The Role of Transcription Factor 7-Like 2 in Hepatic ...The Role of Transcription Factor 7-Like 2 in...
198
The Role of Transcription Factor 7-Like 2 in Hepatic Glucose Metabolism by Wilfred Ip A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by Wilfred Ip 2014
Transcript of The Role of Transcription Factor 7-Like 2 in Hepatic ...The Role of Transcription Factor 7-Like 2 in...
The Role of Transcription Factor 7-Like 2 in Hepatic Glucose Metabolism
by
Wilfred Ip
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Institute of Medical Science University of Toronto
© Copyright by Wilfred Ip 2014
ii
The Role of Transcription Factor 7-Like 2
in Hepatic Glucose Metabolism
Wilfred Ip
Doctor of Philosophy
Institute of Medical Science University of Toronto
2014
Abstract....
Transcription factor 7-like 2 (TCF7L2) is a principal downstream transcription factor that
mediates the function of the developmental canonical Wnt signaling pathway. When partnered
with β-catenin, TCF7L2 stimulates Wnt target gene expression and mediates certain effects of
other signaling cascades such as cAMP and insulin in cell type-specific manners. Recent
genome-wide association studies have reproducibly revealed that common single nucleotide
polymorphisms in TCF7L2 have the strongest genetic association with type 2 diabetes risk in a
multitude of ethnic backgrounds. Following this hallmark discovery in 2006, the role of TCF7L2
in regulating metabolism and glucose homeostasis has been intensely investigated. Recent
studies have shown that TCF7L2 regulates pancreatic β-cell function and survival as well as the
production and function of the incretin hormone glucagon-like peptide-1 (GLP-1). As human
carriers of TCF7L2 diabetes risk polymorphisms also exhibited increased hepatic glucose
production, we aimed to determine the role of TCF7L2 in hepatic glucose metabolism. We
revealed that hepatic TCF7L2 expression is regulated by nutrient availability as feeding
increased TCF7L2 levels in mouse livers while insulin treatment stimulated TCF7L2 expression
in hepatic cell lines. Treatment of hepatocytes with the Wnt ligand Wnt-3a decreased, while
TCF7L2 knockdown increased gluconeogenic gene expression and glucose production,
iii
suggesting that TCF7L2 and Wnt signaling repress gluconeogenesis. To further examine the in
vivo role of TCF7L2 and Wnt signaling in hepatic glucose metabolism, we generated the
LTCFDN transgenic mouse model in which dominant negative TCF7L2 is expressed exclusively
in the liver. LTCFDN mice exhibited a progressive impairment in glucose and pyruvate
tolerance, while LTCFDN hepatocytes showed elevated glucose production and increased
binding of β-catenin to the Pck1 promoter. LTCFDN mice also showed increased serum and
liver lipid content. Adenovirus-mediated expression of dominant negative TCF7L2 also
increased glucose production and the expression of gluconeogenic and lipogenic genes in
primary hepatocytes. Finally, the GLP-1 derivative GLP-1(28-36)amide activated β-catenin via
Ser675 phosphorylation, repressed hepatic gluconeogenic gene expression, and improved
pyruvate tolerance in high fat diet-induced obese mice. Together, our results suggest that
TCF7L2 and Wnt signaling serve a beneficial role in suppressing hepatic gluconeogenesis.
iv
Acknowledgements
I owe my sincerest gratitude to my supervisor and mentor, Dr. Tianru Jin, for sharing his
knowledge, being an inspiration to me, and guiding me along this long journey that has shaped
me to be who I am today. The constant motivations to excel and the provision of autonomy in my
studies have especially helped me develop as a scientist and person.
I would also like to thank the members of my supervisory committee, including Drs. David
Irwin, Dominic Ng, Qinghua Wang, and Xiao-Yan Wen, for offering their insights and criticisms
to aid in my training. Numerous other mentors in the Faculty of Medicine have also helped shape
my education, and for them I am also thankful.
My thesis would not have been possible without the support and companionship of past and
present members of Dr. Jin’s lab. I am particularly thankful to Alex and Joan for helping me
through this challenge since day one. I would also like to thank my friends from the 10th floor of
MaRS, the Canadian Diabetes Association U of T Chapter, the Institute of Medical Science, and
the Varsity Blues Squash Team for the great memories and for making my time as a graduate
student more balanced and enjoyable. Above all, I could not be where I am today without the
constant love and support from my parents, Maria and William, as well as my brother and fellow
scientist, Philbert.
