Proc. Natl. Acad. Sci. USAVol. 92, pp. 1739-1743, February 1995Biochemistry

Translocation of the Escherichia coli transcription complexobserved in the registers 11 to 20: "Jumping" of RNA polymeraseand asymmetric expansion and contraction of the"transcription bubble"

(footprinting)

EVGENY ZAYCHIKOVt, LUDMILLA DENISSOVAt, AND HERMANN HEUMANNMax Planck Institute of Biochemistry, D-82152 Martinsried, Germany

Communicated by Peter H. von Hippel, University of Oregon, Eugene, OR, October 27, 1994

ABSTRACT Translocation of DNA-dependent RNA poly-merase along the DNA template during RNA synthesis en-compasses continuous as well as discontinuous steps. This isdemonstrated by chemical probing of transcription complexesstalled in consecutive registers of RNA synthesis at basepositions +11, +12, +14, +16, +18, and +20. The "tran-scription bubble" translocates by continuous opening of thedownstream edge in tandem with the growing RNA chain anddiscontinuous closing at the upstream edge after at least ninesteps of RNA synthesis. The position of the enzyme remainsunchanged during extension of the transcription bubble and"jumps" 10 bp downstream simultaneously with collapse ofthe transcription bubble.

Footprinting data and other biochemical studies providedgood evidence that the beginning of RNA synthesis proceedsdiscontinuously. DNase I footprinting data from Carpousisand Gralla (1) showed a dramatic change of the footprint ifRNA polymerase proceeded from the binary complex to theternary complex in register 11. Straney and Crothers (2)described the transition from the abortive to the productivestate by a spring model; later on, Metzger et al. (3) suggestedan "inchworm"-like movement of RNA polymerase for thesame stages of transcription. Exonuclease III footprinting bythe same authors suggested that the transcription complexgoes through a maturation process, as RNA synthesis proceedsfrom register 11 to 20. There is a disagreement concerning howRNA polymerase translocates beyond register 20. WhileMetzger et al. (3) claim that RNA polymerase moves step bystep without change of the size of the footprint, Chamberlinand Krummel (4, 5) claim, based on DNase I footprint studies,that RNA polymerase moves discontinuously like an inch-worm. Support for a discontinuous mode of transcription isprovided by studies of Lee and Landick (6). They determinedthe size of the "transcription bubble" (7) and showed that itssize can vary between 12 and 23 bases. Very recently, exonu-clease III footprinting studies covering registers 47-60 (8)indicated that RNA polymerase can translocate in a step-by-step mode as well as discontinuously.

Previous studies of the translocation mechanism (3-5) hadtwo conceptual shortcomings. The distance between consec-utive registers in which the transcription complexes were stud-ied was too great, and the determination of the position of thetranscription bubble and the RNA polymerase was not suffi-ciently precise to draw a clear conclusion about the mode oftranslocation. We have overcome these shortcomings by asystematic analysis of transcription complexes halted in reg-isters 11, 12, 14, 16, 18, and 20. The size and position of the

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

transcription bubble were mapped by applying three differentreagents that react specifically with thymidines, cytidines, andadenines in single-stranded DNA regions. The resolution wassufficient to allow us to determine the edges of the bubble, inmost cases to within 1 base position. The position of RNApolymerase on the DNA was determined by FeEDTA-generated hydroxyl radicals. This probe provides high-resolution information about the contact sites of protein andDNA (9, 10).The combination of mapping data on the transcription bub-

ble and RNA polymerase provides evidence that translocationin registers 11-20 is a process consisting of continuous as wellas discontinuous elements.

MATERIALS AND METHODSPreparation of Escherichia coli DNA-dependent RNA poly-merase, the Al promoter carrying DNA fragment, primerApUpC, and the labeling procedure of DNA were performedas described (3).

