Unexpected complexity in the mechanisms that target assembly of the spectrin

cytoskeleton Amlan Das

1, Christine Base

1, Debasis Manna

2, Wonhwa Cho

2, Ronald R. Dubreuil

1

1Laboratory for Molecular Biology and Department of Biological Sciences and

2 Department of Chemistry; University of Illinois at Chicago, Chicago, IL 60607

Running title: Mechanisms of spectrin assembly

Address correspondence to: Ronald R. Dubreuil, 900 S. Ashland Ave., Rm. 4152 MBRB (m/c567)

Chicago, IL 60607, fax 312 413 2691 Email: ron@uic.edu

The spectrin cytoskeleton assembles within

discrete regions of the plasma membrane in a

wide range of animal cell types. While recent

studies carried out in vertebrate systems indicate

that spectrin assembly occurs indirectly through

the adapter protein ankyrin, recent studies in

Drosophila established that spectrin can also

assemble through a direct ankyrin-independent

mechanism. Here we tested specific regions of

the spectrin molecule for a role in polarized

assembly and function. First, we tested mutant

spectrins lacking ankyrin binding activity and/or

the C-terminal pleckstrin homology (PH)

domain for their assembly competence in

midgut, salivary gland and larval brain.

Remarkably, three different assembly

mechanisms operate in these three cell types: 1)

neither site was required for assembly in

salivary gland; 2) only the PH domain was

required in midgut copper cells; and 3) either

one of the two sites was sufficient for spectrin

assembly in larval brain. Further

characterization of the PH domain revealed that

it binds strongly to lipid mixtures containing

PIP2, but not PIP3. A K8Q mutation in the lipid-

binding region of the PH domain eliminated the

PIP2 interaction in vitro, yet the mutant protein

retained full biological function in vivo. Reporter

gene studies revealed that PIP2 and the spectrin

PH domain codistribute with one another in

cells, but not with authentic wild type

spectrin. Thus it appears that the PH domain

imparts membrane targeting activity through a

second mechanism that takes precedence over its

PIP2 binding activity.

Spectrin is the major protein component of a

submembrane cytoskeletal scaffold found in animal

cells. Spectrin and its adapter ankyrin are thought to

have broad roles in the formation, organization, and

stabilization of the plasma membrane in diverse cell

types. For example, genetic studies have uncovered

effects of spectrin mutations on the shape and/or

stability of the plasma membrane in human

erythrocytes, and in epithelial cells and neurons (1-

6). A second important function became apparent in

studies of polarized cells where spectrin and

ankyrin are restricted to specialized subdomains of

the plasma membrane. Mutations in spectrin or

ankyrin result in a failure of interacting membrane

activities such as ion pumps and channels to

accumulate at their normal sites of function

(reviewed in 7). Recent studies of human bronchial

epithelial cells suggest a more pivotal role in which

spectrin and ankyrin are required for the lateral

membrane domain to form at all (8-9).

The polarized distributions of spectrin and

ankyrin observed in diverse cell types suggests that

there are active mechanisms that generate polarity.

However, it has proven difficult to identify cues

that direct spectrin and ankyrin to specific

membrane domains. There has been recent progress

in understanding how spectrin and ankyrin respond

to their assembly cues. Genetic studies in the mouse

suggest that targeting in cardiomyocytes and

neurons occurs through ankyrin (10-11). Mutations

in ankyrin that interfere with its ability to bind to

spectrin lead to a failure of spectrin recruitment to

the plasma membrane, but they do not appear to

affect targeting of ankyrin. These results suggest

that there is a receptor(s) that acts through ankyrin

to recruit spectrin cytoskeleton assembly. In the

case of the node of Ranvier, that receptor appears to

be neurofascin 186 (12).

In contrast, recent genetic studies in

Drosophila revealed that there are ankyrin-

independent sites that have an important role in

targeting spectrin to the plasma membrane in

epithelia, neurons and muscle (13-15). Inactivation

of the ankyrin-binding activity of spectrin did not

detectably alter the recruitment of spectrin to the

plasma membrane in any of the cells that were

examined. It is remarkable that in two experimental

systems, using a similar approach to test the

contributions of spectrin and ankyrin, that exactly

http://www.jbc.org/cgi/doi/10.1074/jbc.M800094200The latest version is at JBC Papers in Press. Published on March 17, 2008 as Manuscript M800094200

Copyright 2008 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

the opposite results were obtained. Ankyrin appears

to function and be recruited independently of

spectrin in the mouse and spectrin appears to

function and be recruited independently of ankyrin

in the fruit fly. Further studies are required to

distinguish whether these are differences between

systems or trivial differences between the cell types

that have been amenable for study thus far.

In this study we characterized mechanisms

of spectrin assembly in Drosophila using a genetic

approach. Transgene rescue is a straightforward

strategy that relies on the lethality of and

spectrin mutations and the ability to rescue the

lethal phenotype using cDNA-based transgenes

encoding functional spectrin subunits. By using

modified transgenes it is possible to test the

contributions of individual sites in spectrin to its

assembly and function. Here we set out to

characterize the activity of the PH domain that

explains its role in targeting. Previous work

established that in midgut copper cells (an epithelial

cell type) spectrin assembly was abolished by

removal of the PH domain from the C-terminus of

spectrin, but not by removal of the ankyrin-binding

domain (13). We also followed up the observation

that neither the ankyrin-binding domain nor the PH

domain was required for spectrin targeting in the

salivary gland. Here we asked if these two activities

could make a redundant contribution to assembly

by characterizing a doubly mutated transgene. In

the course of our studies we observed a striking

pattern of spectrin antibody labeling in the larval

brain and found that spectrin behavior in the brain

was different from either of the two epithelial cell

types characterized here. We used a combined

biochemical and genetic approach to examine how

the PH domain contributes to spectrin targeting and

function. The results reveal an unexpected

complexity in the mechanisms that explain

polarized assembly of the spectrin cytoskeleton in

diverse cell types.

EXPERIMENTAL PROCEDURES

Antibodies. Rabbit anti- spectrin antibody (KCar;

ref. 16), mouse anti- spectrin antibody (3A9; ref.

17) mouse anti myc-epitope monoclonal antibody

(9E10; ref. 18), and rabbit anti-Scribble (a gift from

Chris Doe, ref. 19) were used as indicated.

Immunoprecipitation from transgenic embryo

homogenates was carried out as previously

described (16). Briefly, 150 ul of dechorionated 12-

24 hour embryos carrying a homozygous insertion

of the PH transgene were homogenized in TBS +

1% Triton X-100 containing the protease inhibitors

benzamidine and leupeptin. The clarified

supernatant was incubated with anti-myc epitope

antibody and antibody complexes were reacted with

Pansorbin (Calbiochem) for 1 hour at 4oC.

Pansorbin was pelleted and washed in buffer two

times before dissolving in SDS sample buffer for

western blotting.

Fly stocks and transgenes. The midgut expression

driver Mex-Gal4 (20) and 21-3-1 encoding a

myc-tagged UAS spectrin PH domain transgene

(21) were kindly provided by Dr. Graham Thomas.

The neuronal driver elav-Gal4 was kindly provided

by Dr. Christian Klambt (Uni Muenster, Germany).

