Unit 3: genetics

Vocabulary

1. Genes: a segment of a chromosome that contains DNA which codes for a visual trait.

Trait: expressed characteristic.

Locus: the location of a gene on a chromosome.

Alleles: opposite pairs of genes – one from mom and one from dad; assigned letters in pairs; may be homozygous or heterozygous (depends on the parents and on chance), and dominant or recessive (depends on type). o Dominant: a trait that only needs dominant one of its alleles present to be expressed.

Represented by an uppercase letter (ex., tall plant = T). o Recessive: a trait that needs both recessive alleles present to be expressed. It is

represented by a lowercase letter (ex., short plant = t). o Homozygous: when both alleles of a trait are the same - both recessive (tt) or both

dominant (TT). In this case, a recessive trait would be expressed if both alleles were lowercase (ex., pp). Also, if both were uppercase, a dominant trait could be expressed. If both alleles are dominant and the trait of that locus is only expressed recessively, then it won’t be expressed or passed on to offspring. Vice versa, also won’t be expressed or handed down to offspring.

o Heterozygous: when the two alleles are opposite, with one dominant and one recessive. If the trait of the locus is recessive, it will not be expressed but CAN be passed to offspring, and if it’s dominant will be expressed in both the organism and the offspring.

o Genotype: the genetic makeup of organisms; the alleles an organism possesses. o Phenotype: the expression of a trait of an organism; the physical appearance as a result of

the genotype. o Generations: when crossing genotypes, we can calculate the probability of the genotypes of

different generations of offspring, starting with a specific parent generation P1 Generation: the parent generation F1 Generation: the filial, or offspring, generation F2 Generation: the generation that is the filial, or offspring, of the F1 generation.

2. Punnett square: a diagram that is used to predict an outcome of a particular cross or breeding experiment. There are three steps to make a Punnett square:

I. Figure out the genotype of the organisms being crossed. (ex. Two flowers are crossed; one is tall, yellow and heterozygous, while the other is short, white and homozygous. Yellow is dominant over white. -> The only possible phenotypes are TtYy for the first and ttyy for the second.)

II. FOIL the individual genotypes for all possible combinations. FOIL is a series of multiplications of the Firsts, Outsides, Insides, then Lasts.

T t Y y = TY, Ty, tY, ty t t y y = ty, ty, ty, ty

III. Make a table with the possibilities for each genotype each side. Match the letters to see the new possible genotypes. From the genotypes we can figure out the phenotypes, as extended as an example to the right of the Punnett Square.

ty ty ty ty Phenotypes:

TY TtYy TtYy TtYy TtYy Tall, Yellow

Ty Ttyy Ttyy Ttyy Ttyy Tall, White

tY ttYy ttYy ttYy ttYy Short, Yellow

ty ttyy ttyy ttyy ttyy Short, White

3. Mendelian Genetics: laws of genetics based on the lifelong studies of Gregor Mendel in the 19th century. He developed three laws that are still used today: the law of dominance, the law of segregation, and the law of independent assortments.

o Law of Dominance: a law stating that a cross of parents that are pure [homozygous] for

opposite traits will only have one of those traits represented in the next generation. The offspring will be hybrid for the trait (heterozygous). One trait masks the effect of another trait. This law is only applicable for single traits, as in a monohybrid cross.

Monohybrid cross: the crossing of two genotypes (homozygous or heterozygous) when only one trait is being studied. Example: T = tall, t = short, tall is dominant, short is recessive.

P1 TT (Homozygous Tall) tt (Homozygous Short)

F1 t t

T Tt Tt

T Tt Tt

o Law of Segregation: law stating that alleles can segregate and recombine in two generations. Characteristics hidden by dominant alleles in the F1 generation (see example from the Law of Dominance) can come back in the F2 generation. It is because of the outcome of the F2 generation that Mendel realized that there must be dominant alleles overshadowing recessive ones.

F1 Tt (Heterozygous Tall) Tt (Heterozygous Tall)

All are heterozygous

and tall.

F2 T t

T TT Tt

t Tt tt

o Law of Independent Assortment: law stating that traits can segregate and recombine independently of other traits in just one generation. Because they can assort themselves independently, we FOIL the genotypes to include all possible pairings. This can be observed when two parents (of a known genotype) are crossed as we follow two characteristics – this is called a dihybrid cross. An example is in Vocab #2.

