA/IL-2 treated T cells that had been transfected with hCCX-CKR (Fig. 7D). Similar data were obtained with primary mouse microglia. Since we observed that treatment with LPS provoked a down regulation of CCX-CKR mRNA and an up regulation of CXCR3, we hypothesized that activated microglia would migrate more towards CXCR3 ligands. Indeed, we observed a significant increase in cell migration towards both CXCL 9 and CXCLlO when microglia was activated with LPS (supplementary Fig. 2C), showing that the down-regulation of CCX-CKR is correlated to an increased chemotactic response.

128

CCX-CKR i nh ibits CXCR3-mediated chemotaxis

(A) (B} 25

:, 0 u

(C)

C ::, 0

(.)

:::, lsotype control □ Negative control shRNA 200

shRNA targeting CCX-CKR

CCX-CKR

(D)

,:, lsotype control □ Mock-transfected □ CCX-CKR-transfected

CCX-CKR

1 50

100

50

0

200

5 150 0 ::e ; 1 00

c: 50 .Ql E

0

• Control □ CXCL 10 ( 1 nM)

Negative control shRNA

shRNA targeting CCX-CKR

* .-------,

Mock CCX-CKR

Figure 7: Presence of hCCX-CKR is associated with suppression of chemotaxis towards CXCLlO in T cells (A) Silencing hCCX-CKR using vectors containing DNA encoding for short hairpin RNA targeting hCCX-CKR resulted in a down-regulation of hCCX-CKR expression by freshly isolated T cells as determined by flow cytometry. Data are representative for 4 d ifferent human donors. (B) Down-regulating hCCX-CKR rescued chemotaxis towards CXCLlO. Data are representative for five different human donors and presented as mean ± SEM. *P<0.05 (Mann-Whitney U-test). (C) Flow cytometric analysis showed successful transfection of PHA/I L-2 treated T cells with hCCX-CKR. The data represent one out of five separate experiments with d ifferent human donors. (D) Re-expressing hCCX-CKR in PHA/IL-2 treated T cells inhibited CXCR3-mediated chemotaxis towards CXCLlO. The data are representative for 6 separate experiments using different human donors and are presented as mean ± SEM. *P<0.05 (Mann-Whitney Li-test).

5. DISCUSSION

Atypical chemokine receptors including DARC, D6 have been shown to efficiently internalize their cognate ligands and act as chemokine scavengers (Hansell et al., 2006). Also CCX-CKR binds and scavenges its ligands CCL21, CCL19, CCL25 a nd CXCL 13 (Comeford et al., 2006; Gosling et al., 2000; Townson and Nibbs, 2002). Here, we show that co-expression of hCCX-CKR abolished hCXCR3-mediated migratory responses towards CXCL9 and CXCLlO, which is not due to scavenging of hCXCR3 ligands, as CXCL 9 and CXCLlO have no affinity for hCCX-CKR (Gosling et al., 2000). It has been demonstrated that chemokine's can signal through monomeric a nd heteromeric receptor complexes (Salanga et al., 2009). Well known chemokine receptor heteromers are CCR2/CCRS (El-Asmar et al., 2005; Mellado et al., 2001; Sohy et al., 2009), CXCR1/CXCR2 (Wilson et al.,

129

• Ct! ll. l­a. <( I L.,

CHAPTER 5

2005), CXCR4/CCR2 (Percherancier et al., 2005; Sohy et al., 2007; Sohy et al., 2009), CXCR4/ CXCR7 (Sierra et al., 2007), CXCR4/CCR5 (Contento et al., 2008; Sohy et al., 2009) and DARC/ CCR5 (Chakera et al., 2008). In some of these cases heteromerization had essential implications for agonist-induced chemotaxis and calcium signaling (Chakera et al., 2008; Sohy et al., 2007; Sohy et al., 2009). We therefore decided to investigate possible heteromerization of hCCX-CKR and hCXCR3 by FRET. Expressed in HEKT293 cells, hCXCR3 formed homomers and also displayed pronounced heteromerization with hCCX-CKR. In contrast hCCX-CKR did not heteromerize with hCCR5 or hGABA

81 receptor, thus confirming the specificity of the FRET assay. Since CCR5-induced

chemotaxis is not affected by co-expression of CCX-CKR, this suggests that heteromerization of hCCX-CKR with hCXCR3 plays an essential role in its inhibitory effect on chemotaxis. Heteromerization could induce changes in receptor conformation that possibly would reduce the receptor-ligand binding properties leading to chemotaxis inhibition. Accordingly, the loss of CXCLlO binding sites observed in binding experiments in cell co-expressing hCXCR3 and hCCX-CKR as compared to cells expressing only hCXCR3, is larger than the loss of CXCLl l binding sites and hCXCR3 cell surface expression as measured by ELISA. Cox et al. (2001) have shown that CXCLl0 and CXCLl l occupy distinct binding sites at hCXCR3. In contrast to CXCLl l binding, the interaction of CXCLl O with CXCR3 is highly dependent on an active conformation of the receptor. The loss of CXCLl0 binding sites in the absence of decreased CXCLl O affinity for hCXCR3 observed in the presence of hCCX-CKR may be explained by a relative increase in the population of CXCR3 in an inactive conformation. Additionally, negative binding cooperativity, induced by ligands both for hCXCR3 and hCCX-CKR was observed. Thus, chemokine's for hCCX-CKR suppressed chemokine binding to hCXCR3 and vice versa. In cells co-expressing hCXCR3 and hCCX-CKR, CCL19 could displace both radiolabeled CXCLl 0 and CXCLl l, whereas CCL21 and CCL25 caused significant displacement of [125 I ] -CXCLl 0 but not [125 1 ]-CXCLl l . The lack of co-operativity between [125 I ]-CXCLl l and CCL21 or CCL25 may be due to the lower affinity of these two chemokine's than that of CCL19 for hCCX-CKR as previously reported by Gosling et al 2000 (i.e. CCL19, CCL21, CCL25, and CXCL13 displaced [125I ] -CCL19 with IC

50 values of 6, 12, 7 and 140

nM, respectively). The lack of negative binding co-operativity between [125 I ]-CCL19 and CXCLl0 may be due to the loss of CXCLl O high affinity binding sites on co-expression of hCCX-CKR with hCXCR3. Additionally, the lack of negative binding co-operativity between hCXCR3 radioligands and CXCL13 is likely due to the moderate affinity of this chemokine for hCCX-CKR. In cells co­expressing hCXCR3 and hCCX-CKR, CXCLl O actually increased [125 I]-CXCLl 0 binding, possibly promoting non-specific binding of the radioligand. This effect was also observed in cells that did not express CXCR3 (data not shown).ln order to study the potential influence of hCCX-CKR co­expression on hCXCR3 dependent chemotaxis in primary cells experiments with human T cells and mouse microglia and macrophages were performed. Interestingly, in all cells it was observed that the presence of hCCX-CKR significantly inhibited the chemotactic response of hCXCR3 ligands. These results thus suggest that co-expression of hCCX-CKR also in a more physiological setting negatively influences the chemotactic response of hCXCR3. In all these cells it was found that an inflammatory activation down-regulated hCCX-CKR expression and thus increased the migratory capacity of these cells to hCXCR3 ligands. It therefore is tempting to speculate that the loss of h CCX-CKR expression is part of the activation program of immune cells that enable them

130

CCX-CKR inhibits CXCR3-mediated chemotaxis

to migrate towards sites of inflammation. Interestingly, Gosling and colleagues (2000) described a similar decrease in CCX-CKR mRNA expression for maturing dendritic cells. Whether CCX-CKR might also influence the migration of dendritic cells remains to be established.

Little is yet known about the physiological function of hCCX-CKR. Since no signaling effects of this receptor-like protein have yet been described, hCCX-CKR is currently considered to function as a chemokine scavenger (Comeford and Nibbs, 2005), similar to the chemokine receptor-like proteins D6 and DARC (Jamieson et al., 2005; Martinez de la Torre et al., 2005). Our current data suggest that hCCX-CKR forms complexes with hCXCR3. This heteromerization might underlie the inhibition of hCXCR3-induced chemotaxis. Negative binding cooperativity upon co-expression of hCXCR3 and hCCX-CKR may also serve as inhibitory mechanism. Similar inhibitory functions have been reported for the atypical CRAM receptor and CCR? (Catusse et al., 2010). However, contrary to CCX-CKR, which do not display affinity for CXCR3 ligands, the inhibitory effect of CRAM on CCR? was a combination of ligand competition as well as other unknown factors that might include negative binding cooperativity or heterodimerization. Recently, a possible role of hCCX-CKR as a regulator of growth and metastasis in breast cancer has been reported (Feng et al., 2009). In this study, over-expression of hCCX-CKR inhibited cancer cell proliferation in vitro, and a significant correlation between hCCX-CKR expression and survival rate in breast cancer patients was found. Whether or not heteromerization of hCCX-CKR with other chemokine receptors (as suggested by our chemotaxis experiments (Table 2) is also involved in inhibition of chemotaxis and proliferation of breast cancer remains to be established.

