University of Groningen

Congenital bowel disordersWerf, Christine Suzanne van der

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2012

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Werf, C. S. V. D. (2012). Congenital bowel disorders. Groningen: s.n.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 01-07-2020

.__________ genital Bowel

Disorders Christine van der Werf

Congenital Bowel

Disorders

Christine van der Werf

-r...-._

Stellingen behorende bij het proefschrift:

Congenital Bowel Disorders

Christine van der Werf, 31 oktober 2012

1. Autosomal recessive Congenital Short Bowel Syndrome is caused by mutations in CLMP. (this

thesis)

2. For the identification of the underlying gene of an autosomal recessive disorder, one patient can

be sufficient. (this thesis)

3. When a male patient presents with Congenital Short Bowel Syndrome, clinicians should be

aware of the possibility of a causative mutation in FLNA. (this thesis)

4. Research on rare disorders can help to understand general mechanisms of disease pathogenesis.

(this thesis)

5. In case of negative results it does not imply that they are untrue. (this thesis)

6. CSBS patients with mutations in CLMP are very similar to CSBS patients with mutations in the

second exon of FLNA, suggesting that CLMP and FLNA are part of the same protein network. (this

thesis)

7. Next to CLMP and FLNA, probably more genes are involved in the pathogenesis of Congenital

Short Bowel Syndrome. (this thesis)

8. The distance between insanity and genius is measured only by success. (Ian Fleming, born in

London)

9. Alleen domoren weten op iedere vraag het antwoord. (Voltaire, geboren te Parijs)

10. Faith is taking the first step even when you don't see the whole staircase. (Martin Luther King Jr,

born in Atlanta)

11. You kind of live and die by the serve. (Pete Sampras, born in Washington DC)

12. Courage is not freedom from fear, it's being afraid and having the strength to carry on. (the

officer Michael ceriale memorial foundation, Chicago)

13. Je moet als wetenschapper niet zeggen: we gaan dit bewijzen. Je moet juist will en weten hoe

iets zit. (Ronald Plasterk)

14. nkakra nkakra, akok:l benum nsuo. (Good things grow easy )

Congenital Bowel Disorders C.S. van der Wert

Thesis, University of Groningen, with summary in English and Dutch.

The research presented in this thesis was mainly performed at the department of Genetics, University Medical Centre Groningen, University of Groningen, Groningen, the Netherlands and was financially supported by the Junior Scientific Masterclass (Univeristy of Groningen), the Ter Meulen Fund, the van Walree Fund, the Royal Netherlands Academy of Arts and Sciences, the Dutch Digestive Foundation, the J. K. de Cock Stichting, and the Stichting Simonsfonds.

Printing of this thesis was financially supported by Rijksuniversiteit Groningen, Groningen Univers�y"'f�te for Drug Exploration (GUIDE), and the Dutch Digestiv6Foun filion.

\ ) ! Cover design and layout �y..._ ..9.aupia Gonzalez Arevalo (argo1983@gmail.com). 1r�N t<o�

Printed by: � Lovebird design & printing solutions, V (Wroclaw, Poland)

© 2012 C.S. van der Wert. All rights reserved. No part of this book may be reproduced or transmitted in any form or by any means without permission of the author.

ISBN: 978-90-367-5639-6

B!]IDE� Research Institute far

Orur f•plorarfon

MAAGO LEVER DARM STICHTING

umcG � /

rijks�niversiteit � gronmgen

RIJKS�IVERSITEIT GRONINGEN

Congenital Bowel Disorders

Proef schrift

ter verkrijging van het doctoraat in de

Medische Wetenschappen

aan de Rijksuniversiteit Groningen

op gezag van de

Rector Magnificus, dr. E. Sterken,

in het openbaar te verdedigen op

woensdag 31 oktober 2012

om 16.15 uur

door

Christine Suzanne van der Werf

geboren op 14 april 1985

te Agogo, Ghana

C..:nir.ile

lvkJi��ht:

Bihltutlin:k Gromug..:n

u M C (j

Promotor:

Beoordelingscommissie

Prof.cir. R.M.W. Hofstra

Prof.cir. J.H. Kleibeuker

Prof.cir. R.M.H. Wijnen

Prof.cir. I.T. Shepherd

Please don't give up the fight

For no reason, but your own

I never said the fight would be easy

Because it won't

(Racoon)

This thesis is dedicated to all patients with rare

genetic disorders and their families

Table of Contents

Chapter 1 General Introduction 13

Chapter 2 CLMP is required for intestinal development, 25 and loss-of-fuction mutations cause Congenital Short-Bowel Syndrome

Chapter 3 CLMP is essential for intestinal development, 51 but does not play a key role in cellular processes involved in intestinal epithelial development

Chapter 4 Congenital Short Bowel Syndrome as the 67 presenting symptom in male patients with FLNA mutations

Chapter 5 A female patient with persistent pulmonary 79 hypertension of the newborn and Congenital Short Bowel Syndrome

Chapter 6 Congenital Short Bowel Syndrome: a review 91 and guide for clinical and genetic diagnosis

Chapter 7 Trying to unravel the genetics of megacystis- 109 microcolon-intestinal hypoperistalsis syndrome

Chapter 8 General discussion and future perspectives 121

Summary 133

Samenvatting 139

Acknowledgments 145

Curriculum Vitae 157

List of abbreviations 161

• •

G e n e r a 1

Introduction

Congenital bowel disorders

The focus of this thesis is on two congenital disorders in which the bowel is

affected, namely Congenital Short Bowel Syndrome (CSBS) and megacystis­

microcolon-intestinal hypoperistalsis syndrome (MMIHS). A shortened small

intestine and malrotation are the main features in Congenital Short Bowel

Syndrome (Figure 1). In megacystis-microcolon-intestinal hypoperistalsis

syndrome the main features are a giant bladder (Figure 2A), a microcolon

(Figure 2B) and hypoperistalsis, while a shortened small intestine is also seen

in some patients.1 More than 40 cases with CSBS2 and more than 200 cases

with MMIHS1 have been published in the literature. Both syndromes have been

described in siblings of both sexes and in consanguineous families, and were

therefore thought to have an autosomal recessive pattern of inheritance. The

genetic cause of both disorders was unknown.

Congenital Short Bowel Syndrome

History

Congenital Short Bowel Syndrome (CSBS) was first described by Hamilton et al

in 1969.3 They described a 6-year old girl who was diagnosed with a shortened

small intestine at the age of 7 months. The diagnosis was made by laparotomy

for continuing symptoms of chronic diarrhoea with unknown cause. The patient

also had a malrotation of the gut with a left-sided cecum and appendix. She

did not have any other abnormalities except for a minor irregularity of the fifth

middle phalanx of the hand. Her parents were unrelated and gave birth to five

girls of whom three were healthy. One sibling died at the age of 1 month, and

a week prior to death, a short small intestine and malrotation were detected at

laparotomy.3 After this first publication of CSBS, more than 40 additional case

reports followed.

Clinical presentation

Patients usually present early in life with bile-stained vomiting and diarrhoea or

failure to thrive. A shortened small intestine and malrotation (Figure 1) are often

detected by ultrasound and confirmed by laparotomy. Other reported anomalies

are an absent appendix,4·6 volvolus,7·8 shortened colon,H,9 hypertrophic pyloric

stenosis,10·15 and a patent ductus arteriosus.11

•13

CSBS patients need total parenteral nutrition (TPN) to survive. Unfortunately,

most patients die of the complications of TPN, which include sepsis and liver

failure.16

Histological findings

In most CSBS patients there are no abnormal histological findings in biopsy tissue

of the gut.3•6•11 However, on studying bowel tissue of CSBS patients, Tanner et al

described the presence of too many neurons in the ganglia, absent or reduced

number of intrinsic argyrophilic ganglion cells, and neuronal nuclei with clumped

chromatin, which is characteristic for neuroblasts.14 In addition, Schalamon et

al observed an abnormal bowel wall with signs of neuronal intestinal dysplasia

in their CSBS patients.17 In one CSBS patient heterotopic gastric mucosa was

found.18 Unfortunately, histology specimens were not obtained from all cases.

Genetics

Familial occurrence of CSBS, in which siblings of both sexes were affected, was

described in around 60% of the cases and consanguinity was seen in around

Figure 1. Congenital Short Bowel Syndrome is characterized by a congenital shortened small intestine and malrotation.

(Illustration: Tom de Vries Lentsch)

•• •

25% of the cases. An autosomal recessive pattern of inheritance was therefore suggested.10·13 However, in a few cases the condition was more likely to be X-linked.11•15

Our identification of CLMP as the affected gene in autosomal recessive CSBS is described in Chapter 2 of this thesis, and our finding of FLNA as the affected gene in X-linked CSBS is described in Chapter 4.

Pathogenesis

The aetiology of CSBS is unknown. The first hypothesis, proposed by Hamilton et al in 1969 concerns a problem in the intestinal development between the 7th and 10th week of the pregnancy, the stage in which an umbilical hernia is present in the human embryo. They believed a problem in the accommodation of the intestine into this umbilical coelom, or the return of the intestine from the umbilical coelom into the abdominal cavity, might cause CSBS.2•1 9 Others suggested that intrauterine volvulus or intussuception, leading to ischemia and autoanastomosis, and autoamputation or intrauterine vascular events might result in a congenital short small intestine.6•12•1 9 These hypotheses are supported by the fact that volvulus has been described in a few patients7•8 and that mouse models for FLNA show vascular defects.20,21

As abnormal peristalsis has been observed in some CSBS patients, Sansaricq et al hypothesised that CSBS patients may lack synthesis of neurotransmitters.11 However, abnormal peristalsis is not reported in all patients. In addition, Schalamon et al suggested that CSBS patients lack growth­stimulating hormones like epidermal growth factor, insulin-like growth factor, and human growth hormone. However, they did not observe abnormal hormone levels in their patient.17

Megacystis-microcolon-intestinal hypoperistalsis syndrome

History

Megacystis-microcolon-intestinal hypoperistalsis syndrome was first described by Berdon et al in 1976. They described five affected girls with abdominal distension due to a giant bladder, microcolon and intestinal obstruction due to absent or reduced intestinal peristalsis.22 Two of these girls were siblings. After this publication more than 200 patients with MMIHS were reported in the

B

Microcolon

Figl.l'e 2. In Megacystis-Microcolon-lntestinal Hypoperistalsis Syndrome the main features are a giant bladder (A), a microcolon (B) and hypoperistalsis. (Illustration: Tom de Vries Lentsch)

literature.23

Clinical presentation

MMIHS might be identified during pregnancy by the ultrasound finding of an enlarged

bladder at as early as 16 weeks' gestation. Both poly- and oligohydramnion

have been reported. After birth, patients with MMIHS present with abdominal

distension, bile-stained vomiting and the absence of spontaneous voiding. Plain

abdominal films are usually suggestive for MMIHS. A megacystis and microcolon

are detected at exploratory laporatomy and these are always found in MMIHS

patients. Other features less frequently described in MMIHS patients include

malrotation, short-bowel syndrome, dilated proximal small bowel and stenosis

of the small bowel.23.24

Management of MMIHS patients is difficult. Many prokinetic drugs have

been tried, but are unsuccessful.24 Many different surgical interventions have

been reported, also without success.23.24 Only around 20% of the reported

patients were alive at the time of publication. Most patients die due to sepsis,

malnutrition and multiple organ failure. Patients need total parenteral nutrition

and multivisceral transplantation to survive.23

Histological findings

For about half of the reported MMIHS patients, histological studies were

included. In most of them, there were no abnormalities of the nerves plexuses.23

Hypoganglionosis,25 aganglionosis,26 hyperganglionosis25•26 and dysganglionosis27

General Introduction 17

were reported in single case reports. Immature ganglion cells were seen in some

cases.27 Other abnormal histological findings include decreased or increased

nerve fibres,24 decreased vasoactive intestinal polypeptide and peptide histidine

methionine fibres, and increased substance P and leucine-enkephalin f ibres.28

Abnormalities of the smooth muscle cells have also been reported. An

absence of or markedly reduced interstitial cells of Cajal, a-smooth muscle

actin, and other contractile and cytoskeletal proteins and vacuolar degeneration

of the smooth muscle cells were reported in some patients.29•30

Genetics

Nineteen familial cases of MMIHS, affecting siblings of both sexes, have been

reported in the literature. The parents were consanguineous in four families, so

that an autosomal recessive pattern of inheritance has been suggested. More

than twice as many females as males have been reported, suggesting MMIHS

has a female predominance.23•24 However, until now, no genetic cause of the

disease has been identified.

In Chapter 7 of this thesis a genetic approach for identifying the cause

of MMIHS is discussed.

Pathogenesis

The aetiology of MMIHS is unknown, with the proposed hypotheses mainly based

on histological findings. Neuropathic25•27•28 and myopathic29•30 changes of the

bowel wall are suggested to be the underlying cause of the disease. In addition,

Jona et al thought that MMIHS patients might have a problem in acetylcholine

storage or production. This was based on the positive effect of bethanechol, a

cholinergic agent, on the small bowel peristalsis in their patient.31

Mouse models of MMIHS include knockouts of the subunits of the nicotinic

acetylcholine receptor: The a3-/- and 132-/-,134-/- mice show similar features to

MMIHS, primarily an enlarged bladder:32•33 In addition, intestinal hypoperistalsis

was present in the 132-/-,134-/- mice. The intestinal length was also reduced

in these mice, but as the mice were also smaller in size it was reduced

proportionally.33 Since the lack of the a3 subunit was seen in MMIHS tissues,

it has been suggested to be the cause of MMIHS.34 However, Lev-Lehman et

al performed mutation analysis in the human CHRNB4 and CHRNA3 genes in

13 MMIHS patients and their family members and did not identify any loss-of­

function mutations.35

Aims and outline of this thesis

The aims of the research presented in this thesis were to identify and characterize

the genes underlying Congenital Short Bowel Syndrome and megacystis­

microcolon-intestinal hypoperistalsis syndrome.

In Chapter 2 we describe the identification of homozygous and compound

heterozygous mutations in CLMP in seven CSBS patients from five different

families. lmmunostainings on human embryos and knockdown experiments in

zebrafish were performed in an attempt to understand the role of CLMP in the

development of the intestine. Transfection of both wild-type and mutant CLMP

showed mislocalization of the mutant CLMP.

In Chapter 3 the function of CLMP is further studied, making use of T84

cell lines overexpressing both WT and mutant CLMP. Assays were performed to

determine the role of CLMP in migration, proliferation, viability and transepithelial

electrical resistance formation. Furthermore we performed aggregation assays

in CHO cells to determine the role of CLMP in adhesion.

In Chapter 4 we describe how male patients with mutations in FLNA can

present with Congenital Short Bowel Syndrome. A two-base-pair deletion in the

second exon of FLNA was found in one X-linked family and in one isolated male

CSBS patient. As the mother of the isolated patient did not carry the deletion,

we concluded that this mutation occurred de nova in this patient.

A case report of a female patient who presented with persistent pulmonary

hypertension and Congenital Short Bowel Syndrome is described in Chapter 5.

This case illustrates how additional genes might be involved in Congenital Short

Bowel Syndrome besides CLMP and FLNA.

In Chapter 6 we give an overview of all the literature on CSBS and, on the

basis of this, we make a recommendation for genetic counselling. The aetiology

of CSBS remains obscure but we propose some possible disease mechanisms.

A genetic approach for identifying the gene underlying MMIHS is discussed

in Chapter 7. Both homozygosity mapping and exome sequencing were used in

an attempt to find the affected gene in this disease.

A general discussion and future perspectives are presented in Chapter 8.

References

1. Gosemann JH, Puri P. Megacystis microcolon intestinal hypoperistalsis syndrome: systematic review of outcome. Pediatr Surg Int. 2011;27:1041-6.

2. Van der Werf CS, Verheij JBGM, Hofstra RMW. Congenital Short Bowel Syndrome: a review and guide for clinical and genetic diagnosis. Manuscript is ready for submission.

3. Hamilton JR, Reilly BJ, Marecki R. Short small intestine associated with malrotation: a newly described congenital cause of intestinal malabsorption. Gastroenterology. 1969;56:124-36.

4. Sabharwal G, Strouse PJ, Islam S, et al. Congenital short-gut syndrome. Pediatr Radio/. 2004;34:424-7.

5. lwai N, Yanagihara J, T suto T, et al. Congenital short small bowel with malrotation in a neonate. Z Kinderchir. 1985;40:371-3.

6. Sarimurat N, Celayir S, Elicevik M, et al. Congenital short bowel syndrome associated with appendiceal agenesis and functional intestinal obstruction. J Pediatr Surg. 1998;33:666-7.

7. Tanner MS, Smith B, Lloyd JK. Functional intestinal obstruction due to deficiency of argyrophil neurones in the myenteric plexus. Familial syndrome presenting with short small bowel, malrotation, and pyloric hypertrophy. Arch Dis Child. 1976;51 :837-41.

8. Kern IB, Leece A, Bohane T. Congenital short gut, malrotation, and dysmotility of the small bowel. J Pediatr Gastroenterol Nutr 1990;11 :411-5.

9. Yutani C, Sakurai M, Miyaji T, et al. Congenital short intestine. A case

I

report and review of the literature. Arch Pathol. 1973;96:81-2.

10. Schnoy N, Bein G, Dumke K. [Familial occurence of congenital short bowel (author's translation)]. Monatsschr Kinderheilkd. 1978;126:431-5.

11. Sansaricq C, Chen WJ, Manka M, et al. Familial congenital short small bowel with associated defects. A long-term survival. Clin Pediatr (Phi/a). 1984;23:453-5.

12. Kern IB, Harris MJ. Congenital short bowel. Aust NZ J Surg. 1973;42:283-5.

13. Royer P, Ricour C, Nihoul-Fekete C, et al. [T he familial syndrome of short small intestine with intestinal malrotation and hypertrophic stenosis of the pylorus in infants]. Arch Fr Pediatr 197 4;31 :223-9.

14. Tanner MS, Smith B, Lloyd JK. Functional intestinal obstruction due to deficiency of argyrophil neurones in the myenteric plexus. Familial syndrome presenting with short small bowel, malrotation, and pyloric hypertrophy. Arch Dis Child. 1976;51:837-41.

15. Nezelhof C, Jaubert F, Lyon G. Familial syndrome combining short small intestine, intestinal malrotation, pyloric hyperthrophy and brain malformation. 3 anatomoclinical case reports. Ann Anat Pathol. 1976;21:401-12.

16. Chu SM, Luo CC, Chou Y H, et al. Congenital short bowel syndrome with malrotation. Chang Gung Med J. 2004;27:548-50.

17. Schalamon J, Schober PH, Gallippi P, Matthyssens L, Hollwarth ME. Congenital short-bowel; a case study and review of the literature. Eur J Pediatr Surg. 1999;9:248-50.

18. Shehata B, Chang T, Greene C, et al.

Gastric heterotopia with extensive involvement of the small intestine associated with congenital short bowel syndrome and intestinal malrotation. Fetal Pediatr Pa tho/. 2011 ;30:60-3.

19. Aviram R, Erez I, Dolfin TZ, et al. Congenital short-bowel syndrome: prenatal sonographic findings of a fatal anomaly. J Clin Ultrasound. 1998;26:106-8.

20. Berdon WE, Baker DH, Blanc WA, et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome: a new cause of intestinal obstruction in the newborn. Report of radiologic findings in five newborn girls. AJR Am

J Roentgenol. 1976;126:957-64. 21. Feng Y, Chen MH, Moskowitz IP, et al.

Filamin a (FLNA) is required for cell­cell contact in vascular development and cardiac morphogenesis. Proc Natl Acad Sci U S A. 2006;103:19836-41.

22. Hart AW, Morgan JE, Schneider J, et al. Cardiac malformations and midline skeletal defects in mice lacking filamin A. Hum Mo/ Genet. 2006;15:2457-67.

23. Gosemann JH, Puri P. Megacystis microcolon intestinal hypoperistalsis syndrome: systematic review of outcome. Pediatr Surg Int. 2011;27:1041-6.

24. Puri P, Shinkai microcolon intestinal syndrome. Semin 2005;14:58-63.

M. Megacystis hypoperistalsis Pedriat Surg.

25. Young LW, Yunis EJ, Girdany BR, et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome: additional clinical, radiologic, surgical, and histopathologic aspects. AJR Am J Roentgenol. 1981;137:749-55.

26. Vezina WC, Morin FR, Winsberg F. Mega cyst is-mi c roe o Ion-int est in a I

hypoperistalsis syndrome: antenatal ultrasound appearance. AJR Am J Roentgenol. 1979;133:7 49-50.

27. Kirtane J, Talwalker V, Dastur DK. Megacystis, microcolon, intestinal hypoperistalsis syndrome: possible pathogenesis. J Pediatr Surg. 1984;19:206-8.

28. Taguchi T, Ikeda K, Shono T, et al. Autonomic innervation of the intestine from a baby with megacystis microcolon intestinal hypoperistalsis syndrome: I. lmmunohistochemical study. J Pediatr Surg. 1989;24:1264-6.

29. Rolle U, O'Briain S, Pearl RH, et al. Mega cyst is-m icrocolon-intest in a l hypoperistalsis syndrome: evidence of intestinal myopathy. Pediatr Surg Int. 2002;18:2-5.

30. Piotrowska AP, Rolle U, Chertin B, et al. Alterations in smooth muscle contralie and cytoskeleton proteins and interstitial cells of Cajal in megacystis microcolon intestinal hypoperistalsis syndrome. J Pediatr Surg. 2003;38:7 49-55.

31. Jona JZ, Werlin SL. The megacystis microcolon intestinal hypoperistalsis syndrome: report of a case. J Pediatr Surg. 1982;16:749-51.

32. Xu W, Gelber S, Orr-Urtreger A, et al. Megacystis, mydriasis, and ion channel defect in mice lacking the alpha3 neuronal nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A. 1999;96:57 46-51.

33. XuW, Orr-Urtreger A, Nigro F, et al. Multiorgan autonomic dysfunction in mice lacking the beta2 and the beta4 subunits of neuronal nicotinic acetylcholine receptors. J Neurosci. 1999;19:9298-305.

34. Richardson CE, Morgan JM, Jasani B,

Generallntroductioff·;,;_-� . -.. _ ' . 21 . _ •• .,1=.... .... �---· .-!....". ,001 / \•. · ... --• -1·.. ,. •

et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome and the absence or the alpha3 nicotinic acetylcholine receptor subunit. Gastroenterology. 2001 ;121:350-7.

35. Lev-Lehman E, Bercovich D, Xu W, et al. Characterization of the human beta-4 nAChR gene and polymorphisms in CHRNA3 and CHRNB4. J Hum Genet. 2001 ;46:3626.

General Introduction 23 ---- --- ----- -

CLMP is re q ui r e d. fo r and. i nt e s t i nal d e v e l o pme nt ,

l o s s - o f - f unc t i o n mut at i o ns c aus e C o nge ni t al Sho r t - B o we l Syn d r o me

Christine S. van der Werf1 , Tara D Wabbersen2, Nai-Hua Hsiao3, Joana Paredes4, Heather C. Etchevers�. Peter M. Kroisel6 , Dick Tibboel7 , Candice Babarit5, Richard A. Schreiber-!\ Edward J. Hoffenbergl, Michel Vekemans�, Sirkka L. Zeder 10

, Isabella Ceccherini1 1 , Stanislas Lyonnet!>, Ana S. R1be1ro1

, Raquel Seruca·i, Gerard J. te Meerman 1, Sven C. D. van IJzendoorn3, lain T.

Shepherd , Joke B. G. M. Verheij1 , Robert M. W. Hofstra 1 . 1Department of Genetics, University Medical Centre Groningen, University of Groningen, Groningen, P.O. Box 30.001 , 9700 RB, Groningen, The Netherlands. "Department of Biology, Emory University, Atlanta, USA. 3The Membrane Cell Biology section, Department of Cell Biology, University Medical Centre Groningen, University of Groningen, Groningen, The Netherlands. 4The Cancer Genetics Group, the Institute of Molecular Pathology and Immunology of the University of Porto, Porto, Portugal. Departement de Genetique, INSERM, U78 1 , H6p1tal Necker-Enfants Malades, Universite Paris Descartes, Paris, France. 6 lnstitute of Human Genetics, Medical University of Graz, Graz, Austria. 7Department of Pediatric Surgery, Erasmus MC-Sophia Children's Hospital, PO Box 2060, 3000 CB, Rotterdam, The Netherlands. 8The Division of Gastroenterology, BC Children's Hospital, Rm K4-200, 4480 Oak Street, Vancouver, Canada. 9Department of Pediatrics, Section of Pediatric Gastroenterology, Hepatology, and Nutrition, University of Colorado, Denver, CO, USA ·10oepartment of Pediatric Surgery, Medical University of Graz, Graz, Austria. 1 1Laboratorio di Genet1ca Molecolare, lst1tuto Giannina Gaslini - 16148 Genoa, Italy.

Gastroenterology. 2012;142:453-462.e3.

Abstract

Background & aims.

Short-bowel syndrome usually results from surgical resection of the small

intestine for diseases such as intestinal atresias, volvulus, and necrotizing

enterocolitis. Patients with congenital short-bowel syndrome (CSBS) are born

with a substantial shortening of the small intestine, to a mean length of 50 cm,

compared with a normal length at birth of 190-280 cm. They also are born with

intestinal malrotation. Because CSBS occurs in many consanguineous families,

it is considered to be an autosomal-recessive disorder. We aimed to identify and

characterize the genetic factor causing CSBS.

Methods. We performed homozygosity mapping using 610K single-nucleotide

polymorphism arrays to analyze the genomes of 5 patients with CSBS. After

identifying a gene causing the disease, we determined its expression pattern in

human embryos. We also overexpressed forms of the gene product that were

and were not associated with CSBS in Chinese Hamster Ovary and T84 cells

and generated a zebrafish model of the disease.

Results. We identified loss-of-function mutations in Coxsackie- and adenovirus

receptor-like membrane protein (CLMP) in CSBS patients. CLMP is a tight­

junction-associated protein that is expressed in the intestine of human embryos

throughout development. Mutations in CLMP prevented its normal localization

to the cell membrane. Knock-down experiments in zebrafish resulted in general

developmental defects, including shortening of the intestine and the absence

of goblet cells. Because goblet cells are characteristic for the midintestine in

zebrafish, which resembles the small intestine in human beings, the zebrafish

model mimics CSBS.

Conclusions. Loss-of-function mutations in CLMP cause CSBS in human

beings, likely by interfering with tight-junction formation, which disrupts intestinal

development. Furthermore, we developed a zebrafish model of CSBS.

• Loss-of-function

Introduction

Patients with Congenital Short-Bowel Syndrome (CSBS) are born with a

shortened small intestine. The mean length of the small intestine in CSBS

patients is approximately 50 cm, compared to a normal length at birth of 190-

280 cm.1·3 Patients with CSBS may develop severe malnutrition as a result of

the hugely reduced absorptive surface of the small intestine. This is similar to

acquired Short-Bowel Syndrome (SBS) that results from surgical resection of the

small intestine for diseases such as intestinal atresias, volvulus and necrotizing

enterocolitis. CSBS usually is diagnosed by barium-contrast radiographs and

confirmed by exploratory laparotomy. Infants with SBS, whether congenital or

acquired, need parenteral nutrition to survive, although parenteral nutrition itself

causes life-threatening complications such as sepsis and liver failure, and a high

rate of mortality early in life. However, some long-term survivors of CSBS have

been reported.4•7 Because consanguinity frequently is seen in families in whom

CSBS occurs, an autosomal-recessive pattern of inheritance is suspected. Until

now, nothing was known about the genetic cause of this disease.

Here, we report the identification and characterization of the Coxsackie­

and adenovirus receptor- like membrane protein (CLMP) as a gene underlying

CSBS.

Family Patient Ethnicity Consanguinity Sex Length small Addlllonal Mutations bowel al birth features (cm)

1 1 -1 German unknown Female 30 c.230delA, (p.E77Glsx24), exon 3

(rel 5) -American Heterozygous frameshift

c.821 G>A, exon 6

Heterozygous splice site mutation

2 2-1 Italian + Male unknown c.371T>A, (pV124D), exon 3

Homozygous missense mutation

3 3-1 Turkish + Male 47 Intestinal Homozygous deletion (with presumed

(rel 7) neuronal inversion) in intron 1 dysplasia

3-2 Turkish + Female unknown Intestinal Homozygous deletion (with presumed neuronal inversion) in intron 1 dysplasia

4 4-1 Dutch unknown Female 54 Homozygous deletion of 12483 bp (including

(rel 4) exon 2)

5 5-1 Canadian unknown Male 50 c.664C> T (p.R222X), exon 5

(rel 6) Homozygous nonsense mutation

5-2 Canadian unknown Female unknown c.664C> T (p.R222X), exon 5

Homozygous nonsense mutation

Table 1. Clinical and molecular data from all congenital short-bowel syndrome patients.

Patients and Methods

Research Subjects

T he CSBS patients included in this study, aged 0-26 years, were either described

previously in the literature or were known to physicians in the field4-7 patients were

born with a shortened small intestine with a length of 30 to 54 cm (see Table

1 ). Patients, of whom some were seen by an experienced clinical geneticist, did

not show any other clinical features besides CSBS. All parents were reported as

normal. Patients 2-1 , 3-1 and 3-2 were from consanguineous families. All patients

were Caucasians, except for patients 3-1 and 3-2 who were of Turkish ancestry.

The study protocol was approved by the institutional and national ethics review

committees at the University Medical Centre Groningen (NL31 708.042 .10), and

written informed consent was obtained.

Homozygosity Mapping

Genomic DNA of all participants was extracted from peripheral lymphocytes

by standard methods. A genome-wide scan was performed on 5 patients of

families 1 -4 using the lllumina 610,000 single-nucleotide polymorphism (SNP)

array (lllumina, San Diego, CA) according to the manufacturer's instructions .

. •

Homozygosity mapping was performed by an automatic search for a minimum

of 400 markers in a row (rv2-3 MB) that were homozygous in at least 3 of the

4 families, and identical for patient 3-1 and 3-2 (Because they were from the

same consanguineous family).

Mutation Screening

Analysis of the 7 exons of CLMP (NM_024769.2) and the flanking intronic regions

was performed in all patients and their parents as well as in 77 Caucasian

control individuals (154 control chromosomes). For primer sequences see

Supplementary Table 1. Sequencing was performed (forward and reverse) with

dye labelled primers (Big Dye Terminator v3.1 Sequencing Kit; Applied Biosystems,

Foster City, CA) on an ABI 3730 automated sequencer (Applied Biosystems).

In Silica Analysis of the Missense Mutation

After analysis of the CLMP protein sequence (NP _079045.1) with the blastp

algorithm (available: http://blast.ncbi.nlm.nih.gov/Blast.cgi), homologous

sequences were obtained. The program M-Coffee was used to align them (http://

www.tcoffee.org).8

The effect of the missense mutation was evaluated by the Russell method

at European Molecular Biology Laboratory (available: http://www.russell.embl­

heidelberg.de/aas/),9 the polymorphism phenotyping algorithm (http://genetics.

bwh.harvard.edu/pph/) and the Sort Intolerant From Tolerant algorithm (http://sift.

jcvi.org/).

