TRACKING MAMMARY EPITHELIAL CELL LINEAGE AND CELL ...
Transcript of TRACKING MAMMARY EPITHELIAL CELL LINEAGE AND CELL ...
The Pennsylvania State University
The Graduate School
Intercollege Graduate Degree Program in Genetics
TRACKING MAMMARY EPITHELIAL CELL LINEAGE AND CELL
DIVISIONS IN THE NORMAL MAMMARY GLAND AND MAMMARY
NEOPLASIA USING TRANSGENIC MICE
A Dissertation in
Genetics
by
Jessica L. Mathers
2011 Jessica L. Mathers
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
August 2011
ii
The dissertation of Jessica L. Mathers was reviewed and approved* by the following:
Edward J. Gunther
Associate Professor of Medicine
Dissertation Advisor
Chair of Committee
Sarah Bronson
Associate Professor of Cellular and Molecular Physiology
Gary Clawson
Professor of Pathology and Biochemistry and Molecular Biology
Jiyue Zhu
Associate Professor of Cellular and Molecular Physiology
David J. Spector
Professor of Microbiology
Chair, Intercollege Graduate Degree Program in Genetics
*Signatures are on file in the Graduate School
iii
Abstract
With as many as 1 in 8 women diagnosed with breast cancer in their lifetime, breast
cancer is the most commonly diagnosed cancer in women in the Western Hemisphere and the
second most common cause of cancer-related death in females. Decades of study have
uncovered causative exposures and mutations that transform normal mammary epithelial
cells (MECs) into breast cancer cells. Nonetheless, the cellular mechanisms that define the
clinical behavior of breast cancers remain incompletely defined. Lineage commitment
pathways yield diverse MEC cell types within the breast, and recent findings suggest these
MEC lineage hierarchies may persist within breast cancers, perhaps helping to explain the
cellular heterogeneity seen in tumors. To extend these studies, models are needed that permit
cell fate tracking in the discrete MEC compartments of both normal and malignant mammary
tissue.
In this work, we describe novel transgenic mouse models that permit temporally-
regulated, MEC compartment-restricted expression of a histone-fused eGFP (H2B-eGFP)
reporter in both normal and malignant mammary epithelium. Transactivator transgenes
expressed in either the luminal or basal layer of mammary ducts drove widespread H2B-
eGFP labeling of luminal or basal MECs, respectively. We tested whether the H2B-eGFP
reporter could be used to track cell divisions within labeled MEC compartments. Indeed,
when H2B-eGFP transgene expression was switched off in pulse-chase experiments, washout
of label depended on partitioning of labeled histones between daughter cells during MEC
proliferation. Moreover, the H2B-eGFP nuclear label was readily detectable in live MECs,
enabling live cell imaging of MECs propagated in culture.
H2B-eGFP labeling was used for short-term lineage tracing of MECs during
lobuloalveolar development. Hormones of pregnancy trigger the development of bi-layered
iv
alveolar outgrowths that are believed to arise from luminal progenitor cells. Contrasting with
this model, we found that labeled cells from both the luminal and basal MEC compartments
contribute to alveolar outgrowths. Furthermore, both luminal and basal MECs proliferated
while contributing to alveologenesis, and did not merely migrate into alveoli or become
incorporated as “bystanders”. These findings clarify a lineage commitment pathway
operative during a key, hormonally-driven stage of mammary gland development. In
separate studies, we labeled either basal or luminal MECs residing in the secretory
epithelium of lactating mice to examine whether a subset of these MECs persist throughout
the mammary gland remodeling program triggered by weaning. Remarkably, substantial
numbers of both luminal and basal MECs survived mammary gland involution and
contributed to remodeled ducts. These findings have implications for understanding how a
lactation-involution cycle protects against breast cancer in rodents and humans.
In other studies, the H2B-eGFP labeling strategy was applied in the context of Wnt1-
driven transgenic mouse models of breast cancer. Here, we sought to use pulse-chase H2B-
eGFP labeling of tumor cells to identify a relatively slow-cycling sub-population of tumor
cells, as relatively quiescent tumor cells have been proposed to be treatment-refractory and
enriched in tumor-propagating potential. Each transactivator drove reproducible,
compartment-restricted H2B-eGFP labeling of a large fraction of MECs within Wnt1-
initiated mammary hyperplasia, as expected. In contrast, the fraction of tumor cells labeled in
Wnt1-initiated mammary cancers showed marked tumor-to-tumor variability, suggesting that
the genetic and epigenetic events that cooperate in tumorigenesis sometimes interfere with
transgene-mediated labeling. Notably, both the luminal- and basal-MEC-directed
transactivators were capable of driving H2B-eGFP labeling of a subset of tumor cells from
v
MMTV-Wnt1 transgenic mice. This finding supports the contention that Wnt1 initiates
“mixed-lineage” mammary tumors comprised of both luminal and basal tumor cells,
suggesting that Wnt1 transforms a bi-potent MEC progenitor. Tumors that labeled efficiently
were studied further by quantifying H2B-eGFP washout on a per-cell basis in pulse-chase
experiments. Mammary cancers typically were comprised of tumor cell populations that were
heterogeneous with respect to rates of proliferation. Together, this work sets the stage for
prospective studies that will compare the biological potential of luminal- versus basal-type
tumor cells (i.e., those labeled using the contrasting compartment-restricted transactivators)
and rapid- versus slow-cycling tumor cells (i.e., those that have depleted versus retained
H2B-eGFP label).
Breast cancers can recur many years after eradication of all clinically-detectable
disease, but the cellular mechanisms that maintain disease dormancy remain undefined. H2B-
eGFP labeling was applied in the context of reversible Wnt1-driven mammary tumors to
investigate the cellular mechanisms that maintain tumor dormancy in a mouse breast cancer
model. Here, H2B-eGFP and Wnt1 were co-expressed such that switching off both
transgenes simultaneously initiated washout of incorporated H2B-eGFP label and regression
of Wnt1-dependent mammary cancers. Subclinical lesions comprised of dormant mammary
cancer persisted long after tumor regression, and these lesions frequently harbored tumor
cells that retained bright H2B-eGFP label, indicating they had ceased proliferating. These
label-retaining cells represent a candidate quiescent tumor cell population that may serve as a
critical link between primary mammary cancer and subsequent disease relapse.
vi
Table of Contents
List of Figures ........................................................................................................................... x
List of Tables ......................................................................................................................... xiii
Abbreviations ......................................................................................................................... xiv
Acknowledgements ................................................................................................................ xvi
Chapter 1 Literature Review ..................................................................................................... 1
1.1 Structure, Function, and Development of the Mammary Gland ............................... 1
1.1.1 Development of the Mammary Gland .................................................................. 1
1.1.1.1 Prenatal Development of the Mammary Gland ........................................... 1
1.1.1.2 Post-natal Development of the Mammary Gland ........................................ 2
1.1.1.3 Terminal Differentiation Induced By Pregnancy and Lactation ................. 3
1.1.2 Cellular Composition of the Mammary Gland ..................................................... 4
1.1.3 Hierarchy of Mammary Epithelial Cells ............................................................... 5
1.1.4 Areas for Further Study ........................................................................................ 8
1.2 Breast Cancer ............................................................................................................ 9
1.2.1 Types of Breast Cancers ..................................................................................... 10
1.2.1.1 Traditional Characterization of Breast Cancers ......................................... 10
1.2.1.1.1 Hormone Receptor Positive Breast Cancers ......................................... 11
1.2.1.1.2 Hormone Receptor Negative Breast Cancers .......................................... 12
1.2.1.1.3 HER2/ErbB2/Neu Initiated Breast Cancers ............................................. 12
1.2.1.2 Transcriptional Profiling of Breast Cancers .............................................. 13
1.2.2 Hierarchy of Cells in Mammary Cancers ........................................................... 14
1.2.3 Breast Cancer and Tumor Dormancy ................................................................. 15
1.2.4 Parity-Related Protection from Breast Cancer .................................................... 16
1.3 Mouse Models of Human Breast Cancer ................................................................ 17
1.3.1 Virally-Induced Mouse Mammary Cancer and the Discovery of the Wnt1
Oncogene ........................................................................................................................ 18
1.3.1.1 Engineering Constitutive MMTV-Driven Expression of Oncogenes in the
Mammary Gland ......................................................................................................... 19
1.3.2 The Role of Wnt Signaling in Mammary Development and Breast Cancer ....... 20
1.3.2.1 Inducible Expression of Wnt1 in the Mammary Epithelium of Transgenic
Mice ............................................................................................................................ 22
1.3.2.1.1 Minimal Residual Disease Lesions Modeled in Transgenic Mice ........ 23
1.3.3 Constitutive MMTV-Neu Driven Tumorigenesis in the Mouse Mammary Gland
............................................................................................................................. 25
vii
1.3.4 Compartment-Restricted Expression of Transgenes ........................................... 25
1.3.5 Inducible Expression of Fluorescently Tagged Histone H2B ............................. 26
1.3.6 Experimental Manipulation of the Mouse Mammary Gland .............................. 27
1.4 Areas Addressed in this Dissertation ...................................................................... 28
Chapter 2 Materials and Methods ........................................................................................... 34
2.1 Mouse Strains, Surgeries and Drug Treatments ........................................................... 34
2.1.1 Housing and Maintenance...................................................................................... 34
2.1.2 Genotyping and Breeding Schemes ....................................................................... 35
2.1.3 Experimental Manipulations of Mice .................................................................... 35
2.1.3.1 Surgical ........................................................................................................... 36
2.1.3.2 Chemotherapeutics .......................................................................................... 37
2.1.3.3 Pregnancy ........................................................................................................ 37
2.2 Mammary Gland and MEC Sample Processing ........................................................... 38
2.2.1 Single Cell Suspensions ......................................................................................... 38
2.2.2.1 Immunophenotyping and Fluorescent Signal Analysis of MECs and Tumor
Cells ............................................................................................................................ 40
2.2.3 Imaging of Whole Mounts and Sections ................................................................ 40
2.2.3.1 Staining ........................................................................................................... 41
2.3 Time-lapse Imaging of H2B-eGFP Labeled Cells ........................................................ 42
Chapter 3 ................................................................................................................................. 45
3.1 Developing a transgenic mouse model enabling inducible H2B-eGFP labeling of
MECs .................................................................................................................................. 45
3.2 Doxycycline-dependent labeling of MG ....................................................................... 45
3.3 Compartment-Specific Labeling in the Mammary Epithelium .................................... 47
3.3.1 MMTV-rtTA Drives Luminal Compartment Restricted Reporter Gene Expression
......................................................................................................................................... 47
3.3.2 Keratin-5 rtTA Drives Basal Compartment-Restricted Reporter Gene Expression
......................................................................................................................................... 48
3.4 Proliferation dependent washout of H2B-eGFP labeling ............................................. 49
3.4.1 Puberty Induced Proliferation Results in Dilution of Incorporated GFP Signal
Differentially in Developmentally Distinct Ductal Areas .............................................. 50
3.4.2 Ovariectomy Blocks Proliferation Dependent Washout of H2B-eGFP Label in
Mammary Epithelial Cells .............................................................................................. 51
3.5 Simultaneous Induction of H2B-eGFP and Tet-responsive Wnt Oncogene Results in
Labeling of Mammary Hyperplasia .................................................................................... 52
3.6 H2B-eGFP Transgene Labeling Allows Live Imaging of Mammary Cells ................. 53
viii
3.7 Discussion ..................................................................................................................... 54
Chapter 4 H2B-eGFP Labeling and Proliferation Dynamics in Mammary Tumors Driven by
Constitutive Oncogenes .......................................................................................................... 73
4.1 Introduction ................................................................................................................... 73
4.2 Experimental Strategies Allowing the Study of Proliferation Dynamics in Mammary
Tumors Driven by Constitutive Oncogenes ........................................................................ 74
4.3 Dox-regulated GFP Labeling Independent of Tumorigenesis ...................................... 75
4.4 Identification of LRC in Explanted Mammary Tumors ............................................... 77
4.5 Adriamycin Treatment Does Not Alter GFP Labeling and Label Retention Dynamics
in MMTV-wnt1 Driven Mammary Tumors ....................................................................... 79
4.6 Keratin-5 Induced Labeling and Label Retention in MMTV-wnt1 Driven Constitutive
Mammary Tumors .............................................................................................................. 80
4.7 Constitutive MMTV-Neu Mammary Tumors can be Labeled with H2B-eGFP .......... 81
4.8 Discussion ..................................................................................................................... 82
Chapter 5 H2B-eGFP Labeling and Proliferation Dynamics in Reversible Mammary Tumors
and Minimal Residual Disease Lesions ................................................................................ 101
5.1 Introduction ................................................................................................................. 101
5.2 Experimental Strategy for the Study of Proliferation Dynamics in Reversible
Mammary Tumors and Minimal Residual Disease Lesions ............................................. 101
5.3 Doxycycline-dependent Labeling of Inducible Mammary Tumors ............................ 103
5.4 MRD Retain Bright H2B-eGFP Label Following Tumor Regression........................ 104
5.5 Discussion ................................................................................................................... 107
Chapter 6 A Transgenic Model for Short-Term Lineage Tracing of Mammary Epithelial
Cells in Pregnancy ................................................................................................................ 121
6.1 Introduction ................................................................................................................. 121
6.2 Contributions of Mammary Epithelial Cell Sub-types to Lobulo-alveolar Outgrowths
of Pregnancy ..................................................................................................................... 123
6.2.1 Tracing the Contributions of Luminal Mammary Epithelial Cells to Lobulo-
alveolar Outgrowths During Pregnancy ........................................................................ 123
6.2.2 Tracing the Contributions of Basal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Pregnancy ..................................................................................... 125
6.3 Contributions of Mammary Epithelial Cell Sub-types to Lobulo-alveolar Outgrowths
Induced by Hormone Stimulation ..................................................................................... 127
6.3.1 Tracing the Contributions of Luminal Mammary Epithelial Cells to Lobulo-
alveolar Outgrowths During Hormone Induced Proliferation and Differentiation ....... 128
6.3.2 Tracing the Contributions of Basal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Hormone Induced Proliferation and Differentiation ..................... 129
ix
6.4 Persistence of Labeled Cells Through Post-Lactational Remodeling of the Mammary
Gland ................................................................................................................................. 130
6.4.1 Luminal Labeled Mammary Epithelial Cells Persist Through Involution ........... 131
6.4.2 Basal Labeled Mammary Epithelial Cells Persist Through Involution ............... 132
6.5 Discussion ................................................................................................................... 134
Chapter 7 Final Discussion ................................................................................................... 158
7.1 Labeling the Luminal and Basal MEC Compartments ......................................... 158
7.2 Using H2B-eGFP Labeling to Characterize Mammary Tumors .......................... 160
7.3 LRCs in MRD and Maintenance of MRD .................................................................. 164
7.4 Lineage Restriction and Cell of Origin in Alveologenesis ......................................... 165
7.5 Parity-related Protection from Breast cancer .............................................................. 168
7.6 Summary ..................................................................................................................... 169
References: ............................................................................................................................ 170
Appendix: Flow Cytometric Analysis Demonstrates Variability of LRCs in MMTV-Wnt1
Induced Mammary Tumor Explants, Additional Samples ................................................... 182
x
List of Figures
Figure 1.1 Basic Anatomy of the Mammary Gland. ..................................................................... 30
Figure 1.2 Secretory Differentiation and Cyclical Remodeling of the Mammary Ductal Tree. .. 31
Figure 1.3 Schematic of Bilayered Mammary Ducts and Keratin Expression Patterns. .............. 32
Figure 1.4 A Proposed Hierarchy of Mammary Epithelial Cells. ................................................. 33
Figure 3.1 Strategy for Temporal Regulation of H2B-eGFP Transgene Expression in
Epithelial Cellular Compartments of the Mammary Gland. ......................................................... 58
Figure 3.2: Dox-Regulated Expression of the H2B-eGFP Transgene in Mammary
Epithelium of MMTV-rtTA/TGFP Mice. ..................................................................................... 59
Figure 3.3 Luminal-Restricted Labeling of MECs in MMTV-rtTA/TGFP Mice. ..................... 60
Figure 3.4 Immunophenotyping of Labeled Mammary Epithelial Cells Confirms
Compartment-Specific H2B-eGFP Fluorescent Labeling ............................................................ 61
Figure 3.5 Dox-Regulated Expression of H2B-eGFP in Basal Mammary Epithelium of K5-
rtTA/TGFP Mice. .......................................................................................................................... 62
Figure 3.6 Basal-Restricted Labeling of MECs in K5-rtTA/TGFP Mice. .................................... 63
Figure 3.7 Immunophenotyping of Labeled Mammary Epithelial Cells Confirms H2B-eGFP
Fluorescent Labeling. .................................................................................................................... 64
Figure 3.8 Selective Washout of H2B-eGFP Fluorescence by Developmental Proliferation
in Terminal End Buds. .................................................................................................................. 65
Figure 3.9 Proliferation is Necessary for the Washout of Induced H2B-eGFP Signal in the
Mammary Gland. .......................................................................................................................... 66
Figure 3.10: Elimination of Ovarian Hormone Induced Proliferation Limits H2B-eGFP
Signal Dilution in the Mammary Gland. ....................................................................................... 67
Figure 3.11 A Strategy for Dox-Regulated H2B-eGFP Labeling of MECs in the Context of
Inducible Wnt1 Expression. .......................................................................................................... 68
Figure 3.12 H2B-eGFP Labeling of Luminal MEC-driven, Wnt1-initiated Mammary
Hyperplasia. .................................................................................................................................. 69
Figure 3.13 H2B-eGFP Labeling of Basal MEC-driven, Wnt1-initiated Mammary
Hyperplasia. .................................................................................................................................. 70
Figure 3.14 H2B-eGFP Labeling of Mammary Epithelial Cells Allows Tracking of Cell Fates
in Real Time via Time-Lapse Confocal Microscopy. ................................................................... 71
Figure 3.15 Time-Lapse Fluorescence Microscopy of H2B-eGFP Labeled Mammary Cells in
Mammary Duct Fragments in Culture Allows Tracking of Cellular Proliferation Dynamics. .... 72
Figure 4.1 Mammary Adenocarcinomas Arising in the MMTV-wnt1 Model Show a Mixed-
Lineage Phenotype. ....................................................................................................................... 87
Figure 4.2 Strategy for the Dox-Dependent H2B-eGFP Labeling of Either Basal-Type or
Luminal-Type Tumor Cells in the MMTV-wnt1 Model. ............................................................. 88
Figure 4.3 Homogeneous Versus Heterogeneous Models of H2B-eGFP Washout in Growing
Mammary Tumors. ....................................................................................................................... 89
xi
Figure 4.4 Wide Variation in the Extent of H2B-eGFP Labeling of Luminal-Type Tumor
Cells in the MMTV-Wnt1 Model. ................................................................................................ 90
Figure 4.5 Wide Variation in the Rate of H2B-eGFP Washout from Luminal-Type Tumor
cells in the MMTV-Wnt1 Model. ................................................................................................. 91
Figure 4.6 Generating Clonally-Related Tumor Outgrowths by Explanting onto Syngeneic
Host Mice. ..................................................................................................................................... 92
Figure 4.7 Variable H2B-eGFP Labeling Among Clonally-Related MMTV-Wnt1 Mammary
Tumor Explants. ............................................................................................................................ 93
Figure 4.8 Evidence for Heterogeneous H2B-eGFP Washout in a Subset of MMTV-Wnt1
Tumor Explants. ............................................................................................................................ 94
Figure 4.9 Variable H2B-eGFP Washout Among Clonally-Related MMTV-Wnt1 Mammary
Tumor Explants. ............................................................................................................................ 96
Figure 4.10 Chemotherapy with Adriamycin Minimally Impacts H2B-eGFP Labeling and
Washout in MMTV-Wnt1 Tumor Explants. ................................................................................. 97
Figure 4.11 H2B-eGFP Labeling of Basal-Type Tumor Cells in the MMTV-Wnt1 Model. ....... 98
Figure 4.12 MMTV-Neu Driven Tumors Contain a Homogeneous Cell Population Capable
of H2B-eGFP Labeling. .............................................................................................................. 100
Figure 5.1 Strategy for the Concurrent Temporal Regulation of the H2B-eGFP and Tet-op
Wnt Transgenes Expression in Mammary Tumors and Minimal Residual Disease Lesions. .... 113
Figure 5.2 Two Models for the Maintenance of Minimal Residual Disease Lesions. ................ 114
Figure 5.3 Wide Variation in the Extent of H2B-eGFP Labeling of Luminal-Type Tumor
Cells in the MMTV-rtTA/TWNT/TGFP Model. ........................................................................ 115
Figure 5.4 Minimal Residual Disease Lesions Retain H2B-eGFP Signal Following Tumor
Regression. .................................................................................................................................. 117
Figure 5.5 MRD Retain Greater Fluorescent Label than Surrounding Normal Ducts. .............. 118
Figure 5.6 Flow Cytometric Analysis of GFP Signal Intensity in Matched Tumor Biopsy,
MRD Lesions, and Regressed Hyperplasia. ............................................................................... 120
Figure 6.1 A Model of Alveolar Progenitors. ............................................................................. 137
Figure 6.2 Parity-Related Protection from Breast Cancer. ......................................................... 138
Figure 6.3 Experimental Timelines For the Investigation of Cell Fates During Pregnancy. ...... 139
Figure 6.4 Schematic Depictions of Potential Outcomes of Lineage Tracing During
Alveologenesis. ........................................................................................................................... 141
Figure 6.5 H2B-eGFP Labeling of Luminal Cells During Pregnancy in MMTV-rtTA/TGFP
Mice. ........................................................................................................................................... 142
Figure 6.6 Luminal Cells Contribute to Lobulo-alveolar Outgrowths During Pregnancy. ........ 143
Figure 6.7 H2B-eGFP Labeling of Basal Cells During Pregnancy in K5-rtTA/TGFP Mice ..... 144
Figure 6.8 Basal Cells Contribute to Lobulo-alveolar Outgrowths During Pregnancy. ............. 145
xii
Figure 6.9 H2B-eGFP Labeling of Luminal Cells During Hormone Induced Lobulo-alveolar
Development. .............................................................................................................................. 146
Figure 6.10 Luminal Cells Contribute to Lobulo-alveolar Outgrowths During Hormone
Induced Lobulo-alveolar Development. ..................................................................................... 147
Figure 6.11 H2B-eGFP Labeling of Basal Cells During Hormone Induced Lobulo-alveolar
Development. .............................................................................................................................. 148
Figure 6.12 Basal Cells Contribute to Lobulo-alveolar Outgrowths During Hormone Induced
Lobulo-alveolar Development .................................................................................................... 149
Figure 6.13 Dox Regulated H2B-eGFP Labeling of Luminal Mammary Epithelial Cells
During Lactation. ........................................................................................................................ 150
Figure 6.14 Post-lactational Remodeling of the Mammary Gland Retains Luminal Labeled
Mammary Epithelial Cells .......................................................................................................... 152
Figure 6.15 Dox Regulated H2B-eGFP Labeling of Basal Mammary Epithelial Cells During
Lactation ..................................................................................................................................... 153
Figure 6.16 Post-lactational Remodeling of the Mammary Gland Retains Basal Labeled
Mammary Epithelial Cells. ......................................................................................................... 155
Figure 6.17 A Revised Model of Alveolar Progenitor Cells. ..................................................... 157
xiii
List of Tables
Table 2.1 Primer Pairs Utilized in Genotyping Transgenic Mice ................................................. 44
xiv
Abbreviations
3D Three-Dimensional
APC Adenomatous Polyposis Coli
BrdU 5-bromo-2-deoxyuridine
C Celsius
CSC Cancer Stem Cell
DCIS Ductal Carcinoma In Situ
DNA Deoxyribonucleic Acid
DNAse Deoxyribonuclease I
Dox Doxycycline
Dsh Dishevelled
E Estrogen
EDTA Ethylenediaminetetraacetic acid
EGF Epidermal Growth Factor
EMT Epithelial to Mesenchymal Transition
ERDs Estrogen Receptor Downregulators
ERα Estrogen Receptor α
FACS Fluorescence Assisted Cell Sorting
FISH Fluorescent In Situ Hybridization
FVB an inbred mouse strain named for their sensitivity to
Friend Virus B strain leukemia
Fz Frizzled
G0P0 Gravida 0, Parity 0; Virgin
GFP Green Fluorescent Protein
GSK3 Glycogen Synthase kinase 3β
H+E Hematoxylin and Eosin
H2B-eGFP Histone H2B Fused to enhanced Green Fluorescent
Protein
HER2/Neu/ERBB2 (HER2) Homologues of the Human ERBB2 Receptor, an EGF
Family Receptor Tyrosine Kinase
HR Hormone Receptor
i.p. intra peritoneal
IDC Invasive Ductal Carcinoma
Inv involution
K14 Keratin 14
K5 Keratin 5
Lact lactation
LRCs Label Retaining Cells
MaSC Mammary Stem Cell
MECs Mammary Epithelial Cells
MMTV Mouse Mammary Tumor Virus
MMTV-LTR Mouse Mammary Tumor Virus Long Terminal Repeat
MNU Methylnitrosourea
MRD Minimal Residual Disease
Ovx ovariectomy
P Progesterone
xv
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PE Phycoerythrin
PFA Paraformaldehyde
PR Progesterone Receptor
Preg pregnant
RNA Ribonucleic Acid
rtTA Reverse-Tet Transactivator
SERMs Selective Estrogen Receptor Modulators
SMA Smooth Muscle Actin
TDLU Terminal Ductal Lobular Units
TEBs Terminal End Buds
TetO Tetracycline Operator
TGFP Tet-Operator Driven H2B-eGFP Transgene
TRAS Tet Operator Driven ras Transgene
TWNT Tet-Operator Driven Wnt1 Transgene
UV Ultra-Violet Radiation
wg wingless
WIF1 Wnt Inhibitory Factor 1
xvi
Acknowledgements
I am deeply indebted to my advisor, Dr. Ed Gunther, for helping me become not just a better
scientist, but also for allowing me the time and encouragement to develop into the teacher,
wife, and mother I am today. Without his patience and guidance, I would not have thrived in
the laboratory over the last several years. Thank you for all your help over my time in the
lab, I am truly grateful that you chose me to join your lab.
I would like to thank the other members of the Gunther Lab for all their assistance, both with
experiments and daily life, over the years. You have all helped me maintain my sanity even
when my mice didn’t behave and my immunos never worked. The advice I was given when
interviewing for grad school was true- don’t choose a lab based on the science- projects come
and go, but the people, they are the ones who will be with you all along. I am so very happy
that I was able to spend my grad school years in the Gunther Lab.
Shelley-Thank you for all the birthday cakes, loaning me your children, watching
mine, watching me do the procedure “just one more time” to make sure I finally can
do it as well as you, ensuring I always had everything I needed to get my work done,
and taking over all the mice I left behind on maternity leaves. I doubt I can ever
express myself sufficiently, but I admire your dedication to both your family and the
lab.
Travis- Thank you for genotyping more mice than I can count and for many late
afternoon games of “name that tune”. I am so glad you came back to Hershey as the
Gunther Lab just wasn’t the same without you there.
Kristin- I was so glad to be able to decorate the middle of the lab with you- we
certainly made some great origami! I will miss being pelted with random lab
plasticware and sharing the latest internet nonsense during a break in experiments.
Allison- I really enjoyed having you in the lab, your sense of humor helped me
survive those last months. It was so nice having you in the grad student corner with
me! Thank you.
Dan, Mike, Will- While you all were in the lab, you each helped me learn skills I will
never forget. From the rules of cricket and the function of ceiling snorkels, to the
importance of explaining the smallest detail, to the necessity of always, ALWAYS
reading the instructions you each reminded me that there is more to life than the
success or failure of any experiment.
I would like to additionally thank
Lynn Budgeon- for preparing countless sections for me, often on incredibly short notice,
and always with a smile.
Jeanette and the other handlers in the mouse room- for making each and every visit to the
mice easier. Your senses of humor and kindness brightened many of my days.
Sarah Bronson, Gary Clawson, and Jiyue Zhu, the members of my committee- for the
xvii
persistence and belief that my developing project would someday grown into a thesis even
with the stumbling blocks along the way and for your encouragement to pursue my career
when I was frustrated.
Kathy Simon and Kathy Shuey- for guiding me through all the paperwork and pitfalls of
graduate school, providing much needed breaks and reminding me that this too would pass. I
am so grateful that you both helped me balance and learn to balance the demands of school
and motherhood.
To my friends in graduate school, thank you for venting lunches, potluck dinners, and nights
spent studying and laughing. I will remember you all as the people who reminded me that
there is life in graduate school and after. To my friends outside graduate school- thank you
for your patience until I “finally” graduated, I’ll try not to talk about mice so much anymore!
Kim- No words can describe how happy I am to have met you. You are more than just my
friend; you are part of our family. You know you are beloved as Aunt Kim to my children,
but I want you to know that you are very loved and appreciated by all of us. Thank you for
everything.
I owe my parents gratitude for always, always believing in me and encouraging me to never
ever quit. I would never have been able to complete this achievement without their unfailing
dedication and support.
I must end this by thanking my family, my husband Craig, and my children Katie and John.
I know the time I have spent in graduate school has been busy and chaotic, but I am grateful
for your love and patience that have supported me through all the changes of these years.
Thanks for sticking with me and not complaining even when we had to have dinner with the
microscope. I love you all very much.
1
Chapter 1 Literature Review
1.1 Structure, Function, and Development of the Mammary Gland
The mammary gland evolved relatively recently, first appearing about 200 million years
ago, with the primary function being to provide newborn mammals with nutrition in the form
of milk. The mammary gland is exquisitely dependent on hormonal stimulation for
regulation of its growth and development [1]. The cellular composition of the mammary
gland has been studied for many years and putative stem cell populations for the ductal tree
have been proposed recently; however, the exact hierarchy of lineage commitment of MECs
has not been completed.
1.1.1 Development of the Mammary Gland
Mammopoiesis is distinct from the development of most organ systems in that only
rudimentary development occurs during the embryonic and fetal stages. The full elaboration
of the mammary gland requires the onset of puberty and a complex milieu of endocrine
signals. Terminal differentiation of the mammary glands is not completed until the onset of
pregnancy induces lobulo-alveolar growth and lactation [2]. The mammary gland also has
the capacity to undergo sequential rounds of proliferation, differentiation, and subsequent
remodeling in response to hormonal stimulation. This cyclical nature of mammary gland
development provides an interesting avenue for the study of lineage commitment and lineage
plasticity of mammary epithelial cells
1.1.1.1 Prenatal Development of the Mammary Gland
During embryogenesis the first sign of the developing mammary gland is found in the
appearance of the milk lines in the ectoderm of both male and female embryos [3], followed
2
by the development of pairs of placodes of epithelial cells that bud into the surrounding
mesenchymal tissue forming a small number of ducts embedded in a fat-pad. Further growth
of the mammary gland is then paused until the onset of puberty, though at birth, the
rudimentary mammary gland structures are competent to produce milk [4].
1.1.1.2 Post-natal Development of the Mammary Gland
Prior to puberty, the mammary gland consists of a few short ducts extending from the
nipple surrounded by stromal tissue commonly called the fat pad (Figure 1.1). The surge in
hormone levels accompanying the onset of puberty drives the formation of club like
structures at the end of the ducts termed Terminal End Buds (TEBs) [5]. Unlike the ducts
which maintain a lumen, the TEBs are comprised of an outer layer of cap cells, which give
rise to myoepithelial cells, and a multilayered internal mass of body cells, the precursors of
luminal epithelium [6]. As circulating estrogen levels begin to rise, a marked increase in
growth of the mammary gland begins [1, 7]. This growth is characterized by: 1) increased
levels of proliferation within the TEBs that drive ductal elongation through the surrounding
fat pad, and 2) regulated apoptosis within the body cells that leads to lumen formation in the
growing duct [5, 6]. The ductal elongation, together with bifurcation of TEBs, leads to
ductal branching and the rapid filling of the fat pad with mammary duct. Morphogenesis of
the developing mammary gland, particularly the formation of lumens, is regulated by a vast
array of signals, including hormones, growth factors, extracellular matrix, morphogens, and
immune cells [6, 8]. These signals facilitate communication between the growing epithelial
cell themselves and between the ductal epithelium and the surrounding stroma [8, 9].
Elongation of the ductal tree induced by puberty ceases when the ducts reach the ends of the
fat pad. In addition to the branching that occurs during ductal morphogenesis, secondary
3
side-branching occurs even after the ductal tree fully invests the fat pad [10]. Side-branching
of the ductal tree appears to be regulated by the detection of neighboring ducts and by the
arrangement of the ductal structures [11-13]. The hormonal changes of the female estrus
cycle can lead to rounds of proliferation and side-branching. Subsequent remodeling of the
mammary gland via apoptosis maintains a homeostatic level of epithelial development [2].
1.1.1.3 Terminal Differentiation Induced By Pregnancy and Lactation
Terminal differentiation of the mammary gland is dependent on the hormones of
pregnancy which induce rapid expansion of the lobulo-alveolar compartment in order to
facilitate lactation [14, 15]. Prolactin and progesterone, in cooperation with proper 3D
structure of the ducts, extracellular matrix, and growth hormones, drive increased side-
branching of the mammary ducts and ductules, and differentiation of alveoli, the structures
which eventually synthesize and secrete milk [16, 17]. As depicted in Figure 1.2, during
pregnancy, a rapid expansion of the epithelial cell population creates the lobules and alveoli
required for milk production. Pregnancy triggers secretory cell differentiation causing the
production of milk proteins and lipids [2]. The lumen of the mammary ducts serves both as
storage for milk produced during lactation and also as the egress route for that milk to the
nipple.
Continued milk production in the mammary gland is dependent on both suckling
stimulation and hormonal influences [18]. Subsequent weaning of offspring induces
involution, a remodeling of the mammary gland that eliminates milk production and restores
the normal homeostasis and virgin-like appearance of the mammary gland (Figure 1.2). This
post-lactational regression is mediated largely by apoptosis of secretory epithelial cells and a
subsequent remodeling of the mammary gland includes disruption and repair of the basement
4
membrane and phagocytosis of apoptotic cells [18-21]. Remodeling of the mammary gland
during involution does not remove or reduce the capacity to undergo subsequent rounds of
pregnancy-induced growth and differentiation.
1.1.2 Cellular Composition of the Mammary Gland
Early in embryogenesis, two distinct cell types can be identified in the developing
mammary gland. These cells are the precursors to the epithelial and stromal cells that the
mammary gland contains. Ducts within the adult mammary gland are comprised of two
layers of pseuodostratified epithelium surrounded by a laminin-containing basement
membrane [22, 23]. The inner layer is composed of luminal epithelial cells surrounding a
hollow lumen and the outer layer is made up of a single cell-layer of myoepithelial (also
referred to as basal) cells (Figure 1.3). The integrity of the basement membrane is important
for regulating polarity, growth and response to hormones for both the luminal epithelial and
myoepithelial layers [24, 25].
The inner layer of luminal epithelial cells display cuboidal morphology and can be
identified by immunohistochemical staining of cells for keratins 8, 11, 14, 20 and 22 [26].
Luminal epithelial cells are also characterized by the following cell surface markers
CD29lo
/CD49f+/CD24
hi/CD61
-/Sca1
+ [27-29]. These cells line the hollow lumen of the
mammary duct and can secrete milk proteins. A small subset of luminal epithelial cells
express Estrogen Receptor α (ERα) and are thus directly hormone responsive [15, 30]. Cell-
cell interactions between luminal layer cells are proposed to maintain cell type specificity
within the ducts of the mammary gland [31].
The myoepithelial, or basal layer, consists of elongated epithelial cells. These cells
are contractile and capable of aiding milk expulsion from the alveoli and through the ducts in
5
response to suckling stimulation [32, 33]. Myoepithelium is also responsible for the
elaboration of basement membrane during the development of the ductal tree [23].
Myoepithelial cells are characterized by expression of keratin 5, keratin 14 and smooth-
muscle actin [22, 34] and are CD29hi
/CD49fhi
/CD24+/CD61
+ [27-29]. The localization of
myoepithelial cells, interposed between the luminal layer, basement membrane and stroma
allows integration of multiple signals from the microenvironment [35-38]. Thus,
myoepithelial cells play a role in coordinating epithelial cell interactions.