The PIP2-binding PLC PH domain-GFP reporter

was kindly provided by Dr. Franck Pichaud (22).

The heat shock Gal4 line (1799), which is

constitutively expressed in larval salivary gland and

midgut (13), and Repo-Gal4 a glial cell reporter

(line 7415) were obtained from the Bloomington

Stock Center. UAS DS-Red was kindly provided by

Dr. Dave Featherstone (UIC).

Production of the wild type specKW3A

and modified

specPH

and speca13

transgenes was previously

described (13). The previously described lethal

spectrin allele specem6

(3) was recently shown to

encode a truncated product that behaves as a

functional null (23). New transgenes were produced

by site-directed mutagenesis of the parent plasmid

WUMB- -spectrin (3) using primers synthesized by

Operon. Sequences were verified at the DNA

Services Facility at the University of Illinois at

Chicago Research Resource Center. Transgenic

lines were produced by standard embryo

microinjection into w1118

by Genetic Services, Inc.

spec13+ PH

. To produce the double mutant

plasmid, a stop codon was introduced at codon

2144 of the spec13

plasmid by mutagenesis, as

previously described (13).

specK8Q

. A point mutation was introduced at codon

2157 using QuikChange with the primer sequence

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

5’

GAAGGATATGTGACACGACAGCACGAGTGG

GACTCG.

specK17Q

. A point mutation was introduced at

codon 2166 using QuikChange with the primer

sequence 5’

GACTCGACCACCAAGCAGGCCTCCAACCGA

TC.

UAS Spec95

. The myc-epitope-tagged coding

sequence from specKW3A

was inserted into the

pUAST vector to produce a Gal4-inducible tagged

spectrin. The production and characteristics of

this transgene will be described in greater detail

elsewhere.

Rescue Crosses. The biological function of

transgenes carrying point mutations in the PH

domain was tested by first crossing the autosomal

insertions into a C(1)Dx (compound X)

background. C(1)Dx/Y; +/+ females were mated to

+/Y; transgene/transgene males to produce an F1

C(1)Dx/Y ; transgene/+ fly (Supplemental Figure).

These F1 females were next crossed to specem6

/Y;

Dp(1:3)BarS3i

D3/+ males. In these males the

endogenous spectrin gene on X is lethally

mutated. Their survival depends on the presence of

an X chromosome duplication on chromosome 3.

The duplication includes a wild type copy of the

spectrin gene as well as a mutation in the

neighboring Bar gene which has an easily scored

dominant eye phenotype. The compound X

chromosome causes an unusual pattern of

inheritance in which daughters receive the

compound X chromosome from their mothers and

sons receive the X chromosome from their fathers

(and a copy of the Y chromosome from their

mother). Because all males inherit the specem6

X

chromosome from their father, they can only

survive if they inherit a functioning copy of the

spectrin gene, either via the duplication

chromosome or a transgene. Because the rescue

cross parents are heterozygous for the duplication

(father) and for the transgene insertion (mother)

there are four expected male progeny classes.

Female progeny all inherit the compound X

chromosome carrying a wild type copy of the

spectrin gene, and therefore are not of interest here.

Rescue crosses with wild type transgenes yield a net

2:1 ratio of Bar-eyed to non-Bar-eyed male progeny

in this scheme (13). One class (shaded) does not

inherit a functioning copy of the spectrin gene

and these males die as embryos. One-third of the

remaining progeny carry a copy of the transgene,

but not the duplication chromosome marked by Bar.

The other two thirds of the males inherit the

duplication, either alone or together with the

transgene (these all survive). If a test transgene

lacks function then only those males that inherit the

duplication can survive, and consequently all the

males have the Bar eye phenotype.

Microscopy. Larval midguts, salivary gland and

brain were dissected and stained as previously

described (3) and mounted using Vectashield

mounting medium at room temperature. Images

were captured using an Olympus FV500 confocal

microscope with a 60X Plan-Apo oil-immersion

objective (NA 1.4) and Fluoview 2.1 software.

Brightness settings were adjusted for control

specimens (either wild type siblings or expression

level-matched transgenes) using the

photomultiplier, and settings were kept constant for

capturing data when samples were to be compared.

Images were saved as “Experiments” in Fluoview

and were converted to jpeg format by NIH ImageJ.

Montages were assembled using Photoshop 6.0

(Adobe) and gamma adjustments after conversion

to grayscale were performed with all panels

simultaneously.

Western blots. Adult flies and immunoprecipitates

were processed for antibody staining as previously

described (13). Fly samples shown were processed

in parallel to allow visual comparison of band

intensities. Mobility standards were the SDS6H kit

from Sigma Chemical Co.

Lipid binding assays. Materials: 1-Palmitoyl-2-

oleoyl-sn-glycero-3-phosphocholine (POPC), 1-

palmitoyl-2-oleoyl-sn-glycero-3-

phosphoethanolamine (POPE), and 1-palmitoyl-2-

oleoyl-sn-glycero-3-phosphoserine (POPS) were

purchased from Avanti Polar Lipids, Inc.

(Alabaster, AL). phosphatidylinositol-4,5-

bisphosphate (PtdIns(4,5)P2), and

phosphatidylinositol-3,4,5-triphosphate

(PtdIns(3,4,5)P3) were purchased from Cayman

Chemical Company (Ann Arbor, MI). The

concentrations of the phospholipids were

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

determined by a modified Bartlett analysis. CHAPS,

(3-[3-cholamidopropyl)dimethylammonio]-1-

propane-sulfonate; Octyl glucoside was purchased

from Fisher. The Pioneer L1 sensor

chip was

purchased from Biacore AB (Piscataway, NJ).

Protein expression and purification: A PH domain

fragment of Drosophila spectrin corresponding to

codon 2144 through the stop codon was amplified

by PCR and cloned in the Topo cloning vector

(Invitrogen) for DNA sequencing. The BamHI –

EcoRI insert fragment was cloned in the pGEX-3X

vector and the protein product was expressed and

purified using standard conditions. Briefly, cells

were induced with IPTG for 14 hours at 25oC,

harvested by centrifugation, then lysed by

sonication in 20 mM Tris buffer pH 8 containing

160 mM KCl, 50 uM PMSF, 2 mM DTT, and 0.1%

Triton X-100. Protein was purified using

glutathione S-transferase-TagTM

resin (Novagen,

Madison, WI) and eluted with 20 mM glutathione.

Purified protein was stored in 20 mM Tris-HCl pH

7.4 with 0.16M KCl at 4oC .

Surface Plasmon Resonance (SPR) measurements:

All SPR measurements were performed at 23 °C

using a lipid-coated L1 chip in the BIACORE X

system as described previously (24). Briefly, after

washing the sensor chip surface with the running

buffer (20 mM HEPES, pH 7.4, containing 0.16 M

KCl), POPC/POPE/POPS/PI (57:20:20:3) and

POPC (100%) vesicles were injected at 5 ml/min to

the active surface and the control surface,

respectively, to give the same resonance unit (RU)

values. The level of lipid coating for both surfaces

was kept at the minimum that is necessary for

preventing the non-specific adsorption to the sensor

chips. This low surface coverage minimized the

mass transport effect and kept the total protein

concentration (P0) above the total concentration of

protein binding sites on vesicles (M0) (25).

