T ~ t i JOURNAL OF BIOLOGICAL CnEnmw 0 1993 by The American Society far Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 23, Issue of August 15, pp. 17057-17062,1993 Printed in U.S.A.

Cloning, Nucleotide Sequence, and Expression of a p-Hydroxybenzoate Hydroxylase Isozyme Gene from Pseudomonas fluorescens*

(Received for publication, February 4, 1993, and in revised form, April 12, 1993)

Barry Shumanf and Thomas A. DixfEin From the Departments of $Chemistry and $Biological Chemistry, UniuersitJ of California, Iruine, California 92717

A gene encoding for a putative isozyme of p-hydroxy- benzoate hydroxylase (PHBH) has been isolated from Pseudomonas fluorescens (ATCC 13525). Acomparison of the translated amino acid sequence with that of the known PHBH from €? fluorescens revealed that the new enzyme contains 3 additional amino acids and has 73% absolute homology to the previously known enzyme; conservation of secondary and active-site structures im- plied that the isozyme and known enzyme share the same general tertiary structure. Subsequent expression of the isozyme in Escherichia coli produced an enzyme with a specific activity about half that of the previously characterized PHBHs from P. fluorescens and Pseudomo- nas aeruginosa; in addition, somewhat weaker binding affinities for both NADPH and p-hydroxybenzoate were observed. Speculations are made on the reason for the existence of the isozyme, which does not appear to be expressed routinely in P. fluorescens.

p-Hydroxybenzoate hydroxylase (PHBHP (EC 1.14.13.2) from Pseudomonas fZuorescens is a FAD-containing monooxy- genase that catalyzes Reaction 1. PHBH has been the primary

60; REACTION 1

model system used to elucidate the mechanism for flavin-de- pendent activation of O2 for addition to a substrate (Spector and Massey, 197213; Entsch et a.l., 1976; Husain and Massey, 1979; Entsch, 1990); it also performs both one- and two-electron reductions of O2 to 0; a n d HsOz, respectively, when oxygen activation is uncoupled from substrate hydroxylation (Spector and Massey, 1972a). While PHBH is quite specific for its sub- strate, the existence of mammalian flavin-dependent monoox- ygenases that catalyze a wide variety of oxygen transfer reac- tions (Walsh, 1980; Ziegler, 1988, 1990; Ghisla and Massey, 1989) indicates that the catalytic potential of this class of en-

grant from the University of California at Irvine. The costs of publica- * This work was supported in part by a biotechnology development

tion of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “uduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequenceis) reported in this paper has been submitted to the GenBankTMIEMBL Data Bank with accession numberis) L13747. ll To whom correspondence should be addressed. Tel.: 714-856-5455;

Fax: 714-725-2210. ’ The abbreviations used are: PHBH, p-hydroxybenzoate hydroxy-

lase; PCR, polymerase chain reaction; IF’TG, isopropyl-l-thio-P-D-galac- topyranoside; X-Gal, 5-bromo-4-chloro-3-indolyl P-n-galactoside; HPLC, high-pressure liquid chromatography; bp, base pair(s).

zymes is relatively untapped. Crystal structures of the PHBH enzyme-substrate and enzyme-product complexes are available (Schreuder et al., 1988, 1989); thus, the enzyme is an ideal candidate for site-directed mutagenesis structure-function studies with the development of general oxygen transfer cata- lysts as a desirable, and feasible, goal (Ulmer, 1983).

PHBH from P fluorescens was cloned recently (Westphal et al., 1990); in addition, a closely related PHBH from Pseudomo- nas aerugin.osa was cloned a few years ago (Entsch et al., 1988). In an a t tempt to clone the enzyme from F? fluorescens, a gene was isolated that appeared to code for a protein with significant homology to the originally characterized enzyme. This paper reports the full sequence of this gene and compares the trans- lated amino acid sequence to that of the known PHBH. In addition, expression of the gene and purification of the enzyme were achieved, and kinetic data comparing the new to the orig- inal enzyme are reported.

E~ERIMENTAL PROCEDURES Materials-The following compounds were purchased from Sigma:

p-hydroxybenzoic acid, dithiothreitol, formamide, tetracycline, ampicil- lin, random hexanucleotide primers, DNase I, NADPH, SDS molecular weight markers, and the restriction enzyme SmaI. A I? fluwescens genomic DNA library constructed in Agtll (Clontech Laboratories, cat- alog No. XL1351b) was obtained from Clontech Laboratories; the F fluorescens DNA was prepared originally by us as described below. Geneclean@ was from Bio 101 (La Jolla, CAI. DNA primers were syn- thesized by Genosys Biotechnologies, Inc. (The Woodlands, “X). LU-~~PI~ATP (3000 Ciimmol) and cy-”S-dATP (1200 CVmmol) were fmm Du Pont-New England Nuclear. The pBluescript SN-1 vector, XL1-Blue cells, Escherichia coli Y1090 cells, and Klenow fragment were from Stratagene (La Jolla, CA). SequenasbVersion 2.0 DNApolymerase and T4 polynucleotide kinase were from United States Biochemical Corp. Sea Kernm GTG agarose was from FMC (Rockland, ME). Nitrocellulose filters [HATF) were from Millipore. EcoRI, BamHI, KpnI, SacI, NdeI, PuuII, HindIII, T4 DNA ligase, calf intestinal alkaline phosphatase, X-Gal, and isopropyl-l-thio-~-~galactopyranoside (IPTG) were from Boehringer Mannheim. Taq DNA polymerase was from Perkin-Elmer Cetus Instruments, A-Hind111 digest was from New England BioLabs, Inc. (Beverly, MA), and 6x174 replicative form HaeIII digest was from Life Technologies, Inc. EcoRI 10-mer phosphorylated linker was from Promega Biotec. BL211DE3) cells were from Novagen (Madison, WI). Hydroxylapatite (Bio-Gel HT) was from Bio-Rad, Sephadex G-100 was from Pharmacia LKB Biotechnology Inc., Cibacron blue F3G-A was from Fluka (Ronkonkoma, NY), and Aquacide I was from Calbiochem. All enzymes were used in accordance with the manufacturer’s instruc- tions unless otherwise noted. Basic laboratory chemicals were pur- chased from Fisher at the highest available level of purity.