Functional Analysis of the Splice Site Mutation

To determine the effect of the splice site mutation found in patient 1-1, we

performed an exon trapping assay. We first generated polymerase chain

reaction (PCR) 2.1-TOPO plasmids (lnvitrogen, Carlsbad,CA), containing

the sequences of the exon of interest (wild-type or mutant) and the flanking

intronic sequences. The sequence of interest was PCR-amplif ied using either

a control or the patient's genomic DNA as the DNA template. We used the

primers GGCG-Ecor1, 5'-AAACCTGCAAATACTCATTC-3', and GACG-BamH1,

5'-AAGTGTTTGTTGAGGATAAG-3'. The amplification was performed using

Phusion High-fidelity DNA polymerase (Finnzymes, Helsinki, Finland). The PCR

•

products were inserted into the PCR 2.1 Topo constructs and thereafter digested

with BamH1 and EcoR. T he inserts from control and mutant subsequently were

cloned into the exon trapping vector pSPL3 (invitrogen). T he inserts were checked

by direct sequencing.

Human embryonic kidney (HEK) 293 cells were grown in Dulbecco's

modified Eagle medium supplemented with 10% fetal calf serum and 1 %

antibiotic solution (penicillin/streptomycin; lnvitrogen) at 3 7 ° C in 5% CO2 •

Human embryonic kidney 293 cells were plated in 6-well plates containing

6 x 105 cells/well. After 24 hours the cells were transfected with 1 µ of the

corresponding plasmid using polyethylenimine (Polyscience, Inc, Warrington,

PA) according to the manufacturer's instructions. T ransfections of the vector

containing the wild-type sequences or the empty pSPL3 vector were used as

controls. After 48 hours cells were lysed and RNA was isolated according to

manufacturer's instructions (Qiagen, Venlo, T he Netherlands). A total of 5µ of

total RNA was used as a template to synthesize complementary DNA (cDNA)

using the cDNA primer pd(N)6 (GE Healthcare, Hoevelaken, The Netherlands).

PCR was performed using the primers (SD6) 5'-CT GAGT CACCT GGACAACC- 3'

and (SA2) 5'-AT CT CAGT GGTAT T T GT GAGC-3' and the following amplification

program: 5 minutes at 94 °C, 35 cycles for 1 minute at 94 °C, 1 minute at 60°C

and 5 minutes at 72°C, and a final elongation time of 10 minutes at 72 °C.

Five microliters of cDNA was used for the PCR in a total volume of 50 µL. PCR

products were checked by gel electrophoresis and the exon trapping results

were confirmed by direct sequencing.

Expression of Wild-Type and Mutant CLMP in Chinese Hamster Ova,y Cells and

T84 Cells

A pCMV6-CLMP-green fluorescent protein ( GFP) vector was obtained from

Origene (Rockville, MD). T he missense mutation was introduced in this vector by

site-directed mutagenesis (Stratagene, Amstelveen, Santa Clara, CA) (for primer

sequences see Supplementary Table 2). The wild-type (WT ) and mutant cDNA were

amplified using the primers CCGCC-Nhel, 5'-AT GT CCCT CCT CCT T CT CC-3',

and GGGCGC-Xhol , 5'-T CAGACCGT T T GGAAGGCT CT G-3'. The amplification

was performed using Pushion High-fidelity DNA polymerase (Finnzymes). T he

PCR products were inserted into PCR 2.1 -TOPO plasmid (lnvitrogen). The PCR

2.1 Topo constructs were digested by Nhel and Xhol restriction enzymes and the fragments were cloned into the vector pCMV-internal ribosomal re-entry site (IRES) coupled to eGFP (GFP l ike protein). The clones were checked by direct sequencing.

Chinese hamster ovary (CHO-K1) and human intestinal epithelial T84 cel ls were grown in commercially available alpha modif ication of eagle's medium (AMEM) medium and Dulbecco's modified Eagle medium/F-12, respectively, supplemented with 4.5 mg/L L-glutamine, 10% heat-inactivated fetal bovine serum, and 1 % antibiotic solution (penicill in-streptomycin; all lnvitrogen). The cells were maintained at 37 °C in a humidified atmosphere with 5% CO2_

WT or mutant pCMV-CLMP-IRES-EGFP was transfected in CHO-K1 cells and T84 cells (1.5 x 105) with Lipofectamine 2000 Transfection Reagent ( lnvitrogen) in a 1 :3 dilution, and transfection efficiencies were evaluated by measuring EGFP expression by flow cytometry.

To observe the cell localization of CLMP, transfected CHO-K1 cells were stained by immunofluorescence. Cells were cultured on glass coverslips (Becton D ickinson Labware, Franklin Lakes, NJ), and fixed with 4% paraformaldehyde (20 minutes). After fixation, cells were treated with 50mmol/L NH4CI for 10 minutes, washed with PBS, and permeablilized with 0.1% Triton X-100 (Sigma Aldrich, Zwijndrecht, The Netherlands) in PBS for 5 minutes at room temperature. Nonspecific binding was blocked by cell treatment with PBS containing 5% bovine serum albumin, for 30 minutes at room temperature. Cells then were stained with a rabbit anti-human CLMP antibody (anti-AP000926.6, Sigma HPA002385, Sigma Aldrich), for 1 hour at a 1:100 dilution. An Alexa 594-conjugated goat anti-rabbit antibody (lnvitrogen) then was used as the secondary antibody. After a wash with PBS, each sample was mounted with Vectashield (Vector labs, Peterborough, United Kingdom) and 4',6-diamidino-2-phenylindole-stained. The cell staining was observed using a Zeiss microscope (lmager Z1, Zeiss, Sliedrecht, The Netherlands) with apotome and images were taken using the Axi ovisi on software (Zeiss).

Transfected T84 cells were fixed with 4% paraformaldehyde at 37 °C for 30 minutes. Cells then were treated with 0.1 mol/L glycine for 10 minutes, washed with PBS, and permeabilized with 0.1% Triton X-100 in PBS at room temperature for 2 minutes. Nonspecific binding was blocked by incubating the cells with

PBS containing 1 % bovine serum albumin and 0.05% Tween 20 (Sigma Aldrich) at room temperature for 1 minute. Cells were immunolabeled with the rabbit polyclonal antibody for CLMP (anti-AP000926.6, Sigma HPA002385), in 1:100 dilution at 37°C for 1 hour. Cells were subsequently washed 5 times with PBS and incubated with mouse monoclonal anti-zonula occludens 1 (ZO-1) antibodies (Zymed, San Francisco, CA) at 1:100 dilution. An Alexa-546-conjugated goat anti-rabbit antibody (lnvitrogen) and a Cy5-conjugated goat anti-mouse antibody were used as secondary antibodies both at a 1:500 dilution. 4',6-diamidino-2-phenylindole (at a 1:1000 dilution) and/or DRAQ5 (Cell Signaling Technology, Leiden, The Netherlands) (at a 1 :500 dilution) were used for nuclear staining. After a wash with PBS, samples were mounted and analysed with a Leica SP2 AOBS confocal laser scanning microscope (Wetzlar, Germany).

CLMP Expression During Human Development

CLMP expression was examined by immunohistochemistry in human embryos and fetal tissue obtained from terminated pregnancies using the mifepristone protocol in concordance with French legislation (94-654 and 08-400) and approved by the Necker Hospital Ethics Committee. Embryonic and fetal tissues were fixed in 4% paraformaldehyde, pH 7.4 or in 1 1% formaldehyde, 60% ethanol, and 10% acetic acid, embedded in paraffin blocks and sectioned at 5 mm. Sections were deparaffinized, rinsed in PBS and incubated 30 minutes in 0.5 mol/L ammonium chloride, rinsed again, and nonspecific binding was blocked by 10% fetal calf serum in PBS for 30 minutes. Classical antigen unmasking in citrate buffer was performed for 20 minutes. Slides were incubated overnight at 4 °C in a humid chamber with the rabbit primary anti-human CLMP antibody (anti-AP000926.6, Sigma HPA002385) at a 1:50 di lution in PBS with 2% fetal calf serum and then rinsed. A goat anti-rabbit-alkaline phosphatase-conjugated secondary antibody was applied at 1 :200 dilution in PBS/2% fetal calf serum, and alkaline phosphatase activity was revealed by the standard nitro-blue­tetrazolium chloride (NBT)-5- bromo-4-chloro-3'-indolyphosphat-p-toluidine salt (BCIP) chromogenic reaction to reveal the immunolocalization of CLMP. Adjacent sections stained without the primary antibody anti-human CLMP were used as negative controls.

Expression Pattern of Orthologs in Zebrafish and Knock-Down Experiments

Zebrafish were kept and bred under standard conditions at 28.5°C.1 0 Embryos were staged and fixed at specific hours after fertilization (hpf). Embryos were grown in media supplemented with 0.2 mmol/L 1-phenyl-2-thiourea (Sigma) to inhibit pigment formation.10

A search for the predicted zebrafish orthologs of CLMP was performed in the Ensembl database (available: www.ensembl.org). To clone the complete open reading frames of the zebrafish orthologs, multiple reverse-transcription (RT)-PCR primers were designed to amplify 5' and 3' overlapping segments of the open reading frame based on the predicted sequences. The cDNA segments were subcloned and sequenced. Sequencher DNA sequence analysis software (Applied Biosystems) was used to assemble the resulting sequences. Rapid amplification of cDNA ends was used to amplify the 5' and 3' ends of the open reading frame. Rapid amplication of cDNA ends was isolated from 72-hpf embryos using a Smart rapid amplification cDNA ends Amp I if ication Kit (Clonetech, Mountain View, CA). The resulting PCR products were subcloned and sequenced to complete the open reading frame sequence for the orthologs. The continuity of the full-length sequence was confirmed by RT-PCR on single­stranded cDNA isolated from 48-hpf embryos. The orthologs were cloned and the sequences were determined by direct sequencing.

Homology studies were completed using publicly accessible programs from SDSC Biology Workbench (San Diego, CA). ClustalW (SDSC) was used to align the amino acid sequences of both zebrafish orthologs (called CLMPa and CLMPb), rat, and human CLMP (called h.CLMP) (Supplementary Figure 2). To determine the temporal expression of CLMPa and CLMPb, RT-PCR was performed at various time points during embryonic and larval development. The primers used amplified a segment of the open reading frame spanning nucleotides 38-881 of CLMPa and nucleotides -3-851 of CLMPb. The following primers were used: CLMPa forward, 5'-GTGATGTCTGCCAGCGCTCG-3', CLMPa reverse, 5'- GGGACGACGACAGAGAGTTC-3', CLMPb forward, 5'- CTGCAGCTGACTGACTCTGG-3' and CLMPb reverse, 5'­GTCTGAAAGGCCTTGCTTTG-3'. The predicted fragment sizes were as follows: for CLMPa, 843 base pairs and for CLMPb, 854 base pairs. To determine the spatial expression patterns of CLMPa and CLMPb, antisense digoxigenin-labeled

probes for both genes were generated and whole mount in situ hybridization was performed as described by Thisse et a/.11

Two different, nonoverlapping, translation-blocking morpholinos (TBMO), a splice-blocking morpholino (SBMO) and a 5-mispair morpholino were designed to target CLMPa and were generated by gene tools (www.gene-tools.com; for morpholino sequences see Supplementary Table 3). Morpholinos wered injected to determine the effects of knocking down CLMPa protein levels.12 The morpholinos were diluted in sterile filtered water over a range of concentrations from 1 to 10 mg/ml. Approximately 1 nl of diluted morpholino was injected at the 1- to 2-cell stage using a gas-driven microinjection apparatus. The morpholino dilutions that resulted in a consistent knockdown of CLMPa were as follows: CLMPa TBMO1 and TBMO2: 2mg/ml, SBMO: 1 mg/ml. A p53 translation-blocking morpholino was co-injected at a concentration of 1.5 times the morpholino concentration to rule out the possibility that the morphant phenotype was caused by a cytotoxic side effect of the morpholinos. A negative control 5-base pair mismatch morpholino based on the sequence of TBMO1 was generated and injected at a concentration of 2mg/ml (Supplementary Table 3). To verify the effectiveness of the CLMP SBMO, RT-PCR was performed on messenger RNA (mRNA) isolated from SBMO-injected and control embryos. The primers used for the RT-PCR were as follows: CLMPaRTPCR forward, 5'- CGCCCTGCTCTTAGTATTGC -3' and CLMP-aRTPCR reverse, 5'- GGGGTTTTGATGGCTTCAAG - 3'.

H&E staining was performed on 3-mm paraffin sections from 96 hpf control and SBMO-injected embryos using standard procedures. The sections were heated for 20 minutes at 60°C, deparaffinised, and hydrated to water. The sections were stained in Haematoxylin 721 1 (Richard Allan Scientific, Kalamazoo, Ml) for 4 minutes, rinsed in water, immersed in Clarifier (Richard Allan) for 1 minute, and rinsed again in water. Subsequently, slides were immersed in Bluing (Richard Allan) for 1 minute, followed by a brief immersion in 95% ethanol, followed by a 45-seconds immersion in Eosin-Y 711 1 (Richard Allan). Slides then were dehydrated in 95% ethanol, followed by absolute ethanol, cleared in xylene, and coverslipped.

For the rescue experiment CLMPa mRNA was made from a pCS2+ expression vector containing the complete Open Reading Frame sequence of the CLMPa ortholog. Synthetic mRNA was synthesized using a mMessage

Loss-of-function • •

mMachine kit (Life Technology, Bleiswijk , the Netherlands).

Results

Loss-of-Function Mutations in CLMP cause Congenital Short-Bowe/ Syndrome

To map the disease gene we performed lllumina 610,000-SNP arrays on 5 patients (1-1 , 2-1, 3-1, 3-2 and 4-1; Figure 1A). We identified a homozygous region shared by 4 (patients 2-1, 3-1, 3-2 and 4-1) on 11 q24.1 , comprising approximately 2 MB and containing 20 genes. In addition, a homozygous deletion in patient 4-1 was identified that involved 5 SNPs (rs7113273, rs7109445, rs4936775, rs7121089 and rs11218981). This deletion leads to a loss of exonic and flanking intronic sequences of exon 2 of CLMP (also called adipocyte specific adhesion

molecule [ASAM]). The deletion results in a frameshift and a premature stop codon. Through PCR and direct sequencing we confirmed that 12,483 base pairs were deleted. Direct sequencing of CLMP in the other patients revealed more mutations. Patient 1-1 was compound heterozygous, carrying a paternally derived heterozygous frameshift mutation (c.589delA) in exon 3, leading to a premature stop codon, and a maternally derived heterozygous potential splice donor site mutation (c.1180G>A). With an in vitro exon trapping assay, we confirmed that c.1 180G>A impairs splicing and likely excludes exon 6 (Supplementary Figure 2A). For the WT sequences the exon was trapped, however, for the mutant it was not. Patient 2-1 carried a homozygous missense mutation (c.730T>A, p.V124D) in exon 3. This missense mutation of a highly conserved amino acid was predicted to be pathogenic by the Russell, polymorphism phenotyping, and Sort Intolerant From Tolerant programs (Supplementary Figure 28). In patients 3-1 and 3-2 we did not find any mutations in the coding sequences of CLMP. We did identify a homozygous deletion (on the array) in the first intron of CLMP

encompassing SNP rs7115102. We confirmed the presence of this deletion with PCR and we showed that this deletion co-segregates with the disease phenotype in this family (Supplementary Figure 2C). However, we were not able to fine-map the deletion using primers in the flanking region. PCR using primer sets flanking the deletion yielded the expected PCR product from controls (of around 5 kb), but no PCR product was detected in the patients (Supplementary Figure 1 C) , whereas a PCR product of around 4 kb was expected. As a result we

hypothesized that an inversion might be present as a way to explain the fact that we were not able to amplify the flanking regions. However, using fluorescence in situ hybridization we were not able to identify a large inversion (data not shown), although a small inversion cannot be excluded. Finally, in patient 5-1, we found a homozygous nonsense mutation (c.664C> T, p.R222X) in exon 5. The mutations identified were not reported in any of the known SNP databases and all presumably are loss-of-function mutations (Table 1 and Figure 1 B), and all were inherited from nonaffected heterozygous parents (data not shown). None of the mutations were found in 154 control chromosomes of Caucasian origin.

CLMP Expression During Human Development

Because CSBS is a developmental anomaly of the intestine we determined the pattern of CLMP expression in the intestine during human embryonic development. lmmunostainings on human embryos at 7 and 8 weeks of development (Figure 2A and B) showed that CLMP was highly abundant in the rapidly dividing cells of the central and peripheral nervous systems, the mesenchyme of the frontonasal and mandibular processes, and the dermamyotome, and critically it was expressed in the endodermal derivatives of the foregut, midgut and hindgut, and also in the liver, lung, esophagus, and trachea. It was expressed less strongly in the prevertebral condensations and extra-embryonic tissues, and the dorsal head mesenchyme. During midterm fetal stages, 18 and 23 weeks of development (Figure 2C and E), increased immunoreactivity for CLMP was observed in the intestinal crypts while expression continued to be present in all tissues, with the lowest expression in the muscular and interstitial layers. Midterm liver and kidney tissues strongly express CLMP in the parenchyma of the lobules and cortex, respectively (Figure 2D and F). CLMP also was observed in the collecting ducts and to a lesser extent in the bile ducts and ureter.

CLMP expression thus was seen in the intestine during different stages of human development. Because CLMP also was expressed in many other tissues, this argues for functional redundancy with a specific function of CLMP during intestinal development.

Mutation of CLMP Abrogated its Normal Localization at the Cell Membrane

CLMP encodes for a transmembrane protein belonging to the CTX (cortical

• Loss-of-function • •

A

B

, .. . ! 0$ • ,C.,�. , • _.. ,,.. IMtl't•• •::i ..... � .,.. -'!i,J .:.e--,,,� I ;. � . ...

, .. ...--------------------�-----, pabent

1-1

:""' ·"-It-,,:,.,. . . • �..,;. , · . .. . u,,s;it,.-..-�, pattent :!-1 OJlll-a.--------------+-----------'

, .. ...---------.-------------------, ; .... ""''"!'""'";;;,.�, ":°'"' ,;4-'f.. •• .; � ... , ... , .. .----,--------------+------.....-,----, ! o.s, .-.bli?JL"Q:" ... .;�.,,., A-:':'"-! :-.,1--'N'-. .: , .... ,

:::::::::::::::::::::=.:�l=;:=;:;;:;!i:::::'.:'..::::�:::::-:::

I g j o,:.u ��i .... •.'t�'!°� ? ! , .... 'f .v , . ,1- -.. : ...,,._,_�......_____,_ ___ 74:==�1 _____ __,

I ,:._____.I. ---------"--T ___,_________�____.___._.I.........__._.. I I .:: f ··---····- --- - ---o- ---�· -··- --· . _ .... _ .. -- - ---- - ·- - - · -t-······-j

..... �- ---�--------------�--���-�-SORL1 BLID

Homozygous deletion /inversion

I 1

UBASH3B BSX H-H+-+--1

HSPA

Homozygous p.V124D

CRTAM CLMP

I Homozygous p.R222X

Homozygous Heterozygous Heterozygous 12483 bp del. c.589delA c.1 1BOG>A

+ +

I II I I I 2 3 4 5 6 7

pnbenl 3-L

pabent 3-:!

pnllenl 4-1

Figure 1. Identification of loss-of-function mutations in CLMP in congenital short-bowel syndrome patients. (A) An overlapping homozygous region (yellow bars) was found in 4 of the 5 patients on the array. A homozygous deletion (red bars) concerning exon 2 of CLMP was detected in patient 4-1 . (B) An overview of CLMP with its 7 exons and all the identified mutations. Loss-of-function mutations in CLMP cause autosomal recessive CSBS 37

thymocyte marker) subfamily of the lmmunoglobulin superfamily. It acts as an adhesion molecule and co-localizes with tight junction proteins.13 To determine whether the missense mutation (c.730T>A, p.V124D) affected the normal cell membrane localization, we transfected CHO and T84 cells with pCMV-CLMP­IRES-EGFP constructs. We expressed both the wild-type protein (CLMP-WT) and the mutant protein (c.730T>A, p.V124D, CLMP-mutant). CLMP was localized at the cell membrane when 2 neighboring CHO cells expressed the WT protein (Figure 3A). In contrast, the mutant protein was localized in the cytoplasm (Figure 3B). Similar results were obtained in a human intestinal epithelial cell model (T84 cells) (Figure 3C and D). However, expression of the WT protein in a cell that did not have a transfected neighboring cell resulted in the retention of the protein in intracellular punctate structures (Figure 3E). Because CLMP has been shown to co-localize with tight junction markers, we determined co­localization of CLMP with the tight junction marker ZO-1. Importantly, WT protein showed co-localization with ZO-1, whereas the mutant protein did not (Figure 4B, C, F and E, arrows). Again, CLMP was localized only to points of membrane apposition when 2 neighboring cells were both transfected. Overexpression of the WT protein did not alter the localization of ZO-1 (compare Figure 4D with E). Instead, expression of the mutant protein resulted in an increased cytoplasmic pool of ZO-1 (Figure 4F).

Together, these results indicate that CLMP plays a role in tight junctions and that the mislocalization of the mutant protein influences the localization of the tight junction protein ZO-1.

A Zebrafish Model for Congenital Short-Bowel Syndrome

To understand the in vivo function of CLMP in intestinal development and gut length determination we investigated the function of CLMP orthologs in the zebrafish model organism. Analysis of the zebrafish genome (Sanger Zv8) revealed two potential zebrafish CLMP orthologs (ENSDARG00000003145 and ENSDARG00000073678) (Supplementary Figure 2). The temporal and spatial expression patterns of both orthologs were determined by in situ hybridizaton (Figure 5A). One ortholog ( CLMPa) specifically was expressed in the intestine at 48 and 72 hours after fertilization, while the other ortholog ( CLMPb) had a much less pronounced intestinal expression (Figure 5A, arrowheads). To determine

A'

B'

r

F'

� 2. lmmunohistochemistry of CLMP on human embryo and fetal tissues shows expression of CLMP in the intestine and in many other tissues. (A) Carnegie stage 15 (circa 33-36 days post-fertilization), cross­section, dorsal to left (and right, for tail bud). CLMP protein was expressed strongly by all embryonic tissues and the umbilical cord. Panel .A:-F': adjacent sections to panels A, B and D-F, nonspecific immunoglobulin­negative controls. (B) Carnegie stage 18 (circa 44 days post-fertilization), parasagittal section, dorsal to right CLMP protein was abundant throughout the central and peripheral nervous systems, through the endodermal layer derivatives of the foregut, midgut and hindgut including the liver, lung, esophagus and trachea, and in the mesenchyme of the frontonasal and mandibular processes. (C and E) Cross- and tangential sections, respectively, of the small intestine and a portion of the large intestine at 18 weeks of development, with increased immunoreactivity in the crypts. (D) Liver parenchyme at 21 weeks of development strongly expressed CLMP, which also was present but to a lesser degree in the bile ducts. (F) Cross-section of kidney at 23 weeks of development, showing medullocortical expression gradient with more CLMP in the glomeruli than the collecting ducts, and only light expression in the ureteral smooth muscle. ao, aorta; bd, bile duct; drg, dorsal root ganglion; fn, frontonasal process; h, heart; int, midgut intestinal herniation (arrowheads in panel B); lu, lung; Iv, liver; md, mandible; nt, neural tube; oe, esophagus; rh, rhombencephalon; sc, spinal cord; st, stomach; tb, tailbud; tel, telencephalon; tr, trachea; ua, umbilical arteries; ur, ureter Scale bar. 1 mm.

Loss-of-function • •

whether loss-of-function of CLMPa leads to a CSBS-like phenotype in zebrafish,

we performed a series of morpholino antisense knock-down experiments.

Injection of either a T BMO or an SBMO morpholino targeting CLMPa resulted

in a similar phenotype. Both SBMO and T BMO morphants showed a significant

developmental delay. Morphants were smaller in overall body length as

compared to WT controls. Likewise the length of the intestine was shorter in

CLMPa knockdown embryos than that of control embryos (mean length, 2.5

CLMP-WT CLMP-mutant

() I 0

-I co �

Figure 3. CLMP-mutant (c.730T >A, p.V124D) abrogated the normal cell membrane localization of CLMP when transiently expressed in CHO and human intestinal epithelial T 84 cells. (A) CLMP-WT localized to the cell-cell contact area of CHO cells. (B) In contrast, CLMP-mutant did not localize at the cell membrane but in the cytoplasm. (C) CLMP-WT localized at the cell membrane of human intestinal epithelial T 84 cells, (D) whereas CLMP-mutant did not. (E) Expression of CLMP-WT in a cell that did not have a CLMP-expressing neighbor cell caused an intracellular retention of CLMP in punctate structures. (F) CLMP-mutant did not show these structures.

mm and 1.9 mm for WT vs morphant, respectively; P;;;;7.0637E-06, n=10 vs 9), however, this shortening was proportional to the overall shorter body length of the morphants (mean gut length, 15.36 and 15.5 somites for WT vs morphant, respectively, P;;;;Q.3211 , n;;;:11 vs 8). To confirm the specificity of the morpholino we generated an additional translation-blocking morpholino for CLMPa (TBMO2) (Supplementary Table 3), which caused a similar phenotype to that observed for the original CLMPa TBMO1 and SBMO (data not shown). A 5-base mis­match control morpholino for TBMO1 was also generated and injected and this did not show any phenotype (data not shown). The potential nonspecific cytotoxic side effect of the morpholinos was excluded by co-injection of a p53 translation-blocking morpholino (Supplementary Table 3). Critically, the knock­down phenotype was rescued by co-injection of CLMPa mRNA with the SBMO (Figure 5B).

H &E staining of sections of both 96 hpf control embryos and SBMO­injected embryos showed a significant difference in the overall gut m orphology (Figure 5C). Goblet cells, which are characteristic of the midintestine in zebrafish, were seen in the control embryos but these cells were absent in the SBMO­injected embryos (Figure 5C, arrowheads). The zebrafish midintestine resembles the small intestine in human beings.14 This result taken with the overall reduction in intestinal length observed in the morphants suggests that loss of function of CLMPa in zebrafish results in abnormal intestinal development that has some similarities to the CSBS clinical phenotype.

Discussion

Congenital short-bowel syndrome is a gastrointestinal disorder of which the genetic basis is unknown. Here we report the identification of a number of loss­of-function mutations in the CLMP gene in patients with CSBS. The mutations we found are thought to result in a loss of CLMP function owing to nonsense mutations (family 5), frameshift/splicing mutations (family 1 and 4) and in mislocalization of the CLMP protein caused by a missense mutation (family 2). In addition, this missense mutation has an influence on the localization of the tight junction protein ZO-1.

• •

To understand how loss of function of CLMP leads to CSBS, we undertook

parental H , ,, ,

* ''

* * ._

,i , ._ * ._

�

:-, I i,J, ;:-, I l I ; I '.' ., I I ,1 :

j parental K L * ., , ,, , * * ._

* ._ , ,. ,

* ._ ._ Z0-1 Z0- 1 Z0- 1

Flgll'e 4. CLMP-WT co-localizes with ZO-1 and CLMP-mutant (c.730T>A, p.V124D) resulted in an increase of cytoplasmic ZO-1 when transiently expressed in human intestinal epithelial T84 cells. (A) T84 cells do not express CLMP endogenously. (B) CLMP-WT co-localized with the tight junction­associated protein ZO-1 (compare to E, affows). (C) CLMP-mutant failed to co-localize with the tight junction-associated protein ZO-1. (D) Endogenous expression of ZO-1 in T84 cells. (E) Expression of CLMP-WT did not visibly alter the localization of ZO-1 (compare to D) (F) The intracellular expression of CLMP-mutant resulted in an increased cytoplasmic pool of ZO-1 that overlapped with CLMP­mutant, but did not inhibit the localization of ZO-1 at the cell membrane (affows).

a series of zebra fish experiments. We showed that a zebra fish ortholog ( CLMPa)

is expressed in the intestine at 48 and 72 hpf. Knock-down of CLMPa in zebrafish

resulted in a very severe phenotype including an affected intestine. A significant

reduction in intestinal length was observed in the CLMPa morphants. Furthermore,

CLMPa morphants also lacked goblets cells in the midintestine, suggesting that

the CLMP function is required for normal small intestin development both in fish

and human beings, and suggesting a potential evolutionary conservation in this

gene's function.

Given the wide expression of CLMP during both human and zebrafish

development (as shown in Figures 2 and 5A) and the severe phenotype observed

in the zebrafish CLMPa morphants, it is intriguing that the phenotype in the

human families we studied is so discrete. All of the patients we included in our

A CLMPa

B WT

C

CLMPb

CLMPa SBMO

WT 96hpf

D

E

PNT SBMO

I�u·

• r:

-� - -

CLMPa SBMO rescue

CLMPa SBMO 96hpf

Fi'11'e 5. CLMPa ortholog is expressed in the intestine of zebrafish embryos and knock-down of this ortholog results in a shortened and maldeveloped intestine. (A) 24 hpf (1,11), 48 hpf (Ill, IV), and 72 hpf N, VI) whole mount in situ hybridized zebrafish embryos hybridized with either CLMPa (I, Ill, V) or CLMPb (11,IV,VI) antisense riboprobes. Arrowheads (I, Ill, IV, V, VI) indicate intestinal expression of CLMP orthologs. (B) Effect of CLMPa SBMO on morphological development. Lateral views of control {I, IV, VII) CLMPa SBMO alone (II, V, VIII) and CLMPa SBMO plus CLMPa mRNA-(1 1 1 , VI, IX) injected embryos at 48 hpf {I, 1 1 , Ill), 72 hpf (IV, V, VI) and 96 hpf Ml, VIII, IX). (C) H&E stained parasagittal cross-sections of 96 hpf control {I, Ill and V) and CLMPa morphant (II, IV, VI) embryos. Arrowheads (V) indicate goblet cells. Intestinal muscle layer (m) and intestinal epithelia (e) are indicated {V, VI). (D) Knock-down of CLMPa verified by RT-PCR. Splice-blocking morpholino-injected embryos (S) show abnormal RT-PCR products as compared to the WT embryos (C). (E) The length of the intestine of the SBMO-injected embryos was significantly shorter. All scale bars : 50µ.

Loss-of-function mutations in CLMP cause autosomal recessive CSBS 43

study do not have additional clinical features besides malrotation and intestinal

neuronal dysplasia, which was reported only in patients 3-1 and 3-2. T his all

argues for functional redundancy of CLMP in human beings.

We have shown that loss-of-function mutations of CLMP underlie CSBS,

and we can further speculate on the pathogenesis of this disease. We and

others have shown that CLMP co-localizes with tight junction proteins. It is

known that overexpression of CLMP in CHO cells induces cell aggregation and

overexpression of CLMP in Madin- Darby canine kidney cells enhances trans­

epithelial resistance.13 Thus CLMP might play a crucial role in tight junction

formation and functions. Because tight junction markers such as ZO-1 and its

interacting protein zonula occludens 1 (ZO-1)- associated nuclei acid binding

protein play an important role in cell proliferation,15·16 loss of function of CLMP

also may play a crucial role in downregulation of proliferation of the small

intestinal epithelial cells during human intestinal development, resulting in the

CSBS phenotype. Because CLMP is also expressed in the small intestine in

adults,13 CLMP might have an important function in adult life. Potentially, CLMP

may play a role in the intestinal elongation process that occurs during a person's

lifetime (the length of the intestine in adults is 600 cm on average, ranging

from 260 to 800 cm2) and in the intestinal adaptation process after surgical

resection. T he effects on intestinal adaptation of growth factors such as growth

hormone, keratinocyte growth factor, epidermal growth factor, and glucagon-like

peptide-2 have been studied.1 7·2° Further studies will elucidate the role of CLMP

in intestinal adaptation in adults and its therapeutic potential.