Preparation of the Paused Complexes. The binary complexwas formed by incubation of "30 pmol of the Al promoterfragment and a slightly molar excess of RNA polymerase for15 min at 37°C in a buffer containing 8 mM Hepes, (pH 8.0),50 mM NaCl, and 6 mM MgCl2. RNA synthesis into register11 was started by addition of 200 pmol of 5'-32P-labeled primerp*ApUpC and 200 pmol ofATP + GTP to the binary complex(total vol, 50 ,ul) and incubation for a further 45 min at 370C.Residual binary complex was destroyed by competition withheparin (final concentration, 10 ,ug/ml for 5 min at 370C).Complexes halted in register 11 were purified from primer

pApUpC and nucleoside triphosphates by passage through a0.7-ml G-50 column in the absence of MgCl2. Nucleosidetriphosphates (0.1 mM each) were added together with 6 mMMgCl2 to the halted complexes, as indicated in Fig. 1. Thecomplexes were incubated for 2 min at 370C in order to resumesynthesis into the desired registers and were immediately usedfor probing.

Application of Chemical Probes. Treatment by OS04 wasdone according to ref. 11 by addition of 5 ml of 12 mMOS04/15 mM bipyridine to 50 ,tl of the complex followed byincubation for 2 min at 370C. Cleavage at C(+G) was per-formed according to ref. 12 except that treatment with hydra-zine (Hz) was performed in 20% butanol. Treatment withdiethyl pyrocarbonate (DEPC) was done essentially as de-scribed (13).Treatment of stalled ternary complexes with FeEDTA was

performed as described (3). Complexes were then immediately

Abbreviations: DEPC, diethyl pyrocarbonate; DMS, dimethyl sulfate;Hz, hydrazine.tPresent address: Limnological Institute, Siberian Division of theAcademy of Sciences of Russia, 664033 Irkutsk, Russia.

1739

Dow

nloa

ded

by g

uest

on

Aug

ust 2

8, 2

021

1740 Biochemistry: Zaychikov et al.

purified from unbound DNA by passing the reaction mixture("200 ,ul) through a nitrocellulose filter (Sartorius; 13 mm).

RESULTS

Step-by-Step RNA Synthesis. Fig. 1 Left outlines the pro-cedure followed to obtain complexes halted at base positions+11, +12, +14, +16, +18, and +20. RNA polymerase wasincubated with a DNA fragment of 110 bp carrying the Alpromoter of the phage T7 and advanced into register 11 asdescribed in Materials and Methods (14-18). Analysis of RNAproducts (Fig. 1 Right) shows that the major RNA chains havethe expected lengths corresponding to the position of haltedRNA polymerase. "Marching back" of RNA polymerase (19-21) is manifested by the presence of shortened RNA chains atregisters 16 and 18 (see Fig. 2A). This effect was minimized byusing highly purified enzyme, presumably free of GreA andGreB proteins (20, 22), which acts to enhance transcript cleav-age, and by shortening the time interval between formation ofthe complex and further chemical probing analysis.

Chemical Probing of Halted Transcription Complexes. Weapplied two different classes of reagents that provided com-plementary information: (i) single-strand-specific reagentsthat interact with the base moiety and (ii) hydroxyl radicalsthat attack the sugar moiety.The Transcription Bubble Translocates by Continuous

Opening of the Downstream Edge and Discontinuous Closingof the Upstream Edge. The halted complexes were treated withsingle-strand-specific reagents-such as OS04, which oxidizesthymidines (11); DEPC, which alkylates adenines (13); anddimethyl sulfate (DMS), which methylates cytidines-resultingin increased instability of the modified cytidines with respectto Hz (12). The DNA was subsequently cleaved at the modifiedbases by treatment with piperidine and applied to a sequencinggel. Fig. 2 shows the DNA patterns obtained after electro-phoresis and Fig. 4A is a graphical representation of theresults.Each reagent provides an estimated minimum and maxi-

mum bubble size: the minimum is the distance between the twooutermost modified residues, while the maximum is the dis-tance to the next potentially modifiable residues in both di-rections. We then compare the minimum and maximum bub-ble sizes obtained by using OS04, DMS/Hz, and DEPC tonarrow down the bubble limits. By using reagents that canmodify 3 of the 4 bases and examining both strands, we can in

+1 +10 +20Icoa

DNA CGGTAGCTCTCCCTGTGCCGCTTATCGGTA.RNA AUCGAGAGGGACACGGCGAAUAGCCAU..