Instrumentation-The thermal cycling for the polymerase chain re- action (PCR) was performed in a programmable heat block (Perkin- Elmer Cetus Instruments). Spectrophotometric measurements were made using a Perkin-Elmer Cetus Lambda 4A UVNis spectrophotom- eter interfaced with an ESC personal computer. Data were acquired and analyzed using W S spectroscopy software from Sofkways (Moreno Val- ley, CA). The temperature for Lc’v time course studies was controlled to within t l “C by use of a Lauda Instruments thermostated circulating water bath plumbed to the spectrophotometer. Either a Sorvall (RCZB, GS3t or an Eppendorf microcentrifuge was used for precipitations. A

17057

17058 Isolation and Expression of PHBH Isozyme Gene

Model W-185-F sonicator (Heat Systems-Ultrasonics, h e . , Plainview, NY) equipped with a microtip was used for cell lysis. HPLC was per- formed with a Waters system interfaced with an IBM AT personal computer running Maxima software (Waters).

DNA Manipulations-Genomic DNA was isolated (Davis et al., 1986) from E? fluorescens (ATCC 13525) grown to the end of log phase at 25 "C on medium containing 3.6 giliter K,HPO,,, 1.0 giliter NH,CI, 4.0 giliter NH4NO:,, 200 mgiliter MgSO4.7H,O, 0.1 mgiliter FeCl,, and 2.1 gfliter p-hydroxyhenzoic acid (Howell et al., 1972). The medium was titrated to pH 7.0-7.2 with NaOH. Plasmid DNA minipreps were performed ac- cording to standard protocols (Sambrook et al., 19893. DNA was rou- tinely purified from solution or agarose gels by following the GeneCleanO procedure supplied by the manufacturer. Sizes and quan- tities of DNA fragments were typically estimated from visual compar- isons with DNA molecular weight standards (either A-Hind111 digest or 6x174 replicative form HaeIII digests).

PCR Protocol-The mixed primers 5'-CCRTGYTGCATNGGYTC-3' and 5'-ATGAARACNCARGTNGC-3' ( N = AGTC, Y = TC, and R = AGI were used for the polymerase chain reaction. Thirty amplification cycles took place in a 10O-pl solution consisting of I mM primers, 0.5 mM dNTPs, 0.5 pg of E? fluorexens genomic DNA, 5 units of Taq DNA polymerase, and reaction huffer. The 10 x reaction buffer consisted of 100 mM "Tis-HCI, pH 8.3, 500 mhf KCI, 15 mM MgC12, and 0.1% (wiv) gelatin. The sample was overlaid with 100 pi of mineral oil and dena- tured at 94 "C. Annealing was done over 3 min a t 45 %, and polymer- ization was accomplished during 3 min a t 72 "C. Each polymerization cycle was increased by 5 s, and the last cycle was extended by 10 min.

SubcEoning of PCR Fragment-The pBluescript SKi-! vector was digested with SmaI and then dephosphorylated with calf intestinal alkaline phosphatase to block self-ligation. The PCR fragment was phosphorylated with T4 polynucleotide kinase and then ligated into the vector with T4 DNAtigase. The ligation mixture contained, in 15 PI, 13 units of T4 DNA ligase, 1 pl of 7.5 mM ATP, 0.05 pg of vector, 0.05 pg of PCR fragment. and 1.5 p1 of buffer. The buffer consisted of 200 mM Tris-HCl, pH 7.6, 50 ma1 MgCl,, and 50 mM dithiothreitol. The reaction was allowed to proceed for 8 h a t -16 "C. The recombinant vector was transformed into XL1-Blue cells that had been made competent by calcium chloride treatment (Sambrook et al., 1989). The transformation was performed according to a Stratagene protocol. Recombinant plas- mids were selected for on LB plates (containing 100 pg/ml ampicillin and 10 pg/ml tetracycline) that had been spread with 100 pl of 1.00 mw IPTG and 40 p1 of 2% X-Gal (in dimethyiformamide) 30 min prior to plating.

Preparation of Radiolabeled Probe-Insert DNA was removed from Bluescript by treatment with BamHI and EcoRI. The probe was then radiolabeled with Ia-:'2PldATP as described by Sambrook et al. (1989), except that SequenaseO Version 2.0 DNA polymerase was used in place of the Klenow fragment of E. coli DNA polymerase I. The reaction mixture, which included random hexanucleotide primers and [CY-"~PJ~ATP (3000 Ci/mmol), was allowed to sit at room temperature for 7 h. The radiolabeled product was estimated, by comparison with mo- lecular weight standards on an agarose gel, to be >600 bp.