Acknowledgements The authors would l ike to thank the patients and their famil ies for participating in this study; Jackie Senior for editing the manuscript; and Dr Arrigo Barabino (Paediatric Gastroenterology Unit, G. Gaslini Institute) for providing details about Italian patients, whose samples were obtained from the Cell Line and DNA Biobank from Patients

affected by Genetic Diseases at G. Gaslini Institute-Telethon Genetic Biobank Network (project GTB07001 ).

Funding This work was funded by the Junior Scientific Masterclass (University of Groningen), the Ter Meulen Fund, the van Walree Fund, the Royal Netherlands Academy of Arts and Sciences, The Maag Lever Darm Stichting, the J. K. de Cock Stichting, and the Stichting Simonsfonds.

References

1. Fitzsimmons J, Chin A, Shepard TH. Normal length of the human fetal gastrointestinal tract. Pediatr. 1998;132:80-4.

2. Reiquam CW, Allen RP, Akers DR. Normal and abnormal small bowel lengths: an analysis of 389 autopsy cases in infants and children. Am J Dis Child 1965;109;447-51 .

3. Siebert JR. Small-intestine length in infants and children. Am J Dis Child 1980;134:593-5.

4. Huysman WA, Tibboel D, Bergmeijer JH, et al. Long-term survival of a patient with congenital short bowel and malrotation. J Pediatr Surg. 1 991 ;26:1 03-5.

5. Ordonez P, Sondheimer JM, Fidanza S, et al. Long-Term Outcome of a Patient with Congenital Short Bowel Syndrome. J Pediatr Gastroenterol Nutr. 2006;42:576-80.

6. Hasosah M, Lemberg DA, Skarsgard E, et al. Congenital short bowel syndrome: a case report and review of the literature. Can J Gastroenterol. 2008;22:71-4.

7. Schalamon J, Schober PH, Gallippi P, et al. Congenital short-bowel; a case study and review of the literature. Eur J Pediatr Surg. 1999;9:248-50.

8. Moretti S, Armougom F, Wallace IM, et al. The M-Coffee web server: a meta-method for computing multiple sequence alignments by combining alignment methods. Nucleic Acids Res. 2007;35:W645-W648.

9. Betts MJ, Russell RB. Amino acid properties and consequences of substitutions. In: Barnes MR, Gray IC, eds. Bioinformatics for Geneticists.

Wiley; 2003. 1 0. Westerfield M. The Zebrafish Book.

Eugene, OR: University of Oregon Press; 1 993.

11 . Thisse C, Thisse B, Schilling TF, et al. Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development. 1993;119:1203-15.

12. Nasevicisu A, Ekker SC. Effective targeted gene 'knockdown' in zebrafish. Nat Genet. 2000;26:21 6-20.

13. Raschperger E, Engstrom U, Pettersson RF, et al. CLMP, a novel member of the CTX family and a new component of epithelial tight junctions. J Biol Chem. 2004;279:796-804.

14. Ng AN, de Jong-Curtain TA, Mawdsley DJ, et al. Formation of the digestive system in zebrafish: Ill. Intestinal epithelium morphogenesis. Dev Biol. 2005;286:114-35.

15. Balda MS, Matter K. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression. EMBO J. 2000;1 9:2024-33.

16. Matter K, Balda MS. Signalling to and from tight junctions. Nat Rev Mo/ Cell Biol. 2003;4:225-366.

17. Wales PW, Nasr A, de Silva N, et al. Human growth hormone and glutamine for patients with short bowel syndrome. Cochrane Database Syst Rev. 2010;6:CD006321.

18. Yang H, Wildhaber BE, Teitelbaum DH. Keratinocyte growth factor improves epithelial function after massive small bowel resection. JPEN J Parenter Enteral Nutr. 2003;27:1 98-206.

19. Kato Y, Yu D, Schwartz MZ. Enhancement of intestinal adaptation by hepatocyte growth factor. J Pedriatr

. . -

Surg. 1998;33:235-9. 20. Martin GR, Beck PL, Sigalet DL. Gut

hormones, and short bowel syndrome: the enigmatic role of glucagons-like

peptide-2 in regulation of intestinal adaptation. World J Gastroenterol. 2006;12:4117-29.

Supplementary Data

Supplementary Table 1 . Primer Sequences for CLMP Mutation Analysis Exon Forward Reverse PCR product size, bp

AGGAGGCAACCATGTGGTTC ACAATCTCGATGGCCGACTG 580

2 CACTTGCCCACGGGAACATC GCCACCACACCCAGCAATAC 443

3 AAGGCAGGCTGAGAGTTACG CGAGGTGACCTCTGAATGTG 383

4 AAACAGCACCACTGGAGTTG AATGGCAGTTCAGGAGGTTC 5 1 2

5 GCATTACGGAATCTCAGCTCAG GGCCAGTCAATTGTTGAGTG 402

6 AAACCTGCAAATACTCATTC AAGTGTTTGTTGAGGATAAG 455

7 TACGAGGAAGCACCTATGAC GTGACTTGAGCTCCAATGAC 525

PCR conditions: 35 cycles of denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute and polymerization at 72°C for 1 minute.

Supplementary Table 2. Primer sequences for Side-Directed Mutagenesis of pCMV6-CLMP­GFP Vector

Target Primer sequence, 5'? 3' Base pair change Forward primer CGCTACGTGTGGAGCCATGACATCTT AAAAGTCTT AG Reverse primer CT AAGACTTTT AAGATGTCATGGCTCCACACGTAGCG

Supplementary Table 3. Morpholino Sequences

Morpholino sequences, 5'? 3' 151 translation blocking morpholino 2nd translation blocking morphoilno 5 mispair morphollno splice blocking morpholino p53 translation blocking morpholino

CGGACTGGGAATCCAACACAAATGT CTGCTTTGCTCCTCAAACCGAACAC CTcCTTTcCTgCTCAAAgCcAACAC GGCACACACCAGCACTCACCACTTT GCGCCATTGCTTTGCAAGAATTG

Amino acid change

Val125Asp Val1 25Asp

Loss:of;tunction;mutations·in CLMF?.dause autosomal recessive CSBS , ·. 47 .

a,._ -.•:· • - �- .... �., • ·"'·· - • ' • - ., •

Bomo . CLMP Rattus . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP Rattus . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP Ratt u s . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP Rattus . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP Rattu s . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP Ratt u s . CLMP Danio . CLMPa Danio . CLMPb consensus

Bomo . CLMP - - - - - - - - - - - - - S S Rattus . CLMP s s Danio . CLMPa T Danio . CLMPb RPP- PP---vv P PGVM s consensus -p-- 1-p- - - - -maet- - -miP-QsrAPQTV

Supplementary Figure 1. CLMP alignment for human, rat and zebrafish

� . •

KVBBANLT -

KABB LT -PPEP SP S

A B C bp

bp lmlO nplens --· Rlllus norvegicus

650 -nuscws Cons -Bos!IM'US 2000 Oob gob 1650

C>rnlhorhyr<:hJ "'1lllhls Doriorerio Xenopus (Sb .. ) tropi<ds

200 T-rqawlcls T...-iopygio sµlalo

�plementary FiQll'8 2. Conservation and intronic deletion in family 3. (A) Hek293 cells were transfected with the pSPL3 vector only (V), the pSPL3 vector with the wild-type sequence of exon 6 and its flanking sequences f,N), and the pSPL3 vector containing the sequences of exon 6 and the presumed splice site mutation (M). T he results of the amplification of the cDNA made of the mRNA of these transfected cells using the splice acceptor site and splice donor site primers are shown. T he exon has been trapped in the wild-type situation f,N), but has not been trapped in the mutated situation (M). T his means that the splice site mutation affects the splice donor site so that it is not recognized by the splicing machinery. (B) T he missense mutation found in patient 2-1 affects a codon which is evolutionary highly conserved. In the figure it can be observed that this amino acid and all the surrounding amino acids are coloured red (labelled as good). Good indicates highly conserved, bad (blue) means not conserved. (C) A homozygous deletion surrounding SNP rs71 15102 in intron 1 was detected in patients 3-1 and 3-2. PCR yielded results for the parents (f: father, m: mother) as well as for the unaffected sibling (s) and for the control (c), but no PCR product was detected in the patients (p). Lane b (b= blanco, negative control) is a PCR without adding DNA. By using primers flanking the deletion (forward, 5'-AT T GGAGGATGT GACCT CT GAGT CT TAT GG-3' and reverse, 5'-GGCAGAGAAAGT GGGAAACCTATAGTMGC-3') the PCR product was expected to be approximately 5 kb for the normal situation. By using small sets of primer pairs surrounding SNP rs7115102 a region of around 1 kb could not be amplified in the patients. T herefore, the PCR product in the patients was expected to be around 4 kb. Because there is no PCR product from the patients' DNA at all, this is indicative of a more complex alteration than the simple deletion detected by the SNP array.

Loss-of-function mutations in CLMP cause autosomal recessive CSBS 49

C LMP i s e s s e n t i al f o r b ut i n t e s t i n al d e v e l o p m e n t ,

d o e s no t p l ay a ke y r o l e i n c e l l ul ar p r o c e s s e s i n v o l v e d i n i n t e s t i n al e pi t k e l i a l d e v e l o p me n t

Christine S. van der Werf 1 , Na1-Hua Hsiao , Siobhan Conroy ' , Joana Paredes\ Ana S Ribeiro\ Yunia Sribudiani,1 •4 Raquel Seruca , Robert MW . Hofstra 1 4 , Helga Westers1, Sven C.D. van 1Jzendoorn2

•

1 Department of Genetics, University of Groningen, University Medical Centre Groningen, Groningen, the Netherlands. 2Department of Cell Biology, University of Groningen, University Medical Centre Groningen, Groningen, the Netherlands. 3The Cancer Genetics Group, Institute of Molecular Pathology and Immunology of the University of Porto, Porto, Portugal. 4Department of Clinical Genetics, Erasmus University Rotterdam, Erasmus Medical Centre, Rotterdam, the Netherlands.

Ready for submission.

Abstract

Loss-of-function mutations in CLMP have been found in patients with Congenital Short Bowel Syndrome (CSBS), suggesting that its encoded protein plays a major role in intestinal development. CLMP is a membrane protein that co-localizes with tight junction proteins, but its function is largely unknown. We expressed wild-type (WT)-CLMP and a mutant-CLMP (associated with CSBS) in human intestinal epithelial T84 cells that, as we show here, do not produce endogenous CLMP. We investigated the effects of WT-CLMP and mutant-CLMP proteins on key cellular processes that are important for intestinal epithelial development, including migration, proliferation, viability and transepithelial resistance. Our data showed that expression of WT-CLMP or mutant-CLMP does not affect any of these processes. Moreover, our aggregation assays in CHO cells show that CLMP does not act as a strong adhesion molecule. Thus, our data suggest that, in the in vitro model systems we used, the key processes involved in intestinal epithelial development appear to be unaffected by WT-CLMP or mutant-CLMP. Further research is needed to determine the role of CLMP in the development of the intestine.

Introduction

CLMP (coxsackie- and adenovirus receptor-like membrane protein) is a membrane

protein that belongs to the CTX (cortical thymocyte marker in Xenopus) family

of proteins.1 The precise function of CLMP is largely unknown although several

suggestions have been made. For instance, it has been suggested that CLMP

plays a role in immunological processes.1 -2 This is based on the fact that there

is a high homology between CLMP and Junctional adhesion molecules (JAMs),

both belonging to the CTX family of proteins. It is known that JAMs are important

for transmigration of leukocytes to inflammatory sites.3 This hypothesis was

further supported by the finding that TNFa, a pro-inflammatory cytokine, is able

to regulate CLMP expression.2 In addition, it has been suggested that CLMP

plays a role in cell-cell adhesion, based on the finding that it co-localizes with

the tight junction proteins zonula occludens 1 (Z0-1)1 ·4 ·5 and occludin1. Moreover,

transfection of human CLMP in Chinese Hamster Ovary cells (CHO) induces cell

aggregation.1 ·6 In addition, transfection of human CLMP into Madin-Darby canine

kidney (MOCK) epithelial cells induces transepithelial electrical resistance (TER),

suggesting a role for CLMP in the junction-barrier function of intestinal epithelial

cells.1

Loss-of-function mutations in CLMP were identified in patients with

Congenital Short Bowel Syndrome (CSBS).4 A missense mutation was identified

(V1240) in one of these CSBS patients. Transient transfection of th is mutant­

CLMP (CLMP containing the missense mutation V124D) in CHO and T84 cells

resulted in mislocalization of CLMP and in an increased cytoplasmic pool of Z0-

1.4 As tight junction proteins like Z0-1 play a role in cell proliferation,7•8 it has been

suggested that loss-of-function of CLMP would probably affect proliferation of

human small intestinal cells during foetal development and thereby causing a

shortened small intestine.4 As the function of CLMP is still obscure, we aimed to

gain a better understanding of the functional cellular role of CLMP.

Materials and Methods

Construction of Plasmids for Transient Transfection of Chinese Hamster Ovary

Cells

A pCMV6-CLMP-green fluorescent protein ( GFP) vector was obtained from Origene (Rockville, MD, USA). The CLMP missense mutation (c.730T>A, p.V124D) was introduced in this vector by site-directed mutagenesis (Strata gene, Amstelveen, Santa Clara, CA, USA) (for primer sequences see our previous publication).4 The wild-type (WT) and mutant cDNA were amplified using the primers CCGCC-Nhel, 5'-ATGTCCCTCCTCCTTCTCC-3', and GGGCGC-Xhal,

5'-TCAGACCGTTTGGAAGGCTCTG-3'. The amplification was performed using Phusion High-fidelity DNA polymerase (Finnzymes, Helsinki, Finland). The PCR products were inserted into PCR 2.1-TOPO plasmid (lnvitrogen, Carlsbad, CA, USA). The PCR 2.1 Topo constructs were digested by Nhel and Xhal restriction enzymes and the fragments were cloned into the vector pCMV-internal ribosomal re-entry site ( IRES) coupled to eGFP (GFP-like protein). The clones were checked by direct sequencing.

Construction of Viral Vectors for Transduction of T84 cells

The pCMV-IRES-EGFP vectors, which were constructed as described above and contained both WT- and mutant cDNA (c.730T>A, p.V124D) of CLMP, were used as a template for amplification using the primers ACCA-Ncal-Myc, 5'- ATGTCCCTCCTCCTTCTC-3' and AACA-Xhal-

5'-TCAGACCGTTTGGAAGGCTCTG-3'. The PCR products were digested with Neal and Xhal and the fragments were cloned into the vector pEntr4. The clones were checked by digestion with Neal and Xhal and direct sequencing. The inserts were subsequently cloned into the vector plenti-CMV-Neo using lambda phage­based site-specific recombination and the Gateway® recombination cloning technology (lnvitrogen).

Production of LentMral CLMP

For the production of the viruses, 2.6 x 106 HEK293 cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% heat-inactivated foetal bovine serum (FBS, lnvitrogen), 1 % antibiotic solution (penicillin-streptomycin,

lnvitrogen) and 1 % sodium pyruvate. The cells were maintained at 37°C in a humidified atmosphere with 5% CO

2. Co-transfection of both WT and mutant

plenti-CMV-CLMP (V124D)-Neo with pVSV-G and pCMVdRB.1 was performed using the CaCl

2 method. The cells were subsequently grown overnight. After

24 hours the medium was changed to DMEM supplemented with 10% heat­inactivated foetal bovine serum (FBS, lnvitrogen) and 1 % antibiotic solution (penicillin-streptomycin, lnvitrogen). After 24 and 48 hours, the medium containing the virus was collected and stored at 4 °C. Fresh medium was added to the cells. The collected medium was filtered using a polyvinylidene difluoride membrane­based filter to remove HEK293 cells.

Cell Culture

Chinese Hamster Ovary (CHO) and human intestinal epithelial T84 cells were grown in commercially available alpha modification of eagle's medium and DMEM/F-12 (both lnvitrogen) respectively, supplemented with 4.5 mg/L L-glutamine, 10% heat-inactivated foetal bovine serum (FBS, lnvitrogen) and 1% antibiotic solution (penicil lin-streptomycin, lnvitrogen). The cells were maintained at 37°C in a humidified atmosphere with 5% CO2.

Production of Stably Transduced CLMP T84 Cell Lines.

For transduction the virus-containing solution and Hexadimethrine Bromide (Sigma; 4 mg/ml PBS) were added to T84 cells. The cells were then grown overnight at 37°C in a humidified atmosphere with 5% CO2 After 24 hours the medium was changed and the cells were grown till a confluency of 80% was reached. Transduction efficiency was checked by qPCR and Western blot analysis (see figure 1A).

Real-time PCR

Expression of CLMP in the transduced T84 cells was quantified with Quantitative Polymerase Chain Reaction (qPCR). Transduced T84 cells were lysed and mRNA was isolated according to the manufacturer's instructions (GeneJET™ RNA Purification Kit, Fermentas). The GAPDH gene was used as an internal standard for normalization. mRNA was used as a template to synthesise cDNA. PCR was performed using the primers (CLMP-F) 5'-GAAGGAAAGCTGTGTGGTG-

3' and (CLMP-R) 5'-CACTAT GCCT GT CACT GCT C-3' for CLMP and

(GAPDH-F) 5'-CAT T T CCT GGTAT GACAACG- 3' and (GAPDH-R)

5'-GT CCAGGGGT CT TACT CCT T - 3' for GAPDH and the following amplification

program: 1 5 minutes 95C, 40 cycles 1 5 seconds 95°C, 1 minute 60°C. Each

amp I if ication reaction was run in triplicate using 10 ng of cDNA, 1 50nM of both

forward and reverse primers, and 1 x SYBR green master mix (ABCM-221 /A,

Westburg, Leusden, the Netherlands) in a total volume of 1 O µL. T he results

were analysed by StepOne1m software v2.2 and recalculated manually using the

Comparative Cr Method.

Western Blotting

Cells were harvested with lysis buffer (100mM NaCl, 20mM T ris-HCI pH 7.6,

T riton X-100 and protease inhibitors (Roche, Almere, the Netherlands)). After

incubation on ice for 30 minutes, the lysate was centrifuged for 5 minutes at

1 4,000 rpm at 4 °C. Protein concentrations were determined using the BCA

protein assay (Pierce Biotechnologies, Rockford, IL, USA) and measured on a

NanoDrop® ND-1000 (T hermo Scientific, Waltham, MA, USA).

Protein extracts (40 µg) were resolved on an SDS/1 5% polyacrylamide gel,

transferred on to a nitrocellulose membrane and blocked with dried milk powder

in T ris-buffered saline with 0.1 % Tween 20 for 1 hour at room temperature. T he

membrane was then incubated with primary antibody rabbit polyclonal antibody

for CLMP (anti-AP000926.6, Sigma-Aldrich) in 1 :500 dilution for 1 hour at room

temperature. After 1 hour incubation with the secondary antibody goat anti­

rabbit conjugated with Horseradish peroxidase ( 1 :1 ,000; Bio-Rad, Hercules,

CA, USA) at room temperature, the proteins were visualized using enhanced

chemiluminescence reagent (Lumi-Light Western Blotting Substrate, Roche).

Scratch/wound Healing Assay

Control T 84 cells or T 84 cells expressing WT -CLMP or mutant-CLMP (V1 24D)

were cultured on glass-bottom petridishes ( 1 .5 x 105 per dish) for 7 days after

which they develop a polarized monolayer with functional tight junctions. T he

dish was mounted on a microscope for live imaging. Monolayers were scratched

with a micropipette and incubated in serum-deprived culture medium. After 24

hours of incubation, the rate of migration into the scratch was determined and

presented as µm/24 hours. Experiments were performed in triplicate and data were expressed as mean ± SD.

BrdU Cell Proliferation Assay

Cell proliferation was measured using a BrdU cell proliferation assay (Cell Signalling Technologies, Danvers, MA, USA) that detects 5-bromo-2'-deoxyuridine (BrdU) incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody. T84 cells (1.5 x 105) (control, WT-CMP or mutant-CLMP (V124D)) were plated and cultured for 2 days. BrdU was included in the culture medium at a final concentration of 10 µM and added to a monolayer of T84 cells (control, WT-CMP or mutant-CLMP (V124D)). After 24 hours, the labelling medium was removed, cells were fixed and BrdU incorporation was measured according to the manufacturer's instructions. Experiments were performed in triplicate and data were expressed as mean ± SD.

XTT Cell Viability Assay

Cell viability was measured using an XTT cell viability assay kit (Cell Signalling Technologies), a colorimetric assay that detects cellular metabolic activities that only occur in viable cells. T84 cells ( 1.5 x 105) were plated and cultured for 2 days. The yellow tetrazolium salt XTT was then added to a monolayer of T84 cells (control, WT-CLMP or mutant-CLMP (V124D)) at a final concentration of 20 µg/ml. After 4 hours of incubation, the formazan dye that formed was quantified by measuring the optical density (OD) at wavelength 450 nm using a spectrophotometer. The OD measured at wavelength 690 nm was used as background reference. The specific OD was calculated by substracting the OD measured at wavelength 690 nm from the OD measured at wavelength 450 nm. Experiments were performed in triplicate and data were expressed as mean ± SD.

Measurement of Transepithelial Electrical Resistance in Mono/ayer T84 Cultures

T84 cells were grown on polycarbonate 24-wells Transwell filter inserts (Corning Costar, Corning, NY, USA) for 7 days. Transepithelial electrical resistance was measured using an epithelial Volt/Ohm-meter (World Precision Instruments, Sarasota, FL, USA). Experiments were performed in triplicate and data were

expressed as mean ± SD.

Transfection of CHO Cells for Aggregation Assays

WT or mutant pCMV-CLMP (V124D)-IRES-EGFP was transfected into CHO

cells (1.5 x 105) with Lipofectamine 2000 T ransfection Reagent (lnvitrogen) in

a 1 :3 dilution, and transfection efficiencies were evaluated by measuring EGFP

expression by flow cytometry (around 50% efficiency).

Aggregation Assays

T he bottoms of the wells of a 96-well plate were covered with semi-solid agar

medium (100 mg Bacto-agar in 15 ml Ringer's salt solution) to prevent cell­

substratum adhesion. T hereafter, a single cell suspension was added and

incubated at 37°C in a humidified atmosphere with 5% CO2 for 24 hours and

48 hours. Aggregation was evaluated under an inverted microscope with a 4X

objective and pictures were taken at both time points.

Results

Viral Transduction of T84 Cells

T 84 colonic adenocarcinoma cells grow to confluent polarized monolayers that

exhibit functional tight junctions and have been used extensively as a model

to study intestinal tight junction integrity.9·11 We found that T 84 cells do not

endogenously express CLMP (Figure 1), which makes this cell line a suitable

model system to explore the effect of CLMP and CSBS-related CLMP mutants

on epithelial functions related to the tight junction. For this, we stably transduced

both WT -CLMP and mutant-CLMP (CLMP containing the missense mutation

V124D). WT -CLMP and mutant-CLMP (V124D) were equally expressed in the

transduced T 84 cells as measured by real-time PCR (see Figure 1A). This result

was confirmed by Western blot (see Figure 1 B).

CLMP does not Affect Migration of T84 cells

To assess whether CLMP plays a role in intestinal cell migration, we performed

a wound healing experiment. T 84 cell monolayers were wounded and incubated

in serum-deprived medium for 24 hours. T here was no significant difference in . •

the rate of directional cell migration (distance travelled/time unit) between the

three groups (see Figure 2A). We concluded that overexpression of WT-CLMP

or mutant-CLMP (V124D) does not affect the directed migration of T84 cells.

CLMP does not Interfere with Proliferation of T84 cells

Proliferation of control and WT-CLMP or mutant-CLMP (V124D) expressing cells

was quantified by measuring BrdU incorporation. There was no difference in

BrdU incorporation between the three groups (see figure 2B). These data show

that overexpression of WT-CLMP or mutant-CLMP (V124D) does not interfere

with T84 cell proliferation.

CLMP does not Affect Cell Viability in TB4 cells

To assess whether CLMP improved cell viability, we performed the in vitro XXT­

based Toxicology Assay. T84 cells (1.5 x 105) Were plated and cultured for 2

days. After 4 hours of incubation with 20 µg/ml XTT, the specific absorbance

was not significantly different between the three groups (see figure 2C). These

data demonstrate that overexpression of WT-CLMP or mutant-CLMP (V124D)

does not affect the viability of the T84 cells.

CLMP does not Increase Transepithelial Electrical Resistance in T84 Cells

Transepithelial electrical resistance is a measurement of ion flux over a polarized

epithelial monolayer and can be used as a model for the junction-barrier function

of tight junctions. Others have shown that overexpression of CLMP in MOCK

cells, which do not express CLMP endogenously, increases the transepithelial

resistance. We therefore assessed whether transfection of human CLMP into

T84 cells influenced the transepithelial resistance. However, we observed no

significant difference in transepithelial resistance between the control (not

transduced) T84 cells, the T84 cells transduced with the WT-CLMP virus and

the T84 cells transduced with the mutant-CLMP (V124D) virus (see Figure 2D).

Thus, WT-CLMP and mutant-CLMP (V124D) do not increase or interfere with the

transepithelial electrical resistance of a T84 cell monolayer.

CLMP does not act as a strong cell-cell adhesion molecule

To determine the ability of CLMP to cause cell-cell adhesion, and the effect of

A

120

100

., IQ .. .t: U 60

WT-CLMP mutant CLMP RFP empty vector

B

100 kDa

Figure 1. Expression of CLMP in T84 cells transduced with wild-type (WT)-CLMP, mutant-CLMP (V124D), RFP and an empty vector. There is no endogenous expression of CLMP in T84 cells (see the right lane (empty vector)). A. WT-CLMP and mutant-CLMP (V1 24D) mRNA were equally expressed in the transduced T84 cells as measured by real-time PCR. B. Western blots showed that WT-CLMP and mutant-CLMP (V1 24D) (at 41kDa) protein were equally expressed. The 1 00 kDa band is an aspecific band derived from the vector:

the missense mutation (V1 24D) on its ability to do so, we decided to perform

a slow aggregation assay, using CHO cells that do not aggregate at all in this

assay. As a positive control, we transfected CHO cells with a Cadherin 1 (CDH1)

vector, Cadherin 1 is also called epithelial or E-cadherin which is a known cell­

cell adhesion protein, which resulted in large aggregates (see Figure 3). However,

there were no significant differences between non-transfected and transient

human CLMP (wild-type or mutant (V1 24D)) transfected CHO cells after 24 hours

or 48 hours of incubation (see Figure 3). We concluded that CLMP does not act

like CDH1 as a strong cell-cell adhesion molecule.

Discussion

Loss-of function mutations in CLMPwere found in CSBS patients.4 These patients

have a congenital short small intestine with a mean length of 50 cm compared

to a normal length of 250 cm at birth. CLMP is a trans-membrane protein and co­

localizes with the tight junction proteins zo-1 1 ,4,s and occludin.1 lmmunostaining

on human embryos showed that CLMP was expressed in many tissues including

the gut. Knock down experiments of the orthologue in zebrafish resulted in general developmental defects including an affected intestine. Goblet cells are normally present in the mid intestine in zebrafish (which resembles the small intest ine in humans}, and can therefore be used as a marker for this epithelial tissue. Since the goblet cells were absent in the morphant zebrafish, knock down of the orthologue of CLMP in zebrafish would probably result in the absence of the small intestine. All these findings suggest that CLMP has an important role in

A. E

�

� ni C

0 ., " C "' 0

C.

C

250

200

150

100

50

0

0 8

0 7

0 6

0 5

0 4

0.3

0.2

0 1

0

T84

--

T84

-

WT·CLMP mutant-CLMP

WT-CLMP mutant-CLMP

B.

iii C

D. E �

., " C "' iii � � oi

.,

0 7

0 6

0 5

0 4

0 3

0 2

0 1

0

500

450

400

350

300

250

200

150

100

50

0

T84

T84

WT-CLMP

-- -

WT-CLMP

mutant-CLMP

---

mutant-CLMP

Figure 2. Overexpression of wild type (WT)-CLMP and mutant-CLMP (V124D) in human intestinal epithelial T84 cells does not affect wound healing/migration, cell proliferation, viability, and trans-epithelial electrical resistance. A. Cell monolayers were wounded and incubated in serum­deprived medium for 24 hours. The rate of directional cell migration (distance travelled/time unit) and wound closure were determined. B. Proliferation was quantified measuring BrdU incorporation using a BrdU cell proliferation assay. There was no significant difference in the specific optical density (OD) (the measured OD at wavelength 370 nm minus the measured OD at wavelength 492 nm) between the three groups. C. Cell viability was estimated using an in vitro Toxicology Assay Kit XTT-based. XTT was added to the cells at a final concentration of 20 µg/ml. After 4 hours of incubation the OD was measured at 450 nm using the 690 nm absorbance as the background. (There was no significant difference between the three groups). D. T ransepithelial electrical resistance was measured in confluent cell monolayers cultured on Transwell filter inserts.

e - I

intestinal development, although its function is still largely unclear.4 However, it is known that transient transfection of human CLMP into human intestinal epithelial T84 cells showed CLMP localization at the cell-cell membrane contacts.4 It is also known that CLMP co-localizes with tight junction proteins, and is therefore claimed as a tight junction-associated protein. Because tight junction proteins play an important role in proliferation,7•

8 we have suggested that loss-of-function of CLMP might affect proliferation.4 Moreover, it was shown that transfection of human CLMP into MOCK cells increases transepithelial resistance.1 Whether it is proliferation, or transepithelial resistance, or indeed another process in which CLMP plays a crucial role and that has impact on the pathophysiology of CSBS, is still unknown.

To elucidate the function of CLMP we performed several functional assays using T84 cells as a model. As previously reported, transient transfection of human CLMP into T84 cells showed localization of WT-CLMP at the cell membrane and mislocalization of mutant-CLMP (V1240) in the cytoplasm.4

Although others have shown that transfection of human CLMP into MOCK cells increases transepithelial electrical resistance,1 we did not observe any differences in the transepithelial electrical resistance in T84 cells. We cannot say whether this discrepancy is due to the use of distinct cell types (MOCK versus T84) or to the fact that CLMP is simply not involved in this process. MOCK cells are kidney cells derived from a seemingly normal adult female cocker spaniel. Many different strains of the MOCK cell line are available and the transepithelial resistance in these different strains differs depending on the tight junction proteins that are expressed.12 This illustrates that even in the same cell line, different results can be obtained. Unfortunately, Raschperger et

al did not mention which strain of the MOCK cell line they used.1 T84 cells are human colon carcinoma cells that have been widely used to study intestinal epithelial function.9-11 We would therefore like to argue that T84 cells form a more representative model for studying the function of CLMP than MOCK cells.

We reported earlier that the missense mutation in CLMP, which was identified in one of the CSBS patients, leads to CLMP cytoplasmatic mislocalization.4 To study whether this missense mutation would also affect the adhesion properties of CLMP, we performed a cell aggregation assay using a widely accepted protocol implemented by Boterberg et al (Metastasis Research

B

CDH1

Figure 3. No significant difference was observed in cell aggregation between CHO cells transfected with and without CLMP (wild-type and mutant (V124D)). A. Mock, CHO cells that were not transfected. B. CHO cells transfected with CDH1. C. CHO cells transfected with wild­type-CLMP. D. CHO cells transfected with mutant-CLMP (V124D).