AUC~~~ .ea1.flC TP+RTP jGel-filtration

.-20[11] -i--i, 18-

CTP RTP; [14a] 14 _ o dGel-filtration 12-.-

L[14b]

1 [161 GTP-CTP Register

[181 GTP+CTP+RTP[201

FIG. 1. Walking along the DNA using the Al promoter. (Left)Elongation of RNA. The complex arrested in register 11 (see Materialsand Methods) was advanced to registers 12 and 14 by addition of eitherCTP or CTP + ATP. The 14-mer complex was the starting point forthe second round of walking. After removal of the substrates, haltedcomplexes in registers 16, 18, and 20 were obtained by addition ofGTP, GTP + CTP, or GTP + CTP + ATP. (Right) RNA products ofthe halted (arrested) complexes. The 5'-end-labeled RNA productswere subjected to a 20% sequencing gel in order to analyze thehomogeneity of the complexes and to prove that the halted complexescontain RNA chains of the expected lengths. Lanes 14a and 14b showproducts of the 14-mer complex before and after gel filtration.

principle determine the status of every position and thus theexact size and position of the bubble.

Determination of cytidines in the neighborhood of guanineswas complicated because of the strong background pattern ofguanines. DMS reacts strongly with guanine in double-stranded DNA, as the control experiment in Fig. 2C [laneContr(-Hz)] shows. For this reason, no conclusion was possibleabout the accessibility of the cytidine at base position + 17 inthe nontemplate strand. As a consequence, the determinationof the downstream border of the bubble in register 16 isuncertain, as indicated in Fig. 4A.

Analysis of unpaired guanines was not possible, since thereis no chemical probe available that reacts specifically withunpaired guanines. In this respect, it is interesting to note thatthe patterns obtained with DMS show enhanced reactivity ofthose guanines that are positioned in the open DNA region.The structural parameters of the transcription bubble-

namely, position of both edges, size of the bubble, distancebetween the position of the template base, and the downstreamedge of the bubble-are drawn in Fig. 4A. These data showthat the bubble has a size of 13 bp in register 11 but that inparallel with RNA synthesis the bubble extends downstream bycontinuous opening of the DNA, reaching its maximum size of19 bp in register 18. The bubble extends downstream bycontinuous opening of the DNA, parallel with the progress ofRNA synthesis. The distance between the growth point of theRNA and the downstream edge of the bubble remains within1-3 bases. While the downstream edge of the bubble movescontinuously, the upstream edge moves discontinuously. Thelatter remains, give or take 1 bp, at the same base position untilRNA synthesis has reached register 18. When transcription hasproceeded one or two steps further, the size of the bubblechanges dramatically, with 10 bp in the upstream region of thebubble becoming closed. A result of this partial collapse isrestoration of the initial bubble size and translocation of thecenter of the bubble 10 bp downstream with respect to thecomplex in register 11.RNA Polymerase Translocates by Jumping Downstream. To

find out whether the same pattern of continuous and discon-tinuous movement also obtains for the RNA polymerase itself,we determined the position of the enzyme on the DNA tem-plate in the different registers of RNA synthesis.

Halted transcription complexes were probed by FeEDTA-generated hydroxyl radicals to determine the position ofRNApolymerase (3). This reagent most likely attacks nucleotidesugars at the Cl and C4 positions, leading to excision of a base.Hydroxyl radicals generated in solution are superior to mostother reagents for footprinting studies for the following rea-sons: (i) The cleavage reaction with hydroxyl radicals is largelysequence independent, facilitating interpretation of the pat-terns (3, 9). (ii) The resolution of the footprints is high becauseof the small size of the probe. (iii) The reagent has no signif-icant influence on complex stability (3).