Equilibrium SPR measurements were done at the

flow rate of 15 ml/min to allow sufficient time for

the R values of the association phase to reach near-

equilibrium values (Req) (26). After sensorgrams

were obtained for 5 or more different

concentrations of each protein within a 10-fold

range of Kd, each of the sensorgrams was corrected

for refractive index change by subtracting the

control surface response from it. Assuming a

Langmuir-type binding between the protein (P) and

protein binding sites (M) on vesicles (i.e., P + M

PM) (25), Req values were then plotted versus P0,

and the Kd value was determined by a nonlinear

least-squares analysis of the binding isotherm using

an equation, Req= Rmax/(1 + Kd/P0) (25). Each data

set was repeated three or more times to calculate

average and standard deviation values. For kinetic

SPR measurements, the flow rate was maintained at

30 ml/min for both association and dissociation

phases.

RESULTS

Characterization of a double mutant spectrin

transgene lacking the PH and ankyrin-binding

domains. We previously described a panel of

recombinant Drosophila spectrin transgenes

carrying an N-terminal myc epitope tag and

expressed under control of the Drosophila ubiquitin

promoter (13). One of the transgenes ( PH) had a

stop codon introduced into the first codon of the C-

terminal PH domain ( PH, Fig. 1A). On western

blots of transgenic flies, the PH product (Fig 1B,

lane 1) had a slightly faster mobility than full length

control transgenes (e.g. lanes 3-4) when probed

with the anti-myc-epitope antibody. In another

transgene, 13, the 15th

spectrin repeat in the

spectrin sequence was removed and replaced with

the 13th

repeat from Drosophila spectrin (filled

ellipse). The 13 product comigrated with full

length (266 kD) wild type spectrin on western

blots (13). Here we produced a double mutant

transgene by introducing the PH stop codon into

the PH domain sequence of 13. Transgenic flies

expressing this transgene exhibited a truncated

product on western blots that was identical in size

to PH (lane 2). Both of these truncated transgene

products appeared relatively stable and accumulated

at significant levels in transgenic flies, although

they were less abundant than full-length transgene

products (lanes 3 and 4, described below).

We compared the behavior of the double

mutant transgene product to the single mutants by

immunofluorescent staining of tissues from larvae

lacking endogenous wild type spectrin. In midgut

copper cells the wild type spectrin transgene

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

product exhibited a characteristic pattern

corresponding to the basolateral domain of these

cells (Fig. 2A, arrowhead). That pattern was

completely lost in PH mutant larvae (Fig. 2C) and

also in larvae expressing the double mutant

transgene (Fig. 2E). But despite the loss of

basolateral spectrin the overall morphology of the

midgut epithelium was largely intact, as revealed by

staining with the septate junction marker Scribble

(Fig. 2, B,D,F).

In the larval salivary gland epithelium, the

PH transgene product (Fig. 2I) had an identical

distribution to the wild type transgene product (Fig.

2G). Spectrin was highly enriched throughout the

lateral zone of cell-cell contact including the

apicolateral septate junction region marked with

Scribble (Fig. 2H & J). The same pattern was also

observed with the double mutant (Fig. 2K)

indicating that neither the PH domain nor the

ankyrin-binding domain was required for spectrin to

assemble at the lateral membrane. Thus there were

different requirements for polarized spectrin

assembly in the salivary gland and midgut

epithelium.

Spectrin targeting in the larval brain

While analyzing the fate of spectrin transgenes in

dissected larval preparations we observed a striking

pattern of myc-epitope staining in the first instar

larval brain. Staining with a monoclonal anti-

spectrin antibody also detected a cortical pattern of

labeled cell outlines a few cells thick, shown en

face here (Fig. 3A). The same pattern was observed

with polyclonal rabbit anti spectrin antibody (Fig.

3C and D, green). Most of these cells correspond to

neurons since they could also be labeled by

expressing cytoplasmic UAS DS-Red under control

of the neuronal driver elav-Gal4 (Fig. 3C and D,

red). This pattern verified that each “cell” outlined

by spectrin staining was simply the plasma

membrane of a single cell that was closely apposed

to neighboring cells. The pattern of elav-Gal4

expression was not uniform, as it did not drive DS-

Red expression in all of the cells that could be

stained with spectrin antibody. However, when

elav-Gal4 was used to drive expression of a UAS-

myc-tagged spectrin transgene we routinely

observed large zones in which nearly every cell was

labeled (Fig. 3B), albeit at widely varying levels.

Thus we conclude that most of the spectrin labeling

pattern described here represents sites of plasma

membrane contact between neighboring neurons.

We analyzed the effects of the three

modified spectrin transgenes described above on

the behavior of spectrin in the larval brain cortex.

As in the salivary gland, removal of the ankyrin

binding site ( 13) left the membrane-staining

pattern in brain intact (Fig. 4A). The PH staining

pattern also resembled the wild type pattern (Fig.

4B) although it was possible to find breaks in the

pattern in some fields (e.g. Fig. 4C). In either case,

most of the labeling pattern was still restricted to

the plasma membrane. In contrast, the regular

pattern of cell outlines was no longer visible in

larvae expressing the double mutant (Fig. 4D). The

speckled pattern superficially resembles the

speckled pattern PH staining observed in midgut

copper cells (Fig. 2 C&E). Analysis of Z-stacks

suggests that some of the pattern represents

intracellular aggregates but we cannot rule out the

possibility that there is some residual plasma

membrane staining. However, the behavior of the

double mutant is distinctly different in the larval

brain (and copper cells) compared to the salivary

gland.

Functional analysis of the PH domain. PH domains

are found in hundreds of different proteins and in

many cases they exhibit phosphoinositide-binding

activity (27). Previous studies showed that inositol

phosphate-binding activity is a conserved feature of

PH domains in mammalian and Drosophila spectrin

(28-29). Here we analyzed the lipid binding activity

of the PH domain from Drosophila spectrin

using recombinant pGEX fusion proteins. The PH

domain coding sequence from codon 2088 to the

stop codon was amplified by PCR and cloned into

pGEX-3X for inducible expression and purification

of a GST fusion protein. We quantitatively

characterized the binding of purified GST- spec-

PH by equilibrium surface plasmon resonance

(SPR) analysis. Binding sensorgrams for GST-

spec-PH reacted with mixed lipid vesicles

containing PtdIns(4,5)P2 (Fig. 5A) were used to

generate a binding isotherm (Fig. 5B) which yielded

a Kd of 125 ± 18 nM. Previous binding assays

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

using soluble GPIns(4,5)P2 as ligand obtained an

estimated Kd of ~40 μM (29).

It has been reported that GST-tagged

proteins have a tendency to dimerize. When we

checked the possibility of the dimerization of the

GST-tagged spectrin PH domain by gel filtration

chromatography, more than 90% of the protein was

eluted as monomer even at 100 uM initial

concentration (data not shown). This indicates that

under our experimental conditions ([protein] < 1

uM), the GST-tagged spectrin PH domain exists

predominantly as monomer. No significant

interaction with lipid was detected using purified

GST alone in this assay (Fig. 5D).

