Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a...
Transcript of Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a...
![Page 1: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/1.jpg)
ORIGINAL ARTICLE
Towards a phylogeny for Astragalus section Caprini (Fabaceae)and its allies based on nuclear and plastid DNA sequences
Mehrshid Riahi • Shahin Zarre • Ali Aasghar Maassoumi •
Shahrokh Kazempour Osaloo • Martin F. Wojciechowski
Received: 7 August 2010 / Accepted: 28 January 2011 / Published online: 15 March 2011
� Springer-Verlag 2011
Abstract We conducted phylogenetic analyses of the
sect. Caprini and its closely related sections within
Astragalus. Analyses of a combined dataset including
nrDNA ETS and three cpDNA markers using maximum
parsimony and Bayesian inference from 44 species of sect.
Caprini and its allied taxa yielded congruent relationships
among several major lineages. These results largely dis-
agree with previously recognized taxonomic groups, most
notably in the following ways: (1) subsects. Caprini and
Purpurascentes of sect. Caprini are not natural groups; (2)
sects. Alopecuroidei and Laxiflori are nested within sect.
Astragalus; and (3) subsect. Chronopus constitutes a sep-
arate phylogenetic lineage. Representatives of sects.
Astragalus, Alopecuroidei, and Laxiflori share a common
ancestor with that of sect. Caprini. Our studies indicate that
Astragalus annularis is an outlier species for the genus
Astragalus and sect. Caraganella is the first-diverging
clade within the genus Astragalus. Results of these analy-
ses are supported by morphology and suggest the need for
new taxonomic delimitations, which are forthcoming. Key
morphological characters were mapped onto the phyloge-
netic tree and discussed.
Keywords Astragalus � sect. Alopecuroidei � sect.
Caprini � sect. Laxiflori � cpDNA � ETS rDNA
Introduction
Astragalus L. (Fabaceae), with over 2,500 species world-
wide, is the largest genus of flowering plants (Mabberley
2008) and phylogenetically belongs to the IRLC (inverted
repeat-lacking clade) of Fabaceae (Wojciechowski et al.
1999, 2000; Wojciechowski 2005; Kazempour Osaloo
2007). The species of the genus are distributed almost
throughout the world except for Australia (Lewis et al. 2005).
Section Caprini DC., with about 280 species, is the largest
of 150 accepted sections that comprise Old World Astraga-
lus (Podlech 1986, 1988; Maassoumi 1998). The majority of
species of sect. Caprini occur in subalpine and alpine areas of
northern Eurasia, from Western Europe and North Africa to
Central Asia where the highest diversity occurs in Afghan-
istan. Iran could be considered as a secondary center of
species diversity (Podlech 1986) of the section. These spe-
cies form important elements of mountain steppe vegetation
in these regions and include a number of important forage
plants (Maassoumi 1989). Section Caprini is morphologi-
cally unique in the genus in having basifixed hairs; thickly
textured unilocular, bilocular, or semi-bilocular legumes; as
well as relatively large yellow flowers arranged in rather
few-flowered short inflorescences.
Section Caprini was established by De Candolle (1825),
but on the basis of morphological characters, the section
has been subdivided into informal groups by different
M. Riahi � S. Zarre (&)
Department of Plant Sciences, School of Biology,
College of Science, University of Tehran,
P.O. Box 14155-6455, Tehran, Iran
e-mail: [email protected]
A. A. Maassoumi
Department of Botany, Research Institute of Forests
and Rangelands, P.O. Box 13185-116, Tehran, Iran
S. Kazempour Osaloo
Department of Plant Biology, Faculty of Biological Sciences,
Tarbiat Modares University, P.O. Box 14115-175, Tehran, Iran
M. F. Wojciechowski
School of Life Sciences, Arizona State University, Tempe,
AZ 85287, USA
123
Plant Syst Evol (2011) 293:119–133
DOI 10.1007/s00606-011-0417-3
![Page 2: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/2.jpg)
authors (Bunge 1869; Goncharov et al. 1965). A compre-
hensive taxonomic treatment covering all species in the
section was performed by Podlech (1988), who recognized
the following subsections, each organized further into
informal groups: (1) Caprini, with morphologically heter-
ogeneous species (ca. 180 spp.); (2) Goncharovaliella
(Kamelin) Podlech, with three to eight series of verticillate
leaflets (ca. 16 spp.); (3) Erionotus (Bunge) Podlech, with a
cotton-like indumentum on the upper surface of leaflets (ca.
15 spp.); and (4) Purpurascentes Podlech, with the floral
keel petal very finely toothed on its upper margins (ca. 70
spp.). The delimitations of these informal groups were
mainly based on combinations of vegetative and repro-
ductive character states, such as the presence of a legume
stipe, indumentum of the inflorescence, and presence of a
septum in the fruit. Although taxonomic treatments of the
Iranian species were published by Maassoumi (1989,
2003), in the absence of an infrasectional classification of
sect. Caprini, the debate about group delimitation and
phylogeny of sect. Caprini remains unresolved.
The only molecular systematic analyses of Old World
Astragalus using DNA sequences of the nuclear internal
transcribed spacer (ITS) and plastid gene ndhF sequences
indicated eight monophyletic large groups (named ‘‘A’’ to
‘‘H’’; Kazempour Osaloo et al. 2003, 2005), which do not
overlap with the previous subgeneric classification of the
genus (Bunge 1868; Podlech 1982). Among these eight
clades, clade ‘‘A’’ is the most basal and includes repre-
sentatives of 13 sections with Caprini as the largest one.
These earlier molecular studies included only a few taxa of
sect. Caprini (9 out of 280 spp.) and provided only limited
insight into phylogenetic relationships of sect. Caprini. A
close relationship between the species of sect. Caprini and
other sections of clade A (Kazempour Osaloo et al. 2003,
2005), i.e., sects. Laxiflori Kirchhoff, Alopecuroidei DC.,
Astragalus, Aegacantha Bunge, as well as Eremophysa
Bunge, has been suggested in previous monographs of
these sections (Deml 1972; Agerer-Kirchhoff 1976; Ager-
er-Kirchhoff and Agerer 1977; Ott 1978; Podlech 1986).
Sect. Caraganella (Bunge) represents a very ancient paleo-
xeromorphic taxon of the genus with no close relative
within Astragalus (Podlech 1975, 1998). However, based
on molecular studies (Kazempour Osaloo et al. 2003,
2005), the phylogenetic relationships between these sec-
tions remained largely unclear due to large polytomies and
low support of the groups. The most important conclusions
drawn from these results are that sect. Caprini is (1) not
monophyletic and (2) forms a weakly supported group with
one representative each of sect. Pendulina Gontsch. and
sect. Aegacantha. In addition, subsect. Erionotus is
monophyletic, and all representatives of sects. Astragalus,
Eremophysa, Alopecuroidei, and Laxiflori constitute a
single clade with low internal resolution.
Hitherto no molecular phylogenetic study has focused
on the species-rich section Caprini. This paper reports
phylogenetic analyses of the nuclear ribosomal external
transcribed spacer (ETS) and the three plastid markers, the
trnY (GUA)-trnT (GGU) (trnY/T) region, the trnS (GCU)-
trnG (UCC) (trnS/G) region, and the psbA-trnH spacer for
44 species of sect. Caprini and its allies. ETS and two
plastid spacers (trnS/G and psbA-trnH) have not been used
previously for phylogenetic analysis in Astragalus. The
main purposes of the study are (1) to examine the evolu-
tionary relationships within sect. Caprini and among sect.