Protocols).1 3 As a positive control we transfected CHO cells with cadherin 1, also called epithelial or E-cadherin, a cell-cell adhesion protein that is an important component of the adherens junction.14•15 In our assay, transfection of CDH1 resulted in large aggregates , but we did not observe wild-type CLMP acting as a strong cell-cell adhesion protein. In the previous reports that claim that CLMP acts as an adhesion protein, the assays were performed differently. Raschperger et al used CAR as a positive control.1 Eguchi et al used low- and high-express ing CLMP stable transfected cell lines and observed a significant difference in the size of the aggregates.6 The incubati on time that Raschperger et al and Eguchi et al used in the aggregation assays was shorter, 60 minutes and 90 minutes compared to the incubation time of 24 hours and 48 hours we used in our experiments. Differences in the formation of aggregations might be found in a shorter time frame, while they probably become equal after a longer incubation

time. This might well explain why we were not able to confirm the previous findings. However, when we compare our f igures with those of both Raschperger et al and Eguchi et al, we notice that the size of the aggregates we observed in CHO cells transfected with CDH1 was far bigger. In addition, the figures in the previous reports are much closer to our figures for the CLMP-transfected CHO cells than to our positive control, CHO cells transfected with CDH1. CLMP might have some adhesion capacity comparable with CAR, but based on our assays we have to conclude that CLMP is not a strong adhesion molecule like CDH1.

Because CLMP co-localizes with tight junction proteins and tight junction proteins play an important role in proliferation,7•

8 we thought that loss-of-function of CLMP might affect proliferation.4 However, in our proliferation assay in T84 cells, we could not elucidate a role for CLMP in proliferation and based on our assays in T84 cells, CLMP also does not play a role in migration and cell viability.

From our results we have to conclude that CLMP does not play a major role in cell-cell adhesion, nor does it affect migration, proliferation, cell viability and transepithelial electrical resistance in T84 cells. The fact that T84 cells do not express CLMP, but do form proper tight junctions, points to the conclusion that CLMP cannot be essential for tight junction formation. Thus, although CLMP co-localizes with tight junction proteins, its functi on is probably not directly related to the tight junction. More research is needed to better understand the function of CLMP and why loss-of-function mutations in CLMP cause Congenital Short Bowel Syndrome.

References Opin Cell Biol. 2003;15:525-30.

1. Raschperger E, Engstrom U, Pettersson RF, et al. CLMP, a novel member of the CTX family and a new component of epithelial tight junctions. J Biol Chem. 2004;279:796-804.

4. Van der Werf CS, Wabbersen TD, Hsiao NH, et al. CLMP is required

2. Sze KL, Lui WY, Lee WM. Post­transcriptional regulation of CLMP 5. mRNA is controlled by tristetraprolin in response to TNFaplha via c-Jun N-terminal kinase signalling. Biochem J. 2008;410:575-83.

3. Bazzoni G. The JAM family of junctional adhesion molecules. Curr

for intestinal development, and loss-of-function mutations cause congenital short-bowel syndrome. Gastroenterology. 2012;142:453-462. e3. Sze KL, Lee WM, Lui WY. Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1 , in mouse TM4 Sertoli cells. J Cell Physiol. 2008;214:334-44.

6. Eguchi J, Wada J, Hida K, et al. Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 2005;387:343-53.

7. Balda MS, Matter K. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression. EMBO J. 2000;19:2024-33.

8. Matter K, Balda MS. Signalling to and from tight junctions. Nat Rev Mo/ Cell Biol. 2003;4:225-36.

9. Juuti-Uusitalo K, Klunder LJ, Sjollema KA, et al. Differential effects of TNF (TNFSF2) and IFN- y on intestinal epithelial cell morphogenesis and barrier function in three-dimensional culture. Plos One. 2011;6:e22967.

10. Clark E, Hoare C, Tanianis-Hughes J, et al. Interferon gamma induces trans location of comm ens al Escherichia coli across gut epithelial cells via a lipid raft-mediated process .

Gastroenterology. 2005;128:1258-67. 11. Naydenov NG, Brown B, Harris G, et al.

A membrane fusion protein aSNAP is a novel regulator of epithelial apical junctions. PLoS One. 2012;7:e34320.

12. Dukes JD, Whitley P, Chalmers AD. The MDCK variety pack: choosing the right strain. BMC Cell Biol. 2011 ;12:43.

13. Boterberg T, Bracke M, Bruyneel EA, et al. Chapter 4. Cell Aggregation Assays. In Metastasis Research Protocols -Volume I I Analysis of Cell Behaviour In vitro and In vivo, Edited by Susan A. Brooks and Udo Schumacher. Humana Press. 33-35, 2001.

14. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell. 2003;112:535-48.

15. Young P, Boussadia 0, Halfter H, et al. E-cadherin controls adherens junctions in the epidermis and the renewal of hair follicles. EMBO J. 2003;22:5723-33.

. Ch¥.�d_g�-�i�?J P.l�Y,/(:?.�i �i:i :iC?°i����;.s/�volved in intestinal epithelial d(=;vel_(?pment 65 .,. . . . .

S h o r t B o we l C o n g e ni t al S y n d r o me as t h e p r e s e n t i n g s ympt o m i n m a l e p a t i e n t s wi t h FLNA mut a t i o n s

Christine S. van der Werf 1 , MD, Yuma Sribudiani 1 ·· , PhD, Joke B.G.M. Verhe1J ' , MD, Matthew Carrol11 , MD, Edward O'Loughlin , MD, Chien-Huan Chen4 , MD, Alice S. Brooks/ MD, PhD, M. Kathryn Liszewsk i"',MD, John P. Atkinson"\ MD, Robert M.W. Hofstra 1 2 , PhD.

1Department of Genetics, University of Grornngen, University Medical Centre Groningen, Groningen, the Netherlands. "Department of Cl inical Genetics, ErasmusMC, Erasmus University Rotterdam, Rotterdam, the Netherlands. 3Department of Paediatric Gastroenterology, Hepatology and Nutrition, The Chi ldren's Hospital at Westmead, Westmead, New South Wales, Australia. 4Department of Medicine, Divisions of Rheumatology and Gastroenterology, Washington University School of Medicine, St Louis, MO, USA.

Accepted for publtcation m Genetics in Medicine

Abstract

Purpose. Autosomal recessive Congenital Short Bowel Syndrome (CSBS) is

caused by mutations in CLMP. No mutations were found in the affected males

of a presumed X-linked CSBS family or in an isolated male patient. Our aim was

to identify the disease-causing mutation in these patients.

Methods. We performed mutation analysis of the second exon of FLNA in the

two surviving affected males of the presumed X-linked family and in the isolated

patient.

Results. We identified a novel two-base-pair deletion in the second exon of

FLNA in all these male patients. The deletion is located between two nearby

methionines at the N-terminus of FLNA. Previous studies showed that translation

of FLNA occurs from both methionines, resulting in two isoforms of the protein.

We hypothesized that the longer isoform is no longer translated due to the

mutation and that this mutation is therefore not lethal for males in utero.

Conclusion. Our findings emphasize that Congenital Short Bowel Syndrome can

be the presenting symptom in male patients with mutations in FLNA.

Keywords: FLNA; short small intestine; mutation; chronic idiopathic intestinal

pseudo-obstruction; synovial lipomatosis.

Introduction

Congenital Short Bowel Syndrome (CSBS) is characterized by a shortened small intestine and intestinal malrotati on. While the normal length of the small intestine at b irth is approximately 275 cms,1 patients with CSBS have a markedly shorter small intestinal length of around 50 ems, on average. CSBS has a high mortality rate within the first few months after birth, although some long-term survivors of CSBS have been reported.2-5

CSBS is an inherited disorder. The identification of homozygous and compound heterozygous mutations in Coxsackie- and adenovirus receptor-Like

Membrane Protein (CLMP) in CSBS patients confirmed an autosomal recessive pattern of inheritance in most affected families.6 However, no CLMP mutations were identified in one Italian family7

·8 nor in an isolated German-American male

(Table) who presented with Congenital Short Bowel Syndrome.5 In the affected family, only males developed the disease, consistent with an X-linked pattern of inheritance (Figure).8

In the literature a family with X-linked Chronic Idi opathic Intestinal Pseudo­obstruction (CIIP) has been described.9·

1 0The patients in this family have very similar features to those seen in CSBS patients with mutations in CLMP, including a shortened small intestine. A two-base-pair deletion in the second exon of Filamin A (FLNA) (c.65-66delAC) was identified in this X-linked CIIP family. This deleti on is located between two nearby methionines at the N-terminus of FLNA. It was shown that translati on of FLNA can occur from either methionine in vitro

and that the deletion only affects the longer form of FLNA.1 0

We hypothesized that the longer form of FLNA is essential for normal small intestinal development and we therefore performed mutation analysis of the second exon of FLNA in the X-linked CSBS family and in the isolated male patient.

I I

I l l

I -1 I I -3 II -9 I l l -5

I -2 II -1 I I -8 I l l -4

II -6 I l l -6

D

0

•

C

C

C

A C

A C

C

T C C

T C C

C

G G G C G

G G G G G

G G G C G

IWV\1\--------- - - - - - - -� male 0 female carrier

female • deceased affected male

affected male

A

B

Figure.A Pedigree of the X-linked CSBS family_ B. Chromatogram showing FLNA exon 2 sequence around c.1 6-17delT C. Top: sequence of healthy family members, same as reference sequence. Middle: sequence of female carriers in the family; heterozygous for the c.16-17delT C mutation_ Bottom: sequence of the male CSBS patients carrying the c.16-17delT C mutation .

•

Materials and Methods

Patients

The presumed X-linked CSBS family was reported by Kern et al.2 As described in their case report, the patients in this family presented with bile-stained vomiting and diarrhoea, symptoms typically seen in Congenital Short Bowel Syndrome patients. The two patients in the Italian family who survived were included in our study. Patient 1 1 -6 was born with a small intestine of a total length of 60 ems. The family pedigree is presented in the figure. The isolated male patient (patient I, family 2) who presented with Congenital Short Bowel Syndrome was described by Siva et al; who emphasized the extensive nature of a rare arthropathy known as synovial lipomatosis.3 The measured small intestinal length of this patient was 90 inches (=228.6 ems) at age 15 (one-third of normal length). This patient is a long-term survivor and is over 40 years old. The arthropathy resolved spontaneously.

Our study protocol was approved by the institutional and national ethics review committees at University Medical Centre Groningen (NL31708.042.10) and at Washington University School of Medicine. Written informed consent was obtained from all the study participants.

Genetic Analysis

Genomic DNA was isolated from peripheral whole-blood lymphocytes by standard procedures. Mutation analysis of the exonic and flanking intronic regions of the second exon of FLNA (NG_011506.1) was performed using the primers FLNA forward, 5'-CGCAACCTCTGCTCCCTGCC-3', and FLNA reverse, 5'-GCGCCACCGACACGTTCTCA-3'. PCR was performed as follows: 35 cycles with 100 nanogram of genomic DNA at 95°C for 1 minute, at an annealing temperature of 55°C for 1 minute and then at 72°C for 1 minute. This was accomplished in two patients of the family and their unaffected relatives, in the isolated male patient (patient I , family 2) and his mother, and in 92 controls of Caucasian ethnicity.

FLNA-mutations 1n maie CSBS patients __ , - - 71 ,r , .. , .• � ...... · ... ·,; ·•-, •-.... .:-: i· -. �J ,•• . . .. � " -

Table. Clinical data on the X-linked Congenital Short Bowel Syndrome patients.

Family Patient Ethnicity Sex Length small bowel Other features Mutation

1 11-6 Italian Male 60 ems at birth Nil e.16-17delCT

111-6 Italian Male Unknown Nil e.16-17delCT

(ref 7 and 8)

2 1 German-American Male At age 15: 228,6 ems Synovial lipomatosis e.16-17delCT (ref 5)

Results

We identified a two-base-pair deletion (c.1 6-17delTC) in the two surviving

affected males in the family and also in the isolated male patient (Figure). We

confirmed co-segregation of the 2-bp deletion in the X-linked family and showed

that all the obligate carriers were heterozygous for this delet ion. Because the

mother of the isolated male patient did not carry the deletion, we concluded

that his mutation had occurred de novo. Moreover, this mutation was absent in

92 controls and is not reported in any SNP database or in the exome sequence

variant database (http://evs.gs.washington.edu/EVS/).

The c.1 6-17delTC deletion results in a frameshift and a premature stop

codon at amino acid 103. In the predicted protein, only the first six amino acids

are retained, which are identical to the wild-type f ilamin A. They are followed by

97 different amino acids. As the c.16-17delTC mutation is located between the

first and second methionine, it likely has a similar effect to the c.65-66delAC

mutation (found in CI IP)10 that results in loss of only the long form of FLNA.

Discussion

Mutations in FLNA are associated with a wide spectrum of disorders, including

periventricular nodular heterotopia, otopalatodigital syndromes types 1 and 2,

frontometaphyseal dysplasia and Melnick Needles syndrome, and X-linked cardiac

valvular dystrophy.11·1 3 Our findings add Congenital Short Bowel Syndrome to this

list as a possible present ing phenotype in male patients with a mutation in FLNA.

We therefore emphasize the importance of FLNA in intestinal development. The

index patient of the family described by Gargiulo et al developed asymmetrical

spastic diplegia and an abnormal intermediate signal in the peritrigonal white

matter was seen on MRl.10 We cannot exclude central nervous system involvement

in our patients because no MRI brain scans were available. However, they did

not have any clinical neurological abnormalities like seizures or spasticity; not

all patients with mutations in FLNA have central nervous system involvement.

The mother of the proband described by Kapur et al did have a duplication of

the first 28 exons of FLNA, but had a normal cranial MRl.14

In addition to Gargiulo et afs finding of a 2-bp deletion in FLNA in one

male CIIP patient, Kapur et al reported FLNA mutations in patients with CIIP.10·1 4

They identified a partial duplication of the first 28 exons of FLNA in one family

and a nonsense mutation (c.7021C> T; Q2341X) in exon 43 in another patient.

However, these patients were diagnosed with multiple congenital anomalies, of

which a congenital short bowel was only one feature.14 These findings support

our hypothesis that FLNA is important for normal small intestinal development.

As the mutations in the second exon are located between the first

two methionines, they probably act as mild mutations, conserving the reading

frame encoding the short isoform, associated with a rather mild phenotype. The

mutations identified in the patients reported by Kapur et al were much more

severe, explaining their more severe phenotype.

Our finding raised the question whether CSBS patients with a mutation

in the second exon of FLNA and CSBS patients with mutations in CLMP have

the same phenotype. Clearly, the congenital short bowel is a feature they have

in common, but also pseudo-obstruction has been described in CSBS patients

with mutations in CLMP. Therefore, the bowel tissue of CSBS patients has been

studied to determine if there is an abnormality of the enteric nervous system

underlying the reduced bowel movements. Although the bowel wall in CSBS

patients seems to be macroscopically normal, Tanner et al described abnormal

histology of the bowel wall revealed by silver staining, in which there were too

many neurons in the ganglia.15 The neuronal nuclei showed clumped chromatin,

which is characteristic of neuroblasts. They observed that the intrinsic argyrophil

ganglia were absent or much reduced in number, and argued that these

histological findings might cause the motility abnormalities described in their

patient as well as in other cases.15 In addition, Schalamon et af6 observed an

abnormal bowel wall with signs of neuronal intestinal dysplasia in a patient from

• •

a consanguineous Turkish family, in whom a truncating homozygous mutation in CLMP was detected.6 In other cases, no abnormalities of the nerve plexus were observed on routine histology or by acetylcholinesterase staining.17

·1 8 However,

histology specimens were not available for all cases. To conclude, the clinical features of CSBS patients with FLNA mutations

conserving the short isoform and CSBS patients with mutations in CLMP are very similar. Both have a congenital shortened small intestine and malrotation. In addition, all CIIP patients described with FLNA mutations have a congenital short bowel as a common feature. Male CSBS patients with either missense mutations or distal truncating mutations in FLNA have in general multiple congenital anomalies, and not only a congenital shortened small intestine. However, the male patients in our study and the male patient described by Gargiulo et al presented with a gastrointestinal phenotype, including malrotation, a shortened small intestine and pseudo-obstruction, and all have a 2-bp deletion in the second exon of FLNA.10 Thus, starting with screening exon 2 of FLNA is therefore recommended in male patients presenting with CSBS without mutations in CLMP. If no mutation is found in the second exon of FLNA, screening the entire FLNA gene might reveal another, more distal, non-truncating mutation. In male patients with CSBS and multiple major congenital anomalies, it is worth screening the entire FLNA gene for mutations. A family history of features associated with FLNA mutations, like periventricular nodular heterotopia and cardiac valvular dystrophy can also point to FLNA mutations. Furthermore, as FLNA mutations have not been found in patients with only pseudo-obstruction, we argue that a diagnosis of CSBS rather than CIIP, with or without central nervous system involvement, should drive additional genetic screening for mutations in FLNA in male patients. These data also suggest that FLNA could be seen as the underlying gene for CSBS rather than for CIIP.10 As mutations in either FLNA or CLMP can explain CSBS, further research is needed to understand a possible interaction of their gene products.

We do not know whether FLNA and CLMP are directly linked or are part of the same protein network. Raschperger et al showed that CLMP co-localizes with actin filaments.1 9 They speculated that CLMP interacts with a protein that directly binds to actin filaments, which would bring CLMP to the tight junction by anchoring CLMP in the actin cytoskeleton. They suggested that Z0-1 could

be such an interacting protein. As FLNA also binds to actin filaments, we can

speculate that FLNA is the link between CLMP and the actin cytoskeleton. It

is known that FLNA interacts with other trans-membrane proteins like integrin

beta and the cystic fibrosis trans-membrane conductance regulator (CFTR).20

There is also supportive evidence that FLNA plays a role in anchoring trans­

membrane proteins in the cell membrane. It has been shown, for example, that

for the expression of CFTR on the cell membrane, the interaction of CFTR

with FLNA is important.20 Therefore, we might suspect that FLNA plays a role

in the internalization of CLMP in the plasma membrane as well. It can be

speculated that the mutations in FLNA influence the expression of CLMP on

the plasma membrane. Further research is needed to determine whether CLMP

and FLNA do indeed interact in the same protein network and, if so, which other

proteins are involved in this network. We cannot exclude that different pathways

underlie X-linked CSBS and autosomal recessive CSBS, with different disease

mechanisms leading to a similar disease phenotype.

Grant support The work was funded by the Junior Scientific Masterclass (University of Groningen), and the J.K. de Cock Foundation.

Acknowledgements We would like to thank the patients and their families for participating in this study, Jackie Senior for editing the manuscript, and Dr: Dineke S. Verbeek for critically reviewing the manuscript.

References

1. Weaver LT, Austin S, Cole T J. Small intestinal length: a factor essential for gut adaptation. Gut. 1 991 ;32:1321-3.

4. Hasosah M, Lemberg DA, Skarsgard E, Schreiber R. Congenital short bowel syndrome: a case report and review of the l iterature. Can J Gastroenterol. 2008;22:71 -4.

2. Huysman WA, Tibboel D, Bergmeijer 5. Siva C, Brasington R, Totty W, Sotelo A, and Atkinson J. Synovial JH, Molenaar JC. Long-term survival

of a patient with congenital short bowel and malrotation. J Pediatr Surg. 1 991;26:103-5.

3. Ordonez P, Sondheimer JM, F idanza S, Wilkening G, Hoffenberg EJ. Long-term outcome of a patient with congenital short bowel syndrome. J Pediatr Gastroenterol Nutr 2006;42:576-80.

lipomatosis (lipoma arborescens) affecting multiple joints in a patient with congenital short bowel syndrome. J Rheumatol. 2002;29:1088-92.

6. Van der Wert CS, Wabbersen TD, Hsiao NH, et al. CLMP is required for intestinal development, and loss-of-function mutations cause

congenital short-bowel syndrome. Gastroenterology. 2012;142:453-462. e3.

7. Kern IB, Harris MJ. Congenital short bowel. Aust NZ J Surg. 1973;42: 283-5.

8. Kern IB, Leece A, Bohane T. Congenital short gut, malrotation, and dysmotility of the small bowel. J Pediatr Gastroenterol Nut[ 1990; 11 :411-5.

9. Auricchio A, Brancolini V, Casari G, et al. The locus for a novel syndromic form of neuronal intestinal pseudoobstruction maps to Xq28. Am J Hum Genet. 1996;58:7 43-8.

10. Garguilo A, Auriccio R, Barone MV, et al. Filamin A is mutated in X-linked chronic idiopathic intestinal pseudo­obstruction with central nervous system involvement. Am J Hum Genet. 2007;80:751-8.

11. Robertson SP. Filamin· A: phenotypic diversity. Curr Opin Genet Dev. 2005;15:301-7.

12. Bernstein JA, Bernstein D, Hehr U, Hudgins L. Familial cardiac valvulopathy due to f ilamin A mutation. Am J Med Genet A. 2001;155A:2236-41.

13. Kyndt F, Gueffet JP, Probst V, et al. Mutations in the gene encoding f ilamin A as a cause for familial cardiac valvular dystrophy. Circulation. 2007;115:40-9.

14. Kapur RP, Robertson SP, Hannibal MC, et al. Diffuse abnormal layering of small intestinal smooth muscle is present in patients with FLNA mutations and

•

x-linked intestinal pseudo-obstruction. Am J Surg Pathol. 2010;34:1528-43.

15. Tanner MS, Smith B, Lloyd JK. Functional intestinal obstruction due to deficiency of argyrophil neurones in the myenteric plexus. Familial syndrome presenting with short small bowel, malrotation, and pyloric hyperthrophy. Arch Dis Child. 1976;51 :837-41.

16. Schalamon J, Schober PH, Gallippi P, Matthyssens L, Hollwarth ME Congenital short-bowel; a case study and review of the literature. Eur J Pediatr Surg. 1999;9:248-50.

17. Hamilton JR, Reilly BJ, Marecki R. Short small intestine associated with malrotation: a newly described congenital cause of intestinal malabsorption. Gastroenterology. 1969;56:124-36.

18. Erez I, Reish 0, Kovalivker M, Lazar L, Raz A, Katz S .. Congenital short-bowel and malrotation: clinical presentation and outcome of six affected off spring in three related families. Eur J Pediatr Surg. 2001;11:331-4.

19. Raschperger E, Engstrom U, Pettersson RF, et al. CLMP, a novel member of the CTX family and a new component of epithelial tight junctions. J Biol Chem. 2004;279:796-804.

20. Playford MP, Nurminen E, Pentikainen OT, et al. Cystic fibrosis transmembrane conductance regulator interacts with multiple immunoglobulin domains of Filamin A. J Biol Chem. 2010;285:17256-65.

FLNA mutations in male CSBS patients 77

•

A f e mal e p at i e n t wi t h p e r s i s t e n t pul mo n ar y h yp e r t e ns i o n o ! t h e n e wb o r n a n d C o n g e n i t al S h o r t B o we l S yn d r o me

Christine S. van der Wert1·, Johanna C. Herkert1 · , Albertus T1mmer2, Klasien A. Bergman3, Andrew G. Nicholson4 , Joke B.G.M. Verheij1 , Robert M.W. Hofstra 1•5•

1Department of Genetics, 2Department of Pathology and Medical Biology, 3Divis 1on of Neonatology, Department of Paediatrics, University of Grornngen, University Medical Centre Groningen, Groningen, the Netherlands. 4Department of Histopathology, Royal Brampton Hospital, London, UK. 5Department of Clinical Genetics, Erasmus University Rotterdam, ErasmusMC, Rotterdam, the Netherlands.

*These authors contributed equally to this work.

Ready for submission

Abstract

Here, we report a female patient who presented with persistent pulmonary

hypertension of the newborn and dysmorphic features. She died at the age of

one month despite extracorporeal membrane oxygenation. At autopsy, intestinal

malrotation and a short small intestine were identified. Array-CGH was performed

because multiple congenital abnormalities were seen and this revealed a normal

female karyotype. The CLMP and FLNA genes were screened for mutations

because of the congenital short small intestine. Subsequently, because she also

showed dysmorphic features that can be seen in Noonan syndrome and its

related syndromes, Cardio-Facio-Cutaneous syndrome and Costello Syndrome,

molecular genetic testing of the genes known in these syndromes was also

performed. However, no mutations were identified. The unusual presentation

of Congenital Short Bowel Syndrome (CSBS) in this female patient presenting

with pulmonary hypertension without alveolar capillary dysplasia suggests a new

disease entity. Furthermore, it shows that next to CLMP and FLNA, there are

probably additional genes involved in CSBS.

:I

Background

Here, we report a female patient who presented with persistent pulmonary

hypertension and dysmorphic features. Despite treatment with extracorporeal

membrane oxygenation, the patient's condition deteriorated and treatment was

discontinued. She died at the age of one month. At autopsy, a shortened small

intestine and malrotation of the bowel were observed. The unusual presentation

of Congenital Short Bowel Syndrome in this female patient presenting with

pulmonary hypertension without alveolar capillary dysplasia suggests a new

disease entity.

Case presentation

A baby girl was born after labour was induced for prolonged rupture of membranes

at 39 + 5 weeks. She was the second child, first girl, of non-consanguineous

Caucasian parents. The family history was negative for congenital anomalies

and mental retardation, except for a third-degree female relative with a neural

tube defect. Pregnancy history was negative for teratogenic or mutagenic factors.

Her birth weight was 3.5 kg and the Apgar scores were 4, 6, 6 at 1, 5, and 1 O

minutes, respectively. Prenatally, polyhydramnios and an absent stomach bubble

were observed and esophageal atresia was therefore suspected. However,

this could not be confirmed after birth. Because of respiratory insufficiency,

she was intubated and mechanically ventilated, and transferred to the neonatal

intensive care unit. Because of severe oxygenation problems due to persistent

pulmonary hypertension of the newborn, she was transferred to a tertiary centre

for extracorporeal membrane oxygenation (ECMO) after maximal conventional

therapy failed to help.

She showed dysmorphic features: a high forehead, a short webbed

neck, a low posterior hairline, an inter-nipple distance of 9.5 cm (p75-p97), and

slightly posterior-rotated ears. In addition, the second and third toes were long

compared to the fourth and fifth toes. Brain MRI, renal echography and total body

X-rays showed no abnormalities. Furthermore, metabolic screening excluded

Carbohydrate-deficient glycoprotein syndrome (CDG), Gaucher syndrome, and

Niemann Pick A+B syndrome. After an uneventful 6 days veno-venous ECMO-run,

she was managed with conventional therapy. Sildenafil was started because of

. •

relapse of pulmonary hypertension. A chest tube was inserted for chylous pleural

effusion which was managed with total parenteral nutrition and minimal enteral

feeding. The pulmonary hypertension deteriorated despite optimal treatment. It

was therefore decided to discontinue treatment and she died shortly afterwards,

at the age of 1 month. The parents gave consent for an autopsy.

At autopsy the girl weighed 4160 gram (0 / +1 SD), her length was 55.5

cm (0 / +1 SD) and her head circumference was 39.5 cm (+2 SD). On internal

examination, non-chylous pleural effusion was found. The left lung consisted of

two lobuli and the right lung of four lobuli. On microscopy pre-acinar and acinar

arteries showed medial hypertrophy. The alveolar architecture was normal.

The alveolar interstitium was widened and showed type 2-cell hyperplasia. In

addition, a moderate chronic inflammatory infiltrate was noticed with congested

capillaries. This histology is compatible with pulmonary hypertension due to

persistent pulmonary hypertension of the newborn. No signs of pulmonary veno­

occlusive disease, pulmonary capillary haemangiomatosis, or alveolar capillary

dysplasia were observed. The heart showed a situs solitus of the atria with

concordant atria-ventricular and ventriculo-arterial connections. No structural

abnormalities were noticed. The right atrium was dilated; the right ventricle was

dilated and apex-forming. The oval foramen was only partially closed by an

incompletely developed flap valve. The ductus arteriosus was patent. Abdominal

examination showed mild chylous ascites. The ligament of Treitz was right­

sided. The small intestine was located at the right sight of the abdomen with a

narrow mesentery. The colon was located at the left side of the abdomen with

a long mesentery. The ileocecal junction was lying free in the abdomen without

fixation. The length of the small intestine was 98 ems (in a normal newborn this

would be approximately 310 ems, on average) and the length of the colon was

52 ems (normally approximately 45 ems, on average).

Differential diagnosis

No clear cut disease entity fits the disease phenotype as observed in this patient.

Because multiple congenital abnormalities were seen, a chromosomal syndrome

was considered and array-CGH was performed. At autopsy a congenital short

small intestine was observed, so we performed mutation analysis for the genes

known to be related to Congenital Short Bowel Syndrome, namely CLMP and

• J. .. .. - • .. -

FLNA.1 •2

Due to her dysmorphic features, we considered Noonan Syndrome and its related syndromes, Cardio-Facio-Cutaneous syndrome and Costello Syndrome. The phenotypic features in these syndromes overlap which can be explained by the fact that mutations are found in genes which are all involved in the RAS-ERK pathway that regulates cell differentiation, prol iferat ion and apoptosis.3 Features that supported the diagnosis of Noonan syndrome were a low posterior hairline, a webbed neck, a high inter-nipple distance, the abnormal appearance of the ears, and pulmonary hypertension with pleural effusion. However, the absence of pulmonary valve stenosis, hypertrophic cardiomyopathy and/or hypertelorism argues against this diagnosis.

Additional arguments for the diagnosis of Cardio-Facio-Cutaneous syndrome were the observation of polyhydramnios, a high forehead, and a large head circumference. Intestinal malrotation has been described in a child with Cardio-Facio-Cutaneous syndrome, although this diagnosis was not confirmed by molecular testing.4 However, our patient did not have a congenital heart disease or cutaneous capillary malformations.

Polyhydramnios and a large head circumference are also features of Costello syndrome, although her birth weight was normal and no skin anomalies were seen.

Investigations

Array-CGH (Agilent 180 K) showed a normal female karyotype. Because Congenital Short Bowel Syndrome was observed at autopsy, sequence analysis for FLNA and CLMPwas performed.1 -2 Molecular genetic testing was performed for the genes involved in Noonan, Costello and Cardio-Facio-Cutaneous Syndromes: PTPN1 1, S0S1, RAF1, KRAS, NRAS, SHOC2, CBL,HRAS, BRAF,MAP2K1 and MAP2K2. However, this did not reveal any mutati ons.

Discussion

Here, we report a female patient who presented with persistent pulmonary hypertension of the newborn, dysmorphic features and who also proved to have Congenital Short Bowel Syndrome.

The main causes of pulmonary hypertension in children are persistent

pulmonary hypertension of the newborn and pulmonary hypertension related to

congenital heart diseases.5 Normally, pulmonary vascular resistance decreases

after birth, causing an increased pulmonary blood flow and closing of the oval

foramen and the ductus arteriosus. The increased p02

in the alveoli and the related

increased arterial p02

and decreased pC02

cause lowering of the pulmonary

vascular resistance. In persistent pulmonary hypertension of the newborn this

process is disturbed. There are many causes for this, such as perinatal asphyxia,

septicemia, meconium aspiration syndrome, pulmonary hypoplasia, hypoglycemia,

hypothermia and hyperviscosity. If the pulmonary vascular resistance does not

decrease, the pulmonary blood flow will not increase and the gas exchange will

be impaired, resulting in hypoxia. Because of the high vascular resistance in

the lungs, blood will shunt through the oval foramen and the ductus arteriosus.

