Tomato Plant Defenses against Helicoverpa zea
Transcript of Tomato Plant Defenses against Helicoverpa zea
The Pennsylvania State University
The Graduate School
College of Agricultural Sciences
Tomato Plant Defenses against Helicoverpa zea
A Dissertation in
Entomology
© 2012
Donglan Tian
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Doctor of Philosophy
August 2012
The dissertation of Donglan Tian was reviewed and approved* by the following:
Gary W. Felton
Professor of Entomology
Dissertation Advisor
Chair of Committee
Head of the Department of Entomology
Edwin G. Rajotte
Professor of Entomology and IPM Coordinator
John Tooker
Assistant professor of Entomology
Yinong Yang
Associate Professor of Plant Pathology
*Signatures are on file in the Graduate School
iii
ABSTRACT
When insects feed on plants, the oral secretions inevitably come in contact with wounded
plant tissue and play very important role in regulating plant defense. These studies used tomato
(Solanum lycopersicum) and Helicoverpa zea (H.zea) as model system to study how oral
secretions affect tomato defense. In my first set of experiments, I found that saliva collected
from the spinnerets of H. zea had higher glucose oxidase (GOX) activity, which induced tomato
defenses. Plants that were wounded mechanically and then treated with with saliva or fungal
GOX had higher levels of PIN2 gene expression in leaves and green fruits, while flowers and red
fruit did not show comparable induction. GOX and saliva treatment also induce trichome number
on newly growth leaf. Mechanically remove trichomes significantly increase insect damage and
growth development.
Since trichomes contribute to plant resistance against herbivory by physical and chemical
deterrents. To understand the role of different type trichome function in insect defense, the
tomato trichome mutants were used to dissect trichome function in the defense. Study showed
that hairless mutants had reduced number of twisted glandular trichomes (type I, IV, VI and VII)
on leaf and stem, while woolly mutants had high density of non-glandular trichomes (type II, III
and V) but only on the leaf. In both mutants, trichome densities were induced by methyl
jasmonate (MeJA), but the types of trichomes present were not affected by MeJA treatment.
Glandular trichomes contained high levels of monoterpenes and sesquiterpenes. High density of
non-glandular trichome on leaves negatively influenced Leptinotarsa decemlineata (Colorado
potato beetle, CPB) feeding behavior and growth, it stimulated H. zea growth. High glandular
trichome density impaired H. zea growth, but had no effect on CPB. Quantitative real-time
polymerase chain reaction (qRT-PCR) showed that glandular trichomes highly express protein
iv
inhibitors (PIN2), polyphenol oxidase (PPOF) and hydroperoxide lyase (HPL) when compared
to non-glandular trichomes. PIN2 in trichomes was highly induced by insect feeding in both
mutant and wild type plants.
As defense signaling cascade is mediated by the synthesis, movement, and perception of
jasmonate (JA) and its interaction with other plant hormones. In order to understand the
interaction of ethylene and JA in regulating plant defense, the never ripe (Nr) mutant with a
partial block of ethylene perception and the defenseless (def1) mutant with deficient in
biosynthesis of JA were used to compare ethylene and JA interactions on tomato induced
systemic defense. Proteinase inhibitor (PIN2) was used as marker gene to compare the plant
response. Exogenous application of MeJA increased plants resistance to Helicoverpa zea and
induced tomato defense gene expression and glandular trichome density on systemic leaves.
Exogenous application of ethephon, an elicitor that releases ethylene, increased insect growth
and interfere the tomato wounding response. Hormone assay showed ethephon treatment
increase salicylic acid (SA) on the systemic leaves. These results showed that JA plays the main
important role on systemic induced defense. Ethylene negatively regulated tomato systemic
defense. This study also found that insect herbivory or MeJA treatment of the maternal
generation induces transgenerational tomato defense in the offspring by increasing glandular
trichome density and by priming defense genes that are regulated by plant phytohormone signals.
v
TABLE OF CONTENTS
LIST OF FIGURES .............................................................................................. vii
LIST OF ABBREVIATIONS …………………………………………………………… viii
LIST OF TABLES ................................................................................................. ix
ACKNOWLEDGEMENTS................................................................................................. x
Chapter I Insect herbivore induced defense in plants
Introduction............................................................................................................... 1
Mechanism of plant defense...................................................................................... 2
The model system in this study……………………………………………………. 21
Reference ................................................................................................................ 24
Chapter II Herbivore Effector Triggered Immunity? Salivary Glucose Oxidase Mediates
the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant
Abstract……………………………………………………………………………… 32
Introduction.................................................................................................................. 33
Materials and Methods................................................................................................ 36
Results……………………………………………………………………………….. 40
Discussion…………………………………………………………………………… 44
Reference.................................................................................................................... 61
Chapter III Role of Trichomes in Defense against Herbivores: Comparison of Herbivore
Response to Woolly and Hairless Trichome Mutants in Tomato (Solanum lycopersicum)
Abstract........................................................................................................................ 67
Introductions................................................................................................................. 69.
vi
Materials and Methods............................................................................................. 72
Results...................................................................................................................... 76
Discussion................................................................................................................ 82
Reference.................................................................................................................. 89
Chapter IV Roles of Ethylene and Jasmonate on Tomato (Solanum lycopersicum)
Systemic Induced Defense to Helicoverpa zea
Abstract..................................................................................................................... 111
Introduction.............................................................................................................. 113
Materials and Methods............................................................................................ 116
Results....................................................................................................................... 119
Discussion................................................................................................................. 125
Reference.................................................................................................................. 139
Appendix Herbivory in the previous generation primes tomato for enhance defense
Introduction.............................................................................................................. 144
Materials and Methods............................................................................................. .145
Results and Discussion............................................................................................. 146
Reference.................................................................................................................. 152
vii
LIST OF FIGURES
Fig. 2.1 Saliva GOX detection on MicroTom-leaves ………… 53
Fig. 2.2 Relative peptide abundance of H. zea salivary proteins ………… 54
Fig. 2.3 PIN2 relative expression of PIN2 in tomato leaves 24 and 48
hours after feeding
…………
55
Fig. 2.4 Compare relative expression of defense genes 24 hours after
wounding and application of H. zea saliva from 10 larvae on
tomato leaf
…………
56
Fig. 2.5 Relative expression of PIN2 on different MicroTom tissues 24
and 48 hrs after wounding and treatment with PBS buffer,
saliva or fungal GOX
………… 57
Fig. 2.6 Trichome induction by wounding treatment or insect feeding.
Average number of trichomes on new growth leaf after
wounding or insect feeding
…………
59
Fig. 2.7 Trichomes significantly affect H. zea feeding and growth ………… 60
Fig. 3.1 Morphology of trichomes on mutant and wild type leaf and
stem, and induction by methyl jasmonate (MeJA)
…………
98
Fig. 3.2 Trichome morphology on leaves in wild type and hl, woolly
mutant plants under scanning electron microcope
…………
99
Fig. 3.3 Trichome density on hl, woolly mutant and wild type plants
and induction by MeJA
…………
100
Fig. 3.4 Representative total ion chromatograms showing MTBE
extractions of leaf trichomes
…………
101
Fig. 3.5 Comparison of monoterpenes and sesquiterpenes levels in
mutant and wild type leaves and stems
…………
102
Fig. 3.6 Relative gene expression in different types of trichomes in hl,
woolly and wild type
…………
103
Fig. 3.7 hl and woolly mutant affect Helicoverpa zea and Colorado
potato beetle growth and feeding time
…………
104
Fig. 3.8 H. zea feeding induced relative expression of proteinase
inhibitor 2 (PIN2) in mutant and wild type plants
…………
105
Fig.3.S1 Oviposition choice on different mutants. Not significantly
different among the mutants
…………
106
Fig.3.S2 Oviposition of H. zea and CPB in woolly mutant ………… 107
Fig. 4.1 Tomato growth affected by MeJA and ethephon treatment ………… 133
Fig. 4.2 MeJA and ethephon treatment induce trichome number on
systemic leaves
…………
134
Fig. 4.3 MeJA and Ethephon affect H. zea growth and neonates’ choice ………… 135
Fig. 4.4 Chemical elicitors spray affects gene expression ………… 136
Fig. 4.5 MS medium grown seedlings gene expression affected by
elicitor treatment
…………
137
Fig. 4.6 Gene expression affected by wounding ………… 138
Fig. I.1 MeJA induced defense on leaf and fruits ………… 150
Fig. I.2 Transgenerational induced resistance in tomato ………… 151
viii
LIST OF TABLES
Table 2.1 Caterpillar oral secretion collection protein and GOX assay …………… 48
Table 2.2 Primers used for real-time PCR assays of relative expression …………… 48
Table 2.3 Proteomic Identification of Salivary Proteins in H. zea by
tobacco plants receiving varying treatments
……………
49
Table 3.1 Primers used for real-time PCR assays of relative gene
expression
……………
95
Table 3.S1 Monoterpenes in mutant and wild type trichomes …………… 108
Table 3.S2 Sesquiterpenes in mutant and wild type trichomes …………… 109
Table 4.1 Primers used for real-time PCR assays of relative expression …………… 130
Table 4.2 Salicylic acid and JA affected by MeJA and Ethephon …………… 131
ix
List of abbreviations
woolly hairy mutant
hl hairless mutant
RU Rutgers wild type plants of woolly mutant
AC Alisa Craig, wild type plants of hairless mutant
MeJA methyl jasmonate
PIN2 protease inhibitor 2
HPL hydroperoxide lyase
SlCycB2 B-Type cyclin
PPOF polyphenol oxidase
CPB Colorado potato beetle
Nr Never ripe mutant
def1 Defenseless 1 mutant
RU Rutgers wild type plants of Nr mutant
CM Castlemart , wild type plants of def1 mutant
ERF1 Ethylene response factor
PR1 Pathogenesis related gene
ET
SA
Ethylene
Salicylic acid
x
ACKNOWLEDGEMENTS
I would like to express my deepest gratitude to my advisor Dr. Gary Felton for his
continuous guidance, support and encouragement during my graduate program. He has been a
great listener and mentor and helped me to develop as a scientist. He not only taught me a lot of
academic knowledge, but also offered great help in life as well. He was always there when I
needed help and without that I could not have come this far. I also want to thank my other
committee members, Dr. Edwin G. Rajotte, Dr. John Tooker and Dr. Yinong Yang; they have
given me valuable suggestions and comments to improve my research. Special thanks to Dr.
Dawn Luthe for her good suggestions on my research and presentations and my proposal writing.
I would also like to thank Michelle Peiffer for being a wonderful resource and a great
friend. I would like to thank the members of the Felton and Luthe Lab for their friendships and
various help all the way. Jinwon Kim, Helene Quaghebeur and Seung Ho Chung always give me
suggestions and help on my research and other lab members have provided endless help.
Finally, I want to thank my husband and my parents for their endless support. Without
them, I cannot have achieved this much. I also thank my two kids, Jessie and Steven. They give
me pressure as well as encouragement to go on. And I will continue to work hard in my life.
1
Chapter I
Insect herbivore-induced defense in plants
Introduction
Higher plants are continuously challenged by numerous environmental factors such as
pathogen attack or herbivory. To avoid attacks or diminish the injury they cause, plants
frequently respond by different defense strategies to protect themselves (Green and Ryan 1972;
Howe and Jander 2008; Stout et al. 1996; Wu and Baldwin 2010). Among the strategies,
synthesis of secondary metabolites and defense proteins are powerful chemical weapons that
influence herbivore nutrition and growth development (Arimura et al. 2005; Baldwin et al. 2001;
Kessler and Baldwin 2001; Vandenborre et al. 2010). These metabolites include glucosinolates,
alkaloids, phenolics, proteinase inhibitors (PIN), polyphenol oxidases (PPO), lipoxygenases
(LOX), among others. Besides these defenses, plants also can release volatile organic
compounds (VOCs) to attract the predators and parasitoids of the herbivores (Arimura et al.
2001; Dicke and Dijkman 2001; Heil and Kost 2006). Physical defenses such as trichomes are
another mechanism of defense in plants to prevent or diminish damage by herbivores. The
occurrence of different trichome types has been associated with specific resistance (Boege and
Marquis 2005; Dalin et al. 2008; Levin 1973). Evidence has accumulated over the past few years
to indicate that defenses are regulated by a network of plant hormones (Berger and Altmann
2000; Steppuhn and Baldwin 2008).
When herbivorous insects feed on plants, they not only physical damage on the plants but
also produce insect derived cues inevitably come in contact with the wounded plant tissue
(Felton and Tumlinson 2008). These chemicals, produced when insect feed or oviposit on
plants, are Herbivore associated Molecular Patters (HAMPs) called effectors and act as elicitors
2
of induced defenses. Effectors are insect secreted chemicals that suppress defenses. The ability
of plants to recognize insect cues and respond is a form of plant immunity. As sessile organisms
plants also have evolved diverse strategies to continuously adjust their response to adapt a broad
range of stresses by transferring the plant defense to next generations, which is called
transgenernational plant immunity.
Effectors and HAMPs
A diversity of plant pathogens, including bacteria, fungi, oomycetes and nematodes,
secrete molecules when invading plants. The broader definition in plant-pathogen interactions of
effectors include many molecules such as microbial (pathogen) -associated molecular patterns
(MAMPs or PAMPs) (Hogenhout et al. 2009). HAMPs are secreted by insect herbivore and
exhibit similar activity as MAMPs in regulating plant defense. Over the years evidence has
accumulated that insects produce a cocktail of chemicals that modulate plant defenses (Felton
and Tumlinson 2008; Mattiacci et al. 1995; Musser 2005; Schmelz et al. 2003b). Until now only
a small quantity of herbivore-derived chemicals have been isolated and structure identified
(Figure. 1).
a) Volicitin
N-(17-hydroxylinolenoyl)-L-glutamine N-linolenoyl-L-glutamine
O NHH
O H
OH
CH3
O
NH2
O NHH
O H
CH3
O
NH2
b) Caeliferin
CaeliferinA 16:1
3
OH
O
O
SO O
OH
O
S
O
O
OH
CaeliferinB16:1
OH
O
O
SO O
OH
O
NH
OOH
c) Inceptin
H2N-IIe-Cys-Asp-IIe-Asn-Gly-Val-Cys-Val--Asp-Ala-COOH
S S
d) Bruchin C e) Benzyl cyanide
OH
OO
(CH2)8(CH2)4
O O
OH
CN
Fig. 1 Structure of the known herbivore derived elicitors a) Fatty acid-amino acid conjugates,
volicitin and N-Linoleoyl-glutamic acid. b) Caeliferins A and B isolated from Schistocerca
americana c) Inceptin is the proteolytic product of plant chloroplastic ATP synthase γ-subunit
found from Spodoptera frugiperda oral secretions d) Bruchins C isolated from pea weevil
oviposition fluids e) Benzyl cyanide in Pieris brassicae oviposition fluids
Fatty acid amino acid conjugates (FACs)
4
Fatty acid amino acid conjugates (FACs) (Figure. 1a) are the best studied HAMPs in plant-
insect interactions. The FACs is composed of two moieties including fatty acid (or linolenic acid
LA) and amino acid moiety (Glu or Gln). The fatty acid and amino acid originate from plants
and insects, respectively and are synthesized in the insect midgut by the addition of a hydroxyl
group and glutamine to linolenic acid obtained directly from the host plants. Volicitin (N-17-
hydroxylinolenoyl-L-glutamine) was first isolated from beet armyworm (Spodoptera exigua)
regurgitant and induce corn seedling to release volatile compounds, which attract parasitic wasps
(Alborn et al. 1997). Several other FACs has been isolated from lepidopteran species, crickets
and fruit flies (Halitschke et al. 2001; Pohnert et al. 1999; Spiteller and Boland 2003; Yoshinaga
et al. 2007). Volicitin is a key component in regulating tritrophic interactions among plants,
insect herbivores, and natural enemies of the herbivores.
Inceptin
In addition to FACs, the other types of HAMPs have been discovered. Inceptin
(Figure.1b) was isolated from oral secretions of fall armyworm (Spodoptera frugiperda). It is a
disulfide-bridged peptide (+ICDINGVCVDA-) and produced by proteolytic degradation of plant
chloroplast ATP synthase γ-subunit. When fall armyworms attack cowpea plants, the ingested
cATPC is cleaved in insect midgut and forms inceptins (Carroll et al. 2006; Schmelz et al. 2006).
The inceptin could promote cowpea ethylene production and trigger increases in the defense
related phytohormones salicylic acid and jasmonic acid.
Caeliferins
5
Caeliferins (Figure 1c) were isolated from the oral secretions of the grasshopper species
Schistocerca americana. The caeliferins are composed of saturated and monounsaturated
sulfated α-hydroxyl fatty acids with varies length from 15-20 carbons. The caeliferin A 16:1 is
predominant and most active in inducing release of volatile compounds. While caeliferins A16:0,
A17:0 and 18:0 are less active in inducing volatile compounds (Alborn et al. 2007).
Bruchins and Benzyl cyanide
Bruchins and benzyl cyanide are two substances found in oviposition fluids. Bruchins
(Figure. 1d) were isolated from pea weevil (Bruchis pisorum) and elicit the tumor-like growth
under the deposited egg, which inhibits the larvae from entering the pea pod. Benzyl cyanide
(Figure. 1e) was isolated from butterfly (Pieris brassicae) which triggers the expression of
defense-related genes (Hilker and Meiners 2002; Mumm et al. 2003). These chemicals regulate
tritrophic interactions among plants, insect herbivores and natural enemies of the herbivores.
Proteins
In addition to the small molecules, the first reported HAMP protein is -glucosidase,
which is present in the regurgitant of Pieris brassicae caterpillar, triggered the emissions of
volatile in cabbage plants (Mattiacci et al. 1995). Recently, glucose oxidase (GOX) was
identified in the saliva of Helicoverpa zea (H. zea) oral secretion and mediates plant defense
response. GOX converts glucose into gluconic acid and H2O2 and is the most abundant protein
found in labial salivary glands of H. zea. Applications of GOX or labial gland extract suppress
the wound-inducible production of foliar nicotine and volatiles in tobacco leaves. The bioassays
6
showed caterpillar survival and growth increased when fed GOX-treated leaves (Bede et al.
2006; Delphia et al. 2006; Musser et al. 2002).
β-D-glucose + O2 D-gluconic acid + H2O2
Functional genomics approaches haves also been utilized to identify the green peach
aphid effectors (Bos et al. 2010). While feeding, aphid saliva secreted into plant cells and
phloem. The saliva contains proteins such as Mp10, Mp42 and MpC002 with diverse activities
and function as induce or suppress plant defense response. Also another recent study with green
peach aphid – Arabidopsis model system indicates that salivary protein fractions between 3–10
kD acts as the potential salivary components that are recognized by the host plant to modulate
plant defense responses (de Vos et al. 2010). But the detail structure and function in plant
defense need more study to confirm. The interactions between plants and insects are complex
and dynamic.
Plant perception of insect herbivore
The insect signal perception is the first step of induced plant defense and has been well
investigated in many insects (Alborn et al. 1997; Alborn et al. 2000; Musser et al. 2002;
Voelckel and Baldwin 2004). Because of different feeding behaviors, the insects use different
methods to deliver their effector to the plants and the plants may have different perception
mechanism. Phloem-feeding insects, such as aphid and whiteflies, could directly deposit their
signals into plant phloem, which alter plant defense signaling and plant development. The insects
use stylets to navigate the cuticle, epidermis, mesophyll and established feeding sites in phloem
sieve elements (SEs) on host plants (Will and van Bel 2006). During the stylet penetration in
Glucose
oxidase
7
plant tissue and feeding from the phloem sap, they inject salivary secretions into the plant. More
studies suggested the phloem-feeding insects use similar strategies as pathogens to introduce
effectors into plant cells by many biochemical and cellular process (Bos et al. 2010). When the
stylets pierce into phloem SEs, plants repair the SEs wounds by depositing callose and proteins
to rapidly seal plasma membranes to prevent the leakage of phloem sap into apoplast (Walling
2009). As a consequence, plant perception of the effectors activates plant signaling pathways to
regulate large set of genes that shape the appropriate defense responses.
The Hessian fly (Mayetiola destructor HF) has extremely minute mandibles which are
not well structured for chewing, produce a shallow punctures on the leaf surface and release
salivary secretions. This process rapid changes the surface wax composition, increases cell
permeability and results in the diffusion of nutrients to the leaf surface during early stages of the
interaction (Chen et al. 2004a). The resulting gene-for-gene recognition of larval salivary
components initiates chemical and physical defenses. Previous studies showed that the RXLR
protein motif mediates oomycete and fungal effectors entry into the plant host cell through the
plasma membrane. Similarly the most recent study on HF study showed the Ave gene in HF
genome encodes the effector proteins which have a modular structure contain RXLR-like motif
and the structure resembles the effectors of filamentous plant pathogens alter plant immunity
(Chen et al. 2010).
Chewing insects release oral secretions during feeding and plants perceive insect attack
through the direct detection of these secretions. For example, maize (Zea mays) and tobacco
(Nicotiana attenuata) can directly perceive the fatty acid amino acid conjugates (FAC) and
induce volatile emissions. Radiolabeled volicitin was identified in the caterpillar regurgitant and
recovered from corn leaves after feeding by Spodoptera exigua (Truitt et al. 2004). 2004).The
8
saliva of Lepidoptera is released from the labial glands via the spinneret and one of the key
functions is to facilitate feeding and digestion (Eichenseer et al. 1999; Felton and Eichenseer
1999). The immune-labeling method was used to confirm H. zea release saliva during feeding.
The results showed that larvae secret microgram amounts of saliva on the leaf surface during a
few hours feeding (Peiffer and Felton 2005).
R-gene mediated plant resistance
Given the diversity of insect herbivores, the inducible defenses may respond differently
in the modulating plant insect interactions. The induced defense response to phloem-feeding
insects is similar to the plant defense to pathogens (Bhattarai et al. 2007; Walling 2000). Plants
recognize pathogens through the pattern recognition receptors (PRRs) located on the cell surface
and result in PAMP (MAMP) triggered immunity (PTI). To counter PTI, the pathogens develop
mechanisms to secrete and deliver effectors into host cells which in turn triggers plant disease
resistance (R) protein production (Dangl and Jones 2001). Previous study in a few systems
showed that R gene products mediate resistance to phloem-feeding insect herbivore. The R gene
in plants encodes NBS-LRR (nucleotide binding site-leucine rich repeat) proteins which
recognize the insect hemipteran herbivore. Mi-1 gene in tomato encodes a protein sharing
structural features with the NBS-LRR confers resistance to potato aphid, white flies and
nematodes (Casteel et al. 2006). Another NBS-LRR protein, encodes by melon Vat gene, confers
increased resistance to Aphis gossypii (cotton aphid) and the transmission of plant virus by this
aphid species. The most recent finding showed that Bph14 gene encodes a coiled-coil NBS-LRR
which resistance to rice brown plant hopper Nilaparvata lugen (Chen et al. 2004b; Wang et al.
9
2004). These studies showed that some insect and plant interactions may fit the gene for gene
model (Dogimont C et al. 2010).
Induced plant defense
Plants use constitutive and/or induced defenses against insect herbivory. One group of
defenses are secondary metabolites; glucosinolate, phenolics, tannins and alkaloids are some of
the most studied toxic secondary metabolites that play important roles in defense against
herbivory (Howe and Jander 2008). The other group is anti-digestive or anti-nutritive proteins. In
addition to direct defenses induced by insect feeding, plants also produce volatile organic
compounds (VOCs) in response the damage. VOCs released by herbivore-attacked plants may
attract arthropod predators and parasitoids in plants. One study showed that volicitin (17-
hydroxylinolenoyl-L-Gln) in the regurgitant of Spodoptera exigua (beet armyworm caterpillars)
activates the emission of VOCs when applied to the damaged maize leaves (Truitt and Pare
2004). The VOCs are high specific and serve as attractants for female parasitic wasps, which
parasitize herbivore larvae (De Moraes et al. 1998).
When herbivore effectors or HAMPs are released on the plants, it could trigger a series of
molecular events in plant cells. Ca2+
has been recognized as secondary messenger involved in
plant signaling. Under normal condition, the cytosolic Ca2+
content are lower than in organelles.
Trans-membrane ion fluxes were generated when insect effectors release at wounding site. The
changes in intracellular Ca2+
further activate calmodulins, calmodulin binding proteins, calcium-
dependent protein kinase (CDPKs) and other calcium-sensing proteins that promote downstream
signaling to modulate plant defense response (Maffei et al. 2006; Maffei et al. 2007).
10
The mitogen- activated protein kinase (MAPK) signaling pathway plays a central role in
mediating plant response to herbivore attack. MAPKs are phosphorylated by MAPK kinases
(MAPKKs) at the threonine and tyrosine residues located in the activation loop (T-loop) between
subdomains VII and VIII of the kinase catalytic domain. Several MAPKs involved in plant
defense have been identified (Heinrich et al. 2011). Nicotiana attenuata, when attacked by
Manduca sexta (M. sexta), recognizes the FACs in M. sexta oral secretions (OS) that are
introduced into wounds during feeding and rapidly activates two MAPKs, salicylic acid-induced
kinase (NaSIPK) and wound-induced protein kinase (NaWIPK) which are required for the
herbivory-induced biosynthesis of jasmonic acid (JA) and ethylene (Wu et al. 2007). Virus
induced gene silencing (VIGS) reduce t MAPK expression confirming their important role in
plant defense. In Arabidopsis, activated (phosphorylated) MAPKs can directly phosphorylate
certain downstream targets and stimulate induced defense (Beck et al. 2011; Chang and Karin
2001).
Hormonal signals involving jasmonate acid (JA), salicylic acid (SA) and ethylene (ETH),
constitute a complex signaling network leading to defense-related gene activation and regulation
(Chini et al. 2007; Howe and Jander 2008; Ludwig et al. 2005; O'Donnell et al. 2003). JA is a
naturally occurring, non-toxic compound and a member of plant hormones which plays an
important role in plant development and control plant defense against herbivores (Wasternack et
al. 2006). The synthesis of JA is occurs in chloroplasts and peroxisomes through the
octadecanoid pathway. In chloroplasts, the reaction begins with linolenic acid (LA 18:2and 18:3),
it is catalyzed by lipoxygenases (LOXs) to form the 13-hydroyperoxide of linolenic acid. The
13-hydroperoxide further processed by allene oxide synthase (AOS) and allene oxide cyclase
(AOC) to form 12-oxophytodienoic acid (OPDA) (Bonaventure et al. 2011; Wasternack et al.
11
2006; Weber et al. 2004). After transport to peroxisomes, ODPA reductase (OPR3) catalyzes the
OPDA, followed by three cycles of β-oxidation to form JA by shortening of the hexanoic and
octanoic acid side chains (Figure. 2) (Wasternack et al. 2006; Wu and Baldwin 2010). It is well
established that JA levels increase in response to wounding, herbivory, elicitor treatment or other
abiotic stress (Constabel et al. 1995). DNA microarray studies showed that the jasmonate
pathway has a dominate role in regulating global changes in gene expression in response to both
mechanical wounding and herbivory (De Vos et al. 2005).
Insect feeding triggers the expression of plant protease inhibitors (PIs) and other defense
compounds that are regulated by the JA- pathway (Creelman and Mullet 1995; Ryan 1974).
These compounds inhibit digestion in the larval midgut and affect insect growth development
(Farmer and Ryan 1992; Pearce et al. 2001). Other enzymes such as polyphenol oxidase (PPO),
lipoxygenase (LOX), arginase (ARG) and threonine deaminase (TD) may reduce the nutritional
quality of plants.
SA is also a signal modulating plant defenses. SA is synthesized from chorismate
through two reactions catalyzed by isochorismate synthase (ICS) and isochorismate pyruvate
lyase (IPL). It’s well studied that SA play a central role as a signaling molecule involved in plant
defense. SA regulates many pathogenesis-related (PR) genes which are antifungal hydrolases
Fig 2. The octadecanoid pathway for the
biosynthesis of JA. JA synthesis is initiated in the
chloroplast, where linolenic acid is converted to 12-
oxo-phytodienoic acid (OPDA) by sequential action
of lipoxygenase (LOX), allene oxide synthase (AOS)
and allene oxide cyclase (AOC). Following transport
to the peroxisome, OPDA is catalyzed by OPDA
reductase (OPR3) and other reactions to produce JA.
JA then activates the transcription of genes (Modified
from Wasternack et al., Plant Physiology
(Wasternack et al. 2006) and Howe & Jander, Annual
Review of Plant Biology (Howe and Jander 2008)) .
12
targeted to the plant cell wall (Traw and Bergelson 2003). One studied showed that an
Arabidopsis transgenic line expressing the salicylate hydroxylase gene (NahG) had reduced the
levels of SA and were more susceptible to P. syringae (Glombitza et al. 2004).A few reports
implicate SA in defense against, but mostly focus on sucking insects like aphids and thrips. One
mutant, the non-expresser of pathogenesis related genes1 (NPR1) showed enhanced resistance to
aphids (Cole et al. 2004). Application of exogenous SA activates expression of plant
pathogenesis-related (PR) genes and induces plant resistance to H. zea and triggers the
accumulation of SA in cotton, tomato and tobacco (Bi et al. 1997).
Ethylene, as gas hormone, in addition to the central role in many plant physiological
process throughout plant development including seed germination, cell elongation, flowering,
fruit ripening, organ senescence could also elicits plant defense (Zhang et al. 2010). Ethylene is
an important signal during herbivory, herbivore attack could enhance the ET burst (Kahl et al.
2000; Schmelz et al. 2003a). In many cases, ET has been shown to act as important modulator of
plant response to SA and JA. Other wound signals include abscisic acid (ABA), reactive oxygen
species (ROS) and nitric oxide (NO) (Adie et al. 2007; Klessig et al. 2000; Liu et al. 2010).
Cross talk of hormone in plant defense
Hormone cross talk is a process in which different hormone signaling pathways act
antagonistically or synergistically to regulate plant development and/or adaptation environment
stresses (Verhage et al. 2010). There is ample evidence for cross talk between SA, JA and ET
signaling pathways in plant immunity (Pieterse and Dicke 2007).
SA-JA The interaction between SA and JA signaling appears to be complex and there is
evidence in both positive and negative interaction. JA may collaborate with the SA response
13
pathway to trigger an indirect defense against an insect herbivore (Van der Ent et al. 2009).
Walling (2000) found that phloem-feeding insects may induce both SA and JA dependent
pathways. Simultaneous expression of SA and JA pathways is also observed in Mi-resistance
gene mediated defense in tomato to aphid feeding (de Vos et al. 2010). There is increasing
evidence that JA and SA are involved in negative cross talk in plant defense networks. For
instance, herbivorous nymphs of the silver-leaf whitefly could activate the SA signaling pathway
but suppress the JA-dependent defense signaling. Some reports indicate that synergistic
interaction between JA and SA. SA could repress JA mediated genes such as PIs and PPO
(Doares et al. 1995; Thaler 2002). Felton et al. (1999) observed an inverse relationship between
endogenous concentrations of SA and JA in tobacco. The JA mutants, mitogen-activated protein
kinase4 (mpk4), suppress the SA insensitivity2 (ssi2) and coi1 (Chini et al. 2009; Kachroo et al.
2005; Liechti et al. 2006). These studies provided genetic evidence that JA signaling negatively
regulated the expression of SA mediated defense in Arabidopsis (Gfeller et al. 2006; Liechti et
al. 2006).
