Universidade de Lisboa -...

Universidade de Lisboa Faculdade de Ciências

Departamento de Biologia Vegetal

A new variant in the interleukin-6 receptor (IL-6R) gene increases gene expression and asthma risk

Queensland Institute of Medical Research

Joana Nunes Mexia Allen Revez

Dissertação

Mestrado em Biologia Molecular e Genética

2013

Universidade de Lisboa Faculdade de Ciências

Departamento de Biologia Vegetal

A new variant in the interleukin-6 receptor (IL-6R) gene increases gene expression and asthma risk

Queensland Institute of Medical Research

Joana Nunes Mexia Allen Revez

Dissertação orientada pelo Prof. Doutor Manuel C. Gomes e pelo Doutor Manuel Ferreira

Mestrado em Biologia Molecular e Genética

2013

ii

Índice

RESUMO EM LÍNGUA PORTUGUESA DA DISSERTAÇÃO III

DISSERTAÇÃO 1 NOTA 2 RESUMO 3 ABSTRACT 4 INTRODUCTION 5 METHODS 6

Study participants 6 sIL-6R serum protein measurements 7 IL6R mRNA measurements 8 IL6R SNP genotyping 9 Statistical analyses 10

RESULTS 12 Common variants affecting sIL-6R serum levels independently of rs4129267 12 Replication of the new association between rs12083537 and sIL-6R serum levels 13 Association between rs12083537 with IL6R mRNA levels 14 Association between rs12083537 and asthma risk 14

DISCUSSION 16 ACKNOWLEDGEMENTS 18 REFERENCES 19

ANEXOS S1

Joana N. M. Allen Revez Mestrado em Biologia Molecular e Genética

Resumo da dissertação iii

Resumo em língua Portuguesa da Dissertação intitulada: “A new variant in the

interleukin-6 receptor (IL-6R) gene increases gene expression and asthma risk.”

A interleucina-6 (IL-6) é uma citocina envolvida na asma alérgica, que atua nas suas células-

alvo através de um recetor constituído por pelo menos duas subunidades membranares: uma

glicoproteína de associação ao ligando (IL-6R) e uma glicoproteína transdutora de sinal

(gp130). Embora a gp130 se expresse na grande maioria das células, apenas algumas são

diretamente estimuladas pela IL-6, porque a expressão da IL-6R membranar (mIL-6R) é

limitada a hepatócitos e determinadas células imunes. No entanto, a IL-6R também existe sob

forma solúvel (sIL-6R), que tanto pode ser formada por clivagem da mIL-6R, como por

splicing alternativo. Uma vez ligada à IL-6, a sIL-6R pode associar-se à gp130, estimulando

as células por uma via alternativa, também viável em células que não expressam mIL-6R.

A variante rs2228145, no gene IL6R, encontra-se na região que codifica para o local de corte

da mIL-6R e é considerada o principal determinante genético dos níveis de sIL-6R,

representando cerca de 19% da sua variabilidade. Portadores do alelo de risco têm elevados

níveis de sIL-6R e maior risco de asma. No entanto, a percentagem de variação nos níveis de

sIL-6R explicada geneticamente é estimada em 70%, muito superior aos 19%

supramencionados, pelo que é possível que outras variantes no IL6R, ou próximo deste,

também contribuam para a sua variabilidade independentemente da rs2228145, e

possivelmente afetem o risco de asma.

Para testar esta hipótese, neste estudo (1) efetuámos uma imputação exaustiva de variantes

comuns na região do IL6R; (2) testámos a associação entre as variantes obtidas e os níveis de

sIL-6R de 360 indivíduos; (3) replicámos o estudo numa amostra independente de 354

indivíduos para as variantes que apresentaram associação mais forte; e (4) testámos a

associação das variantes replicadas (a) com os níveis de transcrito do IL6R (em dois estudos

independentes; N = 851 e N = 5 191) e (b) com o risco de asma (N = 47 514). Segue-se uma

descrição mais pormenorizada de todos estes pontos.

Numa primeira fase, medimos em duplicado as concentrações serológicas de sIL-6R de 360

asmáticos já genotipados. Após eliminar variabilidades técnicas, calculámos a média dos


Resumo da dissertação iv

níveis corrigidos de sIL-6R para cada indivíduo e normalizámos a distribuição global das

medições. Não se verificaram efeitos significativos do sexo ou da idade.

Tendo o 1000 Genomes Project como referência, imputámos 452 variantes no IL6R (± 50 kb)

dos 360 asmáticos, e testámos a sua associação com os níveis de sIL-6R, bem como a de

outras 19 variantes diretamente genotipadas nestes indivíduos.

A variante que apresentou maior grau de associação (P = 0.0005) com os níveis de sIL-6R

ajustados pelo rs4129267, uma variante correlacionada (r2 = 0.99) com a rs2228145, foi a

rs12083537, e a associação manteve-se significativa (P = 0.0496) após correção pelo número

de variantes testadas. Três variantes independentes demonstraram estar significativamente

associadas com os níveis de sIL-6R ajustados pelas variantes rs4129267 e rs12083537, mas

qualquer destas associações deixou de ser significativa depois de corrigir pelo número de

variantes testadas.

Para confirmar a associação entre a variante rs12083537 e os níveis de sIL-6R, replicámos o

estudo de associação em 354 indivíduos não relacionados com os anteriores. Após

ajustamento pelos efeitos do rs4129267, detetámos uma associação significativa entre o

rs12083537 e os níveis de sIL-6R (P = 0.033), sendo a direção do efeito a mesma que a da

análise prévia. Estes resultados confirmam portanto que rs12083537, ou uma variante

correlacionada com esta, regula os níveis serológicos de sIL-6R.

Depois de combinar as duas amostras onde se efetuaram os estudos de associação (N = 714),

o rs12083537 passou a explicar 2.2% da variabilidade dos níveis de sIL-6R ajustados pelo

rs4129267 (P = 6x10-5), sendo que antes do ajuste explicava 0.15%. O alelo rs12083537:G

reduziu os níveis de sIL-6R de forma semelhante nas três classes genotípicas do rs4129267.

Para ajudar a compreender o mecanismo molecular pelo qual o rs12083537 afeta os níveis de

sIL-6R, estudámos em seguida os níveis de RNA mensageiro (mRNA) do IL6R num grupo de

gémeos adolescentes (N = 851) para determinar se esta variante influenciava os níveis da

transcrição. Não foi detetada associação significativa entre o rs12083537 e os níveis de

mRNA, quer com uma sonda para a região 3’UTR, quer com uma sonda para o exão 9. Por

outro lado, detetámos uma associação significativa entre a variante rs4129267 e os níveis de


Resumo da dissertação v

transcrito do IL6R. Contraintuitivamente, o alelo rs4129267:T, que aumenta os níveis de sIL-

6R, demonstrou associação com baixos níveis de transcrito do IL6R.

Para garantir que a ausência de associação entre o rs12083537 e os níveis de mRNA do IL6R

não se deveu a baixo poder de deteção da nossa amostra, realizámos uma análise semelhante à

anterior num estudo independente e maior (N = 5 191). Neste estudo, após correção pelo

número de sondas testadas, não foi detetada uma associação significativa entre a variante e os

níveis de mRNA do IL6R. A sonda para a qual a associação foi mais forte é complementar à

região 3’UTR (P = 0.0031); o alelo rs12083537:A que aumenta os níveis de sIL-6R esteve

associado com uma redução dos níveis de transcrito do IL6R.