Treatment of the impaired oxygenation is mechanical ventilation and sedation.

In addition, inotropics and vasodilating agents like nitrogen oxide can be given.

If this treatment is insufficient, extracorporal membrane oxygenation (ECMO)

is the last treatment option.6 Pulmonary hypertension can also be caused by

ventricular septal defects, atrio-ventricular-septal defects and a patent ductus

arteriosus. Increased blood flow or increased vascular resistance, or both, can

be the underlying mechanisms involved in the pathophysiology of the pulmonary

hypertension.6 Finally, bronchopulmonary dysplasia can also lead to pulmonary

hypertension but is often missed. Pulmonary hypertension is often related to

genetic syndromes, of which trisomy 21 is the most common.5

Thus, pulmonary hypertension may be due to many causes and it

does not have to be inherited or genetic. However, in this patient we also saw

dysmorphic features as well as pulmonary hypertension, pointing to a genetic

syndrome. Because no clear cut disease entity fitted the observed phenotype,

a chromosomal syndrome was considered. We performed array-CGH, which

showed a normal female karyotype. At autopsy a congenital short small intestine

was observed, which is believed to be an inherited disease.

Patients with Congenital Short Bowel Syndrome (CSBS) usually present

within a few days after birth with bile-stained vomiting, diarrhoea, and failure

to thrive. Occasionally, a shortened small intestine and malrotation is detected

later in life when an exploratory laparotomy is performed for significant

gastrointestinal complaints.7 While the mean length of the small intestine at birth is normally 250 ems, patients with CSBS are born with a small intestine of 50 ems, on average. Other gastrointestinal anomalies that are observed in CSBS patients are the absence of the appendix,0-

1 O volvulus,1 1·1 2 a shortened colon,8•

1O,1 3

and hypertrophic pyloric stenosis. Recently, we have identified mutations in Coxsackie- and adenovirus receptor-Like Membrane Protein (CLMP, also called adipocyte specific adhesion molecule [ASAM],- MIM-6 11693) and Filamin A

(FLNA; MIM-300048) in CSBS patients.1-2

The pathology results showed that the lung abnormalities were consistent with a persistent pulmonary hypertension of the newborn, and an open foramen ovale and a patent ductus arteriosus were found. A patent ductus arteriosus has been described in patients with Congenital Short Bowel Syndrome.14

·1 5 In

one case, a patent ductus arteriosus was found at autopsy.14 In another case, a systolic murmur was observed on physical examination and an ECG showed left ventricular hypertrophy, together with the findings on the X-ray, a patent ductus arteriosus was suspected. This patient developed cardiac failure at the age of 6.5 months and was treated with digitalis until surgical correction of the patent ductus arteriosus could be performed at the age of 20 months.14 In addition, Royer et al reported a CSBS patient who presented with gastrointestinal problems and a systolic murmur, suggesting a patent ductus arteriosus.1 5 A male patient was also reported with intestinal pseudo-obstruction and multiple congenital anomalies, including intestinal malrotation, a short small intestine, patent ductus arteriosus and periventricular nodular heterotopia. A duplication of the first 28 exons of FLNA was identified in this patient and in his nephew, who was stillborn at the age of 33 weeks and was also diagnosed with multiple anomalies, including a malrotated short small intestine.1 6 So mutations in FLNA

have been described in male patients with Congenital Short Bowel Syndrome and with multiple congenital anomalies including a patent ductus arteriosus.

Furthermore, mutations in FLNA were found in patients with Congenital Short Bowel Syndrome without a patent ductus arteriosus. A two-base-pair deletion in the second exon of FLNA was identified in a male patient with chronic idiopathic intestinal pseudo-obstruction, a short small bowel, intestinal malrotation, pyloric hypertrophy and an ileal volvulus.17

•1 8 In addition, we identified

a novel two-base-pair deletion in the second exon of FLNA in an X-linked CSBS

family and an isolated male CSBS patient.2 A nonsense mutation c.7021 C> T was identified in FLNA in another male patient with multiple congenital anomalies, including a short small intestine.1 6

Finally, pulmonary disease has been reported in patients with FLNA

mutations but without CSBS.1 9•20 A male patient with a mosaic nonsense

mutation in FLNA has been described who presented with periventricular nodular heterotopia, a patent ductus arteriosus that was ligated after five days and severe congenital lung disease. The lung disease included bilateral atelectasis, lung cysts, tracheobronchomalacia, pulmonary arterial hypertension, and long­term oxygen dependency. Pan-pulmonary emphysema and reduction of bronchial cartilage was seen on histology. A congenital short small intestine was not reported in this patient, but he did have a supra-umbilical hernia and needed nutritional support.1 9 The association of a mutation in FLNA and lung disease was confirmed in a female patient with a missense mutation c.220G>A. She presented with periventricular nodular heterotopia, cardiovascular abnormalities, including an atrial septal defect and coarctation of the aorta and lobar emphysema of the right middle pulmonary lobe with bronchomalacia. Emphysema without inflammation was seen on histology.20

Thus, mutations in CLMP and FLNA were considered. Since patients with CSBS and mutations in CLMP do not usually have additional congenital anomalies, but a restricted gastrointestinal phenotype, mutations in FLNA were more likely to underlie the disease entity in this patient. Although the patient was female, mutations in FLNA were still considered because, as mentioned above, mutations in FLNA have been reported in both male and female patients with a patent ductus arteriosus.1 6

•1 9

• 2 1

·23 However, sequence analysis of both FLNA

and CLMP and array-CGH revealed no mutations, nor homozygous deletions or duplications around FLNA and CLMP.

The female patient we report here had an unusual presentation in that other CSBS cases reported with a patent ductus arteriosus presented with gastrointestinal problems rather than with pulmonary hypertension. In addition, as far as we know, a short neck and a low posterior hairline have never been described in patients with Congenital Short Bowel Syndrome. We therefore performed molecular genetic testing for the genes involved in Noonan Syndrome and its related disorders because these syndromes often show features such as • • • " .. � .. . ... -

a low posterior hairline, webbed neck, and pulmonary hypertension with pleural

effusion. However, no mutations were identified in these genes.

One candidate gene that we considered for our patient was FOXF 1.

Pulmonary hypertension in association with alveolar capillary dysplasia and

gastrointestinal malformations has been reported in patients with FOXF1

mutations.24 Patent ductus arteriosus and bilobed right lung were also described

in such patients. One female patient with a frameshift mutation in the second

exon of FOXF1 was diagnosed with a congenital short bowel, malrotation and

a small omphalocele in addition to alveolar capillary dysplasia.24 However, no

alveolar capillary dysplasia was observed in our patient, and we therefore did

not screen FOXF 1 for mutations.

In conclusion, this is a case report of an unusual presentation of

Congenital Short Bowel Syndrome in a female patient presenting with pulmonary

hypertension without alveolar capillary dysplasia. This suggests a new disease

entity and shows that more genes might be involved in Congenital Short Bowel

Syndrome.

Consent The parents gave written informed consent for publication of this case report and for participating in further research on Congenital Short Bowel syndrome. The study protocol on Congenital Short Bowel Syndrome research was approved by the institutional and national ethics review committees at the University Medical Centre Groningen (NL31 708.042.1 0).

Acknowledgements The authors would like to thank the parents for participating in the study and Jackie Senior for editing the manuscript.

References

1 . Van der Werf CS, Wabbersen TD, Hsiao NH, et al. CLMP is required for intestinal development, and loss-of-function mutations cause congenital short-bowel syndrome. Gastroenterology. 2012;1 42:453-62.

2. Van der Werf CS, Sribudiani Y , Verheij JBGM, et al. Congenital Short Bowel

Syndrome as the presenting symptom in male patients with FLNA mutations. Accepted for publication in Genetics in Medicine.

3. Roberts A, Allanson J, Jadico SK, et al. The cardiof aciocutaneous syndrome. J Med Genet. 2006;43:833-42.

4. McDaniel CH, Fujimoto A. Intestinal malrotation in a child with cardio­facio-cutaneous syndrome. Am J Med

Genet. 1997;70:284-6. 5. Ivy D. Advances in pediatric pulmonary

arterial hypertension. Curr Opin Cardto/. 2012;27:70-81.

6. Van den Brande JL, Heymans HAS, Monnens LAH. Kindergeneeskunde. 3rd ed.Maarssen: Elsevier gezondheidszorg, 1998. p.161 and p.456-457.

7. Siva C, Brasington R, Totty W, et al. Synovial lipomatosis (lipoma arborescens) affecting multiple joints in a patient with congenital short bowel syndrome. J Rheumatol. 2002; 29: 1088-92.

8. Sabharwal G, Strouse PJ, Islam S, et al. Congenital short-gut syndrome. Pediatr Radio/. 2004;34:424-7.

9. lwai N, Yanagihara J, T suto T, et al. Congenital short small bowel with malrotation in a neonate. Z Kinderchir. 1985;40:371-3.

10. Sarimurat N, Celayir S, Elicevik M, et al. Congenital short bowel syndrome associated with appendiceal agenesis and functional intestinal obstruction. J Pediatr Surg. 1998;33:666-7.

11. Tanner MS, Smith B, Lloyd JK. Functional intestinal obstruction due to deficiency of argyrophil neurones in the myenteric plexus. Familial syndrome presenting with short small bowel, malrotation, and pyloric hypertrophy. Arch Dis Child. 1976;51:837-41.

12. Kern IB, Leece A, Bohane T. Congenital short gut, malrotation, and dysmotility of the small bowel. J Pediatr Gastroenterol Nutr. 1990;11 :411-5.

13. Shawis RN, Rangecroft L, Cook RC, et al. Functional intestinal obstruction associated with malrotation and short small-bowel. J Pediatr Surg. 1984;19:172-3.

• •

14. Sansaricq C, Chen WJ, Manka M, et al. Familial congenital short small bowel with associated defects. A long-term survival. Clin Pediatr (Phi/a}. 1984;23:453-5.

15. Royer P, Ricour C, Nihoul-Fekete C, et a l. [The familial syndrome of short small intestine with intestinal malrotation and hypertrophic stenosis of the pylorus in infants]. Arch Fr Pediatr. 1974;31:223-9.

16. Kapur RP, Robertson SP, Hannibal MC, et al. Diffuse abnormal layering of small intestinal smooth muscle is present in patients with FLNA mutations and x-linked intestinal pseudo-obstruction. Am J Surg Pa tho/. 2010;34:1528-43.

17. Auricchio A, Brancolini V, Casari G, et al. T he locus for a novel syndromic form of neuronal intestinal pseudoobstruction maps to Xq28. Am J Hum Genet. 1996;58:7 43-8.

18. Garguilo A, Auriccio R, Barone MV, et al. Filamin A is mutated in X-linked chronic idiopathic intestinal pseudo­obstruction with central nervous system involvement. Am J Hum Genet. 2007;80:751-8.

19. Masurel-Paulet A, Haan E, Thompson EM, et al. Lung disease associated with periventricular nodular heterotopia and an FLNA mutation. Eur J Med Genet. 2011 ;54:25-8.

20. De Wit MC, Tiddens HA, de Coo IF, et al. Lung disease in FLNA mutation: confirmatory report. Eur J Med Genet. 2011 ;54:299-300.

21. Clayton-Smith J, Walters S, Hobson E, et al. Xq28 duplication presenting with intestinal and bladder dysfunction and distinctive facial appearance. Eur J Hum Genet. 2009;17:434-43.

22. FitzPatrick DR, Strain L, T homas AE,

:1 .. . - . , -

et al. Neurogenic chronic idiopathic intestinal pseudo-obstruction, patent ductus arteriosus, and thrombocytopenia segregating as an X linked recessive disorder. J Med Genet. 1997; 34: 666-9.

23. Fox JW, Lamperti ED, Ek�ioglu Y Z, et al. Mutations in f ii a min 1 prevent migration of cerebral cortical neurons in human periventricular heterotopia.

Neuron. 1998;21:1315-25. 24. Stankiewicz P, Sen P, Bhatt SS, et

al. Genomic and genie deletions of the FOX gene cluster on 16q24.1 and inactivating mutations of FOXF1 cause alveolar capillary dysplasia and other malformations. Am J Hum Genet. 2009;84:780-91.

• •

C o n g e ni t al S h o r t B o we l Synd r o me : a r e v i e w a n d g ui d e f o r c l i n i c al a n d g e n e t i c d i ag n o s i s

C.S. van der Werf 1 , J.B.G.M. Verheij', R.M.W. Hofstra'�.

1Department of Genetics, University of Groningen, University Medical Centre Groningen, the Netherlands. 'Department of Clinical Genet ics, University of Rotterdam, ErasmusMC, the Netherlands.

Ready for submission.

Abstract

Congenital short bowel syndrome (CSBS) is a rare gastrointestinal disorder. While

the mean length of the small intestine at birth is normally 250 ems, patients

with CSBS are born with a small intestine of 50 ems, on average. Due to the

much reduced small intestinal surface, they suffer from severe malnutrition.

CSBS patients present within a few days after birth with bile stained vomiting

and diarrhoea or later with failure to thrive. Occasionally, a shortened small

intestine is detected later in life when an exploratory laparotomy is performed for

significant gastrointestinal complaints. Often a barium contrast X-ray will point

to the diagnosis, but it has to be confirmed by exploratory laparotomy. Because

families with several affected family members have been described, it has been

suggested that CSBS has a genetic basis. Recently, mutations in CLMP have

been found to be the cause of the recessive form of CSBS and mutations in FLNA

cause the X-linked form of the disease. We discuss hypotheses on the disease

pathology as well as how the recent genetic findings can help to understand the

cause of CSBS.

Introduction

Congenital Short Bowel Syndrome is a heritable gastrointestinal disorder, first described by Hamilton et al in 1969.1 For many years the underlying genetic cause of the disease was unknown. Recently, mutations in CLMP were identified to be the cause of the autosomal recessive form of the disease2 and mutations in FLNA as the cause of the X-linked form of the disease3• This review describes the clinical aspects, the recent genetic findings, and the aetiological aspects of this gastrointestinal disorder.

Clinical presentation

Patients with congenital short bowel syndrome often present with bile-stained vomiting and diarrhoea or failure to thrive. They usually present within a few days after birth, but the diagnosis has sometimes been made in patients as old as 15 years.4 Patients suffer from ma I absorption due to the reduced absorptive surface of the small intestine.5 As these patients are also diagnosed with malrotation of the bowel, they are likely to have a general developmental defect of the bowel. The cecum is often positioned in the left upper quadrant of the abdomen close to the splenic flexure.1

·6

-1 0 Nonrotation has also been observed, in this case

the cecum is located in the lower left quadrant of the abdomen.1 1 Although radiography can be suggestive for a shortened bowel, the diagnosis is usually confirmed by laparotomy. While the small intestine is normally around 250 ems in neonates, in CSBS patients its length is 50 ems on average. The appendix was absent in three reported patients,5•

7•1 2 and volvulus was found in four patients.1 3·14

In a few cases not only the small intestine, but also the colon was shortened.5•7•

1 2·1 5 Another gastrointestinal anomaly that has been described in ten CSBS patients is hypertrophic pyloric stenosis.1 0

·1 3

·1 6

-19 It has been suggested that

hypertrophic pyloric stenosis is not part of the general developmental defect of the gastrointestinal tract, but is rather a physiological finding that is a result of the remnant small intestine attempting to slow down the gastric emptying to improve absorptive capacity.

The only extra-intestinal finding described in three CSBS patients is a patent ductus arteriosus.1 6

•18 CSBS patients have a normal intellectual ability.20

•21

Although most authors did not report any dysmorphisms, Ordonez et al

reported minor dysmorphic features of ears, nose and digits. T he ears were

prominent, cup-shaped and the attached lobes were small, the nasal bridge

was prominent, and the digits were long.9 The patient described by De Backer

et al had dysmorphic ears and micrognathia and a balanced translocation of

chromosome 2 and chromosome 11 (46,XX,t(2,11 )(q32.2, p12)) was detected.22

Treatment management and outcome

CSBS patients often need total parenteral nutrition for long-term survival and in

some cases this has to be continued for the first two years of life.6·9 Oral feeding

can be introduced gradually. Infection and other life-threatening complications

of parenteral nutrition such as liver failure have to be managed carefully.16

None of the CSBS patients described in the literature had had a small bowel

transplantation. However, this procedure can be considered for CSBS patients

who have recurrent sepsis or other complications of parenteral nutrition. It has

been recommended that CSBS patients should be managed in a multidisciplinary

manner in a centre specializing in the care of children with intestinal failure.9

Only a quarter of the reported CSBS patients survived for more than one

year (see Table), most CSBS patients die of starvation or sepsis within the first

few days after birth. T he central venous catheters that are used for the supply of

parenteral nutrition, in combination with their malnutrition state, leads to a high

risk of developing sepsis, although the outcome is seen to be better in more

recent case reports, suggesting that the care around parenteral nutrition has

improved.

T he functioning of the remnant small intestine of CSBS patients improves

with time, both in length and absorption capacity, leading especially to better

absorption of fat and vitamin B12.1 ·6·14 T he weight and height of CSBS patients

are often below the 50th percentile,1·6·16·21 ·23 but the nutritious outcome is often

normal.6,9 ,14,24

Genetics

Familial occurrence of CSBS was described in the very first case report of

Hamilton et al. in 1969.1 T hey described a CSBS patient with French-Canadian

parents who were not related and who had five daughters, of whom two were

diagnosed with CSBS. One sibling died at the age of 1 month and 1 week prior . �

Figure. The development of the intestine in human beings

to death a laparotomy had shown a small intestine of 30 ems in length.1 More

case reports followed and a familial occurrence was described in around 60%

of the cases published in the literature, often with respect to affected siblings. In

around 25% of the cases the parents were consanguineous (see Table). It has

therefore been suggested by several authors that genetic factors are involved

in CSBS and, because CSBS had been described in siblings of both sexes and

in consanguineous families, an auto soma I recessive pattern of inheritance was

proposed by many of them.6•10•18.2o.25-2a However, in some families only boys were

affected, so an X-linked pattern of inheritance was suggested by others.16•14

•19•

29

Chromosomal abnormalities

Most CSBS patients have a normal karyotype, only two CSBS patients have

been described with chromosomal abnormalities. Hou et al reported a female

patient with multiple congenital anomalies including a congenital short bowel,

malrotation, a patent ductus arteriosus, in addition to major malformations like left

upper amelia, dextrocardia and asplenia. In this girl chromosomal investigation

showed a mosaic pattern with complex rearrangements of chromosome 4: 85%

of the peripheral lymphocytes showed a normal female cell line (46,XX), while

1 2% of the cells showed a pattern with one normal chromosome 4 and a ring

chromosome 4 (46,XX-4,+r(4)(p16-q22.3). The ring caused a deletion of the long

CSBS: a review and guide for cl1nical and genetic diagnosis 95

arm of chromosome 4. Approximately 4% of the cells had a pattern with a partial trisomy of chromosome 4, one normal chromosome 4, one ring chromosome 4 and one chromosome 4 with the same deletion of the long arm of chromosome 4 (47,XX,4,+r(4)(p16-q22.3),+del(4)(pter-q22.3:)).30 De Backer et al described a patient with a de novo balanced translocation between chromosome 2 and 11 (46,XX,t(2,11)(q32.2,p12)). Interestingly CLMP, the gene involved in autosomal recessive CSBS (see next section), is located on chromosome 11 , but it is not in the proximity of this translocation.22

Loss-of-function mutations in CLMP cause recessive CSBS

In seven CSBS patients from five different families, different homozygous and compound heterozygous loss-of-function mutations have been identified in the gene encoding for the Coxsackie- and adenovirus receptor-Like Membrane Protein (CLMP).2 CLMP, located on chromosome 11q24.1, encodes a transmembrane protein that co-localizes with tight junction proteins and acts as an adhesion molecule.2·31 It is expressed in the intestine during different stages of human development and knock down of the orthologue in zebrafish resulted in developmental defects, including some of the intestine of the zebrafish. As tight junction proteins play an important role in proliferation,32·33 it has been hypothesized that loss-of-function of CLMP results in less proliferation of the small intestinal cells during human development, resulting in a shortened small intestine at birth.2

The reported length of the small intestine of patients with mutations in CLMP is 30 to 54 ems and they all have malrotation of the bowel. Neuronal intestinal dysplasia was reported in only two patients (from one family) with a more complex mutation, presumably an inversion.2• 21

Mutations in FLNA cause X-linked CSBS

In a family with X-linked CSBS and in one isolated patient with CSBS, a two-base­pair (bp) deletion in filamin A (FLNA) (c.16-17delCT) has been identified.3 More patients have been described with loss-of-function mutations in FLNA. Some of them had CSBS as part of the disease phenotype. In one male patient of an X-linked family described with Chronic Idiopathic Intestinal Pseudo-obstruction, another 2-bp deletion in the second exon of FLNA (c.65-66delAC) was found . • •

This patient was diagnosed with malrotation, pyloric hypertrophy, intestinal

pseudo-obstruction, and Congenital Short Bowel Syndrome.34 •35 Another male

patient, stillborn at 33 weeks' gestation, was described with a duplication of

the first 28 exons of FLNA. Prenatal ultrasounds showed normal growth with a

single umbilical artery, umbilical vein varix, and persistent dilatation of the bowel,

first seen at 20 weeks gestation. These findings were confirmed by an autopsy

of the foetus, which also detected a bif id uvula, an atrial septa I defect, and a

malrotated short small intestine of 45 ems (at this gestation stage around 164

ems would be normal). The duplication was also detected in his mother, who was

diagnosed with a bif id uvula and patent ductus arteriosus, and in his uncle, who

had multiple congenital anomalies including a bifid uvula, intestinal malrotation,

undescended testes, partial agenesis of the corpus callosum, patent ductus

arteriosus, patent foramen ovale, ventricular septal defect and periventricular

heterotopia, and in whom the small intestine measured only 115 ems at the age

of 1 O years.36 Another patient with a hemizygous nonsense mutation in FLNA

(c.7021 C> T, Q2341X) was diagnosed prenatally with a left diaphragmatic defect,

which turned out to cause a displacement of the spleen, left hepatic lobe, and

portions of the stomach and small intestine into the left hemithorax. He also

had dysmorphic facial features, spina bifida occulta, natal tooth, periventricular

heterotopia, a posterior fossa arachnoid cyst, and proximally placed thumbs. He

died at 6 years of age and at autopsy his small intestine measured 68 cms.36

Thus, CSBS patients with mutations in FLNA in general have multiple

congenital anomalies and not only a congenital shortened small intestine.

However, a mutation in the second exon of FLNA was identified in all reported

male patients with X-linked CSBS but without other major congenital anomalies.3•35

Screening of exon 2 of FLNA is therefore recommended in such cases. In

X-linked families with CSBS patients with multiple congenital anomalies, it is

worth screening the entire FLNA gene for mutations.

The measured length of the small intestine of patients with mutations

in the second exon of FLNA is 55 ems to 235 ems, and the age of diagnosis

ranges from 1 day up till 15 years,4·14 •1 7 suggesting that, in some cases, the

small intestine is less reduced in length and the diagnosis is made later in life

compared to CSBS patients with mutations in CLMP.

Table Overview of the reported CSBS patients.

Small bowel Sex length (cm)

F 40

F 30

M 30

F 42

M 70

F 25 M 70

M 45

F 40

M 106

M 75

M 62

M 65

M 72

M 24

M 27

F 45

F 45

M 45

M 69

M 1 1 2

M 70

M 237

F 54

F 30

M 39

F 30

F 25

M 47

M 42

F 51

M 95

M 35

M 56

F 20

F 30

M 228,6*

M 70

M Unknown

M 50

F 50

M 50

M 24

M 27

* At age 1 5 years "At age 1 O years

Reference

1

1

8

1 5

17

1 8,29

18,29

18

18

42

1 3

10

16

16

11

11

27

27

7

6

14

14

14 20

43

43

43

12

21

26

26

26

25,26

5

23

9

4

19

19

19

22

24

28

28

#intrauterine demise, >20 weeks

Age at time

of death

>7 y

1 month

5 months

35 days

20 weeks

21 days

4 days

7 months

73 days

25 days

165 days

3,5 months

9 weeks

>5,5 y

55 days

5 months

3,5 months

1 ,5 month

2 months

>7 y

1 ,5 months

6 months

>18 y

>21y

4 months

6 months

2 months

6 months

>13 months

5 months

1 month

>14 y

9 weeks

> 1 year

> 15 months

>7 years

>40 years

22 days

16 days

7 months

> 3 years

>2 years

3 months

5 months

Age at t ime of

presentation

4 months

unknown

3 months

3 days

7 weeks

1 month

hours

15 days

5 days

22 days

6 days

13 days

18 days

6 weeks

32 days

2 days

days

24 hours

5 weeks

5 weeks

1 month

6 hours

3 months

9 weeks

2 days

hours

hours

4 days

9 days

2 days

3 days

2 months

48 hours

4 months

4 days

days

childhood

18 days

7 days

15 days

1 day

6 weeks

3 days

2 days

Fami l ia l C onsanguin ity

Yes no

Yes no

unknown unknown

No No

unknown unknown

Yes unknown

Yes unknown

Yes yes

No no

Yes yes

No no

Yes yes

Yes No

Yes No

Yes no

Yes No

Yes Yes

Yes Yes

No No

No Yes

Yes No

Yes No

Yes No

No No

Yes No

Yes No

No No

No No

Yes Yes

Yes No

Yes No

No Yes

Yes Yes

No No

No No

Yes No

No No

Yes No

Yes No

Yes Yes

No No

Yes Unknown

Yes No

Yes No

Phenotypic diversity of FLNA mutations

Mutations in FLNA are associated with a wide spectrum of disorders. Loss-of­

function mutations are found in patients with bilateral periventricular nodular

heterotopia, a neuronal migration disorder characterized by seizures affecting

mainly females since it is often lethal in males. Mutations that alternate the

function of FLNA are associated with the following disorders: otopalatodigital

syndromes types 1 and 2, frontometaphyseal dysplasia, and Melnick Needles

syndrome. These syndromes constitute a phenotypic spectrum, including skeletal

dysplasia, craniofacial-, cardiac-, genito-urinary and intestinal anomalies, and

central nervous system defects.37 In addition, missense mutations in FLNA are

associated with X-linked cardiac valvular dystrophy.38•39

FLNA is a cytoskeletal protein that binds to actin and plays an important

role in cell signalling and migration in response to environmental changes.37 FLNA

has a well-characterized role in the cytoplasm, where it regulates cell shape by

cross-linking actin filaments. In addition to this, a role for FLNA has recently

been discovered in the nucleoli, where it inhibits ribosomal RNA transcription.40

Histological findings in CSBS patients

Based on the literature the question is whether CSBS is a finding in Chronic

Idiopathic Intestinal Pseudo-obstruction patients or whether abnormal

peristalsis is part of the features seen in CSBS patients.3·33

·4 1 Although in

most CSBS patients, the bowel wall seems macroscopically normal, Tanner

et a/13 described an abnormal histology of the bowel wall revealed by silver

staining in their patients. They found too many neurons in the ganglia and

suggested that the normal fall-out of ganglion cells around the time of birth did

not occur in CSBS patients. The neuronal nuclei showed clumped chromatin,

which is characteristic for neuroblasts. They observed the intrinsic argyrophilic

ganglion cells to be absent or much reduced in number: They argued that these

histological findings may cause the motility abnormalities described in some

cases.15 In addition, Schalamon et al observed an abnormal bowel wall with

signs of neuronal intestinal dysplasia in one of their CSBS patients, who turned

out to have a complex mutation in CLMP.1 The sister of this patient, who had the

same homozygous mutation, was also born with a shortened small intestine and

intestinal neuronal dysplasia.2 However, in other cases, no abnormalities of the

• •

nerves plexus were seen on routine or acetyl cholinesterase staining.1 •6

•12

• 16

· 26

•

42.43 In one CSBS patient heterotopic gastric mucosa was found.4 1 Unfortunately,

histology specimens were not obtained in all cases.

Normal development of the small intestine

To understand what might go wrong in the development of the small intestine in CSBS patients we have to know what happens during normal small intestinal development. What we do know is that the primitive gut tube is divided in the foregut, the midgut and the hindgut, and that all have their own arterial supply (the celiac artery, the superior mesenteric artery and the inferior mesenteric artery). The small intestine Gejunum and ileum) originates from the midgut, as do the distal duodenum, cecum, ascending colon, and the proximal two-thirds of the transverse colon. In the 5th week of embryonic life the future ileum is elongating rapidly (see Figure). As the abdominal cavity itself growths less rapidly, the midgut will form an anteroposterior loop, which is called the primary intestinal loop. The cranial limb of this loop includes the ileum and the caudal limb includes the ascending and transverse colons. In a 6 weeks old embryo the primary intestinal loop will herniate into the umbilicus forced by the elongation of the loop and the growth of other abdominal organs. At this time the loop rotates 90 degrees counter clockwise around the axis of the superior mesenteric artery. The future ileum is now lying on the right and the cecum on the left. The cecum and the appendix continue to differentiate and the small intestine elongates further forming jejunal-ileal loops. During the 10th week of gestation, the intestinal loop returns rapidly to the abdominal cavity. It is not known what causes this retraction, but an increase in the size of the abdominal cavity and a relatively decrease in the size of the liver and kidneys seem to play an important role. The small intestine returns first and the ascending and transverse colons follow later. To reach the definitive configuration of the small and large intestines, the intestinal loop rotates another 180 degrees counter-clockwise.44

•46

Disease aetiology

Before the identification of mutations in CLMP and FLNA explaining CSBS, various authors had proposed different hypotheses for CSBS pathogenesis. We will discuss these hypotheses based on distinguishing them into embryology and

II

intrauterine events, and the lack of neurotransmitters and hormones.

Embryology and intrauterine events. Hamilton et a/1 suggested that the abnormally

short small intestine originates during early embryologic development between

the 7th and 10th week. They hypothesised that the accommodation of the primitive

digestive tube in the intraumbilical coelom is prevented in CSBS patients. This

would cause the primitive bowel to stay in the abdominal cavity so that the

cranial portion of the bowel cannot elongate.1 But Aviram et aP5 observed the

presence of bowel loops inside the umbilical cord on prenatal sonography in

a patient with CSBS. The return of the intestine into the abdominal cavity was

in fact delayed. Aviram et al speculated that incomplete dextral rotation and

elongation of the bowel cause this delay, explaining the observed malrotation in

CSBS patients.25 Delayed return of the intestine into the abdominal cavity is also

associated with volvulus and intestinal obstruction.47 It has been speculated that

intrauterine volvulus leading to ischemia prevents normal growth of the primitive

bowel. In addition, antenatal intussusception followed by autoanastomosis and

auto-amputation is suggested as a cause of CSBS.12 However, growth failure

can also be the cause, rather than the outcome of the observed malrotation in

CSBS patients.17

Another hypothesis is that vascular events underlie CSBS.1 7 Intrauterine

infarction of the bowel may lead to reabsorption of the ischemic bowel and

result in a decreased length of the remaining gut.

In cases in which autoanastomoses were found, intrauterine events like

volvulus and infarction can be a reasonable explanation for the shortened small

intestine.5 However, volvulus has been described in only three cases of CSBS.