Finally, I would like to acknowledge the agencies which funded the research carried out for this
thesis via operating grants to Dr. Jin, including the Canadian Institutes of Health Research
(CIHR) and the Canadian Diabetes Association. Furthermore, I am thankful to the CIHR, the
Ontario government, the Banting and Best Diabetes Centre, the University Health Network, and
the University of Toronto for providing personal funding support to me along the way.
v
Contributions
Wilfred Ip (author) solely prepared this thesis. The thesis in its entirety, including the planning,
execution, analysis, and writing of all original research was performed by the author in whole or
in part.
The following people directly contributed to this thesis and are formally acknowledged:
Dr. Tianru Jin (Supervisor): Mentorship; resources; guidance and assistance in the planning,
execution, analysis, writing, and publication of original research for Chapters 2, 3, 4, 5, and 6.
Dr. Weijuan Shao: Guidance and assistance in the execution of experiments for Chapters 3, 4,
and 5. Specific contributions include Figure 4-2C, 4-5E, 4-5F, 4-11A, 4-11C, 4-11D, and 5-2D.
Dr. Yu-ting Alex Chiang: Writing of parts of section 2.3; assistance in the execution of
experiments for Chapters 3 and 5. Specific contributions include Figure 2-6 and 3-1A.
Zhuolun Eric Song: Assistance in the execution of experiments for Chapters 4. Specific
contributions include Figure 4-1G.
Zonglan Chen: Assistance in the execution of experiments for Chapters 4. Specific contributions
include Figure 4-5A and 4-5B.
vi
Table of Contents
ABSTRACT.... ................................................................................. II
ACKNOWLEDGEMENTS ................................................................ IV
CONTRIBUTIONS ............................................................................ V
TABLE OF CONTENTS ................................................................... VI
LIST OF TABLES ........................................................................... XI
LIST OF FIGURES ......................................................................... XII
LIST OF ABBREVIATIONS .......................................................... XIV
CHAPTER 1: GENERAL INTRODUCTION ....................................... 1
1.1 Preamble ............................................................................................................................ 2
1.2 Thesis Organization .......................................................................................................... 3
CHAPTER 2: THE ROLE OF TCF7L2 IN METABOLIC HOMEOSTASIS ......................................................... 4
2.1 Introduction ....................................................................................................................... 5
2.2 Involvement of the Wnt Signaling Pathway and TCF7L2 in Diabetes Mellitus ......... 6
2.2.1 Introduction ................................................................................................................. 6
2.2.2 Overview of the Wnt Signaling Pathway ................................................................... 6
2.2.3 TCF7L2 ....................................................................................................................... 8
2.2.4 Wnt Signaling Pathway .............................................................................................. 8
2.2.5 Genetic Association between TCF7L2 and Type 2 Diabetes Risk ........................... 12
2.2.6 Genetic Association between Other Wnt Signaling Pathway Components and Diabetes Risk ............................................................................................................ 14
2.2.7 Role of the Wnt Signaling Pathway in Adipocytes .................................................. 15
2.2.8 Role of the Wnt Signaling Pathway in Pancreatic Islets .......................................... 16
2.2.9 Mechanistic Exploration of the Involvement of TCF7L2 in Glucose Disposal ....... 18
2.2.9.1 Controversial Observations on the Role of TCF7L2 in Pancreatic β-cells ....... 19
2.2.9.2 Role of TCF7L2 in the Expression and Function of the Incretin Hormones .... 22
2.2.9.3 Role of TCF7L2 in the Regulation of Hepatic Gluconeogenesis ...................... 22
2.2.9.4 Potential Metabolic Effects of TCF7L2 in Other Organs ................................. 25
vii
2.2.10 Crosstalk between Insulin, FoxO, and Wnt Signaling Pathways ............................. 26
2.3 Involvement of TCF7L2 in Glucagon-Like Peptide-1 Metabolism ............................ 29
2.3.1 Introduction ............................................................................................................... 29