PH domains from different proteins exhibit

signature preferences for specific phosphoinositides

(27). We previously speculated that spectrin might

interact with growth signaling pathways that rely on

PI-3 kinase activity to recruit PH domain containing

proteins to the plasma membrane (13). Here we

compared the ability of GST- spec-PH to bind to

PtdIns(4,5)P2 and PtdIns(3,4,5)P3 using the SPR

assay. The results indicate a marked preference of

the spectrin PH domain for PtdIns(4,5)P2 (Fig. 5C).

Thus spectrin is unlikely to have a direct role in

growth factor signal transduction downstream of

PIP3 formation.

Structural analysis of the spectrin PH

domain led to the identification of specific amino

acid positions that contact the lipid head group.

Mutagenesis studies identified a K8Q mutation at

one contact site that interfered with GPIns(4,5)P2

binding activity in vitro (29). A similar point

mutation at a conserved non-contact position in the

PH domain (K17Q) had no effect on ligand binding

in that assay. We engineered the same two

mutations into the GST- spec-PH construct and

then measured their effects on lipid binding in the

SPR assay. The lipid-binding activity of the K17Q

mutant fusion protein was only slightly reduced

relative to the wild type control (Fig. 5D).

However, lipid- binding activity was nearly

abolished by the K8Q mutation, consistent with the

observed effect of the corresponding mutation on

mammalian spectrin binding to GPIns(4,5)P2.

To evaluate the effects of the K8Q and

K17Q mutations in vivo, we introduced the same

two point mutations into a full-length recombinant

spectrin transgene (codons 2157 and 2166

respectively) and produced transgenic flies as

previously described (13). Western blots of total

proteins from the transgenic flies expressing each

protein revealed robust expression of the myc-

epitope-tagged products (Fig. 1B, lanes 3 & 4).

Both transgenes were tested for their ability to

rescue the lethality of the specem6

mutation.

Representative results are shown in Table I. The

rescue cross scheme (ref. 13, described in Methods)

made use of a compound X chromosome in the

female parent to force transmission of the X

chromosome from fathers to sons. The male parent

carried a lethal mutation in the spectrin locus on

X ( specem6

), but these males survive due to the

presence of a duplication of part of the X

chromosome to chromosome 3 (including the wild

type spectrin locus and the neighboring marker

Bar which has an easily scored dominant eye

phenotype). The rescue cross strategy tests the

ability of a mutant transgene to functionally replace

the duplication chromosome, thus allowing males

that carry a lethal mutation in the endogenous

spectrin gene to survive. These flies are recognized

by the absence of the Bar eye marker. A control

wild type transgene (KW3A) yields a net male

progeny ratio of 2:1 Bar:non-Bar-eye adults (Table

I). Crosses with transgenes that lack function yield

only Bar-eyed progeny (13). Both the K8Q and the

K17Q mutant transgenes also yielded male progeny

ratios approaching 2:1, indicating that they were

capable of efficiently rescuing the lethal spectrin

mutation. Thus loss of lipid-binding activity had no

significant effect on the essential function of

spectrin in vivo.

Since it was also formally possible that the

mutant transgenes could rescue the lethality of the

spectrin mutation, but not restore the ability of the

protein to target correctly in copper cells, we also

examined the distribution of the transgene products

in copper cells from rescued larvae (Fig. 6). Both

proteins exhibited complete rescue of basolateral

spectrin targeting (arrowheads) in copper cells.

These results indicate that phosphoinositide-binding

activity is dispensable for spectrin function and that

an activity other than lipid binding is likely to be

responsible for PH domain-dependent targeting of

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

spectrin to the plasma membrane in copper cells.

In parallel studies, we compared the

distribution of PtdIns(4,5)P2 to spectrin in

copper cells and salivary gland cells. A previously

described GFP reporter fused to the PH domain of

PLC was expressed as a UAS transgene (22). This

reporter efficiently labels plasma membrane

domains that are enriched with PtdIns(4,5)P2 (22).

In midgut copper cells the reporter was highly

enriched in the apical membrane domain (Fig.

7A,C, arrow) where it codistributed with H

spectrin (Fig. 7B, arrow). In contrast, a relatively

weak signal was detected in the basolateral domain

where all of the isoform of spectrin is found

(arrowhead, compare to Fig. 6A). Similarly, the

PLC-PH-GFP reporter most strongly stained the

apical membrane domain of salivary gland

epithelium (Fig. 7D, arrow), with a much weaker

signal in the basolateral spectrin-containing

region of the plasma membrane. Thus, the

PtdIns(4,5)P2 distribution observed in vivo does not

match the expectation of a cue that could direct

basolateral assembly of spectrin in copper cells

or salivary gland.

We also examined the distribution of a

myc-tagged reporter corresponding to the PH

domain of spectrin as a UAS transgene product in

vivo (21). The spectrin PH domain accumulated at

the apical membrane of copper cells (Fig. 7E, G,

arrow) and salivary gland cells (Fig. 7H, arrow) in a

pattern that matched the distribution of

PtdIns(4,5)P2. Thus, the spectrin PH domain

reporter closely paralleled the distribution of the

PLC- PH domain reporter, but not the distribution

of endogenous spectrin. It appears that in the

absence of a competing cue the lipid-binding

activity of the spectrin PH domain was sufficient to

guide its polarized assembly, albeit in the wrong

place.

Previous studies of the spectrin PH

domain focused primarily on its membrane binding

activity. We originally observed that the truncated

PH product exhibited partial localization when it

was expressed in the presence of wild type

spectrin (13). Thus we were interested to know if

the partial localization could be due to formation of

mixed tetramers containing both wild type and PH

spectrin. Western blots with anti- spectrin

antibody indicate that the two spectrins are

expressed at similar levels in the transgenic

embryos used in these experiments (Fig. 8, lane 1).

Immunoprecipitation of the myc-tagged PH

transgene product under non-denaturing conditions

(16) using anti-myc antibody efficiently recovered

the truncated PH product (arrowhead), but not the

endogenous full-length spectrin (lane 3, arrow),

which was still present in the unbound fraction

(lane 2). If the PH protein were capable of

forming tetramers, we would have expected to

recover a significant amount of endogenous wild

type spectrin (~50% of PH) in the

immunoprecipitates. Given that the reactions were

carried out under non-denaturing conditions, it

appears that the PH truncation has an unexpected

effect on the ability of the modified protein to form

stable tetramers.

DISCUSSION

Recent studies of spectrin and ankyrin in polarized

cells from vertebrates and invertebrates have

produced conflicting results on the order of events

in their assembly. Studies from Drosophila suggest

that spectrin is upstream of ankyrin in the assembly

pathway (13-15) while studies in the mouse suggest

that ankyrin is upstream of spectrin (10-11). The

results of the present study shed new light on this

apparent discrepancy. There is a remarkable

complexity in the mechanisms that control spectrin

assembly in Drosophila in vivo. Given the

conservation between vertebrate and invertebrate

spectrins, it seems likely that a similar complexity

will emerge as spectrin and ankyrin assembly

mechanisms are characterized in a broader range of

mammalian cell types.