Por fim, como o alelo rs2228145:C aumenta não só os níveis de sIL-6R mas também o risco

de asma, testámos a hipótese de o rs12083537 também ser um fator genético de risco para a

asma. A associação entre esta variante e asma foi testada em 47 514 indivíduos de três

estudos independentes, dos quais 16 705 eram asmáticos diagnosticados por um médico. O

alelo rs12083537:A foi detetado com mais frequência em asmáticos do que nao-asmáticos nos

três estudos individuais, sendo a associação global entre o rs12083537 e o risco de asma fraca

mas estatisticamente significativa (OR = 1.039, 95% I.C. = 1.002 – 1.078, P = 0.0419).

A variante rs12083537 localizada no intrão 1 do IL6R, a 2.9 kb do exão 1, revelou estar

significativamente associada com os níveis de sIL-6R independentemente da variante

rs4129267, e a associação foi confirmada quando replicámos a análise. A variante localiza-se

numa região do gene que, em pelo menos quatro linhas celulares, incluindo fibroblastos

pulmonares e queratinócitos, tem elevado grau de metilação (H3K4Me1). Este tipo de

modificação de histonas está associada a enhancers e promotores, sendo portanto plausível

que o rs12083537 influencie a transcrição do IL6R. No entanto, não foi detetada associação

significativa entre o rs12083537 e os níveis de mRNA do IL6R, pelo que o mecanismo de

ação da variante permanece por elucidar.

Também verificámos que o alelo rs4129267:T, que aumenta os níveis de sIL-6R, está

associado a baixos níveis de mRNA do IL6R. As medições para as quais se verificou esta

associação foram feitas com uma sonda que se liga ao exão 9, o qual pode ser removido por

splicing alternativo. Assim, as medições em causa correspondem apenas aos níveis de mRNA

que não sofreu splicing. Tendo em conta que o alelo rs4129267:T está associado a um


Resumo da dissertação vi

aumento do splicing do exão 9, é portanto de esperar que os níveis da isoforma que não sofreu

splicing diminuam na presença deste alelo.

Por fim, verificámos que a variante rs12083537 está significativamente associada com o risco

de asma. Com base na nossa análise, cada alelo rs12083537:A aumenta os níveis serológicos

de sIL-6R cerca de 2.4 vezes e o risco de asma1.04 vezes.

Em conclusão, este estudo demonstra que pelo menos duas variantes genéticas influenciam os

níveis serológicos de sIL-6R. Como tal, estudos de resposta clínica ao tocilizumab, um

anticorpo monoclonal para o IL-6R já aprovado para o tratamento da artrite reumatoide,

devem avaliar a contribuição das diversas variantes que regulam os níveis de sIL-6R.

Pontuações de risco genético cumulativo poderão ser úteis para explicar variabilidade na

respostas clínica ao tocilizumab.

A new variant in the interleukin-6 receptor (IL-6R) gene increases gene expression and asthma risk.

Joana Allen Revez

Supervised by: Manuel Ferreira PhD Manuel Carmo Gomes PhD

Queensland Institute of Medical Research 2013

Molecular Biology and Genetics


A new variant in the IL6R gene increases gene expression and asthma risk 2

Nota

O conteúdo desta dissertação foi parcialmente submetido para publicação à revista Genes and Immunity em maio de 2013, estando identificado como A new regulatory variant in the interleukin-6 receptor gene associates with asthma risk, sob a autoria de Joana A. Revez, Lisa Bain, Brett Chapman, Joseph E. Powell, Rick Jansen, David L. Duffy, Joyce Y. Tung, AAGC collaborators, Brenda W. Penninx, Peter M. Visscher, Eco J.C. de Geus, Dorret I. Boomsma, David A. Hinds, Nicholas G. Martin, Grant W. Montgomery, Manuel A.R. Ferreira. O manuscrito encontra-se presentemente sob revisão.

Neste trabalho, eu, Joana Nunes Mexia Allen Revez, estive envolvida na análise de associação entre as 714 variantes genéticas e os níveis de sIL-6R da amostra de 360 asmáticos. Participei em todo o processo de replicação desse mesmo estudo, desde a medição dos níveis de sIL-6R, à análise estatística dos resultados. Também participei na análise dos resultados de associação entre a variante rs12083537 e (a) os níveis de transcrito do IL6R e (b) o risco de asma.



Resumo

O principal determinante genético dos níveis de IL-6R solúvel é a variante rs2228145, que se

encontra no local de corte da proteína IL-6R. Por cada alelo Ala, os níveis de sIL-6R

aumentam por ~20 ng/ml e o risco de asma aumenta 1.09 vezes. No entanto, esta variante não

explica a totalidade da componente hereditária dos níveis de sIL-6R. É portanto possível que

outras variantes no gene IL6R também contribuam para variações nos níveis de sIL-6R e

influenciem o risco de asma. Para testar esta hipótese, imputámos 471 variantes comuns no

IL6R e testámos a sua associação com os níveis serológicos de sIL-6R em 360 indivíduos.

Uma variante intrónica (rs12083537) apresentou associação com os níveis de sIL-6R

independentemente da variante rs4129267 (P = 0.0005). Observámos uma associação

significativa e consistente ao replicar o estudo em 354 indivíduos (P = 0.033). Cada cópia do

alelo rs12083537:A aumentou os níveis de sIL-6R em 2.4 ng/ml. Na análise dos níveis de

mRNA em dois estudos independentes não foram identificadas associações significativas

entre a variante rs12083537 e os níveis de transcrição do IL6R. Por outro lado, o alelo

rs12083537:A aumentou o risco de asma 1.04 vezes (P = 0.0419) na análise de 16 705

asmáticos e 30 908 controlos. Pontuações de risco genético poderão portanto ser úteis para

explicar variabilidade na resposta clínica ao tocilizumab, um anticorpo monoclonal contra o

IL-6R.

Palavras-chave: alergia, eQTL, expressão, doença



Abstract

The main genetic determinant of soluble IL-6R levels is the missense variant rs2228145,

which maps to the cleavage site of IL-6R. For each Ala allele, sIL-6R serum levels increase

by ~20 ng/ml and asthma risk by 1.09-fold. However, this variant does not explain the total

heritability for sIL-6R levels. Additional independent variants in IL6R may therefore

contribute to variation in sIL-6R levels and influence asthma risk. To test this hypothesis, we

imputed 471 common variants in IL6R, which were then tested for association with sIL-6R

serum levels in 360 individuals. An intronic variant (rs12083537) was associated with sIL-6R

levels independently of rs4129267 (P = 0.0005). A significant and consistent association for

rs12083537 was observed in a replication panel of 354 individuals (P = 0.033). Each

rs12083537:A allele increased sIL-6R serum levels by 2.4 ng/ml. On the one hand, analysis of

mRNA levels in two cohorts did not identify significant associations between rs12083537 and

IL6R transcription levels. On the other hand, results from 16 705 asthmatics and 30 809

controls showed that the rs12083537:A allele increased asthma risk by 1.04-fold (P = 0.0419).

Genetic risk scores based on IL6R regulatory variants may prove useful in explaining

variation in clinical response to tocilizumab, an anti-IL-6R monoclonal antibody.

Keywords: allergy, eQTL, expression, disease



Introduction

Asthma is a chronic lung disease characterized by airway obstruction, inflammation and

hyperresponsiveness.1 It is caused by a combination of both genetic and environmental factors

but their interaction is complex and still not fully understood.