6. CONCLUSION

Here, we show that hCCX-CKR co-expression has a negative influence on the chemotactic response of the chemokine receptor CXCR3. FRET studies and ligand displacement experiments in hCCX-CKR and hCXCR3 co-expressing cells showed heteromerization and negative binding cooperativity, both of which may influence the migratory capacity of CXCR3. Moreover, we demonstrate that CCX-CKR co-expression also inhibits CXCR3-mediated chemotaxis in human T cells, and mouse myeloid cells. The loss of CCX-CKR expression in these primary cells by activation caused a prominent increase in chemotaxis towards CXCR3 ligands. The inhibition of CXCR3-mediated chemotaxis by CCX-CKR co-expression may therefore be part of the downregulatory program of non-primed immune cells. Thus CCX-CKR apart from being a scavenger for chemokines may have direct influence on the activity status and chemotactic properties of immune cells.

131

II 0 u l­o. <l :r L.

CHAPTER S

7. REFERENCES

Biber K, Klotz KN, Berger M, Gebicke- Harter PJ, van Calker D (1997) . Adenosine Al receptor-mediated activation of phospholipase C in cultured astrocytes depends on the level of receptor expression. J Neurosci 17 : 4956-4964.

Brouwer N, Zuurman MW, Wei T, Ransohoff RM, Bodekke HW, Biber K (2004). Induction of glial L-CCR mRNA expression in spinal cord and brain in experimental autoimmune encephalomyelitis. Glia 46: 84-94.

CatusseJ, Leick M, Groch M, Clark DJ, Buchner MV, Zirlik K, et a I (2010). Role of the atypical chemoattractant receptor CRAM in regulating CCL19 induced CCR7 responses in B -cell chronic lymphocytic leukemia. Mo/ Cancer 9:297.

Chakera A, Seeber RM, John AE, Eidne KA, Greaves DR (2008). The duffy antigen/receptor for chemokines exists in an oligomeric form in living cells and functionally antagonizes CCRS signaling through hetero­oligomerization. Mo/ Pharmaco/73: 1362-1370.

Chomczynski P, Sacchi N (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate­phenol-chloroform extraction. Anal Biochem 162: 156-159.

Combadiere C, Ahuja SK, Murphy PM (1995). Cloning, chromosomal localization, and RNA expression of a human beta chemokine receptor-like gene. DNA Cell Bio/14: 673-680.

Comerford I, Milasta S, Morrow V, Milligan G, Nibbs R (2006). The chemokine receptor CCX-CKR mediates effective scavenging of CCL19 in vitro. Eur J /mmuno/ 36: 1904-191 6.

Comerford I , Nibbs RJ (2005). Post-translational control of chemokine's: a role for decoy receptors? lmmunol Lett 96: 163-1 74.

Contento RL, Molon B, Boularan C, Pozzan T, Manes S, Marullo S, et al (2008). CXCR4-CCR5: A couple modulating T cell functions. Proc Natl Acad Sci USA 105: 10101-10106.

Cox MA, Jenh CH, Gonsiorek W, Fine J, Narula SK, Zavodny PJ, et al (2001). Human interferon-inducible 10-kDa protein and human interferon-inducible T cell alpha chemoattractant are allotopic ligands for human CXCR3: differential binding to receptor states. Mo/ Pharmaco/ 59: 707 -715

El-Asmar L, Springael JY, Ballet S, Andrieu EU, Vassart G, Parmentier M (2005). Evidence for negativebinding cooperativity within CCR5-CCR2b heterodimers. Mo/ Pharmacol 67 : 460-469.

Feng LY, Ou ZL, Wu FY, Shen ZZ, Shao ZM (2009). Involvement of a novel chemokine decoy receptor CCX­C KR in breast cancer growth, metastasis and patient survival. Clin. Cancer Res 15: 2962-2970.

Gosling J, Dairaghi DJ, Wang Y, Hanley M, Talbot D, Miao Z, et al (2000). Cutting edge: identification of a novel chemokine receptor that binds dendritic cell- and T cell-active chemokines including ELC, SLC, and TECK. J /mmuno/ 164: 2851-2856.

Hansell CA, Simpson CV, Nibbs R (2006). Chemokine sequestration by atypical chemokine receptors. Biochem. Soc Trans 34: 1009-1013.

Hensbergen PJ, van der Raaij- Helmer EM, Dijkman R, van der Schors RC, Werner-Felmayer G, Boersma DM, et al (2001). Processing of natural and recombinant CXCR3-targeting chemokines and implications for biological activity. Eur J Biochem 268: 4992-4999.

Horuk R (2001). Chemokine receptors. Cytokine Growth Factor Rev 12: 313-335.

Jalink K, Van Rheenen J (2009). Quantitative imaging of sensitized emission FRET and FLIM techniques. In: Gadella TWJ (ed). Laboratory techniques in biochemistry and molecular biology. Vol.33. Academic Press: Burlington, pp 289-349.

Jamieson T, Cook DN, Nibbs RJ, Rot A, Nixon C, McLean P, et al (2005). The chemokine receptor D6 limits the infla mmatory response in vivo. Nat lmmunol 6: 403-411 .

Jiang H, Kuang Y, Wu Y, Xie W, Simon Ml, Wu D (1997 ). Roles of phospholipase C beta2 in chemoattractant­elicited responses. Proc Natl Acad Sci USA 94: 7 97 1 -7 975.

Johnson M, Li AR, Liu J, Fu Z, Zhu L, Miao S, et al. (2007). Discovery and optimization of a series of quinazolinone-derived antagonists of CXCR3. Bioorg Med Chem Lett 17 : 3339-3343.

Li Z, Jiang H, Xie W, Zhang Z, Smrcka AV, Wu D (2000). Roles of PLC-beta2 and -beta3 and Pl3Kgamma in chemoattractant-mediated signal transduction. Science 287: 1046-1049.

Loetscher M, Gerber B, Loetscher P, Jones SA, Piali L, Clark- Lewis I, et al (1996). Chemokine receptor specific for I Pl0 and mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 184: 963-969.

Martinez de la Torre Y, Locati M, Buracchi C, Dupar J, Cook DN, Bonecchi R, et al (2005). Increased inflammation in mice deficient for the chemokine decoy receptor D6. Eur J lmmunol 35: 1342-1346.

132

CCX-CKR inhibits CXCR3- m ed iated c hemotaxis

Mellado M, Rodriguez-FradeJM, Vila-CoroAJ, FernandezS, Martin de Ana A, Jones DR, et a I (2001). Chemokine receptor homo- or heterodimerization activates distinct signaling pathways. EMBO J 20: 2497-2507.

Murphy PM (2002). International Union of Pharmacology. XXX. Update on Chemokine Receptor Nomenclature. Pharmaco/ Rev 54: 227-229.

Murphy PM, Baggiolini M, Charo I F, Hebert CA, Horuk R, Matsushima K, et al (2000). International union of pharmacology. XXI I . Nomenclature for chemokine receptors. Pharmacol Rev 52: 145-1 76.

Percherancier Y, Berchiche YA, Slight I , Volkmer-Engert R, Tamamura H, Fuji i N, et a I (2005). Bioluminescence resonance energy transfer reveals ligand-induced conformational changes in CXCR4 homo- and heterodimers. J Biol Chem 280: 9895-9903.

Rios CD, Jordan BA, Gomes I , Devi LA (2001). G-protein-coupled receptor dimerization: modulation of receptor function. Pharmaco/ Ther 92: 7 1-87.

Rodriguez-Frade JM, Vila-Coro AJ, de Ana AM, Albar J P, Martinez AC, Mellado M (1999). The chemokine monocyte chemoattractant protein-1 induces functional responses through dimerization of its receptor CCR2. Proc Natl Acad Sci USA 96: 3628-3633.

