(176), ra37. [DOI: 10.1126/scisignal.2001726] 4Science SignalingLiqun Ma, Xuexin Zhang and Haijun Chen (7 June 2011) Conduct Inward Leak Sodium Currents in Hypokalemia

TWIK-1 Two-Pore Domain Potassium Channels Change Ion Selectivity and`

This information is current as of 3 August 2011. The following resources related to this article are available online at http://stke.sciencemag.org.

Article Tools http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37

Visit the online version of this article to access the personalization and article tools:

MaterialsSupplemental

http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37/DC1 "Supplementary Materials"

Related Content http://stke.sciencemag.org/cgi/content/abstract/sigtrans;4/184/pe35

's sites:ScienceThe editors suggest related resources on

References http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37#BIBL

1 article(s) hosted by HighWire Press; see: cited byThis article has been

http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37#otherarticlesThis article cites 54 articles, 23 of which can be accessed for free:

Glossary http://stke.sciencemag.org/glossary/

Look up definitions for abbreviations and terms found in this article:

Permissions http://www.sciencemag.org/about/permissions.dtl

Obtain information about reproducing this article:

the American Association for the Advancement of Science; all rights reserved. byAssociation for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Copyright 2008

(ISSN 1937-9145) is published weekly, except the last week in December, by the AmericanScience Signaling

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

R E S E A R C H A R T I C L E

C H A N N E L S

TWIK-1 Two-Pore Domain Potassium ChannelsChange Ion Selectivity and Conduct Inward LeakSodium Currents in HypokalemiaLiqun Ma, Xuexin Zhang, Haijun Chen*

Dow

nloaded from

Background potassium (K+) channels, which are normally selectively permeable to K+, maintain the car-diac resting membrane potential at around −80 mV. In subphysiological extracellular K+ concentrations([K+]o), which occur in pathological hypokalemia, the resting membrane potential of human cardiomyo-cytes can depolarize to around −50 mV, whereas rat and mouse cardiomyocytes become hyperpolarized,consistent with the Nernst equation for K+. This paradoxical depolarization of cardiomyocytes in sub-physiological [K+]o, which may contribute to cardiac arrhythmias, is thought to involve an inward leaksodium (Na+) current. Here, we show that human cardiac TWIK-1 (also known as K2P1) two-pore domainK+ channels change ion selectivity, becoming permeable to external Na+, and conduct inward leak Na+

currents in subphysiological [K+]o. A specific threonine residue (Thr118) within the pore selectivitysequence TxGYG was required for this altered ion selectivity. Mouse cardiomyocyte–derived HL-1 cells ex-hibited paradoxical depolarization with ectopic expression of TWIK-1 channels, whereas TWIK-1 knockdownin human spherical primary cardiac myocytes eliminated paradoxical depolarization. These findings indi-cate that ion selectivity of TWIK-1 K+ channels changes during pathological hypokalemia, elucidate amolecular basis for inward leak Na+ currents that could trigger or contribute to cardiac paradoxical de-polarization in lowered [K+]o, and identify a mechanism for regulating cardiac excitability.

stke.s

on A

ugust 3, 2011 ciencem

ag.org

INTRODUCTION

Ion channels are characterized by such parameters as ion selectivity, con-ductance, voltage sensitivity, and sensitivity to pharmacological agents.Of these fundamental characteristics, ion selectivity is generally con-sidered to be an invariant property that does not change in response tophysiological or pathophysiological stimuli (1). Indeed, evolutionary pres-sures exist to maintain channel ion selectivity constant (2). This dogmahas been challenged by data showing that the ion selectivity of purinergicreceptors and transient receptor potential cation channels can change dur-ing agonist stimulation (3–5). The ion selectivity of K+ channels is mainlydetermined by the selectivity filter, a functional unit within the pore (6–8),although the cytoplasmic N-terminal influences the ion selectivity ofTREK-1 (TWIK–related K+ channel 1) (9) and electrostatic interactionsinfluence that of GIRK (G protein–activated inwardly rectifying K+ chan-nel) (10). None of more than 80 mammalian K+ channels has been reportedto show dynamic changes in ion selectivity under physiological conditions,although several voltage-gated K+ channels conduct Na+ currents in theabsence of intracellular K+ ions (11–14), implying that the selectivity filterof K+ channels can change its conformation and selectivity.

Hypokalemia refers to blood K+ concentrations lower than the normalvalues of 3.5 to 4.8 mM. Moderate hypokalemia, with 2.5 to 3 mM bloodK+, can cause cardiac arrhythmias; more severe hypokalemia, with 1.7 to2.5 mM blood K+, can result in cardiac arrest and sudden death (15–19).Severe hypokalemia (<2.5 mM blood K+) is often observed in patientswith periodic paralysis (18, 20, 21) or kidney disease (22, 23) and cancerpatients undergoing chemotherapy (18, 24). Cardiac background K+

channels, which are open at the resting membrane potential, maintain

Department of Biological Sciences, University at Albany, State University ofNew York, Albany, NY 12222, USA.*To whom correspondence should be addressed. E-mail: hchen01@albany.edu

the cardiac resting membrane potential at around −80 mV, close to theK+ equilibrium potential (25). Under hypokalemic conditions, human car-diomyocytes can paradoxically depolarize to around −50 mV (26–28),whereas rat cardiomyocytes hyperpolarize in accord with the Nernst equa-tion for K+ (29), suggesting that the function of human but not rat cardiacbackground K+ channels is impaired in lowered [K+]o. This paradoxicaldepolarization has also been observed in human, sheep, and canine cardiacPurkinje fibers (27, 30, 31), and is crucial to the etiology of hypokalemia-induced cardiac disorders (32). In cardiac cells, paradoxical depolarizationis accompanied by a distinct phenomenon characterized by hysteresis ofthe recovery of a hyperpolarized resting membrane potential: When [K+]ois increased following paradoxical depolarization, the membrane poten-tial does not immediately return to the same value observed at that [K+]obefore the paradoxical depolarization. Instead it assumes a more depo-larized value (26, 31). An inward leak Na+ current has been suggested tocontribute to the paradoxical depolarization (30, 31). However, both thechannel through which this inward leak Na+ current flows and the mech-anism that gives rise to it remain unclear. The strong inward rectifier K+

channel (Kir2), which shows nonlinear conductance around normal rest-ing potentials and is believed to play a role in setting the resting membranepotential, has been hypothesized to mediate hypokalemia-induced para-doxical depolarization (33, 34). However, Kir2 channels cannot accountfor the inward leak Na+ currents observed in paradoxically depolarizedcardiac cells, because they do not show changes in ion selectivity inlowered [K+]o (34). Nor can Kir2 channels explain the hysteresis in restor-ing a hyperpolarized resting membrane potential from paradoxical de-polarization (30, 31). This implies that Kir2 channels alone cannot fullyaccount for hypokalemia-induced cardiac paradoxical depolarization andsuggests that other background K+ channels may also contribute to thisphenomenon.

The two-pore domain K+ channels (K2P), a subfamily of backgroundK+ channels, are dimers with each subunit containing two asymmetric

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 1

R E S E A R C H A R T I C L E

Dow

nlo

pore regions (P loop) (Fig. 1A). They mediate simple electrochemical dif-fusion of K+ through the pore (35, 36) and contribute to maintenance ofthe cardiac resting membrane potentials (25, 37, 38). The KCNK1 (potas-sium channel, subfamily K, member 1) mRNA encoding TWIK-1 (alsoknown as K2P1) has been detected in the human heart (39–41) but not inrat and mouse hearts (42, 43), in which paradoxical depolarization in re-sponse to low [K+]o does not occur, suggesting that TWIK-1 may accountfor the difference in response to low [K+]o between human and rat cardio-myocytes. Moreover, the KCNK1 mRNA is the most abundant of thoseencoding any of the cardiac K+ channels in the human atrium, the secondmost abundant in human cardiac Purkinje fibers, and is moderately abun-dant in the human ventricle (40, 41), consistent with the frequent obser-vation of paradoxical depolarization in human cardiac Purkinje fibers andhuman cardiomyocytes (26–28). Consistent with the presence of its mRNA,TWIK-1 is also found in the human atrium and ventricle (40). This suggeststhat exploration of the functional properties of TWIK-1 channels in low[K+]o could provide insight into the mechanisms underlying paradoxicaldepolarization. Here, we report that in subphysiological [K+]o that occursunder hypokalemia, the ion selectivity of TWIK-1 K+ channels changes,so that they become permeable to Na+ and conduct inward leak Na+ cur-rents that may trigger or contribute to cardiac paradoxical depolarization.