4. Test cross: a monohybrid cross with the purpose of learning whether or not an organism’s genotype is homozygous or heterozygous. We do this by crossing the organism in question with another expressing a recessive trait. If half of the offspring show the recessive trait, the organism in question is heterozygous. If none show the recessive trait, then it is homozygous, as demonstrated in the Punnett squares below. *We have two plants. One is short (recessive trait), and the other is tall (dominant trait). The first must be homozygous for it to show its recessive trait. All we know about the genotype of the second is that there must be at least one dominant allele because it shows the dominant trait – it could have one OR two dominant alleles.

P1 Must be tt Could be Tt OR TT

*Now we cross the plants (in real life – this cannot be answered without being given the results of the cross). We will either get Results 1 or Results 2, which will determine the original genotype of the P1 generation.

Short (Recessive) = tt Tall (one in Question) = Tt or TT Tt x tt TT x tt

Homozygous Tall (1) Heterozygous Tall (2) Homozygous Short (1)

Ratio of Short to Tall = 1:3

t t

T Tt Tt

t tt tt

t t

T Tt Tt

T Tt Tt

½ Tall ½ Short

*So if plants had that

result, the genotype in

question was

heterozygous.

All Tall.

*So if plants had that

result, the genotype in

question was

homozygous.

Example Test Cross

5. Autosomes: chromosomes that are not related to gender. Humans have 22 of them. 6. Sex chromosomes: chromosomes that determine gender. The two types are X and Y. If a person has both, he is male. If a person has two X’s, she is female. Below are some mutations affecting the sex chromosomes. - XXX: Triple X syndrome is a form of chromosomal variation characterized by the presence of an extra X chromosome in each cell of a human female. - XYY: syndrome is an aneuploidy (abnormal number) of the sex chromosomes in which a human male receives an extra Y chromosome - XXY: Klinefelter's syndrome: syndrome in males that is characterized by small testes and long legs and enlarged breasts and reduced sperm production and mental retardation - X: Women with Turner syndrome typically have one X chromosome instead of the usual two sex chromosomes. Turner syndrome is the only full monosomy that is seen in humans—all other cases of full monosomy are lethal and the individual will not survive development.

7. Carrier: any allele that is not expressed for whatever reason (i.e., being recessive, sex linked in women) can be handed down to offspring. These alleles are called carries, the person with them being a carrier. This is why children with perfectly healthy family histories can have genetic diseases from earlier generations. Example: *dd = Disease Dd = Carriers DD = Normal Nan Pop Nan Pop Dd DD Dd Dd Mom Dad Dd Dd Sick child dd 8. Sutton: an American geneticist and physician whose most significant contribution to present-day biology was his theory that the Mendelian laws of inheritance could be applied to chromosomes at the cellular level of living organisms. 9. Levene: discovered the nitrogenous bases of DNA. 10. Griffith: managed to induce harmless bacteria into becoming harmful by experimenting with nitrogenous bases – supports theory of DNA. 11. Avery/MacLeod/McCarty: three scientists that proved Griffith’s theory of DNA being the genetic material, excluding the previously accepted protein. 12. Hershey and Chase: did the blender experiment which gave 100% solid proof that DNA was the genetic material in viruses.

13. Watson and Crick: discovered the double helix structure of DNA. 14. DNA (deoxyribonucleic acid): as briefly discussed in Part 1 (#17), DNA is a genetic blueprint for cells. DNA’s role is to direct the manufacturing of proteins, which regulate all functions of a living organism.

Double Helix: the shape of a DNA molecule, discovered in 1956 by Watson and Crick. A helix is shaped like a stretched spring; this double helix is when two helices twist parallel to each other, joined by “bars”; just like a long, stretched ladder that is twisted.

Nucleotides: the “bars” that link the helices of DNA; the order of sequences of nucleotides determine genetic information; they contain a phosphate group, a 5-carbon sugar, and a nitrogenous base (base paired with another), all linked together by phosphodiester bonds.

o Phosphate group: a group with a center phosphate and 4 oxygen molecules.

o 5-Carbon sugar: a carbohydrate with five carbons in it; in DNA, deoxyribose is the sugar, whereas ribose is in the nucleotides of RNA.

o Nitrogenous bases: the “coding” molecules of DNA and RNA. In DNA, there are four nitrogenous bases (and each has another it will ALWAYS pair with from an opposite helix).

o Base pair: one of the pairs of

chemical bases joined by hydrogen

bonds that connect the

complementary strands of a DNA

molecule or of an RNA molecule

Adenine: purine (double-ringed); opposite thymine

Guanine: purine (double-ringed); opposite cytosine

Cytosine: pyrimidine (single-ringed); opposite guanine Thymine: pyrimidine (single-ringed); opposite adenine

o Phosphodiester bonds: bonds that join nucleotides together.

