The search for pathogens in Ixodes ticks

Nathan Lo School of Biological Sciences, The University of Sydney

Ku-rin-gai Council Public Talk, October 26th, 2015  

21/08/13 6:29 AMNorthern beaches hit with tick outbreak, Palm Beach, Avalon, North Narrabeen worst affected | thetelegraph.com.au

Page 1 of 3http://www.dailytelegraph.com.au/newslocal/northern-beaches/north…valon-north-narrabeen-worst-affected/story-fngr8hax-1226700600362

thetelegraph.com.auNorthern Beaches

Northern beaches hit with tick outbreak, Palm Beach,Avalon, North Narrabeen worst affected

by: Boel ErikssonFrom: Manly DailyAugust 20, 2013 3:25PM

Be The First To Respond

Tick season has started early this year.Source: News Limited

A TICK outbreak is plauging the northern beaches, weeks before the tick season normally starts.

Several residents have told the Manly Daily that local tick numbers appear to be high for August, with theseason usually starting in late September.

Pittwater Animal Hospital senior veterinary Dr Bryn Lynar said they had seen more animals than normalbe brought in showing the effects of paralysis tick poison in the last few weeks.

"We've been seeing more cases around this time than in many years before," he said.

The parasite was prevalent in the Pittwater Council area, he said, with Avalon, Bilgola Plateau, Newport,Bayview, Church Point and North Narrabeen, Palm Beach being the hotspots.

Vicki Hammond said her two-year-old son was recently attacked by ticks at both Manly and Seaforth.

NEW Personalise your news, save articles to read later and customise settings Hi there! Sign-upView Demo Log inBETA

Laura France and her mother Michelle are battling to get her condition recognised. Photo: Newcastle Herald

A six-year-old Newcastle girl is at the centre of a major medical storm over whether a debilitating tick-borne disease exists in Australia.

Read later Comments 31

Donna PageFebruary 20, 2012

Battle for Laura: doctors take on NSW Health over girl'scrippling disease

Ticks are bloodsucking parasites. There are many tickspecies in Australia though the most common species that attacks humans in NSW is the paralysis tick, Ixodes holocyclus. This tick is mostly found along a narrowcoastal strip between the Great Dividing Range and thecoast, which in some areas extends inland up to 75 km. As the majority of the human population also lives alongthe coast encounters w ith this tick can be frequent.

Ticks have four distinct stages of development: egg – larva – nymph – adult. Larvae, nymphs and adultfemales must have a blood meal from a host. After theblood meal larvae and nymphs drop off the host andrest in the environment as they develop into the nextstage; adult females drop off the host and lay eggs.The whole cycle usually takes about a year.

While most tickbites cause little or no symptoms, theyoccasionally are a threat to human health, including:

! A llergic reactions

! Toxic effects

! Tickborne infectious diseases – infectious diseasestransmitted by ticks.

Allergic reactions

These can be local or generalised. Local mild allergic reactions and itching due to tickbites can be treated w ith cold compresses and moisturisers. If local reactions persist, or if the itching andswelling cause significant discomfort see yourdoctor for advice. Local bacterial infection mayoccur when the skin has been broken bypersistent scratching.

In some susceptible people a tickbite may cause a severe allergic reaction or anaphylactic shock,which is rare but can be life threatening.

If shortly after a tickbite you experience breathingdifficulties or an unusually severe skin reaction w ith

itchy wheals, seek medical attention immediately.

Toxic effects

Tick paralysis is caused by a toxin contained in the tick’s saliva. Symptoms include general unsteadiness,

lethargy, visual disturbances, breathing difficulties, andweakness of the arms, legs or parts of the face. Tick paralysis

develops over a few days, as the tick injects more saliva thesymptoms may intensify, and the patient’s condition may

continue to worsen even after the tick has been removed.

Children and pets are at greatest risk of the toxic effects. If symptoms of tick paralysis are present, seek medical orveterinary attention immediately.