Rossi D, Zlotnik A (2000). The biology of chemokines and their receptors. Annu. Rev lmmunol 18: 21 7 -242.

Salanga CR, O'Hayre M, Handel T (2009). Modulation of chemokine receptor activity through d imerization and cross talk. Cell Mo/ Life Sci 66: 1307-1386.

Sanchez-Madrid F, del Pozo MA (1999). Leukocyte polarization in cell migration and immune interactions. EMBO J lB: 501-511 .

Sierra F, Biben C, Martinez-Munoz L, Mellado M, Ransohoff RM, Li M, et al (2007 ). Disrupted card iac development but normal hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. Proc Natl Acad Sci USA 104: 14759-14764.

Sohy D, Parmentier M, Springael JY (2007). Allosteric transinhibition by specific antagonists in CCR2/CXCR4 heterodimers. J Biol Chem 282: 30062-30069.

Sohy D, Yano H, de N adai P, Urizar E, Guillabert A, Javitch JA, et al (2009). Hetero-oligomerization of CCR2, CCR5, and CXCR4 and the protean effects of "selective" antagonists. J Biol Chem 284: 31270-31279.

Springael JY, Le Minh PN, Urizar E, Costagliola S, Vassart G, Parmentier M. (2006). Allosteric modulation of binding properties between units of chemokine receptor homo- and hetero-oligomers. Mo/ Pharmaco/ 69: 1 652-1661.

Springael JY, Urizar E, Parmentier M (2005). Dimerization of chemokine receptors and its functional consequences. Cytokine Growth Factor Rev 16: 611-623.

Thelen M (2001). Dancing to the tune of chemokines. Nat lmmunol 2: 129-134.

Thomsen AR, Nansen A, Madsen AN, Bartholdy C, Christensen J P (2003). Regulation of T cell migration during viral infection: role of adhesion molecules and chemokines. lmmunol Lett 85: 119-127.

Townson JR, N ibbs RJ (2002). Characterization of mouse CCX-CKR, a receptor for the lymphocyte-attracting chemokines TECK/mCCL25, SLC/mCCL21 and MIP-3beta/mCCL19: comparison to human CCX-CKR. Eur J lmmuno/ 32: 1230-1241 .

Van Rheenen J, Langeslag M, Jalink K (2004). Correcting Confocal Acquisition to Optimize I maging of Fluorescence Resonance Energy Transfer by Sensitized Emission, Biophysical J 86: 251 7-2529.

Verzijl D, Store I i i S, Scholten DJ, Bosch L, Reinhart TA, Streblow DN, et al (2008). Noncompetitive antagonism and inverse agonism as mechanism of action of nonpeptidergic antagonists at primate and rodent CXCR3 chemokine receptors. J Pharmaco/ Exp Ther 325: 544-555.

Wilson S, Wilkinson G, Milligan G (2005). The CXCRland CXCR2 receptors form constitutive homo- and heterodimers selectively and with equal apparent affinities. J Biol Chem 280: 28663-28674.

Zuurman MW, Heeroma J, Brouwer N, Boddeke HW, Biber K (2003) LPS-induced expression of a novel chemokine receptor (L-CCR) in mouse glial cells in vitro and in vivo. Glia 41: 327-336.

133

• C Ll

<J :I C

CHAPTER S

SUPPLEMENTARY MATERIALS

Supplementary Table 1: Primers used for quantitative rea l -time PCR.

Gene

GAPDH

H PRn

CXCR3

CCX-CKR

Accession number Forward

AF106860 ATGGCCTTCCGTGTTCCTAC

BC000578 TGACACTGGCAAAACAATGCA

X95876 CCACTGCCAATACAACTTCC

AF233281 TCAAGTTCTGCCGAGCCATA

Backward

GCCTGCTTCACCACCTTCTT

AGCTTGCTGGTGAAAAGGACC

ATAGCAGTAGGCCATGACCA

TGTGACTTGGATGGCGATGT

Supplementary Table 2: Threshold cycle number for hCXCR3, hCCX-CKR and the housekeeping gene GAPDH for all HEK293 cel l l ines.

Mock CXCR3 CCX-CKR CXCR3+CCX-CKR

Ct CXCR3 33.5 ± 1 .5 22.6 ± 2.7 35.2 ± 4.6 24.3 ± 0.7

CT CCX-CKR 36.3 ± 3.3 35.2 ± 4.6 27.9 ± 1 .l 28.l ± 1 .5

Ct GAPDH 23.2 ± 1 .1 23.5 ± 1 .4 23.5 ± 1 .2 22.7 ± 0.9

mRNA for hCXCR3 and hCCX-CKR were observed in respectively hCXC3 and hCCX-CKR transfected H EK293 cel ls, and not in non -transfected cel l s . In addition, mRNA for both receptors was found in hCXCR3+hCCX-CKR transfected cel ls .

134

CCX-CKR i n h i bits CXCR3-mediated chemotaxis

1

• •

Supplementary Figure 1: In situ hybridization visualizing hCXCR3 and hCCX-CKR mRNA expression in HEK293 cells stably transfected with hCXCR3 + hCCX-CKR. Stably transfected HEK293 cells were hybridized with sense hCXCR3 (A, 200x magnification) or hCCX-CKR (B, 200x magnification) probes to determine background stain ing . Antisense probes for both hCXCR3 (c, 200x magnification and E, 400x magnification) and hCCX-CKR (D, 200x magnification and F, 400x magnification) revealed perinuclear mRNA accumulation.

1 35

• C u I­C <

J l

CHAPTER 5

(A)

C: C: 5 a:; .Q

� I 4 .c: C. 0 )<

Q) Q) 3 ;? <(

I � 2

1

■ -CTRL LPS

CCX CKR CCX CKR

(C) 300

250

i 200

t 1 50

,;?

� 1 00

50

DMEM

(B)

■ I ■ CTRL LPS CTRL LPS + IFN LPS LPS + IFN

CXCR3 CXCR3 CCX CKR CCXCKR CCX CKR CXCR3

-- � LPS

ATP CXCL10 CXCL9 (1 nM) (1 nM)

Supplementary Figure 2: Primary mouse microglia and macrophages behave similarly as human T cells. Treatment of primary mouse microgl ia with LPS induced a s ignificant reduction of CCX-CKR m RNA expression, whereas CXCR3 mRNA l evels were increased (A). mRNA levels of CCXCKR were a lso down regulated in mouse macrophages when they were treated with LPS and interferon gamma (B). Stranagely, levels of CXCR3 a lso were greatly reduced. Chemotaxis experiments with primary mouse microgl ia show that there migration significantly increase towards ATP, CXCLlO AND CXCL9 when treated with LPS (C) .

136

I C HAPTE R 6

Summarizing discussion

Nederlandse Samenvatting

Acknowledgements

GENERAL D ISCUSSION

Microglia and its regulating factors

Summarizing discussion

M icroglia, the innate immune cells of the CNS, are of the monocytic lineage and are derived from the fetal yolk sac around embryonic day 8.5. Microglia migrate into the

brain early during gestation (El0.5) and colonize the CNS parenchyma (Alliot et al. , 1999; Chan et al., 2007; Ginhoux et al., 2010; Ransohoff and Cardona, 2010). Studies over the last couple of years have revealed that microglia perform several vital functions in the CNS: tissue homeostasis, neuronal plasticity, circuit function, antigen presentation and phagocytosis (Ji et al., 2013; Kettenmann et al., 2011; Nakajima and Kohsaka, 1993; Pont-Lezica et al. , 2011; Sierra et al., 2010). Since intrinsic factors like HDACs and receptors for extrinsic factors like purines and chemokine's have a potential role in microglia inflammation, further progress in this research field could open up new insights and strategies for controlling microglial activity. Earlier studies have shown that the inflammatory response of immune cells is also regulated by epigenetic processes, including DNA methylation (Bird, 2002), covalent histone modifications (Bayarsaihan, 2011) and microRNA expression (Lindsay, 2008). In our studies we investigated HDACs as intrinsic regulators and purinergic, chemokine receptors as extrinsic regulators of microglial inflammation as well in other immune cells. Additionally, a link between these intrinsic as well as extrinsic factors in the modulation of microglial activity is not fully studied. Therefore, the work described in this thesis had three main objectives:

(a) To study the role of HDACs in modulating the glial inflammatory responses as well as their role in demyelinating disorders.

(b) To determine the effect of HDAC inhibition on the expression and function of purinergic receptor and its impact on microglial functionality.