SA-ET Limited data shows both positive and negative interaction between SA and ET
signaling pathway. The accumulation of SA in Xanthomonas campestris infected plants is
dependent on ET synthesis, because no SA accumulation occurs in the ET-insensitive mutant.
Microarray results showed SA and ET may coordinately induce defense-related gene expression
(Odonnell et al. 1996). However the SA-dependent expression of PR genes didn’t require ET
signaling.
JA-ET There are two modes of interaction between JA and ET. One is synergistic and
the other is antagonistic (Pieterse and Dicke 2007). Several studies provide evidence for the
positive interactions. For example, both JA and ET signaling are required for the expression of
14
the defense related gene PDF2 in response to the infection of A. brassicicola in Arabidopsis
(McConn et al. 1997). Treating plants with ethephon, a synthetic ET donor, could elevate the JA,
while blocking the ET with 1-MCP could reduce herbivory-induced volatile emission which are
regulated by JA (Schmelz et al. 2003c). In tomato, the JA and ET interaction is responsible for
the induction of proteinase inhibitors (PIN2) gene after wounding. Although the ET alone is not
able to induce the PIN expression, it cooperates with JA to synergistically induce the gene
expression (O’donnell et al. 1996). Previous studied showed that ET antagonistically to suppress
JA induced gene expression in nicotine biosynthesis and in wounded leaves of Arabidopsis
(Shoji et al. 2008).
The effect of herbivory on plants involves a complex interplay among varied signaling
networks. Increasing evidence suggests that different defense pathways are activated in plants
response to different type of stress. A thorough knowledge at the molecular level of how cross
talk occurs between different hormone pathways is necessary to understand how plants respond
to different stresses and in identifying new ways improve plant defense responses.
Trichome as first line of plant defense
Trichomes are uni- or multicellular hair-like structures that develop from cells of the
aerial epidermis and are produced by many plant species. Numerous studies have shown that leaf
trichomes can serve multiple functions as structural and chemical against herbivores (Amme et
al. 2005; Kang et al. 2010a; Levin 1973). In addition resistance to insect herbivory, trichomes
also provides resistance to abiotic stress, such as drought or UV radiation.
The morphology and density of leaf trichomes vary among plant species. Arabidopsis
foliar trichomes are unicellular, stellate, non-glandular trichomes that usually contain three
15
branches and are an excellent model to study all aspects of cell differentiation (Marks et al.
2009). The trichomes of tomato Lycopersicon (or now Solanum lycopersicum) were first
described by Luckwill (Luckwill 1943) and categorized as seven types trichomes. The type I, IV,
VI and VII are glandular trichomes which have a secretory head and an important site for
biosynthesis and accumulation of a wide range of plant natural products. The type I trichomes
have multicellular base and long multicellular stalk, while type IV trichomes have a unicellular
base and short multicellular stalk compared to type I trichomes. The type VI trichomes
containing the four-celled glandular head have been the most heavily studied trichomes in
tomato. The type VII trichomes are irregularly shape and have short unicellular stalk (Luckwill
1943). The types II, III and V are non-glandular trichomes. The type II and III are similar with
the multicellular and unicellular base individually, while the type V trichomes are short with
unicellular base (Kang et al. 2010b; Levin 1973).
Trichome density is an important factor of resistance against herbivorous insects (Levin
1973; Traw and Dawson 2002a). The presence and density of leaf trichomes can influence both
host-plant selection behavior and performance (i.e. growth, survival and fecundity) of
herbivorous insects, but can be considered a relatively soft “weapon” in plant defense compared
with many other traits that are lethal to insects. The role of glandular trichomes in resistance of
L. hirsutum has been thoroughly explored by Gurr & McGrath (2002). Research has shown
glandular trichomes of tomato species spp. are responsible for resistance to various insects (Kang
et al. 2010a; Kang et al. 2010b). Studies showed the trichome density is negatively related to
insect growth and experimental removal of leaf trichome results increasing insect performance
on several species plants (Ashouri et al. 2001). Experimentally removing glandular trichome
heads and exudates significantly decreased the mortality of neonates on the two accessions with
16
highest levels of resistance in their natural state. This supports similar findings from previous
research conducted on the potato aphid (Gentile et al. 1969), H. zea (Dimock et al. 1982), L.
decemlineata (Kennedy 2003) and T. vaporariorum (Gentile et al. 1969). Glandular trichomes
can be viewed as a combination of a structural and chemical defense (Sarria et al. 2010). Non-
glandular trichome had a negative effect on oviposition, hatching rate and survival of insects
(Baur et al. 1991).
Some plant species respond to insect feeding or mechanical wounding by producing more
trichomes on new growth leaves (Agrawal 1999; Dalin and Björkman 2003). The trichome
density is typically increased between 25%-100% within days or weeks after the wounding (Baur
et al. 1991). For example Björkman study showed that the trichome production was induced by
leaf beetle herbivory in the willow Salix cinerea. The damage on the leaf could also change the
relative proportions of glandular and non-glandular trichomes. Recent study on Arabidopsis
trichomes showed jasmonate acid regulates the systemic trichome development (Karban et al.
2003; Traw and Dawson 2002). Application of jasmonic acid (JA) or methyl jasmonate (MeJA)
and gibberellin (GA) increase trichome production on newly growth leaves but salicylic acid
(SA) reduces trichome production. Thus the hormone levels in plants regulate trichome
production on leaves (Boughton et al. 2005; Traw and Bergelson 2003). The abiotic stress such
as drought and UV-radiation also could induce trichome production (Nagata et al. 1999).
The most remarkable feature of tomato trichomes is their capacity to produce and secrete
a wide variety of plant secondary compounds including terpenoids (Bos et al. 2010; Kang et al.
2010a; Schilmiller et al. 2010), phenolics (Gang et al. 2001), sucrose esters, methylketones
(Ben-Israel et al. 2009) and organic acids (Voirin et al. 1993). Many of the trichome-borne
compounds have significant value as fragrances, food additives or natural pesticide (Wagner
17
1991). Due to the importance of trichome chemicals in defense more studies need to focus on
systemic analysis of the metabolites in trichomes and elucidation of their biosynthetic pathway
(Schilmiller et al., 2008, 2009, 2010; Kang, 2010). For example type VI trichomes in tomato
produce 2-tridecanone and other methylketones that are high toxic to some arthropod pests of
tomato. In Nicotiana species, the accumulation of nicotine in trichomes induced by jasmonate is
toxic to Manduca sexta (Preston et al. 2001).
In contrast to the broad knowledge on trichome morphology and chemistry, the protein
complement of the trichome is relatively less studied. The proteomics and molecular techniques
are useful tools to analysis the enzyme and pathway of the chemicals in trichomes. Shotgun
proteomics analysis allows the identification and relative quantification of the proteins in
trichomes. Extensive DNA sequencing was combined with proteomics aids in the genes and
proteins expressed in trichomes. Studies showed that the monoterpene (MTS1) and sesquiterpene
(SST1) synthesis genes play a key role in regulating terpenoid production in glandular trichomes
in tomato (Besser et al. 2009). Proteinase inhibitor proteins, interfere the herbivory physiology
by inhibiting the digestive process of insects, are constitutively expressed in trichomes. In
addition to proteinase inhibitors, the trichomes of many Solanum species also accumulate
polyphenol oxidase which plays an important role defense insects and pathogens. Trichome-
based host plant resistance may have the potential to reduce pesticide use during tomato
production.
Because tomato (Solanum lycopersicum) is an economically important crop, it serves as a
model for studying plant defenses against herbivores and diseases (Green and Ryan 1972; Howe
and Jander 2008; Mirnezhad et al. 2010). Decades of research on tomato has shown that
jasmonate signaling (JA) plays an important role in plant defense signaling against insect
18
herbivory (Bostock et al. 2001; Thaler et al. 2001). Trichomes in cultivated tomato and related
wild species have been subjects of intense study for many decades (Steffens 1991; Kennedy et al.
1991; Peiffer et al. 2009).
In tomato, the effect of trichome-based resistance on insect herbivores has mostly
focused on glandular trichomes and there has been considerably less study on the role of non-
glandular trichomes against herbivores (Kang et al. 2010a). Because most cultivars possess both
glandular and non-glandular trichomes, it is difficult to separate trichome function(s) in these
commercial varieties. To study different trichome function in plant defense, the mutants with
different type’s trichome will be good to study the function of trichome in plant defense.
Mechanism of transgenerational plant defense
Plants being have evolved diverse strategies to continuously adjust their response to a
broad range of stresses and herbivore challenges. Herbivore resistance mediated by jasmonic
acid (JA) and related metabolites within one generation has been extensively studied
(Wasternack et al. 2006), but there is little investigation into the longer-term inducible defense in
plants or how resistance may persist across generations.
Changes in the parental condition can affect the phenotype of their offspring. This
process is considered as an epigenetic (non-genetic) phenomenon which can persist over many
generations, since the parental effects significantly affect the phenotype of its offspring via
transmission of non-genetic information. Agrawal and colleagues used wild radish (Raphanus
raphanistrum L. brassicacease) and herbivory as model to examine the induced defense in the
next generation, and they found when insects fed on maternal plants, the progeny were more
resistant than progeny from undamaged plants (Agrawal 1999). In the field experiments, plants
19
exposed to herbivory in the early season had 60% higher relative fitness than undamaged
controls (Agrawal 1999). Induced responses in wild radish showed variation corresponding with
different insect herbivores. In some instances, the offspring of the damaged plants showed
higher numbers of trichomes compared to the offspring from their undamaged parts (Agrawal
2001). A similar phenomenon was also observed that the increased glandular trichome density
in the progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to
herbivory (Holeski 2007). Further the maternal generation exposed to herbivory also had positive
effects on other traits in the offspring such as seed biomass and flower production (Streets and
TL 2010). In addition, environmental factors can influence the properties of the offspring, when
seeds from plants grown under warm temperature during flowering and seed development, the
progeny showed higher nitrogen content, higher germination and growth rate, and increased
seed biomass and seed production (BlÖDner et al. 2007). The mechanisms of transgenerational
plant defense study could provide a useful tool for crop management (Chinnusamy and Zhu
2009).
Transgenerational plant defense means that the offspring’s immunity traits are acquired
by the adult parent; in other words the adaptation of the maternal effects responding to the
environment can improve the fitness and immunity traits of the offspring. Several studies have
examined the contribution of maternal stress to offspring’s phenotype and fitness. Agrawal and
colleagues used wild radish (Raphanus raphanistrum L. brassicacease) and insect herbivory as
model to examine induced defenses in next generation, and they found insect feeding on the
maternal wild radish caused progeny to be more resistant than progeny from unfed wild radish
(Agrawal 1999). Field experiments showed that plants exposed to herbivory in the early season
had 60% higher relative fitness than un-exposed controls (Agrawal 1999). In some instances, the
20
offspring of the damaged plants showed higher numbers of trichomes compared to the offspring
from their undamaged parents (Agrawal 2001). A similar phenomenon was also observed in the
progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to
herbivores (Holeski 2007). Transgenerational induction of high trichome density could confer a
selective advantage, if offspring are likely to experience the same herbivore pressure as their
parents.
How plants transmit the stress responsive properties to the next generation, and the
underlying mechanisms of transgenerational adaptation are currently not well known. The
transgenerational defense should not result from random mutagenesis followed by the selection
of the fittest individuals, as the frequency of spontaneous mutations is rather low. The genome
stability is maintained by various repair mechanisms, and homologous recombination may serve
as an important mechanism involved in repair (Schuermann et al. 2005). One recent study
showed that the progeny of Nicotiana tabacum infected with tobacco mosaic virus exhibited a
high frequency of rearrangements at disease resistance gene-like loci (Kathiria et al. 2010), and
other couple studies also found the correlation between transgenerational transmission with the
homologous recombination frequency (HRF) response to stress. These data suggest that
continuous exposure to the stress may lead the evolutionary selection of the adaptive traits which
are beneficial to the plants.
Among the inheritable genome changes, reversible DNA methylation and chromatin
modifications are involved in the regulation of gene expression (Zilberman and Henikoff 2005).
This reversible epigenetic adaptation could serve plants as an alternative strategy to
environmental stresses. DNA methylation include both asymmetric (m
CpHpH)-methylation and
symmetric (m
CpG and m
CpHpG)-methylation. The low level of DNA methylation frequently
21
correlates with the expression of stress specific gene; in one study, virus-infected tomato plants
showed changes in DNA methylation at several marker loci (Mason et al. 2008). Another study
showed that dandelions expose to SA led to genome wide and possible stress specific changes in
DNA methylation and were transmitted to the immediate progeny (Verhoeven et al. 2010). DNA
cytosine methylation in gene promoter is associated with repressive chromatin and with
repression of gene. In maize roots, cold stress induced expression of ZmMI1 was correlated with
the reduction of methylation in the DNA of nucleosome core (Steward et al. 2002). In
Arabidopsis, the drought induced expression of stress responsive gene is associated with an
increase in H3K4 trimethylation and H3k9 acetylation. Histone variant H1 in tomato was shown
involved in regulation of stomatal conductance from drought afflicts (Tsuji et al. 2006).
Another epigenetic factor, short interfering RNAs (siRNAs), is also active in the stress
response, the siRNAs are able to move between cells and through the plant vasculature, and play
import role in signal transduction during the plant development (Chitwood and Timmermans
2010). In fact, a large number of miRNAs and other small regulatory RNAs are encoded by the
Arabidopsis genome and that some of them may play important roles in plant responses to
environmental stresses as well as in development and genome maintenance (Sunkar and Zhu
2004). Endogenous siRNAs that are regulated by abiotic stress have been identified in
Arabidopsis (Sunkar and Zhu 2004). These findings suggest that biotic and abiotic stress could
shape the plant genome by different mechanisms, the heritable epigenetic modification may
provide within generation and transgenerational stress memory.
It would be highly interesting to find distinct profile of DNA or histone methylation,
siRNA of specific stress response, which will supply more understanding of transgenerational
defense and possible as guidance for crop management and insect-resistant improvement.
22
Perspectives and future directions
Many research studies have contributed significant progress to deciphering the molecular
mechanism of plant immunity, including the roles of herbivore effectors in perception and
defense. But until now only very few number of HAMPs and effectors have been identified.
Recent reports from Arabidopsis thaliana have demonstrated how pathogens may exploit protein
interactions to manipulate a plant’s cellular machinery. More study is needed to focus on insect
derived effectors and their function in plant-insect interactions. It may be that insect herbivores
produce cocktails of effectors as seen with pathogens, and that these cocktails broadly induce
host-plant defenses. The study of effector networks will contribute to understanding plant-insect
interactions and may offer clues to improve plant production. The protein-protein interaction
map would be a good technique to study the complex signaling networks of plant and insects.
Main points
When herbivorous insects feed on plants, they cause not only physical damage, but also
produce chemicals which may be perceived by the plants and thus activate plant defenses.
Plants use combinations of constitutive and inducible defense traits to defend against
insect damage. The defense response is regulated by several hormone signaling networks
involving jasmonic acid, salicylic acid, and ethylene.
Induced plant defenses may even persist across generations. Such transgenerational
resistance may provide a novel approach to improve crop production with fewer
environmental problems than current pest management approaches.
The model system in this study
23
Because of its economic importance, relatively small genome, short life cycle, and ease
of growth and maintenance, tomato Solanum lycopersicum (formerly Lycopersicon esculentum)
has long served as a model system for plant genetics, development, pathology, and physiology.
Decades of applied and basic research has focused on defenses employed against tomato diseases
and insect herbivores, including caterpillars (Lepidoptera) and beetles (Coleoptera), both groups
of which include diverse and important group of agricultural insect pests that in addition to
damaging tomatoes cause widespread economic damage on food and fiber crop plant species,
fruit trees, forests, and stored grains.
In this research the generalist noctuid Helicoverpa zea and Solanaceae specialist,
Colorado potato beetle (CPB) (Leptinotarsa decemlineata) were used as the main insects to
study tomato-insect interaction. The larvae of H. zea (sometimes called the tomato fruitworm)
are a major agricultural pest because they feed on many different plants during the larval stage.
Management of the fruitworm requires careful monitoring for eggs and small larvae. It’s
essential to control the pest before the larvae enter fruit, where they are protected from
insecticide sprays and predators. Colorado beetle is a serious pest of potatoes and also cause
significant damage to tomatoes and eggplants. Both larvae and adults feed on the plant leaves
can cause damage.
Objective 1: Determine the function of H. zea saliva in tomato defense
Since tomato fruit is the target for food production in the field, it is imperative to better
understand the response of fruit to herbivores. Because of small size, short life and small genome
(950 Mb), the micro-tom tomato was used in the studying of H. zea saliva function (Yano et al.
24
2007). The main hypothesis is that H. zea saliva differentially modulates plant response at
different plant growth stages.
Previous study showed the glucose oxidase (GOX) is the primary salivary protein from
the caterpillar H. zea ((Musser et al. 2005). In this study I compared the plant defense response to
H. zea saliva at different growth stages including defense gene expression and trichome
induction.
Objective 2: Compare the function of different types of trichomes in defense
Seven types of trichome had been described in tomato, most cultivars possess both
glandular and non-glandular trichomes, it is difficult to separate trichome in the commercial
varieties. Different trichome mutants were used to compare trichomes role in tomato defense. In
this current study, I used two mutants with differing trichome phenotypes to examine the role of
glandular and non-glandular trichomes in resistance to the solanaceous specialist L. decemlineata
and the generalist H. zea. I hypothesized that both glandular and non-glandular trichome
phenotypes will provide different contributions to defense against these herbivorous insect
species.
Objective 3: Cross talk of JA and ET in tomato defense
Tomato has been a primary model for elucidating the signaling pathways and induced
defenses against herbivores. The effects of herbivore on plants involve a considerably more
complex interplay among varied signaling networks than earlier thought. Many researchers have
found that herbivores could elicit multiple defense pathways, which may result in cross talk
among the pathways (Felton and Korth, 2000). Most of the research has focused on signaling
25
and rapidly-induced defenses in leaves (Jose, 2001). The main objective is to study the
interaction of JA and ET on systemic induced defense.
Objective 4: Transgenerational defense in tomato
Previous study showed that changes in the parental condition could affect the phenotype
of their offspring. For example, plants exposed to herbivory in the early season had 60% higher
relative fitness than undamaged controls (Agrawal 1999). Induced responses in wild radish
showed variation corresponding with different insect herbivores. In order to test whether tomato
plants have transgenerational defense insect feeding, I exposed micro-tom tomato plants to H.
zea and collected seeds to compare how the progeny of treated plants respond to insect feeding.
26
References
Adie B, Chico JM, Rubio-Somoza I, Solano R (2007) Modulation of plant defenses by ethylene.
Journal of Plant Growth Regulation 26: 160-177
Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores
and plant fitness. Ecology 80: 1713-1723
Alborn H, Turlings T, Jones T, Stenhagen G, Loughrin J, Tumlinson J (1997) An elicitor of plant
volatiles from beet armyworm oral secretion. Science 276: 945-949
Alborn HT, Hansen TV, Jones TH, Bennett DC, Tumlinson JH, Schmelz EA, Teal PEA (2007)
Disulfooxy fatty acids from the American bird grasshopper Schistocerca americana,
elicitors of plant volatiles. Proceedings of the National Academy of Sciences of the
United States of America 104: 12976-12981
Alborn HT, Jones TH, Stenhagen GS, Tumlinson JH (2000) Identification and synthesis of
volicitin and related components from beet armyworm oral secretions. J. Chem. Ecol. 26:
203-220
Amme S, Rutten T, Melzer M, Sonsmann G, Vissers JPC, Schlesier B, Mock HP (2005) A
proteome approach defines protective functions of tobacco leaf trichomes. Proteomics 5:
2508-2518
Arimura G-i, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.
Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111
Arimura G, Ozawa R, Horiuchi J, Nishioka T, Takabayashi J (2001) Plant-plant interactions
mediated by volatiles emitted from plants infested by spider mites. Biochemical
Systematics and Ecology 29: 1049-1061
Ashouri A, Michaud D, Cloutier C (2001) Unexpected effects of different potato resistance
factors to the Colorado potato beetle (Coleoptera : Chrysomelidae) on the potato aphid
(Homoptera : Aphididae). Environ. Entomol. 30: 524-532
Baldwin IT, Halitschke R, Kessler A, Schittko U (2001) Merging molecular and ecological
approaches in plant-insect interactions. Current Opinion in Plant Biology 4: 351-358
Baur R, Binder S, Benz G (1991) Nonglandular leaf trichomes as short-term inducible defense of
the grey alder, <i>Alnus incana</i> (L.), against the chrysomelid beetle, L.
Oecologia 87: 219-226
Beck M, Komis G, Ziemann A, Menzel D, Šamaj J (2011) Mitogen-activated protein kinase 4 is
involved in the regulation of mitotic and cytokinetic microtubule transitions in
Arabidopsis thaliana. New Phytologist 189: 1069-1083
Bede J, Musser R, Felton G, Korth K (2006) Caterpillar herbivory and salivary enzymes
decrease transcript Levels of Medicago truncatula genes encoding early enzymes in
terpenoid biosynthesis. Plant Mol Biol 60: 519-531
Ben-Israel I, Yu G, Austin MB, Bhuiyan N, Auldridge M, Nguyen T, Schauvinhold I, Noel JP,
Pichersky E, Fridman E (2009) Multiple biochemical and morphological factors underlie
the production of methylketones in tomato trichomes. Plant Physiology 151: 1952-1964
Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of
stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119
Besser K, Harper A, Welsby N, Schauvinhold I, Slocombe S, Li Y, Dixon RA, Broun P (2009)
Divergent regulation of terpenoid metabolism in the trichomes of wild and cultivated
tomato species. Plant Physiol. 149: 499-514
Bhattarai KK, Li Q, Liu Y, Dinesh-Kumar SP, Kaloshian I (2007) The Mi-1-Mediated Pest
27
Resistance Requires Hsp90 and Sgt1. Plant Physiol. 144: 312-323
Bi JL, Murphy JB, Felton GW (1997) Does salicylic acid act as a signal in cotton for induced
resistance to Helicoverpa zea? J. Chem. Ecol. 23: 1805-1818
Boege K, Marquis RJ (2005) Facing herbivory as you grow up: the ontogeny of resistance in
plants. Trends in Ecology & Evolution 20: 441-448
Bonaventure G, VanDoorn A, Baldwin IT (2011) Herbivore-associated elicitors: FAC signaling
and metabolism. Trends in Plant Science 16: 294-299
Bos JIB, Prince D, Pitino M, Maffei ME, Win J, Hogenhout SA (2010) A functional genomics
approach identifies candidate effectors from the aphid species Myzus persicae (green
peach aphid). Plos Genetics 6
Bostock RM, Karban R, Thaler JS, Weyman PD, Gilchrist D (2001) Signal interactions in
induced resistance to pathogens and insect herbivores. European Journal of Plant
Pathology 107: 103-111
Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased
densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 31:
2211-2216
Carroll MJ, Schmelz EA, Meagher RL, Teal PEA (2006) Attraction of Spodoptera frugiperda
larvae to volatiles from herbivore-damaged maize seedlings. J. Chem. Ecol. 32: 1911-
1924
Casteel CL, Ranger CM, Backus EA, Ellersieck MR, Johnson DW (2006) Influence of plant
ontogeny and abiotic factors on resistance of glandular-haired alfalfa to potato leafhopper
(Hemiptera: Cicadellidae). J Econ Entomol 99: 537-543
Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410: 37-40
Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004a) Regulation of plant arginase
by wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem 279: 45998-46007
Chen M-S, Liu X, Yang Z, Zhao H, Shukle R, Stuart J, Hulbert S (2010) Unusual conservation
among genes encoding small secreted salivary gland proteins from a gall midge. BMC
Evolutionary Biology 10: 296
Chen M, Fellers J, Stuart J, Reese J, Liu X (2004b) A group of related cDNAs encoding secreted
proteins from Hessian fly [Mayetiola destructor (Say)] salivary glands. Insect Mol Biol
13: 101 - 108
Chini A, Boter M, Solano R (2009) Plant oxylipins: COI1/JAZs/MYC2 as the core jasmonic
acid-signalling module. FEBS J 276: 4682-4692
Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-
Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ family of
repressors is the missing link in jasmonate signalling. Nature 448: 666-671
Cole AB, Kiraly L, Lane LC, Wiggins BE, Ross K, Schoelz JE (2004) Temporal expression of
PR-1 and enhanced mature plant resistance to virus infection is controlled by a single
dominant gene in a new Nicotiana hybrid. Mol Plant Microbe Interact 17: 976-985
Constabel CP, Bergey DR, Ryan CA (1995) Systemin activates synthesis of wound-inducible
tomato leaf polyphenol oxidase via the octadecanoid defense signaling pathway. Proc
Natl Acad Sci U S A 92: 407-411
Creelman RA, Mullet JE (1995) Jasmonic acid distribution and action in plants: regulation
during development and response to biotic and abiotic stress. Proc Natl Acad Sci U S A
92: 4114-4119
Dalin P, Ågren J, Björkman C, Huttunen P, Kärkkäinen K (2008) Leaf trichome formation and
28
plant resistance to herbivory. In: Schaller A (ed) Induced Plant Resistance to Herbivory,
pp 89-105
Dalin P, Björkman C (2003) Adult beetle grazing induces willow trichome defence against
subsequent larval feeding. Oecologia 134: 112-118
Dangl JL, Jones JDG (2001) Plant pathogens and integrated defence responses to infection.
Nature 411: 826-833
De Moraes CM, Lewis WJ, Pare PW, Alborn HT, Tumlinson JH (1998) Herbivore-infested
plants selectively attract parasitoids. Nature 393: 570-573
de Vos M, Cheng WY, Summers HE, Raguso RA, Jander G (2010) Alarm pheromone
habituation in Myzus persicae has fitness consequences and causes extensive gene
expression changes. Proceedings of the National Academy of Sciences 107: 14673-14678
De Vos MM, Van Oosten VRVR, Van Poecke RMRMP, Van Pelt JAJA, Pozo MJMJ, Mueller
MJMJ, Buchala AJAJ, Métraux JPJ-P, Van Loon LLC, Dicke MM, Pieterse CMCMJ
(2005) Signal signature and transcriptome changes of Arabidopsis during pathogen and
insect attack. Molecular Plant-Microbe Interactions 18: 923-937
Delphia CM, Mescher MC, Felton G, De Moraes CM (2006) The role of insect-derived cues in
eliciting indirect plant defenses in tobacco, Nicotiana tabacum. Plant Signaling and
Behavior 1: 243-250
Dicke M, Dijkman H (2001) Within-plant circulation of systemic elicitor of induced defence and
release from roots of elicitor that affects neighbouring plants. Biochemical Systematics
and Ecology 29: 1075-1087
Doares SH, Narvaez-Vasquez J, Conconi A, Ryan CA (1995) Salicylic acid inhibits synthesis of
proteinase inhibitors in tomato leaves induced by systemin and jasmonic acid. Plant
Physiology 108: 1741-1746
Dogimont C, Bendahmane A, Chovelon V BN (2010) Host plant resistance to aphids in
cultivated crops: genetic and molecular bases, and interactions with aphid populations. C
R Biol 333: 566-573
Eichenseer H, Mathews MC, Bi JL, Murphy JB, Felton GW (1999) Salivary glucose oxidase:
multifunctional roles for Helicoverpa zea? Arch. Insect Biochem. Physiol. 42: 99-109
Farmer EE, Ryan CA (1992) Octadecanoid precursors of jasmonic acid activate the synthesis of
wound-inducible proteinase inhibitors. Plant Cell 4: 129-134
Felton GW, Eichenseer H (1999) Herbivore saliva and its effects on plant defense against
herbivores and pathogens. In: Agrawal AA, Tuzun S, Bent E (eds) Induced Plant
Defenses Against Pathogens and Herbivores. APS Press, St. Paul, MN, pp 19-36
Felton GW, Tumlinson JH (2008) Plant-insect dialogs: complex interactions at the plant-insect
interface. Current Opinion in Plant Biology 11: 457-463
Gang DR, Wang J, Dudareva N, Nam KH, Simon JE, Lewinsohn E, Pichersky E (2001) An
investigation of the storage and biosynthesis of phenylpropenes in sweet basil. Plant
Physiol. 125: 539-555
Gfeller A, Liechti R, Farmer EE (2006) Arabidopsis Jasmonate Signaling Pathway. Sci. STKE:
stke.3222006cm3222001
Glombitza S, Dubuis PH, Thulke O, Welzl G, Bovet L, Gotz M, Affenzeller M, Geist B, Hehn
A, Asnaghi C, Ernst D, Seidlitz HK, Gundlach H, Mayer KF, Martinoia E, Werck-
Reichhart D, Mauch F, Schaffner AR (2004) Crosstalk and differential response to abiotic and
biotic stressors reflected at the transcriptional level of effector genes from secondary
metabolism. Plant Mol Biol 54: 817-835
29
Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible
defense mechanism against insects. Science 175: 776-777
Halitschke R, Schittko U, Pohnert G, Boland W, Baldwin IT (2001) Molecular interactions
between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural
host Nicotiana attenuata. III. Fatty acid-amino acid conjugates in herbivore oral
secretions are necessary and sufficient for herbivore-specific plant responses. Plant
Physiol. 125: 711-717
Heil M, Kost C (2006) Priming of indirect defences. Ecology Letters 9: 813-817
Heinrich M, Baldwin IT, Wu J (2011) Two mitogen-activated protein kinase kinases, MKK1 and
MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca sexta-
induced responses in Nicotiana attenuata. . Journal of Experimental Botany 62: 4355-
4365.