The extra-epithelial or stromal compartment of the mammary gland derives from the
mesoderm. This tissue compartment is composed largely of fat cells which provide a
structural framework for the mammary ductal tree [39]. The stroma also contains the
vasculature required to support the cells of the mammary gland. While the structural role of
the fat-pad is critical, interactions between the stroma and epithelial cells are also crucial to
proper growth and function of the mammary gland. A wide assortment of candidate signal
transduction molecules have been implicated in the interaction between stromal cells and
ductal epithelial cells including matrix metalloproteinases and fibroblast growth factors [8,
39-42].
1.1.3 Hierarchy of Mammary Epithelial Cells
By using transplant studies, DeOme and colleagues demonstrated the presence of
cells throughout the mammary gland capable of giving rise to a fully developed mammary
ductal tree [43-45]. Their studies additionally provided evidence for cells capable of serially
propagating a mammary ductal tree through several rounds of transplantation suggesting the
presence of a stem cell-like population within the mammary duct fragments. Later work
6
demonstrated extended but ultimately limited proliferation if serially implanted ductal
fragments [46].
To better understand mammary stem cell biology, several groups have recently
sought to prospectively isolate a candidate stem cell population from the mammary gland
based on cell surface markers. Adapting the strategy used to isolate hematopoietic stem
cells, single cells isolated from mammary glands and subsequently stained with a range of
cell surface markers can be analyzed by flow cytometry and sorted. These sorted cells can
then be transplanted or studied in culture systems in order to examine their regenerative
capacities. The downstream patterns of cell lineage during normal development are proposed
to consist of a bipotential progenitor cell with high proliferative potential that can give rise to
cells of both luminal and basal type. Further commitment of daughter cells results in ductal-
and myoepithelial-restricted progenitor populations capable of giving rise to only cells of a
single cell layer. The exact characterization and capability of the alveolar progenitor awaits
definition. It is not yet clear whether bi-layered alveolar structures derive solely from
alveolar progenitor cell populations or if each cell type arises from a distinct lineage
committed progenitor population. Figure 1.4 presents a model of lineage pathways within
the cellular hierarchy of the mammary epithelial tree.
A MaSC-enriched population is contained within the CD61+/Sca1
-/CD24
lo/CD29
hi
(β-integrin) or CD61+/Sca
-/CD24
lo /CD49f
hi (α6-integrin) population [27-29]. Cells within
these populations were capable of reconstituting a mammary ductal tree containing cells of
both the luminal and basal lineages following implantation and through sequential rounds of
implantation and gave rise to large colonies containing cells of both luminal and basal
character. Interestingly, the MaSC-enriched populations express neither the ERα or
7
progesterone receptors [47, 48]. However, the absence of hormone receptors from the stem
cell population does not appear to preclude an indirect response of these cells to hormone
stimulation, as they respond to paracrine signaling from other MECs [49].
Similar to the proposed MaSC immunophenotype, basal epithelial cells are CD29hi
or
CD49fhi
and also CD24lo
/CD61+
[27-29]. The overlap in cell-surface markers between the
MaSC population and the basal epithelial cell population within the mammary gland has
supported the potential localization of the MaSC population within the basal layer of the
ducts. A myoepithelial progenitor population has not yet been isolated though it is likely to
segregate with the proposed MaSC population. The myoepithelial progenitor population is
proposed to exist based on the identification of basal restricted cell colonies in culture [50].
Cells in the luminal layer of mammary ducts derive from a luminal committed
progenitor. An immunophenotype of these cells has been suggested as
CD29lo
/CD49f+/CD24
+/CD61
+/KIT
+ and either ERα
+ or ERα
- [27-29, 51]. The variability in
ERα status of luminal progenitors recapitulates the variation in ERα expression in total ductal
cells within the mammary gland. Luminal progenitor cells isolated using this
immunophenotype (excluding ERα status) gave rise to larger colonies in 3D culture in
Matrigel than those arising from CD61- cells. Additionally, these colonies contained only
luminal cells unlike colonies derived from cells in the MaSC population [51]. Committed
cells of the luminal layer bear the CD29lo
/CD49f+/CD24
+/Sca1
+ /CD61
- immunophenotype
[27-29, 51, 52]. The proportion of committed luminal cells to luminal progenitors rises
through puberty and during pregnancy concurrent with the widespread proliferation and
differentiation occurring during those developmental periods [51].
8
The precursor cells that give rise to alveolar outgrowth remain undefined though a
potential alveolar progenitor cell has been described bearing the immunophenotype
CD24+/CD49f
+/Sca1
- [53-55]. The precise contributions and origin of this population is
unknown. One model posits that a luminal progenitor may also give rise to an alveolar
progenitor. An alternative model proposes the existence of an alveolar progenitor population
that gives rise to the lobulo-alveolar differentiated cells during pregnancy from the common
progenitor cell. The first model accounts for bi-layered alveolar outgrowths by assuming
contributions from multiple lineage-committed progenitors. The second model accounts for
the bi-layer by assuming that all the cells in an alveolus are the progeny of a bi-potent
progenitor capable of begetting both luminal and basal MECs.
1.1.4 Areas for Further Study
The developmental patterns and the mechanisms of regulation of proliferation and
differentiation within the mammary gland have largely been described. However, the precise
cellular contributions and lineages that give rise to the developed mammary gland have only
recently been studied. Further characterization of the roles of stem cells and progenitors and
the precise lineage commitment pathways would provide greater insight into the complex
development of the mammary gland and possibly into other epithelial tissues. Additional
characterization of MaSCs would also allow more specific isolation and identification of
these cells with the possible localization of these cells within intact mammary ducts. As the
microenvironment plays a key role in the maintenance of stem cells in a variety of tissues it
is likely that determining the precise localization of MaSC would provide insight into the
mechanisms regulating their maintenance and differentiation.
9
Current methods of isolation of MaSC rely upon varied immunophenotyping markers
to select enriched populations. These markers are not selected based on any specific
biological functions and do not necessarily provide insight into the function of the stem cells
or their regulation. While some work has focused on Hoechst dye efflux as a functional
feature of stem cells based on the proposed ability to pump out toxins, isolation of dye-
excluding cells has not proven effective for enriching stem cell populations [56]. The
prospective isolation of a candidate stem cell population based on a putative characteristic of
those cells would offer the ability to study a viable population with known stem cell
behavior.
The lineage of the cells composing lobulo-alveolar outgrowths also remains unclear.
While putative alveolar progenitors have been identified, the exact contributions of these
cells to the differentiated structures have not been defined. Identifying the source of the cells
comprising the alveoli in both cell layers would provide crucial information about the
developmental pattern of alveologenesis and pregnancy induced differentiation. By tracing
the lineage of the cells composing both the luminal and basal layers of alveoli, the hierarchy
of MECs could be more clearly defined.
1.2 Breast Cancer
Breast cancer is the most commonly diagnosed cancer in women in the Western
hemisphere and the second leading cause of cancer-related death in females. Though
malignant breast disease is very common, with a lifetime risk approaching 1 in 8 women,
breast cancer is a very heterogeneous disease with numerous possible etiologies. The
extensive heterogeneity in both causation and tumor characteristics complicates the study and
treatment of breast cancers.
10
Ductal carcinoma of the breast develops through a series of steps and is characterized
by proliferation of malignant epithelial cells within lobules and ducts of the mammary gland.
The traditional understanding of progression of ductal carcinomas begins with benign
overgrowth in a focal lesion known as hyperplasia or dysplasia, then progresses to ductal
carcinoma in situ (DCIS), and finally to invasive ductal carcinoma (IDC) [57-60]. DCIS is
commonly defined as an overgrowth of epithelium that is contained within an intact
basement membrane, whereas IDC is diagnosed when the malignant growth has breached the
basement membrane. IDC is the most common type of breast cancer. Breach of the basement
membrane and subsequent invasion into the surrounding tissue allows the metastasis of
breast cancer cells to distant sites within the body.
1.2.1 Types of Breast Cancers
The heterogeneity of breast cancers renders the selection of treatment methods more
difficult due to the assortment of clinical and histological forms. Cancers of the breast are
traditionally categorized based on the presence or absence of hormone receptors, histological
appearance, and amplification of HER2/Neu/ERBB2 (hereafter, referred to as HER2). These
methods of identification are commonly used in clinical settings for the determination of
treatment protocols. Recently, transcriptional profiling methods of characterizing mammary
tumors have been developed. Though not yet commonly used in a clinical setting, these
profiles offer greater insight into the precise molecular changes occurring within the tumor.
1.2.1.1 Traditional Characterization of Breast Cancers
In the clinic, tumors are categorized based on the presence or absence of the Estrogen
Receptor (ERα + vs. ERα
-) and Progesterone Receptor (PR
+ vs. PR
-) then by histological
11
appearance as luminal, basal, and HER2-like. Luminal and basal breast cancers are
diagnosed based on the appearance of tumor cells recapitulating the normal cell layers of the
mammary gland and the molecular profile of each group’s similarity to the normal cell type,
while ERBB2+/HER2 tumors are marked by the over-expression or over activation of the
ErbB2 receptor. Luminal and basal character of tumor cells are also determined by
immunohistochemical staining and HER2 status as determined by FISH.
1.2.1.1.1 Hormone Receptor Positive Breast Cancers
In many mammary tumors, the interaction of hormones and hormone receptor-
positive cells capable of responding to hormonal binding provides a critical stimulus driving
over growth of epithelial cells. Approximately 80% of human breast cancers are ERα +, with
2/3 of those also being PR+. The luminal sub-type of breast cancer is usually characterized
as expressing ERα and/or PR and is Keratin 8/18 positive.
Anti-hormonal therapies, treatments which lower the amount of estrogen or decrease
the activity of the ERα, have provided a targeted method to slow tumor growth in hormone
dependent cancers. Three categories of anti-hormonal therapies are commonly used;
aromatase inhibitors, SERMs (Selective Estrogen Receptor Modulators), and ERDs
(Estrogen Receptor Downregulators). ERDs block ERα action throughout the body by
causing its degradation [61, 62]. SERMs, such as tamoxifen, function by competitive
inhibition of the ERα, preventing binding of estrogen to the ERα and can be used in both pre
and post-menopausal women [63]. SERMs can have mixed agonist/antagonist activity. For
example, Tamoxifen can activate ERα in extramammary tissues and is not exclusively anti-
estrogenic. Aromatase inhibitors prevent the enzyme aromatase from converting androgens
into estrogen in peripheral tissues. Ovarian hormone production is largely aromatase-
12
independent, therefore aromatase inhibitors are not effective in reducing estrogen levels in
pre-menopausal women. While aromatase inhibitors are effective treatments against ERα
positive breast cancers, the long-term effects of estrogen deprivation limit their use in many
patients and treated tumors often become hypersensitive to exogenous estrogen [64, 65].
1.2.1.1.2 Hormone Receptor Negative Breast Cancers
Two subsets of breast cancer that do not express high levels of ERα have also been
described. Basal-like, named because of its similarity to normal basal/myoepithelial cells of
the mammary gland and HER2/ERBB2/Neu named for the characteristic high expression of
the gene product of the same name. Basal-like breast cancers typically express keratins 5/6
and 14, EGFR are ERα -/PR
-/HER2
- , (so-called “triple-negative”) [66-68]. Not all basal-like
breast cancers are triple-negative tumors as ER expression has been seen in 5-45% of basal-
type cancers and Rouzier et al. showed HER2 expression in 14% of basal tumors. Anti-
hormonal strategies, such as tamoxifen, are not effective against basal breast cancers due to
the lack of ERα expression. In the absence of targeted therapies for these tumors, traditional
cytotoxic agents, such as chemotherapy and radiation, remain mainstays for treatment of
triple-negative tumors.
1.2.1.1.3 HER2/ErbB2/Neu Initiated Breast Cancers
HER2 is a member of the EGF family of receptor tyrosine kinases [69]. It is a
transmembrane receptor that signals through the Ras/Mek/ERK pathway and the PI3K/Akt
pathway to drive proliferation and inhibit apoptosis in the mammary gland [70]. Several
modes of HER2 dysregulation have been proposed to drive tumorigenesis. The expansion of
copy number of the gene, increased translation of HER2/Neu mRNA, increased cell surface
receptor expression, and alterations in the extracellular domain of the receptor conceivably
13
all provide an oncogenic stimulus [71-75]. Of these modes of HER2 pathway activation,
gene amplification is the most clinically important as amplification detected by fluorescent in
situ hybridization (FISH) predicts response to drugs that target HER2. Alterations in the level
and activity of the HER2 gene product result in increased and deregulated signaling to the
downstream pathways [76]. A variety of therapeutic strategies have been designed that target
HER2. Most notably, the development of Herceptin (trastuzamab), a humanized monoclonal
antibody that recognizes the ErbB2 receptor, has greatly improved outcomes for patients with
HER2+ breast cancer [77]. More recently, small molecule inhibitors of HER2 kinase
activity, such as lapatinib, have shown promising activity against HER2+ cancers that have
acquired resistance to Herceptin [78].
1.2.1.2 Transcriptional Profiling of Breast Cancers
While the traditional methods of categorizing breast cancers based on histology,
immunohistochemistry, and hormone receptor status are still widely used in the clinical
setting expression profiling of tumors by microarray is providing new insight into the
molecular taxonomy of breast cancer. These expression profiles have identified 5 “intrinsic
subtypes” of breast cancer that bear characteristic gene expression patterns; luminal A,
luminal B, basal-like, HER2, and normal breast-like [79-81]. By examining breast cancers in
each subtype, potential pathways may be targeted more precisely allowing more efficient
treatment [82].
14
1.2.2 Hierarchy of Cells in Mammary Cancers
Prior to the 1990s, cancers were typically thought of as homogeneous populations of
cells; however, the description of leukemia stem cells opened a window into the more
complicated hierarchical relationship of the cells composing tumors [83-87]. While “liquid”
tumors had defined hierarchies, solid tumors lacked similar understanding of cancer cell
lineage. In 2003, Clarke and colleagues described the isolation of a minority cell population
isolated from breast cancers capable of reconstituting the tumor following implantation [88].
These cells were distinct from the bulk tumor cell population in this tumor-initiating
capability. The prospective isolation of these CD44+/CD24lo/Lin- tumor-initiating cells
paired with the identification of subsets of solid tumor cells capable of giving rise to colonies
in culture provided evidence for a candidate stem cell population within the tumor.
Importantly, tumor-initiating cells gave rise to the cellular heterogeneity seen in the primary
tumor demonstrating multi-potency of the population. While the identification of these
tumor-initiating cells provides insight into the developmental patterns of many mammary
cancers, some cancer subsets have not had any tumor-initiating populations isolated and
appear to be homogeneous.
The variety of mammary cancer phenotypes may be attributable to the plasticity of
these cancer stem cells or due to cell of origin effects. Luminal type cancers do not
necessarily arise from luminal type cells affected by genetic alternations, and similarly, basal
mammary cancers do not necessarily derive from basal precursor cells [89]. It remains
unclear whether MaSC serve as the cell of origin for breast cancers or whether accumulated
genetic insults activate stem cell-like behaviors in a subset of tumor cells responsible for
tumorigenesis. It is possible that many subsets of mammary cancers derive from a single cell
15
of origin and it is the specific mutations contained within any one tumor which determine the
resulting tumor type. Alternatively, identical mutations in distinct cell populations may result
in different tumor outcomes [90].
The identification of potential cancer stem cells within solid tumors, analogous to
those already described in the hematopoietic cancers provides a new target for the
development of treatments. Increased understanding of the hierarchy contributing to
developing mammary cancer would provide new avenues of attack against breast cancers and
would particularly allow targeted therapies aimed at tumor-initiating cells within the tumors.
Traditionally, therapeutic methods were evaluated on the basis of their ability to decrease
tumor volume and typically target rapidly cycling cells. However, if only a subset of tumor
cells is in fact tumor initiating (and potentially quiescent), and the majority of tumor burden
consists of non-tumorigenic proliferating cells, then targeting instead the small proportion of
cells responsible for tumor formation would prove more beneficial even if not as
immediately effective in reducing tumor bulk. Lineage tracing experiments ought to provide
insight into the cell of origin of mammary tumors and into the interactions between particular
cell of origin and mutation effects.
1.2.3 Breast Cancer and Tumor Dormancy
A relatively common feature of breast cancer progression is the recurrence of local or
metastatic disease following a long interval free of detectable tumor [91, 92]. In addition,
only a small percentage of women develop clinically detectable breast cancers even though
as much as 39% of women aged 40-50 in fact harbor DCIS [93]. These undetected lesions
are presumed to be maintained in a non-invasive state, often for extended periods of time [94,
16
95]. This lack of tumor progression is inconsistent with the common model of unbridled
proliferation of tumor cells. The concept of tumor dormancy has been offered to provide an
explanation for these long periods of relative quiescence of tumor cells within the mammary
gland or metastatic lesion [91].
While tumor dormancy may help explain how breast cancer patients relapse with
metastatic disease long after eradication of their primary tumors, the mechanisms whereby
this dormancy is maintained remain unclear [96]. Immune cell mediation and the requirement
for angiogenesis have been suggested to maintain tumor latency in metastases and in dormant
primary lesions [97-99]. According to one model, tumor cells frequently disseminate to
distant organ sites, however only a small subset is capable of proliferating within the new site
and driving the formation of macrometastases. Some fraction of the remaining cells are
proposed to enter a period of quiescence. It is tempting to speculate that these dormant cells
arise from tissue-specific stem cells and function as cancer stem cells since they can enter
and exit quiescence and retain latent malignant potential. It remains unclear what causes
these cells to exit dormancy and cause disease recurrence. However, identification of the
cells within these dormant lesions and elucidation of the pathways regulating their
quiescence would provide a clear target for the treatment of dormant breast cancer [100].
1.2.4 Parity-Related Protection from Breast Cancer
Numerous epidemiologic studies have identified an array of hormonal and
reproductive factors that affect the risk of developing breast cancer. Among these, the breast
cancer risk reduction afforded by an early first full-term pregnancy is least well understood.
Younger age at first pregnancy is associated with a significant decrease in lifetime risk of
breast cancer and multiparous females also have a decreased risk of developing breast cancer
17
in comparison to nulliparous females [67, 101-105]. This reduction in risk is not
immediately apparent following pregnancy but first manifests several (3-4) years later. One
proposed etiology attributes parity-induced protection to the differentiation of the mammary
ductal tree that occurs during pregnancy and lactation, although the precise cellular and
molecular mechanisms that reduce the risk are undefined [106, 107]. Another model
attributes protection to parity-induced up-regulation of the p53 tumor suppressor pathway
[108-110].
1.3 Mouse Models of Human Breast Cancer
The similarities between the human breast and murine mammary glands as well as human
breast cancers and murine mammary tumors allow animal modeling of breast cancer. Mouse
models of cancer have greatly aided the progress of our understanding of the biology of
development and tumorigenesis by allowing a variety of experimental strategies to be
explored while relying on the homology between the model system and human conditions.
The developmental and genetic homology between humans and mice have allowed the
development of transgenic, knock-out, and chimeric mice to be used to study the role of
many gene products in the mammary gland.
Embryonic development of the mammary gland is highly conserved among mammals.
The rudimentary ducts develop from the ectodermal milk line remain growth arrested until
puberty. While humans typically only develop one pair of nipples and mammary glands,
located on the chest wall, mice typically develop 5 pairs located ventro-laterally [111].
Additionally, the human mammary gland ductal structure is somewhat more complex than
that of the mouse gland. Human ducts divide into segments that feed individually into the
nipple, rather than the single ductal tree that is found in the mouse [111]. The cellular
18
composition of the mammary ductal tree is similar within both human and murine ducts
consisting of an epithelial bilayer of luminal cells surrounded by myoepithelial (basal) cells.
Moreover, the cell layers exhibit similar cytokeratin expression patterns in both species [26,
112]. Unlike the cellular composition of the ducts, the cellular components of the stroma are
divergent. In the human breast, connective tissue supports the ductal tree while in the mouse
mammary gland, fat composes the majority of the stroma [113, 114].
Both the human breast and murine mammary gland respond to the cyclical hormonal
stimulation of the menstrual cycle or estrus with transient proliferation within the mammary
ductal structures [115, 116]. Prior to pregnancy in the mouse, very little lobuloalveolar
branching is seen [111]. In contrast, in the human breast, the corresponding terminal ductal
lobular units (TDLU) commonly develop prior to the onset of pregnancy, due to the
hormonal cycling induced by the menstrual cycle [111, 113]. Notwithstanding these
preexisting differences, the murine and human mammary glands respond similarly to the
hormones of pregnancy and lactation, and weaning induces similar involution via apoptosis
within the alveolar structures [117].
1.3.1 Virally-Induced Mouse Mammary Cancer and the Discovery of the Wnt1 Oncogene
The biology of the mammary gland and the study of mammary oncogenesis was
greatly advanced by the molecular characterization of the Mouse Mammary Tumor Virus
(MMTV) insertion sites in the early 1980s. Though the presence of a “milk factor”
responsible for the vertical transfer of a malignant tendency in mice had been proposed in the
1930s by Bittner, the causative agent remained unidentified [118-122]. MMTV was
identified as the viral agent responsible for the vertical transfer of mammary tumorigenesis in
mice in 1948 and the virus family was further characterized in the 1960s [123-126]. The
19
wnt1 oncogene was discovered by screening of mouse mammary tumors for oncogene
activation following infection with MMTV [127]. First named int1, the gene name was later
changed to Wnt1 after the genetic homology to the previously described wingless (wg) gene
in Drosophila was noted [128]. Insertion of MMTV into the Wnt1 gene occurs in nearly 70%
of MMTV-infected mice [127]. Less commonly, other oncogenes can be activated by
MMTV insertion, including other members of the Wnt family and members of the fibroblast
growth factor family [127, 129-132].
Wnts are secreted signaling proteins that interact with cell-surface Frizzled (Fz)
receptors [133, 134]. The binding of Wnt to Fz initiates a signal transmitted to dishevelled
(Dsh) [135] . Dsh in conjunction with Axin, in turn negatively regulate GSK3 (Glycogen
synthase kinase 3β) which normally phosphorylates β-catenin and targets it for degradation
[136-138]. The inhibition of GSK3 kinase activity allows levels of β -catenin to build up
within the cytosol and subsequently translocate to the nucleus where it can act as a
transcriptional cofactor and activate transcription of Wnt target genes, leading to cell growth
and proliferation [139, 140]. Accumulation of cytosolic β-catenin is opposed by the so-
called “destruction complex” which includes well-known tumor suppressors such as APC
(adenomatous polyposis coli) and Axin [141, 142].
1.3.1.1 Engineering Constitutive MMTV-Driven Expression of Oncogenes in the Mammary
Gland
Originally constructed in 1988 by Tsukamoto and colleagues, the commonly used
transgene for the constitutive expression of Wnt1 contains a genomic fragment harboring a
portion of the Wnt1 promoter and its complete coding sequence fused to an MMTV-LTR
(Mouse Mammary Tumor Virus Long Terminal Repeat), which recapitulates a common
20
insertional mutagenesis event [143]. The MMRV-LTR is responsive to hormone stimulation
and therefore drives expression that is upregulated during puberty and pregnancy [144].
Expression of Wnt1 via this construct leads to mammary gland ductal hyperplasia even prior
to puberty in female mice [145-147]. The ductal hyperplasia precludes female MMTV-Wnt1
transgenic mice from successfully nursing their offspring presumable by disrupting milk
production or delivery. The mean latency of tumors in female mice bearing the MMTV-
Wnt1 transgene is approximately 6 months with breeding mice developing tumors somewhat
earlier than virgin mice [143, 147]. Male Wnt1 transgenic mice also develop mammary
hyperplasia and, occasionally, mammary tumors [143, 148].
1.3.2 The Role of Wnt Signaling in Mammary Development and Breast Cancer
Nineteen Wnts have been identified in mammalian genomes and have been shown to
be potent regulators of proliferation and differentiation in both embryonic and adult tissues
[149-151]. In particular, Wnt signaling is required for the initiation of mammary
morphogenesis in the embryo, is localized along the mammary lines in the developing
embryo, and helps orchestrate ductal arrangement in the mammary gland [3, 149, 152, 153].
In the adult mammary gland Wnt-4, 5a, 5b, 6, and 7b are expressed [154]. Wnt-4 in
particular has been shown to be necessary for proper branching of the mammary ducts during
early pregnancy [155]. It has additionally been demonstrated that progesterone is required
for and induces the expression of Wnt-4 during pregnancy [155]. Based on these
observations, Wnt signaling appears to play a role in both initiation of mammary gland
developments and also in the subsequent maintenance of structural patterns in the epithelial
tree.
21
Wnt signaling impacts both embryonic and adult development of the mammary gland,
since abrogation of the Wnt disrupts the normal developmental patterns of proliferation.
These findings suggest that Wnt family members may play a role in the regulation and
maintenance of the MaSC population [3, 155-157]. Transgenic activation of Wnt1 increases
both the population of cells carrying the stem cell immunophenotype and also the population
of cells capable of reconstituting a mammary gland following implantation [27, 158].
Additional support for Wnt-mediated regulation of stem cell behavior in the mammary gland
is derived from the characterization of Wnt1-driven mammary tumors. Transgenic tumors
from these mice have cells of both luminal and basal character and populations within these
tumors express Keratin-6 and Sca-1, both markers of stem cell-like character [159, 160].
The effects of over- and under-expression of Wnt on stem cell and progenitor populations in
the mammary epithelium support a role of Wnt signaling in the regulation and maintenance
of mammary stem cells.
Viral oncogenesis plays no known role in the development of human breast cancers
and though the importance of Wnt as an oncogene in the murine mammary gland has been
well defined, human breast cancers resulting from Wnt1 mutations have not been identified
[161]. Nonetheless, Wnt pathway mutations have been demonstrated to transform primary
human MECs in culture and autocrine Wnt signaling drives proliferation in some breast
cancer cell lines [162, 163]. Overexpression of WNTs-2, -4, -5A, -7B, -10B, and 13 have
been identified in samples from human breast cancers [164-167]. While mutation of
components of the Wnt signaling pathway does drive tumorigenesis in other human tissues
(most notably in colon cancers where 85% of tumors have lost function of APC), similar
mutations have not been identified in the human breast [141]. Overexpression of β-catenin is
22
correlated with poor prognosis in breast cancers. Aberrant expression of β-catenin has been
identified in breast cancers and suggests altered Wnt signaling but mutations in Axin and β-
catenin were not found [168, 169]. The Wnt-inhibitory Factor, WIF1, has been reported to
be inactivated in cancers of the breast, prostate, and bladder by epigenetic means [170, 171].
The inactivation of inhibitory WIF may explain why Wnt signaling becomes dysregulated in
these cancers in the absence of Wnt (or downstream pathway) mutations. Though Wnt1 itself
does not appear to drive mammary tumorigenesis, other Wnt family members and the Wnt
signaling pathway in general may play critical parts in the transformation of human
mammary epithelial cells.
1.3.2.1 Inducible Expression of Wnt1 in the Mammary Epithelium of Transgenic Mice
To circumvent the difficulties inherent in constitutively activating Wnt1 oncogene
expression as seen in MMTV-Wnt1 transgenic animals, a transgenic model utilizing Tet
operator driven expression of the Wnt1 oncogene in the mammary gland allows reversible
oncogene expression. Tissue specificity and temporal regulation were achieved by the
construction and pairing of two independently incorporated transgenes [172, 173]. The
transactivator, MMTV-rtTA, contains the MMTV-LTR and drives continuous expression of
the reverse-Tet transactivator (rtTA) in the luminal epithelium of the mammary ductal tree
[172]. The second transgene construct, named TWNT, contains a minimal CMV promoter
upstream of seven Tet-operator sequences followed by the Wnt1 gene, an IRES sequence,
and a luciferase gene. This transgene allows the concurrent expression of the Wnt1
oncogene and the luciferase reporter gene in a tetracycline-dependent manner. Doxycycline
is a tetracycline analog that activates the expression Tet-R containing transgenes and
provides favorable pharmokinetics in vivo.
23
In the absence of Dox in bitransgenic MMTV-rtTA/TWNT animals, TWNT is not
expressed. However, following administration of Dox via the animals’ diet, Dox binding to
rtTA causes a conformational change in its structure that allows binding to the TetO sites in
the TWNT transgene, thereby initiating transcription of the downstream sequences.
Subsequent removal of Dox stimulation abrogates TWNT transgene expression. Dox-
regulated expression of the TWNT transgene results in ductal hyperplasia in all mammary
glands [173]. Sustained Dox treatment resulted in the stochastic development of mammary
tumors, primarily adenocarcinomas, in female MMTV-rtTA/TWNT mice, suggesting a
multi-step tumorigenesis. Single transgenic mice carrying only the transactivator or the
TWNT transgene did not develop mammary tumors even during continued Dox treatment.
Similarly, Dox-naïve MMTV-rtTA/TWNT animals did not develop mammary tumors
demonstrating Dox-dependence of tumorigenesis in this model. Similar to the findings in
MMTV-Wnt1 transgenic mice, bitransgenic tumor-bearing mice induced with Dox were
sometimes found to carry lung metastases [173].
1.3.2.1.1 Minimal Residual Disease Lesions Modeled in Transgenic Mice
In addition to allowing the conditional activation of the Wnt1 transgene in order to
limit the hormonal impacts on MMTV-driven expression of the oncogene, the reversible
model of Wnt1 expression mimics the effect of a targeted therapy. Removal of Dox from
the diet terminates expression of the TWNT transgene, mimicking the effects of a
chemotherapeutic that specifically counteracts activation of wnt1. Removal of Dox
stimulation results in the nearly complete regression of mammary tumors generated in
MMTV-rtTA/TWNT animals. However, a small proportion of tumor cells remain as a
Minimal Residual Disease (MRD) lesion. These lesions remain dormant for extended
24
duration and retain latent malignancy [173, 174]. Interestingly, metastatic lesions identified
in these animals were also reliant on continued TWNT expression and regressed following
Dox withdrawal. A fraction of the MRD lesions in mice maintained off Dox spontaneously
formed recurrent tumors after several months, paralleling the findings on dormant breast
cancer in women.
The MRD lesions contain cells capable of giving rise to mammary ducts with the
capacity to repopulate a normal mammary gland and respond to the hormonal signals critical
for the regulation of mammary development following implantation into the mammary fat
pad [174]. However, ductal outgrowths from MRD fragments retained latent malignancy and
rapidly redeveloped into mammary adenocarcinoma following reactivation of Wnt signaling.
Ductal outgrowths derived from the Wnt-induced, but non tumorigenic surrounding ducts did
not retain latent malignancy and did not rapidly develop tumors following readministration of
Dox. MRD-derived outgrowths, when induced to form tumors, contained cells of both
luminal and basal appearance suggesting that the cells contained within the lesion have the
capacity to give rise to cells of both epithelial lineages within the mammary ducts.
This murine model of human breast cancer derived MRD offers potential avenues for
the investigation of MRD development and maintenance. However, while the MRD
developed in this model system have been shown to retain both latent malignancy and some
multipotency in relation to mammary epithelial development, these conclusions were reached
on the basis of fragments of tissue and do not offer insight into the capabilities of single cells
within the lesion. Additionally, the study of MRD in the MMTV-rtTA/TWNT system to date
also does not examine the mechanisms of maintenance of tumor dormancy following the
abrogation of Wnt signal. Finally, the MRD studied by Gestl et al, model only those cancers
25
initiated by Wnt1 expression and as human breast cancer is caused by a diverse range of
genetic and epigenetic causes may not accurately model all or even most human MRD
lesions.
1.3.3 Constitutive MMTV-Neu Driven Tumorigenesis in the Mouse Mammary Gland
Overexpression and aberrant activation of HER2 are associated with breast cancer in
humans. In order to model the effects of HER2 activation in mouse mammary cancer, a
transgenic mouse line expressing an activated rat HER2 allele driven by the MMTV
promoter was engineered. These mice rapidly develop mammary tumors, and this process is
accelerated by pregnancy [175, 176]. In contrast, mice carrying a transgene utilizing
MMTV-driven expression of wild-type (unactivated) HER2 develop mammary tumors only
after an extended latent period [75, 175]. Unlike the multiple cell types comprising MMTV-
Wnt1 driven mammary tumors, MMTV-Neu tumors have a homogeneous luminal epithelial
composition [75, 177]. MMTV-Neu tumors did not show expansion of the stem cell
population by immunophenotyping assays, suggesting a different target cell for oncogenic
transformation [27].
1.3.4 Compartment-Restricted Expression of Transgenes
The mammary gland ductal tree is composed of two epithelial layers. These layers
have distinct appearance, function, and characteristics. Both layers of the mammary ducts
contribute to the morphogenesis of the mammary tree. To elucidate the role of each cell
compartment in the development of the mammary gland, transgenes allowing specific
activation limited to the compartment of interest were developed. By using Tet-operator
26
constructs driven with cell-type specific promoters, both compartment-specificity and
temporal regulation of TetO-regulated transgenes can be achieved.
Luminal-specific expression in the mammary gland is driven by MMTV-LTR. The
MMTV-LTR is hormone sensitive, and its expression increases greatly during pregnancy and
lactation but is present during the entire development of the mammary ductal structure [143-
145, 178]. While expression of reporter transgenes driven by MMTV-LTR is uniform in
younger animals, expression in the ducts of older animals is patchy but widespread [179].
Pairing the MMTV-rtTA transactivator with TetO responder transgenes results in the luminal
MEC-restricted expression of the responder gene product in a Dox-dependent manner [172].
Basal-specific expression in the mammary gland can be driven by the Keratin 5
promoter. Keratin-5 expression is common in basal epithelial tissues throughout the body
including those within the skin and digestive tract [180]. While Keratin-14 is also expressed
in the cells of the basal layer of the mammary ducts, extended expression of genes driven by
this promoter results in labeling of both luminal and basal cells [181]. As both K5 and K14
are widely expressed in a variety of tissues, expression of downstream reporters is not limited
to basal MECs but is also seen in the skin and other epithelial tissues [180]. K5-driven
expression within the mammary ductal tree however is limited to the basal layer of the
epithelial bilayer. By pairing the K5 promoter with rtTA, TetO bearing transgene constructs
can be expressed in the basal compartment in a temporally regulated manner.
1.3.5 Inducible Expression of Fluorescently Tagged Histone H2B
The TetO-H2B-eGFP transgene enables Dox-dependent fluorescent labeling of
chromatin and was developed to study stem cell localization and dynamics in the skin [182].
27
The H2B-eGFP transgene was engineered by fusing human histone H2B to the modified
Aequorea Victoria gene for green fluorescent protein (eGFP) [183]. When expressed, the
fluorescently labeled histone is stably incorporated into the chromatin of living cells [183,
184]. Fuchs and colleagues adapted the H2B-eGFP transgene to allow Dox-dependent
regulation of gene expression in the skin by pairing it with a K5-driven Tet-off element
[182]. This modification allowed the temporal and cell-type specific regulation of
fluorescence expression with a K5-driven transactivator. While maintained on Dox, GFP
was expressed throughout the skin, however following removal of Dox, H2B-eGFP
expression ceased. Subsequent proliferation of labeled cells diluted chromatin-bound H2B-
eGFP in cycling cells while relatively quiescent cells retained brighter H2B-eGFP signal
allowing identification of a slow-cycling stem cell population within the skin. Reversible
expression of the H2B-eGFP transgene allows the tracking of fluorescently labeled cells in
both tissue samples and in vitro systems.