IL-6 is a cytokine known to be involved in allergic asthma2-5 and it binds to its target cells

through a complex of at least two distinct membrane-bound proteins, an 80 kD ligand binding

glycoprotein (IL-6R) and a 130 kD signal transducing glycoprotein (gp130).6, 7 Although

gp130 is expressed on most cells, expression of the membrane-bound form of IL-6R (mIL-

6R) is limited to hepatocytes and some immune cells, such as neutrophils, monocytes, CD4+

T cells and B cells;8, 9 as such, only these cells are directly stimulated by IL-6. However, IL-

6R also exists in a soluble form (sIL-6R) that is either produced by proteolytic cleavage of

mIL-6R or by alternative splicing.10-13 sIL-6R can associate with free IL-6 and this complex is

then recognized by the membrane-bound gp130, hence providing an alternative IL-6

signalling pathway available to cells that do not express mIL-6R, a process known as trans-

signalling.7

The main genetic determinant of sIL-6R levels is thought to be the non-synonymous variant

rs2228145 in exon 9,14 which maps to amino acid position 358 on the main cleavage site of

IL-6R.15 Specifically, individuals that carry the Ala358 allele have increased sIL-6R levels14

– which in turn are associated with increased levels of allergic inflammation in the lung16 –

and also increased risk of asthma.17 However, given that this variant explains ~19% of the

variation in sIL-6R levels18 but the total heritability of this trait has been estimated at ~70%,19

we hypothesised that additional variants in or near the IL6R gene contribute to sIL-6R

variation independently of rs2228145 and may also influence asthma risk.

To test this hypothesis, in this study we (1) used data from the 1000 Genomes Project20 to

comprehensively impute common variants in or near the IL6R gene; (2) tested these variants

for association with sIL-6R levels measured in 360 individuals; (3) followed-up the most

associated variants in an independent sample of 354 individuals; and (4) tested the replicated

variants for association with IL6R transcript levels in two independent cohorts (N = 851 and 5

191) and asthma risk (N = 47 514).



Methods

Study participants

Genetic variants in or near the IL6R gene were tested for association with sIL-6R protein

levels, mRNA levels and asthma risk in the cohorts described below.

Association with IL-6R protein levels – discovery cohort. To find new variants in the IL6R

gene that affect sIL-6R levels, we first studied 360 unrelated asthmatic subjects from the

1995-1998 Asthma and Allergy study, which is described in detail elsewhere.24 Briefly, 3 073

subjects were recruited from 802 families that were registered on the Australian Twin

Registry and had at least one twin who previously reported a history of wheezing in studies

conducted at Queensland Institute of Medical Research (QIMR) and by collaborators

elsewhere in Australia. Participants completed a questionnaire that was designed to validate

the diagnosis of asthma and to obtain data on respiratory symptoms, environmental exposures

and family history of asthma. In addition, participants underwent clinical testing, including

lung function and skin prick tests. For the present study, we selected 360 unrelated individuals

with available DNA and a serum sample, and who answered “Yes, told to me by a doctor” to

the question “Have you ever had asthma?”. Demographics and clinical characteristics for this

discovery sample are summarised in Supplementary Table 1. These individuals were

included in a recent genome-wide association study (GWAS) of asthma.17

Association with IL-6R protein levels – replication cohort. To confirm associations between

SNPs and IL-6R protein levels observed in the discovery sample, we studied an additional

sample of 354 unrelated asthmatics recruited through the QIMR Asthma Genetics Study

between 2011 and 2013. In this study, individuals with a self-reported doctor-diagnosis of

asthma were recruited from the general community through media appeals (newspapers,

radio, television and social media) to participate in a study of genetic risk factors for asthma.

Participation included completing a brief online questionnaire about asthma symptoms,

medication and severity, and the provision of a blood sample for genetic and immune function

testing. Blood was collected at a local pathology laboratory and shipped to QIMR by

overnight courier. Demographics and clinical characteristics for this replication sample are

summarised in Supplementary Table 2.



Association with IL6R mRNA levels. To provide some insight into the molecular mechanisms

underlying SNP-protein associations, SNPs confirmed to associate with sIL-6R protein levels

were then tested for association with mRNA levels measured in 851 individuals from 262

families who participated in a genome-wide gene-expression study reported recently.25

Briefly, adolescent monozygotic and dizygotic twins, their siblings, and their parents have

been recruited over a 21-year period into an ongoing study of the genetic and environmental

factors influencing pigmented nevi and the associated risk of developing skin cancer and

cognition (Twin Moles study)26. Results obtained in this cohort were confirmed by analysing

expression levels from an additional 5 191 individuals who participated in two large-scale

longitudinal studies: the Netherlands Twin Register (N = 3 170) and the Netherlands Study of

Depression and Anxiety (N = 2 021); henceforth we refer to this as the NTR-NESDA eQTL

study. The individual NTR and NESDA cohorts are described in detail elsewhere.27, 28

Association with asthma risk. SNPs associated with sIL-6R protein levels were also tested for

association with asthma risk in 21 039 unrelated individuals of European ancestry who

participated in two independent studies. First, 5 967 individuals who participated in the

Australian asthma GWAS,17 including 2 110 doctor-diagnosed asthmatics and 3 857 controls.

Sample ascertainment and patient characteristics for this study are described in detail in

Ferreira.17 Second, 15 072 customers of 23andMe, Inc., a personal genetics company, who

had been genotyped as part of the 23andMe Personal Genome Service®. We selected 4 230

cases and 10 842 controls of European ancestry who had taken a survey about asthma. Cases

(mean age 48, 54% female, 55% with onset of asthma at or before age 16) gave positive

responses to the question "Have you ever been diagnosed by a doctor with asthma or

bronchial asthma?", and also checked a box indicating that they had ever had "allergic rhinitis

(stuffed or dripping nose caused by allergies)". Controls (mean age 49, 39% females) gave

negative responses to both questions. Association results from these 6 340 cases and 14 699

controls were meta-analysed with publicly available results from 10 365 asthmatics and 16

110 controls included in the GABRIEL GWAS,29 for a combined total sample size of 47 514

individuals, including 16 705 cases and 30 809 controls.

sIL-6R serum protein measurements

A 40 mL venous blood sample was collected from all consenting subjects. After spinning 10

mL of blood in a serum tube at 805g for 10 min, the serum layer was extracted and stored at -



80ºC until analysis. ELISA kits (R&D Systems, Minneapolis, MN, USA) were used to

measure sIL-6R levels according to manufacturer’s procedures. The optical density was

determined using a PowerWave XS2 microplate spectrophotometer (BioTek Instruments,

Inc.) at both 450 and 540 nm wavelengths. Results and standard curves were acquired with

Gen5 2.0 Data Analysis Software. sIL-6R levels were measured in duplicate for each sample.

IL6R mRNA measurements

Whole blood for expression profiling was collected from 851 individuals from the Twin

Moles study and processed as described in detail by Powell et al.25 Briefly, total RNA was

extracted from PAXgeneTM tubes using the QIAGEN whole blood gene RNA purification kit.

RNA quality and concentration was estimated with Agilent Bioanalyzer and subsequently

converted to cDNA, amplified and purified using the Ambion Illumina TotalPrep RNA

Amplification Kit (Ambion). Expression profiles were generated by hybridising 750 ng of

cRNA to Illumina HumanHT-12 v4.0 Beadchip according to Illumina whole-genome gene

expression direct hybridization assay guide (Illumina Inc, San Diego, USA). Beadchips were

then washed and stained and subsequently scanned to obtain fluorescence intensities. Samples

were scanned using an Illumina Bead Array Reader. Samples were randomised across chips

and chip positions, with check for balance across families, sex and generation. For this study,

we restricted our analysis to two probes targeting the IL6R gene, specifically ILMN_1754753

on the 3'-end and ILMN_1696394 on exon 9 (Supplementary Table 5).