Fig. 3 shows the footprints of RNA polymerase at thetemplate and nontemplate strands, depicted graphically in Fig.4A. There is no discernible difference of the footprints inregisters 11-18; 32 nucleotides are in contact with RNA poly-merase on the nontemplate strand and 25 bases are in contacton the template strand. However, the position of the footprintchanges abruptly when transcription proceeds to register 20.The center of the footprint as a whole moves 10 bp downstreamwithout changing its size, indicating a jumping mode of RNApolymerase movement. Fig. 4B shows a simple model thattakes into account the hydroxyl radical footprinting data. SinceRNA polymerase does not move during RNA synthesis fromregister 11 to 18, we have to assume that the domain carryingthe polymerization site must be flexible with respect to the restof RNA polymerase in order to keep contact with the 3' endof the growing RNA chain.

Proc. NatL Acad. Sci. USA 92 (1995)

Dow

nloa

ded

by g

uest

on

Aug

ust 2

8, 2

021

Proc. Natl. Acad Sci. USA 92 (1995) 1741

A _0

+33 _- _

+27 -_

E9-u-

-7

-11-*'

-16--18 -v

-23 -a-25 -

c

..,+26 22

/ =,

-10-s12_ -15-17

-27-28-29

i- i- -ica4x8, - - V- v- T- N

b.

*.^

." .:.

-20-. '

..:

UIme

-17~~

c

.... ....

2-b

15-.17-

C N 5~~~~

CCD ~ ~

48-" kSqa,,. ..7a.s1 v

= 1-- " =

_ ,5

FIG. 2. Mapping of the transcription bubble in complexes stalledat positions between + 11 and +20 using single-strand-specific probes.Transcription complexes, stalled as described in Fig. 1, were subjectedto treatment with chemical probes and applied on an 8% sequencinggel. Numbers beside bands refer to positions of probed bases; numbersin squares refer to those attacked by the probe. Numbers above lanesrefer to registers in which the complexes were stalled. Lane A+Gshows adenines and guanines as a reference; lane Contr shows thepattern obtained on DNA without RNA polymerase. (A) Unpairedthymidines probed by OS04. OS04 was applied to the nontemplatestrand (Left) and the template strand (Right). Lane T shows allthymidines in the DNA strand. The pattern was obtained by applica-tion of OS04 to heat-denatured DNA. (B) Unpaired adenines detectedby treatment with DEPC. DEPC was applied only to the nontemplatestrand. This has no effect on the accuracy of size determination of thebubble, since the complementary strand contains only two adenines inthe DNA region of interest, which are not positioned at the edge of thebubble. (C) Unpaired cytidines visualized by treatment with DMS andHz. DMS + Hz was applied to the template strand (Left) and the

FIG. 3. Hydroxyl radical footprints of stalled RNA polymerase.Complexes stalled as described in Fig. 1 were subjected to treatmentwith hydroxyl radicals and analyzed on a 6% sequencing gel yieldingthe footprints at the nontemplate strand (Left) and the template strand(Right). Numbering ofbands refers to base positions. Lane A+G showsadenines and guanines serving as markers; lane Contr is the referencewithout RNA polymerase. Solid bars indicate strongly protected re-gions; shaded bars indicate weakly protected regions. Determinationof the exact size of the protected regions is difficult because transitionfrom the protected to the unprotected region is not sharp. However,in the context of this study it is important only to ascertain relativechanges of the patterns in different registers of RNA synthesis.

The more complete protection of the DNA in the down-stream part of the bubble indicates that there are strongcontacts between RNA polymerase in this region of the DNA,which is opened when RNA synthesis proceeds from register11 to 18. This finding is in line with the view that DNA strandseparation is mediated by strong interaction of RNA poly-merase with the sugar-phosphate backbone.