Caprini and other closely related sects. Astragalus,
Alopecuroidei, Laxiflori, and Caraganella; (2) to determine
if sect. Caprini is monophyletic and to identify mono-
phyletic units within this section; (3) to determine whether
the phylogeny based on molecular data is congruent with
the current classification and the evolutionary sequence
proposed (Podlech 1982, 1999); and (4) to trace the evo-
lution of some taxonomically important morphological
features in order to assess their value in revealing phylo-
genetic relationships. While the main focus of this study is
on sect. Caprini, we have included A. annularis Forssk. to
examine the position of this species as a potential outlier
for the genus Astragalus and to evaluate the previous
studies on the position of this species (Kazempour Osaloo
et al. 2005; Wojciechowski 2005).
Materials and methods
Taxon sampling
A total of 44 taxa were included in this study (Appendix).
Sectional information and total species numbers are based
on Podlech (1986, 1988). Our sampling strategy focused on
sect. Caprini and included a set of 30 species belonging to
three out of four subsections of sect. Caprini. Our sampling
included representatives from 13 of 52 informal groups.
We emphasized taxon sampling in large species groups in
order to examine the monophyly of these groups. Species
were selected to give more complete representation of the
morphological range of the section. Multiple accessions
were sampled for A. pinetorum subsp. pinetorum to assess
possible intraspecific variation in this widespread species.
A second focus was on the closely related sects.
Astragalus, Alopecuroidei, Laxiflori, and Caraganella.
However, we did not sample from sects. Aegacantha and
Pendulina (endemic to Afghanistan), for which material
was not available. The sampling in sect. Alopecuroidei
aimed to encompass almost all species groups (three out of
four species groups) (Ranjbar et al. 2002) and included 4
out of 33 species belonging to sect. Alopecuroidei. We
sampled 1 of 3 species of sect. Caraganella, 1 of 7 species
120 M. Riahi et al.
123
![Page 3: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/3.jpg)
of sect. Laxiflori, 2 of 16 species of subsect. Chronopus,
and 1 of 40 species of subsect. Astragalus. Species were
intended to represent the whole morphological range of the
sections. It was felt that the final sample size (except in
subsect. Astragalus) was sufficient to test the monophyly of
each section and to clarify the phylogenetic relationships
between them.
According to previous phylogenetic studies on the genus
Astragalus, one species of each of the following genera,
Colutea (C. buhsei [Boiss.] Shap.), Oxytropis (O. aucheri
Boiss.), Halimodendron (H. halodendron [Pall.] Voss.),
and Chesneya (C. astragalina Jaub. & Spach) was selected
as a member of the outgroup (Sanderson and Wojcie-
chowski 1996; Kazempour Osaloo et al. 2005).
Character-state optimization
Based on principal morphological criteria for delimitation
of sections and subsections, six morphological characters
were selected for optimization on the combined molecular
phylogeny by using Mesquite version 1.12 (Maddison and
Maddison 2006) to allow for discussion of the evolution of
these characters in a phylogenetic context. Morphological
features (listed below in Fig. 4) were scored from speci-
mens in the collection of the Central Herbarium of Uni-
versity of Tehran (TUH). Three of these characters have
two states and others are multistate.
Molecular methods
Total genomic DNA was extracted from specimens fol-
lowing the CTAB extraction protocol (Murray and
Thompson 1980) with modifications in which a lower
EDTA concentration (20 mM instead of 50 mM) and a
higher b-mercaptoethanol concentration (1% instead of
0.4%) in the extraction buffer was used (Riahi et al. 2010).
Sequences of the PCR primers, with corresponding refer-
ences, are listed in Table 1. The four plastid regions were
amplified in three fragments. The trnY-T spacer and trnY
intron were amplified together as the trnY/T fragment
using primers of trnT and trnY. The trnS/G spacer was
amplified using primers of trn S and trn G. The psbA-trnH
spacer was amplified using psbA and trnH primers.
The PCR reaction was performed in a 40 ll volume for
cp DNA products and in a 25 ll volume for nr DNA ETS
products containing 19 PCR buffer, 1.5 mM MgCl2,
0.1 mM of each dNTP, and 1 unit of Taq DNA polymerase
(Fermentas, Thermo Fisher Scientific). PCR procedures for
the three cpDNA regions were as follows: 3 min at 94�C,
35 cycles of 1 min at 94�C, 1 min at 53–61�C, 2 min at
72�C, and terminal elongation of 7 min at 72�C. For the
ETS region, PCR cycling parameters were 2 min at 94�C,
35 cycles of 1 min at 94�C, 1 min at 60�C, 2 min at 72�C,
and 5 min terminal elongation. For some taxa, a touch-
down PCR profile was used to eliminate nonspecific
product. The profile was set as follows: 94�C for 2 min; 2
cycles of 94�C 1 min, 60�C for 1 min and 72�C for 2 min,
followed by 12 cycles at decreasing annealing temperature
in decrements of 1�C per 2 cycles, then 1 min at 94�C, 20
cycles of 1 min at 54�C, 2 min at 72�C, and final extension
at 72�C for 5 min. Amplified PCR products were purified
using QIAquick PCR Purification kits (QIAGEN, Hilden,
Germany) and sequenced using the ABI Big-Dye Ready
Reaction kit with an ABI 3730xl DNA Analyzer 96 cap-
illary automated sequencer (Applied Biosystems, USA).
The resulting chromatograms were analyzed using the
program ChromasPro 1.41 (Technelysium).
Sequence alignment and indel coding
Each DNA region was aligned using MUSCLE under
default parameters (Edgar 2004). Obvious alignment errors
were edited manually using Mesquite version 1.12
(Maddison and Maddison 2006). A few sequences were not
obtained due to difficulties with the PCR, in which not all
DNA fragments for the particular species were sequenced.
These sequences were treated as missing data. Of the
75,856 cells in the aligned combined data matrix, 4,982
Table 1 Primers used for PCR and sequencing
Region Name F/R Sequence (50–30) Mode Reference
ETS 18S-ETS R ACTTACCACTGCATGGCTTAATCT P Baldwin and Markos (1998)
ETS-cic2F F GGATTTAATTTGTCATGCT P, S Javadi et al. (2007)
trnY/T trnT (GGU) F CTACCACTGAGTTAAAAGGG P Shaw et al. (2005)
trn Y (GUA) R CCGAGCTGGATTTGAACCA P, S Shaw et al. (2005)
trnS/G trnS F GATTAGCAATCCGCCGCTTT P Xu et al. (2000)
trnG R TTACCACTAAACTATACCCGC P, S Xu et al. (2000)
psbA-trnH psbA F ACTGCCTTGATCCACTTGGC P Hamilton (1999)
trnH R CGAAGCTCCATCTACAATGG P, S Hamilton (1999)
F Forward, R reverse, P PCR amplification, S sequencing
Phylogeny of Astragalus sect. Caprini (Fabaceae) 121
123
![Page 4: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/4.jpg)
(6.5%) cells were scored as missing. Gaps within the
sequence data were treated as missing. However where
indels were shared by two or more ingroup taxa and could
be aligned unequivocally, they were treated as phyloge-
netically informative. Gaps of 2 base pairs (bp) or less were
removed because previous analyses of these regions dem-
onstrated that indels longer than 2 bp are not very prone to
parallelism. Indels of 3 bp and longer were coded as
independent, single, binary characters following Simmons
and Ochoterena (2000) and appended to the sequence
datasets for phylogenetic analyses. Corrected pairwise
sequence divergence per site for each nrDNA and plastid
marker was calculated for the dataset based on the best-fit
model of nucleotide sequence substitution as determined
by Akaike information criterion (AIC) method in Model-
test v. 3.06 (Posada and Crandall 1998).