4. DNA Replication: DNA replicates itself into exact copies for cell reproduction. This task is completed by a number of enzymes:

Helicase: an enzyme that breaks the hydrogen bonds of DNA nucleotides, splitting the DNA’s helices.

DNA topoisomerase: an enzyme that keeps the split strands from tangling.

DNA polymerase: an enzyme that adds complementary nucleotides to the open DNA strands in order to replicate the DNA.

RNA primase: an enzyme that adds starter nucleotides to the S’ end of the split DNA to allow replication to occur. This happens because DNA nucleotides can only attach to a 3’ end, and the RNA molecules temporarily added here by this enzyme mimics the 3’ end.

Leading strand: the strand of split DNA that already has a 3’ end. Here, replication is

continuous.

Lagging strand: the strand of split DNA that has a 5’ end – it requires RNA primase, and is replicated in segments.

o Okazaki fragments: the fragments of replicated DNA on the lagging strand. o DNA ligase: an enzyme that joins the Okazaki fragments together.

Semi-conservative: DNA is semi-conservative because it does not create an entirely new molecule. Rather, it splits the molecule in half and fills in the missing space. The final product is half new and half of the original.

5. RNA (ribonucleic acid): a single strand of nucleotides attached to the 5-carbon sugar ribose. RNA differs from DNA not only in the structure (single strand versus double helix) and in the sugar (ribose versus deoxyribose) but also in one of the nucleotides – uracil (pyramidine single-ring nitrogen base) takes the place of thymine in RNA sequences as the new complement to adenine. There are three types of RNA:

mRNA (Messenger): copies and delivers information stored in DNA.

rRNA (Ribosomal): builds ribosomes (the sites of protein synthesis [Part 2] in the nucleolus).

tRNA (Transfer): transports amino acids (the building blocks of proteins) to mRNA and ribosomes for protein synthesis. They have an anti-codon of nucleotides in order to match mRNA in the right order to build a protein.

mRNA

rRNA

tRNA

6. Protein synthesis: the building of proteins; there are three steps – transcription, RNA processing, and translation.

Transcription: the copying of a specific part of the genetic code from DNA to mRNA. Takes place in the nucleus. There are three steps: initiation, elongation, and termination.

o Initiation: DNA is split by the helicase enzyme, and the promoter (a sequence of DNA that marks where transcription should begin) is found on the sense strand (strand of DNA being used as a template) while the antisense strand (DNA strand not being used) lies dormant.

o Elongation: the addition of RNA nucleotides to each other to form a strand. An RNA polymerase enzyme is used to attach these nucleotides together – for every adenine RNA adds uracil, for every thymine adds adenine, for every guanine a cytosine, and for every cytosine a guanine.

o Termination: similar to a promoter, there is a short series of nucleotides that code for the elongation to cease, release the RNA, and return the DNA to its double helix formation.

RNA processing: the subtraction and addition of substances to mRNA in order to regulate what sequences are to be translated. This takes place in the nucleus.

o Splicing: process (using an RNA-protein complex called a spliceosome) that removes introns (sequences not wanted for translation) and joins exons (sequences left that are wanted for translation) together.

o Poly (A) tail: a molecule added to the 3’ end of the spliced RNA. o 5’ Cap: a molecule added to the 5’ end of the spliced RNA.