1.3.6 Experimental Manipulation of the Mouse Mammary Gland
The large number of inbred mouse strains and genetically altered lines along with the
relative ease of creating novel genetic alterations make mice an attractive model system for a
variety of developmental disease-related questions. The ventral subcutaneous location of
murine mammary gland permits a number of experimental and surgical manipulations. The
technique developed by DeOme and colleagues of clearing a fat pad and subsequent
implanting experimental tissue is of particular importance for the study of the mammary
gland [43, 44]. The relatively quiescent state of the mammary gland from birth until the
onset of puberty provides a window of time in which endogenous epithelium can be excised
from the mouse while preserving a portion of the intact stroma in the form of the mammary
28
fat pad. This surgery can be paired with the implantation of small fragments of mammary
gland or injection of isolated epithelial cells of interest into the empty fat pad. The implanted
tissue or cells then can elaborate an entire ductal tree within the typical extracellular milieu
of the mammary gland. This combination of host stoma and donor epithelium, often using
donors with distinct genetic features, has provided evidence that the mammary gland
contains a population of cells that are capable of giving rise to the entire mammary ductal
tree. This capability of the proposed mammary stem cell population has been shown to
extend over several successive generations of mammary gland implants [27-29, 43, 44].
Additionally, cleared fat pad and implant surgeries have allowed the study of genetically
altered epithelium under conditions that the transgenic donor may not have supported, due to
non-specific activation of transgenes. Finally, interactions between the tissue types,
epithelial and stromal, from distinct genetic backgrounds may be studied to further elucidate
the role of compartmental interactions in the development and function of the mammary
gland. Another technique of particular benefit to mammary cancer researchers is the facility
of explanting samples of mammary tumors onto the flanks of syngeneic or
immunocomprommised host mice. This technique allows the expansion of tumor tissue and
the study of a variety of conditions and treatment on clonally related tumors.
1.4 Areas Addressed in this Dissertation
In this dissertation, new mammary gland biology techniques and reagents are described
including:
Methods for Compartment and Temporal Regulation of Transgene Expression
in the Mouse Mammary Gland
Methods for Inducible Expression of H2B-eGFP in Normal and Neoplastic
Mammary Epithelium
29
We employed these strategies to measure
Proliferation Dependent Washout of H2B-eGFP Signal
Proliferation Dynamics of Constitutive Wnt-initiated Mammary Tumors
Proliferation Dynamics of Reversible Wnt-initiated Mammary Tumors and
Minimal Residual Disease Lesions
Finally, we adapted our labeling strategy to perform
Short-Term Lineage Tracing of MECs During Pregnancy and Involution
30
Figure 1.1 Basic Anatomy of the Mammary Gland.
The panel depicts a carmine-stained mammary gland whole mount from a 4-week old female
imaged by wide field microscopy. The hormones of puberty drive the elongation of the
mammary ducts from the nipple to the distal end of the mammary fat pad. Club-like TEB are
indicated at the distal tips of the developing mammary ductal tree. The clearly visible lymph
node provides a convenient landmark in the orientation of 4th
inguinal mammary gland in the
mouse.
31
Figure 1.2 Secretory Differentiation and Cyclical Remodeling of the Mammary Ductal Tree.
Top panels depict carmine-stained mammary gland whole-mounts collected at the
developmental stage indicated and visualized by widefield microscopy. The lower panels
depict microscopic views of H&E stained from the same mammary glands. The adult virgin
mammary gland contains an arborized epithelial tree penetrating a supporting pad of stroma
and fat. At 15 weeks virgin development, relatively few side branches present and alveolar
outgrowths are absent. The surge in hormones corresponding to the initiation of pregnancy
results in proliferation of MECs driving the formation of lobulo-alveolar outgrowths (d6
pregnancy). Secretory differentiation is indicated by filling of alveoli with lipid droplets (d18
pregnancy). Terminal differentiation with maximal milk production results in markedly
distended alveoli (d9 lactation). Cessation of suckling leads to apoptosis-mediated
elimination of alveolar outgrowths, remodeling of the ductal tree, and the restoration of the
mammary ductal appearance to one resembling that seen in virgin animals. The arrow
indicates that the mammary gland is competent to undergo multiple rounds of proliferation,
differentiation, and involution cycle in response to hormonal stimulation.
32
Figure 1.3 Schematic of Bilayered Mammary Ducts and Keratin Expression Patterns.
Mammary ducts are comprised to bilayered epithelium. The inner, luminal layer, is
composed of cuboidal cells that characteristically express Keratin-8. The outer,
myoepithelial (basal) layer, is made up of epithelial cells that develop contractile capabilities
and express Keratin-5. (Adapted from Grimm et al, Development 2005 and Teuliere et al,
Breast Cancer Research 2006 [185, 186])
33
Figure 1.4 A Proposed Hierarchy of Mammary Epithelial Cells.
A mammary stem cell (MaSC) has been identified and functionally characterized in
implantation studies, spurring investigation into the hierarchical organization and pathways
of lineage commitment for mammary epithelial cells. Briefly, the MaSC is proposed to give
rise to a common bipotential progenitor which in turn differentiates into luminal and
myoepithelial committed progenitors. The myoepithelial progenitor, gives rise to
differentiated myoepithelial cells in the mammary ducts, but remains unidentified. The
luminal progenitor population differentiates to produce the cells of the luminal layer in
mammary ducts. The luminal progenitor is also proposed to give rise to the alveolar
progenitor which in turn produces the cells of the alveoli during pregnancy. The alveolar
progenitor is proposed to contribute to the luminal and basal layers of the alveolar
outgrowths, potentially via the putative myoepithelial progenitor. Reported
immunophenotypes for each cell population are included to illustrate the pathways of lineage
commitment followed by each population. (Adapted from Visvader, Genes and
Development, 2009 [187].)
34
Chapter 2 Materials and Methods
2.1 Mouse Strains, Surgeries and Drug Treatments
2.1.1 Housing and Maintenance
All mice utilized in this study were bred and housed in a barrier facility. Animals
were fed a standard diet of Harlan Tekland chow pellets (HT2018) and had unlimited access
to drinking water. Mouse strains received in the FVB background were maintained in this
background by crosses to other FVB animals. In order to test transgene inducibility in
MMTV-rtTA/TGFP mice, TGFP males of a mixed-strain background were crossed to FVB
females carrying the MMTV-rtTA transgene. Before generating MMTV-
rtTA/TGFP/MMTV-wnt1 tri-transgenic animals to examine the compartment specific
labeling of mammary tumors, the TGFP transgene was backcrossed for 8 generations onto an
FVB background. Wild-type nontransgenic animals used for implant and explant studies
were also FVB. Some FVB animals utilized in this work were obtained from Jackson labs
while others were bred within the Gunther Lab barrier colony. Experimental animals were
sacrificed by CO2 inhalation to allow for the collection of mammary tissue. Lungs and liver
were examined in tumor-prone and tumor-bearing animals for the presence of metastases at
necropsy.
Transgenic lines used in this study were obtained as follows:
MMTV-rtTA: gift from Lewis Chodosh, University of Pennsylvania
K5-rtTA: gift from Adam Glick, the Pennsylvania State University
TGFP: Jackson Labs; STOCK Tg(tetO-HIST1H2BJ/GFP)47Efu/J
TWNT: gift from Lewis Chodosh, University of Pennsylvania
MMTV-wnt1: Jackson Labs; FVB.Cg-Tg(Wnt1)1Hev/J
35
MMTV-neu: Jackson Labs; FVB/N-Tg(MMTVneu)202Mul/J
2.1.2 Genotyping and Breeding Schemes
All transgenic animals were genotyped by PCR analysis of tail-clip DNA using
primer pairs specific for each transgene as listed in Table 2.1. Genomic DNA was prepared
from fresh or fresh-frozen tail biopsies by the Maxwell 16 instrument (Promega) or by
standard methods. Briefly, the non-mechanized method consisted of overnight digestion of
tail biopsy samples in Proteinase K followed by homogenization, extraction, and
precipitation steps. DNA pellets obtained by this method were resuspended in water. DNA
prepared by the Maxwell machine was resuspended in a proprietary buffer.
The MMTV-rtTA and TWNT transgenes were maintained as hemizygous due to
impaired fertility of homozygous animals (data not shown). Parent of origin was tracked but
did not appear to impact transgene expression or transmission to offspring. Most crosses
involving the MMTV-wnt1 transgene employed transgenic males since transgenic females
show a notable deficiency in lactation that precludes the efficient recovery of pups from these
dams. Fostering of pups from MMTV-Wnt1 dams onto wild-type lactating females shortly
following parturition was occasionally used as needed to obtain transgenic animals. MMTV-
neu transgenic animals were maintained as homozygotes in order to facilitate breeding and
genotyping and were crossed with MMTV-rtTA and TGFP bearing mice as needed.
2.1.3 Experimental Manipulations of Mice
Animals were placed on Dox chow to induce transgene expression. Dox diet was
prepared by Bio-Serv (Frenchtown, NJ) at 2.0 g Doxycycline/kg and fed ad libitum. Animals
36
removed from Dox diet were isolated from Dox-naïve animals for a minimum of one week to
avoid transfer of Dox from skin or feces.
2.1.3.1 Surgical
Animals were anesthetized with inhaled isofluorane for all surgical procedures.
Surgical sites were shaved using grooming clippers in preparation of incision and all skin
incisions were closed with stainless steel wound clips. Mammary gland biopsies were
typically performed to collect the 4th
inguinal mammary gland from either the left or right
side. A skin incision was made to expose the mammary fat pad which was then separated
from the skin and peritoneal surface using both blunt and sharp dissection. Electrocautery
was used for hemostasis. Cleared fat pad surgeries were performed by excision of the
proximal, nipple-near end of the #4 mammary fat pad up to and including the lymph node of
mice prior to the onset of puberty (<4 weeks of age) removing the nascent mammary ductal
tree [45]. Fragments of mammary tissue approximately 1mm2 were inserted into the
remaining distal segment of the fat pad. Fragments were derived from freshly biopsied MRD
lesions. Following surgery, implants were allowed to mature for 10-12 weeks prior to assay.
Tumor size was monitored twice weekly with calipers. Tumor biopsies were
performed when tumors grew to approximately 1 cm in diameter. The skin was dissected
away from the tumor and approximately half the tumor volume was excised and collected.
Following biopsy, tumor-bearing mice were maintained on Dox as specified to verify
ongoing tumor growth and subsequently removed from Dox diet as indicated in each
experiment.
Tumor explants were propagated by explanting small fragments of mammary tumor
collected at biopsy or necropsy. Fresh tumor fragments approximately 3 mm in diameter
37
were implanted subcutaneously on the dorsal flank of wild-type host animals. Tumor
explants dependent on Dox were explanted onto the flanks of Dox-induced host females.
Tumor-bearing hosts were subjected to Dox pulse and Dox withdrawal as indicated.
Hormone pellets were implanted subcutaneously onto the dorsal flank of adult virgin
females. 21-day release Estrogen pellets (E 0.025 mg/pellet) and Progesterone pellets (P
25.0 mg/pellet) were purchased from Innovative Research of America (Sarasota, Florida).
2.1.3.2 Chemotherapeutics
MMTV-rtTA/TWNT/TGFP tritransgenic mice were occasionally treated with MNU
(methylnitrosourea) at 6 weeks of age in order to accelerate tumorigenesis in the mammary
gland. Animals were anesthetized with inhaled isofluorane prior to administration of MNU
at a dose of 50 mg/kg body weight. Mice expressing Wnt1 transgenes typically develop
multiple synchronous tumors in the mammary glands following MNU treatment. Tumor
explants bearing animals were treated with a single 300 mg/kg dose of Adriamycin,
administered i.p..
2.1.3.3 Pregnancy
To generate timed pregnancies, adult females were bred and monitored daily for the
presence of vaginal plugs. The plug day was reported as d 0.5 of pregnancy. Embryos were
collected at necropsy and used to verify gestational age. In our early studies of pulse-chase
kinetics during pregnancy, mammary gland biopsies were performed on d 0.5 pregnant
animals to document H2B-eGFP labeling during pulse. However, plug-confirmed pregnant
mice subjected to an early biopsy frequently lacked intrauterine embryos at necropsy,
presumable because of fetal loss. Since surgical intervention early in pregnancy appeared to
38
negatively impact gestation, our protocol was modified to eliminate mammary gland biopsies
on pregnant animals. Instead, pulse labeling was confirmed by analyzing mammary glands
from additional control mice that were sacrificed and necropsied and the conclusion of Dox
pulse.
2.2 Mammary Gland and MEC Sample Processing
Mammary gland whole mounts were routinely prepared on glass slides following
excision. Following a brief period to allow air-drying of the sample and securely affix the
tissue to the slide, samples were immersed in 4% PFA for 2 hours on wet ice. Whole mounts
were subsequently transferred to low PFA (0.4%) for extended storage at 4 C. Tissue
fragments from mammary tumors and normal mammary glands were snap frozen on dry ice
and then transferred to microcentrifuge tubes for long term storage at -80 C. Additional
tumor pieces were fixed in 4% PFA on ice and subsequently stored in low PFA at 4 C.
To obtain mammary gland frozen sections, mammary gland whole mounts were
removed from slides following fixation and storage, then snap frozen on dry ice and
sectioned by microtome. Mammary tumor sections were cut from tumor fragments snap
frozen on dry ice and stored at -80 C. Thick sections (~35 um) were obtained and stored at -
20 C prior to staining in order to limit desiccation of the samples.
2.2.1 Single Cell Suspensions
To prepare single cell suspensions from mammary tumors and MRD lesions, both
mechanical and enzymatic dissociation were employed as previously described [27].
Approximately 5 mm2 fragments of mammary tumor were finely minced by hand or by
McIlwain tissue chopper. This slurry was transferred to a conical tube and incubated with
39
300 U/mL collagenase (Sigma) and 100 U/mL hyaluronidase (Sigma) in DMEM/F12
(Gibco) for 1 hour at 37C in an orbital shaker at 100 rpm. Samples were pelleted for 8
minutes and the supernatant discarded. The resulting pellet was resuspended in prewarmed
(37 C) 0.25% Trypsin-EDTA (Gibco) and agitated vigorously by shaking for 4 minutes and
pelleted again. The supernatant was aspirated and the pellet resuspended in prewarmed 1X
PBS + 40 uL of Deoxyribonuclease I (DNase, 2.3 U/ L, Worthington) and Dispase II
(Neutral Protease, 5 mg/mL, Roche) for 3-5 minutes. Samples were again pelleted and were
resuspended in 0.64% Ammonium Chloride in order to lyse red blood cells. Samples were
pelleted a final time and resuspended in cold 1X PBS, filtered through a single cell filter (40
um, Falcon) and placed on ice prior to further analysis.
To prepare single cell suspensions of MECs from normal mammary gland, up to 8
mammary glands were collected from a single animal (1, 3, 4, and 5 mammary glands from
both sides) and mechanically dissociated by McIlwain tissue chopper. Samples were
digested as in tumors with the following modifications. During enzymatic digestion,
Collagenase/Hyaluronidase (Stem Cell Technologies, Vancouver, British Colombia, Canada)
in DMEM/F12 digestion was extended to 6 hours and was incubated in a 37 C water bath
with agitation by moderate shaking by hand every 1-2 hours. Samples were pelleted after all
digestion steps at 550 g at 4 C for 8 minutes. Samples were passed through the single cell
filter immediately following suspension in DNAse/Dispase mixture. The final product of the
digestion steps was further purified by an immunomagnetic method. EasySep® Mouse
Mammary Stem Cell Enrichment Kits (Stem Cell Technologies) were used to remove non-
epithelial cells from the single cell suspensions. Briefly, approximately 106 resuspended
cells were incubated with the EasySep Negative Selection Epithelial Cell Enrichment
40
Cocktail (25 uL), then the EasySep Biotin Selection Cocktail (50 uL) was added to the
suspension, and finally Easysep Magnetic Nanoparticles (25 ul) were incubated with the cell
suspension. This treatment labels non-epithelial cells with antibodies capable of adhering to
a magnetic column, allowing removal of these tagged cells and enrichment for MECs.
2.2.2.1 Immunophenotyping and Fluorescent Signal Analysis of MECs and Tumor Cells
Cell suspensions were divided into 5 mL Falcon tubes at 0.5-5 million cells per tube.
Unstained and single-antibody stained control cells were included in all flow cytometry runs.
Rat α-Human CD49f antibody (BD Pharmingen) and Alexafluor 647 goat α-rat (Invitrogen)
were added to each tube at 1 uL/sample and incubated on ice for a minimum of 20 minutes
and up to 1 hour. Samples were then centrifuged for 5 minutes at 550 g at 4 C and
resuspended in 1X PBS containing PE rat α-mouse CD24 (BD Pharmingen); 1 uL/sample for
tumor cells and 0.5 uL/sample for normal MECs and incubated at 4 C for a minimum of 1
hour and as long as overnight prior to FACS analysis. Single cell suspensions were
maintained on ice until assay. FSC (Forward Scatter) and SSC (Side Scatter) gates were set
to identify single cells prior to analysis of GFP fluorescence in order to collect 20,000 events.
Single cells not labeled with immunophenotyping antibodies were analyzed on FACS
Calibur in the FL-1 channel alone. FACS Calibur (BD Bioscience, USA) was used to assess
fluorescence in the FL-2 (PE), FL-4 (Alexafluor 647), and FL-1 (eGFP) channels and data
was analyzed using the Cell Quest Pro software (BD Bioscience).
2.2.3 Imaging of Whole Mounts and Sections
Whole mounted samples containing MRD lesions were photographed under both
white-light illumination and hand held long wave UV illumination prior to fixation or
41
preparation of single cell suspensions. Alternatively, excitation of eGFP was achieved using
a blue LED flashlight and fluorescence visualized using a 508 nm viewing filter when
imaging fluorescent tumor samples as previously described [188]. A Nikon digital camera
was used to collect these images and the intraoperative images of fluorescing mammary
tumors.
Mammary gland ductal GFP fluorescence was detected in fixed whole mounts from
MRD bearing mammary glands and normal mammary tissues by wide-field microscopy
using a Zeiss Axiovision Observer microscope equipped with 5X, 10X, and 20X objective
lenses and an AxioCam MRm camera. Matched exposures were obtained for Dox-naïve,
pulse, and pulse-chase trios. In addition, overexposed images were routinely captured from
Dox-naïve and pulse-chase sample in order to demonstrate the range of GFP signal
detectable in mammary epithelial cells.
2.2.3.1 Staining
Nuclei within thick frozen sections of mammary gland and mammary tumors were
counterstained with Hoechst. Briefly, sections were thawed and dried on the bench top for
10 minutes prior to fixation in -20 C methanol for 10 minutes. Slides were then rinsed 3
times in 1X PBS for 2 minutes. Samples were then incubated with 1X PBS +0.1% Triton X-
100 (Shelton Scientific) for 10-30 minutes to permeabilize the tissue. Samples were then
incubated in Hoechst dye (Hoechst 33342 trihydrochloride trihydrate, Invitrogen, 8 ug/mL)
was incubated on samples at room temperature in darkness for 30 minutes. Slides were
finally washed 2X in 1XPBS +0.1% Triton-X and then 1X PBS 3X with agitation. Slides
were removed from wash, briefly shaken dry and mounted and coverslipped.
42
AquaPolyMount (Polysciences). Following overnight drying time at 4 C, coverslips were
sealed to prevent slippage and dehydration.
Frozen sections, counterstained with Hoechst were imaged by Confocal microscopy.
A Leica TCS SP2 AOBS inverted stage Confocal microscope was used to capture Z-stacks
with the 20X objective in the green and blue channels using appropriate excitation
wavelengths and a 0.6 um step size. These z-stacks were processed using the associated
Leica software in order to produce projection views that compiled the stacked images into a
single image. Z-stack heights were selected to encompass the entire ductal fragment or
tumor tissue within the mounted section.
2.3 Time-lapse Imaging of H2B-eGFP Labeled Cells
Time-lapse images were obtained on the Zeiss Axiovision Observer microscope
equipped with a motorized stage and enclosed in an environmentally-controlled imaging
compartment. For time-lapse imaging, the compartment was maintained at 37C and
incubated at 5% CO2. The motorized stage and specialized software allowed the marking of
coordinates within the culture dish and repeated automated image acquisition at these
locations. Images were obtained at 15 or 20 minute intervals (depending on the experiment)
over a period of up to several days. These images were then compiled into time-lapse movie
files documenting the cellular behaviors within each imaged field using the Zeiss Axiovision
software.
Samples monitored in this manner were plated in 3D culture using Matrigel. Cells
and cell clusters were suspended in growth factor reduced Matrigel (BD Biosciences) and
overlaid with DMEM/F12 media supplemented with 10 ug/mL insulin, 5.5 ug/mL transferrin
and 2 ng/mL sodium selenite, (all from Sigma) and antibiotic/antimycotic. Matrigel plating
43
was typically performed the day prior to initiation of imaging in order to allow proper
solidification of the extracellular matrix and minimize drifting of imaged cells. Refocusing
of the desired fields was necessary periodically throughout imaging (approximately once per
24 hours) and was completed concurrent with data download periods and media changes.
Dox was added to the media as needed for each experiment at 1000 ng/mL (in distilled water,
Sigma).
44
Table 2.1 Primer Pairs Utilized in Genotyping Transgenic Mice
Transgenic Line Primer 1 Primer 2
MMTV-rtTA and K5-
rtTA
ACCGTACTCGTCAATTCCAAGGG TGCCGCCATTATTACGACAAGC
CGCCCAGAAGCTTGGTGTAG CGAATAAGAAGGCTGGCTCTGC
TWNT TGCGGTTCCTGATGTATTTTGC TGCATTCCTTTGGCGAGAGG
CACGAAATTGCTTCTGGTGGC TCGAAGATGTTGGGGTGTTGG
MMTV-wnt1 ATCCGCACCCTTGATGACTCCG GGCTATCAACCAACACACTGCCAC
GGACTTGCTTCTCTTCTCATAGCC CCACACAGGCATAGAGTGTCTGC
TGFP AAGTTCATCTGCACCACCG TCCTTGAAGAAGATGGTGCG
CCTTGATGCCGTTCTTCTGCTTGT
C
3 TGFP primers will make 2 bands
45
Chapter 3
3.1 Developing a transgenic mouse model enabling inducible H2B-eGFP labeling of MECs
The pathways of lineage commitment and proliferation dynamics that lead to the
development of the complex structure of the mammary gland are poorly understood. Fuchs
and colleagues pioneered an experimental approach to tracking cell fates in the skin via
inducer-dependent expression of an H2B-eGFP transgene [182]. Here, we tested whether
this strategy could be adapted to permit monitoring of mammary epithelial cell lineages. We
paired the H2B-eGFP transgene with doxycycline-inducible transactivators specific to the
luminal or basal layers within the mammary ductal tree [172, 180]. By verifying restriction
of transgene expression patterns to the expected cell compartments we establish a model to
allow the tracking of cell lineage in later experiments. Additionally, in this first section, we
substantiate that the dilution of GFP signal largely results from cellular division by
contrasting the washout observed in high proliferative regions of the gland to that observed in
low-proliferative regions using fluorescent microscopic examination of tissue sections. Cell
division-dependent washout was further confirmed by eliminating hormone-induced cellular
proliferation in the mammary epithelium and documenting reduced GFP signal dilution by
fluorescence microscopy and flow cytometry. By rigorously defining the patterns of H2B-
eGFP labeling and label retention in these models, we establish a framework for our later
experiments examining proliferation dynamics in mammary tumors and during lobulo-
alveolar development and post-lactational involution.
3.2 Doxycycline-dependent labeling of MG
Our strategy for labeling of MECs is depicted schematically in Figure 3.1. Mice
carrying either the luminal or basal transactivators were engineered to permit the temporal
46
regulation of mammary cell layer-specific expression of the H2B-eGFP fusion protein. As
depicted in Figure 3.1A, in the absence of Dox, H2B-eGFP should not be expressed, but the
addition of Dox to the animals’ diet should result in the TGFP transgene expression and GFP
labeling within the mammary epithelial cell layers. Removal of Dox inducer should abrogate
TGFP transgene expression whereas GFP signal from chromatin bound H2B-eGFP protein
should persist. Transactivators determine cell layer-specific activation of transgene
expression with Keratin-5-driven expression localized to the outer myoepithelial layer and
MMTV driven expression localized within the inner luminal cell layer (Figure 3.1B).
To test whether expression of the H2B-eGFP fusion protein was tightly regulated and
would permit Dox-dependent expression of the H2B-eGFP reporter, bitransgenic MMTV-
rtTA/TGFP mice and monotransgenic controls were generated. Mammary glands harvested
from adult females that were either left untreated or treated with 7 days of Dox were
examined by fluorescent microscopy (Figure 3.2, rows 1-4). Fluorescent labeling of nuclei
was undetectable in whole-mounted mammary glands from Dox-naïve mice and from Dox-
treated genetic control mice lacking either the transactivator or responder transgenes, as
expected. In contrast, bitransgenic mice exposed to a doxycycline (Dox) pulse showed
uniform labeling of mammary ducts from proximal to distal ends visualized as bright,
nuclear-localized green fluorescence in mammary gland whole-mounts.
In order to verify that activation of the H2B-eGFP transgene is reversible in the
mammary epithelium, adult virgin females were pulse labeled with Dox for 7 days and
subsequently subjected to Dox withdrawal for a washout period of 5 weeks (Figure 3.2, final
row). As depicted in Figure 3.1, cessation of Dox induction ought to result in the abrogation
of H2B-eGFP transgene expression but should not impact existing H2B-eGFP fusion protein
47
already incorporated into the chromatin. The chromatin bound GFP signal intensity should
be diluted during cellular proliferation. In the setting of pulse-chase, analysis of mammary
gland whole mounts by wide-field fluorescence microscopy showed a marked decrease in
GFP fluorescence in comparison to that seen in pulse labeled mammary glands (Figure 3.2).
3.3 Compartment-Specific Labeling in the Mammary Epithelium
Next, we sought to confirm compartment-specific labeling within the mammary
epithelial cell populations at the cellular level. Toward this end, we extended our analysis of
transgenic mammary glands using two methods that offer single-cell resolution. First,
Hoechst-counterstained frozen sections of mammary gland whole mounts were imaged by
Confocal microscopy. Second, single-cell suspensions were prepared from mammary glands
and analyzed by flow cytometry. As described below, these experiments confirmed
compartment-specific and temporal regulation of H2B-eGFP expression in the mammary
gland.
3.3.1 MMTV-rtTA Drives Luminal Compartment Restricted Reporter Gene Expression
To examine the cell-layer specificity of Dox-induced H2B-eGFP labeling in MMTV-
rtTA/TGFP mice, mammary glands from Dox-naïve, pulse labeled and pulse-chased mice
were sectioned, counterstained with Hoechst and imaged by Confocal microscopy. In line
with observations from examination of whole mounts by fluorescence wide-field
microscopy, conical imaging confirmed that a large number of ductal cells labeled with GFP
fluorescence (Figure 3.3). Imaging of counterstained sections additionally demonstrated that
the GFP positive cells were localized to the inner lining of ductal structures, the anatomic
position of luminal epithelium. Hoechst-counterstained, GFP-negative nuclei exhibiting the
48
typical elongated shape of myoepithelial cells were seen surrounding the uniform, round
nuclei typical of luminal epithelial cells. Likewise, the cells comprising the fat and stroma
were also devoid of GFP signal. Low-level expression of MMTV-LTR-driven transgenes in
lymphoid tissue has been described previously and rare extra-ductal GFP-positive bodies
were occasionally visualized within the lymph nodes which are readily identifiable in
sections by their distinct Hoechst-stained, tightly-packed nuclei [172].
In order to quantify GFP fluorescence on a single cell level and to further characterize the
mammary cell subtypes labeled by the MMTV-rtTA promoter, the cell surface marker profile
of MECs isolated from pulse labeled mammary glands were determined by flow cytometry.
A proportion of the single cells isolated from the mammary gland were GFP positive as
identified by flow cytometry (Figure 3.4A). GFP-positive cells from these mice were
CD24+/CD49
lo, corresponding to the luminal compartment as previously defined (Figure
3.4B). GFP-negative cells were found in the basal MEC population and non-epithelial
populations as expected.
3.3.2 Keratin-5 rtTA Drives Basal Compartment-Restricted Reporter Gene Expression
In order to verify the compartment and temporal restriction of H2B-eGFP expression
driven by the Keratin-5 transactivator whole mounts from adult K5/TGFP bitransgenic mice
were examined by wide-field and Confocal microscopy. Wide-field fluorescence
microscopy demonstrated widespread labeling of the mammary ductal structures following
transgene expression induction by Dox. GFP-positive nuclei exhibited an elongated
appearance and were located on the exterior of the mammary ducts as expected of basal
MEC-restricted expression of the GFP labeled histone (Figure 3.5). Sections obtained from
whole-mounted mammary glands counterstained with Hoechst reaffirmed the basal location
49
and appearance of eGFP positive nuclei while the GFP negative cells within the ducts were
localized to the interior of the ducts and exhibit the rounded shape typical of luminal
epithelial cells (Figure 3.6). Cells with GFP-positive nuclei were not identified in the
luminal layers of mammary ducts nor within the mammary gland stroma that surrounds and
supports the ductal tree. Rare non-ductal, GFP-positive cells were occasionally visualized in
mammary glands and frozen sections contaminated with muscle or skin fragments, however
these fluorescent cells were easily distinguished from mammary epithelial cells based on
their histology and location.
Analysis of single cells isolated from pulse labeled mammary glands stained with
cell-surface markers by flow cytometry supported compartment-confined labeling induced by
K5-rtTA. A large percentage of epithelial cells isolated were GFP-positive following pulse
labeling. GFP-positive cells isolated from pulse labeled K5/TGFP bitransgenic mice were
largely restricted to the CD24lo
/CD49+ region previously described as harboring basal
mammary epithelial cells (Figure 3.7).
3.4 Proliferation dependent washout of H2B-eGFP labeling
To define the role of cellular proliferation in the dilution of H2B-eGFP signal
incorporated into the chromatin we utilized the differential growth rates that occur within
different developmental stages of mammary gland development. Mammary gland ductal
elongation begins following the onset of puberty when hormonal signals induce rapid
proliferation in club-like structures, terminal end buds, located at the distal end of the ducts.
The proliferation and migration of these distal tips results in elongation of the duct and
progression of the ductal tree through the mammary fat pad. By performing pulse-chase
50
labeling experiments during puberty, we capitalize on the natural differential in proliferation
rates to examine the role of cell division in the washout of H2B-eGFP fluorescence.
Following puberty, proliferation rates generally decrease in the virgin animal. However,
some cell turnover occurs with each estrus cycle, when ovarian hormones induce short term
proliferation. Ablation of ovarian hormones via ovariectomy largely eliminates proliferation
within the adult mammary gland and we utilize this strategy as another avenue to investigate
the role of proliferation in washout of H2B-eGFP labeling. We examine pulse-chase labeling
and assess the proliferation dependent dilution of fluorescent signal in these distinct
developmental stages by Confocal microscopy and by flow cytometric analysis of GFP
intensity in single cell preparations.
3.4.1 Puberty Induced Proliferation Results in Dilution of Incorporated GFP Signal
Differentially in Developmentally Distinct Ductal Areas
In order to measure the role of proliferation in the dilution of fluorescent signal mice
were subjected to Dox pulse from 5 to 6 weeks of age, then underwent mammary gland
biopsy at the conclusion of the pulse. Post-biopsy mice were subjected to Dox withdrawal for
1 week and then necropsied for collection of remaining mammary tissue. The timing of this
experiment allowed the identification of TEB at both biopsy and necropsy and confirmed the
animal to be in mid puberty by localization of the TEB. As proliferation rates are greatest
during puberty, and particularly in the TEB, clear localization of the structures is critical to
the examination of the role of proliferation in the dilution of GFP fluorescence. In Figure
3.8, representative Confocal microscope images depicting the widespread GFP labeling of
nuclei in a pulse labeled MMTV-rtTA/TGFP bitransgenic pubertal mouse. The proximal
ducts have relatively low proliferation rates and in bitransgenic mice submitted to pulse
51
labeling followed by chase, maintain a high concentration of bright GFP labeled cells.
Following off Dox chase, proximal ducts demonstrate only modest washout. In contrast, the
highly proliferative TEB have almost entirely washed out the H2B-eGFP signal as was
expected due to rapid cell cycling. Though proliferation rates vary between the regions of
the pubertal mammary gland, both regions in the chased mammary gland show lower levels
of GFP fluorescence than either region in a pulse-labeled mammary gland as proliferation
does occur in both areas.
3.4.2 Ovariectomy Blocks Proliferation Dependent Washout of H2B-eGFP Label in
Mammary Epithelial Cells
To further demonstrate that the dilution of GFP signal is largely dependent on cell
proliferation, we examined washout kinetics in adult mice subjected to ovariectomy. Ovarian
hormones play a critical role in the induction of cell cycling in the mammary gland and in the
absence of ovarian hormones, cellular proliferation is greatly reduced [189].
In order to assess the role of hormone-mediated cell cycling on GFP washout, 5
week-old bitransgenic MMTV-rtTA/TGFP mice were placed on Dox for 5 weeks and then
underwent excisional mammary gland biopsy. Dox-withdrawal was initiated post-
operatively and mice were sacrificed 4 weeks later. Experimental mice additionally
underwent ovariectomy at the time of mammary gland biopsy prior to initiating Dox
withdrawal. Figure 3.9 shows representative Hoechst counterstained frozen sections imaged
by Confocal microscopy. Ducts in pulse labeled biopsy samples show widespread GFP
fluorescence throughout the inner lining of the structures. Following chase, the mammary
ducts of ovary-intact animals showed markedly decreased GFP fluorescence by Confocal
microscopy. In contrast, mammary ducts from mice ovariectomized prior to Dox withdrawal
52
retained H2B-eGFP label at a much higher level than in ovary-intact mice. This higher level
of label retention in hormone ablated animals supports the conclusion that cellular
proliferation is the cause of GFP signal washout in the mammary gland.
To quantify H2B-eGFP washout at the cellular level, flow cytometry was used to
assess GFP signal intensity in MECs isolated from MMTV-rtTA/TGFP mice under pulse and
pulse-chase conditions in the presence and absence of ovarian hormones. A large proportion
of the MECs isolated from pulse-labeled bitransgenic mice fluoresced brightly in the GFP
channel (Figure 3.10). Dilution of GFP signal by cell division ought to roughly halve the
GFP signal with each round. In the single parameter plots depicting GFP intensity in these
animals, multiple peaks of GFP intensity appeared representing successive halving of GFP
signal. Compared with ovary-intact mice, ovariectomized animals retained larger numbers of
GFP+ and GFP
bright cells following chase. Indeed, single-parameter plots from
ovariectomized animals indicated that very few cell divisions occurred as evidenced by very
modest dilution of the GFP signal. We conclude that hormone-mediated proliferation is
required for the dilution of H2B-eGFP within the mammary epithelium.
3.5 Simultaneous Induction of H2B-eGFP and Tet-responsive Wnt Oncogene Results in
Labeling of Mammary Hyperplasia
By pairing the luminal and basal transactivators with both the H2B-eGFP fusion
transgene and a Tet-responsive oncogene expressing transgene we achieved induction of
compartment specific labeling in induced mammary hyperplasia (Figure 3.11). Induction of
tri-transgenic (MMTV-rtTA/TGFP/TWNT or K5-rtTA/TGFP/TWNT) mice bearing both
responder transgenes resulted in hyperplasia appearing similar to that induced in bitransgenic
MMTV-rtTA/TWNT or K5-rtTA/TWNT mice although epithelial cells within the gland were
53
additionally labeled with bright green fluorescence (Figures 3.12 and 3.13). The
combination of transgenes does not impair the incorporation of GFP labeled histone into the
chromatin of cells induced to divide by wnt oncogene stimulation nor does the GFP label
appear to impair oncogenic stimulus of growth within the mammary epithelium. The ability
to induce compartment specific labeling within oncogene induced hyperplasia and
particularly within Wnt-induced mammary tumors will be followed more in detail in
Chapters 4 and 5 of this thesis.
3.6 H2B-eGFP Transgene Labeling Allows Live Imaging of Mammary Cells
Histone labeling with GFP can be visualized in live cells without fixation allowing an
opportunity to image cells in real time and monitor cellular kinetics. We imaged GFP
labeled tissue fragments and cell clusters via time-lapsed fluorescent Confocal and traditional
microscopy. Pulse-labeled tissue fragments dissected from MMTV-rtTA/TGFP/TRAS
mammary glands. These fragments were placed in coverslip bottomed culture dishes with
Dox-supplemented media and anchored with glass coverslips. This system allowed the time-
lapse Confocal imaging of intact ductal fragments contained in the normal surrounding
stroma. Ductal fragments imaged in this way allowed monitoring of cellular movements
within the ductal fragments and of apoptosis of MECs within the ducts (Figure 3.14). We
have also suspended single cells and small clusters of MECs in Matrigel. Matrigel mimics
basement membrane allowing the maintenance of 3D orientation and development of
polarized epithelium similar to that seen in intact stroma. Time-lapse imaging of cells
suspended in Matrigel visualized cell movements, cell divisions, and apoptosis (Figure 3.15).