Hilker M, Meiners T (2002) Induction of plant responses to oviposition and feeding by
herbivorous arthropods: a comparison. Entomologia Experimentalis et Applicata 104:
181-192
Hogenhout SA, Van der Hoorn RAL, Terauchi R, Kamoun S (2009) Emerging concepts in
effector biology of plant-associated organisms. Molecular Plant-Microbe Interactions 22:
115-122
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant
Biology 59: 41-66
Steffens DW (1991) Biochemical aspects of glandular trichome-mediated insect resistance in
the Solanaceae. Naturally Occuring Pest Bioregulators. A.C.S. symposium series 449
Kachroo P, Venugopal SC, Navarre DA, Lapchyk L, Kachroo A (2005) Role of Salicylic Acid
and Fatty Acid Desaturation Pathways in ssi2-Mediated Signaling. Plant Physiol.:
pp.105.071662
Kahl J, Siemens DH, Aerts RJ, Gäbler R, Kühnemann F, Preston CA, Baldwin IT (2000)
Herbivore-induced ethylene suppresses a direct defense but not a putative indirect
defense against an adapted herbivore. Planta 210: 336-342
Kang J-H, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The Tomato odorless-2
Mutant Is Defective in Trichome-Based Production of Diverse Specialized Metabolites
and Broad-Spectrum Resistance to Insect Herbivores. Plant Physiol.: pp.110.160192
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology
by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental
Botany 61: 1053-1064
Karban R, Maron J, Felton GW, Ervin G, Eichenseer H (2003) Herbivore damage to sagebrush
induces resistance in wild tobacco: evidence for eavesdropping between plants. Oikos
100: 325-332
Kennedy GG, Farrar RR, Kashyap RK (1991) 2-Tridecanone Glandular Trichome-Mediated
Insect Resistance in Tomato - Effect on Parasitoids and Predators of Heliothis-Zea. Acs
Symposium Series 449: 150-165
Kessler A, Baldwin IT (2001) Defensive Function of Herbivore-Induced Plant Volatile
Emissions in Nature. Science 291: 2141-2144
Klessig DF, Durner J, Noad R, Navarre DA, Wendehenne D, Kumar D, Zhou JM, Shah J, Zhang
S, Kachroo P, Trifa Y, Pontier D, Lam E, Silva H (2000) Nitric oxide and salicylic acid
signaling in plant defense. Proceedings of the National Academy of Sciences 97: 8849-
8855
30
Levin D (1973) The role of trichomes in plant defense. Q. Rev. Biol 48: 3-15
Liu X, Williams CE, Nemacheck JA, Wang H, Subramanyam S, Zheng C, Chen M-S (2010)
Reactive Oxygen Species Are Involved in Plant Defense against a Gall Midge. Plant
Physiology 152: 985-999
Luckwill LC (1943) The genus Lycopersicon: A historical, biological and taxonomic survey of
the wild and cultivated tomato. Aberd. Univ. Stud. 120: 1-44
Ludwig AA, Saitoh H, Felix G, Freymark G, Miersch O, Wasternack C, Boller T, Jones JDG,
Romeis T (2005) Ethylene-mediated cross-talk between calcium-dependent protein
kinase and MAPK signaling controls stress responses in plants. PNAS 102: 10736-10741
Maffei ME, Mithofer A, Arimura G-I, Uchtenhagen H, Bossi S, Bertea CM, Cucuzza LS,
Novero M, Volpe V, Quadro S, Boland W (2006) Effects of Feeding Spodoptera littoralis
on Lima Bean Leaves. III. Membrane Depolarization and Involvement of Hydrogen
Peroxide. Plant Physiol. 140: 1022-1035
Maffei ME, Mithöfer A, Boland W (2007) Insects feeding on plants: Rapid signals and responses
preceding the induction of phytochemical release. Phytochemistry 68: 2946-2959
Marks MD, Wenger JP, Gilding E, Jilk R, Dixon RA (2009) Transcriptome analysis of
Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required
for trichome development. Mol Plant 2: 803-822
Mattiacci L, Dicke M, Posthumus MA (1995) -Glucosidase: an elicitor of herbivore-induced
plant odor that attracts host-searching parasitic wasps. Proc. Nat. Acad. Sci. USA 92:
2036-2040
McConn M, Creelman RA, Bell E, Mullet JE, Browse J (1997) Jasmonate is essential for insect
defense Arabidopsis. Proc Natl Acad Sci USA 94: 5473-5477
Mirnezhad M, Romero-Gonzalez RR, Leiss KA, Choi YH, Verpoorte R, Klinkhamer PGL
(2010) Metabolomic Analysis of Host Plant Resistance to Thrips in Wild and Cultivated
Tomatoes. Phytochemical Analysis 21: 110-117
Mumm R, Schrank K, Wegener R, Schulz S, Hilker M (2003) Chemical analysis of volatiles
emitted by Pinus sylvestris after induction by insect oviposition. J. Chem. Ecol. 29: 1235-
1252
Musser R, Hum-Musser S, Eichenseer H, Peiffer M, Ervin G, Murphy J, Felton G (2002)
Herbivory: Caterpillar saliva beats plant defences. Nature 416: 599 - 600
Musser RO (2005) Insect saliva: an integrative approach. Arch Insect Biochem Physiol 58: 53
Nagata T, Todoriki S, Hayashi T, Shibata Y, Mori M, Kanegae H, Kikuchi S (1999) γ-
Radiation Induces Leaf Trichome Formation in Arabidopsis. Plant Physiology 120: 113-
120
O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ (2003)
Multiple hormones act sequentially to mediate a susceptible tomato pathogen defense
response. Plant Physiol 133: 1181-1189
Odonnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as a
signal mediating the wound response of tomato plants. Science 274: 1914-1917
Pearce G, Moura DS, Stratmann J, Ryan CA (2001) Production of multiple plant hormones from
a single polyprotein precursor. Nature 411: 817-820
Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary
glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113
Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as
sensors for insect herbivores. New Phytologist 184: 644-656
31
Pieterse CMJ, Dicke M (2007) Plant interactions with microbes and insects: from molecular
mechanisms to ecology. Trends in Plant Science 12: 564-569
Pohnert G, Koch T, Boland W (1999) Synthesis of volicitin: a novel three-component Wittig
approach to chiral 17-hydroxylinolenic acid. Chemical Communications: 1087-1088
Preston CA, Laue G, Baldwin IT (2001) Methyl jasmonate is blowing in the wind, but can it act
as a plant-plant airborne signal? Biochemical Systematics and Ecology 29: 1007-1023
Ryan CA (1974) Assay and biochemical properties of the proteinase inhibitor inducing factor, a
wound hormone. Plant Physiol. 54: 328
Sarria E, Palomares-Rius FJ, Lopez-Sese AI, Heredia A, Gomez-Guillamon ML (2010) Role of
leaf glandular trichomes of melon plants in deterrence of Aphis gossypii Glover. Plant
Biol (Stuttg) 12: 503-511
Schilmiller A, Shi F, Kim J, Charbonneau AL, Holmes D, Jones AD, Last RL (2010) Mass
spectrometry screening reveals widespread diversity in trichome specialized metabolites
of tomato chromosomal substitution lines. Plant Journal 62: 391-403
Schmelz E, Alborn H, Engelberth J, Tumlinson J (2003a) Nitrogen deficiency increases
volicitin-induced volatile emission, jasmonic acid accumulation, and ethylene sensitivity
in maize. Plant Physiology 133: 295
Schmelz EA, Alborn HT, Tumlinson JH (2003b) Synergistic interactions between volicitin,
jasmonic acid and ethylene mediate insect-induced volatile emission in Zea mays.
Physiologia Plantarum 117: 403-412
Schmelz EA, Carroll MJ, LeClere S, Phipps SM, Meredith J, Chourey PS, Alborn HT, Teal PEA
(2006) Fragments of ATP synthase mediate plant perception of insect attack. Proc Natl
Acad Sci USA 103: 8894-8899
Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH,
3rd (2003c) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic
compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557
Shoji T, Ogawa T, Hashimoto T (2008) Jasmonate-Induced Nicotine Formation in Tobacco is
Mediated by Tobacco COI1 and JAZ Genes. Plant Cell Physiol. 49: 1003-1012
Spiteller D, Boland W (2003) N-(15,16-Dihydroxylinoleoyl)-glutamine and N-(15,16-
epoxylinoleoyl)-glutamine isolated from oral secretions of lepidopteran larvae.
Tetrahedron 59: 135-139
Steppuhn A, Baldwin IT (2008) Induced defenses and the cost-benefit paradigm. In: Schaller A
(ed) Induced Plant Resistance to Herbivory, pp 61-83
Stout M-J, Workman K-V, Duffey S-S (1996) Identity, spatial distribution, and variability of
induced chemical responses in tomato plants. Entomologia Experimentalis et Applicata
79(3): 255-271
Thaler J-S (2002) Effect of jasmonate-induced plant responses on the natural enemies of
herbivores. Journal of Animal Ecology
Thaler JS, Stout MJ, Karban R, Duffey SS (2001) Jasmonate-mediated induced plant resistance
affects a community of herbivores. Ecol Entomol 26: 312-324
Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin
on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375
Traw MB, Dawson TE (2002) Differential induction of trichomes by three herbivores of black
mustard. Oecologia 131: 526-532
Truitt CL, Pare PW (2004) In situ translocation of volicitin by beet armyworm larvae to maize
and systemic immobility of the herbivore elicitor in planta. Planta 218: 999-1007
32
Truitt CL, Wei H-X, Pare PW (2004) A plasma membrane protein from Zea mays binds with the
herbivore elicitor volicitin. Plant Cell 16: 523-532
Van der Ent S, Van Wees SCM, Pieterse CMJ (2009) Jasmonate signaling in plant interactions
with resistance-inducing beneficial microbes. Phytochemistry 70: 1581-1588
Vandenborre G, Groten K, Smagghe G, Lannoo N, Baldwin IT, Van Damme EJM (2010)
Nicotiana tabacum agglutinin is active against Lepidopteran pest insects. Journal of
Experimental Botany 61: 1003-1014
Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant Immunity: It’s the Hormones Talking,
But What Do They Say? Plant Physiology 154: 536-540
Voelckel C, Baldwin IT (2004) Herbivore-induced plant vaccination. Part II. Array-studies
reveal the transience of herbivore-specific transcriptional imprints and a distinct imprint
from stress combinations. Plant Journal 38: 650-663
Voirin B, C.Bayet, M.Coulso (1993) Demonstration that flavone aglycones accumulate in the
peltate glands of Mentha × piperita leaves. Phytochemistry 34: 85-87
Wagner GJ (1991) Secreting glandular trichomes - more than just hairs. Plant Physiology 96:
675-679
Walling L (2009) Adaptive defense responses to pathogens and insects. Advances in Botanical
Research 51: 551-612
Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth
Regulation 19: 195-216.
Wang B, Wang Y, Wang Q, Luo G, Zhang Z, He C, He SJ, Zhang J, Gai J, Chen S (2004)
Characterization of an NBS-LRR resistance gene homologue from soybean. J Plant
Physiol 161: 815-822
Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,
Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant
Physiology 163: 297-306
Weber H, Chetelat A, Reymond P, Farmer EE (2004) Selective and powerful stress gene
expression in Arabidopsis in response to malondialdehyde. The Plant Journal 37: 877-888
Will T, van Bel AJE (2006) Physical and chemical interactions between aphids and
plants. Journal of Experimental Botany 57: 729-737
Wu J, Baldwin IT (2010) New Insights into Plant Responses to the Attack from Insect
Herbivores. Annual Review of Genetics 44: 1-24
Wu J, Hettenhausen C, Meldau S, Baldwin IT (2007) Herbivory rapidly activates MAPK
aignaling in attacked and unattacked leaf regions but not between leaves of Nicotiana
attenuata. Plant Cell 19: 1096-1122
Yoshinaga N, Aboshi T, Ishikawa C, Fukui M, Shimoda M, Nishida R, Lait CG, Tumlinson JH,
Mori N (2007) Fatty acid amides, previously identified in caterpillars, found in the
cricket Teleogryllus taiwanemma and fruit fly Drosophila melanogaster larvae. J. Chem.
Ecol. 33: 1376-1381
Zhang Y, Xu S, Ding P, Wang D, Cheng YT, He J, Gao M, Xu F, Li Y, Zhu Z, Li X, Zhang Y
(2010) Control of salicylic acid synthesis and systemic acquired resistance by two
members of a plant-specific family of transcription factors. Proceedings of the National
Academy of Sciences 107: 18220-18225
33
Chapter II
Salivary glucose oxidase from caterpillars mediates the induction of rapid and
delayed-induced defenses in the tomato plant
Tian, D1, Peiffer, M.
1, Shoemaker, E
1, Tooker, J.
1, Haubruge, E.
2, Francis, F.
2, Luthe, D.S.
3 and
Felton, G.W.1
1Department of Entomology
Center for Chemical Ecology
Penn State University
University Park, PA 16802, USA
2Functional and Evolutionary Entomology
Gembloux Agro-Bio Tech
University of Liege, Liege, Belgium
3Department of Crop and Soil Science
Center for Chemical Ecology
Penn State University
University Park, PA 16802, USA
Correspondence: G.W. Felton
e-mail: [email protected]
Tian D, Peiffer M and Felton GW (2012) Herbivore Effector Triggered Immunity? Salivary Glucose
Oxidase Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant. Plos one
April 2012 | Volume 7 | Issue 4 | e36168
34
Abstract
When Helicoverpa zea (H. zea) feeds on plants, the oral secretions inevitably comes in
contact with wounded plant tissue and play very important role in regulating plant defense. The
proteomic analysis showed glucose oxidase (GOX) is the main protein in H. zea saliva. Saliva
collected from spinneret had higher GOX activity, while the regurgitant showed no GOX
activity. Mechanical ablated spinneret could stop saliva release which is confirmed by
immunodetection method with anti-GOX. Intact insect fed significantly induce proteinase
inhibitor (PIN2) gene expression and trichome number on the newly growth leaves compared to
the ablated fed. Mechanical wounded with saliva or fungal GOX treatment at different growth
stages, showed different induction. Both GOX and saliva induce leaf and green fruit PIN2 gene
expression, while the flower and red fruit didn’t show any induction compare to non-treatment.
GOX and saliva treatment also induce the newly growth leaf trichome number. Experimentally
remove trichome significantly increase the leaf damage and insect growth. These findings
showed that H. zea saliva play important role in tomato defense, including induces defense gene
expression and increase trichome density on newly growth leaves which affect insect growth.
Key words: Helicoverpa zea, Saliva, Glucose oxidase, Solanum lycopersicum, Induced defense,
trichome
35
Introduction
Emerging evidence indicates that when herbivores initiate feeding on a host plant, they
not only mechanical damage plants, but also present “cues” that the plant perceives and uses to
rapidly mobilize induced defenses in response to attack (Fatouros et al. 2008; Maffei et al. 2006;
Mithofer et al. 2005; Musser et al. 2002; Peiffer et al. 2009; Tooker et al. 2010). Over the years
evidence has accumulated that insect derived a cocktail of chemicals during feeding which
modulate plant defenses (Felton and Tumlinson 2008; Mattiacci et al. 1995; Musser 2005;
Schmelz et al. 2007). These include fatty acid-amino acid conjugates (FACs) identified in
various lepidopteran larvae (Alborn et al. 1997; Spiteller et al. 2000), β-glucosidase from larvae
of white cabbage butterfly (Pieris brassicae)(Mattiacci et al. 1995), inceptins isolated from fall
armyworm (Spodoptera frugiperda) larvae and caeliferins identified from grasshopper species
(Schistocerca americana) (Alborn et al. 2007). Glucose oxidase (GOX) was first characterized a
salivary enzyme from Helicoverpa zea (H. zea) (Musser et al. 2002). Although already identified
some chemicals from specific species of insects, our understanding of the chemistry of these
secretions is still very much in its infancy. Identification more chemicals in the oral secretions
will be better to study the oral secretions function.
To investigate oral secretion specific function, researchers have applied larval oral
secretions or regurgitant to mechanical wounds or directly mechanically stop secretions. Several
studies demonstrated that application of insect oral secretion to artificial wounds can mimic most
plant responses to herbivory (Maffei et al. 2004; Musser et al. 2006). For example, β-glucosidase
from Pieris brassicae induces the release of a volatile blend when applied to wounded cabbage
leaves, causing the attraction of the parasitoid Cotesia glomerata (Mattiacci et al. 1995). Fatty
acid–amino acid conjugates (FACs) are produced by many lepidopteran caterpillars and induce
36
direct and indirect defense responses in plants (Alborn et al. 1997; Roda et al. 2004). In general,
these insect oral secretions are important effectors which act as elicitor or suppressor in
mediating of indirect or direct defense (Consales et al. 2011; Delphia et al. 2006; Felton and
Eichenseer 1999; Musser et al. 2005; Weech et al. 2008a; Will et al. 2007).
Plants defensively respond to insect herbivory by both general and specific induced
defense has been documented in a voluminous literature (Kaloshian and Walling 2005; Walling
2000). Among the strategies, the synthesis of secondary metabolites in plants is the powerful
chemical weapon and function similar as toxins to inhibit herbivore's nutrition and growth
(Bergey et al. 1999; Chao et al. 1999; Hui et al. 2003). Besides chemicals weapon plants also
could attract the predators and parasitoids of herbivore through release of volatile organic
compounds (VOCs) (Arimura et al. 2005). The more extensive research found that the plant
induce defense were regulated by plant hormones (Berger and Altmann 2000; Steppuhn and
Baldwin 2008), such as Jasmonic acid (JA) which is rapidly synthesize from fatty acid precursor
following herbivore attack and play a key role in induction of plant defense to chewing
herbivore. The cascade of proteins include proteins such as proteinase inhibitors (Diez-Diaz et al.
2004; Thipyapong et al. 2007); polyphenol oxidases (Constabel et al. 1995; Felton et al. 1989;
Felton et al. 1992); ascorbate oxidase (Felton and Summers 1993); leucine aminopeptidase
(Pautot et al. 1993); arginase and threonine deaminase (Lin et al. 2008) which are regulated by
the octadecanoid pathway (Farmer 2007; Howe et al. 1996; Victoriano and Gregório 2002). In
addition to these proteins, the role of glandular trichomes in resistance of insect feeding has
recently been more thoroughly explored by Gurr & McGrath (2002). Glandular trichomes in
tomato are a formidable defense against some herbivores by secreting sticky, noxious
compounds that affect insect growth (Kang et al. 2010a; Kang et al. 2010b). The production of
37
these trichomes is induced by insect feeding or application of methyl jasmonate (Agrawal 1999;
Boughton et al. 2005).
Every plant has different development growth stage during life. The production of
defense response insect herbivore may be different. The induced plant defense has been mainly
focused on studied in leaves since the biosynthesis of defense compounds is thought to be energy
and nutrient demanding (Karban et al. 2000). Defense on fruits, despite being the preferred
feeding site of a number of caterpillar pests such as H. zea, has been largely ignored. Only a few
study investigate the induce defense in plant reproductive tissues (McCall and Karban 2006;
Wang et al. 2009). Because tomato fruit is the main target for food production, it is imperative to
better understand the response of fruits to herbivory.
Because of the complexity of plant signaling networks, there are multiple points at which
caterpillar secretions may intercept or amplify signaling components. For example, the chewing
herbivores use mandibles and maxillae for chewing and processing the food. By way of
background, their secretions may arise from regurgitant derived from the digestive system
(Peiffer and Felton 2009) or from saliva produced by the salivary glands (Felton 2008a). The
previous study showed that glucose oxidase from the labial glands may suppress wound-induced
accumulation of nicotine in tobacco (Musser et al. 2002). Regurgitant is known to contain scores
of proteins (Liu et al. 2004), as well as fatty acid-glutamine conjugates such as volicitin, which
elicit the production of plant volatiles—important components of indirect defense and plant-plant
signaling (Engelberth et al. 2004; Mori et al. 2001). We initiated this investigation in tomato to
examine the role of saliva in mediating tomato defense at different growth stages. This study
provided evidence of saliva as effectors in induced plant defenses at different growth stages. The
38
micro-tom tomato is the best for us to study the defense at different growth stage because of its
short generation time (ca. 55days), diminutive size and known JA signaling pathway.
Material and Methods
Plants and insects
The tomato (Solanum lycopersicum, cv. Better boy and Micro-Tom) were grown as
described (Peiffer and Felton, 2005) and used at different growth stage. For all induction
experiments, plants were maintained in greenhouse under 800W Super Spectrum lights (Sunlight
Supply Co., Vancouver, WA). Tomato fruit worm (H. zea) eggs were purchased from BioServ
(Frenchtown, NJ) and reared on a wheat germ and casein-based artificial diet (Bansal et al. 2011)
with ingredients from Bioserv in the Entomology Department, Penn State University (University
Park PA, USA).
Collection of H. zea saliva and regurgitant
To collect H. zea saliva, 5th
instar larva were chilled on ice. Flaccid larva were then
immobilized in a metal hair clip and observed with a dissecting microscope. As the larva
returned to room temperature, the saliva was collected from spinneret secretions in glycerol with
gel loading pipette tip (VWR, West Chester, PA) and pooled 10 caterpillar collection as one
sample dispensing them into micro-centrifuge tube on ice. Regurgitant was collected from these
larvae by gently squeezing the caterpillars, collecting the oral secretions using pipette and
dispensing them into a micro-centrifuge tube on ice. All the collections were stored at –80º C
until use.
Proteomics of H. zea Saliva
39
For proteomic identification of saliva proteins, saliva was collected as described above,
except 5mM EDTA in 50 mM Tris-HCl, pH 8.0 was used in place of glycerol. Saliva was
collected from 100 H. zea larva into 30 µl of buffer and stored at -80 C. NanoLC was carried out
using a Dionex Ultimate 3000 (Milford, MA). Mobile phase solvents A and B were 0.1% TFA
(v/v) in water and 0.1% TFA (v/v) in 80% Acetonitrile respectively. Tryptic peptides were
fractionated at a flow rate of 0.6 µl/min using linear gradients and the following program: 5% B
for 5min, 5 to 15% B over 5min, 15 to 60% B over 40 min, 60 to 95% B over 1 min and hold for
5 min. The mobile phase was ramped back to the initial conditions. Fractions were collected at
20-seconds intervals followed by Mass Spectrometry analysis on Applied Biosystems proteomics
Analyzer. Peptides were searched against an insect database.
Glucose oxidase (GOX) activity assay and visualize on leaf
The GOX activity was determined according to the method described by Eichenseer et al.
(1999). The glucose (0.1mM) and o-dianisidine (2.1M) were use as reaction cocktail with the
sample and measure spectrophotometric at 460mm. The regurgitant was used directly after
centrifuge. Because small volume of saliva, it was combined with 30μl PBS buffer for GOX
activity assay. To compare whether ablated and insect fed affect GOX on leaf surface, tissue
printing experiments were followed Peiffer and Felton description (2005). Ablated and intact six-
instar larvae were fed overnight on detached tomato leaf. Then after transfer to nitrocellulose and
superblock, and incubated with anti-GOX, detected with vector ABC Elite and Vector DAB kit.
Insect feeding induce defense
Fifth-instar H. zea larvae were ablated using previous described method (Peiffer, 2005).
The caterpillars were chilled on ice until flaccid and then the spinneret was cauterized by
toughing with a heat pen (Electron Microscopy Sciences, Fort Washington, PA). The ablated
40
larva was allowed to recover and feed on artificial diet for 7 hrs, then starved overnight ready for
experiments. At 4th
node stage, the ablated and intact larvae were caged individually on the
fourth leaf with 6 hour feeding and then removed caterpillar and cages, empty caged plants were
use as control. After 24 hours and 48hrs caterpillar feeding, 100mg caged leaf was harvest in
liquid nitrogen and stored at -80 ° C for later RNA extraction.
Wounding induce defense on different tissues
To investigate the saliva function in regulating tomato defense, the collected saliva was
directly applied to the wounded site. Better boy and Micro-Tom seedlings were both treated to
compare different varieties response saliva treatment. The regurgitant was applied on leaf to
study its function on tomato. To test how saliva directly induce tomato defense on different
growth stages. We wounded tomato on different tissue by punching two ¼ inch diameter hole
along the mid-vein of the terminal leaflet of the 4th
leaf. Fruits were wounded by punching one
hole at the side of the fruits. Green fruit is two weeks after flowering. Red fruit is at the
beginning turning red. Flower treatment I wound at the pedicel. After wounding, we
immediately pipette 20 l of PBS buffer, H. zea saliva or fungal GOX (20ng/µl) onto the edges
of wounded site. Control plants were unwounded leaf, flower or fruit. After treatment 24 and 48
hours, 100mg plant tissues were harvest for RNA extraction and gene expression assay.
Trichome induction and function
To learn how H. zea feeding and oral secretions affect glandular trichome induction, two
methods were used to treat the plants. One treatment is ablated and intact H. zea in caged plants
feeding 6 hours then remove the cage. The other is direct wounding with saliva or fungal GOX
treatment. Each treatment replicated on 10 plants. Tomato plants were maintained in the
41
greenhouse for two weeks after wounding and secretion application, two leaf discs beside the
main vein were sampled and counted as previously described (Boughton et al. 2005).
To test the function of trichome, we mechanically removed trichome by gently touching
and rubbing with hands along the mid-vein of the leaves. In petri-dish we let 3rd
instar larvae
feeding for 24 hours and measure the damage by scanning the leaf and analysis with Sigma Scan.
And also in the small cup we use 1st instar larvae for 5 days bioassay to measure the larvae
weight.
Quantitative Real Time PCR
Tissue (100 mg), harvested from the area around the wound, was homogenized in liquid nitrogen
and total RNA extracted with RNeasy Plus Mini-kit (Qiagen, Valencia, CA). 1g purified RNA
was used with High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City,
CA) to create cDNA. Real-time PCR primers were designed using Primer Quest Software
(Applied Biosystems) (Table 1). All reactions used Power SYBR Green PCR Master Mix and
were run on a 7500 Fast Real-Time PCR System (Applied Biosystems).
The housekeeping gene ubiquitin (Rotenberg et al. 2006) was used to normalize C(T) values.
Relative quantifications, with unwounded plants as the reference group, were then calculated
using the 2-C(T)
method (Livak and Schmittgen 2001). To validate this analysis method,
primer efficiency was analyzed by comparing the normalized C(T) values of 5 serial dilutions of
cDNA. The primers used were list in Table 1. For statistical analysis, relative expression values
were analyzed by ANOVA with MiniTab (Minitab Inc., State College, PA) using Fisher’s
separation of means (P<0.05).
42
Results
GOX activity determination and detection
On the average we can collect about 5 µl of regurgitant and about 0.5 nl of saliva from
each caterpillar. Although the volume is small, regurgitant contains about 0.12µg/µl protein in
the collections, and 10 caterpillar saliva collections contain approximately 560 ng proteins, as
measured by a modified Bradford assay (Vincent and Nadeau, 1983). GOX activity assay
showed regurgitant was no GOX activity, while saliva had high activity around 1.8 mol/min/mg
proteins (Table 1).
To verify the ablation procedure successfully prevented release of saliva, we performed a
tissue blot of leaves fed on by the treated caterpillars (Peiffer and Felton, 2005). Anti-GOX was
used to detect GOX on leaf after H. zea overnight fed, there was significantly different between
the ablated and intact fed on leaf. Most of the GOX were spread on the leaf with intact fed, while
no GOX were detected on the leaf after ablated caterpillar fed. This confirmed that saliva was
released from the caterpillar spinneret at the same time when insect feeding.
The collected saliva was sent to company for shotgun proteomic analysis of secreted
salivary proteins from H. zea to identify potential candidates for plant defense elicitation. The
number of mass spectral counts obtained for each protein provides a quantitative measure of
protein abundance (Old et al. 2005). Of the 33 proteins that were identified, glucose oxidase
(GOX) was by far the most abundant protein accounting for 34% of the identified proteins
(Table 3 and Figure 2). Carboxylesterase, ecdysone oxidase, and fructosidase were the next
most abundant proteins.
H. zea feeding induces tomato defense
43
The previous study showed the H. zea fed on tobacco significantly reduce tobacco
defense by decrease the nicotine synthesis (Musser et al. 2002). To know how H. zea feeding
affect tomato defense, we caged the H. zea on tomato leaf and compare the tomato defense by
gene expression assay. Proteinase inhibitors 2 (PIN2) was chosen as a defense marker gene
because it has been well characterized as a defense in tomato (Ryan 1990). The results showed
H. zea feeding significantly induced PIN2 expression in tomato leaves (Figure 3); after 24 h
feeding, the PIN2 expression was significantly higher than untreated control plants (ANOVA, F
(24hour)=17.46, P=0.03), however, there was no significant difference in PIN2 expression induced
between damage caused by caterpillars whose spinneret was intact and individuals with ablated
spinnerets, which renders them unable to release saliva (Musser et al. 2002). But after 48 h,
feeding by intact caterpillars significantly induced greater PIN2 expression than feeding by
ablated caterpillars (F(48hour)= 36.25, P<0.01). H. zea fed significantly induced PIN2 expression
on tomato leaf (figure 3a.).
To determine if saliva is affecting the genes in signaling pathways in the tomato plant, we
also check quantify the gene expression after 24 hours insect feeding. The results showed that
leaves fed by H. zea had significantly higher expression of PPO compared to untreated controls,
and also the intact fed significantly induced PPO expression than the ablated fed leaves (figure
3b). While the “early responding” signaling genes AOS, LOX and ARG associated with the
octadecanoid pathway after 24hours insect fed were not significantly induced by insect feeding,
since these gene are JA biosynthesis gene and responding at every early stages (figure3b).
Caterpillar secretions affect tomato induced defense
These data showed that H. zea saliva play an important role in induction of PIN2. To
further confirm the role of saliva in inducing defense gene expression, we wounded Better Boy
44
and MicroTom leaves and applied saliva on the wounded site. The amount of salivary protein
(~0.5 g) used in these experiments is a very conservative estimate of how much is secreted
during feeding (Peiffer and Felton 2005). The application of H. zea saliva to wounded leaves
significantly induced the expression of PIN2 after 48 h in both Better Boy and MicroTom
cultivars compared to the wounded control (ANOVA, FBetter boy =8.5, p=0.007; FMicroTom =70.09,
p<0.001 Figure 4a). In contrast, we found that regurgitant did not significantly affect PIN2
expression in micro-tom tomato leaves with 20µl regurgitant (ANOVA, F=2.71 p=0.115)
compared to the wounded control (Figure 4b).
Saliva and GOX affect tomato defense on different tissue
Because GOX was the most abundant salivary protein and earlier reports showed that
infiltration of tomato petioles with a H2O2 generating system consisting of glucose and fungal
glucose oxidase triggered PIN2 expression (Orozco-Cardenas et al. 2001). To test how saliva and
GOX affect tomato defense we tested the effect of GOX and saliva on PIN2 expression in tomato
leaves, green and red fruit, and flower tissues. We applied fungal GOX (0.4µg) at levels
consistent with the amount secreted by caterpillars (0.5µg) (Peiffer and Felton 2005). The fungal
GOX has very similar substrate specificity as the GOX from H. zea salivary glands (Eichenseer
et al. 1999) and thus serves as appropriate model for the insect enzyme.
Relative expression of the late responding gene PIN2 was examined after 24 and 48 hours
wounding and treatment. H. zea saliva or fungal GOX had different effect on the gene
expression on different tissue (Figure 5). Wounding with PBS, saliva or GOX both induce PIN2
induction on the leaf at 24 and 48 hours. However the H. zea saliva and GOX treatment
significantly induced more PIN2 expression than PBS treatment at both time points. At 48 hour,
the PIN2 expression in leaf treatment with saliva and GOX is significantly higher than at
45
24hours time points, while the PBS treatments at the different times were not significantly
different. The effect of induction of PIN2 expression by GOX and saliva was not significantly
different at the two time points (ANOVA, F=20.70, p<0.001, Figure 5a). Treatments of green
fruit with wounding and PBS, saliva or GOX showed PIN2 induction relative to the unwounded
control. Compared to PBS, the saliva and fungal GOX treatments induced PIN2 expression in
green fruit after wounding. At 24 hour, the saliva treatment induced higher PIN2 than the GOX
treatment, while at 48 hour, the two treatments showed no significant differences between saliva
and GOX (ANOVA, F=14.39, p<0.001, Figure 5b). But with red mature fruit, wounding with
PBS, saliva or GOX treatment caused no significant PIN2 induction compared with non-treated
fruits (ANOVA, F=4.43, p=0.058 Figure. 5c) Floral tissues had higher constitutive PIN2
expression level, but again there was no significant response to wounding or saliva in the flower
tissues (Figure. 5d) (ANOVA, F=0.28, p=0.761).
Trichome Induction by H. zea feeding or Saliva treatment
Two weeks after H. zea fed, we counted the glandular trichome number on the newly
growth expanded leaves. The results showed inset fed significantly induce the glandular
trichome number on the newly growth leaves compared to unwounded leaves (425.6/ cm2,
SE=37.3). Compared to mechanical ablated insect fed, the glandular trichome number on the
intact caterpillar fed were significantly induced (ANOVA, F=11.84, p<0.05) (Figure 6a). This
result indicates that insect fed with secretion of saliva induce the glandular trichome number on
the newly growth leaves.