Tickborne infectious diseases

! Spotted fevers are caused by bacteria belonging to the Rickettsia family. In Australia the two types of spotted fevers are Queensland Tick Typhus,which occurs along the coastal strip of easternAustralia from North Queensland to Victoria, andFlinders Island Spotted Fever, which occurs mainlyin Flinders Island in Bass Strait, Tasmania and Victoria.Symptoms of the Spotted Fevers include fever,headache, joint and muscle pains, tenderness oflymph nodes and, usually, a rash characterised byspots. At the site of the bite there may be rednessand swelling and a thick black scab (eschar). C linical diagnosis is confirmed by specific blood tests.Rickettsial infections can be treated w ith antibiotics.Serious illness resulting in death is very rare.

! Lyme disease is the most common tickborne diseasein the world. While the bacteria known to cause thedisease in other parts of the world have not beenfound in Australia, there are reports that exposure toIxodes holocyclus may be associated w ith symptomsresembling those of Lyme disease. Symptoms appearw ithin days, weeks or months of being bitten by atick. Early non-specific symptoms (fever, headache,joint and muscle pains, and sore and swollen lymphnodes) are sometimes accompanied by a characteristicand large ‘bulls-eye’ rash (erythema migrans) at thesite of the tickbite. Later stages of the disease mayaffect the nervous system, the heart and joints. Lyme disease can be treated w ith antibiotics.

Ticks can be a health hazard

Tick stages can overlap across the seasons

• wear protective clothing outdoors • apply repellent to skin• if bitten, remove ticks as soon as possible

How to reduce the likelihood of being bittenWhen outdoors in known tick areas:

! Wear appropriate clothing including long pants tucked into socks and long sleeved shirts tucked into pants. Ticks are more easily detected on lightcoloured clothing

! Spray clothes w ith an insect repellent

! Apply a repellent containing DEET or Picaridin toexposed skin – check the label and follow themanufacturers’ instructions regarding how to apply and when to reapply the repellent.

On return from a known tick area:

! Remove all clothing and search the body for ticksespecially behind the ears, on the back of the head and neck, groin, armpits and back of knees. Be careful where clothes are placed as they mayintroduce ticks into the house. Ticks in clothing can be killed by placing clothes in the dryer for at least ten minutes on the hot cycle

! Don’t forget to check children

! Check pets as they may bring ticks into the house.Many dogs and cats are infested each year and may die from tick paralysis

! Increase sunlight penetration to ground and reducehumidity levels conducive to tick survival in outdoor play areas and paths. Mow lawns regularly, reducemulch and leaf litter, minimise watering, and trimshrubs overhanging those areas.

Reprint September 2004 SHPN (EH) 020057

For further information please contact your Public Health Unit (look under H for NSW Health details in the Business Listingssection of the Telstra White Pages).

A full copy of this brochure can be down-loaded from the NSW Health website: w w w.health.nsw.gov.au

To remove a tick Once found, ticks should be removed as soon as possibleusing fine tipped forceps or fine surgical scissors: press the skin down around the tick’s embedded mouthpart, grip the mouth part firmly, lift gently to detach thetick. Avoid squeezing the body of the tick during removal.

IMPORTANT: In individuals w ith a history of allergic reactions to tickbites, ticks should still be removed as soon as possible, but only by a doctor and whereresuscitation facilities are readily available.

Prevention of tickbite Ticks occur in moist, bushy areas. Eggs are typically laid in leaf litter or mulch. Ticks are not very mobile; larvae, nymphs and adults climb onto grass and the foliage of low bushes where they wait for passing hosts (animals or people) to feed on. Once on the host, ticks craw l upward on the host’s body looking for a place to attach.

Tick Alert

NSW Health Tick Alert Brochure:

“While there is little evidence that Lyme disease is caused by Australian ticks, there may be other germs carried by Australian ticks which can cause an infection similar to Lyme disease”

Tick life cycle

from Barker and Walker 2014

“Questing” ticks

from Barker and Walker 2014

Tick mouthparts

from Barker and Walker 2014

Tick attachment

from Barker and Walker 2014

Tick removal

Egg production

from Barker and Walker 2014

Ixodes holocyclus: paralysis tick

Paralysis tick hosts....  