In addition, adhesions, atresia, stenosis and scars are rarely found in CSBS

patients. These findings make intrauterine events less likely. In a case report

of a premature neonate in whom the small bowel was absent, there was also

no evidence on prenatal sonography of an abdominal wall defect or other intra­

abdominal anomalies.48

Lack of neurotransmitters and hormones. As abnormal peristalsis has

been observed in some CSBS patients, Sansaricq et al hypothesised that CSBS

patients may lack synthesis of neurotransmitters.16 However, abnormal peristalsis

is not reported in all patients. In addition, Schalamon et al suggested that CSBS

patients lack growth-stimulating hormones like epidermal growth factor, insulin-

like growth factor, and human growth hormone, although they did not observe

abnormal hormone levels in their patient.21

Link between CLMP and FLNA

We now know that mutations in CLMP and FLNA underlie CSBS pathology.2•3

But it is not yet known whether CLMP and FLNA interact and, therefore, whether

mutations in either CLMP or FLNA result in a similar course of events during the

development of the small intestine. As CSBS patients with mutations in CLMP

seem to have only a shortened small intestine and malrotation, the phenotype

in these patients seems to be more restricted to the intestine, whereas patients

with mutations in FLNA are more likely to have multiple congenital anomalies.

However, CSBS patients with a deletion in the second exon of FLNA are very

similar to patients with mutations in CLMP. This suggests that FLNA and CLMP

are involved in the same protein network that is essential for normal short bowel

development.

FLNA is an actin-binding protein and its actin-binding domain is located

in its N-terminal region.37.49 •50 Gargiulo et al showed abnormal actin organisation

in the lymphoblastoid cell line of their patient in whom they found a c.65-

66delAC deletion in FLNA.35 There is therefore evidence that the cytoskeletal

actin organisation is disturbed in CSBS patients with mutations in FLNA.

Whether patients with mutations in CLMP have a similar problem is not known.

Raschperger et a/showed, however, that CLMP co-localizes with actin filaments.31

They speculated that CLMP interacts with a protein that directly binds to actin

filaments, which would bring CLMP to the tight junction by anchoring CLMP in

the actin cytoskeleton. They suggested that Z0-1 could be such an interacting

protein. As FLNA also binds to actin filaments, we can speculate that FLNA is the

l ink between CLMP and the actin cytoskeleton. It is known that FLNA interacts

with other trans-membrane proteins like integrin beta and the cystic fibrosis

trans-membrane conductance regulator (CFTR).50·51 There is also supportive

evidence that FLNA plays a role in anchoring trans-membrane proteins in the

cell membrane. It has been shown, for example, that for the expression of

CFTR on the cell membrane, the interaction of CFTR with FLNA is important.51

Furthermore, FLNA controls the internalization of the chemokine receptor 2B

in different dynamic membrane structures.52 Therefore, we might suspect that

•

FLNA plays a role in the internalization of CLMP in the plasma membrane as

well. It can be speculated that the mutations in FLNA influence the expression

of CLMP on the plasma membrane. Further research is needed to determine

whether CLMP and FLNA do indeed interact in the same protein network and,

if so, which other proteins are involved in this network. We cannot exclude that

different pathways underlie X-linked CSBS and autosomal recessive CSBS, with

different disease mechanisms leading to a similar disease phenotype.

It is not known whether there are more genes involved in the pathogenesis

of CSBS than CLMP and FLNA. We did not identify a mutation in all the patients

we screened for CLMP and the second exon of FLNA. However, we did not

screen all the exons of FLNA in all the patients, and therefore this gene might

still play a role in the disease development in some of the remaining patients.

Based on the finding of an abnormal karyotype with a ring chromosome 4 in one

CSBS patient with multiple congenital anomalies,30 a gene on the long arm of

chromosome 4 might be involved as well. In addition, the balanced translocation

found in the patient reported by De Backer et aP2 might have led to undetected

microdeletions. Therefore, additional genes on chromosomes 2 and 11 might

well play a role. Research on the protein networks of CLMP and FLNA might help

to find more candidate genes.

Link between CLMP and FLNA and the proposed hypotheses

How mutations in CLMP and FLNA lead to Congenital Short Bowel syndrome

remains obscure and whether we can link these genes with the proposed

hypotheses is hard to tell. As the affected genes in CSBS patients do not encode

for neurotransmitters, and as far as we know do not have a link to the production

of neurotransmitters, it is very unlikely that a lack of neurotransmitters, as

proposed by Sansaricq et a/,16 is the explanation of the shortened small intestine.

FLNA is however important in vascular development. Two different mouse

models for FLNA showed vascular defects53·54 and developmental anomalies in

the blood vessels have also been reported in patients with FLNA mutations.55·56

An intrauterine vascular event causing small intestinal infarction, as proposed

by Kern et a/,17 might therefore be a reasonable explanation. The observation

of omphalocoele in patients with FLNA mutations37 supports Hamilton et afs

hypothesis1 that the developmental defect in CSBS patients originates in the

I

embryonic stage at which the bowel is accommodated in the intraumbilical coelom. Furthermore, Aviram et al25 observed a delayed return of the bowel into the abdominal cavity in a patient with CSBS. A similar finding was observed in one of the mouse models for FLNA, in which there was a delayed resorption of the umbilical hernia.54 More research is needed to understand the embryological events leading to the CSBS phenotype and CLMP-null mice might help further our understanding of the disease pathology.

References

1. Hamilton JR, Reilly BJ, Marecki R. Short small intestine associated with malrotation: a newly described congenital cause of intestinal ma I absorption. Gastroenterology. 1969;56:124-36.

2. Van der Werf CS, Wabbersen T D, Hsiao NH, et al. CLMP is required for intestinal development, and loss-of-function mutations cause congenita l short-bowel syndrome. Gastroenterology. 2012;142:453-62.

3. Van der Werf CS, Sribudiani Y, Verheij JBGM, et al. Congenital Short Bowel Syndrome as the presenting symptom in male patients with FLNA mutations. Accepted for publication in Genetics in Medicine.

4. Siva C, Brasington R, Totty W, et al. Synovial lipomatosis (lipoma arborescens) affecting multiple joints in a patient with congenital short bowel syndrome. J Rheumatol. 2002; 29:1088-92.

5. Sabharwal G, Strouse PJ, Islam S, et al. Congenital short-gut syndrome. Pediatr Radio/. 2004;34:424-7.

6. Dorney SF, Byrne WJ, Ament ME. Case of congenital short small intestine: survival with use of long­term parenteral feeding. Pediatrics.

1986;77:386-9. 7. lwai N, Yanagihara J, Tsuto T, et al.

Congenital short small bowel with malrotation in a neonate. Z Kinderchk 1985;40:371-3.

8. Konvolinka CW. Congenital short small intestine: a rare occurrence. J Pediatr Surg. 1970;5:574.

9. Ordonez P, Sondheimer JM, Fidanza S, et al. Long-Term Outcome of a Patient with Congenital Short Bowel Syndrome. J Pediatr Gastroenterol Nutr. 2006;42:576-80.

10. Schnoy N, Bein G, Dumke K. [Familial occurrence of congenital short bowel (author's translation)]. Monatsschr Kinderheilkd. 1978;126:431-5.

11. Tiu CM, Chou Y H, Pan HB, et al. Congenital short bowel. Pediatr Radio/. 1984;14:343-5.

12. Sarimurat N, Celayir S, Elicevik M, et al. Congenital short bowel syndrome associated with appendiceal agenesis and functional intestinal obstruction. J Pediatr Surg. 1998;33:666-7.

13. Tanner MS, Smith B, Lloyd JK. Functional intestinal obstruction due to deficiency of argyrophil neurones in the myenteric plexus. Familial syndrome presenting with short small bowel, malrotation, and pyloric hypertrophy. Arch Dis Child. 1976;51:837-41.

14. Kern 18, Leece A, Bohane T. Congenital short gut, malrotation, and dysmotility of the small bowel. J Pediatr Gastroenterol Nut[ 1990;1 1 :411-5.

15. Yutani C, Sakurai M, Miyaji T, et al. Congenital short intestine. A case report and review of the literature. Arch Pathol. 1 973;96:81-2.

16. Sansaricq C, Chen WJ, Manka M, et al. Familial congenital short small bowel with associated defects. A long-term survival. Clin Pediatr (Phi/a). 1984;23:453-5.

17. Kern 18, Harris MJ. Congenital short bowel. Aust NZ J Surg. 1973;42:283-5.

18. Royer P, Ricour C, Nihoul-Fekete C, et al. [The familial syndrome of short small intestine with intestinal malrotation and hypertrophic stenosis of the pylorus in infants]. Arch Fr Pediat[ 1 97 4;31 :223-9.

19. Nezelhof C, Jaubert F, Lyon G. Familial syndrome combining short small intestine, intestinal malrotation, pyloric hyperthrophy and brain malformation. 3 anatomoclinical case reports. Ann Anat Pathol. 1976;21:401 -12.

20. Huysman WA, Tibboel D, Bergmeijer JH, et al. Long-term survival of a patient with congenital short bowel and malrotation. J Pediatr Surg. 1 991 ;26:1 03-5.

21. Schalamon J, Schober PH, Gallippi P, et al. Congenital short-bowel; a case study and review of the literature. Eur J Pediatr Surg. 1999;9:248-50.

22. De Backer Al, Parizel PM, De SA, et al. A patient with congenital short small bowel associated with malrotation. J Beige Radio/. 1 997;80:71-2.

23. Chu SM, Luo CC, Chou YH, et al. Congenital short bowel syndrome

with malrotation. Chang Gung Med J. 2004;27:548-50.

24. Hasosah M, Lemberg DA, Skarsgard E, et al. Congenital short bowel syndrome: a case report and review of the literature. Can J Gastroenterol. 2008;22:71-4.

25. Aviram R, Erez I, Dolfin TZ, et al. Congenital short-bowel syndrome: prenatal sonographic findings of a fatal anomaly. J Clin Ultrasound. 1998;26:1 06-8.

26. Erez I, Reish 0, Kovalivker M, et al. Congenital short-bowel and malrotation: clinical presentation and outcome of six affected off spring in three related families. Eur J Pediatr Surg. 2001;11:331-4.

27. Shawis RN, Rangecroft L, Cook RC, et al. Functional intestinal obstruction associated with malrotation and short small-bowel. J Pediatr Surg. 1984;19:1 72-3.

28. Wei CF, Lai CT. Congenital short small intestine in siblings. J Formosan Med Assoc. 1985;84:620-4.

29. Duveau E, Bardot-Labbe D, Larget­Piet L, et al. [Congenital short bowel syndrome with intestinal malrotation: an unusual cause of chronic diarrhea]. Gastroenterol Clin Biol. 2000;24:585-7.

30. Hou JW, Wang TR.Amelia, dextrocardia, asplenia, and congenital short bowel in deleted ring chromosome 4. J Med Genet. 1996;33:879-81 .

31. Raschperger E, Engstrom U, Pettersson RF, et al. CLMP, a novel member of the CTX family and a new component of epithelial tight junctions. J Biol Chem. 2004;279:796-804.

32. Balda MS, Matter K. The tight junction protein ZO-1 and an interacting

transcription factor regulate ErbB-2 expression. EMBO J. 2000;19:2024-33.

33. Matter K, Balda MS. Signalling to and from tight junctions. Nat Rev Mo/ Cell Biol. 2003;4:225-366.

34. Auricchio A, Brancolini V, Casari G, et al. T he locus for a novel syndromic form of neuronal intestinal pseudoobstructions maps to Xq28. Am J Hum Genet. 1 996;58:743-8.

35. Gargiulo A, Auricchio R, Barone MV, et al. Filamin A is mutated in X-linked chronic idiopathic intestinal pseudo­obstruction with central nervous system involvement. Am J Hum Genet. 2007;80:751 -8.

36. Kapur RP, Robertson SP, Hannibal MC, et al. Diffuse abnormal layering

Gastric heterotopia with extensive involvement of the small intestine associated with congenital short bowel syndrome and intestinal malrotation. Fetal Pediatr Pa tho/. 201 1 ;30:60-3.

42. Dumke K, Schnoy N. [A rare case of a congenital short intestine]. Z Gastroentero/. 1 97 4;1 2:321 -5.

43. Peng HC, Chen HC, Chang WT. Congenital short small intestine: report of three cases. J Formos Med Assoc. 1 993;92:762-4.

44. Carlson BM. Human Embryology and Developmental Biology. 3rd ed. Philadelphia: Elsevier Science; 2004. p. 361 -362.

45. Larsen WJ. Human Embryology. 2nd ed. New York: Churchill Livingtone Inc; 1 997. p. 240-242.

of small intestinal smooth muscle 46. Moore K, Persaud TVN. T he Developing Human. Clinically Oriented Embryology. 7th ed. Philadelphia: Elsevier Science; 2003. p. 266-270.

is present in patients with FLNA mutations and x-linked intestinal pseudo-obstruction. Am J Surg Pathol. 201 0;34:1528-43.

37. Robertson SP. Filamin A: phenotypic diversity. Curr Opin Genet Dev. 2005;1 5:301 -7.

38. Bernstein JA, Bernstein D, Hehr U, et al. Familial cardiac valvulopathy due to filamin A mutation. Am J Med Genet A 2001 ;155A:2236-41 .

39. Kyndt F, Gueffet JP, Probst V , et al. Mutations in the gene encoding filamin A as a cause for familial cardiac valvular dystrophy. Circulation. 2007;1 1 5:40-9.

40. Deng W, Lopez-camacho C, Tang JY, et al. Cytoskeletal protein filamin A is a nuceolar protein that suppresses ribodomal RNA gene transcription. Proc Natl Acad Sci U S A 201 2;109:1524-9.

47. Finley BE, Burlbaw J, Bennett T L, et al. Delayed return of the fetal midgut to the abdomen resulting in volvulus, bowel obstruction, and gangrene of the small intestine. J Ultrasound Med. 1992;1 1 :233-5.

48. Besner GE, Bates GD, Boesel CP, et al. Total absence of the small bowel in a premature neonate. Pediatr Surg Int. 2005;21 :396-9.

49.

50.

Nakamura F, Osborn T M, Hartemink CA, et al. Structural basis of filamin A functions. J Cell Biol. 2007;1 79:101 1 -25. Qiu H, Nomiyama R, Moriguchi K, et al. I dent if ication of novel nuclear protein interactions with the N-terminal part of filamin A. Biosci Biotechnol Biochem. 201 1 ;75:1 45-7.

41 . Shehata B, Chang T, Greene C, et al. 51 . Playford MP, Nurminen E, Pentikainen

• •

OT, et al. Cystic fibrosis transmembrane conductance regulator interacts with multiple immunoglobulin domains of Filamin A. J Biol Chem. 201 0;285:17256-65.

52. Minsaas L, Planaguma J, Madziva M, et al. Filamin A binds to CCR2B and regulates its internalization. Plos one. 2010;5:e1221 2.

53. Feng Y , Chen MH, Moskowitz IP, et al. Filamin A (FLNA) is required for cell­cell contact in vascular development and cardiac morphogenesis. Proc Natl Acad Sci U S A. 2006;103:19836-41.

54. Hart AW, Morgan JE, Schneider J, et

al. Cardiac malformations and midline skeletal defects in mice lacking filamin A. Hum Mot Genet. 2006;15:2457-67.

55. Kakita A, Hayashi S, Moro F, et al. Bilateral periventricular nodular heterotopia due to f ilamin 1 gene mutation: widespread glomeruloid microvascular anomaly and dysplastic cytoarchitecture in the cerebral cortex. Acta Neuropathol. 2002;104:649-57.

56. Guerrini R, Mei D, Sisodiya S, et al. Germline and mosaic mutations of FLN1 in men with periventricular heterotopia. Neurology. 2004;63:51 -6.

csE.is�J:i,reyi��-·and,g��e�f.o_r <:)inici! 31nd_ genetic diagnosis - . . . · · , . 1 07 , :.

• •

Tr yi n g t o u n r av e l t h e g e n e t i c s o f me g a c ys t i s ­m i c r o c o l o n - 1 n t e s t i n a l hypo p e r i s t al s i s s yn d r o me

C.S. van der Werf 1 · , Y. Sribud1an1 1 ·, P. van der Vlies1 , N. Veldman 1 , M.M. Alves7 , M.A. Swertz1 , F. van D1Jk , R. Cone', B. Shehata , J.B.G.M. Verheij1 , R.M W Hofstra;_ *These authors contributed equally to this work. 1Department of Genetics, University of Groningen, University Medical Centre Groningen, the Netherlands. 2Department of Clinical Genetics, University of Rotterdam, ErasmusMC, the Netherlands. 3Genomics Coordination Centre, Department of Genetics, University of Groningen, University Medical Centre Groningen, the Netherlands. 4Department of Pathology, Children's Health Care of Atlanta at Egleston, Emory University, Atlanta, USA.

*These authors contributed equally to this work.

Work in progress.

Abstract

Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a rare

autosomal recessive disorder affecting the bladder and the intestine. So far,

no gene has been identified for this disease although knockout studies in

mice have implicated the human orthologues of the a3 subunit (CHRNA3) and

the �4 subunit ( CHRNB4) of the nicotinic acetylcholine receptor as candidate

genes. We performed homozygosity mapping and exome sequencing in one

consanguineous family with one affected girl using 300K SNP arrays. We

identified three homozygous regions on chromosomes 1, 2 and 8, respectively.

However, no pathogenic mutation was identified in these regions. Neither were

the candidate genes CHRNA3 and CHRNB4 located in these regions. Repeating

the analysis with a higher resolution array in which the probes are more evenly

distributed and with a more efficient exome capturing and enrichment kit, and

including more patients in our study, might help to find the gene underlying MMIHS .

•

Introduction

Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a rare congenital disorder characterized by abdominal distension due to a much dilated non-obstructed bladder, microcolon and decreased or absent intestinal peristalsis.1 Since the first report of this condition by Berdan et al in 1976 ,1 more than 200 cases have been described in literature. MMIHS is more common in girls , with a female to male ratio of 2.4:1.2 MMIHS patients often die before the age of 6 months due to the complications of the total parenteral nutrition that they require because of the intestinal hypoperistalsis.3 The complications include sepsis. It is believed that the condition has a genetic aetiology since 18 families have been reported with two affected siblings and one family with three affected siblings.2•

4 In four families the parents were consanguineous, suggesting an autosomal recessive pattern of inheritance.2 .

4 So far, no genetic cause of the human disease has been identified, although knockout studies in mice have implicated some candidate genes. Knockout mice for the nicotinic acetylcholine receptor subunits, a3-/- and 132-/-,134-/-, all have an enlarged bladder,5•

6 and intestinal hypoperistalsis was present in the 132-/-, 134-/- mice. Only the double knockout of both 132 and 134 subunits resulted in the phenotype and lack of only 134 gave deficiency of bladder contractions, but no megacystis. The intestinal length was also reduced in the 132-/-,134-/- mice, but because the mice were also smaller in size it was proportionally reduced.6 Lack of the a3 subunit was observed in MMIHS tissues, and therefore mutations in the human orthologues of the a3 subunit ( CHRNA3) and the 134 subunit ( CHRNB4) have been suggested to cause MMIHS.7

Our aim was to identify the gene for MMIHS. We therefore performed homozygosity mapping followed by exome-sequencing. In analyzing the data we focused on genes in the homozygous regions. We also checked whether the proposed candidate genes, the human orthologues of the a3 subunit (CHRNA3)

and the 134 subunit ( CHRNB4) of the nicotinic acetylcholine receptor, were located in the homozygous regions and if so, whether mutations in these genes were present.

Methods

Research subjects

The MMIHS patient included in this study was prenatally diagnosed with MMIHS. Ultrasound at 20 weeks' gestation revealed a megabladder. Labour was induced at 34+4 weeks for polyhydramnion and a female infant of 3000 gm (+2.5 SD) was born with APGAR scores of 9/10. The diagnosis of MMIHS was confirmed by ultrasound of the abdomen and by double-contrast barium enema. Radiography was also suggestive for malrotation. The stomach and bladder were atonic. The patient died a few days after birth due to infection and apnea's. The Caucasian parents were distantly related (over five generations). The study protocol was approved by the institutional and national ethics review committees at the University Medical Centre Groningen (NL35920.042.11 ), and informed consent was obtained.

Homozygosity mapping

Genomic DNA of the patient and the parents was extracted from peripheral lymphocytes by standard methods. A genome-wide scan was performed on the patient using the lllumina 300K SNP array (HumanCytoSNP-12.v2 DNA Analysis BeadChip) according to the manufacturer's instructions (lllumina, San Diego, CA). Homozygosity mapping was performed by an automatic search for a minimum of 15 consecutive homozygous probes and a region of minimum 2 Mb.

Exome sequencing

Five µg of the patient's DNA was used for exome sequencing. Exome capturing and enrichment was performed as per manufacturer's instructions (hybrid capture SureSelect Human All Exon kit (38 Mb), Agilent Technologies, Amsterdam, the Netherlands). This method targets most human exons (the region it targets is around 38 Mb). The captured fragments were subsequently sequenced on the Genome Analyzer II (lllumina, San Diego, USA). The alignment to the human genome sequences GRCh37 /hg19, the SNP calling, and the insertion-deletion calling were performed for only the three homozygous regions using CLC genomics workbench (CLC Bio). We set the threshold criteria for the homozygous SNP and insertion-deletion calling at the ratio 20:80 for 'ReferencesNariant' and

: .

Table 1. Primer sequences for confirmation of variants by Sanger sequencing

Primer sequences, 5'7 3'

Gene Forward

A TP284 GCAGATGGCTGGTCAATTAC

MYOG

IL24

TCCTTTGCTGGTCAAGACTG

CAGGCAGGTGGGTTCATCAG

Reverse PCR product size, bp

TCGGCATCCTTGGTGATCTC 352

GTGTGAGAGAGGAGCTAGTTAC 448

CAAGGGCGTGAAGTGTCCAG 332

PCR cond1t1ons: 35 cycles of denaturat1on at 95°C for 1 minute, annealing at 60°C for 1 minute and polymerization

at 72°C for 1 minute.

the coverage at more than 1 O times. The variants that passed these criteria but which were present in dbSNP v.1.31 or in the "in-house controls" variants database, were excluded. This variants database contained all the variants that were present in unrelated samples that were run at the same time on the Genome Analyzer II (lllumina). When newer versions of dbSNP became available we rechecked for the presence of the variants in these databases.

Sanger sequencing

Confirmation of the candidate SNPs was performed by Sanger sequencing in both the patient and the parents. For PCR conditions and primer sequences see Table 1. Sequencing was performed (forward and reverse) with dye-labelled primers (Big Dye Terminator v3.1 Sequencing Kit, Applied Biosystems, Foster City, CA) on an ABI 3730 automated sequencer (Applied Biosystems)

In Si/ico Analysis of the missense mutation

The effect of the missense mutation was evaluated by the 'Russell method' at the European Molecular Biology Laboratory (available from: http://www.russelllab. org/aas/)8 and by the polymorphism phenotyping algorithm (PolyPhen-2) (http:// genetics.bwh.harvard.edu/pph/).

RT-PCR

Because the bowel is affected in MMIHS, we determined the expression of the orthologues of the candidate genes in which the candidate variants were found in mouse intestine. Total RNA was isolated from mice gut embryonic day 14.5

according to the manufacturer's instructions (Qiagen, Venlo, the Netherlands). A

total of 0.5 µg of total RNA was used as a template to synthesize complementary

DNA (cDNA) according to the manufacturer's instructions (Fermentas, Utrecht,

the Netherlands). PCR conditions and primer sequences are given in Table 2.

One µL of cDNA was used for the PCR in a total volume of 30 µL. PCR products

were checked by gel electrophoresis.

Results

Homozygosity mapping was applied using an lllumina 300K SNP array on the

DNA of the MMIHS patient. Three homozygous regions were identified on

chromosome 1 (1q31.2-32.2), chromosome 2 (2q11.1-14.1) and chromosome 8

(8p23.3-23), comprising about 15, 19 and 6 MB, respectively.

A total of 3 GB of single-end sequence data was generated for the

patient, with a mean read length of 79 bps. More than 93.5% of the bases were

mapped to the target exons and, on average, 84.6% of the exome was covered

at least ten times. The list of all the candidate variants in the homozygous

regions, the summary of the CLC-Bio analysis, and the statistics of the exome

sequencing, are presented in Tables 3, 4 and 5, respectively. Only three of the

variants in the homozygous regions were located in coding sequences. All these

variants resulted in amino acid changes (missense variants), and were located

in the genes MYOG, A TP284 and IL24.

Validation of all candidate variants with Sanger sequencing confirmed

Table 2. Primer sequences for RT-PCR.

Primer sequences, 5'7 3'

Gene

ATP284

MYOG

ll24

Forward

GAAGGCGGGTCTGATCATGTCTG

GGAGCTGTATGAGACATCCC

CTTTAGGACCCTAGCAGGAGC

Reverse

CTTGTTCAACCTCACCCTTCTC

CGCGAGCAAATGATCTCCTG

GCATCCAGGTCAGGAGAATGTC

PCR product size, bp

1130

565

569

PCR conditions: 35 cycles of denaturation at 95°C for 1 minute, annealing at 58,5"C for 1 minute and polymerization at 72°C for 1 minute.

Table 3. Variants identified in the homozygous regions

No Chromosome Position Reference Alternative Coverage Gene name Function Amino acid change 1 1 200974176 G A 32 KIF21B lntron 2 1 201077321 C A 11 CI\CNA1S ln1ron 3 1 203053787 C T 17 MYOG Mosaanse Ala181TIY 4 1 203696548 C T 109 ATP28<1 - Ser1053Phe 5 1 203802214 T G 10 ZC3H11A lntron 6 1 205388149 C T 15 LEMD1 lntron 7 1 207075619 A C 10 IL24 lntron 8 1 207076321 T G 18 IL24 Mossense Leu22Val, Leu180Val 9 1 207078220 T C 38 FAIM3 utr-3 10 2 95426753 T C 10 AN<AD20B lnttlfgen,c

1 1 2 95475073 A G 10 AN<AD20B lnlergemc 1 2 2 95599053 C G 10 LOC442028 lnte,gemc 1 3 2 96940649 T C 20 SNRNP200 utr-3 14 2 100181826 G A 89 AFF3 lntron 15 2 102000169 C T 57 CAEG2 lntron 16 2 102378792 A C 11 MAP4K4 lntron 17 2 102773101 G A 10 IL1R1 ln1ron 1 8 2 107050624 G A 65 AGPD3 ln1ron 1 9 2 109311211 C T 13 LOC100288532 lntergen1c 20 2 109311212 T C 13 LOC100288532 lntergen1c 21 2 109311333 T C 24 LOC100288532 lntergen1c 22 2 112141781 T G 38 PAFAH1P2 lntergemc 23 2 112142170 G C 98 PAFAH1P2 lnteraenic 24 2 112544067 G A 11 ANAPC1 lntron 25 2 1 13077182 C T 11 ZC3H6 lntron 26 2 1 13077183 A G 11 ZC3H6 lntron 27 8 1719112 C T 31 CLN8 u1r-5

that the patient was homozygous and the parents were heterozygous for these

variants (see Figure 1). As the bowel is affected in MMIHS, we determined the

expression of the mouse orthologues of MYOG, ATP2B4 and IL24 in the gut

of a 14.5-day old mouse embryo by RT -PCR. ATP2B4 is expressed during the

development of the mouse gut (see Figure 2), but we were not able to determine

MYOG and /L24 expression. For all three missense variants we also determined

their predicted effect using the Russell and Polyphen prediction programs.

Only the missense variant in ATP2B4 was predicted to be pathogenic by both

Polyphen and Russell. The missense variant in ATP2B4 is therefore a plausible

candidate. However, after we had done all the confirmation and functional work,

we rechecked the latest release of dbSNP (v.1.34) and the variant was reported

to be present in the normal population and can therefore no longer be considered

as a candidate.

The MMIHS candidate genes CHRNA3 and CHRNB4 are located on chromosome

15q24 and not in a homozygous region.

g to unravel the genetics of

Table 4. Summary of analysis in CLC-Bio.

Variants Number

Identified by CLC-Bio 1572

In homozygous regions 297

Not identified in dbSNP131 and 1000 27

Genomes

Chromosome 1 9

Chromosome 2 17

Chromosome B 1

Table 5. Summary of statistics of exome sequencing.

Bait territory 38925539

Mean bait overage 36,757176

Mean target coverage 38,071198

Targets covered � 2x 93,50%

Targets covered � lOx 84,60%

Targets covered � 20x 71,40%

Targets covered � 30x 55,90%

Discussion

Here, we describe an attempt to identify the gene underlying MMIHS in one

female patient of a consanguineous familiy by homozygosity mapping and

exome sequencing. We identified three candidate loci by homozygosity mapping

using 300K SNP arrays and after excluding the variants known in dbSNP v.1.31,

we identified three candidate variants all residing in the homozygous region on

chromosome 1. These variants were all missense variants leading to an amino

acid substitution. Only the variant in A TP284 was predicted to be pathogenic

and because the variant was absent in dbSNP v.1.31, we determined the

expression of ATP284 during the development of the intestine in mice. ATP2B4

is a plasma membrane pump Ca(2+)-ATPase. It is expressed in skeletal muscle,

small intestine, heart, spinal cord, and brain.9 In MMIHS the peristalsis of the

small intestine is affected, so this gene seemed to be a good candidate gene

for MMIHS. However, on checking a more recent version of dbSNP (v1 .34), the

variant proved to be present in the normal population. Although the variant is

present in a heterozygous state in the population, the allele frequency is 1.1 % .

•

Thus, it is very unlikely that this variant is the cause of MMIHS. There are only

around 200 MMIHS patients reported in the literature and the frequency of

mutations causing MMIHS is expected to be very low in the population.

As the a3-/- and �2-/-,�4-/- mice show very similar features to MMIHS5•6

and lack of the a3 subunit was seen in MMIHS tissues,7 the human orthologues

of the a3 subunit (CHRNA3) and the �4 subunit (CHRNB4) of the nicotinic

acetylcholine receptor are good candidate genes for MMIHS. T hese genes

were, however, not located in the homozygous regions. Lev-Lehman et al. also

screened CHRNA3 and CHRNB4 in 1 3 MMIHS families, including seven MMIHS

patients, and did not find any loss-of-function mutations.10

To conclude, although we sequenced all the genes in this patient, we

were not able to find the disease causing mutation. It is possible that we missed

the mutation due to a lack of coverage of the exome. We set the criteria on

coverage at more than ten times, which meant that the gene coverage of the

target sequences was only 84.6% and 1 5.4 % of the variants present in these

sequences were missed. Furthermore, the enrichment kit used in this experiment

covered only 81 .33% of the exome, meaning that we had already missed about

1 9% of the exomic data. We conclude that we missed about 31 % of the total

exomic data and thus may well have missed the mutation.

Another possibility is that we missed the homozygous region. A higher

resolution SNP array in which the probes are more evenly distributed might

I 1124 Father I MYOG +

Mother • Patie� 1 t :' F 1:

Mother • t ..

T/G / �VJMM�\/j T/T ,

C/T /\i"[\f\p/\fvvy Father . . • ... c: • c ' • ATP2B4 c • • I I � , • Father ' .. • • ' • • •

T/G _J'JJ\eM/j/j rv}_\ t/YV'/\ C/T / f/V\a/\/wy Control • • • c ' • Patient • � ' ' ' ' • Control • ... • ' " • �-

T/T { M_�M�JJ G/G /)cj\ � qc !' V f\!\e1 fflY.