Translation: the final mRNA after processing finds a ribosome to begin an amino acid. Every three bases on this mRNA is called a codon, and every codon matches an anticodon (with the relationships between the nucleotides); anticodons are found at the bottom of every tRNA which carry amino acids. This is how polypeptides are built, as specific anticodons match specific amino acids. It’s important to note that ribosomes have three binding sites: A (attachment) site, P (polypeptide) site, and E (exit) site. There are three steps to translation (similar to transcription): initiation, elongation, and termination.

o Initiation: an initiation tRNA with anti-codon U-A-C attaches to the mRNA sequence A-U-G in the A site to commence the movement of the mRNA through the ribosome. The amino acid attached to this tRNA in order to start the building of the amino acid is methionine.

o Elongation: as the first tRNA moves to the P site, another tRNA joins at the A site to match another codon for a specific amino acid joining that amino acid. The system then continues to slide to allow the joining of more tRNA to the A site. As they enter the E site, the tRNAs disconnect from the ribosome and leave to pick up more amino acids.

o Termination: once the polypeptide is complete, a stop codon (code of U-A-A, U-A-G or U-G-A) slides into the A site, causing the ribosome to break apart and the polypeptide is released.

15. Extended genetics: Mendel’s theories only apply to certain characteristics, such as the ones he studied. Science has advanced to explain more complicated types of inheritance.

Codominance (multiple alleles): when more than one allele can be expressed at the same time without blending at equal expression. The best example is blood types such as AB (IAIB). In blood, i (type O) is recessive and is overshadowed by both dominant types, IA and IB. But because type A and B are equal, they are expressed simultaneously when together.

Ex., Genotype Phenotype IAi Type A IBi Type B IAIB Type AB ii Type O IAIA Type A IBIB Type B

Incomplete dominance: the blending of traits when neither trait overshadows the other.

almost the same thing as Codominance, the only difference is how they’re expressed. Work

them out the same way. It still has two different dominant alleles expressed at the same time,

but the difference is that the phenotype (what you can see different) looks more like its

blending in incomplete dominance, rather than being totally separated in Codominance.

Example:

Polygenetic inheritance: when a trait is affected by multiple genes; multiple genotypes create one phenotype.

Epistasis: when a gene at one locus can affect the expression of a gene at another locus (ex., mouse fur color is controlled by two loci, one with alleles B (black) or b (brown), and the other with C (dominant no affect) or c (recessive for albino). If the latter is cc, it will overshadow the other locus (whether it’s BB, Bb, or bb) and the mouse will be albino.

Pleiotropy: when one gene (just two alleles) shows multiple phenotypes. An example of this would be sickle-cell disease because it has so many symptoms from one pair of alleles.

Linked genes: when two genes for different characteristics tend to stay grouped together, unable to break apart even in crossing over. These traits tend to be passed on together (ex., flower color and pollen shape are generally together). The probability rule of a dihybrid cross does not apply to these genes.

Recombination mapping: we can figure out a sequence of linked genes, how far they are from one another, and how frequently they recombine using recombination mapping. Given the frequency between multiple genes, we can find distance and order of the genes.

Example: Gene A and C recombination frequency = 24%

Gene A and B recombination frequency = 15% Gene B and C recombination frequency = 9% A (15 units) B (9 units) C 15% 9% _____________________________________

24% (24 units total)

We can also find a missing frequency: Example:

Gene A and C recombination frequency = 21% Gene A and B recombination frequency = Gene B and C recombination frequency = 16% It is simply the difference: 21 – 16 = 5% A (16 units) B (5 units) C 16% 5% _____________________________________

21% (21 units total)

*NOTE: Letters will rarely be in alphabetical order. You may be given percentages and asked for the order or given the order and asked for the most likely percentage. Example 1: Gene D – B = 50% Gene D – A = 30% Gene C – B = 5%

50 – 30 – 5 = 15 30% 15% 5% ________________________________________

D A C B 50%

Order is DACB.

Example 2: If the order of a sequence is CADB and from A – B is 30%, what is most likely the frequency of C-B?

a) 10% b) 5% c) 20%

d) 40% (The only one greater distance than 30%)

Sex-linked genes: genes that are carried on chromosome 23 (sex chromosomes). Some traits carried here are haemophilia (inability to clot blood) and color blindness (inability to identify colors). Most sex-linked traits are carried on the X chromosome (unless otherwise stated). Sex linked traits are similar to recessive traits in females – one defective X will be masked by her other X. In other words, a female must be homologous to a sex-linked defect in order for it to express. However, in males, just one defective X chromosome will always be expressed because there no other X chromosome to mask it.

o Barr Body: an inactive X-chromosome that is dark and condensed in females. It is inactivated during embryonic development and remains inactive in all cells of an adult woman EXCEPT in sex cells. Although it is inactive, it is still replicated in cellular reproduction.