- caused by Rickettsia australis

-  usually mild symptoms

-  malaise, fever, lymphadenopathy, pharyngitis, cough, adbominal pain

Known diseases caused by paralysis ticks

Queensland tick typhus  

-  symmetrical flaccid paralysis

-  caused by neurotoxin produced by tick

Known diseases caused by paralysis ticks

Tick bite paralysis  

-  may cause respiratory muscle paralysis and death

Tick bite meat allergy  

-  swelling of tongue, constriction of throat, wheezing

-  caused by 18 different species of Borrelia burgdorferi s.l.

Lyme disease

-  early stage: erythema migrans, influenza-like symptoms

-  found in Europe and North America, >85000 cases/yr

- early disseminated: meningitis, cranial nerve palsies, carditis

-  late stage: primarily arthritis

-  usually resolved with antimicrobials in 2-4 weeks

Epidemiol. Infect. (1994), 112, 375-384 375Copyright ( 1994 Cambridge University Press

Lyme disease: a search for a causative agent in ticks insouth-eastern Australia

R. C. RUSSELL', S. L. DOGGETT', R. MUNRO2, J. ELLIS3, D. AVERY',C. HUNT4 AND D. DICKESON5

'Department of Medical Entomology, Centre for Infectious Diseases andMicrobiology, University of Sydney and Westmead Hospital, ICPMR, Westmead

Hospital, Westmead NSW 2145, Australia2Department of Microbiology, Liverpool Hospital, Liverpool NSW 2170, Australia

3Department of Microbiology, University of Technology Sydney,Gore Hill NSW 2065, Australia

4Department of Parasitology, Centre for Infectious Diseases and Microbiology,University of Sydney and Westmead Hospital, ICPMR, Westmead Hospital,

Westmead NSW 2145, Australia'Department of Clinical Microbiology, Centre for Infectious Diseases and

Microbiology, University of Sydney and Westmead Hospital, ICPMR, WestmeadHospital, Westmead NSW 2145, Australia

(Accepted 3 October 1993)

SUMMARYAttempts were made to identify the causative organism of Lyme disease in

Australia from possible tick vectors.Ticks were collected in coastal areas of New South Wales, Australia, from

localities associated with putative human infections. The ticks were dissected; aportion of the gut contents was examined for spirochaetes by microscopy, theremaining portion inoculated into culture media. The detection of spirochaetes inculture was performed using microscopy, and immunochemical and molecular(PCR) techniques. Additionally, whole ticks were tested with PCR for spiro-chaetes.

From 1990 to 1992, approximately 12000 ticks were processed for spirochaetes.No evidence of Borrelia burgdorferi or any other spirochaete was recovered from ordetected in likely tick vectors. Some spirochaete-like objects detected in thecultures were shown to be artifacts, probably aggregates of bacterial flagellae.

There is no definitive evidence for the existence in Australia of B. burgdorferi thecausative agent of true Lyme disease, or for any other tick-borne spirochaete thatmay be responsible for a local syndrome being reported as Lyme disease.

INTRODUCTION

Lyme disease is a tick-borne zoonosis caused by the spirochaete bacteriumBorrelia burgdorferi. Symptoms in humans may include a characteristic rash

Is Borrelia burgdorferi in Australia?

Is Borrelia burgdorferi in Australia?

R. C. RUSSELL AND OTHERS

Fig. 1. Dark field micrograph of spirochaete-like objects in culture media withbacillus contaminants. Bar = 50 ,um.

Li~~~~~~~~~~5O

yt .. ../ ... v~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~. .. ....

Fig. 2. Transmission electron micrograph of detail of spirochaete-like objectshowing fibre-like composition. Bar = 5,um.

DNA from the SLOs, when amplified by PCR using the primer pairs osp2/osp4,flal/fla3 and DD02/DD03 yielded no products that could be reproduciblyattributed to B. burgdorferi. PCR using the eubacterial specific primers pA and pEsuccessfully amplified a 950 bp fragment in 92 of 92 SLO cultures, however thefragments amplified produced characteristic enzyme digestion products of a

Bacillus sp. and not a Borrelia sp.