Phylogenetic analyses
The DNA sequences from each molecular marker were
analyzed separately and combined in a final analysis. The
incongruent length difference (ILD) test (Farris et al. 1994)
was performed to test the combinability of the four DNA
regions. Phylogenetic analyses were conducted using
PAUP*4.0b10 (Swofford 2002) for maximum parsimony
(MP) and maximum likelihood (ML) and MrBayes version
3.1.2 (Ronquist and Huelsenbeck 2003) for Bayesian infer-
ence (BI). MP and BI analyses were conducted on both
separate and combined (total evidence analysis) datasets. For
MP analyses, heuristic searches were performed with 1,000
replicates of random stepwise addition and tree bisection
reconnection (TBR) branch swapping with the MULTREES
option in effect. In order to prevent PAUP* from crashing,
the options CHUCK and CHUCKSCORE were used. Sup-
port for individual clades was determined by bootstrap
analyses (Felsenstein 1985) of 1,000 replicates, each with 10
random stepwise addition replicates and TBR branch
swapping with MULTREES on. All equally most parsimo-
nious trees were summarized into a strict consensus tree.
The ML analyses were conducted using a heuristic
search, invoking the as-is option in PAUP*. The substitu-
tion models for ML and Bayesian analyses were obtained
using Modeltest v. 3.06 applying the AIC method. TVM
with gamma distribution rates was identified as best fitting
the sequence data of ETS. For the trnS/G region, TVM?I
was identified as the best fitting model and K81uf?G as the
best model for the trnT/Y and the combined dataset. For
the combined plastid dataset (the three plastid markers), a
K81uf?I?G model was used and for the combined
molecular dataset (nuclear and plastid dataset together), a
K81uf?G model. The gaps recoded as binary data were
analyzed under the F81 evolutionary model (Felsenstein
1981), according to Ronquist et al. (2005).
The BI analyses were conducted using the selected
model of evolution (with uniform priors) and four chains
(one cool and three heated). Chains were allowed to run for
1.0 9 106 generations, and trees were sampled from the
cool chain every 100 generations. In all analyses average
standard deviation of split frequencies had dropped sig-
nificantly below 0.01 (about 0.006) after completion of the
generations. After discarding trees yielded before likeli-
hood stationary (burn-in = 2,000), the remaining 8,000
trees were summarized in a 50% majority rule consensus
tree, using posterior probabilities (PP) as a measure of
clade support.
Test of hypothesis and alternative topology
We used the SH test (Shimodaira and Hasegawa 1999)
to compare the best ML trees recovered from analyses of
the combined molecular data with the constraint topol-
ogies based on existing hypotheses of the monophyly for
each of the two sections Astragalus and Alopecuroidei
constructed in Treeview version 1.6.6 (Page 1996). The
trees were loaded as a backbone into PAUP*. Heuristic
searches were conducted using the ML parameters out-
lined above to find the shortest trees compatible with
constraint. The likelihood score of the best ML tree was
then compared with the score of the best ML tree using
the one-tailed nonparametric SH tests. As a result, the
nuclear gene tree indicates Astragalus is not monophy-
letic, in conflict with the cpDNA tree and morphological
evidence (see the ‘‘Discussion’’ section). The SH test
was performed on the nrDNA ETS dataset to test whe-
ther anomalous placement of A. annularis is significantly
favored over the phylogenetic hypothesis that other evi-
dence suggests.
Results
Aligned DNA sequences
The length and composition of each DNA region
sequenced, as well as the tree statistics from separate and
combined analyses of the four regions, are summarized in
Table 2. Sequence identity for amplified ETS was con-
firmed by comparison with the sequences obtained from
Medicago rigidula (L.) All. and Vicia sativa L. available in
GenBank. No evidence of paralogous sequences was found
for ETS sequences because all PCR products were resolved
as a single band and no polymorphisms due to SNPs pro-
cesses could be identified in sequencing (Brumfield et al.
2003). After introducing gaps and eliminating ambiguous
characters, a 543 bp matrix was generated. Gaps were not
included in the analyses as binary characters.
122 M. Riahi et al.
123
![Page 5: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/5.jpg)
For plastid regions, sequence identity was confirmed
by comparison with the corresponding loci in A. canad-
ensis L., A. coluteocarpus Boiss., and Medicago trunca-
tula Gaertn. available in GenBank. In trnS/G, there was a
section between 320 and 620 bp that could not be
sequenced due to presence of a large poly A/T region. A
poly-A/T tail of 80–100 bp was also detected in all out-
group species and one Astragalus species (A. reshadensis
Podlech). For these, raw forward and reverse sequences
were assembled. The cpDNA regions were aligned with
low ambiguity, although numerous gaps were introduced.
A number of large indels were observed in the psbA-trnH
intergeneric spacer (IGS). There was a large deletion of
115 bp in all Astragalus species except in A. reshadensis.
In trnS/G alignment, A. pseudobrachystachys Sirj. &
Rech. f., A. mozaffarianii Maassoumi, A. kashmarensis
Maassoumi & Podlech, A. nephtonensis Freyn, and A.
macropelmatus Podlech shared an identical insertion of
14 bp. Topologies were unaffected when these indels
were excluded from analyses (data not shown). Following
exclusion of all ambiguous sites, the final aligned length
of the cpDNA data was 1,112 bp, and 11 gaps were
included in the analyses as binary characters. The
matrices are available as NEXUS files upon an email
request to the first author.
Multiple accessions were sampled for A. pinetorum
subsp. pinetorum to assess possible intraspecific variation
in this widespread species. In this case sequences were
identical and only one of them was used for the phyloge-
netic reconstruction.
Individual DNA analyses
For each of the four datasets analysed in this study, MP and
ML ingroup topologies were identical to those obtained
under Bayesian analyses.
The nrDNA ETS dataset placed A. annularis as the
sister taxon (BS = 70%, PP = 1.00) to a clade composed
of Colutea buhsei and Oxytropis aucheri. Relationships
between remaining clades were largely unresolved and
unsupported with regard to the ingroup topology (Fig. 1).
In general, topology of all three plastid datasets as well as
the combined plastid dataset was congruent (Fig. 2).
In the combined plastid dataset analyses, Astragalus
formed a monophyletic group with high support. Within
the Astragalus clade, two species of subsect. Chronopus
Table 2 Data set and tree statistics from separate and combined analyses of the nuclear and three chloroplast regions
Nuclear (NR) sequences Plastid (CP) sequences NR ? CP
ETS trnT/Y trnS/G psbA-trnH Combined
CP
Sequences (n) 43 43 43 35 44 44
Length range (bp) 530–565 598–650 330–670 129–402 NA NA
Aligned length (including informative indels) (bp) 543 549 370 193 1,112 1,655
GC content mean, ingroup (%) 50 31.6 29.1 24.0 29.8 35.9
GC content mean, outgroup included (%) 49.7 31.7 66.9 24.3 29.8 35.9
Sequence divergence, ingroup (%) 0.00–17.5 0.00–4.57 0.00–7.73 0.00–6.24 0.00–5.19 0.00–8.70
Sequence divergence, outgroup included (%) 7.06–36.54 1.69–78.99 4.76–32.12 5.79–52.55 5.06–68.98 5.40–40.39
Average sequence divergence, ingroup (%) 8.75 2.28 3.86 3.12 2.59 4.35
Average sequence divergence, outgroup included (%) 14.28 38.65 13.68 23.38 31.96 19.32
Variable sites, ingroup (n) 122 59 54 20 133 262
Variable sites, outgroup included (n) 238 186 111 97 394 639
Potentially informative characters, ingroup (%) 31 24 28 9 61 99
Potentially informative characters, outgroup (%) 108 50 48 40 138 235
Unambiguously coded indels (n) NA 8 2 1 11 11
Coded indel size range (bp) NA 1–8 1–3 3 1–8 1–8
Ratio of coded indels to potentially informative sites NA 1:6 1:24 1:40 1:12 1:21
CI of MPTs 0.83 0.88 0.84 0.89 0.82 0.81
CI of MPTs (excluding uninformative characters) 0.72 0.71 0.71 0.79 0.64 0.65
RI of MPTs 0.78 0.84 0.85 0.83 0.76 0.74
Number of MPTs 1,110 363 8,500 6 92,900 98,200
Length of MPTs 337 233 157 128 552 917
CI Consistency index, RI retention index, MPTs most parsimonious trees, NA not applicable
Phylogeny of Astragalus sect. Caprini (Fabaceae) 123
123
![Page 6: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/6.jpg)
included in our analysis were resolved together in a sup-
ported group, while all members of sect. Astragalus sub-
sect. Astragalus as well as sects. Laxiflori and
Alopecuroidei formed a well resolved clade. Furthermore,
A. citrinus Bunge was the first-diverging clade within sect.
Caprini (Fig. 2, PP = 0.58) along with A. rufescens Freyn
(Fig. 2, PP = 0.65). These two species formed the sister
group to all species of sect. Caprini.