The present results indicate that there are at

least three distinct mechanisms of spectrin assembly

in Drosophila that differ from the mechanism

described so far in mouse (Fig. 9). The carboxy

terminal PH domain is required for assembly in

midgut copper cells (A), either the ankyrin-binding

domain or the PH domain is required for assembly

in larval brain (B), and an altogether different site is

required for assembly in the salivary gland (C). In

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

mouse neurons and cardiomyocytes, spectrin

assembly appears to strictly depend on binding to

ankyrin (D). There does not appear to be a

redundant alternative pathway operating through

the PH domain in mouse, since no residual spectrin

assembly was observed when the interaction

between spectrin and ankyrin was blocked (11).

With four distinct mechanisms operating in the cells

that have been characterized so far, it seems likely

that even more mechanisms remain to be

discovered. In light of this unexpected complexity it

will be important to experimentally determine

which pathway is operating in future studies of

other cell types.

It is not yet clear whether multiple

pathways might be operating within a single cell to

mediate targeting of spectrin to different plasma

membrane subdomains. So far the results indicate

an all-or-none effect where spectrin assembles

within multiple discrete domains or not at all. For

example the PH domain is required in copper cells

to recruit spectrin to the basal domain (where it

contacts a basement membrane), to the septate

junction which forms an apicolateral adhesive

complex between neighboring cells, and to the sub-

septate junction lateral domain found between the

other two domains. The simplest explanation is that

the PH domain mediates spectrin recruitment by a

single class of receptor that is present in all three

membrane domains.

In mammals the tight junction has been

proposed to form a “fence” that blocks diffusion of

membrane proteins between the apical and

basolateral domains of the plasma membrane (30).

If there is a spectrin receptor in the basolateral

domain then one might imagine that the receptor

could be restricted by the fence function of the tight

junction, thus preventing spectrin from

assembling at the apical domain. In invertebrates

the septate junction fulfills the role of the tight

junction as a permeability barrier in the apicolateral

region of the lateral plasma membrane (31).

However, as seen in the experiments shown here,

the septate junction is a relatively broad zone,

occupying about 1/3 of the lateral domain. Given

that spectrin is found throughout the septate

junction, it seems unlikely that its putative

receptor(s) is corralled by the junction. We

speculate instead that the receptor is active

throughout each of the domains in which spectrin is

observed to assemble, including the septate

junction.

We initially speculated that the PH domain

and ankyrin-binding domain of spectrin could

have a redundant role in targeting spectrin to the

basolateral domain of salivary gland cells, since

neither single mutation appeared to have an effect

on assembly. The lack of effect of a doubly mutant

spectrin lacking both sites suggests that the cue for

assembly is received elsewhere in the spectrin

molecule. The cue is not likely to reside in

spectrin since both spectrin isoforms share the same

subunit in Drosophila but have non-overlapping

distributions in polarized cells (32). For the same

reason it seems unlikely that the actin binding of

activity is involved in polarized assembly, since

both spectrin isoforms share that activity and

neither protein co-distributes with bulk filamentous

actin in cells. Previous biochemical studies of

mammalian spectrin identified an ankyrin-

independent membrane binding site near the N-

terminus of spectrin (33-34), making this region a

promising target for further transgene studies in

Drosophila. However the results at this point only

exclude ankyrin-binding repeat 15 and the PH

domain, making all other regions of the spectrin

molecule viable candidates as recruitment sites in

the salivary gland.

The redundant mechanism that we

originally hypothesized for the salivary gland did

turn out to explain the behavior of spectrin in

neurons in the developing larval brain. We had

previously noticed a striking spectrin staining

pattern in the cortex of the larval brain. Here we

observed that the pattern was eliminated in mutants

expressing the double mutant transgene that lacked

ankyrin-binding activity and the PH domain. Each

single mutant exhibited most or all of the wild type

pattern, suggesting that either site was capable of

directing spectrin assembly. We were not able to

detect any polarity of spectrin assembly in these

cells. Instead, we simply observed that spectrin was

either present on the plasma membrane or not. We

originally considered the possibility that the

spectrin staining pattern corresponds to contacts

between neurons and glia. However, experiments

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

with the glial reporter Repo-Gal4 only produced

sparse patterns of stained cells that could not

account for the closely packed staining patterns we

observed with spectrin antibodies or elav-Gal4

reporters (data not shown). A recent study found

that elav-Gal4 is transiently expressed in glial cells

during embryonic development (35). However

protein products were no longer detected by the end

of embryogenesis, making it unlikely that the

expression pattern observed here in larval brain was

due to the glial components of elav expression.

Therefore, we conclude that the spectrin staining

pattern observed at this stage in development

corresponds primarily to contacts between

neighboring neurons.

Biological properties of the PH domain. Our

experimental approach provided the first

opportunity to directly test the contribution of the

PH domain to spectrin assembly and function in

vivo. The in vitro lipid binding data described in

previous studies (28-29) along with the plasma

membrane targeting activity of a spectrin PH

domain-GFP reporter (36) led to the logical

conclusion that the PH domain could mediate lipid-

dependent targeting activity in vivo. The results

here establish that the PtdIns(4,5)P2 binding activity

of the PH domain is conserved in Drosophila, that

the PH domain prefers this lipid over

PtdIns(3,4,5)P3 and that a spectrin PH domain

reporter codistributes with PtdIns(4,5)P2 in vivo.

However, lipid binding activity was not responsible

for spectrin targeting or for its essential function,

suggesting that something besides loss of lipid

binding activity explains the detrimental effects of

the PH domain truncation.

As we were completing these studies it

became apparent that phosphoinositides are

polarized in epithelial cells and that their polarity

has important ramifications for the maintenance of

polarity. For example, PtdIns(4,5)P2 is normally

present in the apical domain of polarized MDCK

cells and when it is exogenously added to the

basolateral domain that domain acquires

characteristics of the apical domain (37). Similarly,

PtdIns(3,4,5)P3 is normally concentrated in the

basolateral compartment of MDCK cells and

transplanting it to the apical domain confers

basolateral character on the apical domain (38).

Studies with a GFP reporter that specifically binds

to PtdIns(4,5)P2 established that the asymmetric

apical distribution of this lipid is conserved in

Drosophila epithelia (22). Therefore spectrin does

not normally codistribute with the bulk of

PtdIns(4,5)P2 in vivo. Our finding that loss of lipid-

binding activity had no detectable effect on spectrin

targeting or function provides compelling proof that

something other than phosphoinositide binding

activity is responsible for spectrin targeting in vivo.

Why is the PH domain reporter targeted to

the PIP2-rich apical domain of epithelia when the

native spectrin molecule is exclusively targeted to

the basolateral domain? One intriguing answer to

this question emerged from the behavior of the PH

transgene product in immunoprecipitation

experiments. The rationale for the experiment was

to ask if the partial localization of the PH protein

in cells from heterozygotes that also expressed wild

type spectrin (13) was due to mixed tetramer

formation. The experiment was made possible

because 1) the mutant and wild type proteins differ

sufficiently in size to be resolved on western blots

and 2) the transgene product could be selectively

immunoprecipitated using myc tag antibody. The

inability to detect endogenous full length spectrin

co-precipitating with the PH product in this assay

suggests that the truncation impairs stable tetramer

formation.