2.3.2 Overview ................................................................................................................... 29
2.3.3 Incretin Production ................................................................................................... 31
2.3.4 Pancreatic Functions of GLP-1 ................................................................................. 34
2.3.5 Extra-Pancreatic Functions of GLP-1 ....................................................................... 35
2.3.6 Role of GLP-1 in Hepatic Glucose Production ........................................................ 37
2.3.7 Role of TCF7L2 in Regulating Intestinal GLP-1 Production ................................... 38
2.3.8 Role of TCF7L2 in Mediating Pancreatic GLP-1 Signaling .................................... 39
2.3.9 Function of GLP-1 Metabolites ................................................................................ 41
2.4 Hepatic Glucose Metabolism ......................................................................................... 43
2.4.1 Introduction ............................................................................................................... 43
2.4.2 Overview ................................................................................................................... 43
2.4.3 Gluconeogenesis ....................................................................................................... 44
2.4.4 Transcriptional Regulation of Gluconeogenesis ....................................................... 47
2.4.4.1 cAMP Response Element-Binding Protein (CREB) ......................................... 47
2.4.4.2 CREB-Regulated Transcription Co-Activator 2 (CRTC2/TORC2) ................. 48
2.4.4.3 Forkhead Box O1 (FoxO1) ............................................................................... 49
2.4.4.4 Peroxisome Proliferator-Activated Receptor-γ Co-Activator 1α (PGC-1α) ..... 50
2.4.4.5 CCAAT Enhancer-Binding Protein (C/EBP) .................................................... 51
2.4.4.6 Hepatocyte Nuclear Factors (HNF) ................................................................... 52
2.4.4.7 Glucocorticoid Receptor (GR) .......................................................................... 53
2.4.4.8 Summary of Regulation .................................................................................... 53
2.4.5 Glycogen ................................................................................................................... 54
2.4.6 Fatty Acids ................................................................................................................ 55
2.4.7 Lipogenesis ............................................................................................................... 56
2.5 Thesis Aims and Hypothesis .......................................................................................... 58
CHAPTER 3: THE WNT SIGNALING PATHWAY EFFECTOR TCF7L2 IS UP-REGULATED BY INSULIN AND REPRESSES HEPATIC GLUCONEOGENESIS ........ 59
3.1 Abstract ............................................................................................................................ 60
3.2 Introduction ..................................................................................................................... 61
3.3 Materials and Methods ................................................................................................... 63
viii
3.3.1 Cell Culture and Treatment ....................................................................................... 63
3.3.2 Animals ..................................................................................................................... 63
3.3.3 RNA Isolation, RT-PCR, and Real-Time RT-PCR .................................................. 64
3.3.4 Western Blotting and Antibodies .............................................................................. 66
3.3.5 Luciferase Reporter Analysis .................................................................................... 66
3.3.6 Glucose Production Assay ........................................................................................ 67
3.3.7 Statistical Analysis .................................................................................................... 67
3.4 Results .............................................................................................................................. 68
3.4.1 Detection of Wnt Signaling and TCF7L2 Expression in Hepatocytes ..................... 68
3.4.2 Feeding Stimulates TCF7L2 Expression .................................................................. 70
3.4.3 Insulin Stimulates TCF7L2 Expression and β-cat Ser675 Phosphorylation............. 71