To further examine the effect of caterpillar saliva on trichome induction, plants were
wounded and saliva or GOX (20ng/µl) immediately applied to the wound site. After two weeks
treatment, plants treated with saliva increase77.8% trichomes on the new growth leaf compared
46
to unwounded plants. GOX treatment also significantly induced trichome number on the new
growth leaf (Figure 6b) (ANOVA, F=7.42, p<0.05).
Previous studies have shown glandular trichomes of Lycopersicon spp. is responsible for
resistance to various insects (Gentile& Stoner 1968; Gentile et al. 1968; Dimock & Kennedy
1983; Kennedy & Sorenson 1985). Our Sigma Scan analysis showed after mechanical remove
trichome, the leaf got more damage by H. zea 3rd
larvae in 24 hours feeding compared to the
control leaf (Figure7a). The bioassay showed remove leaf trichome could significantly increase
H. zea growth in 5 days feeding assay (Figure 7b). These results consistent with the previous
study of glandular trichome play important role in tomato defense. The trichome hairs on leaf
surface contain chemical that affect insect growth. It may also physically prohibit insect feeding.
DISCUSSION
Noctuid herbivores produce multiple secretions during feeding that have potential to
mediate the induction of direct and indirect plant defenses (Felton 2008b). The typical mount of
saliva released from a single larva is very tiny (~ 0.5nl) and regurgitant is about 5µl from each
caterpillar. The regurgitant contain high quantity protein around 0.60µg in one caterpillar
collections, there is no GOX activity was detected in the collection. The saliva contains 0.056 µg
total protein in one caterpillar collections, but showed high GOX activity. The immunodetection
confirmed when insect feed on leaf they release saliva which main composition is GOX.
One previous study showed highly polyphagous species possess relative high level of
GOX compared to species with limited host range by examining the labial gland GOX activities
in 23 families of Lepidoptera (85 species) (Eichenseer et al. 2010). Our results from shotgun
proteomic analysis based on protein abundance showed that among total 33 proteins identified
47
(Table S1), glucose oxidase (GOX) was by far the most abundant protein in H. zea saliva, which
accounting for 34% of the identified proteins. Since H. zea has wide host range from vegetable
such as asparagus and watermelon to crops such as cotton and corn. This result confirmed the
GOX is the main protein in H. zea saliva. And also carboxylesterase, ecdysone oxidase, and
fructosidase were the next most abundant proteins in saliva. These proteins also need to be
studied to know more functions in plant defense.
Salivary GOX has been reported in a few insect species which function as an effector in
regulating plant defense in multiple plant species including Nicotiana tabacum (Musser et al.
2002), Nicotiana attenuate(Diezel et al. 2009), Medicago truncatula (Bede et al. 2006), and
Arabidopsis thaliana (Weech et al. 2008). In one example with the tobacco budworm Heliothis
virescens showed that the effect of saliva had an inhibitory effect on volatile induction and that
both saliva and regurgitant were necessary to elicit the “volatile signature” of H. virescens
feeding. Since proteinase inhibitor (PIN2) is the marker gene in JA pathway, in our current
study we quantify relative PIN2 gene expression to compare the different response of insect
feeding or saliva treatment. The results showed that insect fed induce PIN2 gene expression.
The intact H. zea fed significantly induce PIN2 gene expression compared with the spinneret
ablated H. zea fed, which stop saliva secretions on leaf. This is different from the previous report
of caterpillar saliva interferes with induce Arabidopsis defense (Weech et al. 2008). These data
are particularly interesting because in tobacco, glucose oxidase acts an effector by suppressing
the induction of nicotine in tobacco (Musser et al. 2005; Musser et al. 2002). When larvae feed
on tomato they synthesize and secrete less glucose oxidase when feeding on tobacco (Peiffer and
Felton 2005). This suggests that larvae may adjust their saliva or salivation to minimize
induction and/or maximize suppression of induced defenses based on their host plant.
48
Since the main component of H. zea saliva is GOX, the results showed that wounding
treatment with saliva or fungal GOX both induce PIN2 expression compared control treatment.
This is different from one previous study; the salivary gland homogenates had a small inhibitory
effect on the induction of trypsin inhibitor activity in tomato (Musser et al. 2005). There were
two differences in the methods employed in these studies. In the current study we used saliva
directly collected from the spinneret, whereas in the previous paper salivary gland homogenates
were used. The homogenates may contain materials that are not secreted during feeding.
However the amounts of saliva that we can collect from the spinneret are small and less than the
caterpillars normally would secrete during feeding (Peiffer and Felton 2005). Second, in the
current study we tested the effects on induction of PIN2, whereas in the first paper total trypsin
inhibitory activity was measured. While the regurgitant from H. zea, at the amounts tested, did
not affect the expression of the defense gene PIN2 compared to control. This is different from
one previous study that oral secretion from the tobacco hornworm Manduca sexta elicits PIN2
expression in the related species Solanum tuberosum (Korth and Dixon 1997). Although the
exact amount of saliva that are secreted by larvae are not known, we used amounts that are
consistent with what has been published in the literature for many lepidopteran species (Alborn
et al. 1997; Qu et al. 2004; Rose and Tumlinson 2005).
Induced plant defense have mainly been studied in leaves (Karban et al. 2000) and only
very few research have investigated induced plant defense on reproduction tissue. This disparity
may be due to the allocation of resources to defense is determined by the cost of production. In
this study we compared tomato leaves, flower, green fruit and red fruit response to wounding
treatment, the results showed saliva and GOX treatment induce PIN2 expression in leaves and
green fruits. While the red fruits didn’t show any PIN2 induction compared to unwounded fruits.
49
The expression of PIN2 in flowers showed significantly higher than in leaves and green fruits,
but no induction by wounding and saliva or GOX treatment compared to unwounded flowers.
This is consistent with the optimal defense theory (ODT)which explained the patterns of plant
chemical defense and predict that induced defense should be rare in reproductive tissues (McCall
and Karban 2006).
Trichome production is an important component of resistance against herbivorous
insects (Antonious and Synder 1993; Levin 1973). While most plants produce trichomes
constitutively, some plant species respond to damage by producing new leaves with an increased
density of trichomes. Both artificial wounding and damage by herbivores can induce trichome
production. The induction of trichome has been observed in both annual and perennial plants
(Abdala-Roberts and Parra-Tabla 2005; Agrawal 1999). This study found insect feeding or
wounding with saliva/GOX treatment could induce the newly growth leaf trichome density. This
confirmed the saliva plays important role in inducing glandular trichome on the newly growth.
The magnitude of the increase in trichome density is between 37%-139% in this study.
Experimentally remove glandular trichome could increase H. zea consume more leaf foliage and
significantly increase insect growth. This supports that trichome density negatively affects insect
growth (Handley et al. 2005, Gentile et al. 1969, Dimock et al. 1982).
In summary, this study confirmed H. zea release saliva when they are feeding on tomato
plants which play important role in regulating tomato and H. zea interactions. The saliva could
induce tomato defense in leaf and green fruit, while flower and red fruit had no defense in
response to the treatment. PIN2 as JA pathway maker gene was induced by insect feeding and
wounding treatment. Trichomes function as defense insect feeding were highly induced by insect
feeding or saliva and GOX treatment.
50
Table 1 Caterpillar oral secretion collection protein and GOX assay
Table 2 Primers used for real-time PCR assays of relative expression
Regurgitant Saliva
Total Protein/Caterpillar 0.6µg 0.56µg GOX activity 0 1.785714 mol/min/mg
Primer
name
Gene Name/ Accession number Primer sequence (5'-3", forward/reverse)
LOX Lipoxygenase D/u37840 F: GTT CAT GGC CGT GGT TGA CAC ATT /
R : TGG TAA TAC ACC AGC ACC ACA CCT
AOS Allene Oxide Synthase/af230371 F: ACC CGT TTA GCA AAC GAG ATC CGA /
R: CGT TGC AAA TGG TTG GTA CCC GAA
ARG Arginase/ AY656838 F: TGG TGA AGG TGT AAA GGG CGT GTA /
R: TTA CCA GCT TCG CAG CAA CCA TTG
PPO Polyphenol oxidase F/ Z12838 F: ATG TGG ACA GGA TGT GGA ACG AGT R:ACT TTC ACG CGG TAA GGG TTA CGA
PIN2 Wound inducible proteinase
inhibitor 2/ K03291
F: GGA TTT AGC GGA CTT CCT TCT G /
R: ATG CCA AGG CTT GTA CTA GAG AAT G
Ubi Ubiquitin/ X58253 F: GCC AAG ATC CAG GAC AAG GA /
R: GCT GCT TTC CGG CGA AA
51
Table 3. Proteomic Identification of Salivary Proteins in H. zea
Protein identification Organism NCBI Accession # of
Pept
ides
Total
Ion
Score
MW pI
1 glucose oxidase Helicoverpa zea gi|215982092 20 1658 66939.1 5.3
2 glucose oxidase-like enzyme Helicoverpa armigera gi|186909546 17 1373 66858.9 5.0
3 carboxyl/choline esterase CCE016d Helicoverpa armigera gi|294846818 13 1243 61508.4 4.8
4 putative ecdysone oxidase Helicoverpa zea gi|219815604 10 680 63822.7 5.4
5 Fructosidase Helicoverpa armigera gi|156968287 3 316 53971.8 4.9
6 epoxide hydrolase Trichoplusia ni gi|2661096 1 116 52813.6 8.6
7 GF21896 Drosophila ananassae gi|194765569 1 86 65895.2 6.1
8 aryl-alcohol oxidase precursor, putative Ixodes scapularis gi|241592310 1 64 62991.9 6.7
9 GM16912 Drosophila sechellia gi|195356860 1 62 19478.5 10.4
10 AGAP001021-PA Anopheles gambiae str. PEST gi|58376848 1 61 112289.2 6.7
11 GH18582 Drosophila grimshawi gi|195036744 1 58 35803.1 7.2
12 GH18646 Drosophila grimshawi gi|195036490 1 58 205225.0 8.9
13 PREDICTED: similar to alaserpin, partial Acyrthosiphon pisum gi|193629771 1 57 39086.8 5.4
14 wd-repeat protein Aedes aegypti gi|157133770 1 56 54519.2 4.4
15 hypothetical protein TcasGA2_TC013848 Tribolium castaneum gi|270007291 1 56 36914.2 9.7
16 esterase Plutella xylostella gi|22324345 1 56 11776.8 4.7
17 GJ14811 Drosophila virilis gi|195401845 2 55 320874.0 6.5
18 GL10752 Drosophila persimilis gi|195150013 1 53 59935.6 5.4
19 dachshund Culex quinquefasciatus gi|170037058 1 53 67174.6 6.6
20 PREDICTED: similar to nuclear receptor
subfamily 2, group E, member 3
Acyrthosiphon pisum gi|193683726 1 53 54684.5 8.7
21 serine protease Culex quinquefasciatus gi|170036773 1 53 17642.0 9.1
22 Putative aminopeptidase W07G4.4 Camponotus floridanus gi|307185505 1 52 46591.9 6.8
23 CG4593-PA Drosophila ananassae gi|269972528 1 52 24610.3 5.8
24 cytochrome P450 4C1 Culex quinquefasciatus gi|170059524 1 52 29405.6 5.4
52
25 GI18727 Drosophila mojavensis gi|195123267 1 51 6764.8 3.8
26 hypothetical protein AaeL_AAEL009299 Aedes aegypti gi|157121612 1 51 75960.2 9.0
27 hypothetical protein EAG_00548 Camponotus floridanus gi|307166578 1 51 31249.9 9.2
28 protein C9orf39, putative Pediculus humanus corporis gi|242019086 1 50 140011.8 8.9
29 carboxylesterase clade A, member 5 Nasonia vitripennis gi|289177094 1 50 60470.7 5.8
30 GF19006 Drosophila ananassae gi|194770241 1 50 997115.9 5.9
31 CG41265, isoform B Drosophila melanogaster gi|161075927 1 49 95193.6 8.9
32 CG33127 Drosophila melanogaster gi|28573984 1 49 30895.5 5.1
33 GF21209 Drosophila ananassae gi|194763357 1 49 70846.1 7.1
53
FIGURE LEGENDS
Fig. 1. Saliva GOX detection on MicroTom-leaves The Micro-tom tomato leaf were fed by
ablated and intact H. zea overnight, Then after transfer to nitrocellulose and superblock, and
incubated with anti-GOX, detected the GOX spread on leaf with vector ABC Elite and Vector a).
Ablated H. zea fed leaf b). Intact H. zea fed leaf
Fig. 2. Relative peptide abundance of H. zea salivary proteins Shotgun proteomic analysis
of secreted salivary proteins showed most abundant protein accounting for the total identified
proteins. Glucose oxidase (GOX) was by far the most abundant protein accounting for 34% of
the identified proteins
Fig. 3. PIN2 relative expression of PIN2 in tomato leaves 24 and 48 hours after feeding, real-
time PCR compare PIN2 gene expression. Data shows mean relative expression ±SE. Letters
represent significant differences between PBS and saliva treated samples (P<0.05) by Fisher’s
comparison. (ANOVA, F(24hour)=17.46, P=0.03; F(48hour)=7.51, P=0.023).
Fig. 4. Compare relative expression of defense genes 24 hours after wounding and application of
H. zea saliva from 10 larvae on tomato leaf. a) Treatment on different varieties Better boy and
Micro-tom tomato leaf both induce PIN2 induction compared to PBS treatment (ANOVA, FBetter
boy =8.5, p=0.007; FMicroTom =70.09, p<0.001). b) Regurgitant treatment on the Micro-Tom leaf
didn’t significantly induce PIN2 relative expression compared to PBS treatment (ANOVA,
F=2.71, p=0.115). Data shows mean relative expression ±SE. Asterisk represent significant
differences between PBS and saliva treated samples (P<0.05) by Fisher’s –LSD comparison
54
Fig. 5. Relative expression of PIN2 on different MicroTom tissues 24 and 48 hrs after
wounding and treatment with PBS buffer, saliva or fungal GOX a) PIN2 significantly induced by
saliva and GOX treatment compared to PBS buffer on leaf; b): PIN2 significantly induced by
saliva and GOX treatment compared to PBS buffer on Green fruit; c) No PIN2 induction on red
fruit, d) Flower Receptacle wounding with treatment didn’t show PIN2 induction. Error bars
represent mean + SE.
Fig. 6. Trichome induction by wounding treatment or insect feeding Average number of
trichomes on new growth leaf after wounding or insect feeding a) Ablated and Non-ablated
insect feeding increase the new growth leaf trichome number b) Wounding and treatment with H.
zea saliva or fungal glucose oxidase (20ng/µl), non-wounding and wounding with PBS buffer
treatment as control. Data shown are error bars represent mean + SE.
Fig. 7. Trichome significantly affect H. zea feeding and growth a) After removing the leaf
surface trichomes, the leaf damage significantly increased. b) The leaf with trichome removed
significantly increased H. zea growth.
55
Fig. 1. Saliva GOX detection on MicroTom-leaves The Micro-tom tomato leaf were fed by
ablated and intact H. zea overnight, Then after transfer to nitrocellulose and superblock, and
incubated with anti-GOX, detected the GOX spread on leaf with vector ABC Elite and Vector a).
Ablated H. zea fed leaf b). Intact H. zea fed leaf
a) Ablated fed b) Intact fed
56
Fig. 2. Relative peptide abundance of H. zea salivary proteins Shotgun proteomic analysis
of secreted salivary proteins showed most abundant protein accounting for the total identified
proteins. Glucose oxidase (GOX) was by far the most abundant protein accounting for 34% of
the identified proteins
Relative Peptide Abundance
glucose oxidase
carboxylesterase
ecdysone oxidase
fructosidase
all others
57
Fig. 3. Relative gene expression in tomato leaves after H. zea feeding. Cage H. zea on the 4th
leaf for 6 hours feeding, after 24 and 48 hours, real-time PCR compare the gene expression.
Ablated fed means the 5th
instar larvae spinneret was ablated, intact fed means regular insect
feeding, control means empty cage on the leaf. a) PIN2 relative expression by ablated and intact
fed with 24h and 48h. b) LOX, AOS, ARG and PPOF relative expression after 24 hour H. zea
fed. Data shows mean relative expression ±SE.
58
Fig. 4. Compare relative expression of defense genes 24 hours after wounding and application
of H. zea saliva from 10 larvae on tomato leaf. a) Treatment on different varieties Better boy and
Micro-tom tomato leaf both induce PIN2 induction compared to PBS treatment (ANOVA, FBetter
boy =8.5, p=0.007; FMicroTom =70.09, p<0.001). b) Regurgitant treatment on Micro-Tom leaf didn’t
significantly induce PIN2 relative expression compared to PBS treatment (ANOVA, F=2.71,
p=0.115). Data shows mean relative expression ±SE. Asterisk represent significant differences
between PBS and saliva treated samples (P<0.05) by Fisher’s –LSD comparison
59
Fig. 5. Relative expression of PIN2 on different MicroTom tissues 24 and 48 hrs after
wounding and treatment with PBS buffer, saliva or fungal GOX a) PIN2 significantly induced by
saliva and GOX treatment compared to PBS buffer on leaf; b): PIN2 significantly induced by
saliva and GOX treatment compared to PBS buffer on Green fruit; c) No PIN2 induction on red
fruit, d) Flower Receptacle wounding with treatment didn’t show PIN2 induction. Error bars
represent mean + SE.
60
61
Fig. 6. Trichome induction by wounding treatment or insect feeding Average number of
trichomes on new growth leaf after wounding or insect feeding a) Ablated and Non-ablated
insect feeding increase the new growth leaf trichome number b) Wounding and treatment with H.
zea saliva or fungal glucose oxidase (20ng/µl), non-wounding and wounding with PBS buffer
treatment as control. Data shown are error bars represent mean + SE.
62
Fig. 7. Trichome significantly affects H. zea feeding and growth a) After removing
trichomes, the leaf damage significantly increased. b) The leaf with trichome removes
significantly increased H. zea growth.
63
Reference
Abdala-Roberts L, Parra-Tabla V (2005) Artificial defoliation induces trichome production in the
tropical shrub Cnidoscolus aconitifolius (Euphorbiaceae). Biotropica 37: 251-257
Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores
and plant fitness. Ecology 80: 1713-1723
Alborn H, Turlings T, Jones T, Stenhagen G, Loughrin J, Tumlinson J (1997) An elicitor of
plant volatiles from beet armyworm oral secretion. Science 276: 945-949
Alborn HT, Hansen TV, Jones TH, Bennett DC, Tumlinson JH, Schmelz EA, Teal PEA (2007)
Disulfooxy fatty acids from the American bird grasshopper Schistocerca americana,
elicitors of plant volatiles. Proceedings of the National Academy of Sciences of the
United States of America 104: 12976-12981
Antonious GF, Synder JC (1993) Trichome density and pesticide retention and half-Life.
Journal of Environmental Science and Health Part B-Pesticides Food Contaminants and
Agricultural Wastes 28: 205-219
Arimura GI, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.
Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111
Bansal R, Hulbert S, Schemerhorn B, Reese JC, Whitworth RJ, Stuart JJ, Chen MS (2011)
Hessian fly-associated bacteria: transmission, essentiality, and composition. Plos One 6
Bede J, Musser R, Felton G, Korth K (2006) Caterpillar herbivory and salivary enzymes
decrease transcript levels of Medicago truncatula genes encoding enzymes in terpeniod
biosynthesis. Plant Mol Biol 60: 519 - 531
Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of
stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119
Bergey DR, Orozco-Cardenas M, de Moura DS, Ryan CA (1999) A wound- and systemin-
inducible polygalacturonase in tomato leaves. Proc Natl Acad Sci U S A 96: 1756-1760
Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased
densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 31:
2211-2216
Chao WS, Gu YQ, Pautot VV, Bray EA, Walling LL (1999) Leucine aminopeptidase RNAs,
proteins, and activities increase in response to water deficit, salinity, and the wound
signals systemin, methyl jasmonate, and abscisic acid. Plant Physiol 120: 979-992
Chippendale G (1970) Development of artificial diets for rearing the Angoumois grain moth.
J.Economic Entomology 63: 844-848
Consales F, Schweizer F, Erb M, Gouhier-Darimont C, Bodenhausen N, Bruessow F, Sobhy I,
Reymond P (2011) Insect oral secretions suppress wound-induced responses in
Arabidopsis. Journal of Experimental Botany
Constabel CP, Bergey DR, Ryan CA (1995) Systemin activates synthesis of wound-inducible
tomato leaf polyphenol oxidase via the octadecanoid defense signaling pathway. Proc
Natl Acad Sci U S A 92: 407-411
Delphia CM, Mescher MC, Felton G, De Moraes CM (2006) The role of insect-derived cues in
eliciting indirect plant defenses in tobacco, Nicotiana tabacum. Plant Signaling and
Behavior 1: 243-250
Diez-Diaz M, Conejero V, Rodrigo I, Pearce G, Ryan CA (2004) Isolation and characterization
of wound-inducible carboxypeptidase inhibitor from tomato leaves. Phytochemistry 65:
1919-1924
64
Diezel C, von Dahl C, Gaquerel E, Baldwin IT (2009) Different lepidopteran elicitors account
for crosstalk in herbivory-induced phytohormone signaling. Plant Physiol 150: 1576-
1586
Dimock MB, Kennedy GG, Williams WG (1982) Toxicity studies of analogs of 2-tridecanone, a
naturally-occurring toxicant from a wild tomato. J. Chem. Ecol. 8: 837-842
Eichenseer H, Mathews MC, Bi JL, Murphy JB, Felton GW (1999) Salivary glucose oxidase:
multifunctional roles for Helicoverpa zea? Arch. Insect Biochem. Physiol. 42: 99-109
Eichenseer H, Mathews MC, Powell JS, Felton GW (2010) Survey of a salivary effector in
caterpillars: glucose oxidase variation and correlation with host range. J Chem Ecol 36:
885-897
Engelberth J, Alborn HT, Schmelz EA, Tumlinson JH (2004) Airborne signals prime plants
against insect herbivore attack. Proceedings of the National Academy of Sciences 101:
1781-1785
Farmer EE (2007) Plant biology: Jasmonate perception machines. Nature 448: 659-660
Fatouros NE, Broekgaarden C, Bukovinszkine'Kiss G, van Loon JJA, Mumm R, Huigens ME,
Dicke M, Hilker M (2008) Male-derived butterfly anti-aphrodisiac mediates induced
indirect plant defense. Proceedings of the National Academy of Sciences 105: 10033-
10038
Felton G-W, Summers CB (1993) Potential role of ascorbate oxidase as a plant defense protein
against insect herbivory. J. Chem. Ecol.
Felton G (2008) Caterpillar secretions and induced plant responses. In: Schaller A (ed) Induced
Plant Resistance to Herbivory. Springer, Hohenheim, Germany, pp 369-387
Felton GW, Donato K, Delvecchio RJ, Duffey SS (1989) Activation of plant foliar oxidases by
insect feeding reduces nutritive quality of foliage for noctuid herbivores. Journal of
Chemical Ecology 15: 2667-2694
Felton GW, Donato KK, Broadway RM, Duffey SS (1992) Impact of oxidized plant phenolics
on the nutritional quality of dietary protein to a noctuid herbivore, Spodoptera exigua.
Journal of Insect Physiology 38: 277-285
Felton GW, Eichenseer H (1999) Herbivore saliva and its effects on plant defense against
herbivores and pathogens. In: Agrawal AA, Tuzun S, Bent E (eds) Induced Plant
Defenses Against Pathogens and Herbivores. APS Press, St. Paul, MN, pp 19-36
Gentile A, wEBB R, Stoner A (1969) Lycopersicon and solanum spp. resistant to the carmine
and the two-spotted spider mite. Journal of Economic Entomology 62: 834-836
Handley R, Ekbom B, Agren J (2005) Variation in trichome density and resistance against a
specialist insect herbivore in natural populations of Arabidopsis thaliana. Ecological
Entomology 30: 284-292
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant
Biology 59: 41-66
Howe GA, Lightner J, Browse J, Ryan CA (1996) An octadecanoid pathway mutant (JL5) of
tomato is compromised in signaling for defense against insect attack. Plant Cell 8: 2067-
2077
Hui D, Iqbal J, Lehmann K, Gase K, Saluz HP, Baldwin IT (2003) Molecular interactions
between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural
host Nicotiana attenuata: V. microarray analysis and further characterization of large-
scale changes in herbivore-induced mRNAs. Plant Physiol 131: 1877-1893
Kaloshian I, Walling LL (2005) Hempiterans as plant pathogens. Annual Review of
65
Phytopathology 43: 491-521
Kang JH, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The tomato odorless-2
mutant is defective in trichome-based production of diverse specialized metabolites and
broad-spectrum resistance to insect herbivores. Plant Physiol.: pp.110.160192
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology
by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental
Botany 61: 1053-1064
Karban R, Baldwin IT, Baxter KJ, Laue G, Felton GW (2000) Communication between plants:
induced resistance in wild tobacco plants following clipping of neighboring sagebrush.
Oecologia 125: 66-71
Kennedy GG, Farrar RR, Kashyap RK (1991) 2-Tridecanone glandular trichome-mediated
insect resistance in tomato - effect on parasitoids and predators of Heliothis Zea. Acs
Symposium Series 449: 150-165
Korth KL, Dixon RA (1997) Evidence for chewing insect-specific molecular events distinct from
a general wound response in leaves. Plant Physiol. 115: 1299-1305
Levin D (1973) The role of trichomes in plant defense. Q. Rev. Biol 48: 3-15
Lin L, Shen TC, Chen YH, Hwang SY (2008) Responses of Helicoverpa armigera to tomato
plants previously infected by ToMV or damaged by H-Armigera. J. Chem. Ecol. 34: 353-
361
Liu F, Cui LW, Cox-Foster D, Felton GW (2004) Characterization of a salivary lysozyme in
larval Helicoverpa zea. Journal of Chemical Ecology 30: 2439-2457
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2-C(T) method. Methods 25: 402-408
Maffei M, Bossi S, Spiteller D, Mithofer A, Boland W (2004) Effects of feeding Spodoptera
littoralis on lima bean leaves. I. Membrane potentials, intracellular calcium variations,
oral secretions, and regurgitate components. Plant Physiol. 134: 1752-1762
Maffei ME, Mithofer A, Arimura G-I, Uchtenhagen H, Bossi S, Bertea CM, Cucuzza LS,
Novero M, Volpe V, Quadro S, Boland W (2006) Effects of Feeding Spodoptera littoralis
on Lima Bean Leaves. III. Membrane Depolarization and Involvement of Hydrogen
Peroxide. Plant Physiol. 140: 1022-1035
Mattiacci L, Dicke M, Posthumus MA (1995) β-Glucosidase: an elicitor of herbivore-induced
plant odor that attracts host-searching parasitic wasps. Proc. Nat. Acad. Sci. USA 92:
2036-2040
McCall AC, Karban R (2006) Induced defense in Nicotiana attenuata (Solanaceae) fruit and
flowers. Oecologia 146: 566-571
Mithofer A, Wanner G, Boland W (2005) Effects of feeding Spodoptera littoralis on lima bean
leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to
elicit herbivory-related volatile emission. Plant Physiol. 137: 1160-1168
Mori N, Alborn HT, Teal PE, Tumlinson JH (2001) Enzymatic decomposition of elicitors of
plant volatiles in Heliothis virescens and Helicoverpa zea. J Insect Physiol 47: 749-757
Musser R, Hum-Musser S, Eichenseer H, Peiffer M, Ervin G, Murphy J, Felton G (2002)
Herbivory: Caterpillar saliva beats plant defences. Nature 416: 599 - 600
Musser RO, Cipollini DF, Hum-Musser SM, Williams SA, Brown JK, Felton GW (2005)
Evidence that the caterpillar salivary enzyme glucose oxidase provides herbivore offense
in solanaceous plants. Arch. Insect Biochem. Physiol. 58: 128-137
Musser RO, Farmer E, Peiffer M, Williams SA, Felton GW (2006) Ablation of caterpillar labial
66
salivary glands: Technique for determining the role of saliva in insect-plant interactions.
J. Chem. Ecol. 32: 981-992
Old WM, Meyer-Arendt K, Aveline-Wolf L, Pierce KG, Mendoza A, Sevinsky JR, Resing KA,
Ahn NG (2005) Comparison of label-free methods for quantifying human proteins by
shotgun proteomics. Molecular & Cellular Proteomics 4: 1487
Orozco-Cardenas ML, Narvaez-Vasquez J, Ryan CA (2001) Hydrogen peroxide acts as a second
messenger for the induction of defense genes in tomato plants in response to wounding,
systemin, and methyl jasmonate. Plant Cell 13: 179-191
Pautot V, Holzer FM, Reisch B, Walling LL (1993) Leucine aminopeptidase: an inducible
component of the defense response in Lycopersicon esculentum (tomato). Proc Natl Acad
Sci U S A 90: 9906-9910
Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary
glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113
Peiffer M, Felton GW (2009) Do caterpillars secrete "oral secretions"? J Chem Ecol 35: 326-335
Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as
sensors for insect herbivores. New Phytologist 184: 644-656
Qu N, Schittko U, Baldwin IT (2004) Consistency of Nicotiana attenuata's Herbivore- and
Jasmonate-Induced Transcriptional Responses in the Allotetraploid Species Nicotiana
quadrivalvis and Nicotiana clevelandii. Plant Physiol. 135: 539-548
Roda A, Halitschke R, Steppuhn A, Baldwin IT (2004) Individual variability in herbivore-
specific elicitors from the plant's perspective. Mol Ecol 13: 2421-2433
Rose USR, Tumlinson JH (2005) Systemic induction of volatile release in cotton: How specific
is the signal to herbivory? Planta 222: 327-335
Ryan CA (1990) Proteinase inhibitors in plants: genes for improving defenses against insects and
pathogens. Ann Rev Phytopathol 28: 425
Spiteller D, Dettner K, Boland W (2000) Gut bacteria may be involved in interactions between
plants, herbivores and their predators: Microbial biosynthesis of N-acylglutamine
surfactants as elicitors of plant volatiles. Biological Chemistry 381: 755-762
Steppuhn A, Baldwin IT (2008) Induced defenses and the cost-benefit paradigm. In: Schaller A
(ed) Induced Plant Resistance to Herbivory, pp 61-83
Thipyapong P, Stout MJ, Attajarusit J (2007) Functional analysis of Polyphenol Oxidases by
Antisense/Sense technology. Molecules 12: 1569-1595
Tooker JF, Peiffer M, Luthe DS, Felton GW (2010) Trichomes as sensors: Detecting activity on
the leaf surface. Plant Signal Behav 5: 73-75
Vandenabeele S, Van Der Kelen K, Dat J, Gadjev I, Boonefaes T, Morsa S, Rottiers P, Slooten
L, Van Montagu M, Zabeau M, Inze D, Van Breusegem F (2003) A comprehensive
analysis of hydrogen peroxide-induced gene expression in tobacco. Proc Natl Acad Sci U
S A 100: 16113-16118
Victoriano E, Gregório EA (2002) Ultrastructure of the excretory duct in the silk gland of the
sugarcane borer Diatraea saccharalis (Lepidoptera: Pyralidae). Arthropod Structure &
Development 31: 15-21
Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth
Regulation 19: 195-216.