Fig. 1 Strict consensus tree
obtained from analysis of
nrDNA ETS sequences of
Astragalus sect. Caprini and its
allies. Nonparametric bootstrap
values of [50% from 1,000
replicates and Bayesian
posterior probabilities are
indicated above and below thebranches, respectively
124 M. Riahi et al.
123
![Page 7: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/7.jpg)
Combined DNA analyses
Trees derived from separate analyses of each of the plastid
and nuclear DNA regions were shown to be significantly
incongruent according to the ILD test (P = 0.01). How-
ever, the topologies obtained were congruent at a confi-
dence limit of 70% BS, exemplifying the difference
between characters and topological incongruences (Allard
and Carpenter 1996). Because no hard incongruence was
found, the inclusion of all DNA regions into a single
analysis should maximize the explanatory power regardless
of the level of character incongruence between datasets
detected with the ILD (Yoder et al. 2001; Darlu and Le-
cointre 2002; Hipp et al. 2004).
Parsimony analysis and Bayesian inference gave very
similar results. The strict consensus tree is shown in Fig. 3.
Fig. 2 Fifty percent majority
rule consensus tree derived from
analysis of the combined plastid
trnY/T, trnS/G, and psbA-trnH
sequences of Astragalus sect.
Caprini and its allies.
Nonparametric bootstrap values
of [50% from 1,000 replicates
and Bayesian posterior
probabilities are indicated aboveand below the branches,
respectively
Phylogeny of Astragalus sect. Caprini (Fabaceae) 125
123
![Page 8: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/8.jpg)
Fig. 3 Strict consensus tree
resulting from phylogenetic
analysis [tree length, 917 steps;
consistency index (CI), 0.81;
retention index (RI), 0.74] of
combined cpDNA and nrDNA
ETS sequences of Astragalussect. Caprini and its allies.
Nonparametric bootstrap values
of [50% from 1,000 replicates
and Bayesian posterior
probabilities are indicated aboveand below the branches,
respectively. Informal groups of
sect. Caprini are indicated
before the species name with asymbol
126 M. Riahi et al.
123
![Page 9: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/9.jpg)
Coding of indels as binary characters generally increased
the statistical support for the clades, both in the MP and
Bayesian analyses.
A. annularis is the first-diverging lineage (Fig. 3,
BS = 97%, PP = 1.00), followed by A. reshadensis
(Fig. 3, BS = 100%, PP = 1.00). A. reshadensis formed
the sister clade to sects. Astragalus, Alopecuroidei, and
Laxiflori, which received weak support (Fig. 3, BS = 62%,
PP = 0.54). Phylogenetic relationships among species of
the sects. Astragalus, Alopecuroidei, and Laxiflori were
fully resolved and comprised two subclades. One of them
was formed by members of sect. Astragalus subsect.
Chronopus with high support (Fig. 3, BS = 100%,
PP = 1.00), the other, also with high support (Fig. 3,
BS = 92%, PP = 1.00), included all representatives of
sect. Astragalus subsect. Astragalus, as well as sects.
Alopecuroidei and Laxiflori.
The species of Caprini analyzed here constitute a single
clade (clade Caprini) (Fig. 3, BS = 72%, PP = 1.00),
indicating that this section is monophyletic. The two sub-
sects. Caprini and Purpurascentes were not monophyletic;
the species of subsect. Purpurascentes, i.e., A. rufescens, A.
macroplematus, A. kashmarensis, and A. nephtonensis,
were placed among the species of subsect. Caprini. Infor-
mal groups were also not monophyletic, as some members
of a certain informal group nested within a clade including
the majority of species belonging to other groups (Fig. 3).
In clade Caprini, A. citrinus, A. rufescens, the group
formed by A. antalyensis A. Duran & Podlech and A.
pellitus Bunge, and the group that included the remaining
species from sect. Caprini constitute a polytomy. In this
clade, A. pseudoibicinus Maassoumi & Podlech, A. ker-
manschahensis Bornm., and A. gypsicolus Maassoumi &
Mozaffarian formed a weakly supported group (Fig. 3,
PP = 0.86) that is sister to another weakly supported group
(Fig. 3, PP = 0.61) comprising the other 23 analyzed taxa
of sect. Caprini. Although relationships within the Caprini
clade were largely unresolved and unsupported, some
species of sect. Caprini formed seven well to moderately
supported groups (A1–A7) (Fig. 3).
Discussion
The present study represents the most comprehensive
phylogenetic analysis of Astragalus sect. Caprini based on
three plastid markers as well as nrDNA ETS sequences.
Although taxon sampling was limited, the three subsections
found in Iran, the presumed secondary center of diversity
of sect. Caprini (Podlech 1986), and representatives of
other sections that have been considered to be closely
related, are represented. The results of the phylogenetic
reconstruction performed here are significant at various
levels, despite incomplete resolution in sect. Caprini, and
are discussed below.
Relationships among sects. Caraganella, Astragalus,
Alopecuroidei, and Laxiflori
In agreement with previous phylogenetic studies in
Astragalus based on combined analysis of plastid trnL-F
and ndhF as well as nrDNA ITS sequences (Kazemi et al.
2009), the results presented here show A. reshadensis, a
representative of sect. Caraganella, as the first-diverging
lineage within clade ‘‘A’’ sensu Kazempour Osaloo et al.
(2003, 2005) (Fig. 3). Section Caraganella as defined by
Podlech (1975) includes only three species. This spiny
subshrubby section has both basifixed and medifixed hairs.
Podlech (1998) regarded sect. Caraganella as ‘‘phyloge-
netically isolated’’ and morphologically anomalous within
the genus.
In accordance with Kazempour Osaloo et al. (2003,
2005), our results suggest the monophyly of sect. Astrag-
alus subsect. Chronopus (Fig. 3). The members of this
section are characterized by indurated or spiny leaf rachis,
free stipules, and completely bilocular and cylindrical pods
with hard leathery valves that might be in turn falcate and
striate on the surface (Fig. 4, characters 1 and 2). This
subsection has been widely recognized as section Chron-
opus (Bunge 1869; Goncharov et al. 1965; Maassoumi
2003), but recently Podlech (1999) reduced it to subsection
rank. Our present data suggest this subsection as sister to a
group consisting of sect. Astragalus subsect Astragalus,
sect. Alopecuroidei, and sect. Laxiflori (Fig. 3). The spe-
cies of this group share a unique and unambiguous 5 bp
deletion in trnT/Y. This group, which is monophyletic, can
be recognized by fruit synapomorphies: smaller pods
compared with the members of subsect. Chronopus cov-
ered by a mixture of long and short hairs. A distinctive
character for Astragalus subsect. Astragalus is the presence
of white or brown hairs, but this trait is also found in some
members of sect. Alopecuroidei. Zarre (2003) suggested
that the character ‘‘hair color’’ seems to be a reliable one
for assessing phylogenetic relationships at species level.