Description of culture productsThe SLOs were examined by light and electron microscopy. Under dark field

microscopy the SLOs appeared straight, rigid and uniformly coiled (Fig. 1), variedin length (10-300 ,um), and had 2-40 complete coils; all appeared to be non-motile.

380

., .....

Our recent study:

I. ricinus, I. holocyclus,

I. tasmani

RESEARCH Open Access

Inhibition of the endosymbiont “CandidatusMidichloria mitochondrii” during 16S rRNAgene profiling reveals potential pathogensin Ixodes ticks from AustraliaAlexander W. Gofton1, Charlotte L. Oskam1, Nathan Lo2, Tiziana Beninati3, Heng Wei2, Victoria McCarl2,Dáithí C. Murray4, Andrea Paparini1, Telleasha L. Greay1, Andrew J. Holmes5, Michael Bunce4, Una Ryan1

and Peter Irwin1*

Abstract

Background: The Australian paralysis tick (Ixodes holocyclus) is of significant medical and veterinary importance as acause of dermatological and neurological disease, yet there is currently limited information about the bacterialcommunities harboured by these ticks and the risk of infectious disease transmission to humans and domesticanimals. Ongoing controversy about the presence of Borrelia burgdorferi sensu lato (the aetiological agent of Lymedisease) in Australia increases the need to accurately identify and characterise bacteria harboured by I. holocyclus ticks.

Methods: Universal PCR primers were used to amplify the V1-2 hyper-variable region of bacterial 16S rRNA genespresent in DNA samples from I. holocyclus and I. ricinus ticks, collected in Australia and Germany respectively. The 16Samplicons were purified, sequenced on the Ion Torrent platform, and analysed in USEARCH, QIIME, and BLAST to assigngenus and species-level taxonomy. Initial analysis of I. holocyclus and I. ricinus identified that > 95 % of the 16S sequencesrecovered belonged to the tick intracellular endosymbiont “Candidatus Midichloria mitochondrii” (CMM). A CMM-specificblocking primer was designed that decreased CMM sequences by approximately 96 % in both tick species andsignificantly increased the total detectable bacterial diversity, allowing identification of medically important bacterialpathogens that were previously masked by CMM.

Results: Borrelia burgdorferi sensu lato was identified in German I. ricinus, but not in Australian I. holocyclus ticks.However, bacteria of medical significance were detected in I. holocyclus ticks, including a Borrelia relapsing fevergroup sp., Bartonella henselae, novel “Candidatus Neoehrlichia” spp., Clostridium histolyticum, Rickettsia spp., andLeptospira inadai.

Conclusions: Abundant bacterial endosymbionts, such as CMM, limit the effectiveness of next-generation 16S bacterialcommunity profiling in arthropods by masking less abundant bacteria, including pathogens. Specific blocking primersthat inhibit endosymbiont 16S amplification during PCR are an effective way of reducing this limitation. Here,this strategy provided the first evidence of a relapsing fever Borrelia sp. and of novel “Candidatus Neoehrlichia”spp. in Australia. Our results raise new questions about tick-borne pathogens in I. holocyclus ticks.

Keywords: Tick, Vector-borne disease, Zoonoses, Metagenomics, 16S community profiling, Ixodes holocyclus,Ixodes ricinus, Candidatus Midichloria, Borrelia, Candidatus Neoehrlichia

* Correspondence: p.irwin@murdoch.edu.au1Vector and Water-Borne Pathogen Research Laboratory, School of Veterinaryand Life Sciences, Murdoch University, Perth, Western Australia, AustraliaFull list of author information is available at the end of the article

© 2015 Gofton et al. This is an Open Access article distributed under the terms of the Creative Commons Attribution License(http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium,provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Gofton et al. Parasites & Vectors (2015) 8:345 DOI 10.1186/s13071-015-0958-3

Our recent study

Ecology (QIIME) [72] to determine the significance ofdifferences in bacterial diversity between samples amp-lified with and without MidBlocker; significance was setat p < 0.05 (Mann-Whitney U-Test).