The capacity to monitor cellular proliferation and movement patterns within the mammary
gland or in fragments of mammary epithelium provides an interesting method of
54
characterizing the behavior of labeled cells within the mammary cell compartments and of
tracking the behavior and lineage of a cell and its progeny over time.
3.7 Discussion
The data provided in this chapter support the use of H2B-eGFP for the analysis of cell
cycling dynamics within discrete populations of cells. It adapts methods used for tracking
cell lineages in other tissues to explore the developmental biology of the mammary epithelial
tree. Analysis of GFP signal dilution within the mammary gland additionally supports a
model of division driven GFP signal washout and provides a basis for the prospective
isolation of viable mammary epithelial cells based on their proliferation histories.
When compared to similar strategies used to examine the lineage and proliferative
histories within the mammary gland, the transgenic model employed here has the clear
benefit of being specific to the mammary gland and further with GFP expression being
specifically regulated in the two cell layers that make up the mammary ducts. We are able
to identify the population of cells initially labeled, and are able to compare proliferation
dynamics between the two mammary epithelial cell compartments.
The ability to specifically analyze the contributions of the epithelial cell types to the
normal development and oncogene induced neoplasia of the mammary gland provides an
opportunity to characterize the lineage of cells of the mammary gland. By pulse-chase
analysis of MECs from each compartment within a defined developmental state of
mammopoiesis or tumorigenesis, the contributions of luminal and myoepithelial cells to the
developed tissue can be teased apart. As both mature ducts and many types of mammary
tumors contain both cell types and the exact pathways contributing to these multi-cell type
55
tumors are not yet understood GFP based lineage tracing may elucidate the paths to lineage
commitment.
Additionally, the use of compartment specific labeling with H2B-eGFP would allow
the prospective isolation of viable MECs with a certain labeling or label retention profile and
the further study of the capacity of those cells in culture or following implantation into
cleared mammary fat pads. A comparable model has been used to identify both the stem cell
population and the niche of those cells within the skin [182]. It is possible that long term
label retaining cells in the mammary gland have stem cell like roles and identification of
these label retaining cells by GFP fluorescence might allow verification of stem cell
capabilities via implantation and tracking of lineage of their progeny. It has been proposed
that H2B-eGFP labeling is superior to traditional BrdU labeling for the identification of
proliferation history of cells as GFP signal is detectable through more divisions than that of
BrdU labeled cells. While immunophenotypes for stem cells within the mammary gland
have been described, they lack the capacity to produce a pure population of stem cells and
instead only enrich a population of mammary epithelial cells [27-29]. Combination of the
previously defined immunophenotypes with GFP label retention properties could allow more
selective isolation of the mammary stem cell population and provide a selection criterion
based on a putative functional biological property of adult stem cells, slow cell cycling.
H2B-eGFP labeling could also be used to purify a stem cell population that is more rapidly
cycling than their surrounding cells by selection of GFP-negative cells that have diluted
H2B-eGFP signal.
GFP signal could be diluted by either cell division or by histone turnover within
labeled cells. GFP label retention over extended periods of time in retinal post-mitotic cells
56
supports a model where label dilution driven almost entirely by proliferation, as non-
proliferative cells retain GFP fluorescence [190]. Photoreceptor cells in the eyes of mice
labeled with ROSA-driven GFP during embryogenesis retained label following six months of
washout supporting a model of H2B-eGFP label stability with low histone turnover.
Additional support for a division driven model of GFP label dilution is provided by the flow
cytometric analysis of cells from a variety of tissues. GFP single parameter plots of labeled
and label retaining cells from the skin show peaks of GFP corresponding to cell divisions
roughly halving the GFP signal intensity with each peak [191].
In these experiments we have labeled the mammary gland during periods of extensive
growth and proliferation and during phases of limited cell turnover providing the possibility
that GFP label incorporation may not require cellular proliferation. H2B-eGFP labeling in
the skin and in the hematopoietic system also suggests that proliferation is not required for
label incorporation by the widespread incorporation of label throughout the tissue even
following short pulse labeling periods in infrequently dividing cell populations. Though
widespread labeling within the infrequently cycling adult mammary gland suggests that
division is not required to incorporate H2B-eGFP into the chromatin further experiments
could be performed to verify this conclusion. Specifically, adult bitransgenic mice could be
ovariectomized to eliminate cell division within the mammary gland and subsequently pulse
labeled with Dox. If proliferation is required for the incorporation of GFP labeled histone,
these mice will not have detectable GFP signal within the mammary ducts.
While compartment specific labeling in the mammary gland does not appear to cross
label compartments it also does not label all of the cells within a particular cell layer. In the
luminal epithelium both hormone receptor positive and hormone receptor negative cells
57
make up the inner cell layer and it is possible that MMTV driven expression reproduces this
hormone receptor status with GFP+ cells appearing in either the HR
- or HR
+ cell populations.
Similarly, the basal cell layer as defined by published immunophenotypes contains both the
myoepithelial cell population and proposed stem cell population. Identification of the precise
cell types labeled with MMTV or K5 driven expression of H2B-eGFP would provide insight
into the expression of mouse mammary tumor virus and the distinct proliferation patterns of
the subtypes of mammary epithelial cells.
58
A. B.
Figure 3.1 Strategy for Temporal Regulation of H2B-eGFP Transgene Expression in
Epithelial Cellular Compartments of the Mammary Gland.
A. Schematic of Transgenes Employed for Compartment-Restricted Expression. Transgenic
mice carrying the MMTV-rtTA-pA transgene express the rtTA transcription factor in the
luminal mammary epithelium but do not express independently integrated responder
transgenes driven by minimal CMV promoters containing multimerized operator sequences.
Similarly, transgenic mice carrying the K5-rtTA-pA transgene express the rtTA transcription
factor in the basal mammary epithelium. In the presence of inducer, rtTA binds Dox and
undergoes a conformational change that allows recognition of Tet operator sequences and
responder transgene activation. Transgenic lines used in this study permit Dox regulated
expression of the reporter gene: Histone H2B-eGFP fusion protein (TGFP line). B. Depiction
of Expected Labeling Pattern of H2B-eGFP signal in Dox-Induced Mammary Epithelial
Cells
Compartment specific expression of transactivators allows compartment specific expression
of histone fused eGFP resulting in GFP positive nuclei in either the luminal (MMTV-rtTA-
driven) or basal (Keratin 5-rtTA-driven) layers of the mammary epithelium within the ductal
structures of the mammary gland.
59
Figure 3.2: Dox-Regulated Expression of the H2B-eGFP Transgene in Mammary
Epithelium of MMTV-rtTA/TGFP Mice.
Panels depict widefield microscopic images of mammary gland whole mounts collected in
the brightfield and fluorescent channels (Mag. 5.1X). Mammary gland whole mounts were
prepared from adult mice of the indicated genotypes and under pulse and pulse-chase
conditions. Third column images are superimposed GFP/white light images. Final row GFP
images are 2X the exposure of other rows.
60
Figure 3.3 Luminal-Restricted Labeling of MECs in MMTV-rtTA/TGFP Mice.
Image depicts a MAX projection image collected by Confocal microscopy (Mag. 20X). A
bitransgenic (MMTV-rtTA/TGFP) adult virgin female was placed on Dox for 7 days prior to
harvest of the 4th
inguinal mammary gland. Following frozen sectioning, sections were
prepared for Confocal microscopy by counterstaining with Hoechst dye (blue). Optical
sections were collected through the entire thickness of the prepared section and compiled into
MAX projections to produce a single image depicting the stack of optical sections. This view
demonstrates GFP fluorescence lining the inside of the ductal structure while single Hoechst
counterstained nuclei line the outside of the ducts, primarily composed of myoepithelial cells.
Hoechst stained fat cells are also visualized in the surrounding stromal tissue.
61
Figure 3.4 Immunophenotyping of Labeled Mammary Epithelial Cells Confirms
Compartment-Specific H2B-eGFP Fluorescent Labeling
Single cells isolated from pulse labeled bitransgenic mice (MMTV-rtTA/TGFP) were stained
for CD24 and CD49 and analyzed for fluorescence by flow cytometry. Panels depict
representative flow cytometric plots demonstrating GFP fluorescence and immunophenotype
results of pulse labeled mammary glands. A. Single Parameter Plots. Histogram depicts
GFP intensity for single cell events. GFP signal intensity was assayed in single cells by flow
cytometry and cells were gated into GFP positive (>102 fluorescence) or GFP negative (<10
2
fluorescence). B. Dual-Parameter Immunophenotyping. Single cell MG preps were stained
with CD24 and CD49 to resolve luminal and basal populations using published methods.
Cells scored as GFP+ versus GFP- on the basis of the gating shown in panel A were plotted
independently as shown. GFP+ cells were primarily contained with tin the CD24 high
/CD49 lo
luminal subset.
62
Figure 3.5 Dox-Regulated Expression of H2B-eGFP in Basal Mammary Epithelium of K5-
rtTA/TGFP Mice.
Panels depict fluorescent channel microscopic images collected from mammary gland whole
mounts obtained from adult K5-rtTA/TGFP bitransgenic mice after 7 days on Dox (left
image) or from a Dox-naïve animal (right image) (Mag. 10X).
63
Figure 3.6 Basal-Restricted Labeling of MECs in K5-rtTA/TGFP Mice.
Image depicts a MAX projection image collected by Confocal microscopy (Mag. 20X). A
bitransgenic (K5-rtTA/TGFP) adult virgin female was placed on Dox for 7 days prior to
harvest of the 4th
inguinal mammary gland. Following frozen sectioning, sections were
prepared for Confocal microscopy by counterstaining with Hoechst dye (blue). Optical
sections were collected through the entire thickness of the prepared section and compiled into
MAX projections to produce a single image depicting the stack of optical sections. This view
demonstrates GFP fluorescence lining the outside of the ductal structure while single Hoechst
counterstained nuclei line the inside of the ducts, primarily composed of luminal epithelial
cells. Hoechst stained fat cells are also visualized in the surrounding stromal tissue.
64
Figure 3.7 Immunophenotyping of Labeled Mammary Epithelial Cells Confirms H2B-
eGFP Fluorescent Labeling.
Single cells isolated from pulse labeled bitransgenic mice (K5-rtTA/TGFP) were stained for
CD24 and CD49 and analyzed for fluorescence by flow cytometry. Panels depict
representative flow cytometric plots demonstrating GFP fluorescence and immunophenotype
results of pulse labeled mammary glands. A. Single Parameter Plots. Histogram depicts
GFP intensity for single cell events. GFP signal intensity was assayed in single cells by flow
cytometry and cells were gated into GFP positive (>102 fluorescence) or GFP negative (<10
2
fluorescence). B. Dual-Parameter Immunophenotyping. Single cell MG preps were stained
with CD24 and CD49 to resolve luminal and basal populations using published methods.
Cells scored as GFP+ versus GFP- on the basis of the gating shown in panel A were plotted
independently as shown. GFP+ cells were primarily contained within the CD24+/CD49
+
epithelial cell subsets.
65
Figure 3.8 Selective Washout of H2B-eGFP Fluorescence by Developmental
Proliferation in Terminal End Buds.
Panels depict representative images obtained by conventional fluorescence microscopy on
whole-mounts (Mag. 5X) and frozen tissue sections as indicated. Tissue sections were
counterstained with Hoechst, imaged by conventional fluorescence microscopy ( Mag. 20X)
and optical sections were compiled to form MAX projection images. MMTV-rtTA/TGFP
bitransgenic female mice began Dox treatment at 5 weeks of age and underwent excisional
biopsy of the right inguinal mammary gland at 6 weeks of age. Dox treatment was stopped
post-operatively, and the contralateral inguinal gland was harvested one week later at
necropsy. Proximal ducts were located between the nipple and the inguinal lymph node,
whereas terminal end buds were distal to the lymph node at the leading edge of duct
migration in pubertal mice.
66
Figure 3.9 Proliferation is Necessary for the Washout of Induced H2B-eGFP Signal in
the Mammary Gland.
Images depict conventional fluorescence microscope views of the Green and Blue channels
of Hoechst counterstained frozen sections of mammary glands (Mag. ??X). MMTV-
rtTA/TGFP bitransgenic female mice began Dox treatment at 5 weeks of age and underwent
excisional biopsy of the right inguinal mammary gland at 10 weeks of age. Dox treatment
was stopped post-operatively, and the contralateral inguinal gland was harvested four weeks
later at necropsy. Ovariectomized (OVX) animals underwent excision of the ovaries at the
time of mammary gland biopsy prior to the removal of Dox.
67
Figure 3.10: Elimination of Ovarian Hormone Induced Proliferation Limits H2B-eGFP
Signal Dilution in the Mammary Gland.
Panels depict representative single parameter plots of GFP signal intensity measured by flow
cytometry. Single cells isolated from pulse and pulse-labeled then chased MMTV-
rtTA/TGFP bitransgenic mice were analyzed by flow cytometry for GFP fluorescence. Top
Panel: A large proportion of the cells isolated from an on Dox mouse are GFP positive (>103
fluorescence). Middle Panel: Following 4 weeks of off Dox chase, the majority of the
brightly labeled cells have divided and have divided their fluorescence among the daughter
cells. Arrows indicate peaks of GFP fluorescence roughly half of the preceding intensity.
Lower Panel: MECs from animals pulse labeled prior to ovariectomy and Dox-withdrawal
retain bright GFP fluorescence and peaks suggesting cell division induced dilution are not
present.
68
Figure 3.11 A Strategy for Dox-Regulated H2B-eGFP Labeling of MECs in the
Context of Inducible Wnt1 Expression.
Transgenic mice carrying the MMTV-rtTA transgene express the rtTA transcription factor in
the luminal mammary epithelium but do not express independently integrated responder
transgenes driven by minimal CMV promoters containing multimerized operator sequences.
Similarly, transgenic mice carrying the K5-rtTA transgene express the rtTA transcription
factor in the basal mammary epithelium. In the presence of inducer, rtTA binds Dox and
undergoes a conformational change that allows recognition of Tet operator sequences and
responder transgene activation. Transgenic lines used in this study permit Dox regulated
expression of the reporter gene: Histone H2B-eGFP fusion protein (TGFP line) and the
oncogene, wnt (TWNT line).
69
Figure 3.12 H2B-eGFP Labeling of Luminal MEC-driven, Wnt1-initiated Mammary
Hyperplasia.
Images demonstrate widespread H2B-eGFP signal throughout the ducts of adult tritransgenic
(MMTV-rtTA/TWNT/TGFP) mice placed on Dox for one week. A. Mammary Gland Whole
Mount. Images depict a wide-field fluorescent micrograph (Mag. 10X) of a representative
mammary gland whole mount. B. Mammary Gland Frozen Section. A MAX projection view
of a representative duct captured by Confocal Microscopy (Mag. 20X) from a Hoechst
counterstained mammary gland showing GFP positive nuclei lining the inner surfaces of the
ducts.
70
Figure 3.13 H2B-eGFP Labeling of Basal MEC-driven, Wnt1-initiated Mammary
Hyperplasia.
Images demonstrate widespread H2B-eGFP signal throughout the ducts of adult tritransgenic
(K5-rtTA/TWNT/TGFP) mice placed on Dox for one week. A. Mammary Gland Whole
Mount. Images depict a wide-field fluorescent micrograph (Mag. 10X) of a representative
mammary gland. B. Mammary Gland Frozen Section. A MAX projection view of a
representative duct captured by Confocal Microscopy (Mag. 20X) from a Hoechst
counterstained mammary gland shows GFP positive nuclei lining the outside of the duct.
.
71
Figure 3.14 H2B-eGFP Labeling of Mammary Epithelial Cells Allows Tracking of Cell
Fates in Real Time via Time-Lapse Confocal Microscopy.
Panels depict frames isolated from a time lapse imaging series collected by Confocal
microscopic imaging (Mag. 20X) of mammary gland fragments in culture. Pulse labeled
MMTV-rtTA/TGFP/Tet-O-HRASG12V
mammary gland was collected, cut into small (~1mm)
pieces and anchored in culture media in glass bottom dishes. These oncogene expressing
fragments were maintained on Dox and imaged over a period of several hours by Confocal
microscopy. Optical sections were collected throughout the depth of the imaging stack at
each time interval and compiled into a series of Max projections. These Max projections
were compiled as a time-lapse movie demonstrating the cellular activity throughout the
imaging period. Of interest, imaging captured cell movements within the tissue fragment and
apoptosis of cells within the structure are indicated by the red arrows.
72
J.Mathers Fig 3.15A.AVI J.Mathers Fig 3.15B.AVI
Figure 3.15 Time-Lapse Fluorescence Microscopy of H2B-eGFP Labeled Mammary
Cells in Mammary Duct Fragments in Culture Allows Tracking of Cellular
Proliferation Dynamics.
Videos show brightfield/fluorescent channel microscopic images of mammary ductal
fragments in culture collected every 15 minutes and compiled into time-lapse series (Mag.
20X). A. Brightfield/GFP fluorescence overlay. B. Fluorescent channel alone. Pulse labeled
MMTV-rtTA/TGFP/MMTV-wnt1 mammary tumors were partially dissociated and plated in
Matrigel Suspension. Organoids were maintained under Dox treatment in culture and
imaged by conventional fluorescent and brightfield microscopy. Cell movements are
apparent throughout the movies and cell division is visible in the movies in the 2 o’clock
position.
73
Chapter 4 H2B-eGFP Labeling and Proliferation Dynamics in Mammary Tumors
Driven by Constitutive Oncogenes
4.1 Introduction
Breast cancers are composed of heterogeneous tumor cell populations but how this
heterogeneity contributes to tumor growth and maintenance remains poorly understood.
Mammary tumors frequently contain cells of both luminal and basal origin and the lineage
history of cells that make up these tumors is unknown. Figure 4.1 illustrates the cell types
found within mammary adenocarcinomas initiated by MMTV-wnt1 expression and
introduces the matter of tumor initiating capacity. Elucidating the role of luminal and basal
cells in the development and maintenance of mammary adenocarcinomas would assist in the
identification of cell of origin for mammary cancers and possibly in the development of
targeted therapies aimed at the specific cell-types required for tumor maintenance.
In addition to the cell-layer diversity found in mammary tumors, mammary tumors
likely contain populations with distinct patterns of activity and growth. Specifically, the
identification of cell populations from either cell type within growing mammary tumors that
have different proliferation rates would allow characterization of distinct cell populations
within a seemingly homogeneous tumor and increase understanding of the complex
developmental patterns of mammary tumors. Recently, the possibility of separate cell
populations with distinct functional characteristics has been used to propose the presence of
cancer stem cells within many kinds of malignant growths. These CSC are proposed to be
chemo-resistant and have increased longevity and proliferative capacity than that of
surrounding bulk tumor cells.
In recent years, strategies for dissecting the roles of distinct tumor cell subsets within
a tumor have emerged. Tumor cell subsets can be defined by lineage markers or by
74
functional assessment such as proliferate rate. By using H2B-eGFP compartment specific
labeling we are able to track the proliferation history of cells in the luminal and basal
compartment. The use of two independent compartment restricted promoters also allows the
tracing of lineage labeled cells and analysis of cell-compartment specific behaviors within
the developing mammary tumors. Additionally, by labeling and following viable label
retaining cells in mammary tumors we establish a model that allows testing of the varying
capabilities of differentially label retaining cells from both epithelial cell compartments in
mammary tumors.
4.2 Experimental Strategies Allowing the Study of Proliferation Dynamics in Mammary
Tumors Driven by Constitutive Oncogenes
In this chapter we paired the labeling strategy employed in Chapter 3 with the
mammary epithelium-specific, constitutive expression of the Wnt1 oncogene to examine
proliferation dynamics in a mouse mammary tumor model. In addition to the MMTV-rtTA,
K5-rtTA, and TGFP transgenes previously described, we utilized an MMTV-wnt1 transgene
expressed in the luminal epithelium of the mammary gland to drive tumorigenesis (Figure
4.2A). In this model, mice develop diffuse hyperplastic growth throughout the mammary
ductal tree and stochastically develop solitary mammary tumors. These tumors are typically
mixed-lineage adenocarcinomas that include both luminal and basal epithelial cells. Tumor
growth is driven independently of labeling of mammary epithelial cells with H2B-eGFP
(Figure 4.2B).
Building on the work described in Chapter 3, we employed Dox-dependent,
compartment-restricted H2B-eGFP labeling in the context of constitutive MMTV-wnt1
driven tumors to investigate proliferation dynamics. As depicted in Figure 4.3, two possible
75
models exist regarding H2B-eGFP label retention in mammary tumors: Either all the tumor
cells within the labeled cell layer proliferate at similar rates and will dilute GFP signal at a
similar pace or populations of cells within the tumor proliferate at distinct rates and will be
detectable by different levels of GFP label retention. Potentially, CSC would additionally
have distinct proliferation rates and could be identified by H2B-eGFP labeling/label-retention
studies. In addition to the differences probable between cell-compartments within the
mammary tumors, based on the descriptions of distinct tumor cell subsets common in a
diverse range of tumors, it is expected that mammary tumors also likely contain cell
populations with disparate proliferation rates.
In this chapter, we examine tumors under pulse-chase conditions to test for either
homogeneous or heterogeneous washout of GFP signal in mammary tumors and by using
both the luminal and basal driven GFP labeling strategies tested for the presence of slower
cycling label retaining cells in both cell compartments of mammary tumors. This strategy
allows the identification of cell proliferation rates in both luminal and basal populations
within growing mammary tumors and the tracing of lineage commitment within the cell
populations within mammary tumors.
4.3 Dox-regulated GFP Labeling Independent of Tumorigenesis
In order to verify the regulation of H2B-eGFP in MMTV-wnt1 driven mammary
tumors we monitored Dox-naïve tritransgenic MMTV-rtTA/MMTV-wnt1/TGFP female
mice until mammary tumors developed. Tumor bearing mice were then Dox-treated for one
week to induce H2B-eGFP expression in the luminal compartment of the mammary tumors
and subjected to tumor biopsies. Figure 4.4A shows the widespread labeling with GFP that
is apparent in gross tumor specimens with appropriate excitation of the GFP. Examination
76
of frozen sections from Dox-pulsed mammary tumors showed widespread fluorescent
labeling of tumor cell nuclei (Figure 4.4B). Flow cytometric measurement of GFP signal
intensity in single cells isolated from these tumors confirmed our visual analysis of the
presence of GFP signal in mice pulse labeled with Dox.
While many tumors were brightly labeled with GFP fluorescence during Dox-pulse
there was a wide range of proportions of tumor cells labeled that varied greatly from tumor to
tumor. Figure 4.4C portrays the variability in pulse labeling between primary tumors where
GFP positive cells are those with fluorescence above 102.5
as illustrated in Figure 4.4B. A
wide range of GFP fluorescence was found with some tumors exhibiting practically no GFP
fluorescence during Dox pulse and others containing nearly 60% brightly GFP positive cells.
This range of fluorescence intensity likely results from the varied accumulated mutations
necessary for tumor initiation altering GFP signal induction patterns and the impact of those
mutations on transgene expression
To examine whether pulse-chase labeling would permit quantification of tumor cell
proliferation, mice were then subjected to Dox withdrawal to allow proliferation dependent
washout of H2B-eGFP during continues tumor growth. As depicted in Figure 4.2B, growing
tumors dilute the GFP signal and flow cytometry of single cells isolated from pulse labeled
and subsequently chased tumors quantified the H2B-eGFP signal retention. Figure 4.5
depicts pulse and post-chase analysis of 16 independent primary tritransgenic MMTV-
rtTA/MMTV-wnt1/TGFP tumors. The first column contains tumors that did not respond to
Dox-induction by producing H2B-eGFP protein. No GFP fluorescence was detectable in
these tumors following pulse eliminating the possibility of comparison to chased matched
samples. The remaining eleven tumor pairs exhibited varying levels of pulse GFP
77
fluorescence and pulse-chase label washout. Washout of H2B-eGFP signal varied between
tumors possibly due to different growth rates between independent tumors and the exact
cellular composition of each tumor. The large variability in initial labeling and in subsequent
washout illustrates the array of tumor variations that occur and recapitulates the diversity
seen in mammary tumors.
4.4 Identification of LRC in Explanted Mammary Tumors
As the analysis of pulse-chase labeling in primary MMTV-wnt1 tumors showed
marked tumor to tumor variability such that only a subset of tumors yielded sufficient
labeling to allow study of proliferation dependent washout. In order to circumvent this
variability, we propagated tumors as explants to determine whether those primary tumors that
permitted efficient H2B-eGFP labeling would yield descendent tumors with similar labeling
patterns. In addition, we reasoned that explants would expand the number of specimens,
allowing a variety of pulse-chase conditions to be performed on “identical” clonally related
tumors. Accordingly, we propagated primary MMTV-rtTA/MMTV-wnt1/TGFP tumors with
bright eGFP label as described in Figure 4.6. This procedure involved taking a biopsy
fragment from a tumor of a given genetic background, in this study MMTV-wnt1/MMTV-
rtTA/TGFP, and implanting one small fragment onto each of the flanks of syngeneic but non-
transgenic mice. These fragments grow into mammary tumors over a period of weeks and
provide multiple time-matched clonally related tumors that can be used to isolate and analyze
labeled and label retaining cells. Additionally, we were able to explant some tumors through
several generations allowing analysis of clonally related tumors over these generations.
Analysis of gross mammary tumor explants pulse labeled with doxycycline displayed
bright GFP fluorescence (Figure 4.7A). Dox-naïve animals bore tumors that did not contain
78
GFP positive nuclei by Confocal imaging or by flow cytometric analysis of single cells
isolated from the tumors (Figure 4.7B). Pulse labeled explanted tumors brightly labeled with
H2B-eGFP as shown in the representative Confocal image and flow cytometry plot of GFP
fluorescence. Figure 4.7C provides an analysis of GFP fluorescent labeling in sibling tumors
of subsequent generations of mammary tumor explants by quantifying GFP fluorescence
from single cells isolated from pulse labeled mammary tumor explants. Tumor generations
generally recapitulated the labeling pattern of the primary tumor with some variability in
fluorescence intensity occurring between generations. However, following rounds of explants
some tumor lines eventually lost their typical adenocarcinoma appearance and developed a
more mesenchymal appearance. This change in tumor type was accompanied by a loss of
GFP signal induction by doxycycline.
The epithelial to mesenchymal transition (EMT) of mammary tumor explant
generations results in a change in the histological appearance of the tumors. Generations of
tritransgenic tumor passaged on syngeneic hosts gradually ceased to respond to doxycycline
induction of GFP as seen in Figure 4.7C. It is most likely that the EMT altered the
expression pattern of the cells composing the mammary tumor away from the luminal
epithelial pattern required for MMTV-driven induction of a transgene. Sequencing of HRAS
mutations throughout the generations could be used to verify tumor progeny. Additionally,
EMT results in characteristic marker changes in these mammary tumors that can be assayed
by Northern analysis of mRNA expression [192].
To examine the proliferation dynamics in growing mammary tumors driven by
MMTV-wnt1 we used a pulse-chase labeling strategy. Pulse labeled mammary tumors
exhibited bright green fluorescence even when gross specimens were examined by eye under
79
UV wavelength excitation (Figure 4.8A). Pulse labeled, chased tumors also had detectable
GFP labeling by this manner though contained less than on Dox tumors (Figure 4.8A).
Increasing periods of off-Dox chase resulted in decreased levels of GFP labeling retained in
the nuclei of tumor cells. Confocal microscope imaging of thick frozen sections of these
tumors showed decreasing numbers of brightly GFP labeled nuclei with increasing periods of
off Dox washout concurrent with tumor growth (Figure 4.9B). The decreased GFP signal
intensity in growing tumors can likely be attributed to dilution of H2B-eGFP by rounds of
cellular division in the rapidly proliferating cells.
We additionally quantified label retention in tumor cells by flow cytometric analysis
of single tumor cells from pulse labeled then chased mice (Figure 4.9; for additional
examples, please see the Appendix). One tumor was able to be followed over 7 sequential
explants generations and was also frozen following 4 explant generations and was
subsequently propagated and monitored for an additional 5 generations. While this tumor
was exceptional in its duration, several explants were followed for 2-4 generations of
explants. Labeling and label retention in pulse-chased tumors was generally consistent
within a generation and followed the pattern of the preceding generations but exact labeled
proportions were not inherent in tumor explants. Later generations lost inducible H2B-eGFP
as measured by flow cytometric analysis of pulse-labeled tumor samples probably due to
EMT as documented by microscopic imaging.
4.5 Adriamycin Treatment Does Not Alter GFP Labeling and Label Retention Dynamics in
MMTV-wnt1 Driven Mammary Tumors
To investigate the effects of chemotherapeutic treatment on the proliferation
dynamics in the tumors we administered a single dose of adriamycin (300mg/kg) to pulse and
80
pulse-chased mammary tumors. Figure 4.10 shows the single parameter plots of GFP
intensity for single cells isolated from sibling mammary tumor explants. Tumors from a
Dox-naïve animal did not have detectable GFP positive nuclei while pulse labeling appeared
to be unaffected by the administration of adriamycin as pulse labeled treated and untreated
animals had similar GFP fluorescence profiles (Figure 4.10). Interestingly, pulse-chase
washout in tumors chases for 6 and 10 days were not distinguishable possibly due to varied
tumor growth rates (Figure 4.10C). Pulse-chase washout of GFP signal also appeared similar
in adriamycin treated and untreated animals (Figure 4.10D). Single dose treatment with
chemotherapeutic drug did not cause tumors to shrink and did not seem to halt cellular
proliferation as measured by GFP signal dilution resulting from cell divisions.
4.6 Keratin-5 Induced Labeling and Label Retention in MMTV-wnt1 Driven Constitutive
Mammary Tumors
We utilized Keratin-5 driven TGFP transgene expression in mice carrying the
MMTV-wnt1 transgene to investigate the labeling and label retention dynamics in the basal
cell components of mammary tumors. Adenocarcinomas consist of both luminal and basal
cell types and by pairing the constitutive oncogene with the basal promoter we are able to
induce labeling in the basal compartment of mammary tumors. Following induction with
doxycycline, we observed widespread H2B-eGFP labeling in tumors from K5-rtTA/MMTV-
wnt1/TGFP mice (Figure 4.11A). Examination of sections from these tumors showed
decreased GFP labeling following Dox-withdrawal. Non-neoplastic duct fragments adjacent
to the growing tumors were also brightly labeled during Dox-pulse but retained higher levels
of GFP signal following chase due to lower proliferation rates in the non-tumor portions of
the mammary gland. Flow cytometric analysis of single cells isolated from pulse-labeled
81
tumor biopsy showed a significant population of GFP positive cells (Figure 4.11B). Pulse-
chased K5-rtTA/MMTV-wnt1/TGFP mammary tumors diluted H2B-eGFP showing washout
of the GFP signal by the decreased number of GFP positive cells following chase. Clonal
tumor explants of basal driven GFP in MMTV-wnt1 tumors showed bright eGFP labeling of
the myoepithelial cells and also demonstrated washout of the GFP signal in pulsed then
chased mammary tumors. The K5-driven expression of H2B-eGFP provides a counterpoint
to the labeling induced by MMTV-rtTA and an avenue for the exploration of proliferation
dynamics in the myoepithelial compartment of mammary adenocarcinoma.
4.7 Constitutive MMTV-Neu Mammary Tumors can be Labeled with H2B-eGFP
While the cellular heterogeneity of MMTV-wnt1 initiated mammary tumors mimics
some forms of human breast cancers, alterations in HER2 commonly cause breast cancer in
women and are quite distinct histological [193]. MMTV-neu driven mammary tumors are
reported to not contain an identifiable stem cell population, possibly attributable to their
homogeneous cellular composition [194]. In order to characterize the patterns of cellular
proliferation and examine the potential for distinct populations with different proliferation
histories we employed our pulse-chase labeling scheme in MMTV-neu driven mammary
tumors. Tri-transgenic MMTV-neu/MMTV-rtTA/TGFP mice were maintained off Dox and
monitored for tumor formation. Upon tumor formation, animals were placed on Dox in order
to induce H2B-eGFP labeling in the mammary tissue. Biopsy samples obtained from these
tumors were variable in efficiency of H2B-eGFP labeling. While several tumors did contain
widespread nuclear labeling with H2B-eGFP, many pulse-labeled tumor biopsy samples did
not contain detectable H2B-eGFP fluorescence (Figure 4.12C and D). The mechanisms
responsible for this loss of regulation of transgene expression are unclear and await further
82
definition. Potentially, the accumulated genetic hits acquired during tumorigenesis may have
silenced or deleted the H2B-eGFP transgene or the transactivator transgene.
In order to examine the potential for the existence of multiple distinct cell populations
within the seemingly homogeneous mammary tumors, we initiated washout of H2B-eGFP
signal by the removal of Dox. MMTV-neu driven tumors that incorporated H2B-eGFP
labeling and were subsequently removed from Dox were analyzed by microscopic imaging
and by flow cytometric assessment of GFP signal intensity and immunophenotype. Frozen
sections from pulse labeled mammary tumors showed the typical uniform cellular appearance
and widespread H2B-eGFP labeling. Cells in pulse labeled then chased tumor sections
demonstrated varied washout but without an identifiable pattern distinguishing label retaining
from non-label retaining cells (Figure 4.12B). Flow cytometric analysis of single cells
isolated from pulse labeled mammary tumors showed a large subset of the single
immunophenotype typical of MMTV-neu tumors were brightly labeled with H2B-eGFP
fluorescence (Figure 4.12A). The limited availability of samples due to the unexpected
absence of H2B-eGFP labeling in a large subset of mammary tumors complicated the
analysis of label retaining cells following off Dox washout. However, MMTV-neu driven
tumors clearly label and retain label in a distinct manner than that seen in MMTV-wnt1
driven mammary tumors, potentially due to the different pathways of tumor promotion and
target cell of mutations.
4.8 Discussion
The H2B-eGFP labeling system provides an interesting manner in which to
investigate proliferation dynamics within developing mammary tumors. By pairing the
reporter transgene with two independent transactivator lines we were able to analyze cellular
83
proliferation rates in both the luminal and basal compartments of MMTV-wnt1 driven
mammary tumors. This ability will allow the contributions of each cell compartment to the
developing mammary tumor to be further characterized. Pulse-chase labeling of mammary
tumors with varying time lines may uncover cell populations with distinct cell-cycle
characteristic and cell cycle characteristics may be paired with defined immunophenotyping
markers to further subdivide cell populations comprising the mammary gland.
Constitutive mammary tumors appear to frequently be composed of cells with
different cycling patterns as demonstrated by the retention of H2B-eGFP label in a small
subset of cells in both luminal and basal labeled mammary tumors. The exact
characterization of these cells would provide insight into the maintenance and growth of
mammary tumors and possibly provide a candidate population of CSC based on their
relatively infrequent cycling. While slower cycling populations within the growing tumor
were common among the samples studied, tumors did not appear to contain non-cycling cells
retaining H2B-eGFP label to the same extent as in pulse-labeled mammary tumors.
Mammary tumor cells seem to have heterogeneous proliferation patterns though the exact
mechanisms driving those patterns are at this point unclear. Isolation of LRCs from pulse-
chased mammary tumors would allow analysis of expression patterns and possible
identification of the mechanisms underlying altered proliferation rates. It is likely that the
distinct proliferation patterns of tumor cells results from specific capabilities of those cells
and plays a role in normal tumor development.