Wang FD, Feng GH, Chen KS (2009) Defense responses of harvested tomato fruit to burdock
fructooligosaccharide, a novel potential elicitor. Postharvest Biology and Technology 52:
110-116
67
Weech M-H, Chapleau M, Pan L, Ide C, Bede J (2008) Caterpillar saliva interferes with
induced Arabidopsis thaliana defence responses via the systemic acquired resistance
pathway. J Exp Bot 59: 2437 - 2448
Will T, Tjallingii WF, Thönnessen A, van Bel AJE (2007) Molecular sabotage of plant defense
by aphid saliva. Proceedings of the National Academy of Sciences 104: 10536-10541
68
Chapter III
Role of Trichomes in Defense against Herbivores:
Comparison of Herbivore Response to Woolly and Hairless Trichome Mutants in Tomato
(Solanum lycopersicum)
Donglan Tian, J. Tooker, M. Peiffer, S. Chung, and G. W. Felton1
Department of Entomology
Center for Chemical Ecology
Penn State University
University Park, PA16802
1Corresponding author: [email protected]; 814-863-7789; 814-865-3048 (FAX)
Tian D, Tooker J, Peiffer M and Felton GW (2012) Role of Trichomes in Defense against
Herbivores: Comparison of Herbivore Response to hl and woolly Mutants in Tomato (Solanum
lycopersicum) Planta DOI 10.1007/s00425-012-1651-9
69
Abstract
Trichomes contribute to plant resistance against herbivory by physical and chemical
deterrents. To better understand their role in plant defense, we systemically studied trichome
morphology, chemical composition and the response of insect herbivores Helicoverpa zea and
Leptinotarsa decemlineata (Colorado potato beetle) on the tomato hairless (hl) and hairy (woolly)
mutants. Hairless mutants showed reduced number of twisted glandular trichomes (type I, IV, VI
and VII) on leaf and stem, while woolly mutants showed high density of non-glandular trichomes
(type II, III and V) but only on the leaf. In both mutants, trichome densities were induced by
methyl jasmonate (MeJA), but the types of trichomes present were not affected by MeJA
treatment. Glandular trichomes contained high levels of monoterpenes and sesquiterpenes. A
similar pattern of transcript accumulation was observed for monoterpene MTS1 (=TPS5) and
sesquiterpene synthase SST1 (=TPS9) genes in trichomes. While high density of non-glandular
trichome on leaves negatively influenced CPB feeding behavior and growth, it stimulated H. zea
growth. High glandular trichome density impaired H. zea growth, but had no effect on CPB.
Quantitative real-time polymerase chain reaction (qRT-PCR) showed that glandular trichomes
highly express protein inhibitors (PIN2), polyphenol oxidase (PPOF) and hydroperoxide lyase
(HPL) when compared to non-glandular trichomes. The SlCycB2 gene, which participates in
woolly trichome formation, was highly expressed in the woolly mutant trichomes. PIN2 in
trichomes was highly induced by insect feeding in both mutant and wild type plants. Thus both
the densities of trichomes and the chemical defenses residing in the trichomes are inducible.
Key words: jasmonate, plant defenses, induced defenses, herbivores, Leptinotarsa
decemlineata, Helicoverpa zea
70
Abbreviations:
woolly hairy mutant
hl hairless mutant
RU Rutgers wild type plants of woolly mutant
AC Alisa Craig, wild type plants of hairless mutant
MeJA methyl jasmonate
PIN2 protease inhibitor 2
HPL hydroperoxide lyase
SlCycB2 B-Type cyclin
PPOF polyphenol oxidase
CPB Colorado potato beetle
71
Introduction
Trichomes are hair-like protuberances that develop from the aerial epidermis on leaves,
stems and other organs on many plant species (Creelman and Mullet 1995; Duffey 1986; Kang et
al. 2010a; Kang et al. 2010b; Reeves 1977; Steffens and Walters 1991; Wagner 1991).
Trichomes are normally classified as either glandular or non-glandular and may vary in size,
shape, number of cells, morphology, and chemical composition(Goffreda et al. 1989; Kang et al.
2010a; Kang et al. 2010b; Schilmiller et al. 2010; Stout et al. 2002). Numerous studies have
shown that trichomes serve multiple functions including defense against herbivores by
interfering with their movement and/or by direct toxicity through chemicals they produce and/or
release (Arimura et al. 2005; Dimock et al. 1982; Kang et al. 2010a; Kang et al. 2010b; Kennedy
2003; Peiffer et al. 2009; Wagner 1991). Trichome-based plant resistance holds potential to
improve sustainability of insect pest management by reducing pesticide use and decreasing the
likelihood that pesticide resistance will develop (Dalin and Björkman 2003; Radhika et al. 2010;
Simmons and Gurr 2004).
High densities of foliar trichomes may prevent feeding damage by herbivores (Handley et
al. 2005; Horgan et al. 2009; Kessler et al. 2011). Several studies have shown that herbivore
feeding or mechanical damage to leaves leads to newly formed leaves with higher densities of
trichomes (Agrawal et al. 2002; Agren and Schemske 1994; Andrade et al. 2005; Stratmann and
Ryan 1997; Traw and Dawson 2002a). In some instances, jasmonic acid regulates trichome
production and plant defense (Halitschke et al. 2008; Li et al. 2004; Traw and Bergelson 2003).
In tomato, application of methyl jasmonate (MeJA) increases densities of glandular trichomes on
new leaves (Boughton et al. 2005). The inducibility of trichome density is ecologically
significant because trichome density can negatively influence herbivore populations (Agrawal
72
1999; Horgan et al. 2009; Kessler et al. 2011). While herbivory or wounding is known to affect
the quantitative variation in trichome density, is unknown if herbivory may also influence
qualitative variation by altering the expression of defensive chemistry within glandular trichomes.
Because tomato (Solanum lycopersicum) is an economically important crop, it serves as a
model for studying plant defenses against herbivores and diseases (Green and Ryan 1972; Howe
and Jander 2008; Li et al. 1999; Mirnezhad et al. 2010; O'Donnell et al. 1996). Decades of
research on tomato has shown that jasmonate signaling (JA) plays an important role in plant
defense signaling against insect herbivory (Bostock 2005; Felton et al. 1994; Howe and Jander
2008; Thaler et al. 2001). Trichomes in cultivated tomato and related wild species have been
subjects of intense study for many decades (Kennedy 2003; Peiffer et al. 2009; Steffens and
Walters 1991). Unlike Arabidopsis, which only has non-glandular trichomes (Seo et al. 1999),
trichomes in Solanum are highly diverse in morphology and chemistry. Tomato foliar trichomes
are categorized as types I-VII, with types I, IV, VI and VII being glandular and types II, III and
V being non-glandular (Kang et al. 2010b; Luckwill 1943). The major distinction between non-
glandular and glandular is that glandular trichomes have heads containing various sticky and/or
toxic chemicals that may poison or repel herbivores (Schilmiller et al. 2010). Non-glandular
trichomes do not have heads and are thought to mainly function in defense by physically
hindering insect feeding behavior and movements (Higgins et al. 2007).
Insect behavior can be dramatically influenced when trichomes obstructs movement
across the plant surface (Radhika et al. 2010; Simmons and Gurr 2005). Moreover, glandular
trichomes may have profound effects on herbivore performance (i.e., growth, survival and
fecundity) and host-plant-selection behavior (Duffey 1986; Higgins et al. 2007; Kennedy 2003;
Neill et al. 2002; Pelletier and Dutheil 2006). The most remarkable feature of tomato glandular
73
trichomes is their capacity to produce and secrete a wide variety of plant secondary compounds
including terpenoids (Hogenhout and Bos 2011; Kang et al. 2010b; Karban and Baldwin 1997;
Ma et al. 2011; Panizzi 1997; Schilmiller et al. 2010), phenolics (Gang et al. 2001), sucrose
esters, methyl ketones (Fridman et al. 2005) and organic acids (Toth et al. 2005). By studying
isolated glands, many of genes involved in the biosynthesis of the chemicals have been
characterized, including the roles of monoterpene MTS1(=TPS5) and sesquiterpene SST1(=TPS9)
synthesis genes in regulating terpene biosynthesis (Besser et al. 2009).
Several methods have been used to study trichome functions in defense including
manipulative and genetic methods. For instance, the experimental removal of tomato glandular
trichome heads and exudates significantly decreased the mortality of aphids, the tomato
fruitworm Helicoverpa zea, and the Colorado potato beetle Leptinotarsa decemlineata (Dimock
et al. 1982; Kennedy 2003; Simmons and Gurr 2004). However, such mechanical treatments of
the leaf are likely to induce JA-regulated defenses (Peiffer et al. 2009) and can confound
interpretation of results by altering the leaf surface and chemistry in ways unrelated to natural
variation in trichome density. The use of mutants is a more rigorous and less ambiguous
experimental approach for deciphering the roles of different trichome types in resistance against
herbivores (Kang et al. 2010a; Kang et al. 2010b).
In tomato, the effect of trichome-based resistance on insect herbivores has mostly
focused on glandular trichomes and there has been considerably less study on the role of non-
glandular trichomes against herbivores (Kang et al. 2010a; Kang et al. 2010b). Because most
cultivars possess both glandular and non-glandular trichome, it is difficult to separate trichome
function(s) in these commercial varieties. In this current study, we use two mutants with
differing trichome types to examine the role of glandular and non-glandular trichomes in
74
resistance to the solanaceous specialist L. decemlineata and the generalist H. zea. In addition to
characterizing the morphologies and densities of the trichomes in these mutants, we also report
their terpene composition. We hypothesize that both glandular and non-glandular trichome
phenotypes will provide different contributions to defense against the herbivorous insect species.
Materials and Methods
Plants and Insects
Tomato (S. lycopersicum) hairless mutant (hl, LA3556) and wild type Alisa Craig (AC,
accession number LA2838), hairy mutant (woolly, LA0258) and wild type Rutgers (RU,
accession number LA1090) were used in all experiments. Seeds were originally obtained from
Tomato Genetics Resource Center (University of California, Davis, CA, USA). Seedlings were
grown as described previously (Peiffer and Felton 2005) in Metromix 400 potting mix (Griffin
Greenhouse & Nursery Supplies Tewksbury, MA) in greenhouse at Penn State University,
University Park, PA, USA). The greenhouse was maintained on a 16-h photoperiod.
Tomato fruitworm (Helicoverpa zea) and Colorado potato beetle (=CPB) (Leptinotarsa
decemlineata) were reared in the Entomology Department, Penn State University (University
Park PA, USA). Helicoverpa zea eggs were purchased from BioServ (Frenchtown, NJ) and
reared on a wheat germ and casein-based artificial diet (Bansal et al. 2011) with ingredients from
Bioserv. Colorado potato beetle was collected from tomato plants in Centre County PA and
reared on tomato plants as described previously (Chung and Felton 2011).
Morphology and density of different type trichome on mutant
At four-leaf stage, ten plants of each cultivar were sampled to compare trichome
morphology and density of the trichome on leaf. Two leaf discs from the youngest fully
75
expanded leaf were cut from each side of the mid-vein. Trichome numbers were counted under a
light microscope on each leaf disc. The density of trichomes was calculated as the number per
disc/cm2.
Scanning electron microscopy (SEM) was performed to compare the morphology of
trichomes on different mutants and followed the protocol described in Kang et al (Kang et al.
2010b). Briefly, tissues were fixed overnight in a solution of 2.5% paraformaldehyde, 2.5%
glutaraldehyde buffered with 0.1M sodium cacodylate, pH 7.0. Samples were dehydrated in a
graduated ethanol series, critical point dried, then mounted, and sputter coated. Samples were
then examined with a 20 kV accelerating voltage with a JEOL JSM5400 microscope (Tokyo,
Japan).
Trichome purification and Real-time PCR
Trichomes were purified following well-established methods with slight modifications
(Peiffer et al. 2009). To isolate trichomes, leaflets/stems were removed, placed in a 50ml conical
tube containing 1g glass beads (diameter, 4mm) (Kimble chase, Vineland, NJ, USA) and liquid
N2, and the tube was shaken vigorously to shear trichomes off the leaf/stem. We then poured the
slurry through a 1mm strainer for non-glandular trichomes and rinsed with liquid N2 while
glandular trichomes need go through100µm strainer again and rinsed with liquid N2. The
purified trichome preparation was used for chemical analyses and quantification of trichome
specific gene expression.
Quantitative real-time polymerase chain reaction (qRT-PCR) was used to compare gene
expression. One hundred mg of purified trichomes were homogenized in liquid nitrogen and total
RNA was purified with an RNeasy Plus Mini-kit which can remove genomic DNA (Qiagen,
Valencia, CA, USA). A High Capacity cDNA Reverse Transcription kit (Applied Biosystems,
76
Foster City, CA,) was used for cDNA synthesis. All qRT-PCR reactions used Power SYBR
Green PCR Master Mix and ran on 7500 Fast Real-Time PCR system (Applied Biosystems)
following standard protocols (10min at 95ºC, with 40 cycles of 15s at 95ºC and 60s at 60ºC).
Relative quantifications were calculated with wild type RU leaf RNA as the reference group. The
ubiquitin gene was used as the housekeeping gene to normalize 2−ΔΔC(T)
(Rotenberg et al. 2006).
To validate this analysis method, primer efficiency was analyzed by comparing the normalized
C(T) values of five serial dilutions of cDNA. Melting curve analysis was conducted to confirm
the specificity of the primers. Three replicates for each varieties. The relative gene expression
value was analyzed by one way ANOVA followed by Fisher-LSD to do the multi-comparisons.
The primers used are shown in Table 1.
Terpene Analyses
Because terpenes have been reported to be important phytochemical components of
tomato trichome-based resistance (Kang et al. 2010a; Kang et al. 2010b; Wagner 1991), we
explored terpene content using two methods. In the first method, we dissolved 100 mg of
purified leaf or stem trichomes directly in 1ml methyl tertiary-butyl ether (MTBE) buffer. For
the second method, we dipped leaves into MTBE to remove surface terpenes. After weighing
two leaves sampled from youngest fully expanded, the leaves were incubated at room
temperature in 1.0 ml of (MTBE) for three minutes with gentle shaking. For both assays, we
collected three replicate samples per treatment.
For all trichome extractions, we added to each sample 200 ng n-octane and 400 ng nonyl
acetate as external standards. Trichome extracts were injected in 1 µl aliquots into an Agilent
model 7890 gas chromatograph (GC) fitted with a flame ionization detector, using a splitless
77
injector held at 250ºC. The column (HP-5; 30 m long × 320 µm interior diameter × 0.25 µm
film thickness; J&W Scientific, Folsom, CA) was maintained at 35º C for 1 min sec, then ramped
at º C per min to 250º C. Quantifications of compounds were made relative to the nonyl acetate
standard using Chem Station software (Agilent Technologies, Wilmington, DE). Identifications
of trichome components were made with GC-MS in electron ionization mode comparing
retention times and spectra with that of commercial standards.
Trichome induction by MeJA and Bioassay
To compare different trichome responses to MeJA treatment, we treated plants with 3.3
mM MeJA (Sigma, St. Louis, MO, USA) in 0.8% ethanol at 4th
leaf stage. Two weeks after the
spray treatment, we counted trichomes on the youngest fully expanded leaf as previously
described. From the same cohort of plants, the two youngest leaves were collected for bioassays
with H .zea and CPB. Thirty insects per treatment were used for the bioassay.
Bioassays using the mutants were conducted to compare how different types of trichomes
affect insect growth. Detached leaves were used for the bioassay. Newly hatched H. zea larvae
were reared on artificial diet for two days before transfer to tomato leaf for bioassay. Newly
hatched CPB larvae were put on tomato leaf directly in a standard 1 oz. cup (BioServ,
Frenchtown, NJ) with 2% agar on the bottom to maintain leaf moisture. Insects were kept at 27º
C, with a 16:8 L:D photoperiod in an incubator. Thirty insects were used for each bioassay. After
5 days, larval weights were recorded using a precision balance and were statistically analyzed by
one-way ANOVA followed by Fisher-LSD for multiple comparisons.
To compare how different trichome type affects insect feeding behavior, we used 3rd
instar H .zea or 2nd
instar CPB larvae on a detached tomato leaf. We recorded in a ten minute
78
interval the time spent feeding during our observation under microscope. Fifteen larvae were
observed for each species and genotype.
We also tested whether the mutants would impact the oviposition of CPB or H. zea moths.
Ten mated female H. zea moths or ten randomly selected CPB adults were released in cages
containing one plant from each of the four genotypes. After 24 h, we examined the plants
thoroughly and counted the number of eggs on each plant. The experiment was replicated in
eight cages. The average number of eggs on plants was compared on different mutant and wild
type plants through one way ANOVA.
Plant response to insect feeding
At the four- leaf stage, 5th
instar H. zea were individually caged on the fourth leaf for 6 h,
control plants had empty cages. Experiment was replicated nine times. Larvae were removed
and after 24 h, the caged leaf was sampled for RNA extraction and qRT-PCR as previous
described to compare PIN2 relative expression with control leaf. Ubiquitin gene was used as
internal control to normalize data.
Statistical analyses
Data was analyzed using general linear models for analysis of variance (ANOVA) and
where appropriate with post-hoc comparison of means using the Fisher-LSD means separation
test using Minitab (University Park, PA).
Results
Morphology and density of trichome on mutants and induction by MeJA
As observed with light microscopy and SEM, the morphology and trichome densities of
the mutants and their respective wild types were highly variable (Fig. 1, 2). The woolly mutant
79
had abundant trichomes on leaves (Fig. 1 a), but primarily non-glandular types II, III and V.
Trichome types II and III were similar in length, but differed in their base, which was multi-
cellular under type II trichomes, but unicellular base under type III (Fig. 2 a). Type V trichomes
were shorter and had unicellular bases (Fig. 2 a). While trichomes on the woolly mutant stem
possessed both glandular and non-glandular trichomes, but were dominated by non-glandular
trichomes on leaf (Fig. 1 a, c)
The hl mutant, which has been described in Kang et al (2010a), had fewer foliar
trichomes than wild-type leaves. These mutant leaves had normal type I trichomes but most
others were highly twisted and swollen (Fig. 1 g). Type VI glandular trichomes have short neck
cells that connect to the four-celled gland, and they showed irregular patterns and low density on
the leaf surface (Fig.1 g and Fig. 2 b). The trichomes on stems of the hl mutant showed similar
twisted, swollen morphology and lower density (Fig.1 g, i). Both wild types AC and RU leaves
and stems possessed all types of trichomes including glandular and non-glandular, but type VI
glandular trichomes were the most abundant on leaves and stems (Fig.1 d, f, j, i & Fig. 2 c, d).
Densities of trichomes on the mutants were significantly different than their respective
wild type genotypes. The mutant hl displayed twisted and low density of glandular trichomes on
leaf surface; the glandular trichome density was reduced by 57% compared to wild AC plants
and no non-glandular trichome on the leaf surface. The density of the twisted glandular
trichomes on hl was induced by MeJA treatment; twisted glandular trichomes on newly growth
leaf were increased 85.8% after MeJA treatment. While the woolly mutant showed high density
of non-glandular trichomes with very few glandular trichome on leaf surface compared to wild
type RU plants (Fig. 3 a, b). The non-glandular trichomes on the woolly mutant also were
induced by MeJA; non-glandular trichome numbers increased 37.8% following treatment. Also
80
the non-glandular trichome length was increased 71.4% by MeJA compared to untreated plants
(Fig. 3 c). The glandular trichome densities on the RU and AC leaf surface were increased 48.1%
and 64.8% by MeJA (Fig. 3 b). Both type trichome densities on the leaf are induced by MeJA
treatment.
Accumulation of terpenes in different trichomes
Glandular trichomes function either as sites for synthesis and/or the site of release for
various defensive compounds. Previous reports indicate that monoterpenes and sesquiterpenes
are produced in leaf trichomes (Fridman et al. 2005). Because there is significant variability in
the morphology and density of trichomes on the leaf and stem of mutants, we compared the
terpenoid composition of trichomes in these mutant lines to their wild types. Trichomes
produced a mixture of several monoterpenes with β-phellandrene, (Z)-3-hexenyl acetate and α/β-
pinene being the main constituents. Monoterpenes in leaf trichomes were significantly more
abundant than in stem trichomes (Fig. 5 a). In the hl mutant, all the monoterpenes in leaf
trichomes were significantly higher than in wild type trichomes. Compared to the hl mutant and
wild type, woolly mutants showed similar monoterpene profiles, with β-phellandrene and (Z)-3-
hexenyl acetate as the main constituents, whereas β-pinene was not detected in the woolly mutant
leaf trichomes (Table S1). The total monoterpenes in the woolly leaf mutant were significantly
less than in the wild type (Fig. 5 a; Table S1). These results indicate that foliar trichome
monoterpene levels were significantly higher than in stems, and also monoterpenes are mainly
produced in glandular trichomes.
The profile of sesquiterpenes in trichomes showed the main components are e-2-
hexenylbutyrate, β-caryophyllene and z-jasmone (Table S2). Compared to monoterpenes, the
quantity of sesquiterpenes was significantly less in the both leaf and stem trichomes (Fig. 5 a, b).
81
Most sesquiterpene levels in stem trichomes were less than foliar trichomes. Also the z-3-
hexenyl butyrate, α-humulene and β-farnesene weren’t detected in both hl and woolly stem
trichomes (Table S2). The hl glandular trichome sesquiterpene level showed higher quantity than
wild type plants, while woolly mutant non-glandular trichome showed lower quantity than wild
type plants.
Analysis of leaf dip extracts also showed that the hl and woolly mutants had less
monoterpenes and sesquiterpenes than their respective wild types AC and RU. This is likely due
to decreased trichome density on hl plants relative to wild types, and the lack of glandular
trichomes on woolly mutants (Fig. 5 c). Results from both extraction methods indicate that
glandular trichomes are the main source of monoterpenes and sesquiterpenes. Kang et al (2010)
reports on the trichome terpenoids analysis showed less β-phellandrene and other sesquiterpenes
in type VI trichomes. These results showed that compared to glandular trichomes, the non-
glandular trichomes accumulate less of these chemicals in the trichomes. Although the
trichomes on the hl mutant showed distorted morphology, it did not significantly affect the
chemical composition in the leaf trichomes.
Comparison of gene expression in different tomato trichomes
Trichomes on many solanaceous species are known to express terpene synthases and
produce a variety of terpenes (Seo et al. 1999). Previous study showed that trichome specific
transcripts play a role in controlling terpenoid production (Besser et al. 2009). In this study, we
examined the expression of two genes encoding terpenoid synthesis: MTS1 (=TPS5) which
encodes for monoterpene synthase and SST1 (=TPS9) which encodes for sesquiterpene synthase.
Transcript levels measured by qRT-PCR showed that MTS1 (=TPS5) and SST1 (=TPS9) are
highly expressed in glandular trichomes (Fig. 6). The relative expression of MTS1 (=TPS5) and
82
SST1 (=TPS9) in the woolly mutant is 9.2 and 3.6- fold lower than the wild type, while in the hl
mutant MTS1 (=TPS5) and SST1 (=TPS9) are more highly expressed than wild type (Fig. 6 a, b).
These results are consistent with the monoterpene and sesquiterpene levels in the trichomes.
In addition to the defense provided by terpenes, Proteinase inhibitors are another class of
defensive proteins in tomato and can accumulate in many plant tissues (Kang et al. 2010a; Kang
et al. 2010b; Ryan 1990). Our study showed the relative expression of PIN2 is highly expressed
in hl trichomes compared to the non-glandular woolly trichomes (Fig. 6 c.). Polyphenol oxidase
(PPO) is another important defensive protein which is encoded by seven-member gene family
and high expressed tomato trichomes (Chen et al. 2010; Thipyapong and Steffens 1997). Our
results showed that PPOF gene is highly expressed in glandular trichomes, but has very low
expression in the woolly mutant, which lacks glandular trichomes. Hydroperoxide lyase (HPL)
cleaves C18-lipid hydroperoxides to form a C6 aldehyde and a 12 carbon oxoacid. HPL activity
has been found in a variety of plants and is associated with plant development and defense. In
our experiments, compared with wild type leaf RNA, the HPL was highly expressed in glandular
trichomes, but less expressed in non-glandular trichomes (Fig. 6 e). Recent study showed that
the B-type cyclin (SlCycB2) gene participates in trichome formation(Chen et al. 2008), and our
study showed that SlCycB2 was highly expressed in woolly mutant trichome, but with lower
expression in hl mutant (Fig 6 d). This result confirmed that SlCycB2 plays an important role in
non-glandular trichome formation.
Effects of mutants on insect growth and oviposition
Because the morphology, density and chemical composition of trichomes are different
between mutants and their wild types, these varieties may differ in their resistance to insect
herbivores. Bioassays showed that H. zea larval grew significantly better on hl mutants than on
83
wild type AC plants indicating that glandular trichomes are an important source of resistance to
this insect. Both hl mutant and wild type glandular trichomes are high induced by MeJA
treatment and the larval growth on induced leaves was significantly reduced on both hl and the
AC wild type plants (Fig. 7 a). While woolly mutant had high density of non-glandular
trichomes, H. zea growth was significantly better on this mutant compared to wild type RU
plants. Again, MeJA treatment enhanced resistance to H. zea for both woolly mutant and wild
type plants (Fig. 7 a). This result confirmed glandular trichome density is an important factor in
resistance to H. zea.
In contrast to H. zea, Colorado potato beetle (CPB) larvae showed no significant
differences in larval growth on hl mutants compared to wild type (Fig. 7 b). These data indicate
that the density of glandular trichomes found on the wild type is not an important mediator of
larval growth in CPB. Additionally, MeJA treatment did not affect larval growth on newly
formed leaves for the hl mutant or its AC wild type. Conversely, the woolly mutants
significantly reduced CPB growth compared to wild type plants (Fig. 7 b), indicating that the
very high densities of non-glandular trichomes on this mutant strongly influenced CPB growth.
To determine if the larval growth data relate to feeding behavior, we recorded the time
larval H. zea and CPB spent feeding on mutant and wild-type plants. The duration of CPB
feeding on the woolly mutant was significantly lower than the amount of time spent feeding on
wild-type leaves indicating that growth reduction can be, in part, explained by a reduction in
feeding due to the high density of non-glandular trichomes. The amount of time H. zea spent
feeding was not influenced by non-glandular trichomes on woolly mutants, but fewer glandular
trichomes on woolly leaves appeared to allow H. zea to feed longer than on wild type plants.
During our observations of H. zea feeding, we found that larvae preferentially ingested non-
84
glandular trichomes prior to feeding on leaf mesophyll. There was no evidence that larvae later
regurgitated the non-glandular trichomes. The CPB do not preferentially feed on the trichomes
and it appears that the trichomes interfere with their access to the leaf (Fig. 7 c).
Because trichomes have been reported to influence insect oviposition (Heinz and Zalom
1995; Horgan et al. 2009; Kessler et al. 2011), we conducted this experiment to determine if
tomato trichomes influence ovipositional choice for both insect species. We found no observable
differences in ovipositional choice for the different plant varieties (Fig. S1). H. zea moths laid
eggs randomly on the adaxial leaf surface of all varieties and CPB laid eggs in clumps of 5-20 on
the adaxial leaf surface equally across varieties (Fig. S2).
PIN2 Induction by insect feeding
Because trichome expression has been shown to be partly dependent upon a functional
jasmonate signaling pathway (Peiffer et al. 2009), we tested if induction of the JA-regulated
defense gene PIN2 was influenced by H. zea feeding. In all genotypes, the expression of PIN2
was significantly induced by feeding compared with their unwounded plants. However, no
differences in levels of PIN2 induction were detected among the different mutants and wild type
plants (Fig. 8). These results indicate that JA signaling is activated by insect feeding damage in
both mutants and wild type plants and suggest that differences in insect growth on the mutants
were likely not due to significant impairments in jasmonate signaling.
Discussion Trichome-based resistance in tomato plants offers a feasible approach to reduce pesticide
applications (Simmons and Gurr 2004). Trichome morphology, density and chemical
composition are important mechanisms of defense to prevent or decrease herbivore damage. The
morphology and density of leaf trichomes vary considerably among plant species and may also
85
vary among populations and within individual plants (Dalin and Björkman 2003). However, in
plants such as tomato which possess a variety of trichome types, these specialized cell types can
be difficult to isolate separately to study the function of each type of trichome. Thus, the use of
mutants provides a good tool to study trichome function. The hl mutant was described as
hairless, and the phenotypic expression of this mutant at the microscopic level shows a
characteristic twisting and shortening of trichomes (Kang et al. 2010b; Reeves 1977). The woolly
mutant was described as hairy with a high density of type II and III non-glandular trichomes on
leaf surface.
Numerous studies have shown that trichomes are capable of synthesizing and either
storing or secreting large amounts of specialized metabolites that could influence their
interaction with herbivores (Hogenhout and Bos 2011; Schilmiller et al. 2010). Chemical profiles
of type VI trichome in hl mutant showed similar profiles of monoterpenes and sesquiterpenes
with wild type plants, but with less β-phellandrene, β-caryophyllene and α-humulene (Kang et al.
2010b). In our experiment, we collected both types of trichome from the hl mutant, but the
profiles of chemical composition were different from previous results. The β-phellandrene, β-
caryophyllene and α-humulene levels were higher in hl trichomes than in the AC wild type
trichomes. The leaf dip method showed the same pattern with previous results (Kang et al. 2010a;
Kang et al. 2010b). These results indicated that although the trichomes were distorted in the hl
mutant, the chemical accumulation in the twisted head cells was not affected. Not surprisingly
the woolly mutant trichomes showed significantly low monoterpenes and sesquiterpenes
confirming that that the glandular trichome is the main source of terpenes. Our results also
indicated that the foliar trichomes had higher levels of monoterpenes and sesquiterpenes than the
stem trichomes.
86
Our results indicate that both glandular and non-glandular trichomes function in insect
defense. The non-choice bioassay showed the growth of H. zea larvae was substantially
improved by feeding on the hl genotype compared to the wild type parent (cv. Alisa Craig). The
bioassay results with the hl mutant are consistent with Kang (2010a) who observed similar
effects with another caterpillar species, Manduca sexta. These results show that caterpillar
growth is compromised by the presence of glandular trichomes which contain an arsenal of
chemical defenses (e.g., terpenes, polyphenol oxidase, etc.) that may entrap small larvae as they
attempt to move on the leaf surface (Simmons and Gurr 2004). Moreover, the feeding time of H.
zea was significantly longer on the hl genotype compared to the parent wild type (cv. Alisa
Craig). Larval H. zea spent more time feeding and had enhanced growth on the woolly genotype
compared to the parent wild type (cv. Rutgers). These results indicate that the absence of
glandular trichomes combined with a high density of non-glandular trichomes greatly enhances
H. zea larval growth. We observed that larvae preferentially ingested the non-glandular
trichomes prior to feeding on the remaining leaf tissue. By comparison, when H. zea feed on
leaves with high densities of glandular trichomes, they frequently are observed to remove the
trichomes and egest them (personal observations). Our results are quite different from the recent
finding in Nicotiana attenuata where neonate M. sexta preferentially consume tobacco glandular
trichomes as their first meal (Celorio-Mancera et al. 2011).
The results with the specialist beetle L. decemlineata were markedly different from what
we observed with H. zea. The L. decemlineata growth was not improved when larvae fed on the
hl genotype compared to the wild type parent. The hl mutant possesses a low density of
glandular trichomes and reduced total terpenes in the leaves compared to the wild type plants.