16S community profiling qPCRThe primers 27F-Y and 338R amplified the 16S V1-2hyper-variable regions (250-320 bp) [73] in I. holocyclusand I. ricinus DNA samples. 27F-Y and 388R primersalso incorporated a six to eight base pair multiplex iden-tifier (MID) sequence together with Ion Torrent sequen-cing adapters A and P1 (Life Technologies, USA). Eachsample was amplified with primers containing a uniquecombination of forward and reverse MID sequences toallow multiplex sequencing and discrimination of se-quences to samples in downstream analysis. All commu-nity profiling qPCRs were carried out in duplicate in25 !l reactions containing 1 ! PCR buffer (5 prime,Germany), 2 mM MgCl2 (5 Prime, Germany), 0.25 mMdNTPs (Fisher Biotech, Australia), 0.01 mg BSA (FisherBiotech, Australia), 0.4 !M of each 27F-Y and 338R pri-mer, 10 !M of MidBlocker, 0.12 ! SYBR Green (LifeTechnologies, USA), 1 U of Perfect Taq Polymerase(5 Prime, Germany), 1 ! ROX dye (Life Technologies,USA), and 2 !l of DNA (1-100 ng/!l). No-template con-trol reactions and extraction reagent blank controls wereincluded in every qPCR run and were incorporated in thesequencing libraries. All PCR amplifications were per-formed on a Step-One real-time qPCR machine (AppliedBiosystems, USA) with the following thermal conditions:initial denaturation at 95 °C for 5 min followed by 35 cyclesof denaturation at 95 °C (30s), annealing at 62 °C (30s),and extension at 72 °C (45 s). Thermocycling was followedby a melt curve and final extension at 72 °C for 10 min.

Library preparation and NGS16S amplicons from all samples and controls werepooled into one of four sequencing libraries in equimo-lar amounts. Amplicon libraries were then purified twiceusing 1.2 volumes of Agencourt Ampure XP beads(Agilent Technologies, USA) and quantified by qPCR

using a known concentration of a serially diluted 152 bpsynthetic oligonucleotide as a standard. qPCR reactionscontained 1X Power Syber Green mastermix (LifeTechnologies, USA), 0.4 !M Ion Torrent primers Aand P1, and 2 !l DNA template, and were run with thefollowing thermal conditions: initial denaturation at 95 °Cfor 5 min followed by 30 cycles of denaturation at 95 °C(30 s), annealing and extension at 60 °C (45 s). Templatingemulsion PCR and enrichment were performed ac-cording to the manufacturer’s recommendations onthe One-Touch 2 and One-Touch ES instruments (LifeTechnologies, USA). Sequencing was performed on an IonTorrent PGM (Life Technologies, USA) using 400 bpchemistry and 316-V2 semiconductor chips, following themanufacturer’s recommendations.

Sequence processing and analysisSequences were first processed in Geneious 8.0.4 [74]by retaining only reads with perfect 27F-Y and 338Rprimers and MID sequences (no mismatches allowed).Sequences were then de-multiplexed into individualsamples based on their unique combination MID se-quences. Primer sequences and distal bases weretrimmed from each read, and reads shorter than theminimum reported length of the amplicon (<250 bp)were discarded. Remaining reads were quality filteredusing USEARCH [75], allowing only reads with a < 1 %error rate to remain and singletons were removed on aper-sample basis. In order to identify bacterial generapresent in samples operational taxonomic units (OTUs)were selected by clustering sequences at 97 % similaritywith the UPARSE algorithm [76]. OTUs were checkedagainst the ChimeraSlayer Gold reference database withthe UCHIME algorithm [77] to ensure OTUs were notthe result of chimeric reads. Genus level taxonomy wasassigned to OTUs against the GreenGenes 16S database(August 2013 release) [78] in QIIME 1.8.0 [72] usingthe UCLUST algorithm [75] with default parameters.Only OTUs assigned to the genus level were used forfurther analysis. Bacterial genera that were identified in ex-traction reagent blanks and no-template controls were