3.4.4 Wnt Activation by Lithium Reduces Gluconeogenesis ............................................ 75
3.4.5 Wnt-3a Reduces Gluconeogenesis ............................................................................ 78
3.4.6 TCF7L2 Negatively Regulates Gluconeogenesis ..................................................... 80
3.5 Discussion ......................................................................................................................... 82
CHAPTER 4: LIVER-SPECIFIC EXPRESSION OF DOMINANT NEGATIVE TCF7L2 CAUSES IMPAIRED GLUCOSE AND LIPID HOMEOSTASIS IN MICE ....................... 87
4.1 Abstract ............................................................................................................................ 88
4.2 Introduction ..................................................................................................................... 89
4.3 Materials and Methods ................................................................................................... 91
4.3.1 Animals ..................................................................................................................... 91
4.3.2 Genotyping ................................................................................................................ 92
4.3.3 In Vivo Tolerance Tests and Glucose Production Assay .......................................... 92
4.3.4 Insulin Measurement ................................................................................................. 92
4.3.5 Isolation of Mouse Primary Hepatocytes and Cell Culture ...................................... 92
4.3.6 Adenovirus Experiments ........................................................................................... 93
4.3.7 Western Blotting ....................................................................................................... 94
4.3.8 RNA Isolation, Reverse Transcription, and Quantitative PCR ................................ 95
4.3.9 Co-Immunoprecipitation ........................................................................................... 97
4.3.10 Chromatin Immunoprecipitation (ChIP) ................................................................... 97
4.3.11 Plasmid DNA Transfection and LUC Reporter Analysis ......................................... 98
4.3.12 Triglyceride, Free Fatty Acid, Cholesterol, and Glycogen Measurement ................ 98
4.3.13 Oil Red O Staining .................................................................................................... 99
ix
4.3.14 Statistical Analysis .................................................................................................... 99
4.4 Results ............................................................................................................................ 100
4.4.1 Generation of the LTCFDN Mouse Model ............................................................. 100
4.4.2 LTCFDN Mice Exhibit Increased Hepatic Glucose Production ............................ 102
4.4.3 Adenovirus-Mediated Expression of TCF7L2DN but not WT TCF7L2 Increases Glucose Production In Vitro ................................................................................... 104
4.4.4 Increased Binding of the β-cat/FoxO1 Complex to the Pck1 Promoter in LTCFDN Hepatocytes ............................................................................................................. 105
4.4.5 Wnt-3a and β-cat Exert Opposite Effects on Pck1 Gene Transcription ................. 107
4.4.6 LTCFDN Mice Possess Impaired Lipid Homeostasis ............................................ 109
4.4.7 Defects in Lipid Homeostasis are Present at a Young Age in LTCFDN Mice ...... 111
4.4.8 LTCFDN Mice Exhibit Normal Insulin Sensitivity ............................................... 112
4.5 Discussion ....................................................................................................................... 114
CHAPTER 5: GLP-1-DERIVED NONAPEPTIDE GLP-1(28-36)AMIDE REPRESSES HEPATIC GLUCONEOGENIC GENE EXPRESSION AND IMPROVES PYRUVATE TOLERANCE IN HIGH FAT DIET-FED MICE .......... 119
5.1 Abstract .......................................................................................................................... 120
5.2 Introduction ................................................................................................................... 121
5.3 Materials and Methods ................................................................................................. 123
5.3.1 Reagents .................................................................................................................. 123
5.3.2 Animals ................................................................................................................... 123