Although beetle larvae were observed to feed for longer bouts on the hl mutant leaf compared to
87
wild plants, this did not result in improved growth during the time course of our bioassay. Our
bioassay results were different from Kang et al (2010b). They investigated resistance of the
odorless-2 (od-2) mutant and found that larval growth of L. decemlineata was significantly
increased on od-2 mutant compared to wild type plants. Although od-2 possesses a normal
glandular trichome phenotype, the levels of terpenes and flavonoids in the trichomes are
compromised. In our study we used L. decemlineata which originated from tomato fields and
has been reared solely on tomato. Perhaps our colony is better adapted to tomato and is not as
sensitive to the level of terpenes and flavonoids in the glandular trichomes. The most surprising
results we observed were with the woolly genotype which negatively influenced larval beetle
weight gain and feeding time. We observed that L. decemlineata larvae prefer to feed on leaves
with very low density of trichomes. We observed that larval L. decemlineata had difficulty
finding a suitable feeding site on the woolly mutant leaf which contains a very high density of
non-glandular trichomes (personal observation). These results indicate that non-glandular
trichomes although harmless or perhaps even beneficial for caterpillar growth, were detrimental
to beetle feeding and growth.
We did not find that trichomes impacted oviposition by either insect species in the
genotypes we tested. Levin (1973) and others have reported that trichomes influence insect
oviposition in a wide range of insects and that trichome length on the leaf surface is often
negatively correlated with the number of eggs laid. But in our study, using a choice-test, H. zea
and CPB adults did not exhibit ovipositional preference for any of the genotypes tested. While
we cannot conclude that trichomes have no effect on oviposition for these insects, at least for
these genotypes there was not sufficient variation in trichome type or density to uncover
differences in ovipositional preference.
88
Trichome density is often inducible by insect herbivory or by plant hormones (Kessler et
al. 2011; Traw and Dawson 2002b). Trichome density is regulated by jasmonates,
brassinosteroids and ethylene in tomato (Boughton et al. 2005; Campos et al. 2009). In fact,
induction of glandular trichomes by herbivory, wounding, or MeJA treatment in the parent
generation persists in the offspring of the parents (Rasmann et al. 2012). In this study, both
glandular and non-glandular types of trichomes were up-regulated by MeJA, although the
specific trichome type was not induced by hormone treatment. When plants were treated with
MeJA, H. zea growth was significantly reduced on treated plants of all genotypes. The growth
of L. decemlineata was not affected by y MeJA treatment in the hl, AC or RU genotypes, except
in the case of the woolly mutant where the non-glandular trichome length was significantly
increased by MeJA treatment. The increase in the length of non-glandular trichomes may further
impair larval feeding. These results provide further support for the role of non-glandular
trichomes in resistance to L. decemlineata.
Trichomes are initiated in the epidermis of developing leaves; previous studies on
Arabidopsis have revealed several key regulators that participate in trichome formation and
induction (need references). The mechanisms trichome formation in tomato is less clear.
Previous study on hl mutant showed that the Hl gene plays an important role in the synthesis of
new cell wall material in developing trichomes. Cloning of the gene is needed to understand the
precise function of Hl in trichome development (Kang et al. 2010b). The woolly (Wo) gene is
responsible for trichome formation and regulates SlCyB2 gene expression that participates in
trichome formation. Suppression of Wo and SlCyB2 using RNAi on the mutant (LA3186)
produced low densities trichomes the leaf surface (Chen et al. 2008). In our study, we used a
89
different woolly mutant (LA0258) from the previous study and our results showed the SlCyB2
gene was also highly expressed in woolly trichomes.
While the induction of high densities of trichomes may impact herbivores, the secondary
metabolites produced by glandular trichomes may also negatively impact herbivore feeding and
growth. Transcriptional co-regulation is an important hallmark of genes involved in secondary
metabolite pathway and our results confirmed that there is high degree of association between
monoterpene and sesquiterpene content and gene expression (i.e., MTS1 (=TPS5) and SST1
(=TPS9) ). In addition to terpenes, glandular trichomes contained other defenses including anti-
nutritive proteins and phenolics, thus it is not surprising that tomato glandular trichomes have
been implicated in resistance to a variety of herbivore species including caterpillars and aphids
(Chen et al. 2008; Kang et al. 2010b). For instance, trichomes of many Solanum species
accumulate significant levels of polyphenol oxidase and play roles in the oxidation of phenolics
that may defend against insects and pathogens (Thipyapong et al. 1997). Proteinase inhibitors are
another class of defensive proteins in tomato and can accumulate in many plant tissues which
affect insect growth (Kang et al. 2010a; Kang et al. 2010b; Ryan 1990). HPL is also associated
with plant development and defense. Our results confirmed that PIN2, PPOF and HPL are highly
expressed in glandular trichomes. High expression of these proteins in the trichomes may reduce
the nutritional quality of dietary protein available to H. zea (Felton and Duffey 1992), but not
that available to CPB (Felton et al. 1992) due to differences in the physico-chemical environment
of their digestive systems (Johnson and Felton 1996; Zhu-Salzman et al. 2008). Moreover, the
expression of the PIN2 gene in the trichomes is induced by H. zea feeding indicating that
herbivory may impact both the density of trichomes as well as their chemical composition.
90
Trichomes of the cultivated tomato are an important source of constitutive and inducible
resistance to insect herbivores and offer potential for exploitation in plant breeding programs.
Novel secondary metabolites are present in the glandular trichomes of wild species of tomato and
could be used for sources of host resistance been shown to produce numerous arthropod
defensive compounds (Karban and Baldwin 1997; Li et al. 2004). Our results with H. zea
provide further substantiation that glandular trichomes play a role in resistance; however, our
study provides several important caveats for development of host plant resistance programs.
Although, H. zea growth was compromised on the hl mutant, the growth of L. decemlineata was
not. The use of non-glandular trichomes may be useful in resistance programs to L.
decemlineata, but could inadvertently enhance susceptibility to some insects such as H. zea.
Thus our findings underscore the necessity to clarify the roles of specific trichomes to different
herbivorous insect species before embarking on a comprehensive plant breeding program.
Acknowledgments: The support of the United State Department of Agriculture, National
Research Initiative is greatly appreciated (2007-35302-18218, awarded to G.W.F.). Tomato
seeds were provided by the Tomato Genetics Resource Center (University of California, Davis,
CA, USA)
91
Reference
Agrawal AA, Conner JK, Johnson MTJ, Wallsgrove R (2002) Ecological genetics of an
induced plant defense against herbivores: additive genetic variance and costs of
phenotypic plasticity. Evolution 56: 2206-2213
Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores
and plant fitness. Ecology 80: 1713-1723
Agren J, Schemske DW (1994) Evolution of trichome number in a naturalized population of
Brassica rapa. American Naturalist 143(1):1-13
Andrade A, Vigliocco A, Alemano S, Miersch O, Botella MA, Abdala G (2005) Endogenous
jasmonates and octadecanoids in hypersensitive tomato mutants during germination and
seedling development in response to abiotic stress. Seed Science Research 15: 309-318
Arimura GI, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.
Biophys. Acta (BBA)- Mol. Cell Biol. Lipids 1734: 91-111
Bansal R, Hulbert S, Schemerhorn B, Reese JC, Whitworth RJ, Stuart JJ, Chen MS (2011)
Hessian fly-associated bacteria: transmission, essentiality, and composition. Plos One 6
Besser K, Harper A, Welsby N, Schauvinhold I, Slocombe S, Li Y, Dixon RA, Broun P (2009)
Divergent regulation of terpenoid metabolism in the trichomes of wild and cultivated
tomato species. Plant Physiol. 149: 499-514
Bostock RM (2005) Signal crosstalk and induced resistance: Straddling the line between cost and
benefit. Annual Review of Phytopathology 43: 545-580
Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased
densities of glandular trichomes on tomato, Lycopersicon esculentum. Journal of
Chemical Ecology 31: 2211-2216
Campos ML, de Almeida M, Rossi ML, Martinelli AP, Litholdo CG, Figueira A, Rampelotti-
Ferreira FT, Vendramim JD, Benedito VA, Peres LEP (2009) Brassinosteroids
interact negatively with jasmonates in the formation of anti-herbivory traits in tomato.
Journal of Experimental Botany 60: 4346-4360
Celorio,MM, Courtiade J, Muck A, Heckel DG, Musser RO, Vogel H (2011) Sialome
of a generalist lepidopteran herbivore: identification of transcripts and proteins from
Helicoverpa armigera labial salivary glands. Plos One 6: e26676
Chen MS, Zhao HX, Zhu YC, Scheffler B, Liu X, Liu X, Hulbert S, Stuart JJ (2008) Analysis
of transcripts and proteins expressed in the salivary glands of Hessian fly (Mayetiola
destructor) larvae. Journal of Insect Physiology 54: 1-16
Chen MS, Liu XM, Yang ZH, Zhao HX, Shukle RH, Stuart JJ, Hulbert S (2010) Unusual
conservation among genes encoding small secreted salivary gland proteins from a gall
midge. Bmc Evolutionary Biology 10
Chung SH, Felton GW (2011) Specificity of induced resistance in tomato against specialist
Lepidopteran and Coleopteran species. Journal of Chemical Ecology 37: 378-386
Creelman RA, Mullet JE (1995) Jasmonic acid distribution and action in plants: regulation
during development and response to biotic and abiotic stress. Proc Natl Acad Sci U S A
92: 4114-4119
Dalin P, Björkman C (2003) Adult beetle grazing induces willow trichome defence against
subsequent larval feeding. Oecologia 134: 112-118
Dimock MB, Kennedy GG, Williams WG (1982) Toxicity studies of analogs of 2-tridecanone, a
naturally-occurring toxicant from a wild tomato. Journal of Chemical Ecology 8: 837-842
92
Duffey SS (1986) Plant glandular trichomes: their partial role in defence against insects. In:
Juniper BE, Southwood TE (eds) Insects and the plant surface Arnold, London, England,
pp 151-172
Felton GW, Bi JL, Summers CB, Mueller AJ, Duffey SS (1994) Potential role of lipoxygenases
in defense against insect herbivory. J Chem Ecol 20: 651-666
Felton GW, Duffey SS (1992) Ascorbate oxidation reduction in Helicoverpa Zea as a
scavenging system against dietary oxidants. Archives of Insect Biochemistry and
Physiology 19: 27-37
Felton GW, Workman J, Duffey SS (1992) Avoidance of antinutritive plant defense - role of
midgut pH in Colorado potato beetle. Journal of Chemical Ecology 18: 571-583
Fridman E, Wang JH, Iijima Y, Froehlich JE, Gang DR, Ohlrogge J, Pichersky E (2005)
Metabolic, genomic, and biochemical analyses of glandular trichomes from the wild
tomato species Lycopersicon hirsutum identify a key enzyme in the biosynthesis of
methylketones. Plant Cell 17: 1252-1267
Gang DR, Wang J, Dudareva N, Nam KH, Simon JE, Lewinsohn E, Pichersky E (2001) An
investigation of the storage and biosynthesis of phenylpropenes in sweet basil. Plant
Physiol. 125: 539-555
Goffreda JC, Mutschler MA, Ave DA, Tingey WM, Steffens JC (1989) Aphid deterrence by
glucose esters in glandular trichome exudate of the wild tomato, Lycopersicon pennellii.
Journal of Chemical Ecology 15: 2135-2147
Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible
defense mechanism against insects. Science 175: 776-777
Halitschke R, Stenberg JA, Kessler D, Kessler A, Baldwin IT (2008) Shared signals - 'alarm
calls' from plants increase apparency to herbivores and their enemies in nature. Ecology
Letters 11: 24-34
Handley R, Ekbom B, Agren J (2005) Variation in trichome density and resistance against a
specialist insect herbivore in natural populations of Arabidopsis thaliana. Ecological
Entomology 30: 284-292
Heinz KM, Zalom FG (1995) Variation in trichome-based resistance to bemisia-argentifolii
(Homoptera, Aleyrodidae) oviposition on tomato. J. Econ. Entomol. 88: 1494-1502
Higgins R, Lockwood T, Holley S, Yalamanchili R, Stratmann J (2007) Changes in extracellular
pH are neither required nor sufficient for activation of mitogen-activated protein kinases
(MAPKs) in response to systemin and fusicoccin in tomato. Planta 225: 1535-1546
Hogenhout SA, Bos JIB (2011) Effector proteins that modulate plant–insect interactions. Current
Opinion in Plant Biology 14: 422-428
Horgan FG, Quiring DT, Lagnaoui A, Pelletier Y (2009) Effects of altitude of origin on
trichome-mediated anti-herbivore resistance in wild andean potatoes. Flora 204: 49-62
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant
Biology 59: 41-66
Johnson KS, Felton GW (1996) Potential influence of midgut pH and redox potential on protein
utilization in insect herbivores. Arch Insect Biochem Physiol 32: 85-105
Kang JH, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The Tomato odorless-2
mutant Is defective in trichome-based production of diverse specialized metabolites and
broad-spectrum resistance to insect herbivores. Plant Physiol.: pp.110.160192
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology
93
by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental
Botany 61: 1053-1064
Karban R, Baldwin IT (1997) Induced responses to herbivory. University of Chicago Press
Kennedy GG (2003) Tomato, Pests, parasitoids, and predators: Tritrophic interactions involving
the genus Lycopersicon. Annual Review of Entomology 48: 51-72
Kessler A, Halitschke R, Poveda K (2011) Herbivory-mediated pollinator limitation: negative
impacts of induced volatiles on plant-pollinator interactions. Ecology 92: 1769-1780
Li AX, Eannetta N, Ghangas GS, Steffens JC (1999) Glucose polyester biosynthesis. Purification
and characterization of a glucose acyltransferase. Plant Physiology 121: 453-460
Li L, Zhao YF, McCaig BC, Wingerd BA, Wang JH, Whalon ME, Pichersky E, Howe GA
(2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the
maternal control of seed maturation, jasmonate-signaled defense responses, and glandular
trichome development. Plant Cell 16: 126-143
Luckwill LC (1943) The genus Lycopersicon: A historical, biological and taxonomic survey of
the wild and cultivated tomato. Aberd. Univ. Stud. 120: 1-44
Ma KW, Flores C, Ma W (2011) Chromatin configuration as a battlefield in plant-bacteria
interactions. Plant Physiology 157: 535-543
Mirnezhad M, Romero-Gonzalez RR, Leiss KA, Choi YH, Verpoorte R, Klinkhamer PGL
(2010) Metabolomic analysis of host plant resistance to thrips in wild and cultivated
tomatoes. Phytochem. Anal. 21: 110-117
Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002) Hydrogen peroxide and nitric
oxide as signalling molecules in plants. Journal of Experimental Botany 53: 1237-1247
O'Donnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as
a signal mediating the wound response of tomato plants. Science 274: 1914-1917.
Panizzi AR (1997) WILD HOSTS OF PENTATOMIDS:Ecological Significance and role in
their pest status on crops. Annual Review of Entomology 42: 99-122
Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary
glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113
Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as
sensors for insect herbivores. New Phytologist 184: 644-656
Pelletier Y, Dutheil J (2006) Behavioural responses of the Colorado potato beetle to trichomes
and leaf surface chemicals of Solanum tarijense. Entomologia Experimentalis et
Applicata 120: 125-130
Radhika V, Kost C, Boland W, Heil M (2010) The role of jasmonates in floral nectar secretion.
Plos One 5: e9265
Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW,
Jander G (2012) Herbivory in the previous generation primes plants for enhanced insect
resistance. Plant Physiology PMID: 22209873
Reeves AF (1977) Tomato trichomes and mutations affecting their development American
Journal of Botany. 64: 186–189
Rotenberg D, Thompson TS, German TL, Willis DK (2006) Methods for effective real-time RT-
PCR analysis of virus-induced gene silencing. Journal of Virological Methods 138: 49-59
Ryan CA (1990) Proteinase inhibitors in plants: genes for improving defenses against insects and
pathogens. Ann Rev Phytopathol 28: 425
Schilmiller A, Shi F, Kim J, Charbonneau AL, Holmes D, Jones AD, Last RL (2010) Mass
94
spectrometry screening reveals widespread diversity in trichome specialized metabolites
of tomato chromosomal substitution lines. Plant Journal 62: 391-403
Seo S, Sano H, Ohashi Y (1999) Jasmonate based wound signal transduction requires
activation of WIPK,a tobacco mitogen-activated protein kinase.The Plant Cell 11:289-
298
Simmons AT, Gurr GM (2004) Trichome-based host plant resistance of Lycopersicon species
and the biocontrol agent Mallada signata: are they compatible? Entomologia
Experimentalis et Applicata 113: 95-101
Simmons AT, Gurr GM (2005) Trichomes of Lycopersicon species and their hybrids: effects on
pests and natural enemies. Agricultural and Forest Entomology 7: 265-276
Steffens JC, Walters DS (1991) Biochemical aspects of glandular trichome-mediated insect
resistance in the Solanaceae. Acs Symposium Series 449: 136-149
Stout MJ, Zehnder GW, Baur ME (2002) Potential for the use of elicitors of plant resistance in
arthropod management programs. Archives of Insect Biochemistry and Physiology 51:
222-235
Stratmann JW, Ryan CA (1997) Myelin basic protein kinase activity in tomato leaves is induced
systemically by wounding and increases in response to systemin and
oligosaccharide elicitors. Proceedings of the National Academy of Sciences 94: 11085-
11089
Thaler JS, Stout MJ, Karban R, Duffey SS (2001) Jasmonate-mediated induced plant resistance
affects a community of herbivores. Ecol Entomol 26: 312-324
Thipyapong P, Joel DM, Steffens JC (1997) Differential expression and turnover of the tomato
polyphenol oxidase gene family during vegetative and reproductive development. Plant
Physiology 113: 707-718
Thipyapong P, Steffens JC (1997) Tomato polyphenol oxidase - Differential response of the
polyphenol oxidase F promoter to injuries and wound signals. Plant Physiology 115: 409-
418
Toth GB, Langhamer O, Pavia H (2005) Inducible and constitutive defenses of valuable seaweed
tissues: consequences for herbivore fitness. Ecology 86: 612-618
Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin
on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375
Traw MB, Dawson TE (2002) Reduced performance of two specialist herbivores (Lepidoptera :
Pieridae, Coleoptera : Chrysomelidae) on new leaves of damaged black mustard plants.
Environmental Entomology 31: 714-722
Wagner GJ (1991) Secreting glandular trichomes - more than just hairs. Plant Physiology 96:
675-679
Zhu-Salzman K, Luthe DS, Felton GW (2008) Arthropod-inducible proteins: broad spectrum
defenses against multiple herbivores. Plant Physiol. 146: 852-858
95
Table .1. Primers used for real-time PCR assays of relative gene expression
Primer Gene name/accession number Primer sequence (5’-3’) PIN2 Wound-inducible proteinase
inhibitor 2 K03271 F: GGA TTT AGC GGA CTT CCT TCT G R: ATG CCA AGG CTT GTA CTA GAG AAT
MTS1 (=TPS5)
Monoterpene synthase TC191446
F: GTA ACA TAG GGA TGA TGG TGG TCA CCTT R: CTG AAC GCC TTG TGG TGG AAAT
SST1 (=TPS9)
Sesquiterpene synthase TC197727
F: AGC AAA CCT TAG AAC AAA CAA GCAA R: CCA AAC AGT TGG GTG AAA ATT AGC
PPO Polyphenol oxidase Z12838
F: ATG TGG ACA GGA TGT GGA ACG AGT R:ACT TTC ACG CGG TAA GGG TTA CGA
SlCycB2 B-type cyclin F: TGA GCA GGA GAA ATG GAA R: CAT TGT CAG CGA CCT TGT
HPL Hydroperoxide lyase AY028373
F:CCT CGG CGC TGA TCC ATC TGT CTCC R:CTT GCA TAT CCG GGT TTT TCT CAT CTC
Ubi Ubiquitin X58253
F: GCC AAG ATC CAG GAC AAG GA R: GCT GCT TTC CGG CGA AA
96
Figure legends
Fig. 1. Morphology of trichomes on mutant and wild type leaf and stem, and induction by methyl
jasmonate (MeJA): (a-c) woolly mutant trichome on leaf , stem and MeJA induction (d-f) Wild type
Rutgers (RU) trichomes on leaves and stems, (g-i) hairless (hl) mutant trichome on leaves and stems and
induction by MeJA, (j –l) wild type Alisa Craig (AC) trichomes
Fig. 2. Trichome morphology on leaves in wild type and hl, woolly mutant plants under scanning electron
microcope: a) woolly mutant with type I and type III trichomes b) hl mutant showing fewer trichomes,
mostly type VI trichomes, and some distored type I trichomes. c) wild type RU leaf with type I, IV and
VI trichomes. d) wild type AC leaf with type I, IV and VI trichomes
Fig. 3. Trichome density on hl, woolly mutant and wild type plants and induction by MeJA. a) Density of
non-glandular trichome on hl, woolly mutant and wild type leaves , induction by MeJA. b) Density of
glandular trichome on hl, woolly mutant and wild type leaves and induction by MeJA. c) Trichome
length induced by MeJA. Data show trichome density as the mean (±SE) trichome number of 20 replicate
leaves of 4th leaf, trichome length is the mean (±SE) mm of 15 non-glandular trichomes on different
leaves . Means followed by different letters are significantly different at P= 0.05).
Fig. 4. Representative total ion chromatograms showing MTBE extractions of leaf trichomes from a)
Rutgers (RU; wild type for woolly), b) woolly (non-glandular trichomes), c) hl (glandular trichomes).
Compounds are: 1) α-pinene, 2) unknown monoterpene, 3) cis-3-hexenyl acetate, 4) β--phellandrene, 5)
nonyl acetate (external standard).
Fig. 5. Comparison of monoterpenes and sesquiterpenes levels in mutant and wild type leaves and stems.
a) Monterpenes in stem and stem b) Sesquiterpenes in stem and leaf c) Leaf dip method for comparion
monoterpenes and sesquiterpenes. Each data point represents the mean±SE of three replicates. Means
followed by different letters are significantly different at P= 0.05).
Fig. 6. Relative gene expression in different types of trichomes in hl, woolly and wild type. Trichomes
were extracted from 30 plant leaves, relative expression is calculated to wild type RU leaf RNA. Bars
indicates standard error of three technical replicates. PIN2 proteinase inhibitor 2 gene, MTS1 (=TPS5)
monosesquiterpene synthase 1 gene, SST1 (=TPS9) Sessquiterpene synthase 1, PPO polyphenol oxidase
gene. SlCycB2, B type cyclin gene. HPL, Hydroperoxide lyase gene. Means followed by different letters
are significantly different at P= 0.05).
Fig. 7. hl and woolly mutant affect Helicoverpa zea and Colorado potato beetle growth and feeding time.
No choice bioassay were performed by placing first instar H. zea and CPB for 4 days bioassay. a) hl,
woolly mutants and wild type influence H. zea growth . b) hl, woolly mutants and wild type influence
CPB growth . c) Feeding time influenced by different mutants compared to wild type plants. Data
represents mean±SE of larval weight (n=30); data of feeding time represents mean±SE of larvae (n=15)
feeding on leaves. Means followed by different letters are significantly different at P= 0.05).
Fig.8. H. zea feeding induced relative expression of proteinase inhibitor 2 (PIN2) in mutant and wild
type plants. woolly is the woolly (hairy) mutant, hl is the hairless mutant, RU and AC are the wild type of
woolly and hl mutant. Relative expression of PIN2, Means followed by different letters are significantly
different at P= 0.05).
97
Fig.S1. Oviposition choice on different mutants. Not significantly different among the mutants. F= 0.03,
P= 0.993 for H. zea; F=0.09, P=0.967 for CPB (n=8)
Fig .S2. Oviposition of H. zea and CPB in woolly mutant. a) H .zea egg on woolly leaf surface with
non-glandular trichomes. b) H .zea eggs on woolly stem with both glandular and glandular trichomes c)
CPB lay eggs on underside leaf of woolly mutant
98
Fig.1.
99
Fig.2.
100
Fig.3.
101
Fig.4.
a)
b)
c)
102
Fig. 5
103
Fig. 6
104
Fig. 7.
105
Fig.8.
106
Fig.S1.
107
Fig. S2.
108
Table S 1. Monoterpene in mutant and wild type trichomes (ng/fresh weight g)
(Z)-3-hexen-1-ol α-pinene β-pinene Myrcene (Z)-3-hexenyl acetate eBocimene Linalool β-phellandrene
hl stem 365.8±78.3 672.7±10.1 84.1±23.1 131.7±7.1 6251.6±57.7 119.6±25.8 62.1±10.5 15621.4±240.6
hl leaf 3123.0±634.6 3909.7±336.7 3966.0±436.8 497.5±45.4 26545.9±245.9 7081.5±726.9 290.5±32.6 78232.8±1172.2
AC stem 321.3±10.7 1054.7±151.8 196.6±13.9 nd 9448.8±1218.5 nd 19.2±2.4 24573.6±582.6
AC leaf 1616.9±184.8 1559.9±141.1 2163.7±108.5 Nd 12971.3±965.8 nd 175.5±42.5 35440.6±505.4
woolly stem 261.9±30.5 625.1±33.4 69.2±25.8 142.2±53.9 5026.6±147.7 169.9±57.4 56.1±3.2 14469.9±796.4
woolly leaf 65.3±10.2 177.8±5.7 nd 98.8±6.3 1341.1±38.2 79.0±21.3 90.4±8.7 4316.6±267.5
RU stem 229.8±6.6 1313.2±27.3 153.7±42.1 184.3±43.1 9488.9±121.8 235.6±46.4 23.5±5.1 30009.8±1158.2
RU leaf 268.4±21.8 1752.1±14.1 189.5±26.9 231.6±16.1 12137.4±53.7 307.7±14.1 28.0±8.5 37958.8±338.6
109
Table S 2. Sesquiterpenes in mutant and wild type trichomes (ng/fresh weight g)
z-3-hexenyl butyrate e-2-hexenyl butyrate z-jasmone caryophyllene α-humulene β-farnescene nerolidol
hl stem Nd 76.17±10.39 18.22±5.68 33.62±2.93 nd nd nd
hl leaf 643.07±78.8 2318.10±323.33 704.62±88.77 902.62±152.55 282.14±29.67 354.61±39.43 206.77±25.73
AC stem 17.2±5.12 67.43±18.07 35.69±13.81 64.98±16.35 nd 11.75±2.53 nd
AC leaf 234.87±67.3 786.18±232.68 340.80±69.85 582.34±168.57 144.13±27.95 147.22±34.98 141.18±43.29
woolly stem nd 53.23±5.19 15.25±6.31 23.70±14.32 nd 6.47±3.49 nd
Woolly leaf nd nd 31.47±10.23 81.92±18.59 35.21±3.73 21.95±10.23 34.08±2.48
RU stem 49.54±4.98 128.91±10.89 54.29±7.05 40.92±3.68 24.46±4.78 21.18±4.50 22.84±1.59
RU leaf 59.66±1.82 150.85±3.38 68.19±3.69 80.25±7.47 31.514.68 22.68±5.77 27.27±3.87
110
Chapter IV
Roles of Ethylene and Jasmonic Acid in Systemic Induced Defense in
Tomato (Solanum lycopersicum) against Helicoverpa zea
Donglan Tian, Michelle Peiffer, Consuelo DeMoraes and Gary W. Felton1
Department of Entomology
Center for Chemical Ecology
Penn State University
University Park, PA 16802
1 Corresponding author. [email protected]
111
Abstract
The plant defense-signaling is mediated by the synthesis, movement, and perception of
jasmonate (JA), and through the interaction with other plant hormones and messengers. To
characterize the interaction of ethylene and JA on induced defenses in tomato, we used the never
ripe (Nr) mutant, which contains a partial block in ethylene perception and the defenseless (def1)
mutant, which is deficient in JA biosynthesis. The defense gene proteinase inhibitor (PIN2) was
used as marker gene to compare plant responses. The Nr mutant showed a normal wounding
response with PIN2 induction, whereas the def1 mutant did not. As expected, methyl JA (MeJA)
treatment restored the normal wound response in the def1 mutant. Exogenous application of
MeJA increased resistance to Helicoverpa zea, induced defense gene expression, and increased
glandular trichome density on systemic leaves. Exogenous application of ethephon, which
penetrates tissues and decomposes to ethylene, resulted in increased H. zea growth and interfered
with the wounding response. Ethephon treatment increased salicylic acid (SA) in the systemic
leaves. These results showed that while JA plays the main role in systemic induced defense,
ethylene acted antagonistically to negatively regulate systemic defense in tomato to H. zea.
Key words: methyl jasmonate, ethephon, induced systemic defense, insect herbivore, trichomes,
proteinase inhibitor, hormones, jasmonic acid, salicylic acid, and elicitors
112
Abbreviations:
Nr Never ripe mutant
def1 Defenseless 1 mutant
RU Rutgers wild type plants of Nr mutant
CM Castlemart , wild type plants of def1 mutant
MeJA methyl jasmonate
PIN2 protease inhibitor 2
ERF1 ethylene response factor
PR1 pathogenesis related gene
PPOF polyphenol oxidase
ET
SA
ethylene
salicylic acid
113
Introduction
Biotic and abiotic stresses negatively impact plant health and fitness. Plants respond to
the biotic stress of insect herbivores and pathogens by inducing systemic resistance pathways.
Plant hormones play important role in regulating this defensive process (Erb et al. 2012; Howe
and Jander 2008). Among them, jasmonic acid (JA), salicylic acid (SA), ethylene (ET) and
abscisic acid (ABA) have been intensively investigated in terms of plant defense against
pathogen infection or insect herbivory (Abe et al. 2011; Fan et al. 2009; Leon-Reyes et al. 2009).
Other plant hormones, such as brassinosteroids (BA), gibberellins (GAs) and auxins have also
been reported as part of the defense-signaling network (Navarro 2006; Yasuda et al. 2003;
Zsogon et al. 2008).
JA is a naturally occurring phytohormone that occurs ubiquitously in plant species and
functions in regulation of seed germination, root growth, pollen development and fruit ripening
(Zhang et al. 2011). In addition to its role in plant growth development, JA and its precursors
perform an important function in regulating host defensive responses. The regulation of plant
defense by JA has been studied by observing the gene expression patterns following exogenous
application of jasmonates or through the use of loss of function or gain of function mutants
(Browse 2009; Howe 2004). Proteinase inhibitors (PINs) and polyphenol oxidases (PPO) are
two of the best studied groups of JA-regulated defense proteins in vegetative tissues. Wound-
induced proteinase inhibitors have been shown to enhance the plant’s resistance to insects by
inhibiting the proteolytic enzymes of the attacking insects (Koiwa et al. 1998). In some instances,
JA partially regulates trichome production, which functions in plant defense (Halitschke et al.
2008; Li et al. 2004; Traw and Bergelson 2003;Tian et al. 2012b). In tomato, application of
methyl jasmonate (MeJA) increases densities of glandular trichomes on new leaves (Boughton et
114
al. 2005). The inducibility of trichome density is ecologically significant because increased
trichome density can negatively influence herbivore populations (Agrawal 1999; Horgan et al.
2009; Kessler et al. 2011).