It is interesting to note that the hydroxyl radical footprintsdiffer from those obtained by chemical probes, such as exo-

nuclease III (3) and DNase I (4). Both enzymatic probes,exonuclease III as well as DNase I, show qualitatively the sameresults. The distance between the 3'-terminal base of the RNAand the downstream positioned edge of the footprint is short-ened when transcription proceeds from register 11 to 20, andthe upstream edge moves in concert with RNA synthesis. It isnot surprising that the enzymatic probes and a chemical probe,such as hydroxyl radicals, yield different footprints. Because oftheir different sizes hydroxyl radicals provide informationabout contacts between RNA polymerase and DNA, and theenzymatic probes provide information about the topology ofthe RNA polymerase, as discussed below.

Analysis of footprints obtained by enzymatic probes re-quires additional care, since they might not be totally blockedby steric hindrance of RNA polymerase, but might also nibbleinto DNA regions that are in contact with DNA, if the affinityof RNA polymerase to DNA is sufficiently low. At least forexonuclease III, such "aggressivity" has been reported (3, 23).The Putative DNA-RNA Hybrid Is Continuously Elongated

and Discontinuously Displaced from the Template Strand. Itis striking that most nucleotides of the nontemplate strandwithin the transcription bubble are accessible to single-strand-specific reagents, whereas in the template strand only the basespositioned at both ends of the bubble are accessible. In light ofour accessibility studies, it is tempting to assume that theintervening protected region represents the DNA-RNA hy-brid-i.e., protection is due to base pairing with the nascent

nontemplate strand (Right). Lane Contr(-Hz), which represents com-plexes treated only with DMS, and lane Contr(-DMS), which repre-sents complexes treated only with Hz, are included as controls.

-+30

- +20

-+10

-+1

-*10

--20

--30

Biochemistry: Zaychikov et aL

ta

Dow

nloa

ded

by g

uest

on

Aug

ust 2

8, 2

021

1742 Biochemistry: Zaychikov et al.

A-

A AT G IC G(

11

B+1 +10 +20 +30 DNA-BINDING

DOMAIN\ DNAEEj&&GGM ,II.1'

ATTCCAACTCGTTAGGGTTGCTTAGCT

AUII I

AUCGAGAGGAC

rA TCGrCCGttAACCTr

I I

A TAGCC ATCCC AATC GA

rTA TCGG TAGGG T TAG CT

INAlReNAACTIVE CENTRE

nnUAlN

AU

TCCC AAT C GA

AGGG TTAGCT

T TA^CAGC C EE A AT AG C CA

16 A_AUCGAGAGGGACACG GI I

WIGGVRIGCGR..T T CAC Emm 0000 TAGC CAT CCC AA T CGA

A ATGTCGG TA CGG TA GG G T T AG C T1T22MJwJ

AUCGGAG NIGGACACGGCG

I

l

FIG. 4. Analysis of RNA polymerase in registers between 11 and20. (A) Map of footprints and single-stranded regions. Numbers on theleft refer to the number of the register. Base positions are indicatedabove. Horizontal bars represent results obtained by hydroxyl radicalfootprinting on both strands. DNA regions that are strongly protectedare solid, and those that exhibit weak protection are shaded. Squaresaround letters indicate bases accessible to single-strand-specificprobes. Bases are grouped into three classes corresponding to theintensity of the footprint bands with fully, moderately, and nonacces-sible bases indicated by open, shaded, and solid bars, respectively.DNA strands were regarded as separated when the base in either oneof the two strands was accessible. Hatched region between DNAstrands shows the size and position of the transcription bubble (theuncertainty in size determination caused by uncertainty in cytidineprobing is shown in light hatching). The size of the transcription bubbledetermined is a lower estimate, since, strictly speaking, we cannotdecide whether inaccessibility of a base at the edge of the bubble is dueto protection by RNA polymerase or nucleic acid. The portions ofRNA supposed to be in a hybrid with DNA are underlined. (B)Cartoon of footprinting data shown in A. Footprinting data ofA aredescribed by a model that takes into account the observation that theRNA polymerase remains at the same position during RNA synthesisfrom register 11 to 18 and jumps downstream by 9 bases, as RNAsynthesis proceeds to register 20. It is assumed that the polymerizingdomain moves together with the 3' end of the growing RNA. Thelength of the springs symbolizes stress in the different complexes.