16. Mutations: an unintentional change in the genetic code. There are two types: substitutions and rearrangements.

Base substitution: when one base is in the place of another.

o Nonsense: terminates protein synthesis early.

o Missense: produces the wrong amino acids in protein synthesis.

o Silent: no visible effect.

Gene Rearrangements: sequences that have deletions, insertions, duplications, inversions, translocations, and/or disjunction. o Deletion: loss of a gene, multiple genes, or a single base. o Insertion: addition of a gene, multiple genes or a single base. o Duplications: caused by unequal crossing over (Part 6), genes can

be copied more than once by accident. o Inversion: when the orientation of chromosomal regions change. o Translocation: when part of a chromosome breaks off and rejoins

somewhere else on itself, or onto another chromosome. The segments of DNA that can rejoin in other areas are called transposons and are, fortunately, easily repaired by special enzymes.

o Nondisjunction: having one too many or one too few of a specific

type of chromosome. The effects of this are severe in a human.

Monosomy: only one chromosome where there should be

two.

Trisomy: three chromosomes where there should be two.

17. Mutation Based Disorders: disorders that are caused by mutations in an individual, rather than being passed down through generations.

Down Syndrome: syndrome that results in a flat face and short stature and mental retardation; it happens in both genders, and is a result of nondisjunction of the 21st chromosome (three chromosomes).

Turner Syndrome: syndrome that results in malformed genitals, sterility, and a stocky stature; it can happen to girls, and is a result of her only having one X chromosome, and no other sex chromosome (X).

Klinefelter Syndrome: syndrome that results in a male with many female characteristics (ie. May have ovaries as well as testes, may develop breasts, my never develop a deep voice, etc.); can happen in boys, and is a result of having an extra X chromosome (XXY).

Features of Down’s Syndrome

Jacob’s Syndrome: syndrome that results in male speech and hearing problems; can happen in boys, and is a result of having an extra Y chromosome (XYY).

18. Genetically Inherited Diseases: diseases that are passed down through generations, rather than mutated in an individual.

Tay-Sachs Disease: an fatal inherited disorder caused by the absence of a vital enzyme, results in the destruction of the nervous system; there currently is no cure; at first development, there is no sign of the disease, however the disease becomes relentless after a few months.

Phenylketonuria (PKU): the absence or deficiency of an enzyme that is responsible for processing the essential amino acid phenylalanine. When this enzyme is deficient, phenylalanine abnormally accumulates in the blood which is toxic to brain tissue; the only cure is to change your diet to not include any phenylalanine.

Sickle Cell Anemia: an autosomal recessive disease cause by one point mutation. It results in the abnormal structure of the bloods hemoglobin, causing them to become sickle shaped (stretched and pinched). White blood cells then attack the hemoglobin, causing pain and potentially organ damage.

Progeria: syndrome that causes accelerated aging. It is believed (but not proven) to be dominant, and is a defect in DNA repair. Most do not live past ten years.

Huntington’s Disease: dominant disease that leads to damage of the nerve cells in the nervous system, particularly the brain. The disease is fatal, it caused by a defect on chromosome 4, and it does not usually develop until after age 30.

19. Genetic Technology: technology can interfere with natural genetics in positive ways, both in medicine and forensics.

Amniocentesis: sampling of amniotic fluid using a hollow needle inserted into the uterus, to screen for developmental abnormalities in a fetus’ genome.

Chorionic Villus Sampling (CVS): test made in early pregnancy to detect congenital abnormalities in the fetus. A tiny tissue sample is taken from the villi of the chorion, which forms the fetal part of the placenta.

Fetoscopy: an endoscopic procedure during pregnancy to allow access to the fetus, the amniotic cavity, the umbilical cord, and the fetal side of the placenta.

Microarrays: grid of DNA segments of known sequence that is used to test and map DNA fragments, antibodies, or proteins.

Karyotype: number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

Bacterial Technology: bacteria are used in gene

technology by cutting their rings of DNA (called plasmids) at specific points using restriction enzymes. Once they are cut, we are left with DNA fragments. Here they can insert the same type of DNA fragment from another organism into the now open space using DNA Ligase, allowing it to integrate with the bacterial DNA. This new DNA is called recombinant DNA. This process can be used for many purposes, such as mass replication, medical therapy, cloning, etc.

o Genetic Screening: the testing of an individual for the presence or absence of a gene.

o Genetic markers: known pieces of DNA sequences that a near a gene of interest; it is here that restriction enzymes cut.

o Gene probe: a fragment of DNA used to detect the presence of specific nucleotide sequences i n other DNA or RNA molecules.

o Gene therapy: the replacement of defective genes; one method is to remove white blood cells or bone marrow cells and inserting the normal gene for the chromosome using a virus or bacteria; the hope is that, once these cells are reinserted into the body, they will replicate and the normal phenotype will be expressed.