(c) To explore the role of chemokine receptor signaling in microglia as well in other immune cells.

Summary of results described in this thesis

Chapter 2 describes the role of HDACs as an intrinsic regulator of the glial (microglia, astrocyte) inflammatory response. Various in vitro studies have suggested a stimulating effect of HDACi in response to inflammatory stimuli in macrophages (Aung et al., 2006), mouse microglia cell lines (Huuskonen et al., 2004) and primary rat microglia (Suuronen et al., 2003, Suuronen et al., 2006). On the other hand, suppressive effects of HDACi on inflammatory responses have been reported in primary mouse dendritic cells (Bode et al., 2007), macrophages (Han and Lee, 2009), human rheumatoid arthritis synovial fibroblasts (Choo et al., 2010), in a mouse endotoxemia model (Li et al., 2009) and in mixed CNS glia (Faraco et al., 2009). Therefore, the role of HDACi in the modulation of inflammatory responses is still a subject of debate. Thus we decided to investigate the role of HDACs in modulating the inflammatory response in two different glial cells, microglia and astrocytes. Here we provide evidence about endogenous transcript levels of HDACs expressed in microglia and in astrocytes, were we observed that certain HDACs (6, 7, 8, 9, 10 and 11) are low in microglia and 6, 9, 10 in astrocytes (Chapter 2, Fig 1), however the physiological relevance of this differential HDAC expression level in both of these glial cells is unclear. Next we observed that upon stimulation with LPS, there is a transient increase of HDACs and pro-inflammatory transcript levels and further the level of

141

• ex LL l­a. <t I L,

CHAPTER 6

these transcripts decline at later time point after LPS stimulation in microglia (Chapter 2, Fig 2A and 4A). This transient induction of HDAC expression levels might be essential to limit the microglial inflammatory response (Chapter 2, Fig 10) which is in agreement with the previous fi ndings as HDACs are shown to modulate TLR mediated signaling (Shakespear et al., 2011) or HDACs negatively regulate their own expression levels by acting on their own promoters, has been observed in macrophages (Aung et al., 2006). A similar effect of LPS on HDAC expression was also observed in in vivo microglia, when mice were exposed to LPS.

On the other hand, we observed an induction of only HDACl and HDAC7 in astrocytes in response to combined LPS and IFNy stimulation (Chapter 2, Fig 3B). The inflammatory cytokine profile of microglia and astrocytes (Chapter 2, Fig 4A and 4B) supported the view that microglia are the initial responders towards an LPS induced inflammatory response where astrocytes respond at a later stage (Saijo et al., 2009). Since the relative levels of HDACs were found to be increased in microglia on stimulation with LPS, we decided to investigate whether small molecule HDACi could alter the inflammatory response mediated by LPS in these microglia cultures. From our study, we concluded that HDACi suppressed the LPS induced inflammatory response in microglia with respect to the cytokine transcript levels (Chapter 2, Fig SC and 6C), cytokine secretion (Chapter 2, Fig 7), activation marker expression (Chapter 2, Fig 8) as well as cellular migration (Chapter 2, Fig 9) suggesting that HDACi suppressed the innate immune activation in primary mouse microglia (Kannan et al., 2013).

In Chapter 3, the effect of TSA (as an HDACi) on EAE etiology was studied. Mu ltiple sclerosis is an autoimmune disorder characterized by cortical demyelination (Ransohoff and Brown, 2012), axonal damage as well as gliosis (Kieseier and Stuve, 2011 ) and loss of blood brain barrier integrity (Dhib-Jalbut, 2007). We observed that T SA did not attenuate the onset (Chapter 3, Fig 2a), progression (Chapter 3, Fig 2b) or inflammatory response of microglia and peripheral macrophages in EAE (Chapter 3, Fig Sa & Sb). It is therefore important to elucidate the response of other glial cells towards TSA. It has been reported that astrocytes might play a role in demyelinating disorders (Leech et al., 2007). Interestingly, our in vitro experiments with primary astrocytes showed that 30 nM TSA potentiated the inflammatory response in these cells (Chapter 3, Fig 6A). However, a similar dose of TSA suppressed inflammatory cytokines expression in microglia in response LPS/IFNy (Chapter 3, suppl Fig 1). Summarizing, these in vitro data suggest that TSA administration in EAE mice might have resulted in an increased inflammatory profile of astrocytes which could be a possible reason for the observed inability of TSA to suppress the progression as well as the inflammatory response of EAE. However, a better understanding of the dosage effect of TSA on the microglia and astrocytes inflammatory response in EAE is essential in order to draw a strong conclusion about the role of TSA in the glial inflammatory response in EAE. Chapter 2 and Chapter 3 of this thesis suggest a central role for HDACs in modu lating glial inflammatory responses.

In chapter 4, the role of purinoreceptors as extrinsic regulators (in particular P2X7) of the neuroprotective function of microglia was studied. Earlier studies showed that microglia under ramified conditions not only survey their microenvironment but also protect neurons after pathological insult (Bannerman et al., 2007; Holley et al., 2003). In the same study, it was found that treatment of organotypic slice cultures with varying concentration of NMDA resulted in neuronal

142

Summarizing discussion

death in hippocampal regions however neurons in the dendrite gyrus seemed to be protected. Our results showed that depletion of microglia enhanced neuronal death upon treatment with NMDA (Chapter 4, Fig lA, lower panel) which is in agreement with the previous findings of van Weering and co-workers., (Vinet et al., 2012b). Several reports showed that ATP is a ligand for the P2X7 receptor (van Weering et al., 2011). Hippocampal slice cultures, prepared from P2X7 1· mice, revealed that NMDA-induced cell death was more pronounced in P2X7-deficient mice compared to wild type mice (Chapter 4, Fig 2C, 20) suggesting that P2X7 is required for microglia mediated neuroprotection. Further, we determined whether expression of P2X7 was regulated by HDACi. In our study we found that long term treatment of slice cultures with VPA prior to NMDA treatment conferred neuroprotection (Chapter 4, Fig 3A). Moreover, our data suggested that VPA treatment resulted in increased P2X7R expression levels (Chapter 4, Fig 4A and 4B) .. It has been previously reported that HDACi induce DNA demethylation by Detich et al., 2003; Dong et al., 2010. A study of Zhou et al., 2009 showed that the human P2X7 receptor gene is regulated by CpG islands downstream of its promoter. Future experiments will have to determine whether VPA treatment resulted in demethylation of these CpG islands in the P2X7 gene promoter.

Chapter 5, describes chemokine's as well as chemokine receptors which regulate cell migration. Generally, chemokine receptors belong to G-protein coupled receptor (GPCRs) which mediate cytoskeleton rearrangement resulting in polarization as well as cellular migration (Chakfe et al., 2002; Ferrari et al., 1997). Additionally, atypical orphan chemokine receptors that do not signal via classic GPCR pathways exist which sequester chemokine's and act as chemokine scavengers (Sanchez-Madrid and del Pozo, 1999; Thelen, 2001). These atypical orphan chemokine receptors include human Duffy antigen receptor for chemokine's (DARC), D6 receptor, CCRL2, chemocentryx chemokine receptor (CCX-CKR) and CXCR7 (Borroni et al., 2006; Fra et al., 2003). Earlier studies have shown that CCX-CKR is expressed in the brain as well as in various immune cells including microglia, dendritic cells and also in T cells (Zuurman et al., 2003; Townson and Nibbs, 2002). Since CCX-CKR is co-expressed with other chemokine receptors, we investigated whether co-expression of CCX-CKR could alter the signaling of other chemokine receptors. In our study we used HEK293 cells expressing hCXCR3, hCCX-CKR or both. Our results showed that HEK293 cells overexpressing CXCR3 display a chemotactic response towards its ligands (CXCL 9 and CXCLl0). However, co-expression of both hCXCR3 and hCCX-CKR abolished CXCR3 mediated HEK293 migration (Chapter 5, Fig 2A, B). In contrast, in HEK293 cells expressing hCXCR3 and hCX3CR1, we observed a significant migration towards chemokine ligands like CXCLl0 and CX3CR1 suggesting that inhibition of cellular migration occurs only when HEK293 cel ls co-expressed with CXCR3 and CCX-CKR. F luorescence Resonance Energy Transfer (FRET) experiments showed that hCCX-CKR heterodimerized with hCXCR3 in HEK293T but not with other chemokine receptors such as hCCR5 or hGABA81 (Chapter 5, Fig 3A, B). Collectively our data suggest that heteromerization of CXCR3 and CCX-CKR could induces a receptor conformation change which in turn reduced the receptor-ligand binding property causing inhibition of chemotaxis (Vinet et al., 2012). Additionally it was shown that CXCR3 and CCX-CKR receptors are also present on T cells (Loetscher et al., 1996; Gosling et al., 2000).