Gene expression association results were confirmed by analysing a further 5 191 individuals

from the NTR-NESDA eQTL study. In this study, venous blood samples were drawn in the

morning after an overnight fast; heparinised whole blood was transferred within 20 minutes of

sampling into PAXgeneTM tubes and stored at -20°C. RNA extraction and analysis was

performed at the Rutgers University Cell and DNA Repository (USA). RNA was extracted

using Qiagen Universal liquid handling system (PAXgene extraction kits following the

manufacturer's protocol). Total RNA was measured by spectroscopy (Trinean DropSense) to

determine purity and concentration, while RNA fidelity was measured by the Agilent

Bioanalyzer analysis. RNA samples were hybridized to Affymetrix U219 array plates

(GeneTitan), which contains 530 467 probes, each 25 bases in length. Array hybridization,

washing, staining, and scanning were carried out in an Affymetrix GeneTitan System

following the manufacturer’s protocol. Non-uniquely mapping probes (hg19) and probes



containing a polymorphic SNP based on snp137 (UCSC) were removed. Expression values

were obtained using RMA normalization implemented in Affymetrix Power Tools (APT, v

1.12.0). Thirty-two probes targeting IL6R were selected for analysis (Supplementary Table

4).

IL6R SNP genotyping

For association with sIL-6R protein levels – discovery cohort. Genome-wide SNP data for the

360 individuals were obtained using Illumina 610-Quad Beadchip as part of the Australian

Asthma Genetics Consortium GWAS, which is described in detail elsewhere.17 For this study,

we selected 254 post-quality control (minor allele frequency [MAF] > 1%, call rate > 95%,

Hardy-Weinberg equilibrium P-value > 10-6) SNPs in or within 1 000 kb of IL6R, including

rs4129267. To expand the genetic coverage of IL6R, these 254 directly genotyped SNPs were

then used to impute 530 common variants (MAF >= 1%) from the 1000 Genomes Project

(March 2012 release, 1,092 samples of all ancestries) using Impute2.30 After quality control

(MAF > 1%, imputation information score > 0.3), there were 471 SNPs located in or within

50 kb of IL6R available for analysis, of which 19 had been directly genotyped.

For association with sIL-6R protein levels – replication cohort. Genotypes for two SNPs

(rs4129267 and rs12083537) were obtained for the 354 individuals with Sequenom

MassARRAY iPLEX platform; 12.5 ng of DNA isolated from buffy coats with a salt

precipitation method were used per assay. SNP sequences were downloaded from the

National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and cross

checked. Design of the PCR and iPLEX Extension assays was done using the Sequenom

Design Suite (https://mysequenom.com/). The assays were then manually adjusted to increase

the level of multiplexing. SNPs were typed using iPLEXTM Gold chemistry and analysed

using a Sequenom MassARRAY Compact Mass Spectrometer (Sequenom Inc, San Diego,

CA, USA). The PCR, SAP and iPLEX reactions were performed using half the volume of

reagents recommended in the manufacturer’s specifications. The post-PCR products were

spotted on a Sequenom SpectroChip 2, and the data was processed and analysed using

Sequenom MassARRAY TYPER 4.0 software. The primers used to amplify both SNPs are

included in Supplementary Table 6.



For association with IL6R mRNA levels. DNA samples from the Twin Moles study (N = 851)

were genotyped by the Scientific Services Division at deCODE Genetics, Iceland, using the

Illumina 610-Quad Beadchip. Genotypes were called with the Illumina BeadStudio software.

Full details of genotyping procedures are given in Medland et al.31 DNA extraction for the

NTR-NESDA eQTL study (N = 5 191) has been described before.27 Genotyping was

performed on multiple SNP array platforms, including Perlegen 5.0, Illumina 370, Illumina

660, Illumina Omni Express 1M and Affymetrix 6.0. Standard pre-imputation quality control

filters were applied first within and then between chip platforms; subsequently, data were

merged into a single dataset. Genome-wide SNP imputation was done with Impute2 30 using

the 1000 Genomes phase I Interim Jun 2011 release. This included the rs12083537 variant

analysed in this study, which was imputed with high confidence (information score > 0.9).

For association with asthma risk. We accessed individual-level genotype data for a single

SNP (rs12083537) from the Australian GWAS (N = 5 967) and the 23andMe cohort (N = 15

072). This SNP was imputed in the Australian GWAS with high confidence (information

score 0.97), using Impute2 and genotype data from the combined 1000 Genomes (60

individuals with northern and western European ancestry from the Centre d’Etude du

Polymorphisme Humain collection [CEU], March, 2010 release) and HapMap 3 (955

individuals from 11 populations, February, 2009 release) projects as the reference panel. In

the 23andMe cohort, rs12083537 was imputed with high confidence (r2 = 0.95) using the

August 2010 release of the 1000 Genomes reference haplotypes.

Statistical analyses

Quality control of sIL-6R ELISA data. Each sample was measured in duplicate (two assays),

with up to 80 serum samples included per ELISA plate. No outlier observations (located six

standard deviations from the mean) were observed for either assay. The same procedure was

used for the discovery and replication cohorts to estimate and remove the effects of both

technical and biological effects on sIL-6R levels. Briefly, we (1) used linear regression to

adjust for assay and plate effects; (2) normalized the distribution using a rank-based inverse-

normal transformation; and (3) tested and, if significant (P < 0.05), adjusted for the effects of

age and sex including these variables in a multiple regression model. Subsequent association

analyses were carried out using the residuals obtained from (3).



Association analyses. Individual SNPs in IL6R, directly genotyped or imputed, were tested for

association with sIL-6R protein levels (discovery and replication cohorts), mRNA levels and

asthma risk. Association with protein levels was tested using multiple linear regression,

assuming an additive model for the SNP effect; for imputed SNPs, we used the inferred allelic

dosage. Analyses were performed before and after adjustment for rs4129267, a SNP highly

correlated with the missense variant rs2228145 (r2 = 0.99), the main genetic determinant of

sIL-6R protein serum levels.21 We permuted sIL-6R levels (100 000 replicates) and repeated

the association analysis to obtain empirical association P-values corrected for the number of

SNPs tested. Association with mRNA levels in the Twin Moles study was tested using

MACH2QTL,32, 33 a software that performs a linear regression analysis based on imputed

dosages and which takes into account the family structure of the data. In the NTR-NESDA

eQTL study, association with mRNA levels was tested using a linear mixed model to correct

for family structure (as random effects) as well as sex, age, body mass index, smoking status,

technical covariates and ancestry (as fixed effects). Lastly, association with asthma risk was

tested using logistic regression, with the dependent variable being asthma status, i.e. asthmatic

or control. The analysis included covariates to adjust for sample origin in the Australian

GWAS and, in the 23andMe cohort, for age, sex and ancestry. Fixed-effects meta-analysis of

results from the Australian GWAS, 23andMe and the publicly available GABRIEL GWAS

was performed with METAL.34



Results

Common variants affecting sIL-6R serum levels independently of rs4129267

To find new common variants associated with sIL-6R levels and possibly with asthma risk,

we first measured sIL-6R serum levels in 360 asthmatics (Supplementary Table 1) who had

been previously genotyped with Illumina 610K SNP arrays.17 sIL-6R measurements were

performed in duplicate, with good agreement between assays (r = 0.95). Assay and plate

effects explained respectively 0.7% (P = 0.013) and 13.6% (P = 3.3x10-20) of the sample

variation in sIL-6R levels and so these effects were removed prior to association analyses.

Duplicate measurements were then averaged and the overall distribution normalised using a

rank-based inverse-normal transformation. There were no significant effects of age (P =

0.256) or sex (P = 0.932) on sIL-6R levels.