:- '

0

� ' M ·,D ·7;· &A ' I '� )t:' I ' ,f\/Vv\ AN;. Figure 1. Validation of variants by Sanger sequencing in patient and parents

unravel the genetics of M M I HS

MYOG

ATP284 l!I IL24

p-acth l:I Figure 2. Expression of the orthologues of MYOG, ATP284 and /L24 in the intestine of the mouse at embryonic day 1 4.5.

help to pick up smaller homozygous regions, which are missed by using the

300K SNP array. These might contain the disease causing mutations. A higher

resolution SNP array might also help to narrow down the homozygous regions

we have identified so far.

In order to find the disease causing mutation we will repeat both the

SNP array as well as the exome sequencing. We will use a higher density SNP

array in which the probes are more or less evenly distributed over the genome,

the human Omniexpress 700K array (lllumina). In addition we will use the 51 MB

Human All Exons V4 SureSelect enrichment kit (Agilent), that will cover more

of the exome. We recently used this kit and acquired 97.5% coverage of the

targeted regions, with a coverage of at least 10 reads. We will also include

more patients in the next study. All this

will, we hope, help us to identify the

disease causing mutation.

References

1 . Berdon WE, Baker DH, Blanc WA, et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome: a new cause of intestinal obstruction in the newborn. Report of radiologic findings in five newborn girls. AJR Am J Roentgenol. 1 976;126:957-64.

2. Gosemann JH, Puri P. Megacystis

microcolon intestinal hypoperistalsis syndrome: systematic review of outcome. Pediatr Surg Int. 201 1 ;27:1 041 -6.

3. Muller F, Dreux S, Vaast P, et al. Prenatal diagnosis of megacystis­microcolon-intestinal hypoperistalsis syndrome: contribution of amniotic fluid digestive enzyme assay and fetal urinalysis. Prenat Diagn. 2005;25:203-9.

4. Puri P, Shinkai M. Megacystis microcolon intestinal hypoperistalsis syndrome. Semin Pediatr Surg.

2005;14:58-63. 5. Xu W, Gelber S, Orr-Urtreger A, et al.

Megacystis, mydriasis, and ion channel defect in mice lacking the alpha3 neuronal nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A. 1999;96:5746-51.

6. XuW, Orr-Urtreger A, Nigro F, et al.

7.

Multiorgan autonomic dysfunction in mice lacking the beta2 and the beta4 subunits of neuronal nicotinic acetylcholine receptors. J Neurosci. 1999;19:9298-305. Richardson CE, Morgan JM, Jasani B, et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome and the absence or the alpha3 nicotinic acetylcholine receptor subunit. Gastroenterology. 2001 ;121 :350-7.

8. Betts MJ, Russell RB. Amino acid properties and consequences of substitutions. In: Barnes MR, Gray IC, eds. Bioinformatics for Geneticists. Wiley; 2003.

9. Brandt P, Neve RL, Kammesheidt A, et al. Analysis of the tissue-specific distribution of mRNAs encoding the plasma membrane calcium-pumping ATPases and characterization of an alternately spliced form of PMCA4 at the cDNA an genomic levels. J Biol Chem. 1 992;267:4376-85.

10. Lev-Lehman E, Bercovich D, Xu W, et al. Characterization of the human beta-4 nAChR gene and polymorphisms in CHRNA3 and CHRNB4. J Hum Genet. 2001 :46;362-6.

Trying to unravel the genetics of MMIHS . . . . , . . 119

• •

G eneral discus sion and future p ers p ectiv e s

CLMP in recessive Congenital Short Bowel Syndrome

Congenital Short Bowel Syndrome is characterized by a shortened small intestine

and malrotation. When the disease is inherited in an autosomal recessive pattern,

it is caused by loss-of-function mutations in CLMP (coxsackie- and adenovirus

receptor-like membrane protein}.1 CLMP is a trans-membrane protein that co­

localizes with the tight junction proteins Z0-11 -3 and occludin.2 The hypothesis

of a possible link between CLMP and Z0-1 was further supported by the

observation of an increased cytoplasmatic pool of Z0-1 when we transfected

a mutant-CLMP (encoded by CLMP containing the missense mutation V124D

that we identified in one of the CSBS patients), that itself also mislocalized

to the cytoplasm, in CHO and T84 cells.1 lmmunostaining on human embryos

showed that CLMP is expressed in the intestine during different stages of human

development. Knock down of the orthologue of CLMP in zebrafish resulted in

general developmental defects and absence of the goblet cells in the intestine,

suggesting that the small intestine was absent.1 However, the function of CLMP

is still largely unclear.

Elucidating the function of CLMP

Because CLMP co-localizes with tight junction proteins, and as tight junction

proteins like Z0-1 play a role in proliferation,4•5 we suggested that loss-of­

function of CLMP could affect proliferation of small intestinal cells during human

development and thereby causes a shortened small intestine.1 To investigate this

hypothesis, we overexpressed CLMP in T84 cells. We observed that CLMP did

not affect the proliferation of these cells (Chapter 3); neither did overexpression

of CLMP influence migration, cell viability or transepithelial electrical resistance

(Chapter 3). Although it has been shown that CLMP acts as an adhesion

molecule,2•6 it does not have a strong adhesion capability (Chapter 3). So the

function of CLMP remains unclear and we do not know why loss-of-function

mutations lead to Congenital Short Bowel Syndrome. An alternative hypothesis is

that CLMP plays a role in the differentiation of the progenitors of small intestinal

cells. This hypothesis is based on the observation that CAR (coxsackie- and

adenovirus receptor), the closest homologue to CLMP with 31% identity on the

protein level, has a possible role in the intercellular communication between

stromal ependymal cells and neuronal stem cells suggested by Hauwel et a/.7 It

has been shown that neurospheres, a culture system composed of free-floating

clusters of neural stem cells, plated on a CAR-coated petridish adhere strongly

and rapidly, inducing a shift in the mixed population of proliferating cells. CAR

signalling promotes the cells' spreading and primes them for the production

of neurons. This might imply a role for CAR in the differentiation of neuronal

stem cells into neurons.7 Knowing this, and knowing that loss-of-function of

CLMP results in a congenital short small intestine, it would be interesting to

determine whether CLMP plays a role in stem cells. Recently, intestinal stem cell

cultures have been established.8 Because these stem cell cultures resemble

the small intestine in such a way that they have the same architecture, cell

type composition, and self-renewal ability as the small intestine, they are called

human small intestinal organoids.8 These small intestinal organoids, presuming

they express CLMP, would provide an excellent model system to study the

function of CLMP. For long-term human intestinal stem cell culture, nicotinamide,

A83-01 (Alk4/5/7 inhibitor) and SB202190 (p38 inhibitor) are needed. Adding

nicotinamide prolongs the cell culture from 7 days to 1 month. With A83-02 and

SB202190, the human intestinal organoids could be expanded for at least 6

months. However, there are no differentiated cells present in these long-term

human intestinal stem cell cultures. For differentiation, withdrawal of wnt is

required, which, interestingly does not result in the production of goblet cells.

For the production of goblet cells in these cultures, nicotinamide and SB202190

have to be withdrawn as well.8 Knockdown of the orthologue of CLMP in zebra fish

resulted in the absence of goblet cells,1 indicating that CLMP might well play a

role in differentiation. It will therefore be interesting to determine whether CLMP

is downregulated in human intestinal organoids treated with nicotinamide and

SB202190, as these cultures do not produce goblet cells and are thus similar to

CLMP knockdown zebrafish.

The availability of an endogenously CLMP expressing cell line might help

to elucidate the function of CLMP. We have searched for such a cell line, but have

so far been unable to find a cell line that does express CLMP (unpublished data).

However, according to the protein atlas, there should be a few cell lines that might

be worth checking, for instance, according to this atlas, CLMP should be strongly

expressed in Hep-G2 cells (http://www.proteinatlas.org/ENSG00000166250/

cell). Screening these cell lines for endogenous expression of CLMP will be the first step. If a cell line is found that does indeed endogenously express CLMP, knock-down experiments can be performed to determine the effects on the same cellular processes we studied in the T84 CLMP overexpressing cell lines. Besides looking for specific functions, like migration and proliferation, in these cell lines endogenously expressing CLMP, looking for proteins that physically interact with CLMP would be a less biased approach to studying the function of CLMP. This can be done, for instance, by pull-down experiments and subsequent mass spectrometry, thereby identifying functional interactors of CLMP. For this, the cell lines endogenously expressing CLMP will be crucial. Finding the interactors of CLMP would be of great help in elucidating the function of CLMP as the function will be known for some, if not most, of the interactors. A similar assay that could be performed is a yeast two-hybrid assay; an assay that can be performed even if no cell line can be identified that endogenously expresses CLMP. A protein network can be built and would help to gain insight into the role of CLMP in different processes. As CLMP is a membrane protein, its hydrophobic character makes it difficult to study its interactors using a conventional yeast two-hybrid assay, which requires an interaction between proteins in the nucleus; therefore interactions of only the soluble domains of membrane proteins are possible in a conventional yeast two-hybrid assay. A modified assay, a membrane yeast two­hybrid assay, has been designed for studying membrane proteins.9 In this system the split ubiquitin principle is used as a sensor of protein-protein interactions. This assay, therefore, does not require an interaction between proteins in the nucleus; it only requires that the membrane protein to be studied, in our case CLMP, has its N and/or C terminus located in the cytosol. This is the case for CLMP, which makes the assay suitable to use in identifying the interactors of CLMP.

In addition to in vitro models for studying the function of CLMP, in vivo

models might also be helpful. As described in Chapter 2, we developed a zebra fish model for Congenital Short Bowel Syndrome.1 However, the development of the intestine in zebrafish is quite different from that in humans. Since the development of the intestine in mice is more similar to that in humans, a CLMP knockout mouse model might help us to better understand the disease aetiology in Congenital Short Bowel Syndrome patients.

•

FLNA in X-linked Congenital Short Bowel Syndrome

Male patients with mutations in FLNA can also present with Congenital Short

Bowel Syndrome. A two-base-pair deletion was identified in an X-linked CSBS

family and in an isolated male patient with a de novo mutation (Chapter 4). The

mutation is located in between the first two methionines of FLNA, and the start

of translation of FLNA can occur from both methionines, so that the mutation

probably only affects the long isoform of FLNA. This could well explain why such

a severe mutation causes a rather mild phenotype. As the phenotype of CSBS

patients with mutations in CLMP is very similar to those with a two-base-pair

deletion in FLNA, there might be an interaction between CLMP and FLNA.

Elucidating the role of FLNA in intestinal development

FLNA is a cytoskeletal protein and mutations in FLNA are associated with a

wide spectrum of disorders, including periventricular nodular heterotopia,

otopalatodigital syndromes types 1 and 2, frontometaphyseal dysplasia, Melnick

Needles syndrome, and X-linked cardiac valvular dystrophy.10-12 Our findings

add Congenital Short Bowel Syndrome to the list as a possible presenting

phenotype in male patients with a mutation in FLNA. We, therefore, emphasize

the importance of FLNA in intestinal development. Gastrointestinal symptoms

have been described in more patients with FLNA mutations. However, most of

them presented with multiple congenital anomalies, of which a congenital short

small intestine was only one of them.1 3 The patients we describe in Chapter 4,

and the patient described by Gargiulo et al, all have a two-base-pair deletion

in the second exon of FLNA between the first two methionines; their main

presenting symptoms were gastrointestinal. However, the index patient of the

family described by Gargiulo et al developed asymmetrical spastic diplegia

and an abnormal intermediate signal in the peritrigonal white matter was seen

on MRl.14 Thus, this patient did have central nervous system involvement. We

cannot exclude central nervous system involvement in the patients we describe

in Chapter 4 because no MRI brain scans were available. However, they did

not have any clinical neurological abnormalities like seizures or spasticity.

Furthermore, it is likely that the patients described in Chapter 4 do not have any

central nervous system involvement, because not all patients with mutations

in FLNA have central nervous system involvement. The mother of the proband

described by Kapur et al did have a duplication of the first 28 exons of FLNA,

but had a normal cranial MRl.13 We therefore argue that male patients who

present with CSBS, with or without central nervous system involvement, must be

screened for mutations between the first two methionines in the second exon of

FLNA. Because it has been shown that translation of FLNA can occur from both

the first or second methionine,14 the two-base-pair deletion in FLNA in the male

CSBS patients will probably only affect the long form of FLNA. A slightly shorter

protein, the short isoform of FLNA, can still be translated. We hypothesized

that the first 27 amino acids, the ones lacking in this shorter FLNA protein,

might be important for the development of the bowel, but less important for the

development of the other organs like the heart. Thorough genotype-phenotype

studies in patients with mutations in FLNA might help to further our understanding

of the function(s) of the different domains of FLNA.

Two mouse models for FLNA have been generated.15·16 Fina-null mice

show maldeveloped bloodvessels and major cardiac defects.15 They also show

delayed resorption of their umbilical hernia.16 However, the intestines of these

mice have not been described. Therefore, it might be interesting to study the

intestines of these mice macroscopically and microscopically. As discussed in

the next section, FLNA and CLMP may interact, or be players in a common

protein network, and it might therefore be interesting to determine whether CLMP

staining in the intestine differs between the wild-type and the knockout mice.

Link between CLMP and FLNA

As the phenotypes of Congenital Short Bowel Syndrome patients with mutations

in CLMP and of male CSBS patients with mutations in the second exon of FLNA

are very similar (Chapter 4)1 it is likely that CLMP and FLNA interact or are

players in a common protein network. Since FLNA is a cytoskeletal protein of

280 kDa,10 overexpression studies with FLNA are difficult, if not impossible,

to perform. As discussed above, the male patients with FLNA mutations who

present with CSBS as the main phenotype have mutations between the first

and second methionine (Chapter 4). We therefore hypothesized that the first 27

amino acids, the ones between the first and second methionine, are important

for the normal development of the small intestine. This part of FLNA might

contain the domain that physically interacts with CLMP and overexpression of a

protein consisting of the first 27 amino acids of FLNA could be used to perform

pull-down experiments with CLMP to test our hypothesis.

Co-immuno-staining of CLMP and FLNA in a representative cell line

that expresses both proteins is a way to determine whether the localization

of CLMP and FLNA overlap and whether an interaction between both proteins

might therefore be likely. There is supporting evidence that FLNA plays a role

in anchoring trans-membrane proteins in the cell membrane. We therefore

hypothesized that FLNA might be important for a correct membrane localization

of CLMP (Chapter 6) A knock-out cell line of FLNA, but positive for CLMP, could

be useful to test this hypothesis. Expressing CLMP in a CLMP-negative cell line

with and without FLNA could also help to determine whether FLNA is needed for

the normal localization of CLMP at the cell membrane.

It seems, however, likely that FLNA and CLMP do not have a direct

interaction, but rather that they are indirectly linked. Searching for overlapping

interactors will therefore help to build the protein network in which they both are

involved. A yeast two-hybrid assay with FLNA will probably reveal many proteins

that are not linked to CLMP. Therefore, using only the first 27 amino acids of FLNA

for the yeast two-hybrid assay would increase the chance of finding common

interactors of FLNA and CLMP. Pull-down techniques and mass spectrometry

are again good alternatives to identify possible interactors. Indirect interactions

of the orthologues of CLMP and FLNA can be studied in a zebrafish model.17

More genes involved in Congenital Short Bowel Syndrome

Because we did not find any mutation in CLMP and FLNA in two female CSBS

patients, more genes might well be involved in the pathogenesis of Congenital

Short Bowel Syndrome. One of these mutation-negative patients presented

at the age of 12 weeks with failure to thrive and abdominal distension; she

has already been described in the literature.18 At laparotomy, malrotation and

congenital short bowel syndrome were found. The length of her small intestine

was 80 ems (normal length approximately 245 ems). Around 45 ems of her

small intestine was dilated and needed to be removed. Almost half of this tissue

consisted of heterotopic fundic gastric mucosa.18 The other female patient described in Chapter 5 had not been described before. She presented with persistent pulmonary hypertension and at autopsy a congenital short small intestine with a length of 98 cm was found.

Because we are now able to perform whole-exome sequencing of individuals, we could potentially identify the causative gene mutations in these individual patients. However, as these would be single-patient studies, additional functional assays will be needed to determine whether the identified mutations are really causative.

Searching for genes involved in Megacystis-microcolon-lntestinal hypoperistalsis

Syndrome

Megacystis Microcolon Intestinal Hypoperistalsis Syndrome (MMIHS) is characterized by abdominal distension due to a largely dilated non-obstructed bladder, microcolon, and decreased or absent intestinal peristalsis.19 Malrotation and short bowel syndrome, the main features in Congenital Short Bowel Syndrome, have also been reported in MMIHS patients. Affected siblings of both sexes have been described in 19 MMIHS families, while the unaffected parents were consanguineous in four MMIHS families, suggesting an autosomal recessive pattern of inheritance.20•21 The genetic cause is, however, unknown. We performed 300K SNP arrays and homozygosity mapping in one consanguineous family. We identified three homozygous regions on chromosomes 1, 2 and 8, but so far we have not been able to identify the disease-causing mutation (Chapter 7).

For identifying the underlying gene in autosomal recessive disorders, one patient can be sufficient (see Chapter 2), however, to get more supportive evidence we need more patients to be included. More patients would be helpful to identify an overlapping homozygous region. A SNP array with a higher density could help to pick up homozygous regions we have missed, and help to narrow down the regions we found. In addition, an array in which the probes are more evenly distributed can also help to identify homozygous regions we have missed. We will therefore use the human Omniexpress 700K SNP array (lllumina), which is a higher density SNP array than the one we have used so far (300K); the probes

. •

on this larger array are also more evenly distributed. In addit i on, for exome sequencing we will use the 51 Mb Human All Exons V4 SureSelect enrichment kit (Agilent), which will cover more of the exome. We recently used this k it and gained 97.5% coverage of the targeted regions with a coverage of minimum 10 reads, and we hope these data will enable us to identify the causative mutations in MMIHS patients. Depending on the gene(s) found to underlie MMIHS, additional functional assays will be performed.

Implications of our f indings for genetic counselling and therapy

In this thesis we describe the identification of loss-of-funct ion mutations in CLMP in autosomal recessive Congenital Short Bowel Syndrome and a two-base-pair deletion in FLNA in male CSBS patients. These findings suggest that when a patient presents with Congenital Short Bowel Syndrome, mutation analysis should be performed in CLMP and/or FLNA, depending on the full phenotype. In general, screening for mutations in CLMP should be the first step, especially if the parents are consanguineous. A male patient with a family history of a patent ductus arteri osus or epilepsy should be screened for mutations in FLNA. Finding a mutation greatly improves genetic counselling and makes prenatal diagnostic testing possible.

Because CLMP is also expressed in the small intestine in adults,2 we hypothesised that CLMP has an important function in more than human embryonic development. We know that the intestine grows longer up to adulthood, because the length of the intestine in adults is 600 ems, on average, while at birth it is 250 ems, on average. CLMP might have an important role in this elongat ion process or in the intestinal adaptation process after surgical resection. Studies have been performed to determine the effects of growth factors, such as growth hormone, keratinocyte growth factor, epidermal growth factor, and glucagon­l ike peptide-2, on the intestinal adaptation process.22

·25 Similar studies could

be performed to see whether CLMP has an effect on intestinal adaptation and whether it can be used in some form of treatment for short bowel syndrome .

. ��ri�i��?;iiitoJ;�-:9 1 .t.yiu_r�;'p,�rspec_tives . . 129 - .. , - ... . ' • 1, ', . • • I •

References

1. Van der Werf CS, Wabbersen T D, Hsiao NH, et al. CLMP is required 9.

adenoma, adenocarcinoma, and Barrett's epithelium. Gastroentero/ogy. 2011 ;141:1762-72. Snider J, Kittanakom S, Damjanovic D, et al. Detecting interactions with membrane proteins using a membrane two-hybrid assay in yeast. Nat Protoc. 2010;5:1281-93.

for intestinal development, and loss-of-function mutations cause congenital short-bowel syndrome. Gastroenterology. 2012;142:453-462. e3.

2. Raschperger E, Engstrom U, Pettersson RF, et al. CLMP, a novel member of the CT X family and a new component of epithelial tight junctions. J Biol Chem. 2004;279:796-804.

3. Sze KL, Lee WM, Lui WY. Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 2008;214:334-44.

4. Balda MS, Matter K. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression. EMBO J. 2000;19:2024-33.

5. Matter K, Balda MS. Signalling to and from tight junctions. Nat Rev Mo/ Cell Biol. 2003;4:225-36.

6. Eguchi J, Wada J, Hida K, et al. I dent if ication of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 2005;387:343-53.

7. Hauwel M, Furon E, Gasque P. Molecular and cellular insights into the coxsackie-adenovirus receptor: role in cellular interactions in the stem cell niche. Brain Res Brain Res Rev. 2005;48:265-72.

8. Sato T, Strange DE, Ferrante M, et al. Long-term expansion of epithelial organoids from human colon,

•

10. Robertson SP. Filamin A: phenotypic diversity. Curr Opin Genet Dev. 2005;15:301-7.

11. Bernstein JA, Bernstein D, Hehr U, et al. Familial cardiac valvulopathy due to f ilamin A mutation. Am J Med Genet A. 2001 ;155A:2236-41.

12. Kyndt F, Gueffet JP, Probst V , et al. Mutations in the gene encoding filamin A as a cause for familial cardiac valvular dystrophy. Circulation. 2007;115:40-9.

13. Kapur RP, Robertson SP, Hannibal MC, et al. Diffuse abnormal layering of small intestinal smooth muscle is present in patients with FLNA mutations and x-linked intestinal pseudo-obstruction. Am J Surg Pathol. 2010;34:1528-43.

14. Garguilo A, Auriccio R, Barone MV, et al. Filamin A is mutated in X-linked chronic idiopathic intestinal pseudo­obstruction with central nervous system involvement. Am J Hum Genet. 2007;80:751-8.

15. Feng Y , Chen MH, Moskowitz IP, et al. Filamin A (FLNA) is required for cell­cell contact in vascular development and cardiac morphogenesis. Proc Natl Acad Sci U S A. 2006;103:19836-41.

16. Hart AW, Morgan JE, Schneider J, et al. Cardiac malformations and midline skeletal defects in mice lacking filamin A. Hum Mo/ Genet. 2006;15:2457-67.

17. Alves MM, Burzynski G, Delalande JM, et al. KBP interacts with SCG10,

linking Goldberg-Shprintzen syndrome to microtubule dynamics and neuronal differentiation. Hum Mo/ Genet. 2010;19:2642-51.

18. Shehata B, Chang T, Greene C, et al. Gastric heterotopia with extensive involvement of the small intestine associated with congenital short bowel syndrome and intestinal malrotation. Fetal Pediatr Pa tho/. 2011 ;30:60-3.

1 9. Berdan WE, Baker DH, Blanc WA, et al. Megacystis-microcolon-intestinal hypoperistalsis syndrome: a new cause of intestinal obstruction in the newborn. Report of radiologic findings in five newborn girls. AJR Am J Roentgenol. 1976;126:957-64.

20. Gosemann JH, Puri P. Megacystis microcolon intestinal hypoperistalsis syndrome: systematic review of outcome. Pediatr Surg Int. 2011 ;27:1041 -6.

21 . Puri P, Shinkai M. Megacystis

microcolon intestinal hypoperistalsis syndrome. Semin Pediatr Surg. 2005;14:58-63.

22. Wales PW, Nasr A, de Silva N, et al. Human growth hormone and glutamine for patients with short bowel syndrome. Cochrane Database Syst Rev. 2010;6:CD006321 .

23. Yang H, Wildhaber BE, Teitelbaum DH. Keratinocyte growth factor improves epithelial function after massive small bowel resection. JPEN J Parenter Enteral Nutr 2003;27:1 98-206.

24. Kato Y, Yu D, Schwartz MZ. Enhancement of intestinal adaptation by hepatocyte growth factor. J Pedriatr Surg. 1998;33:235-9.

25. Martin GR, Beck PL, Sigalet DL. Gut hormones, and short bowel syndrome: the enigmatic role of glucagons-like peptide-2 in regulation of intestinal adaptation. World J Gastroenterol. 2006;1 2:411 7-29

-� - ----- . ,.. .. -� . - . ]"", . .... . ,· . � .. -. General, discussion· and future perspectives. . . 1 3 1 ., � I .-• .._; ,· ;: • • •' ..... _ • .,_� ... _ • • - . • ,

• •

Summa r y

The focus of this thesis is on two inherited congenital bowel syndromes for which the genes had not been identified at the time we started our study, namely Congenital Short Bowel Syndrome (CSBS) and Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS). In Chapter 1 we discuss the history, clinical presentation, histological findings, genetics and pathogenesis of both syndromes.

In Chapter 2 we describe the identification of loss-of-function mutations in Coxsackie- and adenovirus receptor-Like Membrane Protein (CLMP) in Congenital Short Bowel Syndrome patients. Congenital Short Bowel Syndrome is characterized by a congenital short small intestine of 50 ems on average compared to a normal length of 250 ems at birth, and malrotation. CSBS was believed to be an autosomal recessive disease because it occurs in both males and females, it is mostly seen in siblings in one generation of a family, the parents are not affected, and in several cases the parents have proved to be distantly related (consanguineous families). We performed homozygosity mapping in five CSBS patients from four different families and identified an overlapping homozygous region in four of the five patients. A thorough examination of the array data led to the identification of not only a shared homozygous region, but also of a homozygous deletion concerning the second exon of CLMP in one of the patients. Screening the other patients for mutations in this gene revealed different loss-of-function mutations in CLMP. CLMP is a cell membrane protein that co-localizes with the tight-junction protein ZO-1. The hypothesis that CLMP interacts with ZO-1 was further supported by the observation of an increased cytoplasmatic pool of ZO-1 when we transfected a mutant-CLMP (encoded by CLMP containing the missense mutation V124D we identified in one of the CSBS patients), that itself also mislocalized to the cytoplasm, in CHO and T84 cells. Furthermore, we showed that CLMP is expressed in the intestine of human embryos throughout development. Knock-down experiments in zebrafish resulted in general developmental defects, including shortening of the intestine and the absence of goblet cells. Goblet cells are characteristic for the mid-intestine in zebrafish, which resembles the small intestine in human beings, suggesting that the small intestine was absent in these morphant zebrafish.

Thus, we identified loss-of-function mutations in CLMP in patients with

Congenital Short Bowel Syndrome, suggesting a major role for CLMP in

intestinal development. Although we know that CLMP co-localizes with tight

junction proteins, the function of CLMP is not well understood. To determine the

function of CLMP we performed functional assays in human intestinal epithelial

T84 cells and in Chinese Hamster Ovary (CHO) cells; these are described in

Chapter 3. We transduced both wild-type (WT)-CLMP and mutant-CLMP into

T84 cells and determined the role of CLMP in migration, proliferation, viability

and transepithelial electrical resistance. Our data show that expression of WT­

CLMP or mutant-CLMP does not affect any of these processes in the cell model

we used. Moreover, our aggregation assays in a different cell line (CHO) showed

that CLMP does not act as a strong adhesion molecule. Thus, our data suggest

that, in the in vitro model systems we used, key processes involved in intestinal

epithelial development appear to be unaffected by WT-CLMP as well as by

mutant-CLMP. Further research is needed to determine the role of CLMP in the

development of the intestine.

In most Congenital Short Bowel Syndrome patients in whom we performed

mutation analysis, we identified loss-of-function mutations in CLMP. However,

we did not identify any mutation in CLMP in one family with multiple CSBS

patients or in one isolated male CSBS patient. Because only males in the family

were affected, an X-linked pattern of inheritance was suspected. In Chapter 4

we describe the identification of a two-base-pair deletion in the second exon of

FLNA in these male Congenital Short Bowel Syndrome patients.

Altogether we identified two genes, namely CLMP and FLNA, being involved in

Congenital Short Bowel Syndrome. That there may well be more genes involved

in Congenital Short Bowel Syndrome is illustrated by the female patient we

describe in Chapter 5. She had an unusual presentation of persistent pulmonary

hypertension of the newborn and Congenital Short Bowel Syndrome. Mutation

analysis in CLMP and FLNA did not reveal any mutations. Exome sequencing in

this isolated female patient might reveal involvement of an additional gene in

Congenital Short Bowel Syndrome.

In Chapter 6 we give an overview of the literature on Congenital Short Bowel

Syndrome. The clinical and genetic aspects are discussed as wel l as the

proposed hypotheses concerning the disease aetiology. We speculate on how

the recent genetic findings help to understand the cause of Congenital Short

Bowel Syndrome.

The second syndrome we worked on is Megacystis-microcolon-intestinal

hypoperistalsis syndrome (MMIHS) which is also a rare autosomal recessive

disorder, affecting the bladder and the intestine. The genetic background of

this disorder is unknown. However, knockout studies in mice have implicated the

human orthologues of the a3 subunit ( CHRNA3) and the 134 subunit ( CHRNB4)

of the nicotinic acetylcholine receptor as candidate genes. In Chapter 7 we

describe our attempt to identify the underlying gene mutation by homozygosity

mapping and exome sequencing in a consanguineous family with one affected

girl . We identified three homozygous regions on chromosomes 1, 2 and 8,

respectively. However, no pathogenic mutation was identified in these regions.

Neither are the candidate genes CHRNA3 and CHRNB4 located in these regions

(making it highly unlikely that they are involved in the disease development in

this patient). Repeating the analysis with a higher resolution array in which the

probes are better (i.e. more evenly) distributed and with a more efficient exome

capturing and enrichment kit, and including more patients in our study, might help

to find the gene underlying MMIHS.

In Chapter 8 we discuss the work presented in this thesis and speculate on

future perspectives.

Summary 137

• •

Same nvat t i ng

Samenvatting

De focus van dit proefschrift is de genetische ontrafeling van het aangeboren korte darmsyndroom en het megacystsis-microcolon-intestinal hypoperistalsis syndrome. In Hoofdstuk 1 bespreken we de geschiedenis, de klinische presentatie, de histologische bevindingen, de genetica en de pathogenese van beide syndromen.