RESULTS

TWIK-1 K+ channels show altered ion selectivityand conduct inward leak Na+ currents insubphysiological [K+]oWe expressed TWIK-1 channels in Chinese hamster ovary (CHO) cells todetermine whether these K+ channels could become permeable to Na+ inlowered [K+]o. TWIK-1 wild-type (WT) channels produced a small detect-able macroscopic current in only about 1 of 18 transfected cells (fig. S1);therefore, we used TWIK-1•K274E (Fig. 1A), which contains an intra-cellular point mutation that enables the detection of TWIK-1 currents (44),as a tool for this study. As previously reported (44), TWIK-1•K274Echannels were highly K+-selective when exposed to physiological K+ gra-dients: the reversal potential shifted by 52.7 ± 1.3 mV in the depolarizingdirection for every 10-fold increase in [K+]o (Fig. 1, B and D). Reversalpotentials measured in Na+-based bath solutions with low [K+]o (0, 0.5, 1,and 2 mM), however, were far more depolarized than those predicted fromthe Goldman-Hodgkin-Katz (GHK) equation, whereas at 3 mM [K+]o, thereversal potential was close to the predicted value (Fig. 1, B to E). In con-trast, reversal potentials measured in channel-impermeable N-methyl-D-glucamine (NMDG+)–based bath solutions with the same low [K+]o are

www.SCIENCESIGNALING.org

on August 3, 2011

stke.sciencemag.org

aded from

consistent with the predicted values (Fig.1, C to E). Thus, these results suggest thatthe permeability of the channels to Na+ isincreased relative to the K+ permeability insubphysiological [K+]o. Indeed, at subphys-iological [K+]o, the relative Na

+ to K+ per-meability of the channels increased withdecreasing [K+]o (Fig. 1F), a finding con-sistent with the clinical observation that thedegree of hypokalemia correlates with theseverity of cardiac symptoms (15). Using thiscurve, we were able to predict the relativepermeability of Na+ to K+ of TWIK-1 chan-nels at any pathologically hypokalemiccondition.

Unlike most mammalian K2P channels,which show outward rectification, TWIK-1channels have a nearly linear current-voltagerelationship in physiological K+ gradients(Fig. 1) (44). This allows TWIK-1 channelsto conduct large inward Na+ currents witheven the small increase in relative per-meability of Na+ to K+ in subphysiological[K+]o. At 2 mM [K+]o, subtracting thewhole-cell currents recorded in Na+- andNMDG+-based bath solutions revealed theexistence of inward Na+ currents throughTWIK-1•K274E channels (dashed blueline, Fig. 1C). Thus, under hypokalemicconditions, TWIK-1 channels conduct in-ward leak Na+ currents at membrane po-tentials comparable to the cardiac restingmembrane potential.

Inward Na+ currents through TWIK-1channels can be measured directly in 0 mM[K+]o. Replacing 5 mM [K+]o with 0 mM[K+]o shifted the reversal potential of TWIK-1•K274E channels from −72.2 ± 0.7 to−17.3 ± 0.8 mV (Fig. 1E, n = 12 cells). In

Fig. 1. TWIK-1 K+ channels undergo a change in ion selectivity and conduct inward leak Na+ currents in sub-+

physiological [K ]o. (A) Topology of a TWIK-1•K274E subunit. (B) Whole-cell TWIK-1•K274E channel cur-

rents are shown from four different transfected CHO cells in Na+-based bath solutions with the indicated[K+]o. (C) Whole-cell current TWIK-1•K274E channel currents are shown from two different transfected CHOcells in Na+- or NMDG+-based bath solutions with 2 mM [K+]o. Dashed blue line represents net inward Na+

currents calculated from comparison of currents in the presence or absence of Na+. Quinine blockadeconfirmed that the currents recorded in Na+-based bath solutions were mediated by TWIK-1 (purple line).(D) Reversal potentials (Erev) of TWIK-1•K274E channels were plotted as a function of [K+]o. Erev values weremeasured in Na+-based (open and red filled circles, n = 10 to 53 cells) or NMDG+-based (blue filled circles, n =10 to 13 cells) bath solutions with various [K+]o. The continuous curve is a fit for open circles with the GHKequation: Erev = RT/zF *ln[(P [Na+]o + [K+]o)/(P[Na

+]i + [K+]i)], yielding a relative Na+ to K+ permeability (P ) of0.006. (E) Whole-cell currents are shown for TWIK-1•K274E channels before (black lines) and after (red lines)removal of 5 mM [K+]o in Na+-based bath solutions. (F) The relative Na+ to K+ permeability (PNa/PK) valueswere plotted as a function of [K+]o. PNa/PK values were calculated with the GHK equation using Erev valuesmeasured in (B) to (E). The superimposed single-exponential fit yielded a slope factor of [K+]o dependence at0.78 mM per e-fold increase in PNa/PK. The [K+]o range consistent with hypokalemia is marked with an orangebox. Whole-cell currents in 0 mM [K+]o represent those at equilibrium in all figures.

7 June 2011 Vol 4 Issue 176 ra37 2

R E S E A R C H A R T I C L E

Dow

0 mM [K+]o, Na+ was the only extracellular monovalent cation; thus, un-

der these conditions, the channels carried inward Na+ currents and out-ward K+ currents, and replacement of 140 mM extracellular Na+ withequimolar NMDG+ abolished the inward Na+ current (blue line, Fig.1E, n = 6 cells). Whole-cell TWIK-1•K274E currents in 0 mM [K+]o at−140 and +80 mV were increased by 6.7 ± 0.5– and 3.1 ± 0.3–fold, re-spectively, relative to their amplitude in 5mM[K+]o (Fig. 1E and table S1),indicating that the single-channel properties were altered. Quinine, a K+

channel blocker to which TWIK-1 is sensitive (45), reversibly inhibitedthese whole-cell currents (figs. S1E and S2A, n = 6 to 12). In contrast,these results were not observed with five other K2P channels (K2P2,K2P3, K2P9, K2P13, and K2P18; fig. S2).

Although whole-cell currents recorded from TWIK-1 WT channels in5 mM [K+]o were small (table S1), all of the results obtained withTWIK-1•K274E mutant channels were confirmed in TWIK-1 WT chan-nels (fig. S1). These findings support our hypothesis that TWIK-1 K+

channels become permeable to Na+ in subphysiological [K+]o and con-duct inward leak Na+ currents, which have a depolarizing effect on theresting membrane potential, and that ~3 mM [K+]o is necessary to main-tain the K+ selectivity of TWIK-1 channels.

A specific threonine within the selectivity filterdetermines the dynamic change in ion selectivity ofTWIK-1 K+ channels in subphysiological [K+]oWe investigated the molecular mechanism that gives rise to the altered ionselectivity of TWIK-1 channels at subphysiological [K+]o. The K

+ channelsignature sequence Thr-X-Gly-Tyr (or Phe or Leu)-Gly [TxGY(F/L)G, inwhich X stands for any amino acid], which constitutes the K+ selectivityfilter, is conserved in the P loop of K+ channels (6–8, 46). Mutations in anyposition of this selectivity sequence could result in marked changes in ionselectivity (6). Crystal structures indicate that the K+ channel selectivitysequence consists of four ion binding sites (S1 to S4) in the selectivity fil-ter of tetrameric K+ channels (7) (Fig. 2D). Alignment of the amino acid se-quences of two asymmetric P loops of 10 human K2P channels identifieda specific threonine (Thr118) within the TxGYG motif of the P1 loop ofTWIK-1 K+ channels, rather than a conserved isoleucine found in the othernine K2P channels (Figs. 1A and 2A). A recent crystallographic study in-dicated that a corresponding threonine in the selectivity filter acts as a Na+-binding site in NaK channels, which are nonselective cation channels (47).To determine whether the Thr118 residue plays a key role in the altered ionselectivity of TWIK-1 channels, we substituted it with isoleucine to produce

www.SCIENCESIGNALING.org

on August 3, 2011

stke.sciencemag.org

nloaded from

TWIK-1•K274E•T118I mutant channels.These TWIK-1•K274E•T118I channelswereK+-selective and did not change ion selec-tivity in lowered [K+]o (Fig. 2, B and C).