Screening of Bacteriophage Agtll Library-The insert DNA for the I! fluorescens DNA library had been prepared by first mechanically shear- ing the high molecular weight DNA to random fragments. The ends were then flushed with Klenow fragment, and EcoRI linkers were added. The insert DNA was then cut with EcoRI and size-fractionated on a Sepharose column. Fractions of >5OO bp were combined and ligated into Agtll. The library contained 1.5 x 10, recombinants with an aver- age insert size of 3.5 kilobases. E. coli Y1090 served as the plating bacteria. Plaque hybridization was performed by a modification of the method of Benton and Davis (1977). Briefly, A plaques, immobilized on nitrocellulose filters, were prehybridized for 1-2 h at 42 "C in a solution of 50% formamide, 6 x SSPE (1 x SSPE = 0.15 M NaCl, 0.01 M NaH2P0,, 1 mM EDTA, pH 7.41, and 0.05 x BLOTTO. 1 x BLOTTO consists of 5% nonfat dried milk dissolved in water containing 0.02% sodium azide. Approximately 2 x lo7 cpm of the ""P-labeled probe, denatured by heating at 100 "C for 5 min, was added to the prehybridization solution. The hybridization was allowed to proceed overnight (12 h i a t 4 3 4 4 "C. The filters were then washed three times in a solution of 2 x SSC (1 x SSC = 0.15 M NaCI, 15 mM Na3 citrate, pH 7.0) and 0.1% SDS a t room temperature. Finally, the filters were washed twice for 1-1.5 h in a solution of 1 x SSC and 0.1% SDS at 68 "C. The filters were autorad- iographed with Kodak XAR-5 film a t -70 "C with an intensifying screen.

Subcloning of DNA lnserts from Positive ut11 Clones-Large quan- tities of bacteriophage A from the positive clones were prepared by infecting E. coli Y1090 at high multiplicity (Sambrook et al., 1989), and

the DNAs were isolated by the method of Yamamoto et al. (1970). The insert DNA was removed by KpnI and SacI digestion and ligated into Bluescript that had been treated with KpnIISacI and dephosphorylated. Plasmid DNA was obtained, and the insert was again released by KpnI/ SacI digestion. Further elimination of the h g t l l DNA was obtained by digestion with NdeI and PuuII. The DNA was then blunt-ended by treatment with Klenow fragment and the appropriate components nec- essary for polymerization. Phosphorylated EcoRI linkers, in 20-fold mo- lar excess, were then ligated to the DNA, and this in turn was ligated to pBluescript SK(-1 that had been digested with EcoRI and treated with calf intestinal alkaline phosphatase. Transformation and plasmid DNA isolation were accomplished as described above, Treatment with Hind111 afforded three cuts: one within the polylinker region upstream from the PHBH isozyme gene, a second within nonessential P. fluore- scens DNA, and a third a t bp 446 (see Fig. 1). The nonessential DNA was removed, and the remaining two fragments were religated and sequenced to determine if the orientation was correct.

DNA Sequencing-All plasmids were sequenced by the dideoxynu- cleotide sequencing method (Sanger et al., 1977) utilizing the Sequen- ase@ Version 2.0 kit (United States Biochemical Corp.) and a-R5S-dATP 11200 Ci/mmol). The primers used were either those used in the PCR reaction or 5'-GCGGCCCAACTGGTCAC-3' (nucleotides 762-7781, 5'- ACCGTGAAAACCATCAC-3' (nucleotides 498-4821, 5"ACTGGC- CGAGCAGCAAT-3' (nucleotides 67-51), the T3 primer (5'-ATTAAC- CCTCACTAAAG-3'1, or the M13 forward (position -401 primer (5'-

Gene Expression-The recombinant plasmid containing the entire isozyme gene was transformed into BL21(DE3) cells that had been made competent by calcium chloride treatment (Sambrook et al., 1989). A single colony was picked from a fresh LB plate containing ampicillin (100 pg/ml) and grown a t 37 "C with vigorous shaking in M9 medium containing 1.0 giliter NH,Cl, 3.0 g/liter KH2P04, 6.0 giliter Na2HP04, 0.25 gfliter MgSO,, and 4.0 giliter glucose. Ampicillin was added at a concentration of 200 pg/mI. When the culture reached an A,,, of 0.2, IPTG was brought to a concentration of 0.5 m", and 1 ml of LB medium (10 giliter Bacto-Tryptone, 5 giliter Bacto-yeast extract, 10 g/liter NaC11 was added for every 60 ml of M9 medium present. The medium was also supplemented with an additional 200 pg of ampicillin/ml. The culture was grown to an AWo of 1.1-1.2 and then collect.ed by centrifugation (5000 rpm, 4 "C, 60 minf.