5.3.3 Intraperitoneal Glucose and Pyruvate Tolerance Tests .......................................... 124
5.3.4 Insulin Measurement ............................................................................................... 124
5.3.5 Isolation of Mouse Primary Hepatocytes and Cell Culture .................................... 124
5.3.6 Real-time RT-PCR Analysis ................................................................................... 125
5.3.7 Western Blotting and Antibodies ............................................................................ 126
5.3.8 Glucose Production Assay ...................................................................................... 126
5.3.9 cAMP Assay ........................................................................................................... 127
5.3.10 Luciferase (LUC) Reporter Analysis ...................................................................... 127
5.3.11 Statistical Analysis .................................................................................................. 127
5.4 Results ............................................................................................................................ 128
5.4.1 GLP-1(28-36)a Reduces Body Weight Gain in Response to HFD Feeding ........... 128
5.4.2 GLP-1(28-36)a Improves Pyruvate Tolerance in HFD Fed Mice .......................... 130
5.4.3 GLP-1(28-36)a Represses Hepatic Gluconeogenesis ............................................. 132
x
5.4.4 GLP-1(28-36)a Activates cAMP/PKA Signaling ................................................... 134
5.4.5 GLP-1(28-36)a Represses the Expression of Peroxisome Proliferator-Activated Receptor Gamma Co-Activator 1-Alpha (PGC-1α) ............................................... 138
5.4.6 Inhibition of PKA Attenuates the Effect of GLP-1(28-36)a on Gluconeogenic Gene Expression ............................................................................................................... 139
5.5 Discussion ....................................................................................................................... 141
CHAPTER 6: CONCLUDING SUMMARY, GENERAL DISCUSSION, AND FUTURE DIRECTIONS .................................. 146
6.1 Concluding Summary ................................................................................................... 147
6.2 General Discussion ........................................................................................................ 150
6.3 Future Directions .......................................................................................................... 155
6.3.1 Further Characterization of LTCFDN Mice ........................................................... 155
6.3.2 Further Mechanistic Studies ................................................................................... 155
6.3.3 Role of Other TCF Members .................................................................................. 156
6.3.4 Effect of TCF7L2 SNPs on the Function and Expression of TCF7L2 ................... 157
REFERENCES ............................................................................. 158
xi
List of Tables
Table 2-1. List of In Vitro and In Vivo Metabolic Functional Studies on TCF7L2……………...22
Table 3-1. RT-PCR Primers……………………………………………………………………...65
Table 4-1. RT-PCR Primers……………………………………………………………………...96
xii
List of Figures
Figure 2-1. Schematic of the Canonical Wnt Signaling Pathway. ................................................ 11
Figure 2-2. TCF7L2 Genetic Structure, Type 2 Diabetes Risk SNP Locations, and Protein Structure. .................................................................................................................... 13
Figure 2-3. Summary of the Potential Metabolic Functions of TCF7L2. ..................................... 19
Figure 2-4. Crosstalk among Wnt, Insulin, and FoxO Signaling Cascades. ................................. 28
Figure 2-5. Amino Acid Sequences of GLP-1 and its Derivatives. .............................................. 34
Figure 2-6. Schematic Presentation of the Function of GLP-1. .................................................... 36
Figure 2-7. Gluconeogenesis. ....................................................................................................... 45
Figure 3-1. Active Wnt signaling and transcription factor 7-like 2 (TCF7L2) expression are present in hepatocytes. ............................................................................................... 69
Figure 3-2. Feeding stimulates TCF7L2 expression. .................................................................... 70
Figure 3-3. Insulin stimulates TCF7L2 expression in two hepatic cell lines. ............................... 72