We introduced a threonine into the cor-responding residue of TASK-3 (K2P9) chan-nels and produced TASK-3•I94T mutantchannels to determine whether TASK-3•I94Tmutant channels showaltered ion selectivityin lowered [K+]o. We examined the effectsof removing 5 mM [K+]o on the reversal po-tential and ion selectivity of TASK-3•I94Tmu-tant channels. Compared to the slow kineticsobserved in TWIK-1•K274E K+ channels,the effects of removing 5 mM [K+]o in Na+-based bath solutions on whole-cell currentsmediated by TASK-3•I94T channels wererapid, taking only ~2 min to reach equilib-rium. Because TASK-3 channels show out-ward rectification and conduct small inwardK+ currents under physiological K+ gradi-ents, it was not always easy to preciselymea-sure the reversal potentials of TASK-3 andTASK-3•I94T channels in 5 and 0mM[K+]o.However, the trendof reversal potentialmove-ment in TASK-3•I94T channels was dif-ferent from that in TASK-3 channels. Afterremoval of 5mM[K+]o, the reversal potentialof TASK-3•I94T channels shifted from−75.2 ± 0.6 to−56.1 ± 1.6mV (n = 11 cells)(Fig. 3, B andC), and the relative permeabil-ity of Na+ to K+ increased from 0.005 to0.11 ± 0.01. Whole-cell currents at +60 mVof TASK-3•I94T channels were reducedto ~15%, compared to ~87% for TASK-3channels (Fig. 3, A to C). The large reduc-tion of outward K+ currents in TASK-3•I94Tchannels was consistent with increased Na+

permeability and a decrease in the cationelectrochemical driving force across the

Fig. 2. The Thr118 residue in the TWIK-1 channel P1 loop determines the altered ion selectivity inlowered [K+]o. (A) Alignment of the amino acid sequences of the P1 and P2 loops of 10 human K2Pchannels. The K+ channel signature sequence TxGY(F/L)G is marked in red and TWIK-1 Thr118 in blue.(B) Whole-cell currents are shown for TWIK-1•K274E•T118I before (black line) and after (red line) re-moval of 5 mM [K+]o in Na+-based bath solutions; no inward Na+ current was detected in 0 mM [K+]o (n =20 cells). (C) Reversal potentials (Erev) of TWIK-1•K274E•T118I channels are plotted as a function of [K+]o.Erev values were measured in Na+-based bath solutions with various [K+]o (n = 5 to 18 cells). The contin-uous curve is a fit with the GHK equation, yielding a PNa/PK value of 0.002 and a shift of reversal potentialby 54.7 ± 1.3 mV per 10-fold change of [K+]o. Erev values measured at subphysiological [K+]o match thepredicted values. (D) Conductive conformation of the selectivity filter in bacterial tetrameric KcsA K+ chan-nels is shown when the Val76 residue, corresponding to TWIK-1 Thr118, is replaced by a threonine (graysticks) (7). Four purple balls represent bound ions in ion binding sites S1 to S4. Abbreviations for the aminoacid residues are as follows: A, Ala; C, Cys; D, Asp; F, Phe; G, Gly; H, His; I, Ile; L, Leu; M, Met; N, Asn; P,Pro; S, Ser; T, Thr; V, Val; and Y, Tyr.

7 June 2011 Vol 4 Issue 176 ra37 3

R E S E A R C H A R T I C L E

cell membrane. It is also possible that lowering [K+]o regulates the unitarycurrent or open probability of TASK-3•I94T channels. In addition, reversalpotentials measured in Na+-based bath solutionswith 0.5, 1, or 2 mM [K+]owere more depolarized than predicted (Fig. 3D), indicating that the relativepermeability of Na+ to K+ was increased in these low [K+]o. Therefore,TASK-3•I94T mutant channels were K+-selective in physiological [K+]o,but became permeable to Na+ as well when [K+]o was <3 mM.

The introduction of a threonine into the corresponding residue ofTHIK-1 (K2P13) channels, however, produced THIK-1•I112T mutantchannels that were still highly K+-selective in 0 mM [K+]o (fig. S3), sug-gesting that this specific threonine residue is necessary but not alwayssufficient to produce the altered ion selectivity in K2P channels. Theseresults indicate that the Thr118 residue is a major molecular determi-nant of the altered ion selectivity in TWIK-1 K+ channels in subphysio-logical [K+]o.

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

TWIK-1 K+ channels contribute to cardiac restingmembrane potentials in low [K+]oBecause TWIK-1 channels are not found in mouse heart (43), we inves-tigated the possibility that ectopic expression of TWIK-1 channels couldcause paradoxical depolarization of mouse cardiac cells in subphysiologi-cal [K+]o. We used cultured mouse HL-1 cells, a transformed cell line ofmouse atrial cardiomyocytes that resemble mouse primary atrial cardio-myocytes in genotype and phenotype (48, 49), for this analysis; coex-pressed green fluorescent protein (GFP) was used to identify transfectedHL-1 cells. As expected, decreasing [K+]o from 4 to 1 mM caused the mem-brane potential of mouse HL-1 cells to hyperpolarize, going from −77.7 ±0.4 mV in 4 mM [K+]o (n = 33 cells) to −102.4 ± 0.6 mV in 1 mM [K+]o(n = 28 cells). However, mouse HL-1 cells in which TWIK-1 or TWIK-1•K274E channels were ectopically expressed underwent a paradoxicaldepolarization to −62.9 ± 0.9 mV (n = 20 cells) or −63.2 ± 1.0 mV (n =28 cells), respectively, in 1 mM [K+]o (Fig. 4A). In contrast, the same de-crease in [K+]o elicited hyperpolarization in mouse HL-1 cells ectopicallyexpressing either GFP alone (−100.5 ± 1.0 mV, n = 13 cells) or TWIK-1•K274E•T118I K+ channels (−100.1 ± 0.7 mV, n = 24 cells), which donot show altered ion selectivity and do not conduct inward leak Na+ cur-rents in subphysiological [K+]o (Fig. 2, B and C).

TWIK-1 K+ channels are highly abundant in the human heart; there-fore, we determined whether their knockdown could eliminate paradoxicaldepolarization in human cardiac cells. Human primary cardiac myocytes,which are spherical and lack organized sarcomeres, can be isolated fromadult ventricular tissues and proliferate in vitro. Although these cells do notshow spontaneous contractile activity in vitro, they retain many of the char-acteristics of normal cardiomyocytes (50) and can thus be used for in vitrophysiological and pharmacological studies. We found that cultured humanspherical cardiac myocytes had a resting membrane potential of −78.0 ±1.0 mV (n = 22 cells) in 4 mM [K+]o, similar to that of human rod-shapedventricular cardiomyocytes (26). In 1 mM [K+]o, 45.3% of the cultured hu-man spherical cardiac myocytes depolarized to a resting membrane poten-tial of −44.4 ± 1.0 mV (n = 34), whereas 54.7% of them hyperpolarized to−93.8 ± 0.8 mV (n = 41) (open bars, Fig. 4D). This is consistent with pre-vious observations that only a fraction of human rod-shaped ventricularcardiomyocytes shows paradoxical depolarization in lowered [K+]o (26, 27).

To determine the effects of TWIK-1 knockdown on cardiac paradoxicaldepolarization in low [K+]o, we screened a set of four human TWIK-1–specific small hairpin RNA (shRNA) plasmids. We coexpressed TWIK-1with an N-terminal GFP Tag (GFP–TWIK-1) (44) and each TWIK-1 shRNAin CHO cells and then evaluated the effects of each shRNA by examiningthe intensity of green fluorescence in transfected CHO cells. TWIK-1shRNA #1 and #3 were most effective and were chosen to knock down na-tive TWIK-1 in human primary cardiac myocytes. Retroviral delivery ofTWIK-1 shRNA #1 and #3 yielded ~70.3% and ~63.6% knockdown ofTWIK-1 in human spherical cardiacmyocytes (Fig. 4, B andC), respectively,validating the screened results in CHO cells transfected with GFP–TWIK-1.

When transduced into human spherical cardiac myocytes, neither ofTWIK-1 shRNA #1 and #3 nor scrambled shRNA had any significanteffect on resting membrane potential in 4 mM [K+]o (−78.2 ± 1.1 mV,n = 21 cells, 79.9 ± 1.3 mV, n = 9 cells, and −77.9 ± 1.4 mV, n = 20 cells,respectively). However, only 14.7% of human spherical cardiac myocytestransduced with TWIK-1 shRNA #1 showed paradoxical depolarization[to −48.2 ± 1.6 mV (n = 10)] in 1 mM [K+]o, whereas 85.3% of themhyperpolarized [to −92.3 ± 0.6 mV (n = 58)] (orange bars, Fig. 4D). Incontrast, expression of scrambled noneffective shRNA did not significant-ly change the percentage of cells showing paradoxical depolarization(45.8%, n = 38; black bars, Fig. 4D). To rule out off-target effects ofTWIK-1 shRNA #1, we repeated the knockdown experiments with

Fig. 3. TASK-3•I94T mutant channels show altered ion selectivity in sub-physiological [K+]o. (A and B) Whole-cell currents of human TASK-3 orTASK-3•I94T channels are shown before and after changes from 5 mM[K+]o (black lines) to 0 mM [K+]o (red lines) in Na+-based bath solutions.Whole-cell currents in 0 mM [K+]o were obtained at equilibrium. Dashedred line in (B) represents a whole-cell current when the bath solution waschanged back to 5 mM [K+]o for 2 min. Insets: Current traces are shownin shorter voltage ranges (−140 to −20 mV) and narrower current ampli-tudes (−200 to +400 pA) so that reversal potentials are clearly visible.(C) Summary of reversal potentials (Erev, filled black and red bars) andcurrent amplitudes at +60 mV (striped black and red bars) of TASK-3and TASK-3•I94T channels in (A) and (B) (black bars for 5 mM [K+]o;red bars for 0 mM [K+]o; n = 11 cells). Current amplitudes at +60 mVwere normalized by the values measured in 5 mM [K+]o. (D) Reversalpotentials (Erev) of TASK-3 and TASK-3•I94T channels were plotted asa function of [K+]o. Erev values measured in Na+-based bath solutions forTASK-3 (open squares, n = 5 to 29 cells) and TASK-3•I94T (filled blackand red circles, n = 11 to 18 cells) channels. Fits for open squares andfilled black circles with the GHK equation provided the relative permeabil-ity of Na+ to K+ of 0.005 and 0.006 for TASK-3 and TASK-3•I94T channels,respectively. *P < 0.001 for data in 5 mM [K+]o versus data in 0 mM [K+]o.