Protein Purification-The following protocol evolved from the meth- ods of Muller et al. (1979) and Entsch (1990). The purification was conducted a t 4 "C. For all purification steps, PHBH activity was mon- itored by following the rate of p-hydroxybenzoate-dependent oxidation of NADPH at 340 nm at 25 "C (Entsch et al., 1976). The cells (from 3 liters) prepared as described above were centrifuged and taken up in 40 ml of potassium phosphate (50 mM), pH 7.25, containing 0.3 mM EDTA and 0.3 mMp-hydroxybenzoic acid. One mg of DNase I was added, and the cells were stirred for 15 min. Cells were lysed by sonication a t 4 "C for 90 s! followed by a 60-min centrifugation as described above. The supernatant was taken to 25% saturation with ammonium sulfate and recentrifuged (30 mini; the activity remained in the supernatant. The enzyme was then precipitated by adding ammonium sulfate to 60% saturation and centrifuging. The pellet was suspended in 10 ml of potassium phosphate (7.0 mM), pH 7.0, and dialyzed against two 2-liter changes of the same buffer. This solution was then loaded onto a hy- droxylapatite column that had been equilibrated with the loading buffer. The column was washed with 1 bed volume of potassium phos- phate (8.0 m ~ ) , pH 7.0, followed by potassium phosphate (48 mM), pH 7.0. Fractions containing activity were pooled and added to a Sephadex- Cibacron blue affinity column (Muller et al., 1979; Bohme et al., 1972). The column, which had been previously equilibrated with Tris maleate (10 mM), pH 7.0, was washed with the same buffer containing 0.2 Y KC]. The eluted enzyme was then placed in a dialysis bag and concentrated to -5 ml using Aquacide I. The solution was then subjected to a series of ammonium sulfate fractionations i15, 20, 25, 30, 35, 40, 50, 60, and 70%); precipitation occurred in the 50-70% ammonium sulfate fraction- ations. Protein content a t all stages was determined by the method of Lowry (1951) using Sigma's protein assay kit. SDS-10% polyacrylamide gel electrophoresis was performed by the method of Laemmli (1970).

Product Analysis-Products were identified by analyzing reaction mixtures containing 0.33 mMp-hydroxybenzoate and 200 p~ NADPH in Tris sulfate (33 mM), pH 7.9, containing 0.33 mM EDTA. Reactions were initiated a t 25 "C by adding catalytic amounts of enzyme. Aliquots were periodically acidified with trichloroacetic acid and separated isocrati- cally with a C1, HPLC column using 20% methanol and 0.1% acetic acid a t a 1.2 mumin flow rate (Entsch et al., 1991). Products were detected a t 260 nm and identified by co-migration with standards.

GTTTTCCCAGTCACGAC-3').

Isolation and Expression of PHBH Isozyme Gene 17059

Kinetic Characterization of Purified Protein-The dissociation con- stants for the enzyme-p-hydroxybenzoate and enzyme-NADPH com- plexes were determined at 4 ”C in potassium phosphate (50 mw), pH 6.6, containing 10 mM EDTA, Experiments were conducted in a manner similar to that described by Husain and Massey (1979) and Howell et (11. (1972). To determine the binding of p-hydroxybenzoate to the oxidized enzyme, 33 VM PHBH was titrated with increasing amounts of p-hy- droxybenzoate (0.025-0.065 mM), and the decrease in absorbance at 497 nm was recorded. After correcting for dilution, a double reciprocal plot of the absorbance decrease at 497 nm as a function of p-hydroxyben- zoate concentration was obtained. The dissociation constant was calcu- lated from the slope and intercept by the method of Benesi and Hilde- brand (1949). To determine the dissociation constant for the enzyme- NADPH complex, a 10 p~ enzyme solution was first reduced with sodium dithionite. The solution was then slowly oxidized until the ab- sorbance a t 450 nm reached a maximum. The solution was made an- aerobic by alternate evacuations and flushings with nitrogen. Anaerobic solutions of NADPH (0.071-1.4 mM) were added, and the decreases in absorbance a t 450 nm were recorded uersus time. The data were then fit to a first-order rate equation, and the individual rates of enzyme re- duction were obtained. The dissociation constant was then calculated from a double reciprocal plot of the rate of reduction L’ersus NADPH concentration by the method of Benesi and Hildebrand (1949).

RESULTS

Isolation of Partial PHBH Gene-A PCR amplification was performed on genomic DNA from F! fluorescens, primed by two mutiply degenerate 17-mers corresponding to the coding region for the NH2 terminus (bp 10-26) and bp 829-845 (Fig. 1) of the original PHBH amino acid sequence (Weijer et al., 1983; Wijnands et al., 1986). Thirty rounds of amplification yielded three bands of DNA (0.85, 0.5, and 0.3 kilobases; molecular weights were estimated by comparison with +X174 replicative form DNAIHueIII fragments). The 850-bp fragment was ligated into pBluescript SK(-), and the recombinant plasmids were used to transform XL1-Blue cells under selective pressure (ampicillin, tetracycline). Plasmid DNA was prepared from eight positives as evidenced by the blue/white color selection produced by X-Gal and IPTG. Five of these had a 850-bp insert that could be released upon treatment with BamHI and EcoRI. A partial DNA sequence of three of these yielded one (pBL850) that appeared to code for a protein with significant structural homology to the original PHBH (Weijer et al., 1983; Wijnands et al., 1986); the other two coded for unrelated proteins.

Isolation of Positive Clones from Agtll Library-A radiola- beled probe was prepared as follows. The insert was first ex- cised from pBL850 with BamHI and EcoRI, followed by dena- turation and primer extension using random hexanucleotide primers. The probe, which contained the 836-base insert plus 21 bases from pBluescript SK(-), was used to screen a Agtll library of I! fluorescens DNA. Screening of 25,000 plaques, in duplicate, yielded 15 positives. Eleven of these were isolated as individual A clones upon rescreening. After amplification, in- sert DNA from five of these Agtll clones was isolated by cutting with the restriction endonucleases KpnI and SacI. These en- zymes were used after repeated attempts to release the insert DNA with EcoRI had failed. This failure may have been due to the loss of a base(s) from the EcoRI site (see “Experimental Procedures”) during the ligation into AgtlL2 These five inserts, which ranged in size from 3.5 to 5 kilobases (this included 2. l-kilobase vector DNA), were subcloned into Bluescript. Sub- sequent digestions with NdeI, PvuII, and Hind111 (see “Exper- imental Procedures”) afforded a construct of sufficient length to contain the full-length gene and T7 promoter sequence.

