Transcription practice - Plosives

13
Transcription Practice Plosives Transcribe the plosives in the following recordings. (The answers also include transcriptions of the vowels.) © Geoffrey Stewart Morrison 2004

Transcript of Transcription practice - Plosives

Page 1: Transcription practice - Plosives

Transcription Practice

Plosives

Transcribe the plosives in the following recordings.

(The answers also include transcriptions of the vowels.)

© Geoffrey Stewart Morrison 2004

Page 2: Transcription practice - Plosives

1. |

[ibo]

Page 3: Transcription practice - Plosives

2. |

[p]

Page 4: Transcription practice - Plosives

3. |

[te]

Page 5: Transcription practice - Plosives

4. |

[tei]

Page 6: Transcription practice - Plosives

5. |

[k]

Page 7: Transcription practice - Plosives

6. |

[]

Page 8: Transcription practice - Plosives

7. |

[aa]

Page 9: Transcription practice - Plosives

8. |

[aa]

Page 10: Transcription practice - Plosives

9. |

[]

Page 11: Transcription practice - Plosives

10. |

[ua]

Page 12: Transcription practice - Plosives

11. |

[i]

Page 13: Transcription practice - Plosives

12. |

[ku]


MR260 Medical Transcription II Week 3-Chapter 5 “Family Practice & Critical Thinking” Essentials of Medical Transcription.

MR260 Medical Transcription II Week 3-Chapter 5 “Family Practice & Critical Thinking” Essentials of Medical Transcription.

Handout #2 - University of Texas at Austin · Handout #2 More on complementary and contrastive distribution. English: Voiced plosives •English also has voiced plosives: [b, d, g]

Handout #2 - University of Texas at Austin · Handout #2 More on complementary and contrastive distribution. English: Voiced plosives •English also has voiced plosives: [b, d, g]

MR260 Medical Transcription II Week 8-Chapter 10 “Cardiology Practice” Essentials of Medical Transcription Instructor: Kathleen A. Bishop, M.B.A., Ph.D.

MR260 Medical Transcription II Week 8-Chapter 10 “Cardiology Practice” Essentials of Medical Transcription Instructor: Kathleen A. Bishop, M.B.A., Ph.D.

Phonetic Transcription for Speech Language · PDF file1 Phonetic Transcription for Speech Language Pathologists A Practice Manual by Arpita Ray Prepared for a workshop organized by

Phonetic Transcription for Speech Language · PDF file1 Phonetic Transcription for Speech Language Pathologists A Practice Manual by Arpita Ray Prepared for a workshop organized by

Transcription and Translation Practice TACGCTGACGAGAAATTAATTTCCTTGACT Write the mRNA Translate the mRNA into a protein.

Transcription and Translation Practice TACGCTGACGAGAAATTAATTTCCTTGACT Write the mRNA Translate the mRNA into a protein.

Voicing distinctions in the Dutch-German dialect continuum · 108 Nina Ouddeken (unmarked plosives have short-lag VOT in both systems, but marked plosives have VOT values corresponding

Voicing distinctions in the Dutch-German dialect continuum · 108 Nina Ouddeken (unmarked plosives have short-lag VOT in both systems, but marked plosives have VOT values corresponding

OPTIX:Op T I PTI E plosives - TU · PDF fileOPTIX:Op T IPTI x tical echnologiesforthe dentificationof E plosives AlisonJHobro ,BernhardZachhuber ,BernhardLendl andothermembersoftheOPTIXProjectConsortium

OPTIX:Op T I PTI E plosives - TU · PDF fileOPTIX:Op T IPTI x tical echnologiesforthe dentificationof E plosives AlisonJHobro ,BernhardZachhuber ,BernhardLendl andothermembersoftheOPTIXProjectConsortium

Phonetics and Phonology i - Plosives and Affricates

Phonetics and Phonology i - Plosives and Affricates

fricatives and plosives

fricatives and plosives

Chapter 1 - Sapporo Gakuin Universityext-web.edu.sgu.ac.jp/hidetos/HTML/Shiraishi... · Web viewIn word-initial position, WSN contrasts aspirated plosives with non-aspirated plosives,

Chapter 1 - Sapporo Gakuin Universityext-web.edu.sgu.ac.jp/hidetos/HTML/Shiraishi... · Web viewIn word-initial position, WSN contrasts aspirated plosives with non-aspirated plosives,

Medical transcription services - Access Transcription

Medical transcription services - Access Transcription

Transcription and Translation Practice

Transcription and Translation Practice

Transcription Practice Japanese - geoff-morrison.netgeoff-morrison.net/LING205/Transcription/transcription - Japanese.pdfTranscription Practice Japanese Transcribe the following Japanese

Transcription Practice Japanese - geoff-morrison.netgeoff-morrison.net/LING205/Transcription/transcription - Japanese.pdfTranscription Practice Japanese Transcribe the following Japanese

Ipa transcription practice 5th lecture

Ipa transcription practice 5th lecture

IPA TRANSCRIPTION PRACTICE

IPA TRANSCRIPTION PRACTICE

Chapter 10: Transcription and Translation Practice ...woodlandhighag.weebly.com/uploads/1/9/...problems_.pdf · Chapter 10: Transcription and Translation Practice Problems 1. ...

Chapter 10: Transcription and Translation Practice ...woodlandhighag.weebly.com/uploads/1/9/...problems_.pdf · Chapter 10: Transcription and Translation Practice Problems 1. ...

Medical Transcription - Blackstone Career Institute...fundamentals of medical transcription, the med-ical transcription profession, and the practice of medical transcription including

Medical Transcription - Blackstone Career Institute...fundamentals of medical transcription, the med-ical transcription profession, and the practice of medical transcription including

Transcription/Translation Genetic Code is Universal Practice Quiz · between transcription and translation. Answer: Transcription DNA --> RNA (Same Language: Nucleotides) Translation

Transcription/Translation Genetic Code is Universal Practice Quiz · between transcription and translation. Answer: Transcription DNA --> RNA (Same Language: Nucleotides) Translation

The Purpose(s) of Transcription: Transcription Practice in Three …labos.ulg.ac.be/.../uploads/sites/22/2015/07/23_dwyer.pdf · 2015-07-07 · Kevin Dwyer Interval(le)s II.2-III.1

The Purpose(s) of Transcription: Transcription Practice in Three …labos.ulg.ac.be/.../uploads/sites/22/2015/07/23_dwyer.pdf · 2015-07-07 · Kevin Dwyer Interval(le)s II.2-III.1

NHA1 - Consonants Plosives

NHA1 - Consonants Plosives