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 4

R E S E A R C H A R T I C L E

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

TWIK-1 shRNA #3 in human spherical cardiac myocytes. In 1 mM [K+]o,

23.6% of cells transduced with TWIK-1 shRNA #3 depolarized [to−46.5 ± 1.4 mV (n = 13)], whereas 76.4% of them hyperpolarized [to−91.9 ± 0.8 mV (n = 42)] (blue bars, Fig. 4D). Thus, knockdown ofTWIK-1 significantly reduced the percentage of cells in which paradox-ical depolarization occurred in 1 mM [K+]o in human spherical cardiacmyocytes. These results indicate that TWIK-1 K+ channels play a morecritical role in regulating cardiac resting membrane potentials in subphys-iological [K+]o than in normal [K+]o, consistent with the observation thatTWIK-1 K+ channels conduct only small ion currents in normal [K+]o(44, 51). These findings thus support the hypothesis that TWIK-1 K+

channels can trigger or contribute to cardiac paradoxical depolarizationin subphysiological [K+]o.

Our analyses of TWIK-1 knockdown (Fig. 4) suggested that humanspherical cardiac myocytes have abundant TWIK-1 K+ channels, suggest-ing that it might be possible to record TWIK-1–like currents from thesecells. Isolation of whole-cell K+ currents through native TWIK-1 channelsis difficult because of the lack of TWIK-1–specific blockers. However, theobservation that TWIK-1 channels heterologously expressed in CHO cellsconducted inward Na+ currents in Na+-based bath solution with 0 mM [K+]o(Fig. 1E and fig. S1, D and E) provided a strategy to identify TWIK-1–mediated Na+ currents in human primary cardiomyocytes with the K+

channel blocker quinine (which does not block Na+ channels). We recordedwhole-cell quinine-sensitive inward leak Na+ currents in human sphericalcardiac myocytes that underwent paradoxical depolarization (Fig. 5A);at −80 mV, the leak Na+ current amplitude was −850 ± 197 pA (n = 7cells). In contrast, these currents were not observed in human sphericalcardiac myocytes that showed hyperpolarization in lowered [K+]o (Fig. 5B).These quinine-sensitive inward leak Na+ currents are likely mediated bynative TWIK-1 K+ channels.

Kinetics of ion selectivity changes reveala conformational change in TWIK-1 K+ channelsWe studied the kinetics of the conformational change between the K+-selective and the Na+-permeable states of TWIK-1 channels by monitor-

ing the change in reversal potential while switching between 5 and 0 mM[K+]o in Na

+-based bath solutions. Removing 5 mM [K+]o induced a two-phase effect on TWIK-1•K274E channels. Within the first 60 s of changingthe bath solution, the reversal potential followed the Nernst equation forK+ and shifted in the hyperpolarizing direction, indicating that theTWIK-1•K274E channels maintained their K+ selectivity. When the re-versal potential reached −122.6 ± 1.8 mV (n = 12 cells), at about 60 s,however, it began to shift in the depolarizing direction until it reached anequilibrium at −17.3 mV (Fig. 6A), indicating that the channels alteredtheir Na+ to K+ relative permeability during this period. The time constantof the change in the relative permeability of Na+ to K+ during the secondphase was ~373 s (Fig. 6B), reflecting the process whereby the selectivityfilter changes from a K+-selective to a Na+-permeable conformation.

We attempted to restore the K+ selectivity of TWIK-1•K274E channelsby switching back to 5 mM [K+]o from 0 mM [K+]o. After 10 min, the

Fig. 4. TWIK-1 K+ channels contribute tothe resting membrane potential in lowered[K+]o. (A) Membrane potentials of mousecardiomyocyte–derived HL-1 cells without(nontransfected cells, open diamonds; trans-fected cells with GFP alone, open squares)or with ectopic expression of TWIK-1 (blackcircles), TWIK-1•K274E (red circles, posi-tive control), or TWIK-1•K274E•T118I (pinksquares, negative control) channels weremeasured in Na+-based bath solutions withthe indicated [K+]o (n=12 to 33 cells for each

experimental group). *P < 0.001 relative to other three negative controls. (B)TWIK-1–specific shRNA was validated in human spherical cardiac myo-cytes with retroviral delivery and Western blot analysis. Lanes 1 to 3 repre-sent 15 mg of total protein from three groups of human spherical cardiacmyocytes (lane 1, nontransduced cells; lane 2, cells transduced withscrambled shRNA; lane 3, cells transduced with TWIK-1 shRNA #1). Lane4 is empty. Lane 5 represents total protein from CHO cells transfected withTWIK-1•K274E channels and functions as a protein marker. TWIK-1 andGAPDHsignalsweredetected inparallel protein samples.GAPDH functionsas a loading control. (C) Effects of scrambled shRNA (black bar) or theTWIK-1 shRNAs #1 (orange bar) or #3 (blue bar) on TWIK-1 abundance in

human spherical cardiac myocytes. The TWIK-1 shRNAs #1 and #3 show70.3 ± 5.1% (n = 5 experiments) and 63.6 ± 3.2% (n = 4 experiments)knockdown efficiency, respectively, whereas scrambled shRNAhad no sig-nificant effect onTWIK-1abundance. TWIK-1 signalswere first standardizedto the GAPDH signal in the parallel protein sample and then normalized tothe similarly standardized value from nontransduced human spherical car-diac myocytes. *P < 0.001 relative to scrambled shRNA. (D) Percentage ofcells with which paradoxical depolarization or hyperpolarization occurs in1 mM [K+]o in these three groups of human spherical cardiac myocytes.*P < 0.001 relative to scrambled shRNA, n = 75 to 83 cells in eightexperiments for each group.

Fig. 5. TWIK-1–like currents are identified by quinine-sensitive inwardleak Na+ currents in human spherical cardiac myocytes in 0 mM [K+]o.(A and B) Whole-cell currents are shown in Na+-based bath solutions with0 mM [K+]o before (red lines) or after (purple lines) quinine block in humanspherical cardiac myocytes that show paradoxical depolarization (A) orhyperpolarization (B) in lowered [K+]o, respectively. Dashed purple linesare quinine-sensitive currents. n = 4 to 7 cells.

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 5

R E S E A R C H A R T I C L E

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

reversal potential had shifted to only −20.8 ± 0.8 mV from −17.3 ±1.1 mV (Fig. 6C, n = 4 cells), indicating that recovery of K+ selectivity isextremely slow. To determine whether removing bound Na+ ions in theselectivity filter could speed the recovery of K+ selectivity, we first switchedthe bath solution to 140 mM [K+]o from 0 mM [K+]o while recording bothinward and outward whole-cell K+ currents for 10 min. When we thenswitched bath solutions back to 5 mM [K+]o, it still took 40.3 ± 4.1 min(n = 3 cells) to restore the K+ selectivity (Fig. 6D). In addition, removing5 mM [K+]o with NMDG+-based bath solutions that did not contain Na+

ions also affected the selectivity filter, because the reversal potential wentto −26.3 ± 1.5 mV (n = 6 cells) within 2 min after restoration of 5 mM [K+]oin Na+-based bath solutions (Fig. 6E). Moreover, complete recovery of K+

selectivity then took 76.7 ± 4.7 min (n = 3 cells), which is consistent with theabove results that removal of bound Na+ ions in the selectivity filter accel-erates the recovery of the K+ selectivity. The slow recovery of K+ selectivityin TWIK-1 channels suggests that they may be temporarily locked in a non-selective conformation.