DNA Sequence of PHBH Gene with Predicted Primary Struc- ture of Protein-The isolated gene, with the presumptive pro- moter region, was sequenced in its entirety. The open reading frame encoded for a protein of 397 amino acid residues, which

Clontech Laboratories, personal communication

: 56

3 i u LEULEULYSALRTYRAhGGLUGLYRGLYGLi’LEULEUGLUARGTYRSE~lLECYSLEUARGAHGILETRFLYS LEULEULYS~TYRAhGGLUGLYhRG~LEULEUGLU~TYRSERA~lLECYSLEUARGARG~T.~LYS

. .~

T T G C T C A A G G T C T A T C G C G A G G G G C G G G T G G A C C T G C T G G 1023

ALirGLUARGPHESERTRPTRPPMETTHRSERVALLEUHISRRGPF.EPROASPTHRRSPA~PtiESERtiL~ARG~LEGL1.I 364

A L R G L U A R G P H E S E R T Y R T R P M E T T H R S E ~ 1 , E U H I S ~ P H E P R C ~ S P ~ P H E S E R G ~ N A R G I L E ~ GCCGAACGGTTTTCCTGGTGGATGACTTCGRTGTTGCACCAGTTTCCGGAGGCCGACGGGTTCAG~CAGCGCATTGCC

1101

GLNTHRGLULEUGLUTYRTYRLEUGLYSERGLUALAGLYLEU~THRlLE~GLUASNTYRVALG1,YLEUPROTYR 390

~ G L U L E U B L B T Y R S E R G L U ~ G L Y ~ T f i R I L E ~ t i L U A S N T Y R V A L G L Y L E U P R O T Y R GAGAGCGAGCTTGCGTATTTCATCAGCTCCGAGGCGGGCCGC~CCATCGCAG~TTACGTCGGGCTTCCTTAC

1119

GLUGLUILEGLU 394

GLUALAILEGLU”+ GAAGCTATCGAGTAG

1191

FIG. 1. DNA sequence of isozyme and deduced amino acid se- quence. The top protein sequence is that of PHBH from l? fluorescens (Weijer et al., 1983; Wijnands et al., 1986). Underlining of amino acids indicates nonhomology between the two proteins.

was 3 residues longer than the known PHBHs from F! fluore- scens (Fig. 1) and F! aeruginosu. (For ease of discussion, the 3 additional amino acids at the NH2 terminus will be designated as -3, -2, and -1, respectively.) In the construct used for ex- pression, the presumed ribosome-binding site appeared 11

17060 Isolation and Expression of PHBH Isozyme Gene

bases upstream from the start codon and 53 bases downstream from the T7 promoter.

Gene Expression-Growth in M9 medium with glucose pro- duced -10 times more of the desired protein than obtained with LB medium. Induction at an Asoo of either 0.2 or 0.6 gave comparable amounts of target protein, although the ratio of target protein to total protein appeared to be greater when induction occurred at an AGO0 of 0.2. Growths beyond Asoo of 1.1-1.2, for the cells induced at 0.2, resulted in smaller amounts of desired protein. A concentration of 0.5 mM IPTG typically allowed target protein to accumulate to 10% of the total cell protein. Ten mM IPTG resulted in 2-3 times more target protein, but due to economic considerations, 0.5 mM IPTG was used.

Characterization of Enzyme-The enzyme was purified as described above, yielding a single polypeptide of >95% purity (gel visualization, Fig. 2). Table I provides a chronicle of the purification; recovery efficiencies were comparable to those seen previously in the purification of the original I! fluorescens PHBH (Husain et al., 1978; Muller et al., 1979; Entsch, 1990). The molecular weight was calculated to be 44,112 compared to 44,293 for PHBH from I! fluorescens. The HPLC assays re- vealed the formation of 3,4-dihydroxybenzoic acid (retention time of 11.8 min) as the sole product. Its formation was stoi- chiometric with the disappearance of both NADPH and p-hy- droxybenzoic acid (retention time of 7.9 min), indicating the hydroxylation was 100% efficient and that no Hz02 was formed. The enzyme was specific for NADPH; NADH would not serve as the electron donor. In addition, no NADPH turnover occurred in the absence of substrate. The specific activity was determined to be 25.0 unitslmg, about half that observed with PHBHs from P. fluorescens and I? aeruginosa (Table 11). It should be noted that different specific activities and dissocia- tion constants have been reported for PHBHs from l? fluore- scens and l? aeruginosa (Table 11). The two enzymes differ only at amino acids 228 (Thr (I! fluorescens) and Ser (I! aerugi- nosa)) and 249 (Ala (I! fluorescens) and Ser (l? aeruginosa)) (Entsch et al., 1988). These different values appear to be due to variances in experimental procedure rather than to differences in the properties of the two enzymes.

The binding of p-hydroxybenzoate to the oxidized enzyme caused large spectral perturbations in the enzyme-bound FAD, which were identical to those of the previously characterized PHBH (Husain and Massey, 1979). The changes in absorbance at 497 nm as a function of substrate concentration (Fig. 3) yielded a dissociation constant of 69 p ~ , a value higher than

FIG. 2. SDS-10% polyacrylamide gel electrophoresis of PHBH isozyme purification stained with Coomassie Blue. Lanes 1 and 6, bovine albumin ( M , = 66,000) and egg albumin ( M , = 45,000); lane 2, cell-free extract; lane 3, hydroxylapatite column; lane 4, Cibacron blue column; lane 5, final ammonium sulfate precipitation.