The main genetic determinant of sIL-6R levels is thought to be the non-synonymous variant

rs2228145,14 which is in high linkage disequilibrium (r2 = 0.99) with rs4129267, a SNP that

was directly genotyped in all individuals. We confirmed that the rs4129267 SNP has a

significant impact on sIL-6R availability, increasing serum levels by 19.7 ng/ml for each copy

of the T allele and explaining 30% of the inter-individual variation (P = 1.8x10-29,

Supplementary Figure 1). However, given that the heritability of sIL-6R levels has been

estimated at ~70%,19 we hypothesised that additional variants in or near the IL6R gene

contribute to variation in sIL-6R serum levels independently of rs4129267.

To test this hypothesis, we imputed 452 common variants in IL6R (± 50 kb) in the 360

asthmatics using data from the 1 000 Genomes Project as the reference panel. These variants,

as well as 19 additional IL6R SNPs that were present in the Illumina 610K array, were then

tested for association with sIL-6R levels, after adjustment for the effect of rs4129267.

The variant with strongest association with rs4129267-adjusted sIL-6R levels was rs12083537

(uncorrected P = 0.0005, Supplementary Table 2 and Supplementary Figure 2); the

association remained significant after correcting for the number of SNPs tested through 100

000 permutations (P = 0.0496). The rs12083537 variant is in low linkage disequilibrium with

rs4129267 (r2 = 0.03) and has a minor allele (G) frequency of 0.23. An additional 3

independent (r2 < 0.1) SNPs had a significant (uncorrected P < 0.05) association with sIL-6R



levels after adjusting for both rs4129267 and rs12083537 (Supplementary Table 2).

However, these associations did not remain significant after correction for multiple SNP

testing (P > 0.05).

Replication of the new association between rs12083537 and sIL-6R serum levels

To confirm that the observed association between rs12083537 and sIL-6R levels was real and

not a technical or statistical artefact, we performed a replication study using the same

experimental procedure in an additional set of 354 unrelated asthmatics (Supplementary

Table 3), genotyped for both rs4129267 and rs12083537.

After adjusting for the effects of rs4129267, rs12083537 was significantly associated with

sIL-6R levels (P = 0.033), with the same direction of effect observed in the discovery analysis

(Supplementary Figure 3). These results thus confirm that rs12083537 is a new quantitative

trait locus for sIL-6R serum protein levels.

After combining data from the discovery and replication cohorts (combined N = 714),

rs12083537 explained 2.2% of the variation in sIL-6R levels after adjustment for the effects

of rs4129267 (P = 6x10-5). Before adjustment for rs4129267, rs12083537 explained 0.15% of

the variation in sIL-6R levels. The rs12083537:G minor allele decreased sIL-6R levels

similarly in the three rs4129267 genotype classes (Figure 1).

Figure 1. sIL-6R serum levels as a

function of rs4129267 and rs12083537

genotype (N = 714). The proportion of

variation in sIL-6R levels explained by

rs12083537 (r2) is shown for each

rs4129267 genotype class, together with

the estimated regression coefficient (β).



Association between rs12083537 with IL6R mRNA levels

The main genetic determinant of sIL-6R levels, rs2228145, is located on the main cleavage

site of IL-6R and so it is thought to affect protein levels through a post-transcriptional

mechanism.15 To provide some insight into the molecular mechanisms underlying the new

rs12083537 association with sIL-6R protein levels, we investigated if this variant influenced

IL6R mRNA levels measured in whole blood in a cohort of adolescent twins and their

relatives (N = 851). There was no significant association between rs12083537 and IL6R

mRNA levels in this cohort, either measured by a probe targeting the 3' UTR (beta = -0.050

for the G allele, SE = 0.062, P = 0.4234) or exon 9 (beta = -0.062 for the G allele, SE = 0.063,

P = 0.3209). On the other hand, we observed a significant association between rs4129267 (a

proxy for rs2228145) and IL6R gene transcription (exon 9 probe, beta = -0.120 for T allele,

SE = 0.051, P = 0.0187). Counterintuitively, the rs4129267:T allele that increases sIL-6R

protein levels was associated with decreased mRNA expression.

To confirm that the lack of association between rs12083537 and mRNA levels was not due to

low power or incomplete coverage of IL6R expression patterns, we performed a similar

analysis in a larger independent cohort (N = 5 191) with IL6R gene expression levels in whole

blood measured by 32 individual Affymetrix probes, targeting exons 5, 7, 8 and the 3’ UTR.

In this cohort, the rs12083537 variant was also not associated with IL6R transcription levels

after a Bonferroni correction for the number of probes tested (P < 0.0016, Supplementary

Table 4). The strongest association was with a probe mapping to the 3’UTR region (P =

0.0031), with the rs12083537:A allele that increases sIL-6R protein levels being associated

with decreased mRNA expression, as noted above for rs4129267.

Association between rs12083537 and asthma risk

The rs2228145:C allele that increases sIL-6R levels14 also increases asthma risk.17 We

therefore tested the hypothesis that rs12083537 is also a genetic risk factor for asthma.

Specifically, we hypothesised that, as for rs2228145, the rs12083537:A allele that is

associated with higher sIL-6R levels would be predisposing for asthma. Association results

were available for 47 514 individuals from three independent studies, including 16 705

doctor-diagnosed asthmatics and 30 809 controls. A consistent predisposing effect was

observed for the rs12083537:A allele in all three studies (Table 1). Overall, the association



between rs12083537 and asthma risk was weak but statistically significant (OR = 1.039, 95%

C.I. = 1.002 – 1.078, P = 0.0419).

Study N cases N Controls OR* SE P-value AAGC 2110 3857 1.095 0.0528 0.0846

23andMe 4230 10842 1.036 0.0333 0.2888 GABRIEL 10365 16110 1.028 0.0249 0.2726

All samples 16705 30809 1.039 0.0186 0.0419

Table 1. Association between rs12083537 and asthma risk in three independent studies.



Discussion

Recently, Ferreira et al.17 identified a variant (rs4129267) in the IL6R gene with a modest (OR

= 1.09) but genome-wide significant association with asthma risk. This variant is in near

complete LD with the exon 9 missense variant rs2228145, and is associated with a 1.4-fold

increase in sIL-6R levels for each copy of the T allele.21 The goal of this study was to test the

hypotheses that (1) other variants in IL6R regulate gene expression and (2) that these also

associate with asthma risk.

A single variant (rs12083537) located in intron 1 of IL6R, 2.9 kb away from exon 1, was

found to associate with sIL-6R levels independently of rs4129267 and after correction for

multiple SNP testing. A significant and consistent association for this variant was then

observed in our replication panel. Furthermore, at the time of submission, we also noted that

R. Ferreira et al.22 independently reported two new genetic associations for sIL-6R levels, one

of which (rs1386821) is correlated with rs12083537 (r2 = 0.94). The alleles that increase sIL-

6R levels for these two SNPs (rs12083537:A and rs1386821:T) are in phase and so our results

are consistent with those of R. Ferreira et al. Together, these results establish rs12083537, or a

variant in LD with it, as a new regulatory variant for sIL-6R serum levels.

The rs12083537 variant is located in a region with high H3K4Me1 lysine methylation in four

cell lines, including lung fibroblasts and keratinocytes.23 This histone modification is

associated with enhancers and promoters and so it is plausible that rs12083537 may influence

gene transcription. However, analysis of mRNA levels extracted from whole blood in two

independent cohorts did not identify any significant associations between rs12083537 and

IL6R transcription levels, after correcting for multiple testing. Thus, the molecular mechanism

underlying the association between rs12083537 and sIL-6R levels remains to be elucidated.

Gene expression studies in individual immune cell types or upon allergen stimulation may

help characterise the function of this variant in greater detail.