Ion selectivity of K+-selective and Na+-permeableTWIK-1 channelsWe next compared the ion selectivity of K+-selective and Na+-permeableTWIK-1•K274E channels. In <3 mM [K+]o, the Na

+ permeability of thechannels increased with decreasing [K+]o (Fig. 1F). We examined the rel-ative permeability of the channels for monovalent cations in the absenceof extracellular K+, the ionic condition in which the channels show thehighest Na+ permeability, with a Na+ to K+ relative permeability of ~0.52.The channels exhibited different monovalent cation selectivity in 0 mM[K+]o compared to that seen in 5 mM [K+]o (Fig. 7). The channelsshowed a permeability series of K+ > Rb+ > Na+ >> Li+ > NH4+ >>Cs+ in 0 mM [K+]o compared to a sequence of K+ > Rb+ >> NH4+ >>Cs+ ≈ Na+ ≈ Li+ in 5 mM [K+]o. Thus, they become significantly perme-

able to Na+ and Li+, but maintain a similarly high permeability to Rb+ andNH4

+, and still show K+ selectivity over Cs+ (Fig. 7). The measured reversalpotentials and calculated relative permeability in these two conditions

Fig. 6. Kinetics of the change betweenthe K+-selective and the Na+-permeablestates of TWIK-1 channels. (A) Two phasesof the effects of changing bath solutionsfrom 5 to 0 mM [K+]o on whole-cell cur-rents of TWIK-1•K274E channels. The leftpanel shows current traces obtained at 0,30, and 60 s. Current traces obtained at60-s intervals are shown in the right panel.Shifts in reversal potential are indicatedwith “DErev” and arrows. (B) Kinetics ofchanges of the relative Na+ to K+ perme-ability (PNa/PK) in (A). The continuous curveis fit with a single-exponential function,yielding a time constant of 373.3 ± 43.5 s(n = 12 cells). (C) Whole-cell currents ofTWIK-1•K274E channels are shown whena Na+-based bath solution was changedfrom 5 mM (black line) to 0 mM [K+]o(red line), and then back to 5 mM [K+]ofor 10 min (pink line). (D) Whole-cell cur-rents of TWIK-1•K274E channels are shownwhen a Na+-based bath solution with 5 mM

[K+]o (black line) was successively replaced by a Na+-based bath solutionwith 0 mM [K+]o (red line), 140 mM [K+]o (orange line), or 5 mM [K+]o(pink line). (E) Whole-cell currents of TWIK-1•K274E channels are shownwhen a Na+-based bath solution was reversibly changed from 5 mM

(black line) to a 0 mM [K+]o NMDG+-based bath solution (blue line)and then back to 5 mM [K+]o in a Na+-based bath solution for 5 min (pinkline). Quinine blockade in Na+-based bath solutions with 5 mM [K+]o con-firmed that currents in (C) and (E) (purple lines) were mediated by TWIK-1.

Fig. 7. Ion selectivity of TWIK-1•K274E channels for monovalent cationsin 5 or 0 mM [K+]o. (A to D) Whole-cell currents are shown before (black

lines) or after (red lines) removing 5 mM [K+]o in bath solutions on thebasis of the indicated monovalent cations. Quinine blockade (purple lines)confirmed that currents were mediated by TWIK-1 (n = 5 to 10 cells). Whole-cell currents are shown across a narrower voltage range in (C) and (D).

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 6

R E S E A R C H A R T I C L E

are summarized in Table 1. Surprisingly, the channels conduct large in-ward Cs+ currents in 0 mM [K+]o, although the relative Cs+ to K+ per-meability is only ~0.03. Systematic analysis of the Li+ permeability inTWIK-1 channels indicated that these channels also show altered ionselectivity to Li+ in lowered [K+]o and that decreasing [K+]o increasesthe relative Li+ to K+ permeability of the channels in a [K+]o-dependentmanner (Fig. 8). Thus, TWIK-1 K+ channels undergo marked changes inion selectivity in subphysiological [K+]o.

on Augus

stke.sciencemag.org

Dow

nloaded from

DISCUSSION

Physiological implications of hypokalemia-inducedfunctional changes in TWIK-1 K+ channelsAlthough TWIK-1–like K+ channels have not yet been identified in nativecardiac cells, our data suggest that TWIK-1 K+ channels may play a phys-iological role in the heart. In heterologous expression systems, TWIK-1 K+

channels have a low open probability in physiological K+ gradients (44).However, we found that decreasing [K+]o to <3 mM led to marked changesin the ion selectivity of TWIK-1 K+ channels and in inward and outwardcurrents through TWIK-1 K+ channels. These functional changes inTWIK-1 K+ channels would be expected to influence the resting membranepotential or the action potential or both of cardiac cells in hypokalemicconditions. Thus, TWIK-1 channels provide a previously unappreciatedmechanism to regulate cardiac excitability in subphysiological [K+]o.

Cardiac paradoxical depolarization in lowered [K+]o has been de-scribed for more than 3 decades (26–28, 30, 31), but its molecular mech-anism is still not well understood. The resting membrane potential isdetermined by a balance of inward and outward ion currents. The back-ground K+ conductances in the heart are counterbalanced by opposingcationic or chloride leak conductances and function mainly to maintaincardiac resting membrane potential (25). Previous studies have suggestedthat an inward leak Na+ current is responsible for hypokalemia-inducedcardiac paradoxical depolarization (30, 31). Kir2 channels, which showa nonlinear conductance at around the normal resting membrane potential,may contribute to paradoxical depolarization in low [K+]o (33, 34). How-

ever, Kir2 channels, which do not mediate leak Na+ currents, are unlikelyto trigger cardiac paradoxical depolarization. Voltage-gated Na+ channels,which are either closed or inactivated at membrane potentials between −90and −40 mV, cannot conduct such depolarizing background Na+ currents.We found that TWIK-1 K+ channels conduct inward leak Na+ currents inlowered [K+]o in transfected CHO cells (Fig. 1 and fig. S1) and recordedTWIK-1–like inward leak Na+ currents in human spherical cardiac myo-cytes in subphysiological [K+]o (Fig. 5A). If native TWIK-1 channels be-have similarly in the heart, such an inward leak Na+ current could triggerparadoxical depolarization, if cardiac Na+,K+-ATPases (Na+- and K+-dependent adenosine triphosphatases) and other transporters and channelsfailed to adequately compensate for it.

The slow recovery of K+ selectivity after restoration of physiological[K+]o can theoretically provide a biophysical basis to explain the hysteresisof restoring hyperpolarization from paradoxical depolarization, becauseTWIK-1 K+ channels continue to conduct inward leak Na+ currents beforecomplete recovery of K+ selectivity. Although background K+ channelsgenerally contribute only to maintenance of the resting membrane poten-tial and its restoration after depolarization (2), we found that ectopically ex-pressed TWIK-1 K+ channels conferred the ability to undergo paradoxicaldepolarization in mouse cardiomyocyte–derived HL-1 cells in lowered

t 3, 2011

Table 1. Reversal potentials and monovalent cation selectivity ofTWIK-1•K274E channels. PX/PK represents the relative permeabilityof a monovalent cation to K+. X represents the monovalent cationsRb, NH4, Cs, Li, and Na. The PX/PK values were calculated with theGHK equation as described in Fig. 1. N represents the number ofmeasured cells.

Cation

Erev (mV) PX/PK N

5 mM extracellular K+

Rb

−14.8 ± 0.6 0.56 ± 0.005 14 NH4 −55.8 ± 0.9 0.08 ± 0.003 19 Cs −73.0 ± 0.7 0.005 ± 0.001 6 Li −74.5 ± 0.6 0.003 ± 0.001 12 Na −73.3 ± 0.4 0.005 ± 0.001 53

0 mM extracellular K+

Rb

−13.6 ± 0.6 0.57 ± 0.004 17 NH4 −56.3 ± 1.0 0.10 ± 0.005 14 Cs −81.8 ± 1.5* 0.03 ± 0.005* 10 Li −44.8 ± 1.1* 0.14 ± 0.006* 10 Na −17.5 ± 0.5* 0.52 ± 0.002* 27

*P < 0.001 for data in 5 mM [K+]o versus data in 0 mM [K+]o.

Fig. 8. TWIK-1 K+ channels become permeable to Li+ in subphysiolog-ical [K+]o. (A and B) Whole-cell TWIK-1•K274E channel currents areshown from six different transfected CHO cells in Li+-based (black andred lines) or NMDG+-based (blue line) bath solutions with indicated [K+]o.Quinine blockade confirmed that currents in Li+-based bath solutionswere mediated by TWIK-1. (C) Reversal potentials (Erev) of TWIK-1•K274Echannels were plotted as a function of [K+]o. Erev values were measuredin Li+-based (open or red-filled squares, n = 6 to 12 cells) or NMDG+-based (blue circles, n = 10 to 13 cells) bath solutions with various [K+]o.The black continuous line is a fit for open squares with the GHK equa-tion, yielding a Li+ to K+ relative permeability of 0.003. Reversal poten-tials measured in Li+-based bath solutions with <2 mM [K+]o were muchmore depolarized than predicted, suggesting that the relative permeabil-ity of Li+ to K+ is increased. (D) The relative permeability of Li+ to K+ (PLi /PK)was plotted as a function of [K+]o. The superimposed single-exponentialfit yielded a slope factor of [K+]o dependence of 1.25 mM per e-fold in-crease in PLi /PK.