Figure 3-4. Insulin stimulates β-cat Ser675 phosphorylation in two hepatic cell lines. ............... 74
Figure 3-5. Wnt activation represses hepatic gluconeogenesis. ................................................... 77
Figure 3-6. Wnt ligand Wnt-3a represses hepatic gluconeogenesis. ............................................ 79
Figure 3-7. Knockdown of TCF7L2 up-regulates hepatic gluconeogenesis. ............................... 81
Figure 3-8. A schematic presentation of the role of Wnt signaling and TCF7L2 in hepatic gluconeogenesis. ........................................................................................................ 86
Figure 4-1. LTCFDN Mice Express TCF7L2DN Exclusively in the Adult Liver. .................... 101
Figure 4-2. Basic Parameters of LTCFDN Mice. ....................................................................... 102
Figure 4-3. LTCFDN Mice Exhibit Increased Hepatic Glucose Production. ............................. 103
Figure 4-4. Expression of TCF7L2DN but not WT TCF7L2 Increases Glucose Production. ... 104
Figure 4-5. Increased Binding of the β-cat/FoxO1 Complex to Pck1 Promoter in LTCFDN Hepatocytes. ............................................................................................................. 106
Figure 4-6. Wnt-3a and β-cat Exert Opposite Effects on Pck1 Gene Transcription. .................. 108
Figure 4-7. LTCFDN Mice Possess Impaired Lipid Homeostasis. ............................................ 110
xiii
Figure 4-8. TCF7L2DN Expression Causes Increased Glycogen Synthesis. ............................. 111
Figure 4-9. Parameters of Newborn LTCFDN Mice. ................................................................. 111
Figure 4-10. Parameters of Two Week Old LTCFDN Mice. ..................................................... 112
Figure 4-11. LTCFDN Mice Exhibit Normal Insulin Sensitivity. .............................................. 113
Figure 5-1. GLP-1(28-36)a reduces body weight gain in response to HFD feeding. ................. 129
Figure 5-2. GLP-1(28-36)a improves pyruvate tolerance in HFD fed mice. .............................. 131
Figure 5-3. GLP-1(28-36)a reduces hepatic gluconeogenic gene expression. ........................... 133
Figure 5-4. GLP-1(28-36)a stimulates the cAMP/PKA signaling pathway in HFD fed mice. .. 135
Figure 5-5. GLP-1(28-36)a stimulates the cAMP/PKA signaling pathway in primary hepatocytes. .................................................................................................................................. 137
Figure 5-6. GLP-1(28-36)a down-regulates the expression of gluconeogenic transcriptional co-activator PGC-1α. .................................................................................................... 138
Figure 5-7. PKA inhibition attenuates the effects of GLP-1(28-36)a on gluconeogenic gene expression. ................................................................................................................ 140
xiv
List of Abbreviations
ACC Acetyl CoA Carboxylase
Akt Protein Kinase B (PKB)
AMP Adenosine Monophosphate
AMPK AMP-Activated Protein Kinase
ANOVA Analysis of Variance
APC Adenomatous Polyposis Coli
ATF-1 Activating Transcription Factor-1
ATP Adenosine Triphosphate
AU Arbitrary Units
AUC Area Under the Curve
cAMP Cyclic Adenosine Monophosphate
CBP CREB Binding Protein
cDNA Complimentary Deoxyribonucleic Acid
CDK-4 Cyclin-Dependent Kinase-4
C/EBP CCAAT Enhancer-Binding Protein
ChIP Chromatin Immunoprecipitation
ChREBP Carbohydrate Response Element Binding Protein
CIHR Canadian Institutes of Health Research
CK-1α Casein Kinase Iα
CRTC2 CREB-Regulated Transcription Co-Activator 2
CRE cAMP Response Element
CREB cAMP Response Element-Binding Protein
CRU cAMP-Responsive Unit
CtBP-1 C-Terminal Binding Protein-1
xv
DAX-1 Dosage-Sensitive Sex Reversal Adrenal Hypoplasia Congenital Critical Region on the X Chromosome Gene 1
DMEM Dulbecco’s Modified Eagle’s Medium
DN Dominant Negative
DNA Deoxyribonucleic Acid
DPP-4 Dipeptidyl Peptidase 4
Dvl Dishevelled
Epac Exchange Protein Activated By cAMP
ELISA Enzyme-Linked Immunosorbent Assay
ERK1 Extracellular Signal-Regulated Kinase-1
Ex-4 Exendin-4
F6P Fructose-1,6-Bisphosphatase
FAS Fatty Acid Synthase
FBS Fetal Bovine Serum
FCCM Fat Cell-Conditioned Medium
FFA Free Fatty Acid
FGF-10 Fibroblast Growth Factor 10
FoxO Forkhead Box O
FoxO1 Forkhead Box O1
FRIC Fetal Rat Intestinal Cell
FSK Forskolin
G6P/G6Pase Glucose-6-Phosphatase
GFP Green Fluorescent Protein
GIP Gastric Inhibitory Polypeptide (or Glucose-Dependent Insulinotropic Polypeptide)
GIPR Gastric Inhibitory Polypeptide Receptor
GK Glucokinase
xvi
GLP-1 Glucagon-Like Peptide-1
GLP-1R Glucagon-Like Peptide-1 Receptor
GLP-1 Glucagon-Like Peptide-2