Interestingly, we observed that the rs4129267:T allele that is associated with increased sIL-6R

protein levels21 was associated with decreased IL6R mRNA levels, which may appear

contradicting. The Illumina probe for which we observed an association with rs4129267 maps

to exon 9, which is skipped in the main differentially spliced IL6R isoform. Therefore, this



probe measures the levels of the full length isoform, which necessarily decrease if splicing of

exon 9 increases. Given that the rs4129267:T allele, or an allele associated with it (e.g.

rs2228145:C), strongly increases the splicing of exon 9,22 it is in fact not surprising that

consequently this allele is associated with decreased mRNA levels of the full length isoform.

Unlike our results, R. Ferreira22 did not observe a significant effect of rs2228145 on the levels

of the full length isoform. However, as the authors noted, splicing of exon 9 is a rare event.

Therefore, the lack of association in that study likely reflected the low power provided by a

small sample size (N = 88) to detect small differences in the levels of the full length isoform

between genotype classes.

Lastly, we found rs12083537 to be significantly associated with asthma risk. Based on our

analysis, each rs12083537:A allele increased sIL-6R serum levels by 2.4 ng/ml and increased

asthma risk by 1.04-fold. For comparison, each rs4129267:T allele increased sIL-6R serum

levels by 19.7 ng/ml and increases asthma risk by 1.09-fold.17 The association between

rs12083537 and asthma risk was consistent across the three cohorts analysed but only

marginally statistically significant in the overall analysis. Replication of our results by well

powered studies is therefore warranted; over 23 000 cases and 23 000 controls (or, for

example, 18 000 cases and 36 000 controls) are required to achieve 80% power to detect (α =

0.05) the effect we observed.

In summary, our study demonstrates that at least two independent genetic variants influence

sIL-6R serum levels. Consequently, pharmacogenetic studies of clinical response to

tocilizumab, an anti-IL-6R monoclonal antibody approved to treat rheumatoid arthritis34 and

suggested to treat asthma,16, 17 should consider the effects of not only the major genetic

determinant of sIL-6R levels (rs2228145) but also of other confirmed regulatory variants such

as rs12083537. For this purpose, multi-SNP scores that summarise an individual's combined

genetic risk of having high sIL-6R levels may prove useful.



Acknowledgements

I would like to thank all those without whom I would not have been able to complete this

dissertation. First and foremost, I would like to express my deepest gratitude to my supervisor

Dr. Manuel Ferreira. For the opportunity to work on this project, for everything he taught me,

for his excellent guidance and for all the help in writing this manuscript. I would also like to

thank Prof. Dr. Manuel Carmo Gomes for all the help provided to the completion of this

dissertation. I thank my family for all the support and encouragement that brought me here.

Finally, I would like to express my gratitude to Prof. Dr. Grant Montgomery, for the

opportunity to work in his group, and I would like to thank all the group members, especially

Lisa Bain, for all the patience and caring while guiding me in the laboratory.



References

1. Murphy DM, O'Byrne PM. Recent advances in the pathophysiology of asthma. Chest 2010;

137(6): 1417-26.

2. Doganci A, Sauer K, Karwot R, Finotto S. Pathological role of IL-6 in the experimental

allergic bronchial asthma in mice. Clin Rev Allergy Immunol 2005; 28(3): 257-70.

3. Neveu WA, Allard JL, Raymond DM, Bourassa LM, Burns SM, Bunn JY et al. Elevation of

IL-6 in the allergic asthmatic airway is independent of inflammation but associates with loss

of central airway function. Respir Res 2010; 11: 28.

4. Rincon M, Irvin CG. Role of IL-6 in asthma and other inflammatory pulmonary diseases. Int J

Biol Sci 2012; 8(9): 1281-90.

5. Wang J, Homer RJ, Chen Q, Elias JA. Endogenous and exogenous IL-6 inhibit aeroallergen-

induced Th2 inflammation. J Immunol 2000; 165(7): 4051-61.

6. Hibi M, Murakami M, Saito M, Hirano T, Taga T, Kishimoto T. Molecular cloning and

expression of an IL-6 signal transducer, gp130. Cell 1990; 63(6): 1149-57.

7. Taga T, Hibi M, Hirata Y, Yamasaki K, Yasukawa K, Matsuda T et al. Interleukin-6 triggers

the association of its receptor with a possible signal transducer, gp130. Cell 1989; 58(3): 573-

81.

8. Chalaris A, Rabe B, Paliga K, Lange H, Laskay T, Fielding CA et al. Apoptosis is a natural

stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of

neutrophils. Blood 2007; 110(6): 1748-55.

9. Oberg HH, Wesch D, Grussel S, Rose-John S, Kabelitz D. Differential expression of CD126

and CD130 mediates different STAT-3 phosphorylation in CD4+CD25- and CD25high

regulatory T cells. Int Immunol 2006; 18(4): 555-63.

10. Horiuchi S, Koyanagi Y, Zhou Y, Miyamoto H, Tanaka Y, Waki M et al. Soluble interleukin-

6 receptors released from T cell or granulocyte/macrophage cell lines and human peripheral



blood mononuclear cells are generated through an alternative splicing mechanism. Eur J

Immunol 1994; 24(8): 1945-8.

11. Lust JA, Donovan KA, Kline MP, Greipp PR, Kyle RA, Maihle NJ. Isolation of an mRNA

encoding a soluble form of the human interleukin-6 receptor. Cytokine 1992; 4(2): 96-100.

12. Mullberg J, Schooltink H, Stoyan T, Gunther M, Graeve L, Buse G et al. The soluble

interleukin-6 receptor is generated by shedding. Eur J Immunol 1993; 23(2): 473-80.

13. Rose-John S, Heinrich PC. Soluble receptors for cytokines and growth factors: generation and

biological function. Biochem J 1994; 300 ( Pt 2): 281-90.

14. Galicia JC, Tai H, Komatsu Y, Shimada Y, Akazawa K, Yoshie H. Polymorphisms in the IL-6

receptor (IL-6R) gene: strong evidence that serum levels of soluble IL-6R are genetically

influenced. Genes Immun 2004; 5(6): 513-6.

15. Mullberg J, Oberthur W, Lottspeich F, Mehl E, Dittrich E, Graeve L et al. The soluble human

IL-6 receptor. Mutational characterization of the proteolytic cleavage site. J Immunol 1994;

152(10): 4958-68.

16. Doganci A, Eigenbrod T, Krug N, De Sanctis GT, Hausding M, Erpenbeck VJ et al. The IL-

6R alpha chain controls lung CD4+CD25+ Treg development and function during allergic

airway inflammation in vivo. J Clin Invest 2005; 115(2): 313-25.

17. Ferreira MA, Matheson MC, Duffy DL, Marks GB, Hui J, Le Souef P et al. Identification of

IL6R and chromosome 11q13.5 as risk loci for asthma. Lancet 2011; 378(9795): 1006-14.

18. Rafiq S, Frayling TM, Murray A, Hurst A, Stevens K, Weedon MN et al. A common variant

of the interleukin 6 receptor (IL-6r) gene increases IL-6r and IL-6 levels, without other

inflammatory effects. Genes Immun 2007; 8(7): 552-9.

19. Raggi P, Su S, Karohl C, Veledar E, Rojas-Campos E, Vaccarino V. Heritability of renal

function and inflammatory markers in adult male twins. Am J Nephrol 2010; 32(4): 317-23.

20. Abecasis GR, Auton A, Brooks LD, DePristo MA, Durbin RM, Handsaker RE et al. An

integrated map of genetic variation from 1,092 human genomes. Nature 2012; 491(7422): 56-

65.



21. Melzer D, Perry JR, Hernandez D, Corsi AM, Stevens K, Rafferty I et al. A genome-wide

association study identifies protein quantitative trait loci (pQTLs). PLoS Genet 2008; 4(5):

e1000072.