Therefore we decided to use T cells for studying the effect of inhibition of hCXCR3 mediated migration by hCCX-CKR. Interestingly in these cells we observed an down regulation of CCX-CKR

143

• LL l­a. <( I l.,

CHAPTER 6

expression on stimulation with PHA/IL-2. Further we observed an increased migration of these

cells towards hCXCR3 ligands (Chapter 5, Fig 6C, 6D) which could be due to the fact that loss of

CCX-CKR expression after inflammatory challenge will enable the cells to migrate towards the

sites of inflammation. Further, similar findings were confirmed in primary mouse macrophages

as well in primary mouse microglia (Chapter 5, Suppl Fig 2) suggesting that CCX-CKR forms

a complex with CXCR3 which in turn results in the inhibition of CXCR3 induced chemotaxis.

Collectively these investigations suggest that CCXCK R signaling could open up new field of

research for understanding the chemotactic properties of immune cells.

Summarizing, the data presented in this thesis show that HDACs have an important role in the

glial inflammatory response (Chapter 2) and are possibly important targets in demyelinating

disorders (Chapter 3) . Additionally, we demonstrate that purinergic (Chapter 4) and chemokine

receptors (Chapter 5) have an important role in the regulation of inflammatory responses as

well as cellular migration in microglia and in other immune cells.

144

Sum m a rizing d iscussion

REFERENCES

Alliot F, Godin I, Pessac 8. 1999. Microglia derive from progenitors, originating from the yolk sac, a n d which proliferate in the brain. Brain Res Dev Brain Res 1 1 7 :145-152.

Aung HT, Schroder K, Himes SR, Brion K, van Zuylen W, Trieu A, Suzuki H, Hayashizaki Y, Hume DA, Sweet MJ, Ravasi T. 2006. LPS regulates proinflammatory gene expression in macrophages by altering histone deacetylase expression. FAS EB J 20:1315-1327.

Bannerman P, Hahn A, Soulika A, Gallo V, Pleasure D. 2007. Astrogliosis in EAE spinal cord: derivation from radial glia, and relationships to oligodendroglia. Glia 55:5 7-64.

Bayarsaihan D. 201 1 . Epigenetic mechanisms in inflammation. J Dent Res 90:9-17 .

Bird A . 2002. DNA methylation patterns and epigenetic memory. Genes Dev 1 6:6-21 .

Bode KA, Schroder K , H u m e DA, Ravasi T, Heeg K , Sweet MJ, Dalpke AH. 2007. Hi stone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflammatory gene expression by im pairing transcription factor recruitment. l mmunology 122:596-606.

Borroni EM, Buracchi C, de la Torre YM, Galliera E, Vecchi A, Bonecchi R, Mantovani A, Locati M. 2006. The chemoattractant decoy receptor D6 as a negative regulator of inflammatory responses. Biochem Soc Trans 34:1 014-101 7.

Chakfe Y, Seguin R, Antel JP, Morissette C, Malo D, Henderson D, Seguela P. 2002. ADP and AMP induce interleukin-l beta release from microglial cells through activation of ATP-primed P2X7 receptor channels. J Neurosci 22:3061 -3069.

Chan WY, Kohsaka S, Rezaie P.2007. The origin and cell lineageofmicroglia: new concepts. Brain Res Rev53:344-354.

Detich N, Bovenzi V, Szyf M. 2003. Valproate induces replication-independent active DNA demethylation. J Biol Chem 278:27586-27592.

Dhib-Jalbut S. 2007 . Pathogenesis of myelin/oligodendrocyte damage in multiple sclerosis. Neurology 68:S13-21 ; discussion S43-54.

Dong E, Chen Y, Gavin DP, Grayson DR, Guidotti A. 2010. Valproate induces DNA demethylation in nuclear extracts from adult mouse brain. Epigenetics 5 : 730-735.

Faraco G, Pittelli M, Cavone L, Fossati S, Porcu M, Mascagni P, Fossati G, Moroni F, Chiarugi A. 2009. Histone deacetylase (H DAC) inhibitors reduce the glial inflammatory response in vitro a nd in vivo. N eu robiol Dis 36:269-279.

Ferrari D, Chiozzi P, Falzoni S, Hanau S, Di Virgilio F. 1997. Purinergic modulation of interleu kin-1 beta release from microglial cells stimulated with bacterial endotoxin. J Exp Med 1 85:57 9-582.

Fra AM, Locati M, Otero K, Sironi M, Signorelli P, Massardi ML, Gobbi M, Vecchi A, Sozzani S, Mantovani A . 2003. Cutting edge: scavenging o f inflammatory C C chemokines b y t h e promiscuous putatively silent chemokine receptor D6. J lmmunol 1 70:2279-2282.

Gosling J, Dai rag hi DJ, Wang Y, Hanley M, Talbot D, Miao Z, Schall TJ. 2000. Cutting edge: identification of a novel chemokine receptor that binds dendritic cell- and T cell-active chemokines including E LC, SLC, and TECK. J lmmunol 1 64:2851-2856.

Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, Mehler MF, Conway SJ, Ng LG, Stanley ER, Samokhvalov IM, Merad M. 2010. Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science 330:841-845.

Han SB, Lee JK. 2009. Anti-inflammatory effect of Trichostatin-A on murine bone marrow-derived macrophages. Arch Pharm Res 32:613-624.

Holley JE, Gveric D, Newcombe J, Cuzner ML, Gutowski NJ. 2003. Astrocyte characterization in the m ultiple sclerosis glial scar. Neuropathol Appl Neurobiol 29:434-444.

Huuskonen J, Suuronen T, Nuutinen T, Kyrylenko S, Salminen A. 2004. Regulation of microglial inflammatory response by sodium butyrate and short-chain fatty acids. Br J Pharmacol 141 :874-880.

Ji K, Akgul G, Wollmuth LP, Tsirka SE. 2013. Microglia actively regulate the number of functional synapses. PLoS One 8:e56293.

Kannan V, Brouwer N, Ha nisch U K, Reggen, Eggen BJ, Boddeke HW. 2013. Histone deacetylase inhibitors suppress immune activation in primary mouse microglia. Jour.Neurosci Res (Accepted).

Kettenmann H, Hanisch U K, Noda M, Verkhratsky A. 201 1 . Physiology of microglia. Physiol Rev 91 :461 -553.

Kieseier BC, Stuve 0. 201 1 . A critical appraisal of treatment decisions in multiple sclerosis--old versus new. Nat Rev Neurol 7 :255-262.

145

• 0 u l­o. <l :r l.

CHAPTER 6

Loetscher M, Gerber B, Loetscher P, Jones SA, Pia l i L, C lark- Lewis I, Baggiol in i M, Moser B. 1996. Chemokine receptor specific for IPlO and mig: structure, function, and expression in activated T- lymphocytes. J Exp Med 184:963-969.

Leech S, Kirk J, P lumb J, McQuaid S. 2007. Persistent endothel ia l abnormal ities and blood-bra in barrier leak in primary and secondary progressive mult ip le sclerosis. Neuropathol Appl Neurobiol 33:86-98.

Li Y, Liu B, Zhao H, Sa i lhamer EA, Fukudome EY, Zhang X, Kheirbek T, Fi nkelstein RA, Velmahos GC, deMoya M, Ha les CA, Alam HB. 2009. Protective effect of suberoylani l ide hydroxamic acid aga inst LPS-induced septic shock in rodents. Shock 32:517-523.

Lindsay MA. 2008. microRNAs and the immune response. Trends lmmunol 29:343-351.

Nakaj ima K, Kohsaka S. 1993. Functional roles of microgl ia in the bra in . Neurosci Res 17:187-203.

Pont-Lezica L, Bechade C, Bela rif-Cantaut Y, Pascual 0, Bessis A. 2011 . Physiological roles of microglia during development. J Neurochem 119:901-908.

Ransohoff RM , Brown MA. 2012. Innate immunity in the central nervous system. J Clin Invest 122:1164-1171 .

Ransohoff RM, Cardona AE. 2010. The myeloid cel l s of the central nervous system parenchyma . Nature 468:253-262.