Characterization of LRCs, and comparison to washed-out cells, by a variety of means
should provide information on the heterogeneity inherent to mammary tumors. Functional
characterization of LRCs could be obtained by suspension of single isolated LRCs in
84
Matrigel and monitoring of their growth capacity within that environment. If slow cycling
cells are enriched for stem cell like behaviors, increased diversity within resulting outgrowths
would likely be visible in the 3D cultures and could be imaged in real time using the
techniques described in Chapter 3. Expression profiling may provide information about the
growth regulation mechanisms used to maintain cells relatively dormant within the confines
of rapidly growing tumor. Finally, implant studies defining the capacity of LRCs to
recapitulate both mammary tumor and potentially normal mammary gland depending on the
impact of stroma on malignant growth would be useful in characterizing LRCs.
Tumor to tumor variability proved a confounding feature for the identification and
characterization of LRCs in mammary tumors. The wide range of GFP labeling proportions
seen in pulse-labeled tumors may be due to additional genetic lesions acquired during
tumorigenesis that are different in each independent tumor. Identifying these lesions and
possibly the effects they have on tumor growth and progression may help define the changes
that cause the distinct H2B-eGFP labeling patterns. Categorizing primary tumors based on
common mutation spectra may also allow further identification of commonalities in GFP
washout patterns.
As mammary tumors arise from a variety of genetic insults, the variability seen in
this work is not necessarily problematic but is a confounding factor for the isolation of a
uniform population from a series of primary tumors. By using explants we attempted to
circumvent this variability with some success in creating sequential generations that recreate
the pulse and pulse-chase patterns of the primary tumor. While general response to Dox-
pulse was carried through generations of explanted tumors, precise percentage of H2B-eGFP
labeled nuclei was variable. This variability may be due to the regional variation in tumor
85
composition and the relatively small sample taken during tumor biopsy surgeries. Though
not labeled in identical proportions across generations, explants did provide a manner to
obtain pulsed and pulse-chased data from matched tumor sets. Future work may utilize a
similar strategy of serially propagating a mammary tumor but instead of tumor fragments
may use single cells of a specific label retention history to sequentially populate the explants.
A study done in this manner would not only expand the population available for different
experimental conditions but would also help eliminate the sample variability seen by using
tumor fragments consisting of many cells for explants.
Variability in H2B-eGFP labeling seen in mammary tumors while on Dox may
alternatively result from alteration of the expression of the H2B-eGFP transgene. Silencing
may result in the abrogation of fluorescent histone expression. Bisulfite PCR may provide an
avenue to examine the methylation related silencing of the transgene. The absence of a
proliferation benefit for cells expressing H2B-eGFP suggests a potential selection against the
transgene during tumor progression and sequencing of DNA from non-labeling tumors to
identify the continued maintenance of H2B-eGFP transgene in tumor tissue.
The transition of tumors across several generations from adenocarcinoma to
mesenchymal tumors eventually eliminated the utility of each explants series. This transition
varied in length from tumor to tumor, possibly due to genetic variation inherent to the tumor,
and was accompanied by a loss of response to H2B-eGFP induction as expected due to the
loss of luminal type cells. The sustained time frame of growth of the cells explanted serially
may have caused the decay of the epithelial type tumors.
While preliminary study of labeling and washout in constitutive mammary tumors
proved to be complicated by the variability encountered in primary tumors, serial explants
86
provided a more consistent population of tumors for study. Additional work done on more
characterized primary tumors selected for their labeling characteristics and genetic profiles
will provide more insight into the particular patterns of proliferation within mammary
tumors. The characterization of primary tumors and the functional characterization of single
labeled and label retaining cells from those tumors should elucidate the role of distinct cell
populations that appear to comprise mammary tumors driven by MMTV-wnt1.
87
Figure 4.1 Mammary Adenocarcinomas Arising in the MMTV-wnt1 Model Show a
Mixed-Lineage Phenotype.
The upper panels show immunohistochemistical identification of Keratin-8-positive, luminal-
type tumors cells (left) and Smooth Muscle Actin (SMA)-positive basal-type tumor cells
(right). Keratin-8 labeled cells make up the luminal type cells in the mammary tumor and
SMA expressing cells are from the basal cell type. Mammary adenocarcinoma contain cells
of both luminal and basal types however the tumorigenic capacities of these two populations
remains undefined with both populations potentially exhibiting tumor initiating behaviors.
88
Figure 4.2 Strategy for the Dox-Dependent H2B-eGFP Labeling of Either Basal-Type
or Luminal-Type Tumor Cells in the MMTV-wnt1 Model.
A. Schematic of Transgenes Used. Transgenic mice carrying the MMTV-rtTA transgene
express the rtTA transcription factor in the luminal mammary epithelium but do not express
independently integrated responder transgenes driven by minimal CMV promoters
containing multimerized operator sequences. Similarly, transgenic mice carrying the K5-
rtTA transgene express the rtTA transcription factor in the basal mammary epithelium. In
the presence of inducer, rtTA binds Dox and undergoes a conformational change that allows
recognition of Tet operator sequences and responder transgene activation. Transgenic lines
used in this study permit Dox regulated expression of the reporter gene: Histone H2B-eGFP
fusion protein (TGFP line). Transgenic mice carrying the MMTV-wnt1 transgene express the
wnt1 oncogene in the luminal epithelium in a constitutive manner. B. Fluorescent Labeling
of Mammary Tumors. Mice carrying the MMTV-wnt1 transgene develop mammary tumors.
Following tumor development, transgenic animals also bearing the TGFP and either MMTV-
rtTA or K5-rtTA transgenes are placed on doxycycline in order to induce H2B-eGFP
expression and incorporation into the chromatin. Removal of doxycycline from the animals’
diet results in cessation of H2B-eGFP signal production and allows washout of GFP signal
from dividing cells within the tumor.
89
Figure 4.3 Homogeneous Versus Heterogeneous Models of H2B-eGFP Washout in
Growing Mammary Tumors.
The schematic depicts growth of a mammary tumor driven by a constitutive oncogene. Dox
treatment triggers H2B-eGFP labeling of a tumor cell compartment. Cessation of Dox
treatment initiates H2B-eGFP washout, which can occur in at least two distinct ways; the
first, that all cells in the tumor proliferate at similar rates and evenly washout GFP signal in
all cells or alternatively, cells proliferate at different rates leading to differential washout and
the identification of bright label retaining cells. The identification of bright LRCs resulting
from either luminal or basal driven GFP labeling provides the opportunity to isolate and
characterize a distinct population within a mammary tumor.
90
Figure 4.4 Wide Variation in the Extent of H2B-eGFP Labeling of Luminal-Type
Tumor Cells in the MMTV-Wnt1 Model.
Pulse labeling of tritransgenic (MMTV-rtTA/MMTV-wnt1/TGFP) with doxycycline brightly
labels mammary tumors, however variability in the intensity of staining is common. A.
H2B-eGFP Fluorescence in Gross Tumor Specimens. A photograph of a fragment of H2B-
eGFP labeled mammary tumor excised from a tritransgenic Dox-treated mouse under long
UV illumination. B. H2B-eGFP Fluorescence in Tumor Sections. A representative Confocal
microscopy image (Mag. 40X) of a Hoechst counterstained frozen section prepared from a
mammary tumor of a Dox-treated tritransgenic animal. GFP labeled cells are contained in the
luminal cell nests present within the mammary tumor. C. Flow Cytometric Detection of
H2B-eGFP Fluorescence. Single cells isolated from independent primary mammary tumor
samples collected from Dox-induced tritransgenic animals were analyzed by flow cytometry
for GFP signal intensity. The graph depicts the range of H2B-eGFP signal detected with each
bar representing a single independent tumor. The percent GFP positive cells was calculated
as the total population of cells with signal intensity greater than 102.5
.
91
Figure 4.5 Wide Variation in the Rate of H2B-eGFP Washout from Luminal-Type
Tumor cells in the MMTV-Wnt1 Model.
Single cells isolated from 16 primary mammary tumors of MMTV-rtTA/MMTV-wnt1/TGFP
tritransgenic mice were analyzed for GFP content by flow cytometry following 1 week of
Dox treatment (biopsy) and following 1 week of Dox-withdrawal (necropsy). Each graph
represents an individual tumor. Blue lines are pulse-labeled biopsies (Dox treated) while red
lines are from tumors at necropsy following Dox withdrawal. Wide variability of both extent
of GFP labeling during pulse and amount of GFP signal dilution during chase can be
visualized. The right two columns contain tumors that responded to Dox while the left
column contains those tumors without detectable GFP induction in the presence of Dox.
Percent GFP positive cells during Pulse (blue) and following chase (red) are calculated as
cells with GFP signal intensity greater than 102.5
as indicated by the bars in the top of each
column.
92
Figure 4.6 Generating Clonally-Related Tumor Outgrowths by Explanting onto Syngeneic
Host Mice.
Dox-independent tumors from MMTV-wnt1/MMTV-rtTA/TGFP are biopsied and divided
into small fragments. These fragments are then implanted on to the right and left flanks of
Dox naïve wild-type host mice. Following a period of weeks, tumor outgrowths develop at
the implant locations. Groups of “sibling” clonal tumor explants can then be exposed to
various pulse-chase timelines in order to analyze labeling and label retaining cells in growing
constitutively driven mammary tumors. Additional rounds of explanting achieve expansion
of the tumor pool available for study.
93
Figure 4.7 Variable H2B-eGFP Labeling Among Clonally-Related MMTV-Wnt1
Mammary Tumor Explants.
A. H2B-eGFP Fluorescence in Gross Tumor Specimens. These images depict an on Dox,
wild-type FVB female bearing bilateral tritransgenic tumor explants at necropsy. Tumor
explants contain bright green H2B-eGFP signal upon examination under excitation
illumination and were photographed using XXX filter to optimize fluorescence detection and
imaging. Images: Conventional digital photography: white light (left) and UV illumination
(right). B. H2B-eGFP Fluorescence in Tumor Sections and Flow Cytometry. Representative
samples of Dox-naïve (left) and on Dox (right) mammary tumor explants collected from host
mice were prepared for Confocal microscopy imaging with Hoechst counterstain (Mag. 40X)
and flow cytometric assessment of GFP signal intensity and demonstrate the expected
absence and presence of H2B-eGFP labeling in mammary tumors dependent on Dox
induction. C. Flow Cytometric Detection of H2B-eGFP Fluorescence in Tumor Explant
Generations. The graph depicts the GFP fluorescence as quantified by flow cytometry for
mammary tumor explant generations. Single cells isolated from pulse-labeled mammary
tumors were analyzed by flow cytometry for GFP signal intensity. Primary tumors and
subsequent generations are depicted sequentially. Many generations of tumor explant have 2
samples composed of the left and right explants.
94
Figure 4.8 Evidence for Heterogeneous H2B-eGFP Washout in a Subset of MMTV-Wnt1
Tumor Explants.
A. H2B-eGFP Fluorescence and Washout in Gross Explant Tumor Specimens. Photographs
depict UV illuminated gross tumor fragments from sibling tumors under conditions listed.
Dox-treated tumors are brightly green fluorescent even to the naked eye with excitation.
Previously Dox-treated tumors subjected to Dox withdrawal exhibit dimmer GFP
fluorescence but are still easily distinguishable from the unlabeled control Dox-naïve tumor.
B. H2B-eGFP Fluorescence and Washout in Explant Tumor Sections. Panels depict
Confocal microscopy images of frozen tumor sections counterstained with Hoechst (Mag.
20X). Dox-naïve, Dox-treated and post-Dox treated chase mammary tumor samples images
demonstrate labeling and label retained following pulse-chase in a growing mammary tumor
sibling group. Only a minority of labeled cells retain bright GFP fluorescence following a
one week Dox withdrawal.
95
96
Figure 4.9 Variable H2B-eGFP Washout Among Clonally-Related MMTV-Wnt1
Mammary Tumor Explants.
Single cells isolated from primary mammary tumors of MMTV-rtTA/MMTV-wnt1/TGFP
tritransgenic tumor explants were analyzed for GFP signal intensity by flow cytometry. Each
graph is an individual tumor generation with sequential generations appearing in the same
column and numbered by passage generation. The arrow depicts the lineage of a tumor that
was re-explanted from frozen storage of a sample from P4. Dox-naive animals appear in
Blue, Dox-treated tumors are Magenta, and Dox-treated tumors subjected to Dox withdrawal
prior to harvest appear in both Black and Yellow.
97
Figure 4.10 Chemotherapy with Adriamycin Minimally Impacts H2B-eGFP Labeling
and Washout in MMTV-Wnt1 Tumor Explants.
Single parameter plots depict the GFP signal intensity of single cells isolated from sibling
tritransgenic (MMTV-rtTA/MMTV-wnt1/TGFP) mammary tumor explants on host mice.
Colors represent single mice with each mouse bearing two sibling tumors. A. Adriamycin
Treatment does Not Induce Fluorescence. Dox-naïve animals treated with adriamycin 4 days
prior to necropsy and did not have detectable GFP fluorescence. B. Adriamycin Treatment
does Not Appear to Alter GFP Labeling. The yellow and black lines represent the GFP
fluorescence detected in pulse labeled tumors (8-14 days on Dox) treated with adriamycin 4
days prior to necropsy while the pink lines depict the fluorescent signal found in an untreated
mouse on Doxycycline for 4 days. C. Proliferating MMTV-wnt1 Initiated Mammary Tumors
Dilute GFP Signal. Yellow and black lines depict GFP signal intensity of cells isolated from
4 day pulse labeled tumors from mice chased for 6 days and 10 days (Pink lines). D.
Adriamycin Treatment does not Alter H2B-eGFP Washout Pattern in Mammary Tumors.
Graph demonstrates the absence of a change in GFP washout in 4 day pulsed- 10 day chased
mammary tumor explants following adriamycin treatment. Yellow, Blue, and Black lines are
mammary tumors from mice treated with adriamycin while the pink lines are from untreated
mice.
98
Figure 4.11 H2B-eGFP Labeling of Basal-Type Tumor Cells in the MMTV-Wnt1
Model.
Tritransgenic K5-rtTA/TGFP/MMTV-Wnt1 female mice were generated and monitored until
mammary tumors were detected. Mice were subsequently placed on Dox for 4 days to
induce H2B-eGFP labeling of Keratin 5 expressing cells within the mammary gland and
mammary tumor. Following Dox-treatment, animals were removed from Dox for 12 or 14
days as indicated. A. Microscopic Imaging of Primary Tumor Sections. Representative
fluorescence microscopy images (Blue and Green channels, Mag. 20X) counterstained with
Hoechst demonstrate widespread labeling with H2B-eGFP following pulse in both the
mammary tumor and surrounding normal ducts (left). Mice were subsequently removed from
Dox for 2 weeks and washout of H2B-eGFP signal occurred reducing the number of bright
GFP positive nuclei identified by fluorescence microscopic examination of sections (right).
Relatively slower proliferating normal mammary ducts surrounding the tumor retain GFP-
label at a much higher level than that seen in growing tumors. B. Confocal Imaging of
Explant Tumor Sections. Representative fluorescence microscopy images (Mag. 20X)
counterstained with Hoechst demonstrate widespread labeling with H2B-eGFP. Similarly to
what is seen in primary tumors, sibling tumor explants of K5-rtTA/MMTV-wnt1/TGFP
tumors treated with Dox contained large numbers of brightly fluorescing nuclei while
increasing periods of chase resulted in decreased GFP fluorescence. C. Flow Cytometric
Detection of H2B-eGFP Signal in Mammary Tumors. Single parameter plots depict results of
flow cytometric analysis of single cells isolated from basal labeled constitutive mammary
tumors and confirm the patterns seen in frozen sections where pulse labeled tumors exhibit
bright GFP fluorescence while pulse/chase tumors have decreased GFP intensity.
99
100
Figure 4.12 MMTV-Neu Driven Tumors Contain a Homogeneous Cell Population
Capable of H2B-eGFP Labeling.
Dox-treated MMTV-Neu initiated mammary tumors were collected by biopsy after 2-3
weeks of Dox treatment. Animals were subsequently removed from Dox treatment to allow
washout of H2B-eGFP signal prior to necropsy and collection of mammary tumor fragments
for analysis by fluorescent microscopy and flow cytometry. A. Preponderance of luminal-
type cells in the MMTV-Neu model. Representative immunophenotype profiles of tumor
cells derived from MMTV-Neu and MMTV-Wnt models. Nearly all MMTV-Neu tumor
cells were CD24high
, indicating luminal character. B. H2B-eGFP labeling of MMTV-Neu
tumor cells. B. Single Parameter flow of Dox treated and Dox-withdrawal tumor
fluorescence. A representative pair of MMTV-neu/MMTV-rtTA/TGFP tumors during Dox
treatment and following 1 week chase were prepared as single cells and analyzed for GFP
signal intensity. C. GFP Signal detected in MMTV-Neu initiated mammary tumors. The
graph depicts the GFP fluorescence as quantified by flow cytometry for independent MMTV-
Neu initiated mammary tumors both during Dox treatment and following 1 week of Dox
withdrawal. Single cells isolated from pulse-labeled mammary tumors were analyzed by flow
cytometry for GFP signal intensity. D. H2B-eGFP Fluorescence in Tritransgenic MMTV-
Neu-driven Tumors Sections. Hoechst counterstained frozen tumor sections from Dox
treated (1 week on Dox), and Dox-withdrawal (1 week on Dox then 4 weeks off Dox)
MMTV-rtTA/ MMTV-Neu/TGFP mammary tumors were imaged by fluorescence
microscopy demonstrating nuclear H2B-eGFP fluorescence incorporation and washout
following of Dox chase (Mag 20X).
101
Chapter 5 H2B-eGFP Labeling and Proliferation Dynamics in Reversible Mammary
Tumors and Minimal Residual Disease Lesions
5.1 Introduction
While treatment of breast cancers frequently results in elimination of clinically detectable
tumor burden many mammary tumors recur months or even years following treatment.
Relapse has been attributed to a latent population of malignant cells which eventually
repopulate the tumor after a long interval of relative dormancy [174, 195, 196]. The
mechanisms by which these tumor cells are maintained are poorly understood. Here, we
used an H2B-eGFP labeling strategy in the context of a reversible breast cancer model to test
whether residual tumor cells are maintained in a state of dynamic equilibrium or in a state of
cellular dormancy. Specifically, mice were engineered to enable pulse-chase labeling of
tumor cells of Wnt1-dependent mammary cancers. In chapter 3, we established the role of
proliferation in the dilution of H2B-eGFP label in normal MECs. Here we extend this
methodology to study the cycling dynamics of cells within dormant malignant lesions of the
mammary gland. By identifying the cycling status of the cells comprising minimal residual
disease lesions (MRD) we explore the cellular mechanisms that maintain dormant
malignancies in breast cancers.
5.2 Experimental Strategy for the Study of Proliferation Dynamics in Reversible Mammary
Tumors and Minimal Residual Disease Lesions
Our strategy for H2B-eGFP labeling of luminal epithelial cells within reversible
mammary neoplasia is depicted in Figure 5.1A. The transgenes used for luminal MEC-
restricted H2B-eGFP labeling in normal mammary tissue were paired with an additional Tet-
responder transgene expressing the Wnt1 oncogene. In tri-transgenic MMTV-
rtTA/TWNT/TGFP animals, Wnt1 and H2B-eGFP should be co-expressed in a Dox-
102
dependent manner. In previous work, we showed that expression of inducible Wnt1 in the
mammary epithelium of MMTV-rtTA/TWNT mice during chronic Dox treatment induced
widespread mammary hyperplasia that progressed to yield mammary tumors which arise
stochastically after several months. Notably, mammary tumors generated in this manner are
Dox-dependent since Dox-withdrawal results in the abrogation of Wnt1 expression and
tumor regression. Regressed tumors leave behind clinically undetectable MRD lesions that
retain latent malignant potential. Consistent with MRD harboring dormant mammary cancer,
these lesions serve as a source of spontaneous Dox-independent tumor relapse during
extended Dox-withdrawal [174]. Moreover, MRD lesions rapidly regrow into measureable
tumors following the readministration of Dox (Figure 5.1B) [174]. The transgene
combination MMTV-rtTA/TWNT/TGFP is designed to permit H2B-eGFP labeling of
hyperplastic mammary ducts and growing mammary tumors. As the H2B-eGFP and Wnt1
transgenes are co-regulated, Dox-dependent H2B-eGFP labeling of tumor cells should cease
coincident with oncogene withdrawal. As such, only those tumor cells residing in MRD that
cycle infrequently should retain bright H2B-eGFP label during extended Dox-withdrawal.
Two possible models for the maintenance of MRD lesions exist and are depicted in
Figure 5.2. According to the first model, MRD lesions are maintained in a dormant state
through a dynamic equilibrium. Here, the malignant cells comprising the lesion proliferate,
but total lesion size is maintained through roughly equal rates of cell death. According to the
second model, the tumor cells contained within the dormant lesion are themselves maintained
in a dormant state; that is they are relatively slow cycling. We have utilized the H2B-eGFP
labeling system to analyze the cycling status of the cells within the MRD lesions to
distinguish between these two models. If the cells of the MRD are in a state of dynamic
103
equilibrium, very little GFP fluorescence should be detectable following a period of washout
as the cellular divisions will have diluted any H2B-eGFP. However, if MRD are maintained
by cellular dormancy, a large fraction of the epithelial cells composing the lesion will retain
bright H2B-eGFP signal due to their relatively low rates of proliferation.
5.3 Doxycycline-dependent Labeling of Inducible Mammary Tumors
In order to H2B-eGFP label reversible mammary tumors, a cohort of tritransgenic
MMTV-rtTA/TGFP/TWNT mice were subjected to chronic Dox treatment to inducibly co-
express the H2B-eGFP and Wnt1 transgenes. Mice developed mammary tumors that were
labeled with bright GFP fluorescence throughout the luminal compartment. In some cases,
animals were given a single dose of MNU in order to accelerate mammary tumorigenesis and
increase mammary tumor multiplicity. As shown in Figure 5.3A, GFP signal was visible in
on Dox biopsy derived gross tumor fragments and in sections imaged by Confocal
microscopy. Confocal sections demonstrate the localization of GFP-positive nuclei along
the inner surfaces of mammary ducts. In addition to imaging studies, single cells isolated
from pulse-labeled mammary tumors analyzed by flow cytometry showed GFP fluorescent
signal (Figure 5.3B). A significant proportion of cells were GFPbright
with some tumors
exhibiting nearly 90% GFP-positive cells in the analyzed sample.
Unexpectedly, though the majority of tumors contained a subset of tumor cells labeled
with eGFP, the percent of tumor cells labeled with H2B-eGFP during Dox pulse varied
widely as depicted in Figure 5.3C. The percentage of cells labeled ranged from 0 -88% GFP-
positive. Nearly half of the tumors (10/22) that displayed any GFP fluorescence by flow
cytometric analysis contained 50% or greater GFP-positive cells. GFP signal intensity of the
fluorescing GFPbright
cells was similar between labeled tumors with differences in GFP-
104
positive proportions resulting from decreased numbers of nuclei containing any detectable
label. This extensive variability in tumor behavior is illustrated again in the single parameter
plots depicted below the bar graph. Representative plots of GFP signal intensity from non-
labeling, labeling, and extensively labeling mammary tumors show the range of GFP
fluorescence induced by Dox stimulation.
5.4 MRD Retain Bright H2B-eGFP Label Following Tumor Regression
To test the models of maintenance of MRD lesions in the mammary gland, mice bearing
biopsy confirmed GFP labeled mammary tumors were subjected to Dox withdrawal to cause
the regression of mammary tumors. Tritransgenic mice were maintained off Dox for a period
of 6-8 weeks in order to allow complete tumor regression. Following this Dox-withdrawal,
animals were necropsied and MRD lesions were harvested along with normal surrounding
mammary tissue from non-tumor bearing mammary glands. We analyzed these samples first
by imaging mammary gland whole-mounts by wide-field fluorescence microscopy.
Subsequently, MRD lesions were processed to generate either tissue sections (for analysis by
Confocal microscopy) or single cell suspensions (for analysis by flow cytometry). MRD
lesions typically were only several mm in diameter, and thus too small to be divided for both
types of analysis.
In order to visualize GFP label retention, mammary glands harboring dormant
malignancies were digitally imaged using appropriate illumination to excite the GFP fusion
protein. As seen in Figure 5.4A, MRD lesions are identifiable in whole mounted mammary
glands by their darkened appearance. Some MRD lesions retaining bright GFP signal
following weeks of off-Dox washout were imaged to demonstrate GFP label retention within
the lesion. A non-tumor bearing mammary gland collected from the same mouse is also
105
shown to compare the lack of H2B-eGFP fluorescence visible in the normal mammary tissue.
Subsequent Confocal microscopy of frozen sections from pulse-chased MRD lesions
counterstained with Hoechst confirmed the typical appearance of MRD lesions composed of
typical looking ductal structures organized in a densely branching cluster. These ducts were
brightly labeled with H2B-eGFP within the luminal layer and were surrounded by GFP-
negative elongated nuclei typical of myoepithelial cells.
The presence of brightly GFP positive cells following the extensive remodeling of the
MECs during tumor regression is consistent with a model of cellular dormancy for the
maintenance of MRD lesions in the mammary gland and in order to quantify H2B-eGFP
label retention at the cellular level we analyzed single cells isolated from MRD lesions by
flow cytometry. A single representative example of GFP single parameter data obtained of
an MRD retaining H2B-eGFPbright
cells following regression by this analysis is depicted in
Figure 5.4B. As pulse-labeled tumors varied in the intensity of GFP label incorporation
MRD lesions also exhibit a wide range of label retained within the cells. Figure 5.4C
matches the on Dox tumor biopsy and post-washout MRD necropsy data from a panel of
tumors. Tumors generally had higher fluorescence than their regressed counterparts probably
due to the extensive remodeling and cell death associated with tumor regression. Some
MRD lesions did retain substantial levels of H2B-eGFP fluorescence with many brightly
labeled cells remaining even following periods of weeks of Dox withdrawal suggesting that
cellular dormancy may be responsible for tumor dormancy in a subset of the tumors studied.
However, many MRD lesions retain only a small population of H2B-eGFP labeled cells
following Dox withdrawal.
106
The labeling retained in MRD lesions following weeks of Dox-withdrawal is
particularly notable when compared to the washout observed in Dox-independent recurrent
tumors from MMTV-rtTA/TWNT/TGFP and in Dox-withdrawn MMTV-rtTA/MMTV-
wnt1/TGFP tumors. In these settings, continued proliferation of tumor cells rapidly dilutes
H2B-eGFP fluorescence. In constitutive Wnt1 tumors, little GFP fluorescence is detectable
even after substantially shorter periods of Dox-withdrawal (see Fig 4.9 and 4.10/ Figure
5.4D). Tumors from MMTV-rtTA/TWNT/TGFP mice that, though initially labeled with
H2B-eGFP, recurred off Dox also had very little residual H2B-eGFP fluorescence detectable
at necropsy (Figure 5.4D). The maintenance of GFP fluorescence in some MRD lesions
following the extended period of Dox withdrawal, particularly in comparison to the rapid
washout of signal in proliferative cell populations, suggests the possibility of cellular
dormancy as the method of label retention in MRD and potentially explains the maintenance
of dormancy of a subset of MRD lesions.
An interesting comparison to the label retained in MRD lesions is that seen in
surrounding regressed hyperplasia, the normal appearing ducts surrounding the MRD lesion
that do not derive from the mammary tumor. These areas are subject to the normal cycles of
proliferation driven by ovarian hormones. In Figure 5.5, representative sections of tumor
biopsy, and both MRD and regressed hyperplasia harvested at necropsy show varied levels of
H2B-eGFP label retention. Cells within some MRD lesions retained higher levels of H2B-
eGFP signal than those in the surrounding mammary epithelium as seen in 3 of the 6 sample
sets examined by flow cytometry (Figure 5.5B). One additional tumor set showed very
similar levels of label retention in the MRD and surrounding normal tissue, while the
remaining two pairs had higher percentages of label retaining GFP positive cells in the
107
regressed hyperplasia than in the MRD lesion. Figure 5.6 depicts the matched single
parameter GFP plots for single cells isolated from the primary tumor, regressed tumor, and
regressed hyperplasia. GFP intensity was reduced in both regressed hyperplasia and MRD
lesions when compared to pulse-labeled mammary tumor due to infrequent cell divisions,
however in contrast to the washout seen in non-oncogene induced mice (Figure 3.10) GFP
fluorescence is maintained at a higher level with a larger proportion remaining GFP positive.
The variability in MRD label retention, particularly in comparison to the surrounding normal
mammary epithelium, suggests that independent mammary tumors may have distinct
pathways and mechanisms that result in tumor dormancy. However, in a subset of sample
sets, the MRD lesions have substantially higher levels of H2B-eGFP labeling implying a
relatively lower level of cellular proliferation than in the surrounding mammary ducts.
5.5 Discussion
The use of inducible H2B-eGFP labeling of reversible mammary tumors allows the study
of proliferation dynamics within regressed mammary tumors. A population of label retaining
cells is maintained in a subset of the regressed mammary tumors and these cells possible
contribute to the recurrence of mammary tumors as MRD lesions give rise to mammary
tumors rapidly following readministration of Dox. Though it is probable that the cells
comprising the MRD lesion contribute to relapsed mammary tumors they potentially are
maintained in the regressed lesion through alternate mechanisms that would preclude their
contributing to recurrent tumor growth such as senescence or cell death. As MRD lesions
appear stable over extended periods and can be reinsured by Dox stimulation, it appears
unlikely that the cells within these lesions are in fact irreversibly impeded from division.
While specific analysis of LRCs obtained from MRD has not been completed, we have
108
examined the proliferative capacity of MECs isolated from MRD in 3D culture with Matrigel
and seen growth both in the presence and absence of Dox stimulations. This suggests that
these cells are not maintained due to senescence and are in fact viable.
The maintenance of these lesions appears to be driven by cellular dormancy in a subset of
cases as long term off-Dox chased MRD lesions retain brightly labeled nuclei in different
proportions. The identification of a dormant cell population within dormant malignancies
provides a clinical target for the development of follow-up strategies to ensure duration of
effective cancer treatments. Characterization of the mechanisms driving cellular dormancy
within residual disease also provides an interesting avenue for the chronic maintenance of
remission. If dormant malignancies can be forced to remain in the dormant state by external
means it may result in extension of remission periods. By identifying a dormant population
within MRD lesions a specific population possibly responsible for the dormant malignancy
and its capacity for recurrence can be studied.
The cancer stem cell theory has been proposed as a model for the driving force behind
tumorigenesis [197]. In this model, a small population of relatively infrequently cycling cells
gives rise to all other cells within the tumor. It is tempting to propose that the cells
comprising the MRD lesions are in fact a stem cell-like pool simply awaiting reactivation to
regenerate the tumor. Previous work has shown that cells in the MRD retain the ability to
give rise to a functional mammary ductal tree but still retain the latent malignancy and can
rapidly re-establish mammary tumors and so have some normal mammary epithelial stem
cell properties [174]. If some MRD lesions are in fact composed of cancer stem cells they
additionally provide an enriched source of these cells for study. Identification of particular
susceptibilities of these populations would possibly have repercussions in the development of
109
treatment strategies not just of residual disease but of growing tumors as well. Isolation of
single label retaining and non-label retaining cells from residual lesions, followed by
implantation into the cleared fat pads would provide an avenue to investigate the capabilities
of LRCs from MRDs and into the possible links between normal and cancer stem cells
within the mammary gland. Preliminary characterization of isolated LRCs could also be
achieved in culture studies with or without extracellular matrix (Matrigel) and examining the
role of hormonal regulation on the maintenance of cellular quiescence.
While this study provides evidence supporting a model of cellular dormancy for the
maintenance of residual disease it does not exclude a role for immune surveillance or other
means of maintenance of dynamic equilibrium for the continuation of tumor dormancy. It is
likely that a combination of factors preserve tumor dormancy and that the accumulation of
multiple insults is necessary to reactivate tumor growth. This study also investigated only
the contributions and patterns of proliferation in luminal cells within mammary tumors and
MRD lesions. Similar work utilizing the basal-specific promoter K5 activation of H2B-
eGFP would provide an interesting counterpoint to the data collected for the luminal layer
and would provide insight into the role of basal cells in the maintenance of tumor dormancy
and in tumor reinitiation however would be confounded by the alteration of oncogene
expression pattern necessarily resulting from the change in transactivator.
Additional complications barring the extension of this method derive from the signal
variability seen in mammary tumors. Particularly, while a subset of the samples in this study
appear to behave in a manner consistent with cellular dormancy as the mechanism for the
maintenance of tumor dormancy, several MRD lesions did not conform to this model. It is
probable that independently derived mammary tumors accumulate distinct genetic mutations
110
that result in different behaviors in both the primary tumor and in the resulting MRD lesions.
Genetic diversity in MMTV-Wnt1 induced tumors is common, primarily due to the reliance
on multiple mutations to transform initiated MECs. These additional mutations confer
distinct characteristics into each mammary tumor. For example, we have previously
demonstrated that a subset of MMTV-rtTA/TWNT derived tumors will spontaneously recur
following Dox-withdrawal and it is possible that the MRD lesions in these cases are
maintained by other less efficient mechanisms [174, 192]. As variability is a key feature of
these mammary tumors, it is unsurprising that the resulting MRD lesions are also variable.
The extensive variability inherent in mammary tumors, and all cancers, limits the potential to
identify a single mechanism that affects all tumors. So, while it appears probable that some
MRD lesions are maintained by cellular dormancy, it is also possible that dynamic
equilibrium accounts for the maintenance of MRD in other cases.
The analysis of labeling and subsequent quantification of label retention was complicated
by the extensive variability seen in initial fluorescence. Variability in tumor fluorescence
may also be attributed to regional variation in tumor structure and sampling error in the
selection of fragments for flow cytometric analysis. Intratumoral variability is primarily due
to areas of necrosis and different proportions of luminal/basal tissue within in particular
samples. As basal tissue was unlabeled in these experiments but is collected identically and
indistinguishable by single-parameter flow cytometric analysis, sample fragments with
higher ratios of basal cells could alter the perception of GFP labeling and GFP label retained
following Dox-withdrawal. There was not a readily available method to select regions of
tumor for analysis based on appearance and in fact, the heterogeneity is not apparent until
H+E sections are visualized following fixation.
111
The variability of independent mammary tumors greatly complicated the study of the
mechanisms of MRD maintenance. Studies utilizing explants or implant surgical techniques
to amplify tumor fragments would provide larger pools of sibling tumors however several
attempts at propagating H2B-eGFP expressing tumors and MRD in this manner were
unsuccessful. This stumbling block was unexpected due to previously published work
demonstrating the capability of tumor fragments to proliferate following explant into
syngeneic hosts. Similarly, implanted fragments of MRD from non-TGFP mice have shown
successful outgrowth [174]. There is the potential that H2B-eGFP transgene interferes with
transplant studies thus blocking this method of increasing sample size. Potentially
overcoming this hurdle would allow several avenues of investigation to be pursued on
“identical” lesions and allow further characterization of the mechanisms involved in MRD
lesion maintenance. Specifically, amplified sample availability would allow simultaneous
flow cytometric analysis of H2B-eGFP fluorescence and cell cycle characteristics by
Pyronin/7AAD staining, histological examination, and for the culturing and expression
profiling of label retaining and unlabeled cell populations.
112
113
Figure 5.1 Strategy for the Concurrent Temporal Regulation of the H2B-eGFP and Tet-
op Wnt Transgenes Expression in Mammary Tumors and Minimal Residual Disease
Lesions.
A. Schematic of Transgenes Employed for Compartment Specific Expression . Transgenic
mice carrying the MMTV-rtTA transgene express the rtTA transcription factor in the luminal
mammary epithelium but do not express independently integrated responder transgenes
driven by minimal CMV promoters containing multimerized operator sequences. In the
presence of inducer, rtTA binds Dox and undergoes a conformational change that allows
recognition of Tet operator sequences and responder transgene activation. Transgenic lines
used in this study permit Dox regulated expression of the oncogene TWNT and the reporter
gene Histone H2B-eGFP fusion protein (TGFP line) in the luminal epithelium. B. Reversible
Expression of the TWNT Transgene Models the Formation of Minimal Residual Disease
Lesions. Bitransgenic (MMTV-rtTA/TWNT) mice subjected to Dox treatment stochastically
develop mammary tumors. Dox withdrawal causes these tumors to regress leaving behind
clinically undetectable dormant lesions referred to as minimal residual disease (MRD).