22. Ferreira RC, Freitag DF, Cutler AJ, Howson JM, Rainbow DB, Smyth DJ et al. Functional

IL6R 358Ala Allele Impairs Classical IL-6 Receptor Signaling and Influences Risk of Diverse

Inflammatory Diseases. PLoS Genet 2013; 9(4): e1003444.

23. Dunham I, Kundaje A, Aldred SF, Collins PJ, Davis CA, Doyle F et al. An integrated

encyclopedia of DNA elements in the human genome. Nature 2012; 489(7414): 57-74.

24. Ferreira MA, O'Gorman L, Le Souef P, Burton PR, Toelle BG, Robertson CF et al. Variance

components analyses of multiple asthma traits in a large sample of Australian families

ascertained through a twin proband. Allergy 2006; 61(2): 245-53.

25. Powell JE, Henders AK, McRae AF, Caracella A, Smith S, Wright MJ et al. The Brisbane

Systems Genetics Study: genetical genomics meets complex trait genetics. PLoS One 2012;

7(4): e35430.

26. Zhu G, Montgomery GW, James MR, Trent JM, Hayward NK, Martin NG et al. A genome-

wide scan for naevus count: linkage to CDKN2A and to other chromosome regions. Eur J

Hum Genet 2007; 15(1): 94-102.

27. Boomsma DI, Willemsen G, Sullivan PF, Heutink P, Meijer P, Sondervan D et al. Genome-

wide association of major depression: description of samples for the GAIN Major Depressive

Disorder Study: NTR and NESDA biobank projects. Eur J Hum Genet 2008; 16(3): 335-42.

28. Willemsen G, Vink JM, Abdellaoui A, den Braber A, van Beek JH, Draisma HH et al. The

Adult Netherlands Twin Register: twenty-five years of survey and biological data collection.

Twin Res Hum Genet 2013; 16(1): 271-81.

29. Moffatt MF, Gut IG, Demenais F, Strachan DP, Bouzigon E, Heath S et al. A large-scale,

consortium-based genomewide association study of asthma. N Engl J Med 2010; 363(13):

1211-21.



30. Howie BN, Donnelly P, Marchini J. A flexible and accurate genotype imputation method for

the next generation of genome-wide association studies. PLoS Genet 2009; 5(6): e1000529.

31. Medland SE, Nyholt DR, Painter JN, McEvoy BP, McRae AF, Zhu G et al. Common variants

in the trichohyalin gene are associated with straight hair in Europeans. Am J Hum Genet 2009;

85(5): 750-5.

32. Li Y, Willer C, Sanna S, Abecasis G. Genotype imputation. Annu Rev Genomics Hum Genet

2009; 10: 387-406.

33. Li Y, Willer CJ, Ding J, Scheet P, Abecasis GR. MaCH: using sequence and genotype data to

estimate haplotypes and unobserved genotypes. Genet Epidemiol 2010; 34(8): 816-34.

34. Willer CJ, Li Y, Abecasis GR. METAL: fast and efficient meta-analysis of genomewide

association scans. Bioinformatics 2010; 26(17): 2190-1.

A new variant in the interleukin-6 receptor (IL-6R) gene increases gene expression and asthma risk.

Joana Allen Revez

Supervised by: Manuel Ferreira PhD Manuel Carmo Gomes PhD

Queensland Institute of Medical Research 2013

Molecular Biology and Genetics

Supplemental Data


Anexos S2

Supplementary Figure 1. Association between sIL-6R serum levels (after adjusting for

technical covariates) and rs4129267 genotype in the discovery cohort (N = 360). The

association was tested using linear regression; the figure shows the proportion of variation in

sIL-6R levels explained by rs4129267 (r2), the association P-value (p) and the corresponding

regression line.


technical covariates and the effects of rs4129267) and rs12083537 genotype in the discovery

cohort (N = 360). The association was tested using linear regression; the figure shows the

proportion of variation in sIL-6R levels explained by rs12083537 (r2), the association P-value

(p) and the corresponding regression line.


Anexos S3


technical covariates and the effects of rs4129267) and rs12083537 genotype in the replication

cohort (N = 354). The association was tested using linear regression; the figure shows the

proportion of variation in sIL-6R levels explained by rs12083537 (r2), the association P-value

(p) and the corresponding regression line.


Anexos S4

Supplementary Table 1. Demographics and clinical characteristics of 360 asthmatics

included in the cohort used to discover novel SNP associations with sIL-6R serum levels.

rs4129267 genotype CC CT TT All

N 112 170 78 360

Eczema (% yes, no, unknown) 44.6,55.4,0 40,59.4,0.6 35.9,64.1,0 40.6,59.2,0.3

Atopy (% SPT+, SPT-, unknown) 63.4,21.4,15.2 71.2,14.7,14.1 66.7,12.8,20.5 67.8,16.4,15.8

Asthma onset (% ≤16, >16, unknown) 51.8,17,31.2 62.4,9.4,28.2 57.7,11.5,30.8 58.1,12.2,29.7

IgE, SD (IU/mL) 128.4,4.1 162.3,4.3 147.8,4.1 148.3,4.2

Eosinophils, SD (x109/L) 0.31,0.3 0.34,0.34 0.31,0.25 0.32,0.31

Family history (% yes, no, unknown) 90.2,9.8,0 92.9,7.1,0 88.5,11.5,0 91.1,8.9,0

Age (mean, SD, range) 27,13.9,7-69 26,14.7,7-71 28,14.6,8-73 27,14.4,7-73

Sex (% female) 52.7 55.9 51.3 53.9

Smoker ever (% yes, no, unknown) 24.1,75.9,0 21.8,77.6,0.6 28.2,70.5,1.3 23.9,75.6,0.6

Smoker current (% yes, no, unknown) 14.3,38.4,47.3 6.5,52.9,40.6 12.8,47.4,39.7 10.3,47.2,42.5

Medication ever (% yes, no, unknown) 97.3,2.7,0 96.5,3.5,0 97.4,2.6,0 96.9,3.1,0

Medication current (% yes, no, unknown) 78.6,21.4,0 82.4,17.6,0 80.8,19.2,0 80.8,19.2,0

Steroids ever (% yes, no, unknown) 21.4,78.6,0 22.4,77.6,0 23.1,76.9,0 22.2,77.8,0

Steroids current (% yes, no, unknown) 40.2,35.7,24.1 50.6,24.7,24.7 39.7,29.5,30.8 45,29.2,25.8

Hospital ever (% yes, no, unknown) 23.2,74.1,2.7 29.4,66.5,4.1 29.5,66.7,3.8 27.5,68.9,3.6

sIL-6R levels, SD (ng/mL) 54.99,19.92 74.17,25.66 93.99,28.68 72.5,28.4


Anexos S5

Supplementary Table 2. Independent SNPs (r2 < 0.1) with strongest evidence for association

with sIL-6R serum levels in the discovery cohort (N = 360).

SNP Effect

allele Effect allele

frequency Variance

explained, r2 Beta SE

Uncorrected P-value

Corrected P-value*

After adjustment for rs4129267 rs12083537 G 0.23 0.031 -0.259 0.073 0.0005 0.0496

rs138227751 A 0.07 0.018 0.322 0.116 0.0058 0.3827 rs115224285 T 0.01 0.017 0.646 0.244 0.0085 0.4899 rs191793127 T 0.03 0.011 -0.712 0.321 0.0273 0.8489 rs72698116 G 0.01 0.008 -0.745 0.370 0.0449 0.9490

rs147763778 A 0.05 0.008 0.339 0.170 0.0472 0.9551 After adjustment for rs4129267 and rs12083537

rs116059394 G 0.05 0.013 -0.386 0.160 0.0161 0.6947 rs138227751 A 0.07 0.011 0.255 0.114 0.0263 0.8391 rs115224285 T 0.01 0.009 0.506 0.241 0.0364 0.9139

* Empirical P-values corrected for the total number of SNPs tested (N = 471) through 100,000 permutations.