Tetramer formation is thought to occur

through interactions between partial structural

repeats in the and subunits of spectrin (39; Fig.

9E). Much of the spectrin molecule consists of

triple-barrel -helical repeats (40). Tetramer

formation proceeds through formation of a

complete structural repeat from partial repeats at the

ends of and spectrin. Two barrels come from

spectrin and a third barrel comes from the N-

terminus of spectrin (Fig. 9E, middle). Most

spectrin isoforms have the additional PH domain

sequence downstream of the partial spectrin repeat

(41). To accommodate models of the tetramer, the

PH domain has typically been drawn as a projection

away from the long axis of the tetramer (e.g. refs. 7,

21, 42; Fig. 9E, top). However, there is no direct

evidence to support that structural model. Instead,

based on the data shown here, we speculate that the

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

PH domain is more intimately associated with the

partial repeats at the tetramer formation site (Fig.

9E, bottom). That association may help stabilize the

tetramer, preventing its dissociation into dimers.

Tetramer stability is one of the most

conspicuous differences between erythrocyte and

non-erythroid spectrins. Erythrocyte spectrin

spontaneously dissociates into dimers at room

temperature whereas most other spectrins

(including Drosophila spectrin) remain in a

tetrameric state. A recent study of this difference in

stability identified sequence divergence in the

subunit as one cause of tetramer lability (43). The

authors speculate that sequence divergence at this

site contributed to neofunctionalization of diverging

genes after duplication of an ancestral gene early in

vertebrate spectrin evolution. Loss of the PH

domain by the subunit in the course of erythroid

spectrin evolution may represent another

neofunctionalization that helps to explain

differences in tetramer stability between isoforms.

Interestingly, the domain structure of the PH

transgene (Fig. 1) is exactly the same as human

erythrocyte spectrin, with only ~50 amino acids

between partial repeat 17 and the stop codon.

The proposed involvement of the PH

domain in tetramer formation also fits well with two

other results from the current study. First, while the

PH domain from spectrin interacts with PIP2 in

vitro, and the isolated PH domain is targeted to a

PIP2-rich membrane domain in vivo, native spectrin

tetramers do not appear to interact with PIP2. This

observation may be explained if the lipid-binding

site in the isolated PH domain becomes masked

when it forms other protein interactions in the

native spectrin tetramer (Fig. 9E, bottom). Second,

the PH domain is clearly required for spectrin

targeting in some cells, yet the isolated PH domain

does not appear to respond to the cue for basolateral

spectrin assembly (Fig. 7). That observation would

be explained if a new binding site is formed by the

interaction of the PH domain with another site in

the spectrin tetramer. Consequently the PH domain

would only be active in basolateral targeting in the

context of the native tetramer.

Drosophila has proven to be a valuable

model system in which to dissect the protein

interactions that explain spectrin targeting and

function. The modified transgene approach has

uncovered functional sites that have important roles

in Drosophila and by virtue of their conservation

they are likely to be important in mammals as well.

Continued application of the transgene rescue

strategy should allow the identification of the

membrane binding sites that explain polarized

spectrin recruitment in the salivary gland. Ongoing

genetic screens aimed at identifying new mutations

affecting spectrin function will make it possible to

test the hypothesis that the PH domain of spectrin

contributes to spectrin tetramer formation as well as

polarized assembly. For example, we predict that

mutations in the PH domain will be found that

perturb spectrin targeting without affecting its lipid

binding activity. Characterization of such mutants

with respect to their ability to form stable spectrin

tetramers is expected to provide fundamental new

insights into the structure and activity of spectrins.

Another important issue to address using this

approach is whether or not any of the activities

ascribed to the PH domain here involve the ~30

amino acid residues found between the PH domain

and the carboxy terminus of spectrin.

Acknowledgements

We thank Srilakshmi Dhulipala for technical

assistance, Franck Pichaud for providing the PLC -

PH-GFP reporter, Graham Thomas for providing

the spectrin PH domain reporter, Chris Doe for

providing Scribble antibody, Volker Hartenstein

and Christian Klambt for valuable discussions

regarding the larval brain staining patterns.

Supported by NIH GM49301 (RRD) and GM68849

(WC).

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

REFERENCES

1. Lux, S. E., and Palek, J. (1995) Disorders of the Red Cell Membrane. In: Handin, R. I., Lux, S.

E., and Stossel, T. P. (eds). Blood: Principles and practice of hematology, J.B. Lippincott Co.,

Philadelphia

2. Lee, J., Coyne, R., Dubreuil, R. R., Goldstein, L. S. B., and Branton, D. (1993) J. Cell Biol. 123,

1797-1809

3. Dubreuil, R. R., Wang, P., Dahl, S. C., Lee, J. K., and Goldstein, L. S. B. (2000) J. Cell Biol. 149,

647-656

4. Lacas-Gervais, S., Guo, J., Strenzke, N., Scarfone, E., Kolpe, M., Jahkel, M., DeCamilli, P.,

Moser, T., Rasband, M. N., and Solimena, M. (2004) J. Cell Biol. 166, 983-990

5. Yang, Y., Lacas-Gervais, S., Morest, D. K., Solimena, M., and Rasband, M. N. (2004) J.

Neurosci. 24, 7230-7240

6. Hammarlund, M., Jorgensen, E. M., and Bastiani, M. J. (2007) J. Cell Biol. 176, 269-275

7. Dubreuil, R. R. (2006) J. Membrane Biology 211, 151-161

8. Kizhatil, K., and Bennett, V. (2004) J. Biol. Chem. 279, 16706-16714

9. Kizhatil, K., Yoon, W., Mohler, P. J., Davis, L. H., Hoffman, J. A., and Bennett, V. (2007) J.

Biol. Chem. 282, 2029-2037

10 . Mohler, P. J., Yoon, W., and Bennett, V. (2004) J. Biol. Chem. 279, 40185-40193

11. Yang, Y., Ogawa, Y., Hedstrom, K. L., and Rasband, M. N. (2007) J. Cell Biol. 176, 509-519

12. Sherman, D. L., Tait, S., Melrose, S., JOhnson, R., Zonta, B., Court, F. A., Macklin, W. B.,

Meek, S., Smith, A. J. H., Cottrell, D. F., and Brophy, P. J. (2005) Neuron 48, 737-742