TABLE I Summary of purification of PHBH isozyme (based on 1-liter growth)

s tep Total Total Specific

protein activity activity Yield

mg units unitslmg % Cell-free extract 68.2 126 1.85 100 ASa ppt (60%) 49.2 116 2.36 92 Hydroxylapatite 4.20 90.7 21.6 72 Cibacron blue 2.97 71.8 24.2 57 AS ppt (50-70%) 2.22 55.4 25.0 44

Ammonium sulfate.

TABLE I1 Specific activities and dissociation constants of new and known

PHBHs (Weijer et al., 1983) Values in parentheses are for PHBH from F! aeruginosa. Values given

are mean k S.E.

Specific activity" p-Hydroxybenzoate Kdb NADPH KJ"'' unitslmg w W

Isozyme 25.0 f 1.9 69 k 16 150 2 30 PHBH 47.3,d 51.9,' (62-64)f 43,g (12),* (9.5)' 110'

~~~

Measured a t 25 "C and pH 7.9 using standard assay conditions

Determined a t 4 "C in potassium phosphate (50 m ~ ) , pH 6.6, con-

Determined in the absence of p-hydroxybenzoate. Howell et al. (1972).

f Entsch (1990). e Muller et al. (1979).

8 Husain and Massey (1979).

(Entsch et al., 1976).

taining 10 mM EDTA (unless otherwise noted).

Determined at pH 6.5 and 3 "C (Entsch et al., 1990). Determined a t pH 6.5 and 3 "C (Entsch et al., 1991).

100

E 80

0 10 20 30 4 0 l/[p-HYDROXYBENZOATE] mM"

FIG. 3. Spectrophotometric titration of PHBH isozyme with p-hydroxybenzoate. Data were determined a t 4 "C in potassium phosphate (50 mM), pH 6.6, containing 10 m~ EDTA. Isozyme (33 PM) was titrated with increasing amounts of p-hydroxybenzoate (0.025- 0.065 mM), and the decrease in absorbance a t 497 nm was recorded after having corrected for dilution.

those previously reported (Husain and Massey, 1979; Entsch et al., 1990, 1991). To determine the dissociation constant for the enzyme-NADPH complex, the enzyme solution was first re- duced with sodium dithionite and then allowed to oxidize prior to its eventual reduction with NADPH. This process was found to be necessary after repeated attempts to achieve anaerobic conditions had failed. This oxygen could best be removed by its reaction with the reduced flavin to form the flavin 4a-hydro- peroxide, which then decomposes to give FAD and H202 (Entsch et al., 1976). From a plot of the rate of enzyme reduc- tion as a function of NADPH concentration (Fig. 41, the disso- ciation constant was found to be 0.15 mM, slightly higher than the value of 0.11 mM reported by Husain and Massey (1979). The extrapolated rate constant for the reduction of the enzyme at infinite NADPH concentration was calculated from the in-

Isolation and Expression

1 00

80

60

40

*O 0 1 0 5 1 0 15

l/[NADPH] mM“ FIG. 4. Anaerobic reduction of PHBH isozyme by NADPH in

absence of p-hydroxybenzoate. Data were determined at 4 “C in

obic solutions of NADPH (0.071-1.4 mM) were added to a 10 VM enzyme potassium phosphate (50 mM), pH 6.6, containing 10 mhf EDTA. Anaer-

solution, and the decreases in absorbance at 450 nm were recorded uersas time. First-order fits of the data gave the rates of enzyme reduc- tion.

tercept to be 0.03 min”, compared to 0.02 min” (Husain and Massey, 1979). In the presence of 0.35 mM p-hydroxybenzoate and 0.071 mM NADPH, the rate of enzyme reduction was de- termined to be at least 1000-fold faster. This enhancement is consistent with the “effector” role of substrate, a common fea- ture of the external flavoprotein hydroxylases (Flashner and Massey, 1974).

DISCUSSION

The newly cloned and expressed PHBH is 3 amino acids longer than the original enzyme from I? fluorescens and shares 73% homology with the original enzyme on the amino acid level (Weijer et al., 1983; Wijnands et al., 1986). Since the physical properties are very similar and the extent of homology is high, the three-dimensional structures of the two enzymes are pre- sumed to be identical in gross secondary structure. If so, the two regions having the least amount of homology (residues 73-85 and 116-135) are located as random folds near the en- zyme surface.

Important structural similarities of the original and newly cloned PHBHs are as follows. As is the case with the known PHBH and flavoproteins in general, this enzyme contains the sequence Gly-X-Gly-X-X-Gly (residues 9-14), where X denotes a non-glycine residue. Hofsteenge et al. (1980) have postulated that these glycine residues have important structural roles. The first glycine interacts closely with the ribose of the adeno- syl moiety, while the other 2 are involved in the bend connect- ing the first p-strand and the a-helix of the fold. In the original PHBH, there are over a dozen residues that ensure a tight binding of the pyrophosphate, ribityl, and isoalloxazine moi- eties of FAD (Hofsteenge et al., 1980; Weijer et al., 1983). These residues, which form hydrogen bonding, electrostatic, and hy- drophobic interactions with FAD, are all conserved in the newly cloned enzyme. For p-hydroxybenzoate binding, the new en- zyme has the residues necessary for forming two hydrogen bonds and one salt link with the carboxylate (5r-222, Ser-212, and Arg-142) as well as a residue (Tyr-201) for hydrogen bond- ing to the hydroxyl group at the para-position. This tyrosyl hydroxyl group, in turn, can make a hydrogen bond with Tyr- 385. The product 3,4-dihydroxybenzoate is known to form a hydrogen bond at the meta-position with the carbonyl oxygen of Pro-293 (Schreuder et al., 1988); again, this residue is present in the new enzyme. In the crystalline form, PHBH exists as dimers with specific subunit-subunit contacts that have been