Saijo K, Winner B, Carson CT, Coll ier JG, Boyer L, Rosenfeld MG, Gage FH, G lass CK. 2009. A Nurrl/CoREST pathway in microg lia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cel l 137:47-59.

Sanchez-Madrid F , del Pozo MA. 1999. Leukocyte polarization in cell migration and immune interactions. EMBO J 18:501-51 1 .

Shakespear MR, Ha l i l i MA, I rvine KM, Fai rl ie DP, Sweet MJ . 2011 . H istone deacetylases as regulators of inflammation and immunity. Trends lmmunol 32:335-343.

Sierra A, Encinas JM, Deudero JJ, Chancey JH, Enikolopov G, Overstreet-Wadiche LS, Tsirka SE, Maletic­Savatic M. 2010. Microg l ia shape adult h ippocampal neurogenesis through apoptosis-coupled phagocytosis. Cel l Stem Cel l 7:483-495.

Thelen M. 2001 . Dancing to the tune of chemokines. Nat l mmunol 2:129-134.

Townson JR , Nibbs RJ. 2002. Characterization of mouse CCX-CKR, a receptor forthe lymphocyte-attracting chemokines TECK/mCCL25, SLC/mCCL21 and MI P-3beta/mCCL19: comparison to human CCX-CKR. Eur J lmmunol 32:1230-1241.

U lvmar MH, Hub E, Rot A. 2011 . Atypical chemokine receptors. Exp Cel l Res 317:556-568.

van Weering HR, Boddeke HW, Vinet J, Brouwer N, de Haas AH, van Rooijen N, Thomsen AR, Biber KP. 201 1 . CXCL10/CXCR3 signal ing in g l i a cel ls differentia l ly affects NMDA-induced cel l death in CA and DG neurons of the mouse h ippocampus. H ippocampus 21 :220-232.

Vinet J, van Zwam M, Dijkstra IM, Brouwer N, van Weering H R, Watts A, Meijer M, Fokkens MR, Kannan V, Verzijl D, Vischer H F, Smit MJ, Leurs R, Biber K, Boddeke HW. 2012a . I nhibition of CXCR3-Mediated Chemotaxis by the Human Chemokine Receptor- l i ke Protein CCX-CKR. Br J Pharmacol .

Vinet J, Weering HR, Heinrich A, Ka l in RE, Wegner A, Brouwer N, Heppner FL, Rooijen N, Boddeke HW, Biber K. 2012b. Neuroprotective function for ramified microglia in h ippocampal excitotoxicity. J Neuroinflammation 9:27-2094-9-27.

Zuurman MW, Heeroma J, Brouwer N, Boddeke HW, Biber K. 2003. LPS- induced expression of a novel chemokine receptor (L-CCR) in mouse gl ia l cells in vitro and in vivo. G l ia 41:327-336.

Zhou L, Luo L, Qi X, Li X, Gorodeski G I . 2009. Regulation of P2X(7) gene transcription. Purinergic Signal 5:409-426.

146

ALG EMEN E D ISCUSS IE

Microglia en hun regulatie

Nederlandse samenvatting

Microglia, die het niet-adaptieve immuunsysteem van het centrale zenuwstelsel vormen,

behoren tot de monocytaire lijn van cellen en ontstaan in de muis vanaf embryonale dag

8,5 in de foetale dooierzak. Rond embryonale dag 10,5 migreren de microglia naar het parenchym

van het centrale zenuwstelsel en koloniseren het brein (Alliot et al., 1999; Chan et al., 2007;

Ginhoux et al., 2010; Ransohoff and Cardona, 2010). Uit recente studies is gebleken dat microglia

diverse essentiele functies hebben in het centrale zenuwstelsel: weefsel homeostase, neuronale

plasticiteit, functie van neuronale circuits, antigen presentatie en fagocytose (Ji et al., 2013;

Kettenmann et al., 2011; Nakajima and Kohsaka, 1993; Pont-Lezica et al., 2011; Sierra et al. , 2010).

Cel-intrinsieke eiwitten als histon deacytelases (H DAC) en receptoren voor extrinsieke

factoren zoals purines en chemokines spelen een mogelijke rol in microglia inflammatie en

vooruitgang in dit onderzoeksveld kan leiden tot nieuwe inzichten en strategieen om microglia

activiteit te controleren. Eerdere studies hebben aangetoond dat de inflammatoire respons van

immuun cellen mede gereguleerd wordt door epigenetische processen, zoals DNA methylatie

(Bird, 2002), covalente histon modificaties (Bayarsaihan, 2011) en microRNA expressie (Lindsay,

2008). In het onderzoek beschreven in dit proefschrift is onderzoek verricht naar H DAC eiwitten

als intracellulaire regulatoren van inflammatie en purinerge en chemokine receptoren voor

extracellulaire stoffen als regulatoren van inflammatie in microglia en andere immuun cellen.

De connectie tussen intracellulaire en extracellulaire factoren in de modulatie van microglia

activiteit is beperkt bestudeerd. Het werk beschreven in dit proefschrift had drie doelen:

(a) Het bestuderen van de rol van H DAC eiwitten in het moduleren van de inflammatoire

respons in glia cellen en hun rol in demyeliniserende aandoeningen. (b) Het vaststellen van het effect van H DAC remmers op de expressie en functie van purinerge

receptoren en de invloed op microglia functie.

(c) Het onderzoeken van de rol van chemokine receptor signalering in microglia en in andere immuun cellen.

Samenvatting van de in dit proefschrift beschreven resultaten

Hoofdstuk 2 beschrijft de rol van H DAC eiwitten als intracellulaire regulatoren van de gliale

(microglia, astrocyten) inflammatoire respons. Diverse in vitro studies suggereerden een

stimulerend effect van H DAC remmers op de inflammatoire respons in macrofagen (Aung et al. ,

2006), muis microglia eel lijnen (Huuskonen et al., 2004) en primaire rat microglia (Suuronen

et al., 2003, Suuronen et al., 2006). Echter een onderdrukkend effect van HDAC remmers op de

inflammatoire respons is beschreven in primaire muis dendritische cellen (Bode et al., 2007),

macrofagen (Han and Lee, 2009), humane reumato"ide artritis synoviale fibroblasten (Choo

et al., 2010), in een muis endotoxemia model (Li et al., 2009) en gemengde glia culturen uit het

centraal zenuwstelsel (Faraco et al., 2009). Kortom, de rol van H OAC remmers in de modulatie

van inflammatoire responsen is nog niet duidelijk . De rol van H DAC eiwitten in het moduleren

van de inflammatoire respons werd in twee verschillende glia celtypen, microglia en astrocyten, bestudeerd. Er werd door ons aangetoond dat H DAC genen in microglia en astrocyten tot

expressie gebracht werden, en dat sommige HDAC genen (6, 7, 8, 9, 10 and 11) laag tot expressie

147

Nederlandse samenvatting

kwamen in microglia en dat andere HDAC genen (6, 9 en 10) laag tot expressie kwamen in

astrocyten (Hoofdstuk 2, Fig 1 ). De fysiologische betekenis van deze verschillen in HDAC expressie

niveaus tussen deze twee soorten glia cellen is onduidelijk. Vervolgens werd vastgesteld dat

stimulatie met lipopolysacchariden (LPS) leidde tot een tijdelijke verhoging in de expressie van

HDACs en pro-inflammatoire genen in microglia (Hoofdstuk 2, Fig 2A en 4A). Een vergelijkbaar

effect van LPS op HDAC expressie niveaus werd ook waargenomen in microglia in vivo.

Deze tijdelijke verhoging in HDAC expressie is mogelijk essentieel om de inflammatoire

respons van microglia te beperken (Hoofdstuk 2, Fig 10), een observatie in overeenstemming

met eerdere resultaten waarin werd aangetoond dat HDAC eiwitten TLR-gemedieerde signaal

overdracht moduleren (Shakespear et al., 2011). Tevens is gesuggereerd dat HDAC eiwitten hun

eigen gen expressie negatief reguleren (Aung et al., 2006).

I n astrocyten werd alleen een toename van de expressie van HDACl en HDAC7

waargenomen na een gecombineerde stimulatie met LPS en interfon y (IFNy; Hoofdstuk 2,

Fig 38). Het inflammatoire cytoki ne expressie profiel van microglia en astrocyten (Hoofdstuk 2,

Fig 4A en 48) ondersteund de visie dat microglia als eerste reageren op een LPS-ge·induceerde

ontstekingsreactie terwijl astrocyten op een later moment reageren (Saijo et al., 2009).