Name (NCBI accession) Sequence (5’-3’)27F-Y Primer (This study) AGAGTTTGATCCTGGCTYAG

MidBlocker Primer (This study) GGCTYAGAGTGAACGCTGGCGG/C3/Candidatus Midichloria mitochondrii (CP002130) AGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGG

Borrelia burgdorferi (B31_30245) AGAGTTTGATCCTGGCTTAGAACTAACGCTGGCAGBorrelia afzelii (CP009212) AGAGTTTGATCCTGGCTTAGAACTAACGCTGGCAG

Borrelia duttonii (AF107364) AGAGTTTGATCCTGGCTTAGAACTAACGCTGGCAGRickettsia rickettsia (CP000766) AGAGTTTGATCCTGGCTCAGAACGAACGCTATCGGBartonella henselae (AJ223780) AGAGTTTGATCATGGCTCAGAACGAACGCTGGCGG

Ehrlichia chaffeensis (CP007480)Anaplasma phagocytophilum (CP006618)

AGAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGAGAGTTTGATCCTGGCTCAGAACGAACGCTGGCGG

Fig. 1 Alignment of partial 16S rDNA sequences and the 27F-Y and MidBlocker primers. Alignment includes partial 16S sequences of seven tick-bornebacterial pathogens and “Candidatus M. mitochondrii” with the 27F-Y and MidBlocker primers showing mismatches that allow specific blocking of “Can-didatus M. mitochondrii”

Gofton et al. Parasites & Vectors (2015) 8:345 Page 4 of 11

Results: Borrelia relapsing fever from I. holocyclus

the pathogenic relapsing fever Borrelia spp. B. miyamotoiand B. lonestari, with 99.3 % and 97.7 % sequence similar-ity respectively. Sequences derived from nine other I. rici-nus ticks had 100 % sequence identity and clustered withthe Lyme borreliosis-causing B. burgdorferi and B. afzeliiwith bootstrap values of 93.4 % and 86.8 % respectively(Fig. 3).Three I. ricinus ticks and 15 I. holocyclus ticks contained

sequences from the genus “Candidatus Neoehrlichia”and all I. ricinus-derived sequences had > 98 % sequence

similarity, and clustered with “Candidatus Neoehrlichiamikurensis” reference sequences (Fig. 4). Ixodes holocyclus-derived “Candidatus Neoehrlichia” sequences formedtwo distinct novel clades with high bootstrap confi-dence (94.2 % and 97.2 %) that did not group with any“Candidatus Neoehrlichia” sequences in GenBank(Fig. 4). Sequences within each of these novel “Candida-tus Neoehrlichia” clades were less than 1 % dissimilar toeach other but more than 6 % dissimilar to any known“Candidatus Neoehrlichia mikurensis” or “Candidatus

Fig. 2 Rank abundance plots of bacterial genera identified with and without blocking. The ranked relative abundance of bacterial generaidentified in 10 I. holocyclus and 10 I. ricinus ticks when amplified with (blue lines) and without (red lines) the MidBlocker primer. X-axis representsthe number of bacterial genera identified

Fig. 3 Neighbour-joining tree of 16S V1-2 Borrelia sequences from I. holocyclus and I. ricinus ticks. Branch labels are bootstrap values inferred from1000 replicated. Parenthesises after node labels refers to the GenBank accession number. * Indicates sequences from this study

Gofton et al. Parasites & Vectors (2015) 8:345 Page 6 of 11

Borrelia relapsing fever

- caused by Borrelia species distant to B. burgdorferi

- multiple episodes of fever

- first occurs after 7 days, lasts 4-7 days

- up to 2 weeks between subsequent episodes

-  nausea, malaise, headaches, body aches, rashes, jaundice

Leptospira

For personal use. Only reproduce with permission from The Lancet.