Readministration of Dox in the animals’ diet induces regrowth of the dormant lesion and
recurrence of the tumor.
114
Figure 5.2 Two Models for the Maintenance of Minimal Residual Disease Lesions.
This schematic depicts the patterns of labeling and washout of fluorescent label in a
mammary tumor during the formation and maintenance of a dormant lesion. Following Dox-
induced tumorigenesis and H2B-eGFP labeling of the mammary tumor removal of
doxycycline results in tumor regression. We have previously demonstrated that MRD can
remain dormant for extended periods of time and still retain latent malignancy. Two possible
models exist to explain the maintenance of minimal residual disease lesions following tumor
regression. The first model is one of Dynamic Equilibrium; that is that the cells comprising
the lesion are in fact cycling but equal rates of proliferation and cell death result in no net
growth of the lesion. In this model, few if any cells in the MRD lesion will retain bright
H2B-eGFP label following extended Dox withdrawal. Contrasting this model, it is possible
that dormant cells make up the lesion. In this case, non-cycling cells in the MRD would
retain bright H2B-eGFP signal even following an extended period of off-Dox chase.
115
Figure 5.3 Wide Variation in the Extent of H2B-eGFP Labeling of Luminal-Type
Tumor Cells in the MMTV-rtTA/TWNT/TGFP Model.
A. H2B-eGFP Fluorescence in Gross Mammary Tumors and Tumor Sections. The first panel
depicts a fragment of on Dox mammary tumor biopsy illuminated with light in the GFP
excitation wavelength showing widespread GFP fluorescence. The second image was
obtained via Confocal microscopy of a frozen section of pulse labeled mammary tumor
counterstained with Hoechst (Mag. 40X). B. Single Parameter Plot of Flow Cytometric
Detection of H2B-eGFP Signal. A representative single parameter plot demonstrating GFP
signal detected by flow cytometric analysis of single cells isolated from mammary tumor
biopsies of tritransgenic animals treated with Dox depicts GFP signal intensity of the tumor
cells shows two populations, a large GFP positive population with fluorescence greater than
102 (40.08%) and a GFP negative population. C. Flow Cytometric Detection of H2B-eGFP
Fluorescence in Mammary Tumors. Biopsy samples from 25 independent mammary tumors
treated with Dox were prepared as single cell suspensions and analyzed for GFP signal by
flow cytometry as shown in B. The chart in panel C demonstrates the range of signal
intensities observed by these analyses with each bar depicting a single mammary tumor.
Samples marked with stars are those tumors arising in mice treated with MNU.
116
117
Figure 5.4 Minimal Residual Disease Lesions Retain H2B-eGFP Signal Following
Tumor Regression.
Tritransgenic MMTV-rtTA/TWNT/TGFP mice placed on Dox develop mammary tumors.
These tumors can be brightly labeled with H2B-eGFP and subsequent removal of Dox results
in tumor regression and the formation of MRD lesions. A. Detection of GFP Signal in Gross
Mammary Tumor Fragments and MRD Lesions. The top left image in Panel A depicts a
fragment of on Dox mammary tumor biopsy illuminated under UV with widespread green
signal visible throughout the tumor. The right two images depict mammary gland whole
mounts obtained from a pulse then chase labeled tritransgenic animal and photographed
under UV illumination. The left whole mount contains an MRD lesion with visible GFP
signal (see lower left image for a larger view of the MRD) while the right whole mount
image shows a tumor-free mammary gland from the same animal. The non-tumor bearing
gland from the same animal at necropsy provides a comparison for the lack of fluorescence
seen in non-malignant tissue. B. H2B-eGFP Fluorescence in Tumor Sections and Single Cell
Preparations. Representative images obtained via Confocal microscopy of frozen sections of
a pulse labeled mammary tumor and of a pulse-chased MRD lesion counterstained with
Hoechst (Mag. 40X). Single parameter plots demonstrate flow cytometric analysis of single
cells isolated from mammary tumor biopsies and MRD lesions and provide a quantitative
assessment of GFP fluorescence in tumor cells and residual lesions. Residual lesions retain
bright GFP signal in a significant portion of their cells. Shown is a representative plot of
GFP signal intensity from single cells from a pulse-labeled mammary tumor and a
pulse/chase MRD lesion. C. Flow Cytometric Detection of H2B-eGFP in Mammary Tumors
and MRD Lesions. Graph depicts thirteen independent mammary tumor biopsy-necropsy
pairs that were analyzed for GFP signal intensity by flow cytometry. Blue bars depict the %
GFP positive cells detected in on Dox tumor biopsies. Magenta bars represent the percent
GFP positive cells in matched off Dox MRD lesions. A wide range of initial GFP labeling
present in on Dox tumor samples is again demonstrated in the range of GFP signal intensity
seen in the corresponding MRD lesions. While many MRD lesions maintained a large
proportion of cells with bright green signal even after 6-8 weeks off Dox, some samples
demonstrate greater washout of the GFP signal.
118
A.
B.
Figure 5.5 MRD Retain Greater Fluorescent Label than Surrounding Normal Ducts.
A. Imaging of Frozen Sections of Tumor, MRD, and Regressed Hyperplasia. Panel depicts
representative Confocal images obtained from frozen sections of Dox-treated mammary
tumor and post-Dox withdrawal MRD lesion and surrounding non-tumor ducts
counterstained with Hoechst (MAX Projections; Mag. 20X). MRD retain H2B-eGFP
labeling even following extended periods of chase and the extensive remodeling associated
with tumor regression. The relative quiescence of the cells of the MRD lesion is particularly
apparent when compared to the ducts in the surrounding normal tissue which only have
infrequent bright GFP labeled cells. B. Flow Cytometric Detection of H2B-eGFP
Fluorescence in Mammary Tumors, MRD Lesions, and Regressed Hyperplasia. The graph in
panel B summarizes GFP fluorescence results obtained by flow cytometry for 6 independent
matched sets of Dox-treated tumor biopsies and MRDs and Regressed
Hyperplasia/Mammary Gland harvested at necropsy following Dox-withdrawal.
119
120
Figure 5.6 Flow Cytometric Analysis of GFP Signal Intensity in Matched Tumor
Biopsy, MRD Lesions, and Regressed Hyperplasia.
Single parameter plots display the range of GFP signal detected in each sample and GFP-
positive percentages are listed in each plot and were determined using the bracketed area
depicted in the top panel of each column. Six matched sets of Dox-treated tumor biopsies,
and MRD lesions and Regressed Hyperplasia (normal ducts) following Dox-withdrawal were
prepared as single cell suspensions. These cells were analyzed by flow cytometry for H2B-
eGFP fluorescence. MRD lesions frequently retained bright GFP signal even following 6-8
weeks of chase. In particular, the samples in rows 1, 3, and 4 demonstrate greater retained
fluorescence in the MRD than in the surrounding normal mammary tissue (Regressed
Hyperplasia).
121
Chapter 6 A Transgenic Model for Short-Term Lineage Tracing of Mammary
Epithelial Cells in Pregnancy
6.1 Introduction
The changes in mammary gland structure that accompany pregnancy are vast and
rapidly expand the population of cells that compose the ductal tree. While the outcome of
these hormonally-mediated changes has been clearly described and many studies have
examined the regulation of growth during this phase, the precise cellular contributions to
growth and differentiation have not been clearly defined. The most widely held model
suggests that both cell layers within alveoli develop from a single cell or group of cells of
luminal origin (Figure 6.1). Here we adapt the H2B-eGFP labeling scheme utilized in the
previous chapters in order to examine the unique proliferation patterns and development of
the mammary gland during pregnancy. By pairing the H2B-eGFP reporter gene either
luminal or basal-specific MEC transactivators we tracked the proliferation of labeled cells in
each compartment throughout the rapid morphogenesis program that creates alveoli. Using
this method of short-term lineage tracking we identified cells of both luminal and basal origin
that contribute to lobuloalveolar outgrowths. Furthermore, we use the dilution of GFP signal
in dividing cells to show that the influx of MECs from each compartment during
alveologenesis involves proliferation and not merely MEC migration.
Having examined the proliferation and lineage patterns of mammary epithelial cells
during pregnancy, we then extended our studies to examine the remodeling of the mammary
gland during involution. Early first pregnancy has been shown to protect against breast
cancer in women but the exact mechanisms for this parity-related protection are unknown
(Figure 6.2). According to one proposed model, the widespread MEC loss incurred during
involution, by eliminating a large proportion of the MECs that exist during pregnancy,
122
deletes MECs containing pre-neoplastic mutations. Whether MECs from each compartment
persist through involution and contribute to the architecture of the parous gland remains
unknown, The work presented here provides a potential avenue for further study by
demonstrating the persistence of labeled cells from lactation through post-lactational
involution. The persistence of labeled cells from both cell layers following involution
suggests that MEC deletion, though widespread, is incomplete.
In order to examine the contributions of luminal and basal cells to the lobuloalveolar
outgrowths induced by pregnancy and hormonal stimulation and the persistence of cells
through involution we used the MMTV-rtTA and K5-rtTA transactivators to direct tetO-
driven H2B-eGFP labeling of luminal and basal MECs respectively as described in Chapter
3. We then performed pulse-chase labeling experiments during timed pregnancy, during
hormonal stimulation, and following pregnancy to track luminal and basal MEC fates during
MG morphogenesis and remodeling (Figure 6.3). We utilize the H2B-eGFP labeling scheme
to both trace cell layer of origin of the cells contributing to the alveolar outgrowths and to
assess the role of proliferation in the development of alveoli.
Our method of labeling cells in each compartment prior to the induction of
alveologenesis provides a unique manner of examining the contributions of each cell layer to
the completed lobuloalveoloar structure. As depicted in Figure 6.4, there are three possible
outcomes of each set of labeling experiments. Compartment labeled cells may contribute to
the same layer of the developing alveoli, to both cell layers of the alveoli, or may not
contribute at all. The current model of alveologenesis predicts a population of cells of
luminal origin that give rise to both luminal and basal layers of the lobuloalveolar outgrowths
induced during pregnancy and this outcome is highlighted in orange in Figure 6.4. We use
123
H2B-eGFP labeling to explore the contribution of luminal and basal cells to alveoli and to
verify that alveolar cells of each compartment in the alveolar structure result from cell
division and not migration.
6.2 Contributions of Mammary Epithelial Cell Sub-types to Lobulo-alveolar Outgrowths of
Pregnancy
As depicted in Figure 6.4, the exact contributions of each cell type to the
lobuloalveolar outgrowths induced during pregnancy are unclear. In these studies, we
examined luminal and basal specific labeling and washout of H2B-eGFP signal at mid-
pregnancy by inducing labeling prior to pregnancy and then allowing alveologenesis to occur
during chase. We utilize fluorescent imaging of mammary gland whole-mounts, flow
cytometric assessment of GFP fluorescence of individual cells isolated from mammary
glands, and Confocal imaging of Hoechst counterstained frozen sections to track and identify
labeled and label-retaining cells within the mammary ducts and alveolar outgrowths.
6.2.1 Tracing the Contributions of Luminal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Pregnancy
In order to track the contribution of the luminal lineage to alveoli we pulsed adult
virgin female bitransgenic MMTV-rtTA/TGFP mice with Dox prior to pregnancy. These
mice were then paired with breeder males and examined daily for vaginal plugs. At plug,
mice were subjected to Dox withdrawal and sacrificed at day 10.5 of pregnancy (Figure 6.3).
One inguinal mammary gland was prepared for whole mount imaging and the remaining
mammary tissue was digested to generate single cell suspensions for flow cytometric analysis
of GFP signal intensity. Control mammary gland samples were analyzed from d10.5
124
pregnant females that were either Dox-naïve or placed on Dox for 3 days prior to necropsy
(Pulse-only).
Examination of pulse-labeled whole-mounts by wide field microscopy showed
widespread H2B-eGFP labeling throughout the ductal structures and lobulo-alveolar
outgrowths, whereas Dox-naïve whole-mounts lacked detectable H2B-eGFP labeling as
expected (Figure 6.5). Mammary glands harvested under pulse-chase conditions contained
brightly labeled cells within the ducts of the mammary tree and additionally exhibited
dimmer GFP-positive nuclei within the lobulo-alveolar outgrowths.
To quantify washout in the mammary epithelium during pregnancy we analyzed
single cells isolated from experimental mice in all 3 groups. Pulse-labeled mice contained
40% of bright GFP positive nuclei while Dox-naïve MECs lacked detectable bright GFP
nuclei as depicted in Figure 6.5. In the setting of pulse-chase, MECs showed a wide range of
GFP signal intensity. Single parameter plots revealed populations of MECs clustered in
peaks corresponding to halving of GFP signal attributable to cell divisions.
Next, the mammary gland whole-mounts were processed to allow imaging of
Hoechst-counterstained frozen sections by Confocal fluorescent microscopy (Figure 6.6). In
these images, bright GFP signal is seen lining the ducts and along the inner surfaces of
alveolar structures of pulse-labeled mammary glands while no GFP positive nuclei were
visualize in Dox-untreated animals. Imaging of pulse-chased mammary glands showed GFP
positive nuclei lining the inner surfaces of mammary ducts and along the inner lining of
alveolar outgrowths confirming the contribution of luminal duct cells to the alveolar
outgrowths. These nuclei were generally less bright than those found in on Dox animals
however occasional bright GFP nuclei were observed. In particular, GFP positive nuclei
125
within the lobulo-alveolar outgrowths were dimmer than those observed within the
surrounding ducts.
Taken together, our imaging studies and flow cytometry analysis provide compelling
evidence that the proliferating progeny of luminal MECs contribute to alveolar outgrowths.
Decreased H2B-eGFP signal intensity within the outgrowths suggests cellular proliferation of
an initially labeled luminal population drives formation of lobulo-alveolar growths. As we
have previously demonstrated the proliferation dependent washout of H2B-eGFP labeling in
the mammary gland, the presence of cells with decreased GFP signal in the alveolar
outgrowths supports a proliferative rather than migratory origin of these cells. If luminal
labeled ductal cells migrated outward to form the bulk of the alveolar cells than similar
intensity of fluorescence between ductal and alveolar cells would be visible. Strengthening
this conclusion, by pairing the finer resolution of GFP signal intensity obtained by flow
cytometric analysis with the location identifying analysis obtained by microscopic imaging
we confirm cells with decreased overall GFP intensity and can propose that they are the
dimmer labeled cells that compose the alveolar outgrowths.
6.2.2 Tracing the Contributions of Basal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Pregnancy
In order to examine the role of basal cells in the development of alveolar outgrowths
we placed adult virgin female bitransgenic K5-rtTA/TGFP mice on Dox prior to pregnancy.
These mice were then paired with breeder males and examined daily for vaginal plugs. At
plug, mice were subjected to Dox withdrawal and sacrificed at d10.5 of pregnancy (Figure
6.3). Following this 10-day chase period, animals were sacrificed and mammary tissue was
harvested. One inguinal mammary gland was prepared for whole mount imaging and the
126
remaining mammary tissue was digested to generate single cell suspensions for flow
cytometric analysis of GFP signal intensity. In addition we prepared samples from
bitransgenic d10.5 pregnant Dox-naïve and on Dox for 3 days prior to necropsy to provide
control comparisons.
Mimicking the strategy followed in the preceding section, we imaged mammary
gland whole mounts obtained from Dox-naïve, Pulse labeled, and pulse-chased bitransgenic
mice by wide field microscopy. All whole mounts obtained from d10.5 mice demonstrated
lobulo-alveolar outgrowths typical of mid-pregnancy as expected. In Dox untreated animals
no GFP fluorescence was detectable. In animals receiving doxycycline, widespread labeling
of the ductal tree was visible with green fluorescence also detectable in the developing
alveoli (Figure 6.7). Mammary whole-mounts that had been pulse labeled and then subjected
to Dox-withdrawal had bright GFP labeling within the ducts with dimmer GFP signal
apparent in the surrounding outgrowths induced by the hormones of pregnancy. Further
analysis of mammary epithelial cells isolated from experimental animals in this group by
flow cytometry confirmed the impressions gathered from microscopic examinations (Figure
6.7). Additionally, flow cytometric analysis of GFP signal intensity of these mammary
epithelial cells showed a range of GFP brightness suggestive of cellular division mediated
dilution of H2B-eGFP signal.
In order to confirm the presence of GFP label-retaining cells in lobuloalveolar
outgrowths, whole-mounts were frozen sectioned and Hoechst counterstained and imaged by
Confocal microscopy (Figure 6.8). Sections studied in this manner reaffirmed the
impressions obtained during the examination of mammary gland whole mounts with Dox-
naïve animals lacking detectable GFP signal while pulse labeled animals demonstrated
127
widespread bright GFP labeled nuclei with the typical elongated-shape nuclei. Pulse-chased
samples showed bright GFP label within a portion of the cells lining the outer surfaces of the
mammary ducts and contained dimmer GFP positive cells within the alveolar outgrowths.
Our preliminary conclusion based on these images is that the GFP label-retaining cells are
localized along the outer layer of the lobuloalveolar outgrowths but without further
characterization of the location we cannot confirm this supposition. In stark contrast to the
current model of alveologenesis, which does not define a contribution of basal cells to the
alveolar structures, we demonstrate a clear contribution of basal-derived cells within the
lobulo-alveolar outgrowths.
6.3 Contributions of Mammary Epithelial Cell Sub-types to Lobulo-alveolar Outgrowths
Induced by Hormone Stimulation
With evidence in hand that both luminal and basal MECs contribute to lobuloalveolar
outgrowths during pregnancy, we next traced MEC lineages when lobuloalveolar
development was triggered using exogenous hormones. This strategy allowed precise timing
the onset of alveologenesis and circumvented pregnancy losses encountered during timed
pregnancy experiments (see Methods, Chapter 2). Furthermore, this hormone-induction
strategy sets the stage for dissecting the contribution of individual hormones to MEC
proliferation during lobuloalveolar development. Similar to the studies involving pregnant
animals we utilized adult virgin female bitransgenic (MMTV-rtTA/TGFP or K5-rtTA/TGFP)
animals to induce compartment specific labeling of the mammary gland prior to
administration of estrogen and progesterone (E+P) pellets. Subcutaneous insertion of time-
release hormone pellets occurred simultaneous to the excisional biopsy of a single inguinal
mammary gland. Implantation of E+P pellets results in lobulo-alveolar differentiation within
128
the mammary gland [189, 198]. In order to capture label-retaining cells within this
experimental strategy, mice were harvested 7 days following pellet implantation. Though
this period of off-Dox washout was shorter than previously preformed ample lobulo-alveolar
outgrowths were present.
6.3.1 Tracing the Contributions of Luminal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Hormone Induced Proliferation and Differentiation
In order to verify the patterns of labeling and label retention seen in pregnant mice
following luminal compartment restricted labeling, we induced MMTV-rtTA/TGFP animals
with Dox for 4 days. Animals were then subjected to excisional biopsy of a single inguinal
mammary gland and implantation of E+P pellets at the site of mammary gland biopsy, and
removed from Dox post-operatively. Pulse-only controls were placed on Dox at the time of
pellet implant and followed for 7 days prior to necropsy.
In order to confirm labeling of the mammary gland during Pulse, whole mounted
mammary glands taken at the time of biopsy were examined by wide-field fluorescence
microscopy (Figure 6.9). Pulse labeled biopsy samples taken at the time of E+P pellet
implant were brightly labeled as well but lacked the hallmarks of lobuloalveolar development
as was expected as they were not hormonally induced. Though lacking exogenous hormonal
stimulation, mammary cells were still subject to the normal hormonal cycles associated with
estrus in the mouse and the resultant transient proliferation and minimal differentiation and
therefore there was variability in the appearance of the ductal tree even during Dox pulse
prior to hormone implant.
Mammary gland whole mounts imaged by wide field fluorescence microscopy
demonstrated widespread lobulo-alveolar outgrowths that were brightly labeled in mice on
129
Dox concurrent with E+P induction (Figure 6.9). In animals removed from Dox at the time
of pellet implantation widespread alveolar development is apparent in fluorescent imaged
mammary gland whole mounts with GFP signal visible both within the ducts and lobulo-
alveolar outgrowths. Flow cytometric assessment of GFP signal intensity in single cells
isolated from mammary tissue confirms both the large proportion of bright GFP labeled cells
during Dox pulse/hormone inductions but also the presence of label retaining cells following
off-Dox chase in hormone pellet implanted animals (Figure 6.9). The GFP single parameter
plots of pulse-chased MECs particularly demonstrates the saw-tooth pattern indicative of
successive rounds of cell division resulting in dilution of H2B-eGFP signal in the chromatin
among daughter cells. Further investigation into the localization of GFP label retaining cells
by Confocal imaging shows the widespread maintenance of labeling within the luminal layer
of the ducts and shows many GFP positive nuclei lining the inner surfaces of the developing
alveoli (Figure 6.10). Though exhaustive characterization of the localization of GFP label
retaining cells in these sections has not been preformed it appears that cells of the luminal
layer contribute primarily if not exclusively to the luminal layer of the lobulo-alveolar
outgrowths.
6.3.2 Tracing the Contributions of Basal Mammary Epithelial Cells to Lobulo-alveolar
Outgrowths During Hormone Induced Proliferation and Differentiation
To confirm the lineage tracing results of basal cells seen in pregnant animals we pulse
and pulse-chase labeled bitransgenic (K5-rtTA/TGFP) adult virgin females with E+P
hormone pellet implants. Mammary gland biopsies were obtained following pulse, at the
time of hormone pellet implant. Whole mount images of pulse labeled bitransgenic
mammary glands following hormone pellet induction show widespread labeling throughout
130
the ducts with scattered labeling within the alveolar outgrowths, as expected in the alveoli
due to the net like arrangement of myoepithelial cells surrounding the expanding outgrowths
(Figure 6.11). In hormone induced pulse-chased mammary glands, GFP positive nuclei are
visible throughout the ductal structures. Flow cytometric plots depicting GFP signal
intensity of single cells isolated from pulse and pulse-chased hormone implanted animals
show the expected patterns of GFP signal intensity (Figure 6.11). Pulse labeled animals
show a large proportion of cells with bright H2B-eGFP fluorescence while pulse-chased
MECs have a range of GFP signal intensity but are generally dimmer than that seen in on
Dox animals. Confocal projections collected from frozen sections reaffirm the presence of
GFP label-retaining cells within the ducts and in lobulo-alveolar outgrowths (Figure 6.12).
Cells within the outlying growths are generally dimmer than those seen in the central ducts
reconfirming their derivation from initially labeled cells by cell divisions. The GFP positive
cells seen within the lobulo-alveolar outgrowths appear to be restricted to the outer surfaces
but exhaustive characterization would be required to exclude the presence of basal derived
cells within the luminal cell layer within alveoli. The repeated identification of basal-derived
MECs within hormone induced lobulo-alveolar outgrowths supports the assertion that both
luminal and basal MECs play a role in the development of pregnancy induced growth and
differentiation.
6.4 Persistence of Labeled Cells Through Post-Lactational Remodeling of the Mammary
Gland
The rapid proliferation and differentiation of MECs during pregnancy drives the
creation of secretory units specialized for lactation. However, following weaning, these
cellular structures are no longer needed and are deleted from the mammary gland via
131
involution. During this post-lactational remodeling, the mammary gland sheds its extensive
lobulo-alveolar outgrowths, restoring the mammary ductal tree to a virgin-like state (Figure
6.3). The exact patterns of cellular remodeling that result in the restructuring of the ductal
tree have not been elucidated. Here, we adapt the inducible H2B-eGFP labeling strategy to
allow tracing of cells through involution. By inducing labeling during pregnancy and early
lactation and then searching for label retaining cells following an extended chase period
concurrent with involution we can begin to track cell fates through post-lactational
remodeling and perhaps provide insight into the modalities of parity-related breast cancer
protection.
6.4.1 Luminal Labeled Mammary Epithelial Cells Persist Through Involution
In order to assess the retention of luminal cells through involution, MMTV-
rtTA/TGFP bitransgenic timed-pregnant mice were subjected to timed pregnancies and
placed on Dox 4 days prior to parturition in order to induce widespread labeling of luminal
MECs. Following birth, pups were removed and dams were subjected to excisional
mammary gland biopsy. Post-operatively, mice were subjected to Dox withdrawal during a
period of involution. At the conclusion of this 4-week chase, mice were sacrificed and the
remaining mammary tissue harvested. Control mice followed an identical time-line but were
maintained Dox-naïve throughout the experiment (Figure 6.3).
Figure 6.13 demonstrates the Dox-dependence of labeling during lactation. Both
whole mount images obtained by conventional fluorescence microscopy and Confocal
imaging of frozen sections derived from pulse-labeled biopsy mammary gland samples
demonstrate widespread H2B-eGFP labeling throughout the ducts and alveoli. In the Dox-
naïve animal, while green fluorescence is visible in the whole mount, subsequent Confocal
132
imaging fails to detect the presence of any GFP positive nuclei. The green color seen in the
whole mount image is likely auto-fluorescence due to milk as the non-specific illumination is
seen in other color channels.
Having confirmed Dox-dependent regulation of H2B-eGFP transgene expression
during lactation we sought to track the persistence of luminal MECs through the remodeling
of the mammary gland during lactation. Pulse-labeled mice were removed from Dox
following delivery of pups and allowed to proceed through involution for 4 weeks and then
sacrificed. Whole mount imaging of these samples was hampered by the greatly decreased
signal intensity of the remaining H2B-eGFP signal that persisted over the extended period of
washout combined with the brighter autofluorescence seen in involuted mammary glands
(Figure 6.14). Subsequent imaging of frozen sections obtained from those whole mounts
provided clear images of GFP positive label retaining cells within the inner layers of the
involuted ducts while none was seen in glands harvested from untreated animals. Flow
cytometric analysis of single cells isolated from Dox-untreated animals did not identify GFP
positive nuclei. However, analysis of MECs from pulse-chased labeled mammary glands did
identify a number of GFP positive cells within a wide range of signal intensity. Peaks
depicting the rounds of cellular proliferation that occurred during the period of chase also
suggest that maintained cells play a role in driving the development of the restructured
mammary epithelial tree.
6.4.2 Basal Labeled Mammary Epithelial Cells Persist Through Involution
In order to assess the retention of basal cells through involution, MMTV-rtTA/TGFP
bitransgenic timed-pregnant mice were subjected to timed pregnancies and placed on Dox 4
days prior to parturition in order to induce widespread labeling of basal MECs. Following
133
birth, pups were removed and dams were subjected to excisional mammary gland biopsy.
Post-operatively, mice were subjected to Dox withdrawal during a period of involution. At
the conclusion of this 4-week chase, mice were sacrificed and the remaining mammary tissue
harvested. Control mice followed an identical time-line but were maintained Dox-naïve
throughout the experiment (Figure 6.3).
Figure 6.15 demonstrates the Dox-dependence of labeling during lactation. Both
whole mount images obtained by conventional fluorescence microscopy and Confocal
imaging of frozen sections derived from pulse-labeled biopsy mammary gland samples
demonstrate widespread H2B-eGFP labeling throughout the ducts and alveoli. Fluorescent
nuclei appear in a scattered pattern around the outside of alveolar structures as expected due
to the discontinuous myoepithelial layer already characterized in alveoli [10, 41, 199]. In the
Dox-naïve animal, while green fluorescence is visible in the whole mount, subsequent
Confocal imaging fails to detect the presence of any GFP positive nuclei. The green color
seen in the whole mount image is likely auto-fluorescence due to milk as the non-specific
illumination is seen in other color channels and does not have the concentrated nuclear
appearance of H2B-eGFP fluorescence.
Having confirmed Dox-dependent regulation of H2B-eGFP transgene expression
during lactation we sought to track the persistence of basal MECs through the remodeling of
the mammary gland during lactation. Pulse-labeled mice were removed from Dox following
delivery of pups and allowed to proceed through involution for 4 weeks and then sacrificed.
Repeating the situation seen in luminal-labeled glands, whole mount imaging of these
samples was hampered by the greatly decreased signal intensity of the remaining H2B-eGFP
signal that persisted over the extended period of washout combined with the brighter
134
autofluorescence seen in involuted mammary glands (Figure 6.16). Subsequent imaging of
frozen sections obtained from those whole mounts provided clear images of GFP positive
label retaining cells within the involuted ducts while none was seen in glands harvested from
untreated animals. Flow cytometric analysis of single cells isolated from Dox-untreated
animals did not identify GFP positive nuclei however; analysis of MECs from labeled and
chased mammary glands did identify a number of GFP positive cells within a wide range of
signal intensity. Peaks depicting the rounds of cellular proliferation that occurred during the
period of chase also suggest that maintained cells play a role in driving the development of
the restructured mammary epithelial tree.
6.5 Discussion
By tracing the lineage of luminal and basal epithelial cells during pregnancy and
hormone-induced lobulo-alveolar differentiation we provide evidence supporting the role of
both luminal and basal type MECs in the development of alveolar outgrowths. Our findings
contrast with the existing model in which a progenitor cell of luminal origin gives rise to both
luminal and basal cells in the alveoli. This finding also helps provide a clarification in the
hierarchy of mammary epithelial cell (Figure 6.17).
The work begun on pregnant animals here also offers the possibility of study during
different phases of pregnancy and lactation to help identify the particular contributions of
each cell type to alveologenesis and lactation. The characterization of the specific cell
populations within each cell layer that give rise to the alveolar outgrowths and the regulation
of these progenitor populations would offer insight into the maintenance of a maintained
adult stem cell-like population in the mammary gland. Considering that the plasticity of
135
MECs has been noted to play a role in the development of mammary cancers and the alveolar
progenitor populations may have the ability to proliferate and differentiate in a distinct
manner than the bulk cells of the mammary duct, the potential exists that alveolar progenitors
may be cells of origin for some breast cancers [89]. It is also possible that identifying the
precise capacities of luminal and basal epithelial cells following hormone stimulation may
shed light onto the capacities of normal and transformed MECs. By further elucidating the
precise hierarchy of MECs during development potential cell of origin effects of particular
mutations on ultimate tumor subtype may be better understood and more precise and
efficacious treatments for the particular lineage and mutation history can be developed [90].
Capitalizing on the use of exogenous hormonal stimulation to drive the formation of
lobulo-alveolar outgrowths in the mammary gland by providing a basis for the study of single
hormone effects may possibly elucidate the roles of individual hormones on the regulation of
proliferation or MEC subtypes during pregnancy. The ability to experimentally manipulate
the developmental state of the mammary gland and the capacity to induce labeling in viable
cells of both epithelial cell types offers a method to identify cell population subsets based on
additional distinct characteristics. This additional characterization may help further clarify
the precise signals required for the induction of alveolar progenitor populations.
This investigation also begins to shed light on the interesting phenomenon of parity-
related protection from breast cancer. While it has been recognized that a full-term
pregnancy early in life offers significant protection against breast cancer, no model has been
identified that explains the precise cause of that protection [106-110]. It has been suggested
that the overarching remodeling of the mammary ductal tree during involution results in the
elimination of the majority of cells present prior to involution and therefore any pre-
136
neoplastic cells are lost [106, 107]. While the work presented here does not explain parity
related breast cancer, it provides an initial glimpse into the possible explanations by
eliminating complete reconstruction of the mammary gland as a method of removal of pre-
neoplastic cells. It is possible that involution processes somehow select particular cells for
elimination but a sizeable proportion of the cells composing the remodeled duct contained
H2B-eGFP suggesting that many cells are retained though post-lactational remodeling.
Interestingly, others have reported a cell type that is present in the mammary gland
following a round of pregnancy that is hormone responsive and preserved through involution.
They have termed these as “parity-induced” cells and they have been demonstrated to self-
renew and give rise to both ductal and alveolar outgrowths and carry an immunophenotype
consistent with the population of MECs containing the stem cell population [200, 201].
These cells have also been shown to be targets for MMTV-neu driven tumorigenesis in
parous mice [176]. Additionally, some of the more common strains of laboratory mouse are
frequently unable to nurse their first litter though subsequent litters are maintained without
issue. It is apparent that some changes in the composition of the mammary ductal tree occur
following pregnancy and perhaps altered H2B-eGFP labeling schemes would help tease out
the populations supporting these changes.
137
Figure 6.1 A Model of Alveolar Progenitors.
A schematic depiction of the commonly held model of mammary alveologenesis. This
model proposes that during pregnancy a single cell (or group of cells) of luminal origin gives
rise to the complete lobulo-alveolar outgrowth consisting of both luminal and myoepithelial
cell layers.
138
Figure 6.2 Parity-Related Protection from Breast Cancer.
A schematic depiction of the potential avenues of parity related protection from breast
cancer. Early first full term pregnancy offers protection from development of breast cancer in
women. The exact processes that provide this protection are unclear. It is possible that the
wholesale remodeling of the mammary ductal tree during post-lactational involution removes
pre-neoplastic cells and thereby limits the presence of transformed cells within the mammary
epithelium.
139
Figure 6.3 Experimental Timelines For the Investigation of Cell Fates During
Pregnancy.
The images at the top are representative whole mount images depicting whole mount
mammary glands stained with Carmine stain and imaged by brightfield microscopy. Three
independent time courses were followed to obtain the data depicted in this chapter and to
allow lineage tracing in the mammary gland during pregnancy. Experimental protocols were
as follows: The Mid-pregnancy group was placed on Dox diet simultaneous to their breeding
and removed from Dox when pregnancy was initiated by identification of a plug. They were
maintained in Dox-withdrawal for 10 days until mid-pregnancy d10.5 and subjected to
necropsy and mammary gland harvest. In the hormone induction group, adult virgin females
were treated with Dox for 4 days. These animals were then subjected to biopsy of a single
mammary gland and subcutaneous implanting of time-released estrogen and progesterone
pellets and removed from Dox. They were maintained off Dox for 7 days prior to necropsy
and harvesting of mammary tissue. The final experimental group consisted of adult females
bred off Dox. Timed pregnant animals were placed on Dox 4 days prior to parturition. Both
Dox and pups were removed following delivery and the animals were maintained off Dox for
4 weeks in order to allow for involution to occur.
140
141
Figure 6.4 Schematic Depictions of Potential Outcomes of Lineage Tracing During
Alveologenesis.
This diagram depicts the possible outcomes for label tracking through lobulo-alveolar
development. The current models of lobulo-alveolar development propose that a single cell
population of luminal origin is responsible for both the luminal and myoepithelial layers of
the outgrowths with no contribution from the original basal layer. Inducible H2B-eGFP
labeling prior to pregnancy followed by chase allows the short-term tracing of lineage during
pregnancy induced growth and differentiation. Indicated in orange are the currently held
models for the contributions of luminal and basal cells to pregnancy induced lobulo-alveolar
development. Briefly, potential outcomes include; cells from each cell layer may contribute
exclusively to their layer of origin, to both cell layers of alveoli, or may not contribute to the
differentiated structure.
142
Figure 6.5 H2B-eGFP Labeling of Luminal Cells During Pregnancy in MMTV-rtTA/TGFP
Mice.
Representative single parameter flow cytometry plots for GFP fluorescence obtained by
analysis of single mammary epithelial cells isolated from adult d10.5 pregnant females with
or without Dox treatment as indicated are displayed in the first column. The second column
is composed of wide field fluorescence images (Mag. 10X) of whole-mount mammary
glands from the same mice. Pulse animals (n=2) were placed on Dox from d7.5 to d10.5 of
pregnancy. Dox-naive animals (n=2) were maintained without Dox prior to and during the
experiment. Pulse-chase animals (n=5) were bred on Dox and removed from Dox when a
plug was detected.
143
Figure 6.6 Luminal Cells Contribute to Lobulo-alveolar Outgrowths During Pregnancy.
A.H2B-eGFP Fluorescence in Mammary Gland Sections. Images depict whole-mounted
mammary glands that were frozen-sectioned, counterstained with Hoechst (blue) and imaged
by Confocal microscopy (MAX Projections; Mag. 20X). Dox-treated pregnant mammary
glands were brightly labeled with GFP fluorescence as expected. No GFP fluorescence was
detectable in mammary gland sections obtained from Dox naïve animals. GFP labeled cells
were present in both the ducts and outgrowths in pulse-chased mammary glands. B. H2B-
eGFP Signal is Detectable in Lobulo-alveolar Outgrowths. The panels present a more
detailed view of an imaged area of a pulse-chased mammary gland (Confocal Microscopy,
MAX Projections; Mag. 20X). Both GFP/Hoechst (left) and GFP channel alone (right)
images demonstrate the presence of GFP labeled cells in the luminal layer of the duct and in
the lobulo-alveolar outgrowth.