Omdat het niveau van HDAC gen expressie verhoogd was na LPS stimulatie in microglia,

werd onderzocht of remmers van HDAC eiwitten de ontstekingsreactie die door LPS werd

ge'induceerd in microglia konden moduleren . Deze studie toonde aan dat HDAC remmers de

LPS-ge·induceerde inflammatoire reactie van microglia konden onderdrukken op het n iveau

van cytokine gen expressie (Hoofdstuk 2, Fig SC en 6C), cytokine secretie (Hoofdstuk 2, Fig 7),

expressie van activatie merkers op het eel oppervlak (Hoofdstuk 2, Fig 8) en cellulaire migratie

(Hoofdstuk 2, Fig 9); suggererend dat HDAC remmers de niet-adaptieve immuunrespons van

primaire muis microglia onderdrukten (Kannan et al., 2013).

In Hoofdstuk 3 werd het effect van HDAC remmer trichostatine A (TSA) op de etiologie

van experimentele auto-immuun encefalitis (EAE), een diermodel voor multiple sclerose,

bestudeerd. Multiple sclerose is een auto-immuun aandoening gekarakteriseerd door

demyelinisatie van zenuwcellen (Ransohoff and Brown, 2012), axon ale schade en gliose (Kieseier

and Stuve, 2011) en verlies van integriteit van de bloed hersen barriere (Dhib-Jalbut, 2007). Er

werd waargenomen dat TSA geen invloed had op het tijdstip van aanvang (Hoofdstuk 3, Fig 2A),

progressie (Hoofdstuk3, Fig 28) of inflammatoire res pons van microglia en perifere macrofagen

in EAE (Hoofdstuk 3, Fig SA en SB). Het is door anderen gerapporteerd dat astrocyten mogelijk

een rol spelen in demyeliniserende aandoeningen (Leech et al., 2007). Opmerkelijk is dat in

in vitro experimenten met primaire astrocyten, 30 nM TSA de inflammatoire respons in deze

cellen zelfs versterkte (Hoofdstuk 3, Fig 6A). Echter, een zelfde dosis TSA onderdrukte de

expressie van inflammatoire cytokines in microglia in respons op LPS en IFNy (Hoofdstuk 3,

suppl Fig 1). Samenvattend, deze in vitro data suggereren dat de toediening van TSA bij EAE

mogelijk leidde tot een verhoogd inflammatoir profiel van astrocyten hetgeen een mogelijke

reden kan zijn voor het feit dat TSA de progressie en het niveau van inflammatie van EAE n iet

onderdrukte. Echter, een beter beg rip van het dosis-respons effect van TSA op de inflammatoire

reactie van microglia en astrocyten tijdens EAE is essentieel alvorens een conclusie te kunnen

trekken wat betreft de rol van TSA in de gliale inflammatoire response bij EAE . Hoofdstuk 2

148

Nederlandse samenvatting

en Hoofdstuk 3 van dit proefschrift suggereren een centrale rol voor HDAC eiwitten in het moduleren van de inflammatoire respons in glia cellen.

In hoofdstuk 4 is de rol van purinereceptoren (met name P2X7) als receptor van extracellulaire regulatoren in de neuroprotectieve functie van microglia bestudeerd. Eerdere studies toonden aan dat geramificeerde microglia niet alleen hun micromilieu verkennen maar ook neuronen beschermen na een beschadiging (Bannerman et al. , 2007; Holley et al., 2003). In dezelfde studie werd beschreven dat de behandeling van organotypische kweken met varierende hoeveelheden N-methyl-D-aspartaat (NMDA) resulteerde in neuronale dood in hippocampale gebieden maar dat neuronen in de dentate gyrus beschermd waren. Onze resultaten toonden aan dat microglia depletie leidde tot meer NMDA-geinduceerde dood van neuronen (Hoofdstuk 4, Fig lA, onderste panel) wat in overeenstemmming is met eerdere observaties van Van Weering en medewerkers (Vi net et al., 2012b ). Diverse studies hebben gerapporteerd dat adenosi ne trifosfaat (ATP) een ligand is voor de P2X7 receptor (van Weering et al., 2011). Organotypische hippocampale slice kweken, gegenereerd uit P2X7 1 muizen, toonden aan dat NMDA-ge·induceerde eel dood uitgebreider was in P2X7-deficiente muizen vergeleken met controle muizen (Hoofdstuk 4, Fig 2C en 2D), suggererend dat P2X7 noodzakelijk is voor microglia-gemedieerde bescherming van neuronen. Verder werd bepaald of de expressie van het P2X7 gen gereguleerd werd HDAC rem me rs. In onze studie werd gevonden dat langdurige behandeling van hippocampale, organotypische kweken met valpro"inezuur (VPA) bescherming bood tegen een daaropvolgende NMDA behandeling (Hoofdstuk 4, Fig 3A). Daarnaast suggereerden onze data dat VPA behandeling leidde tot een verhoogde P2X7R expressie (Hoofdstuk 4, Fig 4A en 4B). Opvallend was dat andere HDC remmers als TSA en natriumbutyraat geen effect hadden op het P2X7 receptor expressie niveau. Eerder is beschreven dat HDAC remmers leidden tot verlaagde DNA methylatie niveuas (Detich et al., 2003; Dong et al., 2010). Een studie van Zhou en medewerkers (Zhou et al., 2009) liet zien dat het humane P2X7 receptor gen gereguleerd werd door CpG eilanden 3' van de P2X7 promoter. Toekomstige experimenten zullen moeten uitwijzen of VPA behandeling resulteerde in verlaagde methylatie van de CpG eilanden in de P2X7 gen promoter.

In HoofdstukS is beschreven hoe chemokines en chemokine receptoren eel migratie reguleren . In het algemeen behoren chemokine receptoren tot de klasse van G-eiwit gekoppelde receptoren (GPCRs) die het cytoskelet reorganiseren leidend tot eel polarisatie en cellulaire migratie (Chakfe et al., 2002; Ferrari et al., 1997). Daarnaast bestaan atypische chemokine receptoren die niet via G-eiwitten signaleren maar chemokines binden en ze zo weg vangen (Sanchez-Madrid and del Pozo, 1 999; Thelen, 2001). Tot deze atypische chemokine receptoren behoort de humane Duffy antigen receptor voor chemokines (DARC), de D6 receptor, CCRL2, de chemocentryx chemokine receptor (CCX-CKR) en CXCR7 (Borroni et al., 2006; Fra et al., 2003). Eerdere studies toonden aan dat CCX-CKR tot expressie komt in het brein en in diverse immuun cellen waaronder microglia, dendritische cellen en T cellen (Zuurman et al., 2003; Townson and Nibbs, 2002). Omdat CCX-CKR tot expressie komt samen met andere chemokine receptoren, werd onderzocht of co-expressie van CCX-CKR de signalering van andere chemokine receptoren be"invloedde. In deze studie werden HEK293 cellen gebruikt die CXCR3, CCX-CKR of beide genen tot expressie brachten. Onze resultaten lieten zien dat HEK293 cellen die CXCR3 tot expressie brachten een chemotactische response vertoonden naar de liganden CXCL 9 en ------------------------------- - - ---

149

Nederlandse samenvatting

CXCLl0. Echter, co-expressie van CCX-CKR met CXCR3 blokkeerde de CXCR3-gemedieerde

migratie van HEK293 cellen (Hoofdstuk 5, Fig 2A en 2B) . Daarentegen, HEK293 cellen die CXCR3

en CX3CR1 tot expressie brachten, lieten een significante migratie naar chemokine liganden

CXCLl0 en CX3CR1 zien, suggererend dat remming van cellulaire migratie alleen optrad in

HEK293 cel len die zowel CXCR3 als CCX-CKR tot expressie brachten. Fluorescence Resonance

Energy Transfer (FRET) experimenten toonden aan dat CCX-CKR heterodimerizeerde met

CXCR3 maar niet met andere chemokine receptoren zoals CCR5 of GABA61

(Hoofdstuk 5, Fig 3A

en 3B). Samengenomen, suggereerden deze data dat heteromerizatie van CCX-CKR met CXCR3

leidde tot een verandering in receptor conformatie hetgeen resulteerde in verminderde

receptor-ligand binding eigenschappen met een remming van chemotaxis als gevolg (Vinet

et al., 2012). Omdat CXCR3 en CCX-CKR receptoren ook aanwezig zijn op T cellen (Loetscher

et al. , 1996; Gosling et al., 2000), zijn T cellen gebruikt om het remmende effect van CCX-CKR

op CXCR3-gemedieerde migratie te bestuderen. In T cellen werd een afname in CCX-CKR

expressie waargenomen na co stimulatie met phytohemagglutinine en interleukine 2. Tevens

werd een toegenomen migratie van T cellen naar CXCR3 liganden waargenomen (Hoofdstuk 5,

Fig 6C en 6D) wat veroorzaakt zou kunnen worden door de verminderde CCX-CKR expressie na

een inflammatoire stimulus en dit stelt de cellen mogelijk in staat te migreren naar de bron van

de ontsteking. Vergelijkbare resultaten werden waargenomen in primaire muis macrofagen en

microglia (Hoofdstuk 5, Suppl Fig 2) suggererend dat CCX- CKR een complex vormt met CXCR3

dat vervolgens CXCR3-ge"induceerde chemotaxis remt. Samengevat, suggereren deze data dat

CCX-CKR signalering een nieuw onderzoeksveld kan vormen aangaande de chemotactische

eigenschappen van immuun cellen.