RNA rather than to interaction with RNA polymerase. Theprotected region shows the same pattern of continuous anddiscontinuous changes depending on register, as observed withthe bubble. The size of the inaccessible region increases, in stepwith RNA synthesis, from 8(+2) bases in register 11 to 15(+2)bases in register 18 and decreases when RNA synthesis reachesregister 19 or 20, shrinking to its initial size of 8(+ 1) bases(number in parentheses indicates uncertainty). Further sup-

port for the suggestion that the protected region represents theDNA-RNA hybrid is provided by analysis of the binary com-plex by means of single-strand-specific reagents, in which theunpaired bases of the template strand within the bubble arefully accessible (24). This indicates, at least in the binarycomplex, that the template strand is not protected by inter-action with RNA polymerase. Studies showing that short com-plementary DNA or RNA oligomers protect the templatestrand within the bubble, indicating hybrid formation, remainto be done (E.Z., unpublished data).

If we accept that the protected region represents theDNA-RNA hybrid, the data in Fig. 4A suggest displacement ofthe RNA and reannealing of the DNA in the upstream regionof the bubble upon transition from register 18 to 20. Nothingis known about the displacement mechanism. However, mon-itoring the accessibility of thymidine at position + 13 of thetemplate strand in the different registers may provide a clueto this mechanism. The finding that this base is accessible inregisters 11 and 12 but not in registers 14 and 20 is in line withthe concept that bases in the template strand are accessible ifthey are positioned at the edges of the bubble and protectedby hybrid formation in between. However, thymidine at posi-tion + 13 is accessible in registers 16 and 18. This accessibilityof thymidine at + 13 in the middle of the bubble may be causedby distortion of the DNA-RNA hybrid. We speculate that thedistortion may serve to weaken the duplex to facilitate re-formation of the DNA duplex.

DISCUSSION

Superimposing Continuous and Discontinuous MovementElements During Translocation. The translocation processconsists of two phases, as indicated by Fig. 4. The continuousphase between registers 11 and 18 is characterized by a step-by-step extension of the transcription bubble in concert withRNA synthesis, whereby the position of RNA polymeraseremains unchanged. The discontinuous phase of translocationis confined to register 19 or 20. Several processes take placesimultaneously in the discontinuous phase-namely, displace-ment of RNA and reannealing of DNA as well as downstreammovement of RNA polymerase. Whether the pattern of con-tinuous and discontinuous movement elements observed inregisters 11-20 indicates a maturation process of the transcrip-tion complex as suggested previously (3) or whether it repre-sents one cycle of a periodic translocation process has not beenestablished. However, we can analyze to what extent the resultswe obtained in registers 11-20 fit into results obtained in otherregisters obtained by other techniques.Comparing the footprinting studies of complexes in registers

1-10 (2, 23, 25, 26) with our studies suggests that RNA syn-thesis in registers 11-18 represents the same process as inregisters 1-10 but without the initiation-specific events such aso-factor release and abortive synthesis. RNA polymerase re-mains essentially at the same position between registers 1-10and 11-18, respectively, and translocates around registers 10and 18. A further parallel in the two transcription cycles mightbe the existence of stressed intermediates in registers 8 and 9(2, 23, 25) and in registers 16 and 18, respectively, as indicatedby the accessibility of the template strand at position + 13 (thisstudy).Another line of evidence that translocation occurs in cycles

is provided by the characteristic changes of the size of thetranscription bubble and the RNA polymerase footprints. Thetranscription bubble inflates and deflates, depending on reg-ister, suggesting that the transcription bubble translocates in a"breathing" mode. RNA polymerase shows an analogous be-havior-namely, translocation into register 11, arrest betweenregisters 11 and 18, and again jumping at register 20 (orregister 19). Involvement of a saltatory process in transloca-tion has previously been proposed by Krummel and Cham-

TTACAGC

AATOTCG

DG irb12 L-F

Proc Natl. Acad Sci. USA 92 (1995)