of PHBH Isozyme Gene 17061

described extensively by Weijer et al. (1983). Two ion pairs and five hydrogen bonds involving 13 residues contribute to the dimerization. All of these residues, except 1, are identical in the isozyme, with the one change being a conservative Thr-366 to Ser-366 switch.

One notable structural difference occurs at residue 116 in the newly cloned enzyme: an alanine residue is substituted for a cysteine. It was shown that during puri~cation of the original enzyme, the cysteine (which is located near the enzyme sur- face) slowly oxidizes (Van Berkel and Muller, 1987). Although the catalytic properties remained the same, the oxidation prod- ucts strongly interfered with the crystallization of the enzyme (Van Der Laan et al., 1989). Protein sulfhydryl oxidations are known to “mark” enzymes for degradation (Kirschke et al., 1980); the lack of this residue in the newly cloned PHBH may indicate a difference in the modes of regulating the two en- zymes.

On the nucleotide level, the enzyme has 75% homology to the gene encoding PHBH from P. aeruginosa (Entsch et al., 1988); the PHBH gene from I-! fluorescens differs in only 14 nucle- otides from the P. aeruginosa. gene (Westphal et al., 1990). This homology, together with the structural similarities, clearly in- dicates that the three enzymes evolved from a common precur- sor (Matthews et al., 1981). The product studies demonstrated that the isozyme hydroxylates p-hydroxybenzoate to give 3,4- dihydroxybenzoate with 100% efficiency, albeit a t a slower rate. The identical spectral perturbations observed upon binding p- hydroxybenzoate, similar binding affinities, and the large ef- fector role of substrate clearly indicate that the same catalytic mechanism is in operation. The possibility that this enzyme may accept a different range of substrates is currently under investigation.

The evidence suggesting that this gene is not expressed in I? fluorescens is as follows. The isozyme’s similarities to the known PHBH most probably would have resulted in the co- migration of the two enzymes upon purification, yet the protein sequence analysis of PHBH from I? fluorescens yielded no evi- dence of a second contaminating protein (Hofsteenge et al., 1980; Vereijken et al., 1980; Weijer et al., 1982). Had there been a difference in migratory aptitudes, one would expect a differ- ence in enzyme recovery efficiencies upon comparing the puri- fications of PHBHs from I? fluorescens (Husain et al., 1978; Muller et al., 1979) and I? ueruginosa (Entsch and Ballou, 19891, presuming that only the former expressed this isozyme. No significant differences in recovery efficiencies have been noted. In our hands, purification of PHBH from the cells from which the isozyme’s gene was isolated resulted in recovery of an enzyme having the same kinetic properties as was originally reported for PHBH, e.g. the higher specific activity enzyme versus the isozyme (data not shown). The failure of I? fluore- scens to express this gene is intriguing. Very little is known about the induction process, let alone why one enzyme might be induced at the complete exclusion (or expense) of another. One possibility is that the gene encoding the isozyme has evolved to a functional level, while the regulatory sequences have not. A late development of regulatory sequences would be consistent with the wide variety of transcriptional regulators found in Pseudomonas (Deretic et al., 1987, 1989) compared to E. coli, which has more defined consensus sequences (Lodge et al., 1990). This variety might play a key role in the unusually high adaption and catabolic potential exhibited by pseudomonads (Lindow et al., 1989). Another point of speculation is that the isozyme gene may have served as a template from which the expressed gene evolved. Having a “spare” copy of a gene would allow evolution without the risk of lethal consequences to the cell (Richmond and Clarke, 1975).

17062 Isolation and Expression

In conclusion, a hitherto unknown isozyme of the well-ehar- acterized PHBH from E! fluorescens has been cloned and ex- pressed. This enzyme, in comparison to the original, will pro- vide a useful template on which to perform protein dissection and reconstruction, with the goal of creating a better, more general, oxygen transfer catalyst.