Consistent with previous studies (Kazempour Osaloo et al.
2003, 2005), our data clearly show that none of the sections
Astragalus, Alopecuroidei, and Laxiflori forms a natural
group as currently circumscribed by Podlech (1999).
Constraining sect. Astragalus to be monophyletic requires
eight more steps (parsimony analysis), and this topology
has a lower likelihood value (one-tailed SH test; significant
values P = 0.016).
Nested among sect. Astragalus species is the strongly
supported clade of sects. Alopecuroidei and Laxiflori, a find-
ing consistent with results of Kazempour Osaloo et al. (2003,
2005). Constraining Alopecuroidei to be monophyletic
Phylogeny of Astragalus sect. Caprini (Fabaceae) 127
123
![Page 10: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/10.jpg)
(i.e., excluding sect. Laxiflori) would add 18 more steps to the
tree length, and this topology has a significantly lower like-
lihood value (SH test; significant values P = 0.002). Sect.
Laxiflori can be distinguished by the loose raceme from sect.
Alopecuroidei (Agerer-Kirchhoff and Agerer 1977; Podlech
1999). The monophyly of this group (subsect Astragalus, sect.
Alopecuroidei, and sect. Laxiflori) is not surprising because
these species share several morphological characters such as
caulescent, head-like inflorescence, yellow corolla, a more or
less inflated fruiting calyx, and bilocular fruit. Therefore, they
have been considered closely related (Agerer-Kirchhoff
1976). Subsection Astragalus is distributed mostly in dry
regions, from Western Europe and North Africa far into
central Asia, with its centers of diversity in Afghanistan and
the western Orient and Turkey (Podlech 1986). A similar
pattern of distribution is evident for sect. Alopecuroidei
(Becht 1978). In our phylogenetic hypothesis, representatives
of sects. Astragalus, Alopecuroidei, and Laxiflori are derived
from a common ancestor (Fig. 3).
Relationships within sect. Caprini
The monophyly of sect. Caprini (BS = 72, PP = 1.00), as
well as its close relationship to sects. Astragalus, Alopec-
uroidei, and Laxiflori, is supported in this study. Section
Caprini shares a common ancestor with sects. Astragalus,
Fig. 4 Optimization of six
morphological characters of
taxonomic importance in
Astragalus mapping on
dichotomous Bayesian
inference tree derived from
analyses of molecular data.
Numbers above branchesindicate the characters
according to the list, while the
trait states are indicated belowthe branches. Characters and
trait states: 1 stipules—all free
(0), basally connate (1), connate
for more than 2 mm (2); 2spines—rachis nonindurated
(0), rachis indurated (1); 3 stem
internodes—more than 4 cm
(0), less than 4 cm (1); 4 keel
teeth—absent (0), present (1); 5fruit septum—unilocular (0),
semibilocular (1), bilocular (2);
6 calyx shape—campanulate
(0), broadly tubular and inflated
(1), tubular and gibbous (2)
128 M. Riahi et al.
123
![Page 11: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/11.jpg)
Alopecuroidei, and Laxiflori, a finding that is confirmed by
many morphological similarities. Agerer-Kirchhoff (1976)
suggested a close relationship among sects. Astragalus,
Alopecuroidei, Eremophysa, Laxiflori, and Caprini based
on similarities in morphological characters. Among their
shared features, we mapped fruit septum and calyx shape
traits. Both characters, however, show homoplastic nature
(Fig. 4, characters 5 and 6), indicating their low phyloge-
netic value.
Podlech (1999) believed that sect. Caprini is closely
related to the sect. Aegacantha mainly based on spiny taxa
presented in both sections. The recent analyses of nrDNA
ITS sequences also confirm a close relationship between
these two sections (Kazempour Osaloo et al. 2003, 2005),
but the trait ‘‘spiny leaf rachis’’ appears to be derived at
several positions inside sect. Caprini and outside it (Fig. 4,
character 2).
The only member of subsect. Erionotus, A. citrinus, is
nested within a basal-branching clade in sect. Caprini in
the combined analysis (Fig. 3). This subsection has a
restricted distribution in Iran, and is most widely
distributed in Afghanistan (Podlech 1986). Presence of
cotton-like indumentum on the upper surface of leaflets is a
synapomorphy not otherwise known in Old World
Astragalus. This subsection has been treated as sect.
Erionotus in the past (Bunge 1869; Goncharov et al. 1965),
but Podlech (1999) reduced this section to subsection rank
within sect. Caprini. Our data corroborate Podlech’s view
of the submersion of sect. Erionotus into sect. Caprini
(Podlech 1986).
The phylogenetic study presented here does not support
the monophyly of subsect. Purpurascentes, as this sub-
section is clearly nested within subsect. Caprini (Fig. 3).
Most species of this subsection are restricted to Afghani-
stan (Podlech 1986). The most important morphological
synapomorphy of Purpurascentes should be the unique
feature of finely toothed corolla keel. However, this trait is
derived at least five times in sect. Caprini (Fig. 4, character
4) and thus is considered to be of low importance.
Despite little resolution within sect. Caprini, the results
of analyses performed are in agreement with seven groups
(Fig. 3) within sect. Caprini (although sometimes with low
support). Group A1 includes A. pellitus (belonging to
informal A. pellitus group) and A. antalyensis (of uncertain
species group) with moderate support (BS = 68%,
PP = 0.95). A distinctive synapomorphy of this group is
the bilocular pod with a septum not reaching the top of the
fruit and with striate as well as papery valves. Furthermore,
the pods in this group of species are covered by long soft
hairs. A second well-supported clade (BS = 87%,
PP = 1.00), the A2, consists of A. pseudoibicinus
(belonging to A. angustiflorus group), A. kermanschahensis
(belonging to A. caprinus group), and A. gypsicolus
(uncertain species group). The synapomorphies for this
clade are the incompletely bilocular pods, with leathery
valves that are densely covered by curly hairs. Group A3
consists of A. impexus Podlech (belonging to the A. pine-
torum group), A. kirpicznikovii Grossh. (belonging to the A.
exscapus group), A. macropelmatus (belonging to the A.
macropelmatus group), A. pseudobrachystachys (belonging
to the A. flexus group), A. kashmarensis, and A. nephton-
ensis (belonging to the A. macronyx group). The group is
well resolved, and its monophyly is strongly supported
(BS = 91%, PP = 1.00). The morphological synapomor-
phies of this third group are the incompletely bilocular
pods with papery valves that are covered by long soft hairs.
This group is additionally supported by a unique insertion
(30 bp) in the trnS/G marker. Group A4 is represented by
A. johannis Boiss. (belonging to the A. pinetorum group),
and A. neo-podlechi Maassoumi (belonging to the A. in-
durescens group) but with low support (BS = 59%,
PP = 0.91). The morphological features supporting this
group are bilocular pods with papery valves that are cov-
ered with sparse, short, and soft hair. Group A5
(BS = 78%, PP = 1.00) includes A. multijugus DC.
(belonging to the A. pinetorum group), A. apricus Bunge
(belonging to the A. pinetorum group), and A. mozaffarianii
(belonging to the A. amygdalinus group). A. multijugus is
sister to other members of this clade (PP = 0.75). This
group can be distinguished by bilocular pods with papery
valves that are densely covered with long and soft hairs.
Two more clades were resolved in the obtained trees of
combined sequence analyses. The first one comprised A.
aegobromus Boiss & Hohen. (belonging to the A. ovinus
group) and A. gaubae Bornm. (belonging to the A. caprinus
group) (PP = 0. 95), which are characterized by a complete
bilocular pod possessing semi-leathery valves marked with
prominent striate venations and covered by long soft hairs.