* -

II*I

Dow

nloa

ded

by g

uest

on

Aug

ust 2

8, 2

021

Proc. Nat. Acad Sci USA 92 (1995) 1743

berlin (4). However, the data are not sufficient to draw a

conclusion as to how many steps of RNA synthesis take placeprior to translocation, especially since the translocation eventmay well be sequence dependent. In this respect, it is note-worthy that the position of the bubble collapse is sequence

dependent, as a comparison of our bubble mapping data withthose obtained by Lee and Landick (6) shows. These authorsused a DNA sequence different than ours and showed that thetranscription bubble decreases its size somewhere betweenregisters 22 and 26, two to six steps further downstream thanin our case.Models of the Translocation Process. Our data show that the

transcription bubble and RNA polymerase show differentmodes of translocation between registers 11 and 20. While thetranscription bubble translocates by step-by-step opening atthe downstream edge and subsequent discontinuous closing atthe upstream edge, the RNA polymerase translocates by jump-ing downstream in a discontinuous step. A translocation modelfor RNA polymerases has to deal with the problem that theenzyme remains at the same position on the DNA despiteprogress of RNA synthesis. This indicates that the polymer-izing domain of the RNA polymerase can move relative to therest of RNA polymerase and the DNA in order to maintainclose contact with the 3' terminus of the growing RNA. Thisis the simplest explanation for the observed footprints. Amodel that accounts for the observed behavior of the tran-scription complex, termed the "moving domain" model, isshown in Fig. 4B. The most direct evidence for mobility of thepolymerizing domain at least during the first eight steps ofRNA synthesis came from crosslinking studies (27). On thebasis of the moving domain model, the back reaction of RNApolymerase was also explained (20). Our data are in line withthis model, which assumes a "stressed intermediate," as al-ready suggested for the transcription complex during the first11 steps of RNA synthesis (2). We assume that this stress is dueto tension between the polymerization domain and the rest ofthe polymerase, indicated by the string in Fig. 4B. Goldfarb'sgroup interprets the stressed intermediates in terms of an

inchworm-like movement of RNA polymerase. We would pre-

fer to describe this transition by a moving domain model, sinceRNA polymerase remains at the same position and translo-cates by a jump-like movement, while the polymerizing domainmoves continuously.Our footprinting data obtained by using hydroxyl radicals

differ from those obtained by using enzymatic probes, such as

exonuclease III (3) and DNase I (4,5) in registers 11-20. Theseprobes show that the downstream edge remains at the same

position, and the upstream positioned edge of the protectedregion moves roughly in concert with RNA synthesis. Theseasymmetric changes of the upstream and downstream posi-tioned edges of the footprints with progress of RNA synthesiswere interpreted (4,5) by an inchworm-like movement ofRNApolymerase (5). A less complicated explanation is provided bya model suggested by Metzger et al. (3). These authors assumedthat the angle between the long axis of RNA polymerase istilted with respect to the long axis of the DNA, if RNAsynthesis proceeds, and, as a consequence, the accessibility ofthe DNA changes depending on the tilting angle due to thebulkiness of the enzyme probe. This topological view forexplaining the enzymatic footprints is attractive, since tilting ofRNA polymerase with respect to DNA could also account forthe observed dramatic decrease in size of the DNase I footprintduring transition from the binary to the ternary complex (1, 2),as suggested previously (3).

This tilting model can be further specified by taking intoaccount that the DNA in the ternary complex is bent (28, 29)

and by assuming that the bending angle changes if RNAsynthesis proceeds. Such an assumption is not unreasonable,since the transcription bubble changes its size without chang-ing the contacts between RNA polymerase and DNA, asindicated by the hydroxyl radical footprints. As a consequence,stress between protein and DNA can be built up, which mightbe partially relieved by change of the bending angle. Theexistence of accumulated stress in the DNA is supportedexperimentally by the enhanced accessibility of thymidine atposition 13 in the template strand, as described in Results. Wespeculate that movement of the polymerizing domain is real-ized by tilting of RNA polymerase with respect to DNA.