144
Figure 6.7 H2B-eGFP Labeling of Basal Cells During Pregnancy in K5-rtTA/TGFP Mice.
Single parameter plots presenting representative flow cytometry results for GFP fluorescence
obtained by analysis of single mammary epithelial cells isolated from adult K5-rtTA/TGFP
d10.5 pregnant females with or without Dox treatment as indicated are displayed in the first
column. The second column is composed of wide field fluorescence images of whole-mount
mammary glands from the same mice. Pulse animals (n=2) were placed on Dox from d7.5 to
d10.5 of pregnancy. Dox-naive animals (n=2) were maintained without Dox both prior to and
for the duration of the experiment. Pulse-chase animals (n=4) were bred on Dox and
removed from Dox when a plug was detected.
145
Figure 6.8 Basal Cells Contribute to Lobulo-alveolar Outgrowths During Pregnancy.
A.H2B-eGFP Fluorescence in Mammary Gland Sections. Images depict whole-mounted
mammary glands from K5-rtTA/TGFP mice that were frozen-sectioned, counterstained with
Hoechst (blue) and imaged by Confocal microscopy (MAX Projections; Mag. 20X). Pulse-
labeled pregnant mammary glands were brightly labeled with GFP fluorescence as expected.
No GFP fluorescence was detectable in mammary gland sections obtained from Dox naïve
animals. GFP labeled cells were present in both the ducts and outgrowths in pulse-chase
mammary glands. B. H2B-eGFP Labeling in the Lobulo-alveolar Outgrowths. The panels in
B present a more detailed view of an imaged area of a pulse-chased mammary gland
(Confocal Microscopy, MAX Projections; Mag. 20X). Both GFP/Hoechst (left) and GFP
channel alone (right) images demonstrate the presence of GFP labeled cells in the basal layer
of the duct and in the lobulo-alveolar outgrowth.
146
Figure 6.9 H2B-eGFP Labeling of Luminal Cells During Hormone Induced Lobulo-alveolar
Development.
Representative single parameter flow cytometry plots for GFP fluorescence obtained by
analysis of single mammary epithelial cells isolated from adult, MMTV-rtTA/TGFP,
hormone pellet implanted females during or following Dox treatment as indicated are
displayed in the first column. The second column is composed of wide field fluorescence
images (Mag. 10X) of whole-mount mammary glands from the same mice. Pulse +pellet
animals (n=1) were implanted with estrogen and progesterone pellets, and placed on Dox for
7 days. Pulse-chase animals (n=5) were placed on Dox for 4 days then removed from Dox
and implanted with estrogen and progesterone pellets for 7 days prior to necropsy.
147
Figure 6.10 Luminal Cells Contribute to Lobulo-alveolar Outgrowths During Hormone
Induced Lobulo-alveolar Development.
A. Microscopic Imaging of GFP signal in Alveolar Outgrowths. These panels depict whole-
mounted mammary glands that were frozen-sectioned, counterstained with Hoechst (blue)
and imaged by Confocal microscopy (MAX Projections; Mag. 20X). Mammary glands
collected from Dox-treated and during Dox-withdrawal demonstrated extensive lobulo-
alveolar development following hormone pellet implant. The luminal layer was brightly
labeled during on Dox pulse as expected. Bright GFP nuclei were seen in both the inner
lining of the ducts and outgrowths in pulse-chased mammary glands. B. GFP Fluorescence in
alveolar outgrowths. The images present a more detailed view of a representative imaged
area of a pulse-chase mammary gland. Both GFP/Hoechst and GFP alone images
demonstrate the presence of GFP labeled cells in the luminal layer of the duct and in the
lobulo-alveolar outgrowth (MAX Projections; Mag. 20X).
148
Figure 6.11 H2B-eGFP Labeling of Basal Cells During Hormone Induced Lobulo-
alveolar Development.
Samples from adult K5-rtTA/TGFP, hormone pellet implanted females with or without Dox
treatment were collected as indicated to allow analysis of GFP fluorescent labeling. Pulse
animals (n=2) were implanted with estrogen and progesterone pellets, and placed on Dox for
7 days. Pulse/chase animals (n=4) were placed on Dox for 4 days then removed from Dox
and implanted with estrogen and progesterone pellets for 7 days prior to necropsy.
Representative single parameter flow cytometry plots for GFP fluorescence obtained by
analysis of single mammary epithelial cells isolated as indicated are displayed in the first
column. The second column is composed of wide field fluorescence images (Mag. 10X) of
whole-mount mammary glands from the same mice.
149
Figure 6.12 Basal Cells Contribute to Lobulo-alveolar Outgrowths During Hormone
Induced Lobulo-alveolar Development
Mammary glands collected from mice during Dox-treatment and following Dox-withdrawal
demonstrated extensive lobulo-alveolar development following hormone pellet implant in
K5-rtTA/TGFP females. The basal layer was brightly labeled during pulse as expected.
Bright GFP nuclei were seen in both the inner lining of the ducts and outgrowths in pulse-
chased mammary glands. A. Microscopic Imaging of GFP signal in Alveolar Outgrowths.
These panels depict whole-mounted mammary glands that were frozen-sectioned,
counterstained with Hoechst (blue) and imaged by Confocal microscopy (MAX Projections;
Mag. 20X). B. GFP Fluorescence in Alveolar outgrowths. The images present a more
detailed view of a representative imaged area of a pulse-chase mammary gland. Both
GFP/Hoechst and GFP alone images demonstrate the presence of GFP labeled cells in the
basal layer of the duct and in the lobulo-alveolar outgrowths (MAX Projections; Mag. 20X).
150
Figure 6.13 Dox Regulated H2B-eGFP Labeling of Luminal Mammary Epithelial Cells
During Lactation.
Bitransgenic MMTV-rtTA/TGFP females were placed on Dox for 4 days while Never Dox
samples were collected from Dox-naïve animals. Both Pulse and Never Dox samples
displayed lobulo-alveolar outgrowths as expected. Images in the top row were taken from
the mammary glands by biopsy the day of parturition and imaged as whole mounts by
fluorescent wide-field microscopy (Mag. 10X). Following sectioning, after Hoechst
counterstain, images were collected by Confocal microscopy (MAX Projections; Mag. 20X).
Widespread nuclear H2B-eGFP labeling is apparent in the Pulse labeled mammary glands
but is not observed in Dox-naïve samples. The green signal visualized in Never Dox whole-
mounts is autofluorescent and is not detected by Confocal imaging.
151
152
Figure 6.14 Post-lactational Remodeling of the Mammary Gland Retains Luminal
Labeled Mammary Epithelial Cells
Panels present fluorescent microscopic and Confocal microscopic imaging of whole mounts
and sections, and the single parameter depiction of GFP signal intensity obtained by flow
cytometry of single cells collected from bitransgenic MMTV-rtTA/TGFP mice that were
placed on Dox 4 days prior to parturition and removed from Dox after delivery of pups
(Pulse-Chase) or on an identical timeline from Dox-naïve animals. The mammary glands
were collected from these mice following 4 weeks of involution and analyzed by
conventional fluorescent microscopy of whole mounts (Mag. 10X). Following sectioning and
Hoechst staining, images were obtained by Confocal microscopy (MAX Projections; Mag.
20X). Single cells prepared from mammary tissue at the time of necropsy were also analyzed
by flow cytometry for GFP signal intensity. H2B-eGFP signal is visible in the remodeled
ducts of pulse labeled-chased mammary glands by both conventional and Confocal
fluorescent microscopy but is not seen in Dox-naïve samples. Involuted mammary ducts
contained globular areas of autofluorescence that did not correspond to H2B-eGFP signal.
Flow cytometric assay of GFP signal intensity replicates the observation seen in the imaging
studies. Interestingly, peaks representative of rounds of cell proliferation are visible in the
single parameter plot of Pulse-Chase group MEC populations.
153
Figure 6.15 Dox Regulated H2B-eGFP Labeling of Basal Mammary Epithelial Cells
During Lactation
Panels depict photomicrographs of whole mount and sectioned mammary glands. Images in
the top row were taken from the mammary glands of transgenic K5-rtTA/TGFP mice by
biopsy the day of parturition and imaged as whole mounts by fluorescent wide-field
microscopy (Mag. 10X). Following sectioning after Hoechst counterstain, images were
collected by Confocal microscopy (MAX Projections; Mag. 20X). Samples were obtained
from mice on Dox for 4 days (Pulse) and from Dox-naïve animals. Both Pulse and Dox-naive
samples displayed lobulo-alveolar outgrowths as expected. Widespread nuclear H2B-eGFP
labeling is apparent in the Pulse labeled mammary glands but is not observed in Dox-naïve
samples. The green signal visualized in Dox-naive whole-mounts is autofluorescent and is
not detected by Confocal imaging.
154
155
Figure 6.16 Post-lactational Remodeling of the Mammary Gland Retains Basal Labeled
Mammary Epithelial Cells.
Panels present fluorescent microscopic and Confocal microscopic imaging of whole mounts
and sections, and the single parameter depiction of GFP signal intensity obtained by flow
cytometry of single cells collected from bitransgenic K5-rtTA/TGFP mice that were placed
on Dox 4 days prior to parturition and removed from Dox after delivery of pups (Pulse-
Chase) or on an identical timeline from Dox-naïve animals. The mammary glands were
collected from these mice following 4 weeks of involution and analyzed by conventional
fluorescent microscopy of whole mounts (Mag. 10X).Following sectioning and Hoechst
staining, images were obtained by Confocal microscopy (MAX Projections; Mag. 20X).
Single cells prepared from mammary tissue at the time of necropsy were also analyzed by
flow cytometry for GFP signal intensity. H2B-eGFP signal is visible in the remodeled ducts
of pulse-chase mammary glands by both conventional and Confocal fluorescent microscopy
but is not seen in Dox-naïve samples. Involuted mammary ducts contained globular areas of
autofluorescence that did not correspond to H2B-eGFP signal. Flow cytometric assay of GFP
signal intensity replicates the observation seen in the imaging studies. Interestingly, peaks
representative of rounds of cell proliferation are visible in the single parameter plot of Pulse-
Chase group MEC populations.
156
157
Figure 6.17 A Revised Model of Alveolar Progenitor Cells.
This diagram depicts our proposed model of lobuloalveolar development based on the
outcomes of our label tracking experiments. We identified label retaining cells originating
from both cell layers in the lobulo-alveolar outgrowths stimulated by pregnancy and hormone
implants. We additionally demonstrated that the cells contained within the outgrowths have
less retained H2B-eGFP fluorescence and showed flow cytometry analyses demonstrating
H2B-eGFP signal consistent with proliferation dependent washout. In light of these findings,
and in contrast to the commonly held model (boxed in orange), we propose that both luminal
and basal cell layers contribute to the development of alveoli (shaded in yellow).
Furthermore, these contributions to alveologenesis are proliferation dependent and do not
represent migration of ductal cells. We suggest that cell contributions during differentiation
may be confined to the cell layer of origin, but cannot yet confirm this model (shaded in
peach).
158
Chapter 7 Final Discussion
While much is understood about the mammary gland on a structural level, the specific
cellular contributions to the developing mammary gland have not yet been fully elucidated.
By pairing compartment-specific transactivators in the mammary gland with the recently
developed H2B-eGFP transgene we developed a method that tracks proliferation history and
also lineage path for cells of the mammary epithelial tree. We additionally extended this
method to examine the proliferation histories of the cells comprising mammary tumors and
regressed MRD lesions.
7.1 Labeling the Luminal and Basal MEC Compartments
In Chapter 3, a method allowing the temporal and tissue specific regulation of
transgene expression was described. Expression of the TGFP reporter transgene results in
the labeling of chromatin within the luminal or basal cell layers of the mammary epithelial
tree induced by MMTV-driven or Keratin5 –driven transactivators. This fluorescent labeling
may subsequently be diluted by cell division allowing both the tracking of lineage and
monitoring of proliferation history. By examining reporters for both luminal and basal
specific compartments, this method allows the study of the lineage commitment in the
development of mammary ductal structures.
While MMTV is widely expressed within the luminal epithelium, this expression is
not uniform and is altered by hormone fluctuations. During pregnancy and lactation,
MMTV-driven expression is greatly increased in both intensity and proportion of cells
expressing MMTV. As an alternative method for driving transgene expression, Whey Acidic
Protein (WAP) has been used to induce transgene expression in the luminal epithelium of
adult parous mice [202]. This promoter is not expressed prior to pregnancy as it is a
159
component of the secreted milk produced during lactation. Expression driven by the WAP
promoter could be useful for the study of luminal alveolar-derived epithelial cells in the adult
parous animal and during pregnancy. As this promoter is then transcribed in the cells that
have participated in lactation, the ability to monitor the fate of these cells through lactation
and involution and throughout subsequent pregnancies provides an interesting avenue to
explore the altered capacity of MECs following hormonally driven proliferation and
differentiation.
We have described the presence of slower-cycling cells in the mammary ductal tree
during development but did not identify a typical location along the branching structures that
harbors these cells. As microenvironment plays a critical role in the development and
maintenance of the mammary gland it is likely that particular subsets of cells, either slower
or rapidly cycling are maintained in a particular niche. Additional pulse-chase conditions
during puberty and adult stages may help identify locations that harbor LRCs. Some adult
stem cell populations are maintained in a quiescent state; notably the stem cells of the skin
are maintained in a quiescent state in the skin and in the corneal limbus [182, 203]. As there
does not appear to be a biological requirement for quiescence in stem cell populations the
identification of cycling stem cell populations has also occurred. The niche of the stem cell
population within the gut and the proliferation patterns of these cells has been well described
[204]. The identification of particular cycling patterns within the candidate mammary stem
cell population may also offer a pulse-chase timeline ideal for the isolation of stem cells
based on their retention or washout of H2B-eGFP labeling under specific developmental
phases.
160
Niche has been demonstrated to play a regulatory role in the maintenance and growth
patterns of normal stem cells and in tumorigenic stem cells in some tissues including the skin
and blood and brain tumors [160, 182, 205]. Identification of niche locations has facilitated
the characterization of the signaling pathways and cell-extracellular matrix interactions that
regulate the division and maintenance of these cells [206, 207]. The identification of LRCs
within mammary ducts raises the question of whether these cells are stem or progenitor-like
cells; and localization of the niche for these cells will permit investigation into the
maintenance of this compartment. Fluorescent labeling studies offer the benefit of allowing
isolation of viable cells of a specific population and thus would allow isolation of a single
cell of interest based not only on H2B-eGFP labeling, or label retention, but also on location
within a tissue. H2B-eGFP label retention of cells may help identify a stem cell niche within
the mammary gland. Following identification of a structural localization of stem cells within
the mammary gland, the biochemical properties of the niche could be explored to define the
role of the niche in the maintenance of MaSCs. Cells isolated from potential niches, if found,
could subsequently be studied in culture or via implant procedures to assay for stem cell-like
capacity. While identification of cells based on incorporation of H2B-eGFP label provides a
clear manner for the selection of a desired population, non-labeled cells may also be selected
based on the absence of GFP label under desired conditions.
7.2 Using H2B-eGFP Labeling to Characterize Mammary Tumors
In Chapter 4 we adapted the inducible compartment specific labeling of MECs to
label mammary tumors. We demonstrated inducible H2B-eGFP labeling in both the luminal
and basal layers of these tumors and demonstrated proliferation dependent washout in a
subset of these tumors. The extensive variability seen in MMTV-wnt1 initiated tumors
161
proved a challenge in the identification of cell populations with distinct proliferation patterns
in constitutive tumors. Though clouding the conclusions in these experiments, the variability
inherent in MMTV-Wnt1 initiated mammary tumors reflects the wide range of mammary
cancers seen in humans. Characterization of particular tumor-type variants would allow
more clear interpretation of labeling and label retaining cell populations in growing tumors.
Specifically, the potential identification of genetic causes for the loss of H2B-eGFP signal in
Dox-induced tumors would provide one manner to group transgenic tumors for study of
labeling and label retention. Additionally, the characterization of accumulated mutation
patterns accompanying MMTV-Wnt1 initiated mammary tumors may provide insight into
the variability seen in inducible H2B-eGFP labeling of those tumors.
A candidate breast cancer stem cell has been isolated from human tumors based on
animal transplant studies and 3D culture, however the in situ capabilities of this cell type
have not been defined [88]. Cancer stem cells may have different proliferative behavior than
bulk tumor cells and the isolation of distinct tumor cell populations based on proliferation
history offers an alternative method for the isolation of putative stem cells. A number of
tumors driven by constitutive Wnt1 expression did contain populations with variable
proliferation histories. Isolating these cells based on the H2B-eGFP signal intensity by
FACS, possibly paired with cell-surface markers, would allow for the characterization of
individual cells (or cell populations) with a distinct biological feature. LRCs isolated from
mammary tumors potentially harbor CSC-like capacity and may also be derived from the
normal stem cell population of the mammary epithelium.
The role of microenvironment plays a crucial part in the maintenance of adult stem
cells and there is the possibility that when implanted into normal stroma that even malignant
162
cells may behave in a “normal” fashion. In particular, the mammary gland stroma and non-
tumorigenic epithelial cells have been demonstrated capable of reprogramming embyronal
cancer cells [208]. In these experiments, human embryonal cancer cells mixed with normal
MECs were implanted into the cleared mammary fat pad of athymic mice and did not
develop into new tumor lesions but instead differentiated to produce MECs. Building upon
this observation, single cells of the desired H2B-eGFP labeling phenotype from mammary
tumors could be implanted into cleared fat pads in order to examine the effects of
extracellular signaling and architecture on the regulation of proliferation and differentiation.
The implanted mammary glands can be monitored for tumor development and following a
prescribed time period animals could be induced with Dox, sacrificed, and the contributions
of the transgenic H2B-eGFP expressing cells to the developed mammary gland assessed.
This method would require isolation of MECs from mammary tumors by fluorescent assisted
cell sorting and recovery of viable cells. Furthermore, these cells would have to be
implanted into cleared fat pads via injection in suspension with wild-type MECs. While
some successes with FACS and injection implant have been described by others, in our hands
these techniques remain unpredictable. Injection of mixed cell populations would produce
mixed-lineage outgrowths and in each instance, tumor derived cells may or may not
contribute in a significant manner to the ductal outgrowths.
By isolating and implanting different cell populations from luminal and basal H2B-
eGFP labeled MMTV-wnt1 tumors the capabilities of all distinct populations within the
tumor could be elucidated. This characterization would help clarify the potential for a CSC
population within Wnt-initiated mammary cancers. The variability of these wnt-initiated
cancers could possible preclude the isolation of a single “cell of origin” for all the tumors
163
studied, however, it is likely that tumors could be grouped by common genetic alterations
and similar results in the capacity of labeled or label retaining cells could be identified.
Cytokinetic resistance, the resistance to chemotherapeutic treatment by non-
proliferative cells, has complicated the development and use of many chemotherapeutics. By
isolating and characterizing the capacity of the LRCs in mammary tumors, the potential
exists to develop alternate therapies that would eliminate these treatment resistant
populations such as immunotherapies targeted to the LRCs in particular. If alternatively,
characterization of slower-cycling cells indicates that they are in fact non-tumorigenic, the
lack of response to chemotherapeutic treatments would be insignificant. Potentially, these
cells which compose a substantial portion of some tumors, may remain following treatment
that successfully removes tumor-initiating cells, but as they lack that capacity they do not
pose a high risk for either tumor relapse or for the seeding of metastases. By assaying the
response of labeled subpopulations from both the luminal and basal compartments of well
characterized mammary tumors to a range of typical cancer therapeutics, a more complete
picture of tumor response may be achieved. While the single set of clonal tumors assayed in
Chapter 4 did not display a difference in response of labeled and unlabeled luminal MECs to
a single treatment with Adriamycin, the potential exists that different time frames, dose, and
duration of treatment, as well as alternate treatments such as radiation may offer different
results. Additionally, the extensive variability seen in the mammary tumors in this study
suggest that though the example studied in Chapter 4 did not demonstrate a response to
treatment, it is by no means representative of all mammary tumors or even all Wnt-initiated
mammary tumors.
164
7.3 LRCs in MRD and Maintenance of MRD
Again, though extensive variability complicated the analysis of the presence of LRCs
in MRD lesions in Chapter 5, several tumor sets were identified that provided evidence in
support of a model of cellular dormancy for the maintenance of tumor dormancy in the
mammary gland. As discussed previously, in several instances there was not extensive label
retention in the cells of the MRD when compared to the surrounding normal ducts (regressed
hyperplasia) but nearly all the MRD lesions had much higher label retention than that seen in
constitutive MMTV-Wnt1 tumors, particularly when considered in light of the substantially
longer periods of Dox-withdrawal they were subjected to.
Metastasis of cancer is a primary cause of mortality in cancer patients and an
unexamined feature of the MMTV-rtTA/TWNT/TGFP model of mammary tumors and
labeling is the identification of distant metastases by fluorescence. Previous work has
identified multiple instances of metastases, primarily to the lung and liver, in MMTV-
rtTA/TWNT mice. Though lung and liver were examined at necropsy in the tri-transgenic
tumor-bearing mice utilized in this study, no macrometastases were identified. This may be
due to the comparatively small sample size of MMTV-rtTA/TWNT/TGFP mice studied to
date in comparison to the long history of MMTV-rtTA/TWNT mice or to some unexpected
effect of the TGFP transgene on metastatic potential of the mammary tumor cells.
Disseminated tumor cells are dispersed throughout the body; however the molecular
characteristics that identify the subset of cells capable of giving rise to macrometastases at
distant sites are unknown. If metastatic lesions or disseminated fluorescent cells, can be
identified in H2B-eGFP labeled and chased animals they provide an opportunity to further
characterize the potential of a specific population of cells within the growing mammary
165
tumor and of the residual disease maintained even following abrogation of oncogenic
stimulation. By examining metastases prone tissues of tumor bearing mice by fluorescence
microscopy, we offer a method to identify micrometastatic lesions in situ. The potential
exists that distant metastases are maintained in a dormant state in either identical or
dissimilar manners to those occurring within the mammary gland and by assaying for label
retention in these metastases not only the lineage of the cells composing the lesion but also
the mechanism of maintenance may be analyzed by using compartment specific transgene
expression and examining H2B-eGFP label retention when removed from Dox stimulation.
7.4 Lineage Restriction and Cell of Origin in Alveologenesis
In Chapter 6, we describe our investigation of the lineage specific contributions to the
lobuloalveolar outgrowths of pregnancy utilizing the compartment-specific induction of
H2B-eGFP expression. While this work demonstrates the contribution of both luminal and
basal cells to the lobulo-alveolar outgrowths developed during pregnancy, in contrast to the
common model suggesting a luminal cell of origin for the entire alveolar structure, it does not
define the precise contribution of each cell type to the differentiated structure nor the
pathways or signaling mechanisms required to modulate the this proscribed growth
patterning.
Common progenitor cells and dedifferentiation of lineage committed cells have both
been offered as potential sources of the development of new structures within the adult
animal. In limb amputation models in amphibians, dedifferentiation has been proposed to
occur in blastema, but may be somewhat restricted with tagged cells giving rise only to cells
of highly similar lineage and suggest the contributions of multiple populations of slightly
dedifferentiated or committed cells driven to repopulate the limb bud [209-211]. Though
166
mice are not capable of the large scale regrowth of limbs as seen in amphibians, many tissues
including the mammary epithelium are capable of responding to stimuli such as wounding
and changes in the hormonal milieu by increasing proliferation rates and altering the
pathways of lineage commitment. During pregnancy, the increase in estrogen and
progesterone levels drives proliferation and formation of the alveolar structures of the
mammary gland in an analogous manner to the signals driving limb regeneration in many
amphibians. The common model for alveologenesis posits a cell of luminal origin that gives
rise to both cell layers within the developed outgrowth. As the luminal cell is proposed to be
further committed than the normal mammary stem cell and basal cell populations within the
mammary it seems contrary to predict it giving rise to cells of both the luminal and basal cell
layers. Identifying the cell-layer specific contributions to the differentiated lobulo-alveolar
outgrowths by H2B-eGFP based lineage tracing allows the characterization of the role of
dedifferentiation or transdifferentiation by identification of specific compartment labeled
cells in the other cell layer of the developed alveolar structures.
A first step to examining the possibility of cross-contributions to each cell layer
could be obtained by immunohistochemical characterization of the label-retaining cells
within the alveolar structures of mid-pregnant mice to verify the appearance of lineage
restricted contribution to the alveoli seen in Chapter 6. A variety of defined IHC markers for
both luminal and basal cell populations exist and have been clearly defined. The
complicating feature of this experiment derives from the relative instability of H2B-eGFP
when subjected to standard histological procedures such as paraffin embedding and the
difficulty in utilizing the standard cell compartment markers in frozen sections that preserve
H2B-eGFP signal. Attempts at staining paraffin embedded sections with primary antibodies
167
for eGFP were partially successful but demonstrated a loss in sensitivity for the range of GFP
levels. Further optimization of the IHC procedures may allow for careful identification of
the cell-layer of LRCs in the pregnant mammary gland.
While the MMTV-rtTA/TGFP system provides a clever manner for tracing the cell-
layer of origin of differentiated mammary epithelial cells it does not provide as simple a
manner for the tracing of single-cell of origin. The lobulo-alveolar structures derive from
cells of both cell layers but the work described in Chapter 6 does not address whether all
cells within each cell population or if only a select subset contribute to alveologenesis. Cell-
culture studies might provide a method of elucidating the specific cell or cells of origin for
these structures. Specifically, isolated GFP-labeled luminal (or basal) cells could be
assembled into organoids with non-transgenic epithelial cells of both lineages and grown in
3D culture under hormone-stimulation to induce differentiation. Additional
subcategorization of candidate alveolar progenitor cells could be made on particular
characteristics, including hormone receptor status and these populations could be analyzed
for contribution to differentiated structures.
Similarly, in a manner analogous to that used to assess the role of dedifferentiation
and transdifferentiation in the regrowth of amphibian limbs, and building upon the implant
studies that identified a candidate MaSC, single cells of interest from MMTV-rtTA/TGFP (or
K5-rtTA/TGFP) could be isolated and implanted into the cleared fat pads of host animals
mixed with non-transgenic mammary epithelial cells from syngeneic donors. The host
animals could be rendered pregnant while receiving Dox and the contributions of the
transgenic cells to lobulo-alveolar outgrowths could be assessed by flow cytometry and
histological means. Several candidate populations could be examined in this manner to
168
illuminate the specific contributions of each population to the terminally differentiated
mammary gland and the level lineage restriction of each population.
The identification of the cell population(s) that give rise to the alveoli may also
provide insight into the stem cell population responsible for maintenance and development of
the mammary gland as a whole. Though a putative stem cell population has been described,
the localization of this population has not yet been offered in the adult mammary gland
though it is presumed to be basal based on the similarity of the proffered immunophenotype
to that of myoepithelial cells. It is possible that alternate time frames for Dox pulse and Dox
withdrawal, and extensive examination of MECs isolated from virgin mammary glands
would identify a candidate stem cell population that retains H2B-eGFP fluorescence
indicating relative quiescence and allow localization of this population. The potential exists
that a similar or perhaps slightly more lineage committed cell population is responsible for
the development of the alveolar outgrowths of pregnancy.
7.5 Parity-related Protection from Breast cancer
The final sections of Chapter 6 offered a preliminary glimpse into a potential
mechanism for the breast cancer protection related to pregnancy. The widespread remodeling
of the mammary gland following cessation of lactation does not remove the entire population
of MECs present during pregnancy and lactation but instead pairs remodeling with copious
reductions in cell number. The identification of label-retaining cells following involution
verifies the survival of cells through this period of post-lactational remodeling.
While this work counters a model of wholesale elimination of pre-neoplastic cells as
the mechanism of parity protection from breast cancer it does not illuminate the effects on
pre-neoplastic cells at the hormonal or genetic level, nor does it eliminate the possibility that
169
potentially tumorigenic cells are selectively destroyed during involution. The selective
removal of genetically altered cells could be assessed by the implantation of single cells
isolated from MRD lesions of MMTV-rtTA/TWNT/TGFP mice in conjunction with isolated
cells from wild-type female mice. The resulting mammary ductal structures should bear
mosaic ducts comprised of both normal and “pre-neoplastic” cells. Subsequent induction of
pregnancy, lactation, and involution followed by short term induction with Dox would induce
labeling in those genetically altered cells that survive involution. Microscopic and flow-
cytometric detection of GFP signal in these chimeric glands would provide an indication if
selection of tumorigenic cells for elimination during involution may be responsible for
parity-related protection from breast cancer.
7.6 Summary
The work presented in this thesis provides not only the description of a model
allowing the labeling of mammary epithelial cells in a compartment specific manner and
consequently allowing the tracking of lineage of MECs during development and
differentiation, it also provides a system that permits the tracking of cell proliferation in
normal and neoplastic mammary tissue. By building upon the strategies described in this
document, a greater understanding of the processes governing tumorigenesis and tumor
regression following treatment might be obtained. The adaptability of this strategy to the
study of disparate phases of development and differentiation will provide a wide array of
experimental avenues in the pursuit of mammary stem cells and improved treatment of
mammary cancers.
170
References:
1. Halban, J., Die innere Sekretion von Ovarium und Placenta und ihre Bedeutung fuer
die Function der Milchdruese. Mschr. Geburtsh Gynaek, 1900. 12: p. 496-503.
2. Robinson, G.W., et al., Mammary epithelial cells undergo secretory differentiation in
cycling virgins but require pregnancy for the establishment of terminal
differentiation. Development, 1995. 121(7): p. 2079-90.
3. Chu, E.Y., et al., Canonical WNT signaling promotes mammary placode development
and is essential for initiation of mammary gland morphogenesis. Development, 2004.
131(19): p. 4819-29.
4. Hens, J.R. and J.J. Wysolmerski, Key stages of mammary gland development:
molecular mechanisms involved in the formation of the embryonic mammary gland.
Breast Cancer Res, 2005. 7(5): p. 220-4.
5. Daniel C.W., S.G.B., ed. Postnatal development of the rodent mammary gland. The
mammary gland: Development, regulation, and function, ed. D.C.W. Neville M.C.
1987, Plenum Press: New York, NY. 3-36.
6. Humphreys, R.C., et al., Apoptosis in the terminal endbud of the murine mammary
gland: a mechanism of ductal morphogenesis. Development, 1996. 122(12): p. 4013-
22.
7. Bern, H.A., S. Nandi, and V. Finster, Induction of lactation in precancerous
hyperplastic alveolar nodules in the mammary gland of C3H/He Crgl mice.
Experientia, 1959. 15(4): p. 155-7.
8. Sternlicht, M.D., et al., Hormonal and local control of mammary branching
morphogenesis. Differentiation, 2006. 74(7): p. 365-81.
9. Puca, G.A. and F. Bresciani, Decrease to complete loss of ability to bind estradiol by
a soluble macromolecular fraction of C3H mammary tumors. Eur J Cancer, 1968.
3(6): p. 475-9.
10. Silberstein, G.B., Postnatal mammary gland morphogenesis. Microsc Res Tech,
2001. 52(2): p. 155-62.
11. Nelson, C.M. and M.J. Bissell, Of extracellular matrix, scaffolds, and signaling:
tissue architecture regulates development, homeostasis, and cancer. Annu Rev Cell
Dev Biol, 2006. 22: p. 287-309.
12. Silberstein, G.B., et al., Regulation of mammary morphogenesis: evidence for
extracellular matrix-mediated inhibition of ductal budding by transforming growth
factor-beta 1. Dev Biol, 1992. 152(2): p. 354-62.
13. Joseph, H., et al., Overexpression of a kinase-deficient transforming growth factor-
beta type II receptor in mouse mammary stroma results in increased epithelial
branching. Mol Biol Cell, 1999. 10(4): p. 1221-34.
14. Brisken, C., et al., A paracrine role for the epithelial progesterone receptor in
mammary gland development. Proc Natl Acad Sci U S A, 1998. 95(9): p. 5076-81.
15. Bocchinfuso, W.P., et al., Induction of mammary gland development in estrogen
receptor-alpha knockout mice. Endocrinology, 2000. 141(8): p. 2982-94.
16. Lin, C.Q. and M.J. Bissell, Multi-faceted regulation of cell differentiation by
extracellular matrix. FASEB J, 1993. 7(9): p. 737-43.
17. Brisken, C., Hormonal control of alveolar development and its implications for breast
carcinogenesis. J Mammary Gland Biol Neoplasia, 2002. 7(1): p. 39-48.
171
18. Li, M., et al., Mammary-derived signals activate programmed cell death during the
first stage of mammary gland involution. Proc Natl Acad Sci U S A, 1997. 94(7): p.
3425-30.
19. Strange, R., et al., Apoptotic cell death and tissue remodelling during mouse
mammary gland involution. Development, 1992. 115(1): p. 49-58.
20. Streuli, C., Extracellular matrix remodelling and cellular differentiation. Curr Opin
Cell Biol, 1999. 11(5): p. 634-40.
21. Monks, J., et al., Epithelial cells remove apoptotic epithelial cells during post-
lactation involution of the mouse mammary gland. Biol Reprod, 2008. 78(4): p. 586-
94.
22. Radice, G.L., et al., Precocious mammary gland development in P-cadherin-deficient
mice. J Cell Biol, 1997. 139(4): p. 1025-32.
23. Williams, J.M. and C.W. Daniel, Mammary ductal elongation: differentiation of
myoepithelium and basal lamina during branching morphogenesis. Dev Biol, 1983.
97(2): p. 274-90.
24. Streuli, C.H. and M.J. Bissell, Expression of extracellular matrix components is
regulated by substratum. J Cell Biol, 1990. 110(4): p. 1405-15.
25. Talhouk, R.S., M.J. Bissell, and Z. Werb, Coordinated expression of extracellular
matrix-degrading proteinases and their inhibitors regulates mammary epithelial
function during involution. J Cell Biol, 1992. 118(5): p. 1271-82.
26. Asch, H.L. and B.B. Asch, Expression of keratins and other cytoskeletal proteins in
mouse mammary epithelium during the normal developmental cycle and primary
culture. Dev Biol, 1985. 107(2): p. 470-82.
27. Shackleton, M., et al., Generation of a functional mammary gland from a single stem
cell. Nature, 2006. 439(7072): p. 84-8.
28. Sleeman, K.E., et al., CD24 staining of mouse mammary gland cells defines luminal
epithelial, myoepithelial/basal and non-epithelial cells. Breast Cancer Res, 2006.
8(1): p. R7.
29. Stingl, J., et al., Purification and unique properties of mammary epithelial stem cells.
Nature, 2006. 439(7079): p. 993-7.
30. Cheng, G., et al., Estrogen receptors ER alpha and ER beta in proliferation in the
rodent mammary gland. Proc Natl Acad Sci U S A, 2004. 101(11): p. 3739-46.
31. Smalley, M.J., et al., Differentiation of separated mouse mammary luminal epithelial
and myoepithelial cells cultured on EHS matrix analyzed by indirect
immunofluorescence of cytoskeletal antigens. J Histochem Cytochem, 1999. 47(12):
p. 1513-24.
32. Linzell, J.L., The silver staining of myoepithelial cells, particularly in the mammary
gland, and their relation to the ejection of milk. J Anat, 1952. 86(1): p. 49-57.
33. Linzell, J.L., Some observations on the contractile tissue of the mammary glands. J
Physiol, 1955. 130(2): p. 257-67.
34. Smith, G.H., T. Mehrel, and D.R. Roop, Differential keratin gene expression in
developing, differentiating, preneoplastic, and neoplastic mouse mammary
epithelium. Cell Growth Differ, 1990. 1(4): p. 161-70.
35. Glukhova, M., et al., Adhesion systems in normal breast and in invasive breast
carcinoma. Am J Pathol, 1995. 146(3): p. 706-16.