Aangezien de syndromen voorkomen bij zowel mannen als vrouwen, de ziekten vrijwel altijd bij kinderen in een generatie worden gezien en niet bij de ouders, en omdat de ziekten vaak worden gezien bij consanguine families, wordt van beide syndromen gedacht dat het een autosomaal recessief overervingspatroon heeft. Bij consanguine families zijn de ouders familie van elkaar, zoals in nicht­neef huwelijken. De genetische oorzaak van beide syndromen was onbekend toen we aan dit onderzoek begonnen. In Hoofdstuk 2 beschrijven wij de zoektocht naar en de ontdekking van het onderliggende gemuteerde gen voor het aangeboren korte darmsyndroom. Patienten die geboren worden met het aangeboren korte darmsyndroom hebben een sterk verkorte dunne darm (van gemiddeld 50 cm ten op zichte van een normale lengte van gemiddeld 250 cm) en een afwijkende draaiing van de darmen (malrotatie). Onze zoektocht begon met het zoeken naar overlappende homozygote gebieden bij vijf aangeboren korte darmsyndroompatienten van vier verschillende families. Homozygote gebieden zijn gebieden waarbij de DNA volgordes in een specif iek stuk van een chromosoom gelijk zijn op beide chromosomen, dat wil zeggen dat het stukje chromosoom dat men van zijn vader krijgt gelijk is aan het stukje chromosoom dat men van zijn moeder krijgt. Bij een autosomaal recessieve aandoening in een consanguine familie verwacht je namelijk dat de patient op beide chromosomen eenzelfde mutatie heeft (met daar omheen een gelijk stukje chromosoom), dit omdat die mutatie (en het stukje chromosoom rand de mutatie) afkomstig is van eenzelfde voorouder. Dus de patient krijgt dezelfde mutatie van die (soms verre) voorouder van zowel zijn moeder als van zijn vader. We hebben vijf patienten onderzocht op dergelijke homozygote gebieden en vonden bij vier van de vijf een overlappend homozygoot gebied. In dit overlappende homozygote gebied werd bij een van de patienten een

identieke deletie op beide chromosomen (een homozygote deletie) gevonden. De deletie zorgt ervoor dat het tweede exon van het Coxsackie- and adenovirus

receptor-like membrane protein (CLMP) gen afwezig is waardoor het eiwit dat het gen maakt niet meer goed werkt. Het screenen van de andere patienten voor mutaties in dit gen leidde tot de ontdekking van verschillende verlies-van­functie mutaties in CLMP. CLMP is een celmembraaneiwit dat op dezelfde plaats in de eel wordt gevonden als (co-localiseert met) het tight-junction eiwit Z0-1. Een tight junction is het verschijnsel dat ontstaat als van twee cellen hun membranen samenkomen en vervolgens een soort barriere vormen ten opzichte van vloeibare stoffen. Verder lieten we zien dat CLMP aanwezig is in de darm van menselijke embryo's tijdens de gehele ontwikkeling. Het uitschakelen van het gen (knock-down) in zebravissen resulteerde in algemene ontwikkelingsafwijkingen, waaronder een verkorting van de darm en de afwezigheid van slijmbekercellen in de darm. Slijmbekercellen zijn karakteristiek voor de middendarm bij zebravissen. De middendarm komt overeen met de dunne darm bij mensen, wat suggereert dat de dunne darm afwezig is in deze zebravissen.

We hebben dus verlies-van-functie mutaties gevonden in CLMP bij patienten met het aangeboren korte darmsyndroom. Dit suggereert een belangrijke rol voor CLMP in de darmontwikkeling. CLMP co-localiseert zoals gezegd met tight junction eiwitten, maar de functie van CLMP is niet goed bekend. In Hoofdstuk

3 beschrijven wij proeven die we hebben gedaan om hier meer helderheid over te krijgen. We hebben deze 'functionele assays' gedaan in menselijke darmbekleding (darmepitheel) T84 cellen en in Chinese Hamster Ovarium (CHO) cellen. We brachten zowel normaal (wild type; WT)-CLMP als mutant-CLMP in T84 cellen en bepaalden de rol van CLMP in migratie, celvermeerdering (proliferatie), levensvatbaarheid en transepitheliale electrische weerstand. Onze data lieten zien dat het aanwezig zijn van WT-CLMP of mutant-CLMP geen invloed heeft op deze processen. Daarnaast lieten onze experimenten zien dat CLMP zich niet gedraagt als een sterk adhesiemolecuul. Onze data suggereert dus dat, in het model dat wij hebben gebruikt, de sleutelprocessen die betrokken zijn bij darmepitheelontwikkeling niet be'invloed warden door WT-CLMP en mutant­CLMP. Verder onderzoek is nodig om de rol van CLMP in de darmontwikkeling te bepalen.

Bij de meeste patienten met het aangeboren korte darmsyndroom bij wie we op zoek gingen naar DNA veranderingen, vonden wij verlies-van-functie mutaties in CLMP. We ontdekten echter geen mutaties in CLMP in een familie met meerdere korte darmsyndroompatienten en in een ge"isoleerde mannelijke patient. Omdat in de familie alleen mannen waren aangedaan, was een X-chromosomale overerving waarschijnlijk. In Hoofdstuk 4 beschrijven wij de ontdekking van een deletie van twee basenparen in het tweede exon van FLNA in deze mannelijke aangeboren korte darmsyndroompatienten.

In dit proef schrift beschrijven wij dus dat mutaties in twee genen, namelijk CLMP en FLNA, betrokken kunnen zijn bij het ontstaan van het aangeboren korte darmsyndroom. Oat er misschien meer genen betrokken zijn bij het aangeboren korte darmsyndroom wordt ge"illustreerd door de vrouwelijke patiente die wij beschrijven in Hoofdstuk 5. Ze had een ongewone presentatie van persisterende hoge bloeddruk in de longen (pulmonale hypertensie) en aangeboren korte darmsyndroom. Mutatieanalyse van CLMP en FLNA leverde geen mutaties op. Het sequencen van alle genen (exome sequencing) in deze ge"isoleerde vrouwelijke patiente zou kunnen leiden tot de ontdekking van de betrokkenheid van nog een gen bij het ontstaan van het aangeboren korte darmsyndroom.

In Hoofdstuk 6 geven wij een overzicht van de literatuur over het aangeboren korte darmsyndroom. Zowel de klinische en genetische aspecten als de voorgestelde hypotheses over het ontstaan van de ziekte worden besproken. We speculeren over hoe de recente genetische bevindingen helpen om de oorzaak van het aangeboren korte darmsyndroom te begrijpen.

Het tweede syndroom dat we hebben onderzocht is het megacysitis­microcolon-intestinal hypoperistalsis syndrome (MMIHS). Dit syndroom is, net als het aangeboren korte darmsyndroom, een zeldzame autosomaal recessieve aandoening. Bij het megacystis-microcolon-intestinal hypoperistalsis syndrome zijn de blaas en de darm aangedaan. De genetische achtergrond van deze aandoening is onbekend. Onderzoek bij muizen waarin specifieke genen zijn uitgeschakeld (zogenaamde knockout muizen) leverde een aantal

goede kandidaatgenen op, namelijk de a3 subunit (CHRNA3) en de �4 subunit

( CHRNB4) van de nicotine acetylcholine receptor. In Hoofdstuk 7 beschrijven

wij onze poging om de onderliggende genmutatie te vinden in een consanguine

familie met een aangedaan meisje door opnieuw te zoeken naar homozygote

gebieden en door alle genen in deze gebieden op mutaties te onderzoeken

(exome sequencing). We vonden drie homozygote gebieden op respectievelijk

chromosoom 1, 2 en 8 . Echter, we vonden geen ziekteveroorzakende mutatie

in deze gebieden. Ook lagen de kandidaatgenen CHRNA3 en CHRNAB niet in

deze gebieden. Herhaling van de experimenten met betere arrays (arrays met

meer probes en waarbij de probes meer gelijk verdeeld zijn), verbeterde exome

sequencing (we misten met de gebruikte methode een deel van de exonen) en

de inclusie van meer patienten in ons onderzoek, zal mogelijk helpen om het

onderliggende gen voor MMIHS te vinden.

In Hoofdstuk 8 bespreken wij het werk dat gepresenteerd is in dit proefschrift

en speculeren we over de vooruitzichten voor de toekomst.

Acknowl edgments / D ankwoord

In 2006 begon ik met mijn wetenschappelijke stage op de afdeling Genetica. Nu bijna 6 jaar later schrijf ik mijn dankwoord. In 6 jaar is er veel veranderd en veel mensen waarmee ik nauw samenwerkte in het begin van mijn onderzoekstijd zijn allang uitgevlogen en anderen zijn gekomen. Een grote opgave dus om niemand te vergeten in mijn dankwoord.

Allereerst wil ik alle patienten en hun familieleden bedanken voor hun deelname aan het onderzoek. Zonder hen was dit proefschrift er nooit geweest. De meeste patienten en familieleden heb ik nooit ontmoet en zal ik nooit ontmoeten. Een ontmoeting was voor mij dan ook heel bijzonder.

Dan wil ik mijn begeleiders Prof.cir. Robert M.W. Hofstra en drs. Joke B.G.M. Verheij bedanken.

Beste Robert, wat was het een feest toen we het gen vonden! lk weet nog goed dat ik jouw kamer binnen kwam en vertelde dat er een overlappend homozygoot gebied was en dat het leek alsof een van de patienten een deletie had in dit gebied. Jij schudde mij toen de hand en feliciteerde mij, want jij had gelijk door dat we het gen hadden gevonden. lk was nog helemaal in verwarring, niet realiserende dat we gevonden hadden waarnaar we toch al ruim 2 jaar op zoek waren. Daarna ging het in een stroomversnelling en mocht ik van jou naar labs in Parijs en later in Atlanta, een mooiere beloning voor het harde werk had ik niet kunnen krijgen! Ook was het spannend en heel erg leuk om vervolgens onze data te mogen presenteren op grote congressen, waaronder het ESHG. lk denk dus dat we samen trots mogen zijn op ons werk en ik wil je heel erg bedanken voor je steun en vertrouwen. Het is fijn dat je altijd laagdrempelig te benaderen bent en ik heb je snelle en kritische revisies heel erg gewaardeerd. Mede hierdoor heb ik alles op tijd kunnen inleveren bij de leescommissie. Je hebt me alle vrijheid gegeven om een zelfstandig onderzoekster te worden, die alle ruimte had om zelf met ideeen te komen. lk heb dit zeer gewaardeerd en ik hoop dat het me in de toekomst nog van pas zal komen.

Beste Joke, het was fijn om een klinische begeleider te hebben zoals jij die mij goed op weg kon helpen. lk heb veel gehad aan jouw georganiseerdheid, kritische feedback en ik heb de vele korte gesprekjes over het leven als coassistent en het leven naast het werk erg gewaardeerd. Misschien was het voor jou een teleurstelling dat ik erachter kwam dat ik voor mijzelf geen toekomst zag als klinisch geneticus. Je hebt het in elk geval niet laten blijken en

� .

alle andere alternatieven werden door jou gelukkig niet bekritiseerd. I would like to thank the members of the reading committee, Prof. J.H.

Kleibeuker, Prof. R.M.H. Wijnen and Prof. LT.Shepherd, for taking the time to read my thesis and for giving their approval for the defense.

In het bijzonder Prof.cir. J.H. Kleibeuker, als meisje dat vroeger speelde in uw straat had ik toch nooit gedacht dat ik ooit zou promoveren en dat mijn proefschrift zou warden beoordeeld door de slimme vader van mijn buurmeisjes.

Dear lain, thank you very much for the opportunity to work in your laboratory. It was my very first time in America and it was overwhelming. Thank you for teaching me how to work with zebrafish and how to perform the knock down experiments. It was great that you invited me to come over to your house and to meet your family. I loved working with the zebrafish embryos and I had an amazing time in Atlanta!

Beste Prof.cir. Wijnen, bedankt voor uw positieve beoordeling en ik hoop dat ik ooit in de gelegenheid zal komen om u persoonlijk te bedanken.

Hierbij wil ik het hoof d van de afdeling genetic a bedanken, Prof.cir. Cisca Wijmenga. Beste Cisca, de veranderingen die onder jouw leiding zijn doorgevoerd op de af de ling zijn heel waardevol geweest voor iedereen die er werkt. De invoering van onder meer de genetica retraite heeft het niveau van ons werk naar mijn mening tot een hoger niveau gebracht. Ook is het waardevol om af en toe stil te staan bij wat ieders ambities zijn en hoe men deze kan verwezenlijken. Bijzonder vind ik oak de persoonlijke interesse die jij en Marten tonen in jullie promovendi.

Ook grote dank aan alle andere stat van de afdeling genetica. Beste Edwin en Hayo, bedankt voor jullie hulp achter de schermen. Beste Marina, bedankt voor je zorg voor alle financiele zaken! Beste Bote, Mentje, Ria, Joke en Helene, bedankt voor jullie hulp en de f ijne gesprekken, het voe It toch altijd een beetje als thuis komen als ik jullie kantoor binnen ren!

Dear people of the Hirschprung/RET group, Jan, Yunia, Maria, Danny, Hans, Alice, Greg, Thomas, Duco and Rajendra. I started to work on a syndromic form of Hirschprung, but it turned out to be a quite isolated subject. Nevertheless, we all worked on a developmental defect of the bowel and we used similar laboratory methods. I am pleased that this was enough for me to be accepted in the group and to be allowed to attend the ENS meeting in London together.

Beste Jan, bedankt dat je mij bij mijn eerste schreden in het laboratorium

hebt geleerd hoe je moet pipetteren en hoe je een labjournaal bij hoort te houden

zodat jijzelf en anderen jaren later kunnen teruglezen wat je hebt gedaan en

dat de experimenten in de herhaling weer precies zo goed zullen verlopen. lk

heb daar veel profijt van gehad, zeker doordat ik op en af in het laboratorium

aanwezig was. Een hoogtepunt dat ik met jou en Klaske heb mogen beleven

is toch wel onze fietstocht naar Oldenburg. Wat was dat een mooi weekend!

Volgend jaar is er weer een lustrum, dus ik hoop dat we dan weer samen op de

f iets mo gen spring en!

Dear Yunia, you are really special to me. I do not remember how we

became friends, as we were working on quite different subjects and we both

travelled quite a bit. However, I have loved sharing with you all our brilliant, and

less brilliant, hypotheses. I still feel very sorry that I was not present at your

defense, but I know you did a great job! Thank you for having me to stay with you

in Rotterdam and for teaching me how I can try to become such a grown up and

social person as you are. I really hope we will keep in touch and that I will meet

your family in Indonesia one day!

Dear Maria, thank you very much for teaching me so many laboratory

skills. I am so proud that you will continue the work on Congenital Short Bowel

Syndrome with Danny. I am sure you will do just great and I am looking forward to

read the publication on how you identified the underlying gene for MMIHS! Thank

you also for all the nice activities outside the laboratory. I wish you and Kaushal

all the best in your future together! Two clever people should make brilliant

progeny.

Dear Danny, how you have impressed us already! I am sure you will be

very successful in both your research and your clinical work as a doctor. I hope

that you will still remember me in the future when you publish papers in Science,

Nature or Cell. I hope your family will be able to come over to the Netherlands

and that you will not be separated for long. Good luck my friend!

Beste Hans, het was leuk om iemand bij de groep te hebben die in

eenzelfde traject zat als ik. Oat labwerk erg frustrerend kan zijn en dat het

combineren van onderzoek en coschappen ook niet altijd gemakkelijk is, hebben

wij beiden ervaren. Het is dan best eens fijn om over die frustraties te praten.

Toch denk ik dat wij er allebei absoluut geen spijt van hebben. lk wens je heel

veel succes in je toekomst als gepromoveerde dokter, wie weet kunnen we nog eens samen aan een onderzoeksproject werken!

Beste Alice, in de eerste maanden van mijn onderzoeksperiode was jij a Ileen nog maar een begrip. Van alle verhalen die tijdens de onderzoeksbespreking ter tafel kwamen met jou als hoofdrolspeelster, bleek wel dat dit over een grate onderzoekster moest gaan. Het was dan ook leuk om je voor het eerst in Landen te ontmoeten. Helaas was een verhuizing van de gehele onderzoeksgroep naar Rotterdam ervoor nodig om jouw hersens te mogen lenen voor het FLNA paper. Door jouw inbreng is het een heel mooi verhaal geworden, bedankt!

Dear Greg, you know why I am so thankful to you. I hope you will come back to research and that otherwise Yunia and I can visit you in Poland one day!

Dear Thomas, it feels like ages ago that you were in Groningen. It was great having you with us!

Beste Duco, helaas hebben wij maar kort samen in de Hirschsprung groep gewerkt. Voor jou was ik waarschijnlijk meer iemand die altijd maar op reis was en blijkbaar ook zo kon promoveren. Mijn harde laboratoriumjaren heb je niet meegemaakt, en dat is misschien maar goed ook. Jij bent in elk geval een welkome collega en ik weet zeker dat jij heel succesvol zal z ijn! Zowel in het voetbal, je thuisleven en je onderzoek!

Dear Rajendra, although we have not really worked together I enjoyed your presence in the Hirschsprung group. I wish you good luck in your project, I am sure you will discover many exciting things!

Ook grate dank aan alle anderen die bij de vrijdagochtendbesprekingen aanwezig waren en waarvan ik feedback op mijn werk heb mogen ontvangen: Conny, Peter, Jorieke, Nicole, en Bart Eggen.

Beste Siobhan, jou ben ik heel veel dank verschuldigd. Jij hebt het aangedurf d om aan een project te werken van een iemand die n iet aanwezig was in het lab. lk denk dat je daarmee veel risico hebt genomen en je daardoor veel zelf hebt moeten uitvinden. lk vind dat je het heel goed hebt gedaan. lk hoop dat je jezelf veel vaardigheden hebt kunnen aanleren die van pas zijn gekomen in Houston. Heel veel succes met je eigen promotieonderzoek!

Beste Helga, ook jou ben ik heel erg dankbaar. Ten eerste kon ik altijd heerlijk bij je komen zeuren over van alles en nog wat. lk heb echt genoten van je nuchterheid en humor, en terwijl ik dit schrijf krijg ik weer een glimlach op mijn

� .

gezicht. Bij deze wil ik je nogmaals bedanken voor het feit dat je mijn project op je hebt genomen terwijl ik in de kliniek was. Oat terwijl het toch erg weinig te maken had met je eigen onderzoek. lk wens je heel veel succes in je werk als universitair docent en ik hoop dat je in de toekomst ook weer tijd zult vinden om onderzoek te doen!

Working on a rare genetic disorder means working together with researchers from all over the world. I would like to thank all my collaborators, some of whom I have never met in real life.

Dear Professor Lyonnet, one email from Robert to you was enough to get me to Paris inside a week. Thank you very much for the warm welcome in your laboratory. I was very honoured to be the first PhD student from Robert's group to work in Paris. I greatly enjoyed my time there and I would recommend that every researcher collaborate with you.

Dear Heather, thank you very much for my week in Paris. It sounds like the title of a movie and it felt like I was living in a dream. Paris is such a beautiful city and it was very special for me to work in your laboratory under your supervision.

Dear Candice, I am wondering whether you will ever read this. Although I could not really speak French that well, we had very nice conversations. I would still like to improve my French so that the next time we meet we can talk in French.

Dear Tara, you are really my partner in crime with the zebrafish work. I do not know how to thank you for all you have done for me. Thank you for taking me to places in Atlanta and making me understand how delicious sushi is! I really hope we will meet you and Paul in the Netherlands soon, so I can show you around!

Dear Sven and Nai-Hua, it was great to collaborate with you! Hopefully we will understand one day what the function of CLMP is exactly. At least we now know what it does not do, which is equally important.

Dear Peter Kroisel, thank you for your faith in our group. I really appreciated your support during our research and it was great to meet you in Amsterdam!

Dear Joana, Anna and Raquel, it was great to collaborate with you on the aggregation assays. I hope I will meet you one day.

Beste Gerard, wat was het een feest toen we het gen hadden gevonden! Bedankt voor alles wat je me hebt geleerd. lk heb grate bewondering voor je

grate brein en hart. Het was bijzonder om met jou en Tjip in Ghana te reizen. Dear Isabella, it was great to cycle with you around the lake in Groningen!

Thank you very much for your help in our project and I hope to meet you again one day.

Beste Dick Tibboel, dear Richard Schreiber, Edward Hoffenberg, Matthew Carroll, Edward O'Loughlin, Chien-Huan Chen, Kathryn Liszewski, John Atkinson, thank you all so much for your collaboration! Without your help, this thesis would never have been achieved.

Beste Anne, wat was het leuk om binnen zo'n korte tijd met jou een artikel te schrijven! lk was erg onder de indruk van je zorgvuldige werkwijze en slimme opmerkingen. lk wens je al het geluk in je toekomst als klinisch geneticus!

Beste Bert Timmer en Klasien Bergman, heel erg bedankt voor jullie zeer snelle revisies. Jullie inbreng was zeer waardevol! Dear Andrew Nicholson, thank you for your very fast reply, it was great to collaborate with you!

Beste Nina, Morris Swertz, Freerk, Bahig Shehata, en alle anderen die mee hebben gewerkt aan het MMIHS project, thank you all for the collaboration on the MMIHS project, hopefully the results of all our efforts will follow soon!

Beste Pieter, heel erg bedankt voor alles wat je me hebt geleerd! Toen ik ruim 5 jaar geleden mijn eerste racefiets kocht zouden we al eens samen een rondje f ietsen rand Groningen. Dit zal toch eens een keer in onze drukke agenda's moeten staan.

Dear Jackie, thank you for your very quick editing and your helpful lessons to improve my English. Thank you also for your personal interest, that meant a lot to me.

Dear Claudia, thank you so much for designing the cover and layout of my thesis. I have a lot of respect for you doing all this work while we had our one week of summer this year and while you also have to take care of Simone. You, Javier and Simone form a great family!

Beste Tom, bedankt voor je enthousiasme in het maken van de prachtige figuren! Het was fijn om als buitenstaander vanuit Groningen me zo welkom te voelen in Rotterdam.

Beste Dineke, Ellen en Cleo. Jullie zijn toch wel echt onze voorbeeldvrouwen op het lab! Jullie voorbeeld van zowel succesvol zijn op het werk als thuis (met jonge kinderen) geeft jonge onderzoeksters zoals ik de moed om ambities na

te blijven streven. Heel erg bedankt ook voor de inhoudelijke feedback op mijn werk!

Bedankt ook alle anderen die mij kleine of grate dingen hebben geleerd en met wie ik ook soms over andere dingen kon praten dan werk alleen. Sommigen zal ik in het speciaal bij naam noemen, anderen weten dat zij er ook bij horen te staan: Yvonne, Krista vD.B., Krista K., Bea, Bart, Jos, Ludolf, Paul, Chris, Esther, Monique, Renee, Ana, Tjakko, Annemieke, Karen, Mats, Gerben, Paul, Marlies, Suzanne, Karin, Noortje, Marcel, Martin W., Eva, Justyna, Jihane, Anna, Bahram, Mariska, Elvira, Agata, Gosia, Asia, Mitja, Javier en Mathieu.

Naast alle mensen die direct betrakken waren bij het onderzoek, heb ik ook veel gehad aan alle vrienden. Het is goed om zo nu en dan even niet na te denken over het onderzoek, maar ook andere verhalen te horen en samen te sporten of andere afleiding te hebben.

In het bijzonder wil ik Marjan bedanken. Wij wisten beiden niet precies waar we aan begonnen toen wij besloten onze coschappen te combineren met het doen van een promotieonderzoek. Vele tegenslagen, maar gelukkig ook een aantal hoogtepunten hebben wij gekend. lk denk dat jij heel goed hebt geweten hoe je met de tegenslagen moest omgaan en hoe je ook af en toe je eigen hoogtepunten moest weten te creeren, met vakanties in West-Amerika en Australie. lk ben erg vereerd dat ik jouw paranimf mag zijn en ik ben heel blij dat je mijn grate back-up bent!

Lieve Annelies, wat ben ik er trots op dat jij mijn paranimf wilt zijn! lk heb veel respect voor wat jij allemaal hebt bereikt. Ook al hebben wij beiden een ander pad gekozen na de middelbare school, we hebben gemeen dat we onze ambities graag willen verwezenlijken en daarbij soms over onzelf heenlopen. lk hoop ook echt dat je je niet uit het veld laat slaan door problemen die eventueel zullen komen, maar dat je je hart blijft volgen en datgene bereikt wat je zo graag zou willen bereiken. Jij bent de oudste vriendin die ik heb en het betekent veel voor me dat we na ruim 20 jaar nog steeds van elkaar weten wat ons bezig houdt. Bedankt dat je er op 31 oktober voor me bent!

Lieve Lotte en Marian, bedankt ook voor jullie steun. Wat keek ik er altijd tegenop hoe snel jullie door de coschappen vlogen en hoe goed jullie het deden in de eerste jaren als arts-assistent. Marian, wat leuk dat ook jij gaat pramoveren! lk hoop dat we samen nog vaak kunnen genieten van wijntjes bij

het Paterswoldse Meer:

Lieve Dorien, wat kijk ik op tegen alles wat jij kunt en doet! lk wens je een

hele fijne toekomst met Freek. Nienke, jij ook bedankt voor de mooie momenten,

we moeten echt snel weer eens samen naar de Enzo!

Vele lieve vrienden wil ik bedanken, die ik helaas niet alien bij naam kan

noemen, maar die weten dat ze erbij horen: Mariette, Fetsje, Stefan, Laura,

Oldrik, Mariet, Ilse, Niels, Josine, Marco, Jan-Fokke, Gerko, Tom, Wim, Wendy,

Nora, Jimmy, Jeremy, Paul, Antonia, Laila, Thecla en Lysbert.

Ook dank aan Dames 6, dat heeft gezorgd voor de nodige sportieve

afleiding.

Lieve familie, zonder jullie steun was het me niet gelukt.

Lieve Klaas, ik had me geen fijnere schoonvader kunnen wensen! lk heb

groot respect voor jou en de manier waarop je altijd klaarstaat voor je kinderen.

Het is moeilijk om in woorden uit te drukken hoe dankbaar ik jou ben.

Lieve Ida, bedankt voor je grote belangstelling en medeleven. Wat is het

fijn dat je erbij bent! Lieve Cor, bedankt voor je grote interesse. Lieve Pim, wat

een bijzonder brein heb jij en wat weet jij toch veel meer over auto's dan ik!

Lieve Annelies, Wouter en Jelle, bedankt voor de vele mooie momenten

in binnen- en buitenland. Wat is het fijn om jullie drietjes op te zoeken in Houten!

Lieve Marijne, dear Troy, it was great to visit you in Australia! You are so

fortunate to live over there! I really hope we will be able to visit you soon again,

but for now I am looking forward to meeting you in the Netherlands next year:

The only downside of you being in Australia is really the distance. Lieve Marijne,

wat ben jij een geweldige gastvrouw en ik ken niemand die zo attent is als jij!

Wat was het fijn om samen op te trekken in Australie en wat missen wij jou hier,

maar hoe fijn is het dat jij in zo'n mooi land woont en jullie het zo goed hebben

samen daar!

Lieve Wim en Hen, wat vind ik het bijzonder dat jullie aanwezig waren bij

mijn buluitreiking en wat is het fijn om jullie af en toe op te zoeken in Glimmen!

lk ben gezegend met geweldige familieleden die ik allemaal bij naam

zou willen noemen, maar waarvan ik er een aantal in het bijzonder bedank:

Li eve Winette, zonder jou was dit proef schrift er nooit geweest, bedankt voor je

grote belangstelling en medeleven. Lieve AnneMarijn, wat ben ik trots op zo'n

sportieve en dappere nicht als jij! Lieve Rosalie, jij bent mijn grote voorbeeld!

Lieve oma, wat is het fijn dat u nu wat dichterbij woont en bedankt voor uw grote interesse. Lieve Machteld, Justine en Kasper, bedankt!

Li eve Anneloes en Sil, wat is het toch altijd f ijn om jullie op te zoeken in Amsterdam! Lieve Anneloes, jij bent echt de slimste vrouw die ik ken en ik weet zeker dat jou een grote toekomst wacht.

Lieve Ernie, Jan-Willem, Emma en Chris, wat is het fijn om jullie af en toe op te mogen zoeken in Baflo! Lieve Ernie, wat ben ik trots op jou! En wat een eer om te zijn vernoemd.

Lieve papa en mama, heel erg bedankt voor al jullie steun en vertrouwen. Jullie hebben ons altijd geleerd om het onderste uit de kan te halen en ik ben jullie daar heel dankbaar voor. Het is fijn om af en toe lekker thuis te komen en stoom af te blazen. Soms wil ik veel te veel, maar jullie remmen mij nooit af in al mijn ambities. Op die manier kom ik mezelf soms wel eens tegen, waar ik veel van leer. Gelukkig weten jullie wel wat sturing te geven, en dat is erg fijn. Bedankt voor al jullie wijsheid en dat ik geworden ben wie ik ben!

Lieve Sander, jij bent het beste wat mij ooit is overkomen! Wat ben ik trots op alles wat jij doet en de persoon die jij bent. Wat is het fijn om heerlijk samen te lachen, te mogen genieten van jouw nuchterheid en van onze mooie fietstochten. En wat hebben we het toch eigenlijk gewoon vreselijk goed samen. Wat kijk ik ernaar uit om ons verdere leven te delen. Je bent er altijd voor me, ook al ben ik aan de andere kant van de wereld. Wat was ik in paniek toen ik je niet zag op het vliegveld in Londen, ik zou niet weten wat ik zonder jou moest. Je bent mijn alles!

Curric ulum Vi t ae

Curriculum Vitae

Christine Suzanne van der Wert was born on 14th April 1985 in Agogo, Ghana. After she left school, the 'Willem Lodewijk Gymnasium' in Groningen, with a pre-university diploma (VWO), she started studying Medicine at the University of Groningen. During her studies, she was a member of the editiorial board of the student edition of the 'Nederlands Tijdschrift voor Geneeskunde'. She did her scientific internship in the Department of Genetics at the University Medical Centre Groningen, under the supervision of Prof. Robert M.W. Hofstra and Joke B.G.M. Verheij. She continued the search for the gene underlying Congenital Short Bowel Syndrome in her MD/PhD programme, which resulted in this thesis. During her PhD programme she visited Paris, where she worked in the 'Hopital Necker-Enfants Malades' under the supervision of Dr. Heather C. Etchevers, and she went to Atlanta, where she worked at the Department of Biology, Emory University, under the supervision of Prof. lain T. Shepherd. Her internships were performed in the 'Sint Lucas ziekenhuis' in Winschoten, the University Medical Centre Groningen, the 'Nij Smellinghe' hospital in Drachten, and the Agogo Presbyterian Hospital in Ghana. For her final internship (the 'semi-artsstage'), in Gynaecology and Obstetrics, she went to the Lyell McEwin Hospital in Adelaide and the Gawler Health Service in Gawler, Australia. On 1st August 2012 she started her residency at the Department of Gynaecology and Obstetrics, 'Medisch Spectrum Twente', in Enschede.

Curriculum Vitae 159

• •

Li s t o f ab b r e v i at i o ns

ASAM adipocyte specific adhesion molecule ATP2B4 plasma membrane calcium-transporting ATPase 4 bp base pair CAR Coxsackie- and Adenovirus Receptor CDH1 cadherin 1 cDNA complementary DNA CHO Chinese Hamster Ovary CHRNA3 neuronal nicotinic acetylcholine receptor, alpha3 subunit CHRNB4 neuronal nicotinic acetylcholine receptor beta 4 subunit CIIP Chronic Idiopathic Intestinal Pseudo-obstruction CLMP CSBS CTX DAPI dbSNP DMEM DNA EGFP FBS FLNA GADPH GFP HEK IL24 IRES JAMs MOCK MMIHS mRNA MYOG pCMV PCR qPCR RNA RT-PCR SBMO

•

Coxsackie- and adenovirus receptor-Like Membrane Protein Congenital Short Bowel Syndrome Cortical Thymocyte marker in Xenopus

4 ',6-diamidino-2-phenylindole the Single Nucleotide Polymorphism database Dulbecco's Modified Eagle Medium deoxyribonucleic acid GFP like protein Fetal Bovine Serum Filamin A glyceraldehyde-3-phosphate dehydrogenase Green Fluorescent Protein Human embryonic kidney interleukin 24 internal ribosomal re-entry site Junctional adhesion molecules Madin-Darby canine kidney Megacystis microcolon intestinal hypoperistalsis syndrome messenger RNA Myogenin promoter of cytomegalovirus polymerase chain reaction quantitative polymerase chain reaction ribonucleic acid reverse-transcription polymerase chain reaction splice-blocking morpholino

SNP single-nucleotide polymorphism

TBMO translation-blocking morpholino

TER transepithelial electrical resistance

TPN total parenteral nutrition

WT wild-type

Z0-1 zonula occludens 1

a-MEM alpha modification of eagle's medium

t/i ()I rJJ, Pl.