In addition to jasmonic acid, additional plant hormones are known to regulate plant
defenses. Ethylene was the first identified gaseous hormone and it is involved in many plant
physiological process throughout plant development including, seed germination, flowering, fruit
ripening, organ senescence and response to stress (Zhang et al. 2010). Previous study showed
that the key components of ethylene biosynthesis, 1-amino-cyclopropane - 1carboxylic acid
synthesis (ACS) and 1-aminocyclopropane-carboxylic acid oxidase (ACO) are critical for
ethylene biosynthesis (An et al. 2006; Yang and Hoffman 1984). Regulation of the ethylene
pathway is important in mediating plant development and stress response (Diaz et al. 2002;
Mantelin 2009; Zhang et al. 2011). Ethylene accumulation during pathogen infection up-
regulates the expression of many genes in plants (Diaz et al. 2002). Ethylene response factors
(ERFs), which represent the second largest transcription factor family in plants, have been shown
to integrate signals from different plant hormone pathways and play important roles in stress
response (Onate-Sanchez et al. 2007).
Hormone cross talk is a process where different hormone signaling pathways interact
antagonistically or synergistically to regulate responses to complex and changing environments
(Verhage et al. 2010). There is ample evidence for cross talk among SA, JA and ET signaling
pathways in plant immunity (Leon-Reyes et al. 2009). Cross talk likely minimizes fitness costs
and creates a flexible signaling network that allows the plant to fine-tune its defense response to
the appropriate invaders (Bostock 2005; Thaler et al. 2012;Pieterse and Dicke 2007). In some
instances, JA may collaborate with the SA response pathway to trigger an indirect defense
115
against an insect herbivore as observed in Arabidopsis (van Poecke and Dicke 2002). Walling
(2000) found that phloem-feeding insects may induce both SA and JA dependent pathways.
Simultaneous expression of SA and JA pathways was observed in the Mi-gene mediated
resistance in tomato during aphid feeding (Martinez de Ilarduya et al. 2003). While in tobacco, it
was observed that there was an inverse relationship between endogenous concentrations of SA
and JA (Felton et al. 1999). Exogenous application of SA has been shown to inhibit both JA
synthesis and downstream defenses in tomato (Chandok et al. 2004; Thaler et al. 2010).
Moreover it was shown that ET enhanced the plant response to SA, resulting in the expression of
the SA-responsive marker gene pathogenesis-related-1 (PR-1) (Leon-Reyes et al. 2009). ET can
synergistically or antagonistically interact with JA in the regulation of plant development and
stress responses (O'Donnell et al. 1996; Zhao 2003). Many defense-related genes such as
proteinase inhibitors are regulated via a signaling pathway that requires both ET and JA (Adie et
al. 2007a; Pieterse et al. 1998). In maize, the inhibition of ET biosynthesis or perception
increased herbivore performance and damage in treated plants (Harfouche et al. 2006). However
ethylene acts antagonistically to suppress JA induced expression of nicotine biosynthesis in
tobacco (Rojo et al. 1999; Shoji et al. 2000). Exogenous ethylene application on Arabidopsis
increased the growth rate of the Egyptian cotton worm (Mantelin 2009; Stotz et al. 2000). These
studies on the interaction of plant hormones frequently show different impacts on plant defense,
but some of the differences may be attributed to varied methodologies, treatments, etc.
Furthermore, the interaction of plant hormones in defense depends on the specific plant-
herbivore system studied.
Tomato has been a primary model system for elucidating induced defenses and their
signaling pathways against herbivores, yet most of the research has focused on signaling and
116
rapidly-induced defenses in leaves (Melotto et al. 2008). Considerably less study has focused on
systemic induction and the induction of defenses that require days to weeks to generations for
expression (Rasmann et al. 2011; Tian et al. 2012a). In this study, we used tomato mutants and
application of hormones to dissect the interactions of JA and ethylene that regulate plant
systemic defense to a chewing herbivore, Helicoverpa zea. We used the tomato never ripe (Nr)
mutant, which is impaired in ethylene-mediated plant response and the def1 mutant which is
deficient in JA biosynthesis to study the hormone interactions. We used a combination of insect
bioassay, defense gene expression, and plant hormone analysis to identify the key interactions
between JA and ethylene.
Materials and Methods
Plant materials and insects
Tomato (Lycopersicon esculentum) seeds of the def1 mutant and wild type Castlemart
(CM) were kindly provided by Dr. Gregg Howe (Michigan State University). Seeds for the Nr
mutant (accession number LA3001) and the wild type Rutgers (RU, accession number LA1090)
were obtained from the Tomato Genetics Resource Center (University of California, Davis). All
the plants were grown in Metromix 400 potting mix (Griffin Greenhouse & Nursery Supplies
Tewksbury, MA) in a greenhouse at Pennsylvania State University, University Park, PA, USA).
The greenhouse was maintained on a 16-h photoperiod (Peiffer and Felton 2005). Tomato
fruitworm (Helicoverpa zea) eggs were purchased from BioServ (Frenchtown, NJ) and were
reared on a wheat germ and casein-based artificial diet (Chippendale 1970) with ingredients from
Bioserv.
Plant treatments
117
To compare the effect of exogenous hormones on plant defense, tomato plants were
sprayed with 2.5mM methyl jasmonate (MeJA) in 0.8% ethanol or 3mM ethephon (2-
chloroethylphosphonic acid, CEPA, Sigma, St. Louis, MO, USA) at the four-leaf-stage. The
treated plants were allowed to grow in the greenhouse for another two weeks after treatment.
Two weeks after the spray treatments, the plant height was measured to compare how the
exogenous hormones affected plant growth. Two leaf discs from the top fully expanded leaf
were cut from each side of the mid-vein. Glandular trichome numbers were counted under a light
microscope on each leaf disc. The density of trichomes was calculated as the number per
disc/cm2.
To compare how plant hormones regulate the wounding response, two weeks after
treatment, the newly emerged leaves on treated tomato plants were mechanically wounded by
punching two ¼ inch diameter holes along the mid-vein of the terminal leaflet. Twenty-four
hours after the wounding treatment, the wounded leaf was used for RNA extraction and gene
expression assay.
To examine the effect of hormone treatment on seedling growth, we surface sterilized
seeds and allowed them to germinate on agar plates with 100µM MeJA or 100µg/L ethephon in
Murashige and Skoog (MS) medium (Sigma, St. Louis, USA). One week later, we compared
seedling growth by measuring the hyopocotyl and root length. Also we collected the seedlings to
compare the effect of hormone treatment on defense gene expression.
Insect Bioassays
To determine if the hormones directly affected fruitworm growth, we used an artificial
diet bioassay. Based on diet weight, 100µg/g MeJA or 100µg/g ethephon was added on the diet
118
surface. After twenty minutes of drying, one neonate larva was placed in each cup. A total of
thirty larvae were tested per treatment.
Detached leaf bioassays were conducted to compare how different plant treatments
affected insect growth. Newly hatched H. zea larvae were reared on artificial diet for one day
before transfer to the bioassay cups. A detached newly emerged leaf from plants was used for the
bioassay. The treated leaves were put in a standard 1 oz. cup (BioServ, Frenchtown, NJ) with 2%
agar on the bottom to maintain moisture. Insects were kept at 27º C, with a 16:8 L:D photoperiod
in an incubator. Thirty insects were used for each treatment. After five days, larval weights were
recorded to the nearest 0.1 mg.
A choice test with MS medium grown seedling was conducted to compare how different
treatments affect larval choice. The control and two treated seedlings were placed in the edge of
a 150x15mm petri-dish and fifteen first instar larvae were placed in the center. All experiments
were repeated three times. After 24 hours, we compared the number of caterpillars on each
seedling.
RNA extraction and quantification analysis
To extract RNA, 100 mg leaf sample for each replicate was homogenized in liquid
nitrogen and total RNA was purified with a RNeasy Plus Mini-kit (Qiagen,Valencia, CA, USA).
High Capacity Transcription kit (Applied Biosystems, Foster City, CA) was used for cDNA
synthesis. All quantitative RT-PCR (qRT-PCR) reactions used Power SYBR Green PCR Master
Mix and ran on 7500 Fast Real-Time PCR system (Applied Biosystems) following standard
protocols (10 min at 95ºC, with 40 cycles of 15s at 95ºC and 60s at 60ºC). The ubiquitin gene
was used as the housekeeping gene to normalize 2−ΔΔC(T) (Rotenberg et al. 2006).
119
Plant hormone analysis
Plant hormone levels were determined two weeks after JA or ethephon treatment. To
measure hormones, 100 mg of newly emerged leaves were collected to into FastPrep® tubes
(Qbiogene, Carlsbad, CA) containing 1 g of Zirmil beads (1.1 mm; Saint-Gobain ZirPro,
Mountainside, NJ), and frozen at -80° C until processing. The new emerged leaf would not have
been directly exposed to the hormone treatments.
To extract and detect JA and SA, we used a previously described method (Tooker and De
Moraes, 2005) which was modified slightly from (Schmelz et al. 2003). Briefly, we derivatised
the carboxylic acid to its methyl ester, which was isolated using vapor phase extraction and
analyzed by GC-MS with isobutane chemical ionization using selected-ion monitoring.
Statistical Analysis
Data were analyzed using general linear models for analysis of variance (ANOVA) where
appropriate with post-hoc comparison of means using the Fisher-LSD means separation
(MiniTab Software, State College, PA).
Results
Hormone application with ethephon and MeJA affect tomato growth
To examine how MeJA and ethephon affect plant growth, plant height was measured two
weeks after treatments. The def1 and Nr mutant without hormone treatment grew normally
during this period and did not show any growth reduction compared to their respective wild type
plants. MeJA/ ethephon treatments exhibited significant changes on tomato growth. Compared
to the untreated plants, plant height in the Nr mutant was reduced 12.5 % by MeJA treatment and
31.0% by the ethephon treatment. While def1 mutant plant height was reduced 34.5 % and 69.2
120
% by each treatment respectively. Although Nr mutant displays reduced ethylene sensitivity, the
ethephon treatment still reduced growth. Both wild type plants showed significantly reduced
plant growth after the treatment. After ethephon treatment, the height of RU and CM plants were
reduced by 54.1% and 52.3% respectively. The MeJA treatment reduced the height by 22.6%
and 26.1% on both RU and CM plants (Fig. 1A, F=97.48, p<0.01.).
When MeJA and ethephon were both added to MS medium plates at same time, the
seedling growth was significantly affected by the treatment. Compared to control seedlings, both
MeJA and ethephon significantly reduced hypocotyls length and root growth (Fig. 1 B; F=28.73,
p<0.001and C; F=7.01, p<0.001).
Trichome production regulated by hormone application
A striking reduction in type VI glandular trichome density was observed on JA deficient
def1 mutant compared to the wild type CM trichome number (Fig. 2A; F=27.18, p<0.01). The
trichome numbers on the def1 mutant were 40.9% less than on CM. While the trichome numbers
on the Nr mutant did not show significant differences compared to wild type Rutgers (RU) plants
(Fig. 2B; F=0.15, p=0.696).
The MeJA and ethephon showed different effects on trichome production. The trichome
density on both mutants and wild type plants was significantly increased by MeJA treatment.
The def1 and CM showed a 67.5% and 71.4% increase respectively. The trichome density on Nr
and RU was increased by 81.6% and 71.5% compared to the untreated control. Conversely the
trichome density on ET-treated plants was decreased from 6.5%-27%, but with no significant
reduction compared to the untreated mutants and wild type plants (Fig 2 A, B.). These results
are consistent with a previous study where MeJA induced trichomes on new growth leaves and
confirms that JA plays important role in trichome formation (Boughton et al. 2005). The effects
121
of ethylene on trichome production have shown different results from previous studies, but may
be to due to differences in application time, concentration or different hosts (Gibson 2003; Plett
et al. 2009).
Hormone application and systemic resistance against H. zea
While various studies have shown that elicitors such as JA and ET regulate plant defense
to insect feeding (Adie et al. 2007a; Ankala et al. 2009), we determined if the elicitors had any
direct effects on the insect. MeJA or ethephon in diet did not directly affect larval growth rate
over a five-day feeding period (Fig. 3A; F=0.23, p=0.799).
We then tested the growth of larvae on the ethylene and JA mutants. The bioassays with
leaves from Nr mutant and RU wild type plants showed that H. zea growth was not significantly
different between the two genotypes (Fig. 3B; F=9.42, p<0.01). However, the growth of H. zea
significantly increased on the def1 mutant compared to its wild type CM (Fig. 3B). To assess
how JA and ET treatments of plants affected insect growth, the new growth leaves were removed
for bioassay. The results showed that treatment of plants with ethephon significantly increased
caterpillar growth on both mutants and wild type plants compared to control plants (Fig. 3B).
Because a small amount of ethanol is added to dissolve MeJA, we also used an ethanol control
treatment; nevertheless MeJA significantly reduced the caterpillar growth compared with the
ethanol treatment in all the mutants and wild type plants (Fig. 3C; F=17.91, p<0.01). The choice
test with MS medium grown seedlings showed ethephon treatment seedlings were more
attractive to first instar larvae than MeJA and control treatment (Fig. 3D; F=29.88, p<0.01).
MeJA and ethephon treatment effects on plant gene expression
122
Proteinase inhibitors (e.g., PIN2) are known to act as defensive proteins against insects
by affecting their larval nutrition (Ryan et al. 1986; Wasternack et al. 2006). The PIN2 defense
gene is mainly regulated by JA, which syntheses via the octadecanoid pathway (Howe 2004).
Our results showed there were no difference in the constitutive expression of PIN2 between the
Nr mutant and its wild type RU. While in the def1 PIN2 expression was significantly lower
compared to its wild type CM leaves as expected (Fig. 4A; F=8.19, p<0.01).
To investigate the roles of ET and JA in defense gene expression, we compared PIN2
expression on systemic leaves after ethephon or MeJA treatment. PIN2 expression on Nr mutant
was not significantly reduced after the ethephon treatment compared with untreated plants;
however the wild type plants showed significant reduction after the ethephon treatment.
Ethephon treatment on CM plants also significantly reduced PIN2 expression, but in the case of
the def1 mutant, the steady state levels of PIN2 are already very low and were not further
reduced by ethephon treatment. In general, the ethephon significantly reduced PIN2 expression
on systemic leaves of wild type genotypes. Compared to control ethanol treatments, MeJA
treatments significantly induced PIN2 expression in both mutants and wild types. After MeJA
spray, the PIN2 expression for the def1 mutant was not significantly different from the treated
wild type CM plants (Fig. 4B, F=0.15, p=0.929), indicating that this mutant is still responsive to
JA as expected.
After 7 days growth on MS medium, whole seedlings were collected for analysis of
PIN2 gene expression. The results showed the same trend of PIN2 expression on MS medium as
the treatment with ethephon significantly reduced PIN2 expression (Fig. 5A; F=6.49, p<0.01).
The PIN2 expression on MS medium with MeJA treatment was significantly induced compared
with the control seedlings. The expression of PIN2 was significantly lower than MeJA alone
123
treatment when both elicitors were added in the medium, (Fig. 5B, F=9.87, p<0.01). This
indicates that as expected, JA plays important role in PIN2 induction; however, ET negatively
regulates PIN2 expression through an antagonistic interaction.
In addition to PIN2 expression, we also examined PPOF, ERF1 and PR1 expression in
the MS medium grown seedlings. Polyphenol oxidase (PPOF) plays a defensive role in plant
defense against insects (Bi et al. 1997; Felton et al. 1989; Thipyapong and Steffens 1996). The
results in this study showed that PPOF expression was also significantly decreased by ethephon
treatment, while highly induced by MeJA treatment. Thus ethephon negatively regulated PPOF
expression in a manner similar to PIN2 (Fig. 5C, D).
Previous study showed multiple tomato PR proteins and their corresponding mRNAs are
regulated by salicylic acid and ethylene treatment (Vankan et al. 1995). The ERF1 gene which
play important role in stress response is regulated by ethylene (Nakano et al. 2006; Onate-
Sanchez et al. 2007). Our results showed significant induction of ERF1 and PR1 by ethephon on
def1 mutant and wild type seedlings. The Nr mutant, which is semi-dominant ethylene
insensitive, showed no significantly induction of ERF1 and PR1 expression compared to control.
The wild type RU showed significantly induction of both genes (Fig. 5E, F, G, H). These results
are consistent with a previous study indicating that ethylene and SA positively regulate ERF1
and PR1 expression (Berrocal-Lobo et al. 2002; Huang et al. 2005). MeJA treatment did not
significantly induce either gene, while MeJA and ethephon together produced similar results as
ethephon alone. These results confirmed that ERF1 and PR1 gene are up regulated by ethylene.
JA but not ethylene is required for PIN2 wound-induced expression
124
Because PIN2 is a well-characterized wounding response gene in tomato, we used this as
marker to compare the wounding response in different mutants and after different hormone
treatments. We compared the PIN2 gene expression 24 h after wounding. RNA from untreated
leaves of the wild type RU was used as a reference level to calculate the relative PIN2 expression
across other treatments. The Nr mutant, which has partially reduced ethylene response, showed
significantly greater PIN2 induction after mechanical wounding compared to the wild type RU
plants. The def1 mutant, which lacks a functional octadecanoid pathway, did not show significant
PIN2 induction upon wounding. Its wild type CM showed a significant wounding response
compared to control untreated plants (Fig. 6A; F=23.19, p<0.01).
To investigate the effect of ethephon and MeJA on the systemic wounding response,
plants were sprayed as previously described. After two weeks, the 5th
leaf on plants was
wounded as previous described. Twenty-four hours after mechanical wounding, the PIN2
expression was compared with RU untreated plants. The results showed after ethephon treatment,
the plants still showed a wounding response with induced PIN2 expression compared to
untreated plants. The def1 mutant had still lower PIN2 expression compared to CM plants (Fig.
6B; F=9.78, p<0.01). After MeJA spray the plants showed a normal wounding response. The
PIN2 gene expression on both Nr and def1 mutants and wild type plants was significantly
increased compared to the untreated plants, but no difference among mutants and wild type
plants was observed (Fig. 6C; F=2.10, p<0.179). In this study, the ERF1 gene did not show any
induction upon wounding in both mutants and wild type plants although def1 mutant showed
high ERF1 expression (Fig. 6D; F=110.92, p<0.01) . PR1 gene was up-regulated by mechanical
wounding on def1 mutant, but no induction was observed on the Nr mutant and two wild type
plants (Fig. 6F; F=97.65, p<0.01).
125
Plant hormones in systemic leaves
To understand how the cross interaction of JA and ET affects plant hormones, we
quantified SA and JA on the systemic leaves two weeks after treatment. After ethephon
treatment, the SA levels in the Nr mutant systemic leaves increased 2.6 times compared to the
control plants (Table 2). Wild type RU plants showed a 6.4 fold increase compared to the
control. After ethephon treatment, the SA levels in both the def1 mutant and wild type CM plants
increased ca. 10-fold compared to control plants. While the MeJA treatment did not significantly
increase SA levels in both mutants and wild type systemic leaves. Expectedly, the JA quantity
was significantly increased on systemic leaves compared to ethanol treatment after MeJA
treatment. The ethanol treatment did not show any effect on JA levels. JA levels in the systemic
leaves of the Nr and def1 mutants showed no significant decrease after ethephon treatment;
however, in the RU plants, JA was reduced after ethephon treatment compared to control plants.
However, JA in CM plants was not reduced by ethephon treatment (Table 2).
Discussion
The plant hormones SA, JA and ET are known to play the important signaling roles in
local and systemic plant defense insect herbivores (Howe 2004; Onkokesung et al. 2010).
Among them, JA signaling plays a prominent role in promoting plant defense responses to many
herbivores (Bodenhausen and Reymond 2007; Cooper and Goggin 2005; McConn et al. 1997).
Other hormones such as SA and ET may interact with JA in regulating plant defense (Adie et al.
2007a; Beckers and Spoel 2006; Campos et al. 2009; Wasternack et al. 2006). Both positive and
negative effects of ET on JA regulated responses have been observed (O'Donnell et al. 1996;
Stotz et al. 2000).
126
Our results confirm the role of JA in defense against the caterpillar H. zea. Caterpillar
growth was significantly increased on the def1 mutant compared with the wild type plants.
Pretreatment of tomato plants with MeJA significantly decreased H. zea growth on both mutants
and wild type plants. The MeJA treatment rescued def1 mutant resulting in increased resistance
to the insect herbivore. Larval growth on the Nr mutant was not affected compared to the wild
type plants, but pretreatment with ethephon compromised resistance to H. zea in both Nr and
wild type plants. This antagonistic interaction has also been reported in other plants such as a
previous study showing that pretreatment of Arabidopsis with ethephon, elevated susceptibility
to generalist insects including the Egyptian cotton worm (Stotz et al. 2000). Ethylene negatively
regulated local expression of lectin GS-II in Griffonia simplicifolia, which inhibited insect
growth and development (Zhu-Salzman et al. 1998). Ethylene also negatively regulates JA-
induced nicotine biosynthesis and reduced direct plant defenses (Kahl et al. 2000). In contrast
maize blocking ethylene synthesis and perception in maize resulted in plants more susceptible to
caterpillar feeding (Harfouche et al. 2006; Ankala et al. 2009). These studies suggest that the role
and outcome of ET in defense may depend on the specific plant-herbivore system being studied.
Glandular trichomes are an important component of the defended phenotype of many
plants. Trichome density is regulated by jasmonates, brassinosteroids and ethylene (Boughton et
al. 2005; Campos et al. 2009; Tian et al. 2012). JA plays a positive role in glandular trichome
induction in different plant species (Peiffer et al. 2009; Rasmann et al. 2012; Traw and Bergelson
2003; van Schie et al. 2007). In this study, the def1 mutant with JA deficiency showed
significantly trichome reduction compared to its wild type CM plants; while the Nr mutant did
not show any trichome reduction compared to wild type RU plants although the ethylene
perception was partially blocked. JA significantly induced glandular trichomes on systemic
127
leaves, while ethylene did not affect tomato glandular trichome density. There are different
reports on ET function in regulating trichome formation; for example in Arabidopsis ET inhibits
trichome formation on stems and leaves (Gibson 2003), while another study showed ET
positively regulated plant cell division and increased trichome initiation and development
(Kazama et al. 2004). Exogenous application of ET has been found to increase the branch
number in cucumber trichomes and increased ethylene synthesis has been correlated with
trichome branching (Plett et al. 2009b). Differences in these studies may be due to specific plant
species or differences in application rates and timing. Ethylene may regulate non-glandular
trichome branching, but we did not examine its possible effect on these trichomes.
Plants respond to wounding or insect herbivory by activating a series of wound-
responsive defensive genes (Baldwin et al. 2001; Bergey et al. 1999; Chen et al. 2004; Heinrich
et al. 2011). Jasmonates are recognized as essential signals in this process (Gfeller et al. 2010).
As expected, we observed lower expression of PIN2 in the def1 mutant compared to CM plants.
Wounding did not induce significant PIN2 expression in the def1 mutant compared to wild type
CM plants. Nr, which is an ethylene insensitive mutant, showed normal constitutive and wound-
induced PIN2 expression as the wild type RU plants. This confirmed that JA, but not ET is
required for the wounding response. The wounding response in systemic leaves was also
affected by ethephon and MeJA treatment. Not surprisingly, the MeJA treatment restored the
def1 mutant to a normal wounding response. The ethephon treatment decreased the wound-
inducible PIN2 gene expression in systemic leaves. Similar study also found ethylene treatment
reduced proteinase inhibitor 1(PIN1) gene expression in tomato (Diaz et al. 2002).
However a synergistic interaction of ET and JA in the regulation of proteinase inhibitor
genes has been shown in some instances (Adie et al. 2007b; O’donnell et al. 1996). Our study
128
showed MeJA application induced PIN2 gene expression in systemic leaves, while ethephon
treatment decreased PIN2 gene expression in these leaves. The assays conducted with seedlings
grown on MS medium showed the same trend of PIN2 gene expression as the spray treatment.
Polyphenol oxidase F (PPOF) was similarly up-regulated by MeJA treatment and down-
regulated by ethephon treatment. Thus our results contradict some of these previous reports
indicating that wound-induced PIN2 gene expression depends on both JA and ET (O’donnell et
al. 1996). In those experiments, specific inhibitors or elicitors, which regulate ET on plants,
were applied to leaves and gene expression on local leaves was quantified after wounding,
whereas in our study we focused on PIN2 expression in systemic leaves. Also in some cases the
methods were different: in our study we used 3 mM ethephon spray on the plants, whereas some
previous studies incubated plants in gas tight chambers with ethylene for a short time before
wounding plants. The method of gene expression analysis may also have affected the results; in
our study, we used quantitative RT-PCR to quantify the gene expression change upon treatment
rather than northern blots or semi-quantitative RT-PCR.
The ethylene response factor 1 (ERF1) acts as a positive regulator of JA and ET signaling
and has been shown to play an important role in mediating defense responses in Arabidopsis
(Lorenzo et al. 2003). The expressions of ERF1 and the SA-regulated PR1 genes in the MS
media-grown seedlings were not significantly induced by MeJA treatment, but were significantly
induced by ethephon treatment. We did not find ERF1 to be induced by our method of
mechanical wounding in both tested plants. The def1 mutant showed high constitutive ERF1
expression compared with wild type plants. Over all in this study, the ethephon treatment
induced ERF1 expression and decreased the PIN2 wounding response. This reduction is
consistent with a previous report that ERF1 represses wound-responsive PDF1.2 gene in
129
Arabidopsis (Lorenzo et al. 2003). PR1 transcripts are regulated by high levels of SA and
pathogen attack in tomato plants (Tornero et al. 1997), but the effect of wounding on PR1
expression was not previously reported. In this study, the Nr mutant and wild type plants did not
show PR1 induction by mechanical wounding, while this gene was induced by wounding in the
def1 mutant. Because the def1 mutant is deficient of JA biosynthesis, the lack of JA as a negative
SA regulator may explain the induction of PR1. This current study is consistent with previous
studies of ERF1 and PR1genes that were shown to be up regulated by ethylene response (Cole et
al. 2004; Lorenzo et al. 2003).
Significant progress has been made in identifying the key components and understanding
the interactive roles of SA, JA and ET in plant responses (Abe et al. 2011; Kniskern et al. 2007;
Leon-Reyes et al. 2009). In this study, we showed that ethephon treatments significantly
increased SA levels in systemic leaves and decreased JA levels in systemic leaves. Significant
ERF1 and PR1 gene induction was observed when SA levels were increased by ethephon
treatment. Our results confirm that the JA pathway plays the main role in plant defense against
H. zea. JA positively regulated PIN2 gene expression and glandular trichome density, but ET
positively regulated SA biosynthesis and response with the induction of ERF1 and PR1 gene
expression. Whereas ET frequently interacts synergistically with JA to mediate insect resistance
in some plant species, we found that ET inhibited induced resistance against the tomato
fruitworm through decreasing the JA response as observed by decreased PIN2 and PPOF gene
expression and insect bioassays.
130
Table 1. Primers used for real-time PCR assays of relative expression
Primer
name
Gene Name/ Accession number Primer sequence (5'-3’)
PIN2 Wound inducible proteinase inhibitor 2
/ K03291
GGA TTT AGC GGA CTT CCT TCT G
ATG CCA AGG CTT GTA CTA GAG AAT G
PPOF Polyphenol oxidase
/z12837
ACT TTC ACG CGG TAA GGG TTA CGA
ATG TGG ACA GGA TGT GGA ACG AGT
PR1 Pathogenesis related gene1
/NM 001247429
GTC CCC AGC TGT TTG ATT GG
TTG GAT TCG GTC CTA TGA CAT G
ERF1 Ethylene response factor1
/EU395634
AATGGAATTAGGGTTTGGTTAGGAA
GACCAAGGACCCCTCATTGA
Ubi Ubiquitin
/ X58253
GCC AAG ATC CAG GAC AAG GA
GCT GCT TTC CGG CGA AA
131
Table2 Salicylic acid and JA affected by MeJA and Ethephon
132
Salicylic acid (ng/gm fresh weight) JA(ng/gm fresh weight)
Control Ethephon EtOH MeJA Control Ethephon EtOH MeJA
Nr 11.33±2.27cd 29.83±7.67b 10.70±2.32cd 9.58±2.95cd 23.76±1.94c 15.25±4.12c 21.50±1.61c 283.63±45.26b
RU 12.54±3.92c 73.95±8.14a 8.64±2.76d 15.80±1.09c 20.34±2.88c 8.70±1.78c 19.98±2.12c 278.59±32.32b
def1 6.32±2.85d 66.97±11.36a 9.41±1.23cd 10.28±3.58cd 11.13±1.14c 6.44±1.87c 12.38±1.31c 384.62±43.67a
CM 8.90±1.38d 67.72±13.02a 7.22±2.21d 12.71±4.57c 19.17±4.32c 7.28±2.24c 19.37±2.39c 490.62±51.78a
133
FIGURE LEGENDS
Fig. 1. Tomato growth affected by MeJA and ethephon treatment. A.) MeJA and ethephon
reduce tomato height B.) Wild type RU seedling growth by different treatment C.) Hypocotyl
length was affected by different treatment D.) Root length of different mutant and affected by
ethephon, MeJA and combined treatment. Each data point represents the mean±SE of twenty
plants. Means followed by different letters are significantly different at P= 0.05.
Fig. 2. MeJA and ethephon treatment induce trichome number on systemic leaves. A.)
Glandular trichome number on Nr mutant and its wild type leave and affected by ethephon and
MeJA treatment. B.) Glandular trichome number on def1 mutant and its wild type CM leaves
and affected by ethephon and MeJA. Each data point represents the mean±SE of twenty leaves.
Means followed by different letters are significantly different at P= 0.05.
Fig. 3. MeJA and Ethephon affect H. zea growth and neonates’ choice A.) Artificial diet with
MeJA and Ethephon didn’t affect insect growth B.) Ethephon treated leaves increase H. zea
growth C.) MeJA treated leaves reduce H. zea growth. Each data point represents the mean±SE
of thiry insects. Means followed by different letters are significantly different at P= 0.05.
Fig. 4. Chemical elicitors spray affects gene expression A.) PIN2 expression on leaves was
reduced by ethephon treatment B.) PIN2 expression was highly induced by MeJA spray
treatment. Each data point represents the mean±SE of three replicates. Means followed by
different letters are significantly different at P= 0.05.
Fig. 5. MS medium grown seedlings gene expression affected by elicitor treatment A,B) PIN2
gene expression affected by ethephon and MeJA. C,D) PPOF expression affected by treatment.
E,F) PR1 expression, G,H) ERF1 expression. Each data point represents the mean±SE of three
replicates. Means followed by different letters are significantly different at P= 0.05.
Fig. 6. Gene expression affected by wounding A) PIN2 expression by wounding on control
plants B) PIN2 expression by wounding on ethephon treated plants. C) PIN2 expression by
wounding on MeJA treated plants. D) ERF1 expression not induced by wounding. E) PR1
expression by wounding. Each data point represents the mean±SE of three replicates. Means
followed by different letters are significantly different at P= 0.05.
134
135
136
137
138
Fig. 5.
138
Fig. 6.