The second clade is represented by A. leonardii Maassoumi
and A. remotijugus Boiss. & Hohen. (belonging to A. ovinus
group) (PP = 0.87), and characterized by completely
bilocular pods with leathery valves that are glabrous and
striate. Interspecific relationships of the other ten species
remain unclear as they are unresolved in a polytomy.
Phylogenetic position of A. annularis
In principal agreement with earlier studies (Kazempour
Osaloo et al. 2003, 2005; Kazemi et al. 2009), the results of
the nrDNA ETS sequence analyses presented here place A.
annularis as sister to a clade comprising Colutea and
Oxytropis (Fig. 1). In contrast, the plastid data place this
taxon as sister to all other Astragalus taxa (Fig. 2). Con-
straining Astragalus to be monophyletic based on nuclear
sequence data requires no additional step, and surprisingly
the likelihood of the constrained topologies is not
Phylogeny of Astragalus sect. Caprini (Fabaceae) 129
123
![Page 12: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/12.jpg)
statistically lower (SH test; P value from 0.999 to 0.212).
There is no unique important synapomorphy that could
support the placement of A. annularis within Coluteineae
(Podlech 1999). Based on molecular evidence, Wojcie-
chowski (2005) concluded that A. pelecinus plus A. epi-
glottis, and most likely A. annularis, comprise the most
basal branching lineage within Astragalus. These species
differ from all other members of the genus by having very
short flowers (not exceeding 5 mm), five fertile stamens, as
well as densely papillose short hairs on pods and calyces
(Liston and Wheeler 1994; Wojciechowski et al. 1999;
Kazempour Osaloo et al. 2003; Taeb et al. 2007). This
analysis provides clear evidence that A. annularis is placed
in a well supported basal branching position in Astragalus.
Morphological characters
All characters that have been considered to be of major
taxonomic value in Astragalus were found to be subject to
homoplasy (Fig. 4). Nonetheless, considerable correlations
are distinguished between well to moderately supported
groups and features of fruits such as pod septum (uniloc-
ular, incompletely bilocular, nearly bilocular, bilocular),
valve texture (papery, semi-leathery, leathery), valve sur-
face (striate, smooth), and valve indumentum (hairless,
curly hair, long and soft hairy, short and soft hairy). No
other morphological character could be significantly cor-
related with these groupings. It seems, therefore, that pod
morphology may be a better indicator of phylogenetic
relationships within sect. Caprini and its allies than floral,
leaf, or stipule morphology.
Conclusion and future research perspectives
Our phylogenetic analyses strongly suggest that the current
classification (Podlech 1999) does not properly reflect the
phylogeny of sect. Caprini and allied sections. Apart from
pod characters, other morphological characters are not
helpful in shaping a new classification for sect. Caprini and
its closest relatives. Sanderson (1991) also observed an
evolutionary significance of pod structure within North
American Astragalus. Morphological features of the pod
have not historically been important characters in the
classification of Old World Astragalus, but in this study
they could provide a number of criteria that are still useful
in identifying monophyletic groups in sect. Caprini and
related sections.
Being mostly incongruent with Podlech’s (1999) sec-
tional and infrasectional circumscriptions, our results sug-
gest some taxonomic revisions may be necessary in
Astragalus; for example, sects. Astragalus, Laxiflori, and
Alopecuroidei should not be considered as separate
sections. In addition, all subsections and informal groups of
sect. Caprini investigated here were not reflected as
monophyletic. This degree of incongruence of phylogenies,
traditional classifications, and intrasectional delimitations
indicates that classifications based on single morphological
characters are problematic in genera such as Astragalus.
Poor resolution within sect. Caprini in our phylogenetic
analyses may be explained by rapid and/or very recent
diversification (Zhang et al. 2009; Scherson et al. 2008).
Therefore, different molecular techniques or markers such
as AFLPs or ISSRs, or more variable genomic regions, may
have to be applied in order to confidently resolve rela-
tionships at this level of relatedness.
The present work sheds new light on interpretations of
systematic relationships within sect. Caprini and its rela-
tives and the role that the fruit may play in driving the
evolution of these sections. Sampling of more individuals
is necessary to confirm the monophyletic groups presented
in this paper. Future research might reveal still more
complex patterns in the evolution of sect. Caprini and its
relatives.
Acknowledgments The authors are indebted in Prof. Dr. D. Podlech
(Munich) for his critical comments and suggestions. We thank the
following: Dr. F. Attar, Dr. H. Ebrahimzadeh, Dr. V. Niknam, and
M. Mirmasoumi (Department of Plant Sciences, University of Teh-
ran) for providing lab facilities. We are grateful to the curators of
Central Herbarium of University of Tehran (TUH) and the Herbarium
of Research Institute of Forests and Rangelands (TARI) for the loan
of materials and permission to extract DNA from selected specimens.
Grants from the Research Council, as well as Council of International
Office of the University of Tehran to S.Z. are gratefully acknowl-
edged. Alexander von Humboldt Stiftung (Germany) also supported
S.Z. through a generous scholarship.
Appendix
List of investigated specimens, with GenBank accession
numbers for the ETS, psbA-trnH, trnY/T, trnS/G region,
including voucher numbers. Sections and species of
Astragalus are in alphabetical order. All specimens are kept
in the Central Herbarium of Tehran University (TUH). All
sequences are new for this study.
Genbank accession number of taxa
For species whose markers were sequenced during this
study, complete voucher information as well as GenBank
accession numbers are given. All samples were collected
mostly in Iran and the vouchers are deposited in Tehran
University Herbarium (TUH). Where the country is not
indicated, the specimen was collected from Iran.
Astragalus section Alopecoroidei: A. alopecias Pall.,
Khorrassan, Mashahad, 21906, JF409729, JF409766,
130 M. Riahi et al.
123
![Page 13: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/13.jpg)
JF409808, JF409852; A. jessenii Bunge, Tehran, Damav-
and, 7727, JF409742, JF409779, JF409822, JF409865; A.
ponticus Pall., Kordestan, Kamyaran, 9737, JF409752,
JF409790, JF409835, JF409878; A. echinops Boiss.,
Lorestan, Khorramabad, 23723, JF409737, JF409775,
JF409849, JF409860.
Astragalus section Annulares: A. annularis Forssk.,
Arak, 28828, JF409730, JF409768, JF409809, JF409850.
Astragalus section Astragalus: A. dacylocarpus Boiss.
subsp. dactylocarpus, Khuzestan, Masjed-Soleyman,
33598, JF409894, JF409773, JF409816, JF409858; A.
vanillae Boiss., Isfahan, Zarrin-Shahr, 54838; A. siversi-
anus Pall., Khorasan, Quchan, 27320, JF409758,
JF409798, JF409842, JF409886.