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 7

R E S E A R C H A R T I C L E

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

[K+]o. TWIK-1 knockdown decreased the percentage of cells in whichparadoxical depolarization occurred in human spherical cardiac myocytesin subphysiological [K+]o. Thus, in aggregate, our findings support thehypothesis that TWIK-1 channels trigger or contribute to hypokalemia-induced paradoxical depolarization in the heart.

The Kir2 channel has been hypothesized to contribute to the low [K+]o-induced paradoxical depolarization because it shows a nonlinear decreasein conductance at potentials depolarized from the K+ equilibrium potential.Decreases in [K+]o cause a progressive decline in the Kir2 conductance, sothe decreased Kir2.1 conductance is insufficient to compensate for the in-fluence of a depolarizing inward current (34). Our findings do not conflictwith this previous hypothesis. Instead, our findings supplement it by de-scribing a molecular mechanism for inward leak Na+ currents and pro-viding a biophysical basis for the hysteresis of restoring hyperpolarizationafter paradoxical depolarization.

Regulation of ion selectivity of TWIK-1 K+ channelsAlthough previous studies have shown that the selectivity filter in severalvoltage-gated K+ channels can change its conformation and selectivity inthe absence of intracellular K+ (11–14), we provide evidence showing thathighly selective ion channels can exhibit the altered ion selectivity in re-sponse to physiological or pathopathological stimuli.

We found that the ion selectivity of TWIK-1 K+ channels changeswhen [K+]o decreases from physiological to pathophysiological levels.About 3 mM [K+]o is required to stabilize the conformation of the selec-tivity filter and maintain TWIK-1 channel K+ selectivity. That is, de-creasing [K+]o to that found in hypokalemia triggers functional changesin the TWIK-1 selectivity filter. To understand the molecular mechanismunderlying the altered ion selectivity of TWIK-1 channels, we need toanswer several basic questions. First, how does lowering [K+]o trigger con-formational changes in the TWIK-1 selectivity filter? Bound Na+ ions arenot necessary for these conformational changes, because they still occurwhen external K+ is removed in NMDG+-based bath solutions (Fig. 6E).One possibility is that K+ binding sites or K+ sensors may exist near theouter mouth of the pore of TWIK-1 K+ channels. Lowering physiological[K+]o also decreases outward K

+ currents of Kv1.4 and hERG voltage-gatedK+ channels (52, 53), suggesting that extracellular K+ ions may regulatetheir pores as well.

Second, how do Na+ ions pass the TWIK-1 selectivity filter? The se-lectivity filter of tetrameric KcsA K+ channels has four ion binding sites(Fig. 2D). The KcsA selectivity filter is in a conductive conformation oropen state when all ion binding sites are accessible to ions (7). Com-pared to tetrameric K+ channels, the selectivity filters of K2P channelsare not well understood (36, 46). K2P channels are dimers (54, 55), andeach subunit contains two asymmetric P loops with the GxGY(F/L)G se-lectivity sequences. Among the 15 mammalian K2P isoforms, we foundthat TWIK-1 has a specific threonine residue within the TxGYG motif inthe P1 loop that determines the altered ion selectivity. This Thr118 residue,which may be located in the bottom of the selectivity filter, may consti-tute ion binding site 3 or 4 (Fig. 2D). Thr118 is necessary but not alwayssufficient to produce the altered ion selectivity in K2P channels, becauseintroduction of a threonine into the corresponding residue of TASK-3 orTHIK-1 channels had a much less potent or no effect on ion selectivity inlowered [K+]o (Fig. 3 and fig. S3).

Third, what happens in gating of TWIK-1 channels? Previous reportshave indicated that Kv2.1 and Shaker K+ channels become permeable toNa+ during C-type inactivation (12, 56), a gating process that originatesfrom transitions at the selectivity filter and develops with slow kinetics(57). However, both inward and outward whole-cell currents are increasedafter changes of ion selectivity in TWIK-1 channels (Fig. 1), suggesting

that C-type inactivation does not play a role in the dynamic change of ionselectivity of TWIK-1 channels.

MATERIALS AND METHODS

Molecular biologyMouse THIK-1 in pCMV-SPORT6 and mouse TRESK-2 in pCR-BluntII-TOPO plasmids were purchased from Open Biosystems. Mouse TRESK-2complementary DNA was subcloned into pMAX, a dual-purpose vectorfor Xenopus oocyte or mammalian cell expression (44). All K2P muta-tions were created by Pfu-based mutagenesis kits (Stratagene) and con-firmed by automated DNA sequencing.

Cell culture, transfection, and retroviral deliveryCHO cells were maintained in DMEM (Dulbecco’s modified Eagle’s me-dium) supplemented with 10% fetal calf serum in a 5% CO2 incubator.CHO cells were seeded in 35-mm dishes 24 hours before transfection.Cells showing at least 80% confluence were transfected by Lipofectamine2000 (Invitrogen) with 3 mg of K2P plasmids and 1 mg of pEGFP plas-mids and studied 24 hours later. GFP expression was used to identifyeffectively transfected CHO cells.

Mouse HL-1 cells were cultured in Claycomb Medium supplementedwith 10% fetal bovine serum in a 5% CO2 incubator as previously described(48). HL-1 cells at 60 to 80% confluencewere transfected with K2Por pEGFPplasmids or both by Lipofectamine 2000 for electrophysiological recordings.

Human spherical primary cardiac myocytes (PromoCell) were main-tained in the PromoCell cell growth medium in a 5% CO2 incubator and sub-cultured at 70 to 90% confluence. Because human spherical primary cardiacmyocytes have many of the characteristics of normal cardiomyocytes for atleast 15 population doublings, we used these cardiac myocytes between 2and 13 doublings for electrophysiological and biochemical experiments.

A set of five shRNA plasmids were purchased from Origene. The oligosencoding human TWIK-1–specific shRNA (TWIK-1 shRNA #1 sequence,GCACATCATAGAGCATGACCAACTGTCCT; TWIK-1 shRNA #3sequence, GCCGCTGTCTTCTCAGTCCTGGAGGATGA) or scramblednoneffective shRNA (GCACTACCAGAGCTAACTCAGATAGTACT)were cloned into retroviral pRFP-C-RS vectors in which red fluorescenceprotein (RFP) functions as an expression reporter. We screened theseTWIK-1 shRNA plasmids with fluorescence microscopy; we coexpressedeach of these plasmids with GFP–TWIK-1 plasmids in CHO cells, whichwere cultured in 35-mm dishes, and examined the intensity of green flu-orescence in transfected CHO cells under a confocal microscope (LSM510, Carl Zeiss) after 60 hours.

The effective TWIK-1 shRNA #1 or #3 was used to knock down na-tive TWIK-1 in human spherical primary cardiac myocytes. Packagingcells (RetroPack PT67 cell line, Clontech) were transfected with TWIK-1shRNA #1 or #3 plasmids by Lipofectamine 2000. After 48 hours, viruswas collected, filtered, and overlaid on human spherical cardiac myocytes,which were electrophysiologically recorded or prepared for Western blottinganalysis 3 days later.

Western blot analysisHuman spherical cardiac myocytes or transfected CHO cells were harvestedby aspirating the medium and washing twice with phosphate-bufferedsaline (PBS). Cells were then suspended in 1 ml of PBS and centrifuged.Isolated cell pellets were lysed for 20 min at 4°C in buffer containing50 mM tris-HCl, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 1% sodiumdeoxycholate, 1 mM EGTA, and protease inhibitors. Extracts were centri-fuged at 13,000g for 20 min at 4°C. Protein was quantified with the BCA

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 8

R E S E A R C H A R T I C L E

on August 3, 2011

stke.sciencemag.org

Dow

nloaded from

(bicinchoninic acid) protein assay kit (Pierce). Total proteins (15 mg) wereseparated on 10% acrylamide gel with SDS–polyacrylamide gel electro-phoresis (SDS-PAGE) and transferred to polyvinylidene fluoride mem-branes. Membranes were blocked with 5% (w/v) nonfat milk in 50 mMtris, 500 mM NaCl, and 0.1% (w/v) Tween 20 (pH 7.6) for 1 hour. Mem-branes were then analyzed with primary antibodies directed against TWIK-1(1:500) (Alomone) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(1:1000) (Santa Cruz Biotechnology). Blots were scanned and analyzedwith the image software ChemiDoc XRS (Bio-Rad).