In the past decade, leptospirosis has emerged as a globallyimportant infectious disease. It occurs in urbanenvironments of industrialised and developing countries, aswell as in rural regions worldwide. Mortality remainssignificant, related both to delays in diagnosis due to lack ofinfrastructure and adequate clinical suspicion, and to otherpoorly understood reasons that may include inherentpathogenicity of some leptospiral strains or geneticallydetermined host immunopathological responses. Pulmonaryhaemorrhage is recognised increasingly as a major, oftenlethal, manifestation of leptospirosis, the pathogenesis ofwhich remains unclear. The completion of the genomesequence of Leptospira interrogans serovar lai, and othercontinuing leptospiral genome sequencing projects, promiseto guide future work on the disease. Mainstays of treatmentare still tetracyclines and !-lactam/cephalosporins. Novaccine is available. Prevention is largely dependent onsanitation measures that may be difficult to implement,especially in developing countries.

Lancet Infect Dis 2003; 3: 757–71

Leptospirosis is a zoonotic disease of global importance.1 Inrecent years, endemic and epidemic severe pulmonaryhaemorrhage has increasingly become recognised as animportant manifestation of leptospiral infection.2–5

Leptospirosis has also emerged as a disease of the adventuretraveller, especially affecting participants in water-sports.6,7 Ithas a worldwide distribution but is more common in thetropics where conditions for its transmission are particularlyfavourable. However, disease continues to occur indeveloped countries,6 for example among holiday-makers inHawaii8 or sporadically in inner-city residents.9 Importantadvances have been made in diverse aspects of this emerginginfectious disease. Although leptospirosis does not have thepotential to be used as a weapon, its clinical manifestationscan mimic those of viral haemorrhagic fevers, meritingattention in the age of bioterrorism.

Microbiology and taxonomyLeptospires are spirochetes (figure 1), a group of bacteriathat diverged early in bacterial evolution.10 The familyleptospiraceae includes two genera, Leptospira andLeptonema. Typically, leptospires were classified accordingto antigenic determinants.11,12 More recently, a molecularclassification has been described that divides the Leptospiragenus into several species on the basis of DNArelatedness.13–16 The reclassification of leptospires using

genetic determinants provides useful taxonomicinformation, but is independent of the establishedserological classification with which epidemiologists andclinicians are more familiar. Hence, serovar and serogroupdesignations will continue to be used for the foreseeablefuture.

MicrobiologyThe leptospiral genome consists of two circularchromosomes17 and its entire sequence was recentlyestablished.18 The genome is large compared with thegenomes of other spirochetes such as Treponema spp19 andBorrelia spp,20 which indicates the ability of Leptospira spp tolive within diverse environments: animal hosts and freely inthe environment. Little is known about genetic exchangeamong the Leptospira, although lateral transfer has beensuggested.21 Tools for genetic manipulation of leptospires arebeing developed for studies of pathogenesis, virulence

THE LANCET Infectious Diseases Vol 3 December 2003 http://infection.thelancet.com 757

Leptospirosis: a zoonotic disease of globalimportance

Ajay R Bharti, Jarlath E Nally, Jessica N Ricaldi, Michael A Matthias, Monica M Diaz, Michael A Lovett, Paul N Levett, Robert H Gilman, Michael R Willig, Eduardo Gotuzzo, and Joseph M Vinetz, on behalf of thePeru–United States Leptospirosis Consortium

ARB, MAM, and JMV are at the Division of Infectious Diseases,Department of Medicine, University of California San Diego School ofMedicine, La Jolla, CA, USA; JEN and MAL are at the Division ofInfectious Diseases, Department of Medicine, University of CaliforniaLos Angeles School of Medicine, Los Angeles, CA; JNR and EG are atthe Alexander von Humboldt Institute of Tropical Medicine,Universidad Peruana Cayetano Heredia, Lima, Peru; MMD and MRWare at the Ecology Program, Department of Biological Sciences,Texas Tech University, Lubbock, TX, USA; PNL is at the Meningitisand Special Pathogens Branch, National Center for InfectiousDiseases, Centers for Disease Control and Prevention, Atlanta, GA,USA; and RHG is at the Department of International Health, JohnsHopkins Bloomberg School of Public Health, Baltimore, MD, USA.