Astragalus section Caprini: A. aegobromus Boiss. &
Hohen., Tehran, Shemshak, 11617, JF409728, JF409767,
JF409807, JF409851; A. antalyensis A.Duran & Podlech,
Antalya, Akseki, Turkey, 2792 (GAZI), JF409731, -,
JF409810, JF409853; A. apricus Bunge, Azarbaiejan,
Marand, Mishou-Dagh, 55246, -, JF409896, JF409811,
JF409854; A. avicennicus Parsa, Hamadan, Avaj, 66443,
JF409732, JF409769, JF409812, JF409855; A. caprinus L.,
Turkey, Sanliorfa, Gurbaba merkii, 2319 (GAZI),
JF409733, JF409770, JF409813, JF409856; A. chrysan-
thus Boiss. & Hohen., Tehran, Damavand, 21283,
JF409734, JF409771, JF409814, JF409857; A. citrinus
Bunge, Gorgan, Mayamey to Golestan Forest, 27307,
JF409735, JF409772, JF409815, -; A. gaubae Bornm.,
Lorestan, Khorramabad, Veisslan, 23730, JF409738,
JF409776, JF409818, JF409861; A. gypsicola Maassoumi
& Mozaffarian, Khuzestan, Masjed Solyman, 70190,
JF409739, JF409777, JF409819, JF409862; A. impexus
Podlech, Hamadan, Kuh-e Alvand, 64925, JF409740, -,
JF409820, JF409863; A. ischredensis Bunge, Chaharma-
hal-e Bakhtiari, Broujen, 7750, JF409741, JF409778,
JF409821, JF409864; A. johannis Boiss., Shiraz, Dasht-
Arjan, 7751, JF409897, -, JF409823, JF409866; A. kash-
marensis Maassoumi & Podlech, Golestan, Golestan
National Park, 24404, JF409743, JF409780, JF409824,
JF409867; A. kermanschahensis Bornm., Lorestan, Esla-
mabad, 64383, JF409895, JF409781, JF409825, -; A. kir-
picznikovii Grossh., Azarbaijan, Ahar, 55358, JF409744,
JF409782, JF409826, JF409868; A. leonardii Maassoumi,
Lorestan, Khorramabad, 23734, JF409745, JF409783,
JF409827, JF409869; A. macropelmatus Bunge subsp.
macropelmatus, Esfahan, Abyane, 18213, JF409746,
JF409784, JF409848, JF409870; A. mozaffarianii Maas-
soumi, Azarbaijan, 64475, JF409747, JF409785, JF409828,
JF409871; A. multijugus DC., Azarbaiejan, Marand, Iran,
9752, JF409748, -, JF409829, JF409872; A. neopodlechi
Maassoumi, Yazd, Taft, 5972, JF409760, JF409829,
JF409873, -; A. nephtonensis Freyn, Golestan, Golestan
National Park, 24454, JF409749, JF409786, JF409831,
JF409874; A. ovinus Boiss., Chaharmahal-e Bakhtiari,
Brujen, 54905, JF409750, JF409787, JF409832, JF409875;
A. pellitus Bunge, Khorassan, Birjand, 22203, JF409765,
JF409788, JF409833, JF409876; A. pinetorum Boiss.
subsp. pinetorum Gilan, Deylaman, 18589, JF409751,
JF409789, JF409834, JF409877; A. pseudobrachystachys
Sirj. & Rech.f., Semnan, Firuzkuh, 5729, JF409753, -,
JF409837, JF409879; A. pseudoibicinus Maassoumi &
Podlech; Chaharmahal-e Backhtiari, Brujen, 57184,
JF409754, JF409791, JF409836, JF409880; A. remotijugus
Boiss. & Hohen., Mazanderan, Haraz, 6287, JF409755,
JF409792, JF409838, JF409881; A. rufescens Freyn, Shi-
raz 5541, -, JF409795, -, JF409883; A. touranicus Freitag
& Podlech, Balouchestan, Iranshahr, 9112, JF409757,
JF409797, JF409841, JF409885; A. vereskensis Maasso-
umi & Podlech, Semmnan, Damghan, 23711, JF409759,
JF409799, JF409843, JF409887.
Astragalus section Caraganella: A. reshadensis Pod-
lech, Farah, Afghanistan, 70152 (MSB), JF409756,
JF409793, JF409839, JF409882.
Astragalus section Laxiflori: A. dictyolobus Bunge,
Kordestan, Divan Darreh, 34594, JF409736, JF409774,
JF409817, JF409859.
Outgroups: Chesneya astragalina Jaub. & Spach,
Tehran, Eivanakey, 5551, JF409761, JF409800, JF409844,
JF409888; Colutea buhsei (Boiss.) Shap., Gorgan, Park-e
Golestan, 5865, JF409762, JF409802, JF409845,
JF409889; Halimodendrun halodendrun (Pall.) Voss.,
Tehran, Karaj, 28284, JF409763, JF409803, JF409846,
JF409891; Oxytropis aucheri Boiss., Golestan, Golestan
National Park, 24412, JF409764, JF409804, JF409847,
JF409890.
References
Agerer-Kirchhoff C (1976) Revision von Astragalus L. sect. Astra-
galus (Leguminosae). Boissiera 25:1–197
Agerer-Kirchhoff C, Agerer R (1977) Eine neue Sektion der Gattung
Astragalus L.: Laxiflori Agerer-Kirchhoff. Mitt Bot Staatssamml
Munchen 13:203–234
Allard MW, Carpenter JM (1996) On weighting and congruence.
Cladistics 12:183–198
Baldwin BG, Markos S (1998) Phylogenetic utility of the external
transcribed spacer (ETS) of 18S-26S rDNA: congruence of ETS
and ITS trees of Calycadenia (Compositae). Mol Phylogenet
Evo 10:449–463
Becht R (1978) Revision der Sektion Alopecuroidei DC. der Gattung
Astragalus. Phanerogamarum Monographiae X. Cramer, Vaduz
Brumfield RT, Beerli P, Nickerson DA, Edwards SV (2003) The
utility of single nucleotide polymorphisms in inferences of
population history. Trends Ecol Evol 18(5):249–256
Bunge A (1868) Generis Astragali species Gerontogeae. Mem Acad
Imp Sci Saint Petersburg 11:1–140
Bunge A (1869) Generis Astragali species Gerontogeae. Mem Acad
Imp Sci Saint Petersbug 15:1–254
Phylogeny of Astragalus sect. Caprini (Fabaceae) 131
123
![Page 14: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/14.jpg)
Darlu P, Lecointre G (2002) When does the incongruence length
difference test fail? Mol Biol Evol 19:432–437
De Candolle AP (1825) Notice sur quelques genres et especes
nouvelles de legumineuses, extraite de divers Memoires
presentes a la Societe d’Histoire naturelle de Geneve, pendant
le cours des annees 1823 et 1824. Ann Sci Natur 4:90–103
Deml I (1972) Revision der Sektionen Acanthophace Bunge und
Aegacantha Bunge der Gattung Astragalus L. Boissiera
21:1–235
Edgar RC (2004) MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res
32(5):1792–1797
Farris JS, Kallersjo M, Kluge AG, Bult C (1994) Testing significance
if incongruence. Cladistics 10:315–319
Felsenstein J (1981) Evolutionary tree from DNA sequences: a
maximum likelihood approach. J Mol Evol 17:368–378
Felsenstein J (1985) Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 38:783–791
Goncharov NF, Borisova AG, Gorshkova SG, Popov MG, Vas-
ilchenko IT (1965) Astragalus. In: Komarov VL, Shishkin BK
(eds) Flora of the USSR, vol 12. Israel Program for Scientific
Translations/Smithsonian Institution and the National Science
Foundation, Jerusalem/Washington, pp 1–918
Hamilton MB (1999) Four primer pairs for the amplification of
chloroplast intergenic regions with intraspecific variation. Mol
Ecol 8:521–523
Hipp AL, Hall JC, Sytsma KJ (2004) Phylogenetic accuracy,
congruence between data partitions, and performance of the
ILD. Syst Biol 53:81–89
Javadi F, Wojciechowski MF, Yamaguchi H (2007) Geographical
diversification of the genus Cicer (Leguminosae: Papilionoideae)
inferred from molecular phylogenetic analyses of chloroplast and
nuclear DNA sequences. Bot J Linn Soc 154(2):175–186
Kazemi M, Kazempour Osaloo S, Maassoumi AA, Rastegar Pouyani
E (2009) Molecular phylogeny of selected Old World Astragalus(Fabaceae): incongruence among chloroplast trnL-F, ndhF and
nuclear ribosomal DNA ITS sequences. Nord J Bot
27(12):425–436
Kazempour Osaloo S (2007) Phylogenetic relationships in the inverted
repeat lacking clade (IRLC) of papilionoid legumes based on
nrDNA ITS sequences. In: Abstract book. First National Plant
Taxonomy Conference of Iran, Tehran, pp 106–107
Kazempour Osaloo S, Maassoumi AA, Murakani N (2003) Molecular
systematics of the genus Astragalus L. (Fabaceae): phylogenetic
analysis of nuclear ribosomal DNA internal transcribed spacers
and chloroplast gene ndhF sequences. Pl Syst Evol 242:1–32
Kazempour Osaloo S, Maassoumi AA, Murakani N (2005) Molecular
systematics of the Old World Astragalus (Fabaceae) as inferred
from nrDNA ITS sequence data. Brittonia 57:367–381
Lewis GP, Schrire BD, Mackinder BA, Lock M (2005) Legumes of
the world. Royal Botanic Gardens, Kew, pp 475–481
Liston A, Wheeler JA (1994) The phylogenetic position of the genus
Astragalus (Fabaceae): evidence from the chloroplast genes
rpoC1 and rpoC2. Biochem Sys Ecol 22:377–388
Maassoumi AA (1989) The genus Astragalus in Iran, vol 2. Jahad-e
Sazandgi Research Institute of Forests and Rangelands, Tehran
Maassoumi AA (1998) Astragalus in the Old World check-list.