Acknowledgments-We thank Drs. Lawrence Marsh and Lisa Scherer for assistance in performing the polymerase chain reaction and Dr. Charles Glabe for providing primers used in the DNA sequencing.

REFERENCES Benesi, H. A,, and Hildebrand, T. A. (19491 J. Am. Chem. Soe. 71,2703-2707 Benton, W. D., and Davis, R. W. (1977) Science 196, 180-182 Bohme, H. J., Koppersclager, G., and Schulz, J. 11972)J. Chromatogr: 69,209-214 Davis, L. G., Dibner, M. D., and Battey. J. F. (1986) Basic Mefhods in Molecular

Deretic, V., Gill, J., and Chakrabarty, A. 119871 BioiTechnology 5, 469-477 Biology, pp. 4446 , Elsevier Science Publishing Co., Inc.,, New York

Deretic, V., Konyecsni, W. M., Mohr, C. D., Martin, D. W., and Hibler, N. S. (1989)

Entsch, B. 119901 Methods Enzymol. 188, 138-147 Entsch, B., and Ballou, D. P. 11989) Biockim. Biophys. Acta 999, 313-322 Entsch, B., Ballou, D. P., and Massey, V. (19761 J. B id . Chem. 251, 2550-2563

Entsch, B., Palfey, B. A,, Ballon, D. l?, and Massey, V. (1990) in Flauins and Entsch, B., Nan Y., Weaich, K., and Scott, K. E i 1988) Gene 1Anzst. ) 71, 279-291

Fhoproteins (Curti, B., Ronchi, S.. and Zanetti, G.. edsi pp. 219-230, Walter de

Entsch, B., Palfey, B. A., Ballou, D. P., and Massey, V. 11991) J. Biol. Chenz. 266, Gruyter & Co., Berlin

Flashner, M. S., and Massey, V. (1974) in Molecular Merhanisrns of Oxygen Acti- 17341-17349

Ghisla, S., and Massey. V. (1989) Ear. J. Biochem. 181, 1-17 cation (Hayaishi, O., edt pp. 245-283, Academic Press, New York

Hofsteenge, J . , Vereijken, J. M., Weijer, W. J., Beintema, J. J., Wierenga, R. K., and

Husain, M., and Massey, V. (1979) J. Biol. Chem. 254,6657-6666 Howell, L. G., Spector, T., and Massey, V (1972) J. Bioi. Chem. 247,4340-4350 Husain, M., Schopfer, L. M., and Massey, V. 119781 Methods Enzymol. 53,543-558 Kirschke, H,, Langner, J., Riemann, S., Wiederanders, B., Ansorge, S., and Bohley,

P. (1980) in Protein Degradation in Health and Disease (Evered, D., and Whelan, J., edsi pp. 15-35, Excerpta Medica, Amsterdam

BiolTechnology 7, 1249-1254

Drenth, J . (19801 Bur. 3. Biochem. 113,141-150

Laemmli, U. K. (1970) Nature 227,680-685

of PHBH Isozyme Gene Lindow, S. E., Panopoulos, N. J., and McFarland, B. L. (1989) Sczence 244, 1300-

1307 Lodge, J., Williams, R., Bell, A,, Chan, B., and Busby, S. (1990) FEMS Microbiol.

Lett. 67, 221-226 Lowry, 0. H., Rosebrough, N. J., Farr,A. L., and Randall, R. J. (1951)J. Biol. Chem.

193,265-275 Matthew, B. W., Remington, S. J., Grntter, M. G., and Anderson, W. F. (1981) J.

Mol. Biol. 147, 545-558 Muller, F., Voordouw, G., Van Berkel, W. J. H., Steennis, P. J., Visser, S., and Van

Rooijen, P. J . (19791 Eur. J . Biochem. 101, 235-244 Richmond, M. H., and Clarke, P H. 11975) in Genetics and Biochemistry of

Pseudomonas (Clarke, P. H., and Richmond, M. H., eds) pp. 341-358, John

Sambrook, J., E'ritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Labo- Wiley & Sons Ltd., London

ratory Manual: 2nd Ed., pp. 1.25-1.28, 1.82-1.84, 10.14-10.15, and 2.70-2.81, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

Schreuder, H. A,, Van Der Laan, J. M., Hol, W. G. J., and Drenth, J. (1988) J. Mol. Aiol. 199. 637-648

Schreuder, H. A., Prick, P. A. J., Wierenga, R. K., Vriend, G., Wilson, K. S., Hol, W.

Spector, T., and Massey, V. t1972ai J. Bid . Chem. 247,4679-4687 Spector, T., and Massey, V. (1972bl J. BioE. Chem. 247, 7123-7127 Ulnler, K. M . (1983) Science 219, 666-671 Van Berkel, W. J . H., and Muller, F. (1987) Eur: J. Biochem. 167, 35-46 Van Der Laan. J . M., Swarte, M. B. A., Groendijk, H., HoI, W. G. J., and Drenth, J.

Vereijken, J. M., Hofsteenge, J.. Bak, H. J., and Beintema. J. J. (1980) Eor. J.

Walsh, C. iL98O)Acc. Chem. Res. 13, 148-155 Weijer, W. J. , Hofsteenge. J., Vereijken, J. M., Jekel, P. A., and Beintema, J. J.

Weijer, W. J., Hofsteenge, J., Beintema, J. J., Wierenga, R. K., and Drenth, J. (1983) 119821 Biochim. Biophys. Acta 704,385-388

Westphal, A. H., Eschrich, K.. Van Dongen, W. M. A. M., Benen, J. A. E., De Kok, Eur cJ. Biochem. 133, 109-118

A., and Van Berkel, W. J. H. (1990) in FZavins and Flavoproteins (Curti, B., Ronchi, S., and Zanetti, G., eds) pp. 231-234, Walter de Gruyter & Co., Berlin

Wijnands, R. A,, Weijer, W J . , Muller, F., Jekel, P. A., Van Berkel, W. J. H., and Beintema, J. J. (1986) Biochemistry 25, 4211-4218

Yamamoto, K. R., Alberts, B. M., Benzinger, R., Lawhorne, L., and Treiber, G. 11970) Virology 40, 734-744

Ziegler, D. M. (19881 Drug Metab. Reu. 19, 1-32 Ziegier, D. M. (19901 Pends l'harrnacol. Sei. 11, 321-324

G. J., and Drenth, J. (19891 J. Mol. Eiol. 208, 679-696

(1989) Eur. J. Riochem. 179, 715-724

Biochem. 113, 151-157