ElectrophysiologyStandard whole-cell patch-clamp recordings were performed with theEPC-10 USB amplifier and a Dell 745 computer with PatchMaster soft-ware (HEKA Elektronik). Patch pipettes with resistances of 2.0 to 3.5 meg-ohms were used. The resistance was compensated at least 80% to minimizevoltage errors. Whole-cell currents of K2P channels heterologously ex-pressed in CHO cells were recorded each 15 s with a standard 2.2-s voltageramp from −140 to +80 mV from a holding potential equivalent to thereversal potential. Currents were low-pass filtered at 5 kHz and sampledat a rate of 2 kHz. In nontransfected CHO cells or CHO cells transfectedwith GFP alone, maximum endogenous whole-cell currents induced byvoltage ramp pulses were <250 pA, and average currents at +80 and−140 mV were around 40 and −20 pA, respectively (n = 20) (45). Max-imum TWIK-1•K274E currents <500 pAwere discarded. When measuringreversal potentials, quinine blockade was always used to confirm TWIK-1currents. For measurement of resting membrane potentials in mouse HL-1cells or human spherical primary cardiac myocytes, we built a Macro pro-gram in PatchMaster software so that the resting membrane potentialcould be measured with whole-cell current-clamp techniques within 1 to2 s of establishing the whole-cell configuration. Data analysis was per-formed with Fitmaster (HEKA Elektronik), IGOR Pro (WaveMetrics),and Excel (Microsoft). All data are presented as means ± SEM. Two-tailedStudent’s t tests were used to check for significant differences between twogroups of data.

The pipette solution contained 140 mM KCl, 1 mM MgCl2, 10 mMEGTA, 1 mMK2-ATP (adenosine triphosphate), and 5 mMHepes. The pHwas adjusted to 7.4 with KOH. The bath solution contained 135 mM NaCl,5 mM KCl, 2 mM CaCl2, 1 mMMgCl2, and 10 mM Hepes (pH 7.4). Thetotal concentration of Na+ and K+ in bath solutions was 140 mM; bathsolutions with various [K+]o were obtained by increasing or decreasingK+ and replacing it with equimolar Na+. Monovalent cation (Cs+, Li+,NH4+, and Rb+)– or NMDG+-based bath solutions with various [K+]owere obtained by replacing extracellular Na+ with equimolar monovalentcations or NMDG+.

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/4/176/ra37/DC1TextFig. S1. TWIK-1 WT K+ channels show altered ion selectivity and conduct inward leak Na+

currents in subphysiological [K+]o.Fig. S2. Effects of removing 5 mM [K+]o on TWIK-1 WT K+ channels and five other types ofK2P channels.Fig. S3. Effects of removing 5 mM [K+]o on THIK-1 WT and THIK-1•I112T mutant channels.Table S1. Reversal potentials and whole-cell currents of TWIK-1 WT and TWIK-1•K274Echannels in 5 and 0 mM [K+]o.References

REFERENCES AND NOTES1. D. Bautista, D. Julius, Fire in the hole: Pore dilation of the capsaicin receptor TRPV1.

Nat. Neurosci. 11, 528–529 (2008).2. B. Hille, Ion Channels of Excitable Membranes (Sinauer, Sunderland, MA, 2001),

p. 469.

3. B. S. Khakh, X. R. Bao, C. Labarca, H. A. Lester, Neuronal P2X transmitter-gated cationchannels change their ion selectivity in seconds. Nat. Neurosci. 2, 322–330 (1999).

4. M. K. Chung, A. D. Guler, M. J. Caterina, TRPV1 shows dynamic ionic selectivityduring agonist stimulation. Nat. Neurosci. 11, 555–564 (2008).

5. C. Virginio, A. MacKenzie, F. A. Rassendren, R. A. North, A. Surprenant, Pore dilationof neuronal P2X receptor channels. Nat. Neurosci. 2, 315–321 (1999).

6. L. Heginbotham, Z. Lu, T. Abramson, R. MacKinnon, Mutations in the K+ channelsignature sequence. Biophys. J. 66, 1061–1067 (1994).

7. Y. Zhou, J. H. Morais-Cabral, A. Kaufman, R. MacKinnon, Chemistry of ion coordinationand hydration revealed by a K+ channel-Fab complex at 2.0 Å resolution. Nature 414,43–48 (2001).

8. D. A. Doyle, J. Morais Cabral, R. A. Pfuetzner, A. Kuo, J. M. Gulbis, S. L. Cohen, B. T. Chait,R. MacKinnon, The structure of the potassium channel: Molecular basis of K+ conductionand selectivity. Science 280, 69–77 (1998).

9. D. Thomas, L. D. Plant, C. M. Wilkens, Z. A. McCrossan, S. A. Goldstein, Alternativetranslation initiation in rat brain yields K2P2.1 potassium channels permeable to sodium.Neuron 58, 859–870 (2008).

10. D. Bichet, M. Grabe, Y. N. Jan, L. Y. Jan, Electrostatic interactions in the channelcavity as an important determinant of potassium channel selectivity. Proc. Natl. Acad.Sci. U.S.A. 103, 14355–14360 (2006).

11. S. J. Korn, S. R. Ikeda, Permeation selectivity by competition in a delayed rectifierpotassium channel. Science 269, 410–412 (1995).

12. J. G. Starkus, L. Kuschel, M. D. Rayner, S. H. Heinemann, Macroscopic Na+ currentsin the “Nonconducting” Shaker potassium channel mutant W434F. J. Gen. Physiol.112, 85–93 (1998).

13. H. Gang, S. Zhang, Na+ permeation and block of hERG potassium channels. J. Gen.Physiol. 128, 55–71 (2006).

14. Z. Wang, X. Zhang, D. Fedida, Regulation of transient Na+ conductance by intra- andextracellular K+ in the human delayed rectifier K+ channel Kv1.5. J. Physiol. 523,575–591 (2000).

15. D. Garth, Hypokalemia. eMedicine Emergency Medicine, http://emedicine.medscape.com/article/767448-overview (2010).

16. A. Rastegar, M. Soleimani, Hypokalaemia and hyperkalaemia. Postgrad. Med. J. 77,759–764 (2001).

17. T. J. Schaefer, R. W. Wolford, Disorders of potassium. Emerg. Med. Clin. North Am.23, 723–747 (2005).

18. C. J. Cheng, Y. H. Chen, T. Chau, S. H. Lin, A hidden cause of hypokalemic paralysisin a patient with prostate cancer. Support. Care Cancer 12, 810–812 (2004).

19. A. Shimony, S. Bereza, A. Shalev, H. Gilutz, R. Ilia, D. Zahger, Ventricular fibrillationas the presenting manifestation of adrenocortical carcinoma. Am. Heart Hosp. J.7, 65–66 (2009).

20. F. S. Hsu, W. S. Tsai, T. Chau, H. H. Chen, Y. C. Chen, S. H. Lin, Thyrotropin-secretingpituitary adenoma presenting as hypokalemic periodic paralysis. Am. J. Med. Sci. 325,48–50 (2003).

21. S. H. Lin, T. Chau, A puzzling cause of hypokalaemia. Lancet 360, 224 (2002).22. S. H. Lin, J. S. Chiu, C. W. Hsu, T. Chau, A simple and rapid approach to hypokalemic

paralysis. Am. J. Emerg. Med. 21, 487–491 (2003).23. N. Jeck, C. Derst, E. Wischmeyer, H. Ott, S. Weber, C. Rudin, H. W. Seyberth, J. Daut,

A. Karschin, M. Konrad, Functional heterogeneity of ROMK mutations linked to hyper-prostaglandin E syndrome. Kidney Int. 59, 1803–1811 (2001).

24. M. Mohammadianpanah, S. Omidvari, A. Mosalaei, N. Ahmadloo, Cisplatin-inducedhypokalemic paralysis. Clin. Ther. 26, 1320–1323 (2004).

25. A. Gurney, B. Manoury, Two-pore potassium channels in the cardiovascular system.Eur. Biophys. J. 38, 305–318 (2009).

26. J. R. McCullough, W. T. Chua, H. H. Rasmussen, R. E. Ten Eick, D. H. Singer, Twostable levels of diastolic potential at physiological K+ concentrations in human ventricularmyocardial cells. Circ. Res. 66, 191–201 (1990).

27. G. Christé, Effects of low [K+]o on the electrical activity of human cardiac ventricularand Purkinje cells. Cardiovasc. Res. 17, 243–250 (1983).

28. J. R. McCullough, C. M. Baumgarten, D. H. Singer, Intra- and extracellular potassiumactivities and the potassium equilibrium potential in partially depolarized human atrialcells. J. Mol. Cell. Cardiol. 19, 477–486 (1987).