Samengevat, de data gepresenteerd in dit proefschrift laten zien dat HDAC eiwitten

een belangrijke rol vervullen in de inflammatoire respons in glia cellen (Hoofdstuk 2) en dat

ze mogelijk belangrijke doelwitten zijn in demyeliniserende aandoeningen (Hoofdstuk 3) .

Daarnaast, hebben we aangetoond dat purinerge (Hoofdstuk 4) en chemokine receptoren

(Hoofdstuk 5) een belangrijke rol hebben in de regulatie van de inflammatoire respons en cellulaire migratie in microglia en in andere immuun cellen.

150

ACKNOWLEDGMENTS

Acknowledgements --- --- ----

Finally the time has come to acknowledge and thank the many people I have met during my 4 years PhD in the department and other collaborators. Please forgive me whether I have

forgotten to mention any one of your name ...

First and foremost, I offer my sincere gratitude to my supervisor and promoter Prof. Dr. H.W.G.M. Boddeke for giving me the opportunity to pursue my doctoral studies in the laboratory. Dear Erik, your support, patience, and motivation, were a great factor in completing my PhD. I am very grateful for the care and optimistic attitude which you had towards me which eventually helped me to complete my PhD without troubles and delay. Erik, I am also thankful for providing me an opportunity to work in a team as well as independently. Moreover, I am thankful for all the scientific discussions, valuable suggestions and critical comments about my manuscript and thesis chapters.

I express my sincere gratitude to Dr. B.J .L . Eggen, my supervisor and co-promoter for his guidance and supervision which really helped me a lot to complete my projects in time. Dear Bart, your support and scientific discussions helped me so much to think critically and stay focused about the project. I am glad that we had lots of discussions which helped to improve my scientific writing in this thesis. I am also grateful for your confidence in me, your inspiration, patience, and your help to get my manuscript published.

Sincere thanks to our collaborator Prof. Dr. K. P.H. Biber for giving me the scientific input and suggestions and valuable time on the purinoreceptor project.

I also thank our collaborators Dr. Tommy Reggen and Prof. Dr. Uwe Karsten Hanisch for their critical comments and proofreading the manuscript very carefully.

I sincerely thank Dr. Sjef Cop ray, for arranging the scientific discussion with Dr. Patrizia Casaccia, and for all conversations during the lab days.

Thanks to the members of the reading committee: Prof. Dr. U.L.M Eisel, Prof. Dr. O.C.M. Sibon and Prof. Dr. L.A" Hart for sparing their time and careful reading of the thesis and for their valuable suggestions.

I owe sincere thanks to all the staff at BCN graduate school: Diana, Janine for all their help, and support during the last 4 years. I thank Gerry for her valuable administrative work which really helped me to get ready with my visa things in a faster and easier way. I thank Trix van der Sluis especially for helping me with the paper work for the defense.

My sincere thanks to Mieke Kapteyn, at the Graduate School of Medical Sciences for arranging paper work related to the defense.

My sincere thanks to Nieske Brouwer for her valuable help, Evelyn Wesseling, for her kind co-operation and Loes Drenth for her cell culture instructions and for taking care of our microglial cultures.

Thanks to Dr. Jonathan Vinet in our department for the scientific discussions as well as for working together on the chemokine receptor project.

151

Acknowledgements

I am grateful to Dr. Raj. Patel, Dr. Mark Leyland, Dr. N. Subramanian my ex-supervisors for their

scientific support and inspiration to start with my PhD in the Dept. of Neuroscience in Groningen.

I would like to give thanks to Ming-san, for his friendly and caring nature you have shown towards

me during my PhD time. I admire your help and favour which you do for very one in the lab. I

enjoyed all our conversations and discussions which we had. Good luck with finishing your PhD.

My sincere thanks to Wandert, for motivating me with his words and nice talks during the

microglia isolation times and for his friendly attitude towards me. You have really helped me in

becoming socialising with other colleagues and I still remember you keep saying to me I should

become "stress resistant" in science whenever I faced some difficulties in the project which I

will keep in my mind while continuing in science. Good luck with your completion of your PhD.

Laura, you are very hard working and an interested student towards science. Thanks a lot for

helping us with pups isolations whenever we needed it and also for having Spanish parties. I

Wish you good luck with your job.

I sincerely thank Marcin, for his honesty and nice talks with me. Thanks for helping and your

friendly nature towards me during the lab works as well as during thesis writing. I enjoyed

playing pool with you as well as our talks during break times. Finally I admire your nature

towards taking care of all the colleagues when they need any help. Good luck and success with

completing your PhD.

Kasia, thanks for your help and giving me materials when I needed them and also for your

friendly nature. Good luck with completing your PhD.

I thank Ria, third office mate, who helped in translating the Dutch conversations to English

always with patience. We had nice discussion about our work vacation, holidays. I admire your

polite attitude and your quiteness in our office.

Tjalling who helped in fixing the computers and connections. Thanks to Wieb, Inge and Rob for

their opinion during section meetings while presenting my work.

Inge, my sincere thanks for giving your feedback on my scientific presentation which really

helped me to improve to present my work. I admire your independence, honesty and truthful

towards science. Thanks for all the scientific discussions which we had and also for joining with

the coffee breaks. Wish you a good luck with PhD time.

I thank Ilia, for his service for scoring the mice and with injections. I thank you for this co­

operation and time which you have invested in the project.

I thank my other colleagues Koen, Duca, Su ping, Zhilin, Zhoran, ltje, Michel, Ellie, Kumar, Divya,

and Arun for making the working environment very friendly as well as for their co-operation.

I also thank the ex-lab mates Reinhard, Marta, Falak, Fabrizio for their comments in the lab

meeting and for their co-operation. I thank Xin for his friendly and nice talks.

I sincerely thank Sham for his help and inspiration during my PhD times and also for cheering me

up with several jokes. I really enjoyed all discussions and dinners together, our conversations

also helped me to proceed with my lab work smoothly.

152

Acknowledgements

I sincerely thank Raj for his friendly nature and help towards me. I admire your honesty and hard working attitude . You have really made me interested in working with viral transduction in microglia l cells and taught me so many things which I need to keep in mind.

I thank all other ex-masters students Sjaak. Mense. Silvia and present masters students Lasse, Sabrina, Eunice, Chiwan and Thijs for making the working environment in the department friendly and encouraging.

I thank Henk Moes, Geert Mesander and Roelof - Jan van der Lei at the FACS facility for their help, assistance and co-operation for sorting and acquisition of samples.

I thank all people in the animal facility for their help and co-operation for doing the animal work.

My special thanks to my friends: Vipin, Jayabalan, Devi, Smitha, Venkatesh, lndranil, Meena, Seema for all their help, support and care which helped me go forward in my scientific career.

My special thanks for Shankara Narayanan for considering me as one among them in the family for support and encouragement at a ll times of my PhD life.

Last but not the least. I thank my family (Appa, Amma, Vidhya akka, Ba lu bhava, Madhu anna, Lavanya vathina, Rishi, Lakshmi, Koushik and Sahithiya, my lovely fiancee) for their constant support, encouragement and showing confidence in me and for being there for me in good and bad times. Without their support and insipiration I couldn't have completed my PhD. Before the end, I like to remember my late Grandmother, who protected, encouraged and supported me to become successful in my career. I miss you athaa.

Vishnu Kannan

153