GP Glycogen Phosphorylase
GPCR G-Protein Coupled Receptor
GR Glucocorticoid Receptor
GRE Glucocorticoid Responsive Element
GRPP Glicentin-Related Pancreatic Polypeptide
GRU Glucocorticoid Responsive Unit
GS Glycogen Synthase
GSK3 Glycogen Synthase Kinase-3
GTT Glucose Tolerance Test
GWAS Genome-Wide Association Study
HA Hemagglutinin
HBP-1 HMG-Box Transcription Factor 1
HDAC Histone Deacetylase
HE Hematoxylin & Eosin
HFD High Fat Diet
HGP Hepatic Glucose Production
HMG High Mobility Group
HNF Hepatocyte Nuclear Factor
HPLC High Performance Liquid Chromatography
IDDM4 Insulin-Dependent Diabetes Mellitus Locus 4
IGF-1 Insulin-Like Growth Factor-1
IgG Immunoglobulin G
i.p. Intraperitoneal
xvii
IP1 Intervening Peptide-1
IP2 Intervening Peptide-2
IR Insulin Receptor
IRE Insulin-Responsive Element
ITT Insulin Tolerance Test
JNK c-Jun N-Terminal Kinase
LacZ Beta-Galactosidase
LEF1 Lymphoid Enhancer-Binding Factor 1
LPA Lysophosphatidic Acid
L-PK Liver-Type Pyruvate Kinase
LRP5/6 Lipoprotein Receptor-Related Protein 5/6
LTCFDN Liver-Specific Dominant Negative TCF7L2 Mouse Model
LUC Luciferase
MAPK Mitogen Activated Protein Kinase
MEK Mitogen-Activated Extracellular Signal-Regulated Kinase
MLT Mouse Liver Tissue
MPGF Major Proglucagon Fragment
MPH Mouse Primary Hepatocytes
mRNA Messenger Ribonucleic Acid
mTOR Mammalian Target of Rapamycin
NEP 24.11 Neutral Endopeptidase 24.11
ORO Oil Red O
PBS Phosphate Buffered Saline
PC Pyruvate Carboxylase
PC2 Prohormone Convertase 2
PC3 Prohormone Convertase 1/3
xviii
PCR Polymerase Chain Reaction
PEPCK Phosphoenolpyruvate Carboxykinase
PGC-1α Peroxisome Proliferator-Activated Receptor-γ Co-Activator 1α
PI3K Phosphoinositide 3-Kinase
PKA Protein Kinase A
PKB Protein Kinase B (Akt)
PKC Protein Kinase C
PLC Phospholipase C
PTT Pyruvate Tolerance Test
RIP Rat Insulin Promoter
RNA Ribonucleic Acid
ROS Reactive Oxygen Species
RT-PCR Reverse Transcriptase Polymerase Chain Reaction
SCD Stearoyl-CoA Desaturase
SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
SEM Standard Error of the Mean
SFRP1 Secreted Frizzled-Related Protein 1
SGK Serum- and Glucocorticoid-Induced Protein Kinase
SHP Small Heterodimer Partner
shRNA Short Hairpin Ribonucleic Acid
siRNA Small Interfering Ribonucleic Acid
SNP Single Nucleotide Polymorphism
SREBP-1c Sterol Regulatory Element Binding Protein-1c
TCF T-cell Factor
TCF7 Transcription Factor 7 (previously known as TCF-1)
TCF7L1 Transcription Factor 7-Like 1 (previously known as TCF-3)
xix
TCF7L2 Transcription Factor 7-Like 2 (previously known as TCF-4)
TCF7L2DN Dominant Negative TCF7L2
TCF7L2WT Wild Type TCF7L2
TG Triglyceride
TORC2 CREB-Regulated Transcription Co-Activator 2
TxNIP Thioredoxin-Interacting Protein
UDP Uridine Diphosphate
VDF Vancouver Diabetic Fatty
WT Wild Type
1
Chapter 1: General Introduction
2
1.1 Preamble
It has been well established through developmental studies and cancer research that the Wnt
signaling pathway and its downstream components, including transcription factor 7-like 2
(TCF7L2, previously known as TCF-4), are vital for embryonic development and cell
proliferation (1, 2). The involvement of TCF7L2 in metabolic homeostasis, however, has only
been recognized recently, beginning with the discovery of the role of TCF7L2 in the production
of the incretin hormone glucagon-like peptide-1 (GLP-1) by our group in 2005 (3). In the
following year, a hallmark genome-wide association study (GWAS) revealed a strong
association between common single nucleotide polymorphisms (SNPs) in the human TCF7L2
gene and the risk of type 2 diabetes (4). To this date, the most robust genetic risk factors of type
2 diabetes continue to be the variants of TCF7L2 (4-6). This discovery motivated researchers
around the world to investigate the function of TCF7L2 in metabolism, thereby expanding its
role outside of development and cancer.
Great efforts have been made to elucidate the function of TCF7L2 especially in pancreatic β-
cells. Investigators have shown that TCF7L2 exerts a beneficial role in regulating β-cell survival,
insulin secretion, and incretin function (7-9). On the other hand, others demonstrated that
TCF7L2 plays no role at all in β-cells (10), or has a detrimental effect on overall glucose
homeostasis (11), thus revealing both the complexity and controversy surrounding this topic.
Two human studies indicated that TCF7L2 SNPs are also associated with abnormally elevated
hepatic glucose production (9, 12). As whether TCF7L2 and Wnt signaling possess metabolic
functions in the liver was unknown, my study aimed to explore the metabolic role of TCF7L2 in
regulating hepatic glucose metabolism.
3
1.2 Thesis Organization
The remainder of this thesis is divided into five chapters following the “multiple papers” format.