29. R. Bouchard, R. B. Clark, A. E. Juhasz, W. R. Giles, Changes in extracellular K+ con-centration modulate contractility of rat and rabbit cardiac myocytes via the inwardrectifier K+ current IK1. J. Physiol. 556, 773–790 (2004).

30. S. S. Sheu, M. Korth, D. A. Lathrop, H. A. Fozzard, Intra- and extracellular K+ and Na+

activities and resting membrane potential in sheep cardiac purkinje strands. Circ. Res.47, 692–700 (1980).

31. D. C. Gadsby, P. F. Cranefield, Two levels of resting potential in cardiac Purkinjefibers. J. Gen. Physiol. 70, 725–746 (1977).

32. A. Zaza, Serum potassium and arrhythmias. Europace 11, 421–422 (2009).33. R. J. Geukes Foppen, H. G. van Mil, J. S. van Heukelom, Effects of chloride transport

on bistable behaviour of the membrane potential in mouse skeletal muscle. J. Physiol.542, 181–191 (2002).

www.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 9

R E S E A R C H A R T I C L E

on Au

stke.sciencemag.org

Dow

nloaded from

34. A. F. Struyk, S. C. Cannon, Paradoxical depolarization of BA2+-treated muscle exposedto low extracellular K+: Insights into resting potential abnormalities in hypokalemic paralysis.Muscle Nerve 37, 326–337 (2008).

35. D. Kim, Physiology and pharmacology of two-pore domain potassium channels. Curr.Pharm. Des. 11, 2717–2736 (2005).

36. S. A. Goldstein, D. A. Bayliss, D. Kim, F. Lesage, L. D. Plant, S. Rajan, InternationalUnion of Pharmacology. LV. Nomenclature and molecular relationships of two-P potassiumchannels. Pharmacol. Rev. 57, 527–540 (2005).

37. C. Putzke, K. Wemhöner, F. B. Sachse, S. Rinné, G. Schlichthörl, X. T. Li, L. Jaé,I. Eckhardt, E. Wischmeyer, H. Wulf, R. Preisig-Müller, J. Daut, N. Decher, The acid-sensitive potassium channel TASK-1 in rat cardiac muscle. Cardiovasc. Res. 75,59–68 (2007).

38. X. T. Li, V. Dyachenko, M. Zuzarte, C. Putzke, R. Preisig-Müller, G. Isenberg, J. Daut,The stretch-activated potassium channel TREK-1 in rat cardiac ventricular muscle.Cardiovasc. Res. 69, 86–97 (2006).

39. F. Lesage, E. Guillemare, M. Fink, F. Duprat, M. Lazdunski, G. Romey, J. Barhanin,TWIK-1, a ubiquitous human weakly inward rectifying K+ channel with a novel struc-ture. EMBO J. 15, 1004–1011 (1996).

40. N. Gaborit, S. Le Bouter, V. Szuts, A. Varro, D. Escande, S. Nattel, S. Demolombe,Regional and tissue specific transcript signatures of ion channel genes in the non-diseased human heart. J. Physiol. 582, 675–693 (2007).

41. B. Ordög, E. Brutyó, L. G. Puskás, J. G. Papp, A. Varro, J. Szabad, Z. Boldogkoi, Geneexpression profiling of human cardiac potassium and sodium channels. Int. J. Cardiol.111, 386–393 (2006).

42. W. Liu, D. A. Saint, Heterogeneous expression of tandem-pore K+ channel genes in adultand embryonic rat heart quantified by real-time polymerase chain reaction. Clin. Exp.Pharmacol. Physiol. 31, 174–178 (2004).

43. F. Lesage, I. Lauritzen, F. Duprat, R. Reyes, M. Fink, C. Heurteaux, M. Lazdunski,The structure, function and distribution of the mouse TWIK-1 K+ channel. FEBS Lett.402, 28–32 (1997).

44. S. Rajan, L. D. Plant, M. L. Rabin, M. H. Butler, S. A. Goldstein, Sumoylation silencesthe plasma membrane leak K+ channel K2P1. Cell 121, 37–47 (2005).

45. M. Zhou, G. Xu, M. Xie, X. Zhang, G. P. Schools, L. Ma, H. K. Kimelberg, H. Chen,TWIK-1 and TREK-1 are potassium channels contributing significantly to astrocytepassive conductance in rat hippocampal slices. J. Neurosci. 29, 8551–8564 (2009).

46. K. H. Yuill, P. J. Stansfeld, I. Ashmole, M. J. Sutcliffe, P. R. Stanfield, The selectivity,voltage-dependence and acid sensitivity of the tandem pore potassium channelTASK-1: Contributions of the pore domains. Pflugers Arch. 455, 333–348 (2007).

47. A. Alam, Y. Jiang, Structural analysis of ion selectivity in the NaK channel. Nat. Struct.Mol. Biol. 16, 35–41 (2009).

48. W. C. Claycomb, N. A. Lanson Jr., B. S. Stallworth, D. B. Egeland, J. B. Delcarpio,A. Bahinski, N. J. Izzo Jr., HL-1 cells: A cardiac muscle cell line that contracts andretains phenotypic characteristics of the adult cardiomyocyte. Proc. Natl. Acad.Sci. U.S.A. 95, 2979–2984 (1998).

w

49. S. M. White, P. E. Constantin, W. C. Claycomb, Cardiac physiology at the cellularlevel: Use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structureand function. Am. J. Physiol. Heart Circ. Physiol. 286, H823–H829 (2004).

50. M. Koller, B. O. Palsson, J. R. W. Masters, Eds., Human Cell Culture: Primary Mes-enchymal Cells (Kluwer Academic Publishers, New York, 2001), vol. 5, pp. 103–124.

51. S. Feliciangeli, S. Bendahhou, G. Sandoz, P. Gounon, M. Reichold, R. Warth,M. Lazdunski, J. Barhanin, F. Lesage, Does sumoylation control K2P1/TWIK1 back-ground K+ channels? Cell 130, 563–569 (2007).

52. L. A. Pardo, S. H. Heinemann, H. Terlau, U. Ludewig, C. Lorra, O. Pongs, W. Stühmer,Extracellular K+ specifically modulates a rat brain K+ channel. Proc. Natl. Acad. Sci. U.S.A.89, 2466–2470 (1992).

53. M. C. Sanguinetti, C. Jiang, M. E. Curran, M. T. Keating, A mechanistic link betweenan inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassiumchannel. Cell 81, 299–307 (1995).

54. F. Lesage, R. Reyes, M. Fink, F. Duprat, E. Guillemare, M. Lazdunski, Dimerization ofTWIK-1 K+ channel subunits via a disulfide bridge. EMBO J. 15, 6400–6407 (1996).

55. C. M. Lopes, N. Zilberberg, S. A. Goldstein, Block of Kcnk3 by protons. Evidence that2-P-domain potassium channel subunits function as homodimers. J. Biol. Chem. 276,24449–24452 (2001).

56. L. Kiss, J. LoTurco, S. J. Korn, Contribution of the selectivity filter to inactivation inpotassium channels. Biophys. J. 76, 253–263 (1999).

57. L.G.Cuello,V.Jogini,D.M.Cortes,A.C.Pan,D.G.Gagnon,O.Dalmas,J.F.Cordero-Morales,S. Chakrapani, B. Roux, E. Perozo, Structural basis for the coupling between activationand inactivation gates in K+ channels. Nature 466, 272–275 (2010).

58. Acknowledgments: We thank L. K. Kaczmarek, S. A. Goldstein, F. Lesage, andD. Thomas for providing K2P plasmids; W. C. Claycomb for providing cultured HL-1cells; and S. H. Heinemann, J. Schmidt, and G. Lnenicka for comments on the man-uscript. Funding: This work is supported by an American Heart Association Scien-tist Development Grant, start-up funds, and a Faculty Research Award Program Aaward from State University of New York-Albany (to H.C.). Author contributions:H.C. designed the experiments, analyzed and interpreted the data in electrophysiol-ogy, and wrote the manuscript. L.M. performed experiments on molecular biology,Western blot analysis, and electrophysiology in CHO cells, mouse HL-1 cells, andhuman primary cardiac myocytes. X.Z. performed electrophysiological experimentsin CHO cells and mouse HL-1 cells. Competing interests: The authors declare thatthey have no competing interests.

Submitted 30 November 2010Accepted 18 May 2011Final Publication 7 June 201110.1126/scisignal.2001726Citation: L. Ma, X. Zhang, H. Chen, TWIK-1 two-pore domain potassium channelschange ion selectivity and conduct inward leak sodium currents in hypokalemia. Sci.Signal. 4, ra37 (2011).

gu

ww.SCIENCESIGNALING.org 7 June 2011 Vol 4 Issue 176 ra37 10

st 3, 2011