13. Das, A., Base, C., Dhulipala, S., and Dubreuil, R. R. (2006) J. Cell Biol. 175, 325-335

14. Pielage, J., Fetter, R. D., and Davis, G. W. (2006) J. Cell Biol. 175, 491-503

15. Garbe, D. S., Das, A., Dubreuil, R. R., and Bashaw, G. J. (2007) Development 134, 273-284

16. Dubreuil, R. R., and Yu, J. (1994) Proc. Natl. Acad. Sci. USA 91, 10285-10289

17. Dubreuil, R., Byers, T. J., Branton, D., Goldstein, L. S. B., and Kiehart, D. P. (1987) J. Cell Biol.

105, 2095-2102

18. Evan, G. I., Lewis, G. K., Ramsay, G., and Bishop, J. M. (1985) Mol. Cell. Biol. 5, 3610-3616

19. Albertson, R., and Doe, C. Q. (2003) Nat. Cell Biol. 5, 166-170

20. Phillips, M. D., and Thomas, G. H. (2006) J. Cell Sci. 119, 1361-1370

21. Williams, J. A., MacIver, B., Klipfell, A. A., and Thomas, G. H. (2004) J. Cell Sci. 117, 771-782

22. Pinal, N., Goberdhan, D. C. I., Collinson, L., Fujita, V., Cox, I. M., Wilson, C., and Pichaud, F.

(2006) Curr. Biol. 16, 140-149

23. Hulsmeier, J., Pielage, J., Rickert, C., Technau, G. M., Klambt, C., and Stork, T. (2007)

Development 134, 713-722

24. Stahelin, R. V., and Cho, W. (2001) Biochemistry 40, 4672-4678

25. Cho, W., Bittova, L., and Stahelin, R. V. (2001) Anal. Biochem. 296, 153-161

26. Stahelin, R. V., Karathanassis, D., Bruzik, K. S., Waterfield, M. D., Bravo, J., Williams, R. L.,

and Cho, W. (2006) J. Biol. Chem 281, 39396-39406

27. Lemmon, M. A., and Ferguson, K. M. (2000) Biochem. J. 350, 1-18

28. Zhang, P., Talluri, S., Deng, H., Branton, D., and Wagner, G. (1995) Structure 3, 1185-1195

29. Hyvonen, M., Macias, M. J., Nilges, M., Oschkinat, H., Saraste, M., and Wilmanns, M. (1995)

EMBO J. 14, 4676-4685

30. Gumbiner, B and Louvard, D. (1985) T.I.B.S. 10, 435-438

31. Tepass, U., and Hartenstein, V. (1994) Dev. Biol. 161, 563-596

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

32. Dubreuil, R. R., Maddux, P. B., Grushko, T., and MacVicar, G. R. (1997) Mol. Biol. Cell 8,

1933-1942

33. Lombardo, C. R., Weed, S. A., Kennedy, S. P., Forget, B. G., and Morrow, J. S. (1994) J. Biol.

Chem. 269, 29212-29219

34. Davis, L. H., and Bennett, V. (1994) J. Biol. Chem. 269, 4409-4416

35. Berger, C., Renner, S., Luer, K., and Technau, G. M. (2007) Dev. Dynamics 236, 3562-3568

36. Wang, D.-S., Miller, R., Shaw, R., and Shaw, G. (1996) BBRC 225, 420-426

37. Martin-Belmonte, F., Gassama, A., Datta, A., Yu, W., Rescher, U., Gerke, V., and Mostov, K.

(2007) Cell 128, 383-397

38. Gassama-Diagne, A., Yu, W., Beest, M. t., Martin-Belmonte, F., Kierbel, A., Engel, J., and

Mostov, K. (2006) Nat. Cell Biol. 8, 963-970

39. Tse, W. T., Lecomte, M.C., Costa, F.F., Garbarz, M., Feo, C., Boivin, P., Dhermy, D., and

Forget, B. G. (1990) J. Clin. Invest. 86, 909-916

40. Yan, Y., Winograd, E., Viel, A., Cronin, T., Harrison, S. C., and Branton, D. (1993) Science 262,

2027-2030

41. Tse, W. T., Tang, J., Jin, O., Korsgren, C., John, K. M., Kung, A. L., Gwynn, B., Peters, L. L.,

and Lux, S. E. (2001) J. Biol. Chem. 276, 23974-23985

42. Bennett, V., and Baines, A. J. (2001) Physiol. Rev. 81, 1353-1388

43. Salomao, M., An, X., Guo, X., Gratzer, W. B., Mohandas, N., and Baines, A. J. (2006) Proc. Natl

Acad. Sci. USA 103, 643-648

FOOTNOTES

Abbreviations used are: PH, pleckstrin homology; PtdIns(4,5)P2 and PIP2 phosphatidylinositol-4,5-

bisphosphate; PtdIns(3,4,5)P3 and PIP3, phosphatidylinositol-3,4,5-trisphosphate; PLC,

phospholipase C; POPC, 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine; POPE, 1-palmitoyl-

2-oleoyl-sn-glycero-3-phosphoethanolamine; POPS, 1-palmitoyl-2-oleoyl-sn-glycero-3-

phosphoserine; CHAPS, 3-[3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate; DTT,

dithiothreitol; SPR, surface plasmon resonance; GPIns(4,5)P2, L- glycerophospho-D-myo-

inositol-4,5-bisphosphate; MDCK, Madin-Darby Canine Kidney; ABD, actin-binding domain.

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

FIGURE LEGENDS

Fig. 1: Production of modified spectrin transgenes. A. spectrin is divided into discrete structural

domains including an N-terminal actin binding domain (ABD) a C-terminal pleckstrin homology domain

(PH), 16 copies of degenerate ~106 amino acid long spectrin repeats (ellipses), and one partial (2/3)

repeat near the C-terminus. Two of the degenerate repeats (14 and 15) have been implicated in ankyrin-

binding activity. All recombinant transgenes include a 10 amino acid myc epitope tag at the N-terminus in

place of the first 10 natural codons of spectrin. Modified transgenes include PH (truncated PH

domain), 13 (ankyrin binding repeat of spectrin replaced with inactive repeat 13 of spectrin), double

mutant (both of the above modifications), and point mutations at codon 2157 (K8Q) and 2166 (K17Q). B.

Western blot of total proteins from transgenic flies expressing modified transgenes in a wild type

background (0.8 fly/lane). Lane 1: PH; Lane 2: double mutant; Lane 3: K8Q; Lane 4: K17Q. Blot strips

were stained with anti myc antibody 9E10 and alkaline phosphatase conjugated secondary antibody.

Molecular weight markers are indicated to the right in kD, arrow marks the mobility of full-length

spectrin and the arrowhead marks the position of the truncated PH products.

Fig. 2: Targeting of mutant spectrin transgene products to the plasma membrane of copper cells (A-F)

and salivary gland (G-L). Transgene products were detected with the anti-myc antibody and TRITC

labeled secondary antibody (red) and compared with the pattern of Scribble staining as a control for the

septate junction labeled with FITC secondary antibody (green). All specimens are specem6

males that

lack endogenous wild type spectrin. The wild type transgene product specKW3A

exhibited the typical

basolateral staining pattern with a small gap corresponding to the vestibule to the apical invagination

(visible in favorable sections, arrowhead). Scribble staining (B) marks septate junctions which appear as

comma shapes on either side of the opening to the apical invagination. Plasma membrane labeling was

lost in the PH (C) and double mutants (E), although Scribble staining of septate junctions revealed that

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

the epithelium remained intact. The wild type spectrin exhibited basolateral staining in the salivary

gland, primarily at lateral contacts (G) including the septate junction (marked by Scribble, H). Both the

PH (I) and the double mutant transgene (K) exhibited the same pattern of lateral membrane staining.

Bars = 10 uM.