Research Institute of Forests and Rangeland, Tehran
Maassoumi AA (2003) Papilionaceae I (Astragalus), vol 43. Research
Institute of Forests and Rangelands, Tehran
Mabberley DJ (2008) Mabberley’s plant-book. A portable dictionary
of plants, their classification and uses, 3rd edn. Cambridge
University Press, Cambridge
Maddison DR, Maddison WP (2006) Mesquite, a modular system
for evolutionary analysis. http://mesqiteproject.org/mesquite/
mesquite.html
Murray MG, Thompson WF (1980) Rapid isolation of high molecular
weight plant DNA. Nucleic Acids Res 8:4321–4326
Ott E (1978) Revision der Sektion Chronopus Bge. der Gattung
Astragalus L. Phan Monogr, vol 9. Cramer, Vaduz
Page RDM (1996) TREEVIEW: an application to display phyloge-
netic trees on personal computers. Comp Appl Biosci
12:357–358
Podlech D (1975) Revision der Sektion Caraganella Bunge der
Gattung Astragalus L. Mitt Bot Staatssamml Munchen
12:153–166
Podlech D (1982) Neue Aspekte zur Evolution und Gliederung der
Gattung Astragalus L. Mitt Bot Staatssamml Munchen
18:359–378
Podlech D (1986) Taxonomic and phytogeographical problems in
Astragalus of the Old World and southwest Asia. Proc R Soc
Edinb 89:37–43
Podlech D (1988) Revision von Astragalus L. sect. Caprini DC.
(Leguminosae). Mitt Bot Staatssamml Munchen 25:1–924
Podlech D (1998) Phylogeny and progression of characters in Old
World Astragali (Leguminosae). In: Zhang A, Wu S (eds)
Floristic characteristics and diversity of East Asian plants. China
Higher Education Press, Beijing, pp 405–407
Podlech D (1999) Papilionaceae III: Astragalus I. In: Rechinger KH
(ed) Flora Iranica, vol 174. Akademische Druck-u. Verlagsan-
stalt, Graz, pp 1–350
Posada D, Crandall KA (1998) Model test: testing the model of DNA
substitution. Bioinformatics 14:817–818
Ranjbar M, Maassoumi AA, Podlech D (2002) Astragalus sect.
Alopecuroidei (Fabaceae) in Iran, complementary notes with a
key to the species. Willdenowia 32:85–91
Riahi M, Zarre S, Maassoumi AA, Attar F, Kazempour Osaloo S
(2010) An inexpensive and rapid method for extracting papilio-
noid genomic DNA. Genet Mol Res 9:1334–1342
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phyloge-
netic inference under mixed models. Bioinformatics
19:1572–1574
Ronquist F, Huelsenbeck JP, Van der Mark P (2005) MrBayes 3.1
manual. http://mrbayes.csit.fsu.edu/mb3.1_manual.pdf
Sanderson MJ (1991) Phylogenetic relationships within North Amer-
ican Astragalus L. (Fabaceae). Syst Bot 16:414–430
Sanderson MJ, Wojciechowski MF (1996) Diversification rates in a
temperate legume clade: are there ‘‘so many species’’ of
Astragalus (Fabaceae)? Am J Bot 83:1488–1502
Scherson RA, Vidal R, Sanderson MJ (2008) Phylogeny, biogeogra-
phy, and rates of diversification of New World Astragalus(Leguminosae) with an emphasis on South American radiations.
Am J Bot 95:1030–1039
Shaw J, Lickey E, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC,
Winder CT, Schilling EE, Small RL (2005) The tortoise and the
hare II: relative utility of 21 noncoding chloroplast DNA
sequences for phylogenetic analysis. Amer J Bot 92:142–166
Shimodaira H, Hasegawa M (1999) Multiple comparisons of log-
likelihoods with applications to phylogenetic inference. Mol Biol
Evol 16:1114–1116
Simmons MP, Ochoterena H (2000) Gaps as characters in sequence-
based phylogenetic analyses. Syst Biol 49:369–381
Swofford DL (2002) PAUP*. Phylogenetic analysis using parsi-
mony,* and other methods. 4.0b10. Sinauer Associates,
Massachusetts
Taeb F, Zarre S, Podlech D, Tillich HJ, Kazempour Osaloo S,
Maassoumi AA (2007) A contribution to the phylogeny of
annual species of Astragalus (Fabaceae) in the Old World using
hair micromorphology and other morphological characters.
Feddes Repert 118:206–225
Wojciechowski MF (2005) Astragalus (Fabaceae): a molecular
phylogenetic perspective. Brittonia 57:382–396
132 M. Riahi et al.
123
![Page 15: Towards a phylogeny for Astragalus section Caprini ... · PDF fileORIGINAL ARTICLE Towards a phylogeny for Astragalus section Caprini (Fabaceae) and its allies based on nuclear and](https://reader030.fdocuments.net/reader030/viewer/2022020315/5a9da5b77f8b9a21688d52a7/html5/thumbnails/15.jpg)
Wojciechowski MF, Sanderson MJ, Hu JM (1999) Evidence on the
monophyly of Astragalus (Fabaceae) and its major subgroups
based on nuclear ribosomal DNA ITS and chloroplast DNA trnL
intron data. Syst Bot 24:409–437
Wojciechowski MF, Sanderson MJ, Steele KP, Liston A (2000)
Molecular phylogeny of the ‘‘temperate herbaceous tribes’’ of
papilionoid legumes: a super tree approach. In: Herendeen P,
Bruneau A (eds) Advances in legume systematics, part 9. Royal
Botanic Garden, Kew, pp 277–298
Xu DH, Sakai AJ, Kanazawa M, Shimamoto A, Shimamoto Y (2000)
Sequence variation of non-coding regions of chloroplast DNA of
soybean and related wild species and its implications for the
evolution of different chloroplast haplotypes. Theor Appl Genet
101:724–732
Yoder AD, Irwin JA, Payseur BA (2001) Failure of the ILD to
determine data combinability for slow loris phylogeny. Syst Biol
50:408–424
Zarre S (2003) Hair micromorphology and its phylogenetic applica-
tion in the phylogeny of Astragalus. Bot J Linn Soc 143:323–330
Zhang M, Kang Y, Zhou L, Podlech D (2009) Phylogenetic origin of
Phyllolobium with a further implication for diversification of
Astragalus in China. J Integr Plant Biol 51:889–899
Phylogeny of Astragalus sect. Caprini (Fabaceae) 133
123