139
Reference
Abe H, Tomitaka Y, Shimoda T, Seo S, Sakurai T, Kugimiya S, Tsuda S, Kobayashi M (2011)
Antagonistic plant defense system regulated by phytohormones assists interactions
among vector insect, thrips, and a tospovirus. Plant and Cell Physiology 10:1093
Adie B, Chico JM, Rubio-Somoza I, Solano R (2007a) Modulation of plant defenses by
ethylene. Journal of Plant Growth Regulation 26: 160-177
Adie B, Pérez-Pérez J, Pérez-Pérez MM, Godoy M, Sánchez-Serrano J-J, Schmelz EA,
Solano R (2007b) ABA is an essential signal for plant resistance to pathogens affecting
JA biosynthesis and the activation of defenses in Arabidopsis. The Plant Cell 19: 1665-
1681
Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores
and plant fitness. Ecology 80: 1713-1723
Ament K, Kant MR, Sabelis MW, Haring MA, Schuurink RC (2004) Jasmonic acid is a key
regulator of spider mite-induced volatile Terpenoid and methyl salicylate emission in
tomato. Plant Physiol. 135: 2025-2037
An LZ, Xu XF, Tang HG, Zhang MX, Hou ZD, Liu YH, Zhao ZG, Feng HY, Xu SJ, Wang XL
(2006) Ethylene production and 1-aminocyclopropane-1-carboxylate (ACC) synthase
gene expression in tomato (Lycopersicon esculentum Mill.) leaves under enhanced UV-B
radiation. Journal of Integrative Plant Biology 48: 1190-1196
Ankala A, Luthe DS, Williams WP and Wilkinson (2009) Integration of ethylene and jasmonic
acid signaling pathways in the expression of maize defense protein Mir 1-CP. Molecular
Plant-Microbe Interactions 22:1555-1564
Baldwin IT, Halitschke R, Kessler A, Schittko U (2001) Merging molecular and ecological
approaches in plant-insect interactions. Current Opinion in Plant Biology 4: 351-358
Beckers GJM, Spoel SH (2006) Fine-tuning plant defence signalling: Salicylate versus
jasmonate. Plant Biology 8: 1-10
Bergey DR, Orozco-Cardenas M, de Moura DS, Ryan CA (1999) A wound- and systemin-
inducible polygalacturonase in tomato leaves. Proc Natl Acad Sci USA 96: 1756-1760
Berrocal-Lobo M, Molina A, Solano R (2002) Constitutive expression of ETHYLENE-
RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi.
Plant J 29: 23-32
Bi JL, Murphy JB, Felton GW (1997) Antinutritive and oxidative components as mechanisms of
induced resistance in cotton to Helicoverpa zea. J. Chem. Ecol. 23: 97-117
Bodenhausen N, Reymond P (2007) Signaling pathways controlling induced resistance to
insect herbivores in Arabidopsis. Molecular Plant-Microbe Interactions 20: 1406-1420
Bostock RM (2005) Signal crosstalk and induced resistance: Straddling the line between cost
and benefit. Annual Review of Phytopathology 43: 545-580
Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased
densities of glandular trichomes on tomato, Lycopersicon esculentum. Journal of
Chemical Ecology 31: 2211-2216
Browse J (2009) Jasmonate passes muster: A receptor and targets for the defense hormone.
Annual Review of Plant Biology 60: 183-205
Campos ML, de Almeida M, Rossi ML, Martinelli AP, Litholdo CG, Figueira A, Rampelotti-
140
Ferreira FT, Vendramim JD, Benedito VA, Peres LEP (2009) Brassinosteroids interact
negatively with jasmonates in the formation of anti-herbivory traits in tomato. Journal of
Experimental Botany 60: 4346-4360
Chandok MR, Ekengren SK, Martin GB, Klessig DF (2004) Suppression of pathogen-inducible
NO synthase (iNOS) activity in tomato increases susceptibility to Pseudomonas syringae.
Proc Natl Acad Sci USA 101: 8239-8244
Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004) Regulation of plant arginase by
wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem 279: 45998-46007
Chippendale GM (1970) Metamorphic changes in fat body proteins of the southwestern corn
borer, Diatraea grandiosella. Journal of Insect Physiology 16: 1057-1068
Cole AB, Kiraly L, Lane LC, Wiggins BE, Ross K, Schoelz JE (2004) Temporal expression of
PR-1 and enhanced mature plant resistance to virus infection is controlled by a single
dominant gene in a new Nicotiana hybrid. Mol Plant Microbe Interact 17: 976-985
Cooper WR, Goggin FL (2005) Effects of jasmonate-induced defenses in tomato on the potato
aphid, Macrosiphum euphorbiae. Entomologia Experimentalis et Applicata 115: 107-115
Diaz J, ten Have A, van Kan JAL (2002) The role of ethylene and wound signaling in
resistance of tomato to Botrytis cinerea. Plant Physiol. 129: 1341-1351
Duffey SS (1986) Plant glandular trichomes: their partial role in defence against insects. In:
Juniper BE, Southwood TE (eds) Insects and the plant surface Arnold, London, England,
pp 151-172
Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions.
Trends in plant science 17: 250-259
Fan J, Hill L, Crooks C, Doerner P, Lamb C (2009) Abscisic acid has a key role in modulating
diverse plant-pathogen interactions. Plant Physiol 150: 1750-1761
Felton GW, Broadway RM, Duffey SS (1989) Inactivation of protease inhibitor activity by
plant-derived quinones complications for host-plant resistance against noctuid herbivores.
Journal of Insect Physiology 981–990
Felton GW, Korth KL, Bi JL, Wesley SV, Huhman DV, Mathews MC, Murphy JB, Lamb C,
Dixon RA (1999) Inverse relationship between systemic resistance of plants to
microorganisms and to insect herbivory. Current Biology 9: 317-320.
Gfeller A, Liechti R, Farmer EE (2010) Arabidopsis jasmonate signaling pathway. Sci Signal 3:
cm3
Gibson S (2003) Ethylene inhibits trichome formation on stems and brancing on leaves.
International conference. 14: 501707200
Halitschke R, Stenberg JA, Kessler D, Kessler A, Baldwin IT (2008) Shared signals - 'alarm
calls' from plants increase apparency to herbivores and their enemies in nature. Ecology
Letters 11: 24-34
Harfouche AL, Shivaji R, Stocker R, Williams PW, Luthe DS (2006) Ethylene signaling
mediates a maize defense response to insect herbivory. Molecular Plant-Microbe
Interactions 19: 189-199
Heinrich M, Baldwin IT, Wu J (2011) Two mitogen-activated protein kinase kinases, MKK1
and MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca
sexta-induced responses in Nicotiana attenuata. Journal of Experimental Botany 62:
4355-4365.
Horgan FG, Quiring DT, Lagnaoui A, Pelletier Y (2009) Effects of altitude of origin on
trichome-mediated anti-herbivore resistance in wild Andean potatoes. Flora 204: 49-62
141
Howe GA (2004) Jasmonates as signals in the wound response. Journal of Plant Growth
Regulation 23: 223-237
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant
Biology 59: 41-66
Huang Z, Yeakley JM, Garcia EW, Holdridge JD, Fan JB, Whitham SA (2005) Salicylic acid-
dependent expression of host genes in compatible Arabidopsis-virus interactions. Plant
Physiol 137: 1147-1159
Kahl J, Siemens DH, Aerts RJ, Gabler R, KA hnemann F, Preston CA, Baldwin IT (2000)
Herbivore-induced ethylene suppresses a direct defense but not a putative indirect
defense against an adapted herbivore. Planta 210: 336-342
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010) Distortion of trichome morphology by
the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental
Botany 61: 1053-1064
Kazama H, Dan H, Imaseki H, Wasteneys GO (2004) Transient exposure to ethylene stimulates
cell division and alters the fate and polarity of hypocotyl epidermal cells. Plant
Physiology 1614-1623
Kessler A, Halitschke R, Poveda K (2011) Herbivory-mediated pollinator limitation: negative
impacts of induced volatiles on plant-pollinator interactions. Ecology 92: 1769-1780
Kniskern JM, Traw MB, Bergelson J (2007) Salicylic acid and jasmonic acid signaling defense
pathways reduce natural bacterial diversity on Arabidopsis thaliana. Molecular Plant-
Microbe Interactions 20: 1512-1522
Koiwa H, Shade RE, Zhu-Salzman K, Subramanian L, Murdock LL, Nielsen SS, Bressan RA,
Hasegawa PM (1998) Phage display selection can differentiate insecticidal activity of
soybean cystatins. Plant Journal 14: 371-379
Leon-Reyes A, Spoel SH, De Lange ES, Abe H, Kobayashi M, Tsuda S, Millenaar FF,
Welschen RAM, Ritsema T, Pieterse CMJ (2009) Ethylene modulates the role of NPR1
in cross-talk between salicylate and jasmonate signaling. Plant Physiol.108.133926
Li L, Zhao YF, McCaig BC, Wingerd BA, Wang JH, Whalon ME, Pichersky E, Howe GA
(2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the
maternal control of seed maturation, jasmonate-signaled defense responses, and glandular
trichome development. Plant Cell 16: 126-143
Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE
FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense.
The Plant Cell 15: 165-178
Mantelin S, Kishor KB, Isgouhi K (2009) Ethylene contributes to potato aphid susceptibility in a
compatible tomato host. New Phytologist 444–456
Martinez de Ilarduya O, Xie Q, Kaloshian I (2003) Aphid-induced defense responses in Mi-1-
mediated compatible and incompatible tomato interactions. Mol Plant Microbe Interact
16: 699-708
McConn M, Creelman RA, Bell E, Mullet JE, Browse J (1997) Jasmonate is essential for insect
defense Arabidopsis. Proc Natl Acad Sci USA 94: 5473-5477
Melotto M, Mecey C, Niu Y, Chung HS, Katsir L, Yao J, Zeng WQ, Thines B, Staswick P,
Browse J, Howe GA, He SY (2008) A critical role of two positively charged amino acids
in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl
isoleucine-dependent interactions with the COI1F-box protein. Plant Journal 55: 979-988
Navarro L (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin
142
signaling. Science 312: 436-439
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006). Genome-wide analysis of the ERF gene
family in Arabidopsis and rice. Plant Physiology 2006;140:411-432.
O’Donnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as
a signal mediating the wound response of tomato plants. Science 274: 1914-1917
Onate-Sanchez L, Anderson JP, Young J, Singh KB (2007). AtERF14, a member of the ERF
family of transcription factors plays a nonredundant role in plant defense. Plant Physiol.
143: 400-409.
Onkokesung N, Galis I, von Dahl CC, Matsuoka K, Saluz H-P, Baldwin IT (2010) Jasmonic
acid and ethylene modulate local responses to wounding and simulated herbivory in
Nicotiana attenuata leaves. Plant Physiol. 153: 785-798
Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary
glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113
Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as
sensors for insect herbivores. New Phytologist 184: 644-656
Pieterse CM, van Wees SC, van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, van
Loon LC (1998) A novel signaling pathway controlling induced systemic resistance in
Arabidopsis. The Plant Cell 10: 1571-1580
Pieterse CMJ, Dicke M (2007) Plant interactions with microbes and insects: from molecular
mechanisms to ecology. Trends in Plant Science 12: 564-569
Plett JM, Mathur J, Regan S (2009) Ethylene receptor ETR2 controls trichome branching by
regulating microtubule assembly in Arabidopsis thaliana. Journal of Experimental Botany
60: 3923-3933
Rasmann S, De Vos M, Casteel CL, Tian DL, Halitschke R, Sun JY, Agrawal AA, Felton GW,
Jander G (2011) Herbivory in the previous generation primes plants for enhanced insect
resistance. Plant Physiol. 158(2):854-63
Reymond P, Weber H, Damond M, Farmer EE (2000) Differential gene expression in response
to mechanical wounding and insect feeding in Arabidopsis. The Plant Cell 12: 707-720
Rojo E, León J, Sánchez-Serrano JJ (1999) Cross-talk between wound signalling pathways
determines local versus systemic gene expression in Arabidopsis thaliana. The Plant
Journal 20: 135-142
Ryan CA, An G, Thornburg RW, Lee J, Fox E, Pearce G (1986) Activation of plant defense
genes by wound signals. Journal of Cellular Biochemistry: 3-3
Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH,
3rd (2003) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic
compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557
Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses jasmonate-induced gene
expression in nicotine biosynthesis. Plant and Cell Physiology 41: 1072-1076
Stotz HU, Pittendrigh BR, Kroymann J, Weniger K, Fritsche J, Bauke A, Mitchell-Olds T (2000)
Induced plant defense responses against chewing insects. Ethylene signaling reduces
resistance of Arabidopsis against Egyptian cotton worm but not diamondback moth. Plant
Physiol 124: 1007-1017
Tian D, Peiffer M, Shoemaker E, Tooker J, Haubruge E, Francis F, Luthe DS, Felton GW
(2012a) Salivary Glucose Oxidase from Caterpillars Mediates the Induction of Rapid and
Delayed-Induced Defenses in the Tomato Plant. PLoS ONE 7: e36168
Tian D, Tooker J, Peiffer M, Chung S, Felton G (2012b) Role of trichomes in defense against
143
herbivores: comparison of herbivore response to woolly and hairless trichome mutants in
tomato (Solanum lycopersicum). Planta: 1-14
Thaler JS, Agrawal AA, Halitschke R (2010) Salicylate-mediated interactions between
pathogens and herbivores. Ecology 91: 1075-1082
Thaler JS, Humphrey PT, Whiteman NK (2012) Evolution of jasmonate and salicylate signal
Cross-talk. Trends in plant science 17: 260-270
Thipyapong P, Steffens JC (1996) Defensive role of polyphenol oxidases against Pseudomonas
syringae pv tomato. Plant Physiology 111: 791-791
Tooker, JF. and De Moraes CM. 2005. Jasmonate in lepidopteran eggs and neonates. J. Chem.
Ecol. 31: 2753-2759.
Tornero P, Gadea J, Conejero V, Vera P (1997) Two PR-1 genes from tomato are differentially
regulated and reveal a novel mode of expression for a pathogenesis-related gene during
the hypersensitive response and development. Mol Plant Microbe Interact 10: 624-634
Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin
on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375
van Poecke RMP, Dicke M (2002) Induced parasitoid attraction by Arabidopsis thaliana:
involvement of the octadecanoid and the salicylic acid pathway. Journal of Experimental
Botany 53: 1793-1799
van Schie CCN, Haring MA, Schuurink RC (2007) Tomato linalool synthase is induced in
trichomes by jasmonic acid. Plant Molecular Biology 64: 251-263
Vankan JAL, Cozijnsen T, Danhash N, Dewit P (1995) Induction of tomato stress protein
mRNAs by ethephon, 2,6-dichloroisonicotinic acid and salicylate. Plant Molecular
Biology 27: 1205-1213
Vera P, Conejero V (1990) Effect of ethephon on protein degradation and the accumulation of
`pathogenesis-related' (PR) proteins in tomato leaf discs. Plant Physiology 92: 227-233
Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant Immunity: It’s the hormones talking,
but what do they say? Plant Physiology 154: 536-540
Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,
Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant
Physiology 163: 297-306
Yang SF, Hoffman NE (1984) Ethylene biosynthesis and its regulation in higher plants.
Annual Review of Plant Physiology 35: 155-189
Yasuda M, Nakashita H, Hasegawa S, Nishioka M, Arai Y, Uramoto M, Yamaguchi I, Yoshida
S (2003) N-cyanomethyl-2-chloroisonicotinamide induces systemic acquired resistance
in arabidopsis without salicylic acid accumulation. Biosci Biotechnol Biochem 67: 322-
328
Zhang L, Jia C, Liu L, Zhang Z, Li C, Wang Q (2011) The involvement of jasmonates and
ethylene in Alternaria alternata f. sp. lycopersici toxin-induced tomato cell death. Journal
of Experimental Botany 62: 5405-5418
Zhang Y, Xu S, Ding P, Wang D, Cheng YT, He J, Gao M, Xu F, Li Y, Zhu Z, Li X, Zhang Y
(2010) Control of salicylic acid synthesis and systemic acquired resistance by two
members of a plant-specific family of transcription factors. Proc Natl Acad Sci USA 107:
18220-18225
Zhao Y (2003) Virulence systems of Pseudomonassyringae pv. tomato promote bacterial speck
disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499
Zhu-Salzman K, Salzman RA, Koiwa H, Murdock LL, Bressan RA, Hasegawa PM (1998)
144
Ethylene negatively regulates local expression of plant defense lectin genes. Physiologia
Plantarum 104: 365-372
Zsogon A, Lambais MR, Benedito VA, Figueira AVD, Peres LEP (2008) Reduced arbuscular
mycorrhizal colonization in tomato ethylene mutants. Scientia Agricola 65: 259-267
145
Appendix: Herbivory in the previous generation primes tomato for induced defense
Introduction
As sessile organisms, plants have evolved diverse strategies to continuously adjust their
responses to a broad range of abiotic and biotic stresses including herbivore challenges. The
mechanisms of induced plant defense have been well studied (Ryan et al. 1986; Walling 2000;
Wasternack et al. 2006). To avoid the herbivore attack, plants must immediately respond to the
challenges with various defense strategies (Green and Ryan 1972). Among the strategies, the
synthesis of the secondary metabolites in plants is a powerful chemical weapon because they
often function as toxins to inhibit the herbivore's nutrition and growth (Lawrence et al. 2008;
Maffei et al. 2007). Besides these chemicals weapons, plants also attract predators and
parasitoids of the herbivore through the release of volatile organic compounds (VOCs) (Arimura
et al. 2005). Trichomes are an example of physical defenses and may be inducible in some plants
such as tomato (Kang et al. 2010). Transgenerational plant defense means the offspring’s defense
traits are acquired by the adult parent; in other words the adaptation of the maternal effects
responding to the environment can improve the fitness and immunity traits of the offspring.
Several studies have examined the contribution of maternal stress to offspring’s phenotype and
fitness (Agrawal 2001; Slaughter et al. 2011).
Tomato (Solanum lycopersicum), as a model to study plant defense, had been
extensively studied (Arimura et al. 2005; Liechti et al. 2006; Wasternack et al. 2006). To test
whether the progeny of tomato plants exposed to herbivory or MeJA treated are more resistant to
herbivores than those of undamaged naïve plants. We used Micro-Tom tomato and Helicoverpa
146
zea (H. zea) as a model to study whether insect fed or MeJA treatment could produce the
progeny, which have more resistance.
Materials and methods
Plants and insects
Tomato seeds (cv. micro-tom , originally purchased from Tomato Growers Supply Co,
Fort Myers, FL.) were grown as described (Peiffer and Felton 2005), in Metromix 400 potting
mix (Griffin Greenhouse & Nursery Supplies Tewksbury, MA) in greenhouse at Penn State
University, University Park, PA, USA). The greenhouse was maintained on a 16-h photoperiod.
For all induction experiments, plants were maintained in the greenhouse under 800W Super
Spectrum lights (Sunlight Supply Co., Vancouver, WA). The H. zea eggs were purchased from
BioServ (Frenchtown, NJ) and reared on a wheat germ and casein-based artificial diet
(Chippendale 1970) with ingredients from Bioserv in the Entomology Department, Penn State
University (University Park PA, USA).
Tomato leaf and fruit induced defense by MeJA
To compare the long term induced defense MeJA on leaf and fruit. When plants have
small fruits, we use 2.5mM MeJA in 0.8% ethanol spray on tomato plants. The control is no
spray and spray with 0.8% ethanol. After 10 days spray took the leaves and fruit stages for
bioassay. Neonates fed on artificial diet for one day and then transfer on the leaf to feed for 6
days in the cup. Compare the insect weight by precision balance.
At same time 50mg leaves and fruits were separately sampled for polyphenol oxidase
(PPO) assay and 100mg tissue for gene expression assay. PPO assay was followed by Felton
(1992) described. Briefly described as grind tissue in liquid nitrogen and immediately extract by
0.1M KPO4 with 5% PVPP, sit on ice for 5minutes and centrifuge at 4 ºC for 10minutes.
147
Immediately measure the absorbance at 450nm of the reaction with 5µl sample and 200µl 3M
caffeic acid. The activity was expressed as OD/min/mg tissue.
Transgenerational induced defense
Previous studies showed insects feeding or mechanical damage induced the plant defense.
To investigate the effect of parent plants treatment on next generational defense, we challenged
the parent plants with H. zea fed, mechanical wound or MeJA treatment. Six week old plants
(flower stage/fruit) were challenged by 4th
instar H. zea randomly feeding for three days or
mechanically wound small fruit. 2.5mM MeJA sprayed on plants as MeJA treatment. Harvest
damaged or sprayed fruits and get seeds for F1 seeding trichome, bioassay and wounding
response experiments. Neonates fed on artificial diet for one day and then transfer on the leaf to
feed for 4 days in the cup. Compare the insect weight by precision balance.
When seedling had 4 fully expanded leaves, glandular trichomes were count on the upper
side of the 4th
leaf. Two leaf disks (0.6 cm diameter) were punched out beside the mid-vein.
Numbers of type VI trichomes were counted using a dissecting scope. We mechanically wound
the 4th
leaf to compare the defensive response in the next generation plants. After 24 hours
wound, the leaf were sampled for RNA extraction and quantitative RT- PCR.
Results and Discussion
The inducible defenses are regulated by plant hormones (Berger and Altmann 2000; Erb
et al. 2009), such as jasmonic acid (JA), which is rapidly synthesized from a fatty acid precursor
following herbivore attack. JA regulated defenses play a key role in the induction of plant
defenses against chewing herbivores. Exogenous application of MeJA also induces a series of
defense responses (Singh et al. 2008). In tomato, JA-response proteins include proteinase
inhibitor 2 (PIN2) and polyphenol oxidase (PPO) (Angelini et al. 2008; Wasternack et al. 2006).
148
It has been shown that their induced gene expression is correlated with enhanced abundance of
their protein products, which inhibit insect growth. In this experiment, two weeks after we
sprayed plants with 2.5mM MeJA at the flowering/ green fruit stage, the bioassay with leaves
and fruits showed significantly reduced H. zea growth compared to control plants (F=31.41,
p<0.01) (Fig. 1a). MeJA treatment significantly induced polyphenol oxidase (PPO) activity
compared with the control plants on both leaves and fruits (Fig. 1b). Gene expression of PIN2
showed that the MeJA could induce the expression on both leaves and fruits (Fig. 1c). It is
confirmed that the induced protein activity and gene expression is correlated with enhanced
abundance of their protein products, which inhibit insect growth.
Transgenerational plant defense means that the offspring’s immunity traits are acquired
by the adult parent; in other words the adaptation of the maternal effects responding to the
environment can improve the fitness and immunity traits of the offspring. Several studies have
examined the contribution of maternal stress to offspring’s phenotype and fitness. Agrawal and
colleagues used wild radish (Raphanus raphanistrum L. brassicacease) and insect herbivory as
model to examine induced defenses in next generation, and they found insect feeding on the
maternal wild radish caused progeny to be more resistant than progeny from unfed wild radish
(Agrawal 1999). Field experiments showed that plants exposed to herbivory in the early season
had 60% higher relative fitness than un-exposed controls (Agrawal 1999). In some instances, the
offspring of the damaged plants showed higher numbers of trichomes compared to the offspring
from their undamaged parents (Agrawal 2001). A similar phenomenon was also observed in the
progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to
herbivores (Holeski 2007). Transgenerational induction of high trichome density could confer a
149
selective advantage, if offspring are likely to experience the same herbivore pressure as their
parents.
In this study, after plants were challenged by insects or MeJA treatment, the plants were
allowed to continue growth and produce seeds for the next generation (F1). These seeds were
planted to test their response to insect feeding. At the 4th
leaf stage, the 4th
leaves were used to do
bioassays with neonates to identify the inherited increase in herbivore resistance. All three
treatment decreased growth of H. zea on the progeny of treated tomato plants by about 40%
relative to controls (Fig. 2a, F=11.269, p<0.001). Preliminary experiments also showed that the
small amount of ethanol used to dissolve MeJA for elicitation experiments has no subsequent
herbivory.
At 4th
leaf stage, the top fully expanded leaf glandular trichomes were counted using a
dissecting microscope. The result showed the glandular trichomes number on the progeny of
parent plants treated with MeJA or H. zea feeding, increased significantly compared to untreated
plants (Fig. 2b F=6.61, p<0.001). These results were consistent with the previous study on wild
radish and monkey flower. Both studies provide strong evidence that transgenerational defense
can be induced by herbivory or MeJA treatment.
In another experiment to determine if MeJA could prime F1 plants to respond more
rapidly to wounding, at the 4th
leaf stage, mechanical wounded the 4th
leaf on F1 plants whose
parents were treated with MeJA. Twenty-four hours after wounding, the wounded leaf was
assayed for the expression of proteinase inhibitor 2 (PIN2) using quantitative Reverse
Transcription PCR (qRT-PCR). The wounded leaf from the MeJA treatment showed the highest
level of PIN2 expression and was significantly higher than all other treatments (Fig. 2c). These
results indicate that the induced transgenerational defense is likely to result from a combination
150
of increased trichome density and more potent defensive responses to herbivore or wounding.
These results are consistent with recent work (Luna et al. 2011; Slaughter et al. 2011)
demonstrated a similar transgenerational resistance phenomena in response to priming-inducing
by plant pathogens, salicylic acid (SA) or beta-aminobutyric acid (BABA). Both of these
findings demonstrate that the induced defense can be transmitted to following generation.
Transgenerational defense is heritable, transient and potentially regulated by epigenetic
modifications, while the short-term induced defense is reversible when the stress is removed.
Taken together, transgenerational stress immunity may provide a novel and useful tool for crop
management and protection (Rasmann et al. 2012).
151
Figure 1 . Induced defense by MeJA on leaf and fruits a) No-choice bioassay of H. zea
growth affected by MeJA on leaf and fruits. b) PPO activity affect by MeJA treatment c) PIN2
expression affected by MeJA treatment on leaf d) PIN2 expression affected by MeJA treatment
on fruit
152
Figure 2. Transgenerational resistance in tomato a) Helicoverpa zea growth on tomatoes
originating from parents that were either left undamaged (control) or subjected to caterpillar
feeding, MeJA treatment, or mechanical damage. b) Trichome production on F1 tomato leaves.
Trichomes were counted on the upper side of fully expanded 4th
leaf. Plants were originating
from parents that were left undamaged (open bars) or subject to H. zea feeding, MeJA
application or mechanical damage (black bars).c) Effect of wounding on PIN2 gene expression
F1 plants. The parent plants of F1 treated with MeJA. PIN2 measured 24 h after wounding
damage.
153
Reference
Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores
and plant fitness. Ecology 80: 1713-1723
Agrawal AA (2001) Transgenerational consequences of plant responses to herbivory: An
adaptive maternal effect? The American naturalist 157: 555-569
Angelini R, Tisi A, Rea G, Chen MM, Botta M, Federico R, Cona A (2008) Involvement of
polyamine oxidase in wound healing. Plant Physiology 146: 162-177
Arimura G-i, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.
Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111
Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of
stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119
Chippendale G (1970) Development of artificial diets for rearing the Angoumois grain moth.
J.Economic Entomology 63: 844-848
Erb M, Flors V, Karlen D, de Lange E, Planchamp C, D'Alessandro M, Turlings TCJ, Ton J
(2009) Signal signature of aboveground-induced resistance upon belowground herbivory
in maize. Plant Journal 59: 292-302
Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible
defense mechanism against insects. Science 175: 776-777
Holeski LM (2007) Within and between generation phenotypic plasticity in trichome density of
Mimulus guttatus. Journal of Evolutionary Biology 20: 2092-2100
Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010) Distortion of trichome morphology
by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental
Botany 61: 1053-1064
Lawrence SD, Novak NG, Ju CJT, Cooke JEK (2008) Examining the molecular interaction
between potato (Solanum tuberosum) and Colorado potato beetle Leptinotarsa
decemlineata. Botany-Botanique 86: 1080-1091
Liechti R, Gfeller A, Farmer EE (2006) Jasmonate Signaling Pathway. Sci. STKE 2006: cm2-
Luna E, Bruce TJA, Roberts MR, Flors V, Ton J (2011) Next Generation Systemic Acquired
Resistance. Plant Physiology
Maffei ME, Mithofer A, Boland W (2007) Insects feeding on plants: Rapid signals and responses
preceding the induction of phytochemical release. Phytochemistry 68: 2946-2959
Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary
glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113
Ryan CA, An G, Thornburg RW, Lee J, Fox E, Pearce G (1986) Activation of Plant Defense
Genes by Wound Signals. Journal of Cellular Biochemistry: 3-3
Slaughter A, Daniel X, Flors V, Luna E, Hohn B, Mauch-Mani B (2011) Descendants of primed
Arabidopsis plants exhibit resistance to biotic stress. Plant Physiology
Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth
Regulation 19: 195-216.
Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,
Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant
Physiology 163: 297-306
VITA
DONGLAN TIAN
PhD Candidate, Entomology department
501 ASI building, Pennsylvania State University, University Park, PA 16802
Voice: 814-863-2871; Fax: 814-865-3048
E-mail:[email protected]
Professional Preparation
China Agricultural University Agronomy B.S. 1996
University of Illinois at Urbana-Champaign Plant pathology M.S. 2003
Pennsylvania State University Entomology Ph.D. 2012
Appointment
Pennsylvania State University
Ph.D. Research in
Entomology
2006-2012
Pennsylvania State University
Research technician in Plant
Biology
2003-2006
University of Illinois at Urbana-Champaign M.S. Research in Plant
Pathology
2001-2003
Plant Protection Institute, China Academy of
Agricultural Sciences
Research assistant in Plant
Pathology
1996-2001
Publication 1. Tian D, Peiffer M and Felton GW (2012) Herbivore Effector Triggered Immunity? Salivary Glucose
Oxidase Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant. Plos
one April 2012 | Volume 7 | Issue 4 | e36168
2. Tian D, Tooker J, Peiffer M and Felton GW (2012) Role of Trichomes in Defense against
Herbivores: Comparison of Herbivore Response to hl and woolly Mutants in Tomato (Solanum
lycopersicum) Planta :1-14
3. Tian, D, Peiffer M and Felton GW (2012) Roles of Ethylene and Jasmonate on Tomato (Solanum
lycopersicum) Systemic Induced Defense to Helicoverpa zea (Planta, Submitted)
4. Rasmann S, Vos M, Tian D, Felton GW and Jander G (2012) Transgenerational resistance against
insect herbivory requires jasmonates and siRNA synthesis. Plant physiology pp.111.187831
5. Felton GW, Chung S, Hernandez MGE, Louis J and Tian D (2012) Herbivore oral secretions are the
first line of protection against plant induced defense. Annual Plant Reviews
6. Zahn ML, Ma X, Naomi S, Tian D, and Ma H (2010) Comparative transcriptomics among major
shoot organs of the basal eudicot Eschscholzia californica: a reference for comparison with core
eudicots and basal angiosperms. Genome Biology 11:R101
7. Babadoost M, Tian D and Islam SZ and Pavon C (2008) Challenges and Options in Managing
Phytophthora Blight (Phytophthora capsici ) of Cucurbits. Proceedings of IXth Eucarpia p399-406.
8. Naomi A, Leebens MJ, Zahn ML, Tian D, Ma H and dePamphilis C (2006) Behind the Scenes:
Planning a Multi-species microarray experiment. Chance. Vol 19, No 3. P27-38.
9. Babadoost M, Islam SZ, Tian D and Pavon C (2005) Phytophthora Blight (Phytophthora capsici) of
Pepper in Illinois Occurrence and Management. Second World Pepper Convention, Mexico.p6-12.
10. Tian D and Babadoost M (2004) Host range of Phytophthora capsici from pumpkin and
pathogenicity of isolates. Plant Diseases. 88:485 - 489.
11. Tian D and Babadoost M (2003) Analysis genetic variability among isolates of P. capsici using ITS,
ISSR and AFLP techniques. Phytopathology. 93:S84.