Polymerase Chain Reaction: another way to replicate DNA that does not involve bacteria; DNA is heated and cooled in a tube, and all the necessary enzymes and nucleotides for DNA replication are added; the heating and cooling facilitates the reactions necessary for replication. This is often used in forensics so there are large amounts of DNA in storage, even if they only collected a very small sample.

Gel Electrophoresis: the separation of fragmented pieces of DNA according to size; they are ordered by placing them in an electrical field – the lightest sequences being pulled the farthest. They are dyed to we can follow their path, creating a genetic fingerprint. If this process is repeated three times with different restriction enzymes, it is guaranteed that they are the sequences of one specific person.

20. The Human Genome Project: an international scientific research project with a primary goal to determine the sequence of chemical base pairs which make up DNA and to identify and map the approximately 20,000–25,000 genes of the human genome from both a physical and functional standpoint. 21. Genetically Modified/Engineered Organisms (GMO or GEO): an organism whose genetic material

has been altered using genetic engineering techniques. An example of a GMO is a corn variety that was engineered to be more disease resistant. Although it was resistant, it had a side effect of the pollen becoming toxic to the monarch butterfly, causing thousands of them to die. GMO can be useful and harmful!

22. Clones: genetically identical organisms; this was succeeded in a large organism with Dolly the sheep by splitting basically developed embryos into two, and then implanting them into surrogate mothers. This process is far from perfect, as Dolly died young as she aged quickly.

23. Stem Cells: undifferentiated cell of a multicellular organism that is capable of giving rise to indefinitely more cells of the same type. These cells can be multiplied through cloning and used in medical treatments.

Adult Stem Cells: can mainly become tissue based cells; they do not replicate easily and are not of much use to a patient.

Embryonic Stem Cells: can become all cell types; are extremely helpful as they replicate easily; this is why many parents are harvesting and storing their children’s stem cells, in case they ever need them in the future.

Important Points You must be able to code DNA into an amino acid sequence using a chart like the one below:

EXAMPLE: What is the amino acid sequence of a strand of DNA reading: TACGGGTTTGGGCTCAAAATT?

DNA SEQUENCE (Divide into triplets)

TAC GGG TTT GGG CTC AAA AAT

First, you must code the DNA into RNA with their complimentary base pairs.

RNA SEQUENCE

AUG CCC AAA CCC GAG UUU UUA

Then, you must use the chart to find those RNA sequences, and write their corresponding amino acids.

AMINO ACID SEQUENCE

Methionine (START)

Proline Lysine Proline Glutamate Phenylalanine STOP

The amino acid sequence is: Methionine(START)-Proline-Lysine-Proline-Glutamate-Phenylalanine-STOP

*You may also be asked to explain what is happening in a particular mutation on a sequence. You must then code first for the original sequence, then for the mutated sequence and compare their amino acid chains. For example, below is a mutation to the above original example of DNA: EXAMPLE: Substitute the third T of the third triplet with C. What type of mutation is this, and what change does it cause? We already have the final amino acid code for the original sequence:

ORIGINAL AMINO ACID SEQUENCE

Methionine (START)

Proline Lysine Proline Glutamate Phenylalanine STOP

Now we must repeat the process with the new mutation:

MUTATED DNA SEQUENCE

TAC GGG TTC GGG CTC AAA AAT

First, you must code the DNA into RNA with their complimentary base pairs.

NEW RNA SEQUENCE

AUG CCC AAG CCC GAG UUU UUA

Then, you must use the chart to find those RNA sequences, and write their corresponding amino acids.

NEW AMINO ACID SEQUENCE

Methionine (START)

Proline Lysine Proline Glutamate Phenylalanine STOP

Compare the Old and New Sequence

OLD Methionine

(START) Proline Lysine Proline Glutamate Phenylalanine STOP

NEW Methionine

(START) Proline Lysine Proline Glutamate Phenylalanine STOP

There is no change, therefore it is a point mutation that is silent.