The authors thank Gisela Baer for preparation of RNA polymeraseand DNA fragments and Dr. A. Wedel and Anne Whelan for valuablesuggestions. This work was supported by the Deutsche Forschungs-gemeinschaft.

1. Carpousis, A. J. & Gralla, J. D. (1985) J. Mo. Biol. 183, 165-177.2. Straney, D. C. & Crothers, D. M. (1987) J. Mol. Biol. 193, 267-

278.3. Metzger, W., Schickor, P. & Heumann, H. (1989) EMBO J. 8,

2745-2754.4. Krummel, B. & Chamberlin, M. J. (1992b) J. Mol. Bio. 225,

239-250.5. Chamberlin, M. J. (1994) Harvey Lect. 88, 1-21.6. Lee, D. N. & Landick, R. (1992) J. Mol. Bio. 228, 759-777.7. Yager, T. D. &von Hippel, P. H. (1987) in TranscriptElongation and

Termination in Escherichia coli and Salmonella typhimurium, eds.Neidhardt, F. C., Ingraham, J. L., Low, K B., Magasanik, B., Schae-chter, M. & Umberger, H. E. (Am. Soc. Microbiol, Washington,DC), pp. 1241-1275.

8. Nudler, E., Goldfarb, A. & Kashlev, M. (1994) Science 265,793-796.

9. Tullius, T. D. & Dombroski, B. A. (1986) Proc. Natl. Acad. Sci.USA 83, 5469-5473.

10. Schickor, P., Metzger, W., Werel, W., Lederer, H. & Heumann,H. (1990) EMBO J. 9, 2215-2220.

11. Palecek, E. (1992) Methods Enzymol. 212, 139-155.12. Kirkegaard, K, Buc, H., Spassky, A. & Wang, J. C. (1983) Proc.

Natl. Acad. Sci. USA 80, 2544-2548.13. Buckle, M. & Buc, H. (1989) Biochemistry 28, 4388-4396.14. Kassavetis, G. A., Zentner, P. G. & Geiduschek, E. P. (1986) J.

Biol. Chem. 261, 14256-14265.15. Levin, J. R., Krummel, L. & Chamberlin, M. J. (1987) J. Mol.

Biol. 196, 85-100.16. Grachev, M. A. & Zaychikov, E. F. (1980) FEBS Lett. 115,23-26.17. Carpousis, A. J. & Gralla, J. D. (1980) Biochemistry 19, 3245-

3253.18. Metzger, W., Schickor, P., Meier, T., Werel, W. & Heumann, H.

(1993) J. Mol. Biol. 232, 35-49.19. Surrat, C. K., Milan, S. C. & Chamberlin, M. J. (1991) Proc. Natl.

Acad. Sci. USA 88, 7983-7987.20. Borukhov, S., Sagitov, V. & Goldfarb, A. (1993) Cell 72,459-466.21. Kassavetis, G. A. & Geiduschek, E. P. (1993) Science 259, 944-

945.22. Borukhov, S., Polyakov, A., Nikiforov, V. & Goldfarb, A. (1992)

Proc. Natl. Acad. Sci. USA 89, 8899-8902.23. Straney, D. C. & Crothers, D. M. (1985) Cell 43, 449-459.24. Suh, W. C., Ross, W. & Record, Jr., M. T. (1993) Science 259,

358-361.25. Krummel, B. & Chamberlin, M. J. (1989) Biochemistry 28, 7829-

7842.26. Spassky, A. (1992) Biochemistry 31, 10502-10509.27. Mustaev, A., Kashlev, M., Zaychikov, E., Grachev, M. & Gold-

farb, A. (1993) J. Biol. Chem. 268, 19185-19187.28. Heumann, H., Ricchetti, M. & Werel, W. (1988) EMBO J. 7,

4379-4381.29. Rees, W. A., Keller, R. W., Vesenka, J. P., Yang, G. & Busta-

mante, C. (1993) Science 260, 1646-1649.

Biochemistry: Zaychikov et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

8, 2

021