172
36. Djonov, V., et al., MMP-19: cellular localization of a novel metalloproteinase within
normal breast tissue and mammary gland tumours. J Pathol, 2001. 195(2): p. 147-55.
37. Gudjonsson, T., et al., Normal and tumor-derived myoepithelial cells differ in their
ability to interact with luminal breast epithelial cells for polarity and basement
membrane deposition. J Cell Sci, 2002. 115(Pt 1): p. 39-50.
38. Runswick, S.K., et al., Desmosomal adhesion regulates epithelial morphogenesis and
cell positioning. Nat Cell Biol, 2001. 3(9): p. 823-30.
39. Neville, M.C., et al., The mammary fat pad. J Mammary Gland Biol Neoplasia, 1998.
3(2): p. 109-16.
40. Kouros-Mehr, H. and Z. Werb, Candidate regulators of mammary branching
morphogenesis identified by genome-wide transcript analysis. Dev Dyn, 2006.
235(12): p. 3404-12.
41. Richert, M.M., et al., An atlas of mouse mammary gland development. J Mammary
Gland Biol Neoplasia, 2000. 5(2): p. 227-41.
42. Stamenkovic, I., Extracellular matrix remodelling: the role of matrix
metalloproteinases. J Pathol, 2003. 200(4): p. 448-64.
43. Daniel, C.W., Regulation of cell division in aging mouse mammary epithelium. Adv
Exp Med Biol, 1975. 61: p. 1-19.
44. Daniel, C.W., et al., Unlimited division potential of precancerous mouse mammary
cells after spontaneous or carcinogen-induced transformation. Fed Proc, 1975. 34(1):
p. 64-7.
45. Deome, K.B., et al., Development of mammary tumors from hyperplastic alveolar
nodules transplanted into gland-free mammary fat pads of female C3H mice. Cancer
Res, 1959. 19(5): p. 515-20.
46. Hoshino, K. and W.U. Gardner, Transplantability and life span of mammary gland
during serial transplantation in mice. Nature, 1967. 213(5072): p. 193-4.
47. Asselin-Labat, M.L., et al., Steroid hormone receptor status of mouse mammary stem
cells. J Natl Cancer Inst, 2006. 98(14): p. 1011-4.
48. Sleeman, K.E., et al., Dissociation of estrogen receptor expression and in vivo stem
cell activity in the mammary gland. J Cell Biol, 2007. 176(1): p. 19-26.
49. Asselin-Labat, M.L., et al., Control of mammary stem cell function by steroid
hormone signalling. Nature, 2010. 465(7299): p. 798-802.
50. Stingl, J., et al., Phenotypic and functional characterization in vitro of a multipotent
epithelial cell present in the normal adult human breast. Differentiation, 1998. 63(4):
p. 201-13.
51. Asselin-Labat, M.L., et al., Gata-3 is an essential regulator of mammary-gland
morphogenesis and luminal-cell differentiation. Nat Cell Biol, 2007. 9(2): p. 201-9.
52. Asselin-Labat, M.L., et al., Delineating the epithelial hierarchy in the mouse
mammary gland. Cold Spring Harb Symp Quant Biol, 2008. 73: p. 469-78.
53. Bouras, T., et al., Notch signaling regulates mammary stem cell function and luminal
cell-fate commitment. Cell Stem Cell, 2008. 3(4): p. 429-41.
54. Oakes, S.R., et al., The Ets transcription factor Elf5 specifies mammary alveolar cell
fate. Genes Dev, 2008. 22(5): p. 581-6.
55. Harris, J., et al., Socs2 and elf5 mediate prolactin-induced mammary gland
development. Mol Endocrinol, 2006. 20(5): p. 1177-87.
173
56. Vaillant, F., et al., The emerging picture of the mouse mammary stem cell. Stem Cell
Rev, 2007. 3(2): p. 114-23.
57. Wellings, S.R., A hypothesis of the origin of human breast cancer from the terminal
ductal lobular unit. Pathol Res Pract, 1980. 166(4): p. 515-35.
58. Wellings, S.R., Development of human breast cancer. Adv Cancer Res, 1980. 31: p.
287-314.
59. Cardiff, R.D., D. Moghanaki, and R.A. Jensen, Genetically engineered mouse models
of mammary intraepithelial neoplasia. J Mammary Gland Biol Neoplasia, 2000. 5(4):
p. 421-37.
60. Cardiff, R.D., et al., The mammary pathology of genetically engineered mice: the
consensus report and recommendations from the Annapolis meeting. Oncogene,
2000. 19(8): p. 968-88.
61. Wijayaratne, A.L. and D.P. McDonnell, The human estrogen receptor-alpha is a
ubiquitinated protein whose stability is affected differentially by agonists,
antagonists, and selective estrogen receptor modulators. J Biol Chem, 2001. 276(38):
p. 35684-92.
62. Wijayaratne, A.L., et al., Comparative analyses of mechanistic differences among
antiestrogens. Endocrinology, 1999. 140(12): p. 5828-40.
63. Systemic treatment of early breast cancer by hormonal, cytotoxic, or immune therapy.
133 randomised trials involving 31,000 recurrences and 24,000 deaths among 75,000
women. Early Breast Cancer Trialists' Collaborative Group. Lancet, 1992.
339(8784): p. 1-15.
64. Masamura, S., et al., Estrogen deprivation causes estradiol hypersensitivity in human
breast cancer cells. J Clin Endocrinol Metab, 1995. 80(10): p. 2918-25.
65. Masamura, S., et al., Aromatase inhibitor development for treatment of breast cancer.
Breast Cancer Res Treat, 1995. 33(1): p. 19-26.
66. Dent, R., et al., Triple-negative breast cancer: clinical features and patterns of
recurrence. Clin Cancer Res, 2007. 13(15 Pt 1): p. 4429-34.
67. Laakso, M., et al., Cytokeratin 5/14-positive breast cancer: true basal phenotype
confined to BRCA1 tumors. Mod Pathol, 2005. 18(10): p. 1321-8.
68. Li, H., et al., Nestin is expressed in the basal/myoepithelial layer of the mammary
gland and is a selective marker of basal epithelial breast tumors. Cancer Res, 2007.
67(2): p. 501-10.
69. Coussens, L., et al., Tyrosine kinase receptor with extensive homology to EGF
receptor shares chromosomal location with neu oncogene. Science, 1985. 230(4730):
p. 1132-9.
70. Craven, R.J., H. Lightfoot, and W.G. Cance, A decade of tyrosine kinases: from gene
discovery to therapeutics. Surg Oncol, 2003. 12(1): p. 39-49.
71. King, C.R., M.H. Kraus, and S.A. Aaronson, Amplification of a novel v-erbB-related
gene in a human mammary carcinoma. Science, 1985. 229(4717): p. 974-6.
72. Slamon, D.J., et al., Human breast cancer: correlation of relapse and survival with
amplification of the HER-2/neu oncogene. Science, 1987. 235(4785): p. 177-82.
73. Slamon, D.J., et al., Studies of the HER-2/neu proto-oncogene in human breast and
ovarian cancer. Science, 1989. 244(4905): p. 707-12.
174
74. Hudziak, R.M., J. Schlessinger, and A. Ullrich, Increased expression of the putative
growth factor receptor p185HER2 causes transformation and tumorigenesis of NIH
3T3 cells. Proc Natl Acad Sci U S A, 1987. 84(20): p. 7159-63.
75. Guy, C.T., et al., Expression of the neu protooncogene in the mammary epithelium of
transgenic mice induces metastatic disease. Proc Natl Acad Sci U S A, 1992. 89(22):
p. 10578-82.
76. Yarden, R.I., M.A. Wilson, and S.A. Chrysogelos, Estrogen suppression of EGFR
expression in breast cancer cells: a possible mechanism to modulate growth. J Cell
Biochem Suppl, 2001. Suppl 36: p. 232-46.
77. Hudziak, R.M., et al., p185HER2 monoclonal antibody has antiproliferative effects in
vitro and sensitizes human breast tumor cells to tumor necrosis factor. Mol Cell Biol,
1989. 9(3): p. 1165-72.
78. Konecny, G.E., et al., Activity of the dual kinase inhibitor lapatinib (GW572016)
against HER-2-overexpressing and trastuzumab-treated breast cancer cells. Cancer
Res, 2006. 66(3): p. 1630-9.
79. Sorlie, T., et al., Repeated observation of breast tumor subtypes in independent gene
expression data sets. Proc Natl Acad Sci U S A, 2003. 100(14): p. 8418-23.
80. Sorlie, T., et al., Gene expression patterns of breast carcinomas distinguish tumor
subclasses with clinical implications. Proc Natl Acad Sci U S A, 2001. 98(19): p.
10869-74.
81. Perou, C.M., et al., Molecular portraits of human breast tumours. Nature, 2000.
406(6797): p. 747-52.
82. Neve, R.M., et al., A collection of breast cancer cell lines for the study of functionally
distinct cancer subtypes. Cancer Cell, 2006. 10(6): p. 515-27.
83. Weissman, I.L. and J.A. Shizuru, The origins of the identification and isolation of
hematopoietic stem cells, and their capability to induce donor-specific
transplantation tolerance and treat autoimmune diseases. Blood, 2008. 112(9): p.
3543-53.
84. Weissman, I.L., D.J. Anderson, and F. Gage, Stem and progenitor cells: origins,
phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev
Biol, 2001. 17: p. 387-403.
85. Weissman, I.L., Normal and neoplastic stem cells. Novartis Found Symp, 2005. 265:
p. 35-50; discussion 50-4, 92-7.
86. Dick, J.E., Acute myeloid leukemia stem cells. Ann N Y Acad Sci, 2005. 1044: p. 1-5.
87. Bonnet, D. and J.E. Dick, Human acute myeloid leukemia is organized as a hierarchy
that originates from a primitive hematopoietic cell. Nat Med, 1997. 3(7): p. 730-7.
88. Al-Hajj, M., et al., Prospective identification of tumorigenic breast cancer cells. Proc
Natl Acad Sci U S A, 2003. 100(7): p. 3983-8.
89. Molyneux, G., et al., BRCA1 basal-like breast cancers originate from luminal
epithelial progenitors and not from basal stem cells. Cell Stem Cell, 2010. 7(3): p.
403-17.
90. Ince, T.A., et al., Transformation of different human breast epithelial cell types leads
to distinct tumor phenotypes. Cancer Cell, 2007. 12(2): p. 160-70.
91. Uhr, J.W., et al., Cancer dormancy: opportunities for new therapeutic approaches.
Nat Med, 1997. 3(5): p. 505-9.
92. Meltzer, A., Dormancy and breast cancer. J Surg Oncol, 1990. 43(3): p. 181-8.
175
93. Welch, H.G. and W.C. Black, Using autopsy series to estimate the disease
"reservoir" for ductal carcinoma in situ of the breast: how much more breast cancer
can we find? Ann Intern Med, 1997. 127(11): p. 1023-8.
94. Demicheli, R., Tumour dormancy: findings and hypotheses from clinical research on
breast cancer. Semin Cancer Biol, 2001. 11(4): p. 297-306.
95. Demicheli, R., et al., Local recurrences following mastectomy: support for the
concept of tumor dormancy. J Natl Cancer Inst, 1994. 86(1): p. 45-8.
96. Aguirre-Ghiso, J.A., Models, mechanisms and clinical evidence for cancer dormancy.
Nat Rev Cancer, 2007. 7(11): p. 834-46.
97. Koebel, C.M., et al., Adaptive immunity maintains occult cancer in an equilibrium
state. Nature, 2007. 450(7171): p. 903-7.
98. Teng, M.W., et al., Immune-mediated dormancy: an equilibrium with cancer. J
Leukoc Biol, 2008. 84(4): p. 988-93.
99. Watnick, R.S., et al., Ras modulates Myc activity to repress thrombospondin-1
expression and increase tumor angiogenesis. Cancer Cell, 2003. 3(3): p. 219-31.
100. Vessella, R.L., K. Pantel, and S. Mohla, Tumor cell dormancy: an NCI workshop
report. Cancer Biol Ther, 2007. 6(9): p. 1496-504.
101. Kelsey, J.L. and M.D. Gammon, Epidemiology of breast cancer. Epidemiol Rev,
1990. 12: p. 228-40.
102. Kelsey, J.L. and M.D. Gammon, The epidemiology of breast cancer. CA Cancer J
Clin, 1991. 41(3): p. 146-65.
103. Kelsey, J.L., M.D. Gammon, and E.M. John, Reproductive factors and breast cancer.
Epidemiol Rev, 1993. 15(1): p. 36-47.
104. Lambe, M., et al., Parity, age at first and last birth, and risk of breast cancer: a
population-based study in Sweden. Breast Cancer Res Treat, 1996. 38(3): p. 305-11.
105. Layde, P.M., et al., The independent associations of parity, age at first full term
pregnancy, and duration of breastfeeding with the risk of breast cancer. Cancer and
Steroid Hormone Study Group. J Clin Epidemiol, 1989. 42(10): p. 963-73.
106. Russo, J., et al., The protective role of pregnancy in breast cancer. Breast Cancer
Res, 2005. 7(3): p. 131-42.
107. Russo, J., L.K. Tay, and I.H. Russo, Differentiation of the mammary gland and
susceptibility to carcinogenesis. Breast Cancer Res Treat, 1982. 2(1): p. 5-73.
108. Jerry, D.J., et al., Regulation of apoptosis during mammary involution by the p53
tumor suppressor gene. J Dairy Sci, 2002. 85(5): p. 1103-10.
109. Jerry, D.J., et al., Regulation of p53 and its targets during involution of the mammary
gland. J Mammary Gland Biol Neoplasia, 1999. 4(2): p. 177-81.
110. Jerry, D.J., et al., Delayed involution of the mammary epithelium in BALB/c-p53null
mice. Oncogene, 1998. 17(18): p. 2305-12.
111. Cardiff, R.D. and S.R. Wellings, The comparative pathology of human and mouse
mammary glands. J Mammary Gland Biol Neoplasia, 1999. 4(1): p. 105-22.
112. Moll, R., et al., The catalog of human cytokeratins: patterns of expression in normal
epithelia, tumors and cultured cells. Cell, 1982. 31(1): p. 11-24.
113. Haagensen, C.D., The physiology of the breast as it concerns the clinician. Am J
Obstet Gynecol, 1971. 109(2): p. 206-9.
114. Ailhaud, G., P. Grimaldi, and R. Negrel, Cellular and molecular aspects of adipose
tissue development. Annu Rev Nutr, 1992. 12: p. 207-33.
176
115. Bartow, S.A., Use of the autopsy to study ontogeny and expression of the estrogen
receptor gene in human breast. J Mammary Gland Biol Neoplasia, 1998. 3(1): p. 37-
48.
116. Haslam, S.Z., et al., Progestin-regulated luminal cell and myoepithelial cell-specific
responses in mammary organoid culture. Endocrinology, 2008. 149(5): p. 2098-107.
117. Strange, R., et al., Programmed cell death during mammary gland involution.
Methods Cell Biol, 1995. 46: p. 355-68.
118. Green, R.G., M.M. Moosey, and J.J. Bittner, Serial transmission of the milk agent of
mouse mammary carcinoma. Proc Soc Exp Biol Med, 1946. 61: p. 362.
119. Barnum, C.P., et al., The Milk Agent in Spontaneous Mammary Carcinoma. Science,
1944. 100(2608): p. 575-6.
120. Bittner, J.J., The Milk-Influence of Breast Tumors in Mice. Science, 1942. 95(2470):
p. 462-3.
121. Bittner, J.J., The Preservation by Freezing and Drying in Vacuo of the Milk-Influence
for the Development of Breast Cancer in Mice. Science, 1941. 93(2422): p. 527-8.
122. Bittner, J.J., Some Possible Effects of Nursing on the Mammary Gland Tumor
Incidence in Mice. Science, 1936. 84(2172): p. 162.
123. Porter, K.R. and H.P. Thompson, A particulate body associated with epithelial cells
cultured from mammary carcinomas of mice of a milkfactor strain. J Exp Med, 1948.
88(1): p. 15-24.
124. Dux, A. and O. Muhlbock, Propagation of the mammary tumor agent (Bittner virus)
in the absence of mammary glands in mice. J Natl Cancer Inst, 1968. 40(6): p. 1309-
12.
125. Dux, A. and O. Muhlbock, Susceptibility of mammary tissues of different strains of
mice to tumor development. J Natl Cancer Inst, 1968. 40(6): p. 1259-72.
126. Hageman, P.C., J. Links, and P. Bentvelzen, Biological properties of B particles from
C3H and C3Hf mouse milk. J Natl Cancer Inst, 1968. 40(6): p. 1319-24.
127. Nusse, R. and H.E. Varmus, Many tumors induced by the mouse mammary tumor
virus contain a provirus integrated in the same region of the host genome. Cell, 1982.
31(1): p. 99-109.
128. Nusse, R., et al., A new nomenclature for int-1 and related genes: the Wnt gene
family. Cell, 1991. 64(2): p. 231.
129. Roelink, H., et al., Wnt-3, a gene activated by proviral insertion in mouse mammary
tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos
and adult brain. Proc Natl Acad Sci U S A, 1990. 87(12): p. 4519-23.
130. Lee, F.S., et al., Insertional mutagenesis identifies a member of the Wnt gene family
as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice.
Proc Natl Acad Sci U S A, 1995. 92(6): p. 2268-72.
131. Dickson, C., et al., Tumorigenesis by mouse mammary tumor virus: proviral
activation of a cellular gene in the common integration region int-2. Cell, 1984.
37(2): p. 529-36.
132. Peters, G., et al., The mouse homolog of the hst/k-FGF gene is adjacent to int-2 and is
activated by proviral insertion in some virally induced mammary tumors. Proc Natl
Acad Sci U S A, 1989. 86(15): p. 5678-82.
133. Bhanot, P., et al., A new member of the frizzled family from Drosophila functions as a
Wingless receptor. Nature, 1996. 382(6588): p. 225-30.
177
134. Dann, C.E., et al., Insights into Wnt binding and signalling from the structures of two
Frizzled cysteine-rich domains. Nature, 2001. 412(6842): p. 86-90.
135. Chen, W., et al., Dishevelled 2 recruits beta-arrestin 2 to mediate Wnt5A-stimulated
endocytosis of Frizzled 4. Science, 2003. 301(5638): p. 1391-4.
136. Mao, J., et al., Low-density lipoprotein receptor-related protein-5 binds to Axin and
regulates the canonical Wnt signaling pathway. Mol Cell, 2001. 7(4): p. 801-9.
137. Zeng, X., et al., A dual-kinase mechanism for Wnt co-receptor phosphorylation and
activation. Nature, 2005. 438(7069): p. 873-7.
138. Davidson, G., et al., Casein kinase 1 gamma couples Wnt receptor activation to
cytoplasmic signal transduction. Nature, 2005. 438(7069): p. 867-72.
139. Brunner, E., et al., pangolin encodes a Lef-1 homologue that acts downstream of
Armadillo to transduce the Wingless signal in Drosophila. Nature, 1997. 385(6619):
p. 829-33.
140. van de Wetering, M., et al., Armadillo coactivates transcription driven by the product
of the Drosophila segment polarity gene dTCF. Cell, 1997. 88(6): p. 789-99.
141. Polakis, P., Wnt signaling and cancer. Genes Dev, 2000. 14(15): p. 1837-51.
142. Spink, K.E., P. Polakis, and W.I. Weis, Structural basis of the Axin-adenomatous
polyposis coli interaction. EMBO J, 2000. 19(10): p. 2270-9.
143. Tsukamoto, A.S., et al., Expression of the int-1 gene in transgenic mice is associated
with mammary gland hyperplasia and adenocarcinomas in male and female mice.
Cell, 1988. 55(4): p. 619-25.
144. Cato, A.C., D. Henderson, and H. Ponta, The hormone response element of the mouse
mammary tumour virus DNA mediates the progestin and androgen induction of
transcription in the proviral long terminal repeat region. EMBO J, 1987. 6(2): p.
363-8.
145. Lin, T.P., et al., Role of endocrine, autocrine, and paracrine interactions in the
development of mammary hyperplasia in Wnt-1 transgenic mice. Cancer Res, 1992.
52(16): p. 4413-9.
146. Cunha, G.R. and Y.K. Hom, Role of mesenchymal-epithelial interactions in
mammary gland development. J Mammary Gland Biol Neoplasia, 1996. 1(1): p. 21-
35.
147. Shackleford, G.M., et al., Mouse mammary tumor virus infection accelerates
mammary carcinogenesis in Wnt-1 transgenic mice by insertional activation of int-
2/Fgf-3 and hst/Fgf-4. Proc Natl Acad Sci U S A, 1993. 90(2): p. 740-4.
148. Kwan, H., et al., Transgenes expressing the Wnt-1 and int-2 proto-oncogenes
cooperate during mammary carcinogenesis in doubly transgenic mice. Mol Cell Biol,
1992. 12(1): p. 147-54.
149. Gavin, B.J., J.A. McMahon, and A.P. McMahon, Expression of multiple novel Wnt-
1/int-1-related genes during fetal and adult mouse development. Genes Dev, 1990.
4(12B): p. 2319-32.
150. Jakobovits, A., et al., Two proto-oncogenes implicated in mammary carcinogenesis,
int-1 and int-2, are independently regulated during mouse development. Proc Natl
Acad Sci U S A, 1986. 83(20): p. 7806-10.
151. Roelink, H. and R. Nusse, Expression of two members of the Wnt family during
mouse development--restricted temporal and spatial patterns in the developing neural
tube. Genes Dev, 1991. 5(3): p. 381-8.
178
152. DasGupta, R. and E. Fuchs, Multiple roles for activated LEF/TCF transcription
complexes during hair follicle development and differentiation. Development, 1999.
126(20): p. 4557-68.
153. Weber-Hall, S.J., et al., Developmental and hormonal regulation of Wnt gene
expression in the mouse mammary gland. Differentiation, 1994. 57(3): p. 205-14.
154. Gavin, B.J. and A.P. McMahon, Differential regulation of the Wnt gene family during
pregnancy and lactation suggests a role in postnatal development of the mammary
gland. Mol Cell Biol, 1992. 12(5): p. 2418-23.
155. Brisken, C., et al., Essential function of Wnt-4 in mammary gland development
downstream of progesterone signaling. Genes Dev, 2000. 14(6): p. 650-4.
156. Hsu, W., R. Shakya, and F. Costantini, Impaired mammary gland and lymphoid
development caused by inducible expression of Axin in transgenic mice. J Cell Biol,
2001. 155(6): p. 1055-64.
157. Lindvall, C., et al., The Wnt signaling receptor Lrp5 is required for mammary ductal
stem cell activity and Wnt1-induced tumorigenesis. J Biol Chem, 2006. 281(46): p.
35081-7.
158. Liu, B.Y., et al., The transforming activity of Wnt effectors correlates with their
ability to induce the accumulation of mammary progenitor cells. Proc Natl Acad Sci
U S A, 2004. 101(12): p. 4158-63.
159. Rosner, A., et al., Pathway pathology: histological differences between ErbB/Ras and
Wnt pathway transgenic mammary tumors. Am J Pathol, 2002. 161(3): p. 1087-97.
160. Li, Y., et al., Evidence that transgenes encoding components of the Wnt signaling
pathway preferentially induce mammary cancers from progenitor cells. Proc Natl
Acad Sci U S A, 2003. 100(26): p. 15853-8.
161. Van de Vijver, M.J. and R. Nusse, The molecular biology of breast cancer. Biochim
Biophys Acta, 1991. 1072(1): p. 33-50.
162. Ayyanan, A., et al., Increased Wnt signaling triggers oncogenic conversion of human
breast epithelial cells by a Notch-dependent mechanism. Proc Natl Acad Sci U S A,
2006. 103(10): p. 3799-804.
163. Hingorani, S.R. and D.A. Tuveson, Targeting oncogene dependence and resistance.
Cancer Cell, 2003. 3(5): p. 414-7.
164. Huguet, E.L., et al., Differential expression of human Wnt genes 2, 3, 4, and 7B in
human breast cell lines and normal and disease states of human breast tissue. Cancer
Res, 1994. 54(10): p. 2615-21.
165. Dale, T.C., et al., Compartment switching of WNT-2 expression in human breast
tumors. Cancer Res, 1996. 56(19): p. 4320-3.
166. Lejeune, S., et al., Wnt5a cloning, expression, and up-regulation in human primary
breast cancers. Clin Cancer Res, 1995. 1(2): p. 215-22.
167. Bui, T.D., et al., A novel human Wnt gene, WNT10B, maps to 12q13 and is expressed
in human breast carcinomas. Oncogene, 1997. 14(10): p. 1249-53.
168. Ozaki, S., et al., Alterations and correlations of the components in the Wnt signaling
pathway and its target genes in breast cancer. Oncol Rep, 2005. 14(6): p. 1437-43.
169. Lin, S.Y., et al., Beta-catenin, a novel prognostic marker for breast cancer: its roles
in cyclin D1 expression and cancer progression. Proc Natl Acad Sci U S A, 2000.
97(8): p. 4262-6.
179
170. Wissmann, C., et al., WIF1, a component of the Wnt pathway, is down-regulated in
prostate, breast, lung, and bladder cancer. J Pathol, 2003. 201(2): p. 204-12.
171. Ai, L., et al., Inactivation of Wnt inhibitory factor-1 (WIF1) expression by epigenetic
silencing is a common event in breast cancer. Carcinogenesis, 2006. 27(7): p. 1341-8.
172. Gunther, E.J., et al., A novel doxycycline-inducible system for the transgenic analysis
of mammary gland biology. FASEB J, 2002. 16(3): p. 283-92.
173. Gunther, E.J., et al., Impact of p53 loss on reversal and recurrence of conditional
Wnt-induced tumorigenesis. Genes Dev, 2003. 17(4): p. 488-501.
174. Gestl, S.A., et al., Dormant Wnt-initiated mammary cancer can participate in
reconstituting functional mammary glands. Mol Cell Biol, 2007. 27(1): p. 195-207.
175. Guy, C.T., R.D. Cardiff, and W.J. Muller, Activated neu induces rapid tumor
progression. J Biol Chem, 1996. 271(13): p. 7673-8.
176. Henry, M.D., et al., Parity-induced mammary epithelial cells facilitate tumorigenesis
in MMTV-neu transgenic mice. Oncogene, 2004. 23(41): p. 6980-5.
177. Guy, C.T., R.D. Cardiff, and W.J. Muller, Induction of mammary tumors by
expression of polyomavirus middle T oncogene: a transgenic mouse model for
metastatic disease. Mol Cell Biol, 1992. 12(3): p. 954-61.
178. Mok, E., T.V. Golovkina, and S.R. Ross, A mouse mammary tumor virus mammary
gland enhancer confers tissue-specific but not lactation-dependent expression in
transgenic mice. J Virol, 1992. 66(12): p. 7529-32.
179. Stamp, G., et al., Nonuniform expression of a mouse mammary tumor virus-driven
int-2/Fgf-3 transgene in pregnancy-responsive breast tumors. Cell Growth Differ,
1992. 3(12): p. 929-38.
180. Diamond, I., et al., Conditional gene expression in the epidermis of transgenic mice
using the tetracycline-regulated transactivators tTA and rTA linked to the keratin 5
promoter. J Invest Dermatol, 2000. 115(5): p. 788-94.
181. Vassar, R., et al., Tissue-specific and differentiation-specific expression of a human
K14 keratin gene in transgenic mice. Proc Natl Acad Sci U S A, 1989. 86(5): p. 1563-
7.
182. Tumbar, T., et al., Defining the epithelial stem cell niche in skin. Science, 2004.
303(5656): p. 359-63.
183. Kanda, T., K.F. Sullivan, and G.M. Wahl, Histone-GFP fusion protein enables
sensitive analysis of chromosome dynamics in living mammalian cells. Curr Biol,
1998. 8(7): p. 377-85.
184. Hadjantonakis, A.K. and V.E. Papaioannou, Dynamic in vivo imaging and cell
tracking using a histone fluorescent protein fusion in mice. BMC Biotechnol, 2004. 4:
p. 33.
185. Grimm, S.L., et al., Keratin 6 is not essential for mammary gland development.
Breast Cancer Res, 2006. 8(3): p. R29.
186. Teuliere, J., et al., Targeted activation of beta-catenin signaling in basal mammary
epithelial cells affects mammary development and leads to hyperplasia.
Development, 2005. 132(2): p. 267-77.
187. Visvader, J.E., Keeping abreast of the mammary epithelial hierarchy and breast
tumorigenesis. Genes Dev, 2009. 23(22): p. 2563-77.
188. Yang, M., et al., Facile whole-body imaging of internal fluorescent tumors in mice
with an LED flashlight. Biotechniques, 2005. 39(2): p. 170, 172.
180
189. Daniel, C.W., G.B. Silberstein, and P. Strickland, Direct action of 17 beta-estradiol
on mouse mammary ducts analyzed by sustained release implants and steroid
autoradiography. Cancer Res, 1987. 47(22): p. 6052-7.
190. Brennand, K., D. Huangfu, and D. Melton, All beta cells contribute equally to islet
growth and maintenance. PLoS Biol, 2007. 5(7): p. e163.
191. Waghmare, S.K., et al., Quantitative proliferation dynamics and random chromosome
segregation of hair follicle stem cells. EMBO J, 2008. 27(9): p. 1309-20.
192. Debies, M.T., et al., Tumor escape in a Wnt1-dependent mouse breast cancer model
is enabled by p19Arf/p53 pathway lesions but not p16 Ink4a loss. J Clin Invest, 2008.
118(1): p. 51-63.
193. Zhou, B.P. and M.C. Hung, Dysregulation of cellular signaling by HER2/neu in
breast cancer. Semin Oncol, 2003. 30(5 Suppl 16): p. 38-48.
194. Vaillant, F., et al., The mammary progenitor marker CD61/beta3 integrin identifies
cancer stem cells in mouse models of mammary tumorigenesis. Cancer Res, 2008.
68(19): p. 7711-7.
195. Gretschel, S., et al., Markers of tumour angiogenesis and tumour cells in bone
marrow in gastric cancer patients. Eur J Surg Oncol, 2008. 34(6): p. 642-7.
196. Allgayer, H. and J.A. Aguirre-Ghiso, The urokinase receptor (u-PAR)--a link between
tumor cell dormancy and minimal residual disease in bone marrow? APMIS, 2008.
116(7-8): p. 602-14.
197. Reya, T., et al., Stem cells, cancer, and cancer stem cells. Nature, 2001. 414(6859): p.
105-11.
198. Lyons, W.R., Sako, Y., Direct action of estrone on the mammary gland. Proceedings
of the Society for Experimental Biology and Medicine, 1940. 44: p. 398-401.
199. Deugnier, M.A., et al., Myoepithelial cell differentiation in the developing mammary
gland: progressive acquisition of smooth muscle phenotype. Dev Dyn, 1995. 204(2):
p. 107-17.
200. Matulka, L.A., A.A. Triplett, and K.U. Wagner, Parity-induced mammary epithelial
cells are multipotent and express cell surface markers associated with stem cells. Dev
Biol, 2007. 303(1): p. 29-44.
201. Boulanger, C.A., K.U. Wagner, and G.H. Smith, Parity-induced mouse mammary
epithelial cells are pluripotent, self-renewing and sensitive to TGF-beta1 expression.
Oncogene, 2005. 24(4): p. 552-60.
202. Creamer, B.A., A.A. Triplett, and K.U. Wagner, Longitudinal analysis of
mammogenesis using a novel tetracycline-inducible mouse model and in vivo
imaging. Genesis, 2009. 47(4): p. 234-45.
203. Cotsarelis, G., et al., Existence of slow-cycling limbal epithelial basal cells that can
be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell,
1989. 57(2): p. 201-9.
204. Barker, N., M. van de Wetering, and H. Clevers, The intestinal stem cell. Genes Dev,
2008. 22(14): p. 1856-64.
205. Calabrese, C., et al., A perivascular niche for brain tumor stem cells. Cancer Cell,
2007. 11(1): p. 69-82.
206. Li, L. and T. Xie, Stem cell niche: structure and function. Annu Rev Cell Dev Biol,
2005. 21: p. 605-31.
181
207. Lin, H., The stem-cell niche theory: lessons from flies. Nat Rev Genet, 2002. 3(12): p.
931-40.
208. Bussard, K.M., et al., Reprogramming human cancer cells in the mouse mammary
gland. Cancer Res, 2010. 70(15): p. 6336-43.
209. Morrison, J.I., et al., Salamander limb regeneration involves the activation of a
multipotent skeletal muscle satellite cell population. J Cell Biol, 2006. 172(3): p. 433-
40.
210. Sobkow, L., et al., A germline GFP transgenic axolotl and its use to track cell fate:
dual origin of the fin mesenchyme during development and the fate of blood cells
during regeneration. Dev Biol, 2006. 290(2): p. 386-97.
211. Kragl, M., et al., Cells keep a memory of their tissue origin during axolotl limb
regeneration. Nature, 2009. 460(7251): p. 60-5.
182
Appendix: Flow Cytometric Analysis Demonstrates Variability of LRCs in MMTV-
Wnt1 Induced Mammary Tumor Explants, Additional Samples
Single cells isolated from primary mammary tumors of MMTV-rtTA/MMTV-Wnt1/TGFP
tritransgenic tumor explants were analyzed for GFP content by flow cytometry. Each graph
is an individual tumor generation with sequential generations appearing in the same column.
The arrow depicts the lineage of a tumor that was re-explanted from frozen storage. Never
Dox animals appear in Blue, Pulsed tumors are Magenta, and pulse then chased tumors
appear in both Black and Yellow. Wide variability of both extent of GFP labeling during
pulse and amount of GFP signal dilution during off-Dox chase can be visualized.
183
184
Vita Jessica (Biddle) Mathers
Education
Ph.D. Candidate, Intercollege Graduate Degree Program in Genetics 2003-2011
The Pennsylvania State University College of Medicine, Hershey, PA
B.S. in Biology and International Studies with a minor in Spanish 1999-2003
The Pennsylvania State University and the Schreyer Honors College, University Park, PA
Honors Thesis: Characterization of a Novel Two-Component Signaling System in
Bordetella sps Thesis Advisor: Eric T. Harvill, Ph.D.
Honors and Service
Graham Endowed Graduate Fellowship 2003
the Pennsylvania State University, Graduate School
Junior Mentor, SURIP Program 2007
Symposium Organizer 2007
5th
Annual Genetics Intercollege Graduate Degree Program Symposium
Undergraduate Research Grant 2002
the Pennsylvania State University, College of Agriculture
Academic Excellence Scholarship 1999-2003
the Pennsylvania State University, Schreyer Honors College
Posters and Publications
Jessica Mathers, Shelley Gestl, Dan Beachler, and Edward Gunther. A Transgenic Model
for Short-Term Tracking of Mammary Epithelial Cell Fates During Pregnancy in Mice
(manuscript in preparation)
Michael T. Debies, Shelley A. Gestl, Jessica L. Mathers, Oliver R. Mikse, Travis L.
Leonard, Susan E. Moody, Lewis A. Chodosh, Robert D. Cardiff and Edward J. Gunther
(2008). Tumor escape in a Wnt1-dependent mouse breast cancer model is enabled by
p19Arf
/p53 pathway lesions but not p16Ink4a
loss. Journal of Clinical Investigation
2008;118(1):51–63
Jessica Mathers, Shelley Gestl, Edward Gunther. Identification of Quiescent Cells in a
Mouse Model of Dormant Mammary Cancer. International Society for Stem Cell Research,
Philadelphia, PA July 2008
Jessica Mathers and Edward Gunther. A Strategy for Labeling Viable, Infrequently Cycling
Cells in the Mouse Mammary Gland. Keystone Symposia: Stem Cells and Cancer, Keystone,
CO March 2007
Shelley A. Gestl, Travis L. Leonard, Jessica L. Biddle, Michael T. Debies, and Edward
J. Gunther (2007). Molecular and Cellular Biology 2007;27(1):195-207
Jessica Biddle and Eric T. Harvill. Characterization of a Novel Two-Component Signaling
System in Bordetella sps. American Society for Microbiology Annual Meeting, Washington,
DC May 2003