Supplementary Table 3. Demographics and clinical characteristics of 354 asthmatics

included in the cohort used to replicate SNP associations with sIL-6R serum levels.

rs4129267 genotype CC CT TT All

N 136 160 58 354

Age (mean, SD, range) 49,17.57,13-87 50,16.08,10-86 52,15.14,9-90 50,16.51,9-90

Sex (% female) 63.2 68.8 74.1 67.5

Hay fever (% yes, no, unknown) 61.8,36,2.2 55.6,42.5,1.9 60.3,39.7,0 58.8,39.5,1.7

Eczema (% yes, no, unknown) 34.6,64.7,0.7 36.9,61.9,1.2 37.9,62.1,0 36.2,63,0.8

Family history (% yes, no, unknown) 64.7,31.6,3.7 68.8,30.6,0.6 72.4,24.1,3.4 67.8,29.9,2.3

Asthma onset (% ≤16, >16, unknown) 60.3,33.1,6.6 59.4,30.6,10 56.9,34.5,8.6 59.3,32.2,8.5

sIL-6R levels, SD (ng/mL) 49.68,13.04 71.78,16.27 88.25,20.92 65.99,21.31


Anexos S6

Supplementary Table 4. Association results between rs12083537 (effect allele: G) and IL6R

mRNA levels measured by 32 individual Affymetrix probes, using RNA extracted from

whole blood (N = 5 191).

Probe Locus Start, bp End, bp Sequence P-value T

11741958_a_at;264;163 Exon 5 154407569 154407594 TACAGACTACGGTTTGAGCTCAGAT 0.4850 0.70 11741958_a_at;314;329 Exon 5 154407576 154407601 TACGGTTTGAGCTCAGATATCGGGC 0.1068 1.61 11736510_a_at;323;134 Exon 7 154420604 154420629 CAGGAGTCCTCCAGCTGAGAACGAG 0.7989 0.25 11741958_a_at;582;132 Exon 7 154420604 154420629 CAGGAGTCCTCCAGCTGAGAACGAG 0.8337 0.21 11736510_a_at;201;497 Exon 7 154420613 154420638 TCCAGCTGAGAACGAGGTGTCCACC 0.3149 -1.01 11741958_a_at;202;497 Exon 7 154420613 154420638 TCCAGCTGAGAACGAGGTGTCCACC 0.8479 -0.19 11736510_a_at;484;717 Exon 8 154422428 154422453 GATTCTGCAAATGCGACAAGCCTCC 0.6635 0.44 11741958_a_at;483;717 Exon 8 154422428 154422453 GATTCTGCAAATGCGACAAGCCTCC 0.8186 0.23 11736510_a_at;609;718 3'-end 154437649 154437674 AAGACAAGCATGCATCCGCCGTACT 0.4188 -0.81 11741958_a_at;610;718 3'-end 154437649 154437674 AAGACAAGCATGCATCCGCCGTACT 0.6768 0.42 11741958_a_at;705;156 3'-end 154437682 154437707 CAGCTGGTCCCGGAGAGGCCTCGAC 0.4211 -0.80 11736510_a_at;58;615 3'-end 154437760 154437785 GGGTCTGACAATACCTCGAGCCACA 0.6003 -0.52

11736510_a_at;659;168 3'-end 154437779 154437804 GCCACAACCGACCAGATGCCAGGGA 0.9457 0.07 11736510_a_at;390;362 3'-end 154437807 154437832 ACGGAGCCCTTATGACATCAGCAAT 0.8324 -0.21 11736510_a_at;46;386 3'-end 154437834 154437859 AGACTACTTCTTCCCCAGATAGCTG 0.8752 0.16 11741959_x_at;218;13 3'-end 154438769 154438794 ATCAAAACGGTTTTACTGCAGCTTT 0.6968 0.39

11741959_x_at;586;417 3'-end 154438780 154438805 TTTACTGCAGCTTTGTTTGTTGTCA 0.5539 0.59 11741959_x_at;7;323 3'-end 154438789 154438814 GCTTTGTTTGTTGTCAGCTGAACCT 0.1111 1.59

11741959_x_at;109;540 3'-end 154438797 154438822 TGTTGTCAGCTGAACCTGGGTAACT 0.8790 -0.15 11741959_x_at;505;200 3'-end 154438903 154438928 CTGCTGACTGTTTTCTCTTGAGAGG 0.4423 -0.77 11741959_x_at;548;21 3'-end 154438916 154438941 TCTCTTGAGAGGGTGGAATATCCAA 0.5571 -0.59

11741959_x_at;361;694 3'-end 154438932 154438957 AATATCCAATATTCGCTGTGTCAGC 0.4901 0.69 11741959_x_at;267;582 3'-end 154438945 154438970 CGCTGTGTCAGCATAGAAGTAACTT 0.9922 -0.01 11741959_x_at;260;360 3'-end 154438986 154439011 AGCACCATAACTTTGTTTAGCCCAA 0.3022 1.03 11736509_x_at;495;603 3'-end 154439660 154439685 GTTCCTTGAGTTGATTCAGCTCTGC 0.2138 1.24 11736509_x_at;553;369 3'-end 154439733 154439758 ACTTCAGCTGACTTTTCTGTCCGAG 0.0031 2.96 11736509_x_at;545;104 3'-end 154439782 154439807 GGTTACCCAGTTAGCTCTCAAGTTA 0.9530 0.06 11736509_x_at;551;225 3'-end 154439795 154439820 GCTCTCAAGTTATCAGGGTATTCCA 0.5074 0.66 11736509_x_at;308;15 3'-end 154439837 154439862 AAATCAGCCGTGTAACCATGGACCC 0.4184 -0.81

11736509_x_at;372;285 3'-end 154439953 154439978 CCATGTTTTGTTTACGGTTTTCCAG 0.5067 -0.66 11736509_x_at;61;280 3'-end 154439990 154440015 ACTGTCTTCAGTAAGCCGTGATTTT 0.4114 -0.82

11736509_x_at;40;550 3'-end 154440035 154440060 GATTTTAGACCCTATTGCTGCTTGA 0.9373 -0.08


Anexos S7

Supplementary Table 5. DNA sequence targeted by the two Illumina probes used to measure

IL6R transcription levels in whole-blood (N = 851).

Probe Locus Sequence

ILMN_1754753 3'-end GACCCTATTGCTGCTTGAGGCAACTCATCTTAGGTTGGCAAAAAGGCAGG

ILMN_1696394 Exon 9 TCTTCAGTACCACTGCCCACATTCCTGGTTGCTGGAGGGAGCCTGGCCTT

Supplementary Table 6. Primers used to amplify the rs4129267 and rs12083537 SNPs in the

replication cohort (N = 354) using Sequenom MassARRAY.

SNP Primer Sequence

rs4129267 Reverse ACGTTGGATGTGTGGTCTAGTCCCTACTTG

Forward ACGTTGGATGACTTGCTCAGCTTGGAGTGG

Extension TGAGTGGGGTCAATTCT

rs12083537 Reverse ACGTTGGATGTCTACAAATACCCAGTGAGG

Forward ACGTTGGATGCAGGCACACTGATCCTGAC

Extension TCCCAATTAGGGGAGTATTTGTTTACCC

Universidade de Lisboa -...

Documents

Transcript of Universidade de Lisboa -...