Correspondence: Dr Joseph M Vinetz, Division of InfectiousDiseases, Department of Medicine, University of California SanDiego School of Medicine, 9500 Gilman Drive Mail Code 0640, Celland Molecular Medicine-East 2052, La Jolla, CA 92093-0640, USA. Tel +1 858 822 4469; fax +1 858 534 6020; email jvinetz@ucsd.edu

Reviews

Figure 1. High-resolution scanning electron micrograph of Leptospirainterrogans serovar copenhageni. (A) Note characteristic hooked ends.(B) At high magnification the surface of the spirochete seems ruffled andbeaded. The leptospires were grown in vitro, fixed in cacodylate buffer,dehydrated through ethanol, processed through hexamethyldisilazine, airdried, and visualised without metal coating (x3000). Courtesy of VsevolodPopov and Violet Han, Department of Pathology, University of TexasMedical Branch, Galveston, TX, USA.

Neoehrlichia sp. and Anaplasma sp.

Neoehrlichia lotoris” 16S sequences. One I. holocyclustick also contained sequences that grouped with relativelyhigh bootstrap confidence (75.1 %) with Anaplasma boviswithin a clade that also includes the pathogens A. platys,A. Phagocytophilum and A. odocoilei (Fig. 4).The genus Rickettsia was identified in five I. ricinus

ticks and six I. holocyclus ticks. In two I. ricinus ticks,R. helvetica was identified with 100 % matches to refer-ence sequences [GenBank: L36212, KJ740388, GQ413963]and no other matches > 97 %. Four I. ricinus ticks were in-fected with Rickettsia spp. that could not be identified tothe species level due to high sequence homology (> 99 %)between many sequences including pathogenic and benignspecies: one of these ticks was also co-infected with R. hel-vetica. Rickettsia sequences in six I. holocyclus ticks wereunable to be resolved to the species level due to highsequence homology (> 99 %) at the loci sequenced be-tween many Rickettsia spp., including pathogenic and be-nign species.The genera Leptospira and Clostridium were identified

in 18 and 30 I. holocyclus ticks respectively. Leptospirasequences derived from all ticks had 100 % sequence

similarity with Leptospira inadai [GenBank: NR115296,AY631891, AY631887] and did not match any otherspecies-specific sequence > 98 %. Clostridium sequencesfrom 15 I. holocyclus ticks matched with the patho-genic Clostridium histolyticum [GenBank: NR113187,NR104889] with sequence similarity (99.4 %), howeverspecies designation of sequences from the 10 other tickswere unable to be resolved due to high sequence hom-ology (> 99 %) with between many Clostridium spp.

Bacterial endosymbionts in I. holocyclus and I. ricinus ticksIn addition to CMM mentioned previously, the genusFrancisella was identified in three questing I. holocy-clus nymphs. Francisella sequences from these ticksmatched > 98 % with Francisella-like endosymbiontsfrom Amblyomma, Dermacentor, and Ornithodoros ticks,and all sequences were > 6 % dissimilar from the zoonoticpathogen Francisella tularensis. The arthropod endosym-biotic genus Rickettsiella was also identified in eightI. holocyclus ticks and 15 I. ricinus ticks, however species-specific discrimination was not possible due to high se-quence homology (> 99 %) between many Rickettsiella

Fig. 4 Neighbour-joining tree of 16S V1-2 “Candidatus Neoehrlichia” sequences from I. holocyclus and I. ricinus ticks. Branch labels are bootstrapvalues inferred from 1000 replicated. Parenthesises after node labels refers to the GenBank accession number. * Indicates sequences fromthis study

Gofton et al. Parasites & Vectors (2015) 8:345 Page 7 of 11

Neoehrlichia sp. and Anaplasma

- Neoehrlichia is a newly recognised human pathogen

- Anaplasma: causes febrile illness thrombocytopenia, leukopenia, and elevated hepatic enzymes

Conclusions

- We have identified some new candidate pathogens

- More work needs to be done to determine pathogenicity

- Most of these pathogens will be eliminated with simple antibiotics, especially if treated early