Fig. 3: Distribution of spectrin in the first instar larval brain. Staining of dissected brain tissue with mouse

anti- spectrin antibody (A) or rabbit anti- spectrin antibody (C,D green) revealed a cortical layer of

staining, 2 – 3 cells deep. Expression of the soluble reporter DSRed under control of elav-Gal4 revealed

that the space within spectrin-stained outlines corresponds to single cells(C,D red). Expression of myc-

tagged UAS spectrin under control of elav-Gal4 (B) produced much of the same pattern detected with

antibodies against endogenous spectrin, indicating that much of the staining corresponds to cortical

neurons. Bar = 10 uM.

Fig. 4: Effects of spectrin mutations on transgene product targeting in larval brain. The 13 mutant

lacking ankyrin-binding activity (A) and the PH mutant (B) both exhibited the wild type pattern of

spectrin staining in specem6

neurons, although gaps in the plasma membrane labeling pattern were often

observed in the latter (C). In contrast, the double mutant transgene lacking both ankyrin-binding and the

PH domain no longer exhibited the characteristic plasma membrane staining pattern (D). Bar = 10 uM.

Fig. 5: Membrane binding activity of the spectrin PH domain measured by equilibrium SPR analysis. A.

Purified spectrin PH domain GST fusion was injected at 15 ul/min at varying concentrations (as

indicated) over the POPC/POPE/POPS/PtdIns(4,5)P2 (57:20:20:3) coated surface and Req was measured

(arrow marks sample injection). B. Binding isotherm generated from Req (average of triplicate

measurements) vs. the concentration of spectrin. A solid line represents a theoretical curve constructed

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

from Rmax (=313 ± 14) and Kd =125 ± 18 nM. 20 mM HEPES buffer, pH 7.4 with 0.16 M KCl was used

for all measurements. C. Kinetics of binding of wild type spectrin PH to lipid mixtures containing either

PtdIns(4,5)P2 or PtdIns(3,4,5)P3. D. Kinetics of binding of spectrin PH wild type, spectrin PH K17Q,

spectrin PH K8Q, and GST control to surfaces coated with the above lipid mixture including

PtdIns(4,5)P2. Flow rate = 30 ul /min and protein concentration = 1 uM in C and D.

Fig. 6: Transgenes carrying point mutations in the PH domain are correctly targeted in copper cells.

Dissected midguts from rescue larvae expressing PH domain point mutant transgenes (A: K8Q; B: K17Q)

were stained with antibody against the myc epitope tag in a background lacking endogenous wild type

spectrin. Both transgene products were efficiently recruited to the basolateral domain of copper cells

(arrowheads). Bar = 10 uM.

Fig. 7: Comparison of the distribution of PtdIns(4,5)P2 to spectrin in vivo. A transgene encoding the

PLC -PH domain fused to GFP was used to characterize the distribution of PtdIns(4,5)P2 in copper cells

(A-C; E-G) and salivary gland (D,H). PLC -PH-GFP (A,C,D) was most concentrated in the apical

membrane domains of both cell types (arrows) with significantly less staining in the basolateral region

(arrowhead). In copper cells the majority of PLC -PH-GFP staining codistributed with H spectrin in the

apical domain (arrow), rather than with spectrin in the basolateral domain (arrowhead in B, stained

with anti- spectrin antibody). A reporter consisting of the myc-epitope-tagged PH domain of spectrin

was also expressed in copper cells (E,G) and salivary gland (H). The spectrin PH domain reporter was

primarily targeted to the apical membrane domain (arrows), suggesting that the lipid binding activity of

the PH domain was capable of targeting assembly but that normally other signals in authentic spectrin

mediate basolateral assembly. Scribble staining marks the apicolateral septate junction of copper cells in

F. Bars = 10 uM.

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

Fig. 8: Immunoprecipitation of PH spectrin from embryo homogenates reveals a defect in tetramer

formation. Transgenic 12 -24 hr fly embryos that were homozygous for the PH transgene 15-5 and

endogenous wild type spectrin were homogenized and centrifuged to produce a clear supernatant. The

myc-tagged transgene product was immunoprecipitated using anti-myc antibody and Pansorbin. Fractions

were analyzed on western blots probed with rabbit-anti- spectrin to detect both the recombinant

transgene product and endogenous spectrin. The two proteins were present at comparable levels in the

embryo homogenate (lane 1), but only the truncated recombinant product was efficiently precipitated

(lane 3) and the full-length spectrin remained in the unbound fraction (lane 2).

Fig. 9: The distribution of spectrin in vivo is controlled by multiple factors acting at different sites in the

spectrin molecule. Basolateral assembly of spectrin in the copper cell depends on the PH domain (A).

Targeting in larval neurons can be mediated by either the PH domain or the ankyrin-binding domain (B).

Targeting in the salivary gland does not require either of those sites (C), but instead is likely to require a

site in the N-terminal part of the molecule. Further complexity is indicated by results in mammalian

neurons and heart showing that ankyrin can provide the primary cue for spectrin assembly (D),

independently of the PH domain. E) The head to head interaction of spectrin dimers to form tetramers

(top) is mediated by partial repeats near the C-terminus of spectrin and the N-terminus of spectrin

(middle) that form a complete triple barrel structural module. Recent models place the PH domain, which

resides downstream of the partial repeat in spectrin, as a projection away from the partial repeat so as

not to interfere with tetramer formation. However, current evidence that tetramers do not form in the

absence of the PH domain raises the possibility that the PH domain has a stabilizing role at the tetramer

formation site (bottom).

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

Supplemental Figure:

Rescue cross strategy for evaluating the effects of spectrin mutations on its biological function. A

Punnett Square illustrates the expected progeny classes for crosses between compound-X females that are

heterozygous for a test transgene insertion on chromosome 3 and specem6

mutant males. Survival of these

males depends on the presence of a duplication of part of the X chromosome to chromosome 3. The

duplication (Dp(1:3) BS3i

) includes a wild type copy of the spectrin gene that rescues spectrin

function when heterozygous. The duplication is marked with a mutation in the neighboring Bar gene that

produces an easily scored adult eye phenotype. Black squares are non-viable progeny classes. Female

progeny (upper right) are all phenotypically normal due to the presence of the wild type spectrin gene

on compound X. Male progeny (lower left) are divided into four classes. One class (yellow) is embryonic

lethal due to the absence of spectrin function. The other three classes are rescued by the duplication

(Dp), the test transgene, or both. If a transgene lacks function, then all of the rescued male progeny

exhibit the Bar eye phenotype, marking the duplication. Fully functional transgenes yield a 2:1 ratio of

Bar:non-Bar eye male progeny.

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

Table I: spectrin mutant rescue with transgenes carrying PH domain point mutations.

Total females Male siblings Rescue males Total progeny

Control KW3A 86 57 27 170

K8Q PH 91 84 47 222

K17Q PH 60 46 17 123

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Amlan Das, Christine Base, Debasis Manna, Wonhwa Cho and Ronald R. Dubreuilcytoskeleton

Unexpected complexity in the mechanisms that target assembly of the spectrin

published online February 19, 2008 originally published online February 19, 2008J. Biol. Chem. 

  10.1074/jbc.M800094200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2008/03/11/M800094200.DC1

by guest on May 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from