This format best presents the three bodies of research in a logical manner. It is my hope that the
reader will be able to appreciate the emerging evidence on the role of TCF7L2 in hepatic glucose
metabolism as they are presented in successive chapters. Chapter 2 serves as a review of the
relevant literature related to this thesis, part of which has been reproduced from two peer-
reviewed review articles (Ip et al., Cell Biosci 2012; Chiang, Ip, and Jin, Front Physiol 2012)
(13, 14). Chapters 3, 4, and 5 contain original research and are presented as three self-contained
manuscripts with similar formatting for consistency of style. Chapters 3 and 5 consist of
primarily unaltered peer-reviewed content, reproduced from two published articles (Ip et al., Am
J Physiol Endocrinol Metab 2012 and 2013) (15, 16), while Chapter 4 constitutes a manuscript
which is currently undergoing peer review (Ip et al., Diabetes 2014 submitted). Finally, Chapter
6 summarizes the overall conclusions from my work and unifies the three distinct yet related
original research chapters, followed by suggesting where this research is headed in the future.
4
Chapter 2: The Role of TCF7L2 in Metabolic Homeostasis
This chapter contains modifications from the following:
Ip, W., Chiang, Y.A., and Jin, T. (2012) The involvement of the Wnt signaling pathway and TCF7L2 in diabetes mellitus: the current understanding, dispute, and perspective. Cell Biosci. 2(1): 28.
Chiang, Y.A., Ip, W., and Jin, T. (2012) The role of the Wnt signaling pathway in incretin hormone production and function. Front Physiol. 3: 273.
5
2.1 Introduction
This review chapter is divided into three main sections. I begin in section 2.2 by introducing
transcription factor 7-like 2 (TCF7L2) as a key downstream effector of the Wnt signaling
pathway and a type 2 diabetes risk gene, followed by describing the studies that have explored
the metabolic role of TCF7L2. In section 2.3, I highlight the function of TCF7L2 in regulating
both the production and function of the incretin hormone glucagon-like peptide-1 (GLP-1) and
summarize the recently elucidated biological activities of GLP-1 metabolites. In section 2.4, I
then review the role of the liver in maintaining glucose homeostasis with a focus on
gluconeogenesis. Finally, the aims and hypotheses of this thesis are outlined in section 2.5.
6
2.2 Involvement of the Wnt Signaling Pathway and TCF7L2 in Diabetes Mellitus
2.2.1 Introduction
This section introduces the Wnt signaling pathway and its major downstream effector, TCF7L2,
then discusses the genetic studies that have demonstrated the strong association between single
nucleotide polymorphisms (SNPs) in the human TCF7L2 gene and type 2 diabetes risk. Finally,
the various functional roles of the Wnt signaling pathway and TCF7L2 in different organs, along
with the existence of crosstalk with other signaling pathways, will be described.
Section 2.2 is expanded with some modification from a review article by Ip et al. published in
Cell & Bioscience, 2012, (13).
2.2.2 Overview of the Wnt Signaling Pathway
The Wnt signaling pathway was initially recognized in breast and colon cancer research as well
as in embryonic developmental studies of Drosophila, Xenopus and other organisms (2, 17, 18).
This pathway involves not only a large battery of Wnt ligands, receptors and co-receptors, but
also a number of proteins that can regulate the production of the Wnt ligands, the interactions
between different types of Wnt ligands and receptors on the target cells, the physiological
responses of target cells to Wnt ligand binding, as well as the formation of active effector
molecules. Hyper-activation of the Wnt signaling pathway, such as via the attenuation of the
repressive machinery or the expression of a constitutively active effector, may lead to the
development of colorectal and other types of tumors (1). During the last decade, we have learned
7
that Wnt signaling not only interacts with several other important signaling pathways in
orchestrating organogenesis, but is also involved in regulating hormone gene expression and
metabolic homeostasis (3, 19). Abnormalities in the Wnt signaling pathway may lead to the
development of diseases other than tumors, including type 2 diabetes and other disorders (20-24).
When Wnt ligands bind to specific Frizzled receptors on the cell membranes of target cells, it
leads to the activation of either the canonical (β-cat-dependent) or non-canonical (β-cat-
independent) Wnt signaling pathway. The latter is further sub-divided into the planar cell
polarity and Ca2+ pathways, which are important for polarization of cells along the embryonic
axis and cell motility and behaviour, respectively (25). The major effector of the canonical Wnt
signaling pathway (defined as Wnt pathway hereafter) is known as β-cat/TCF. This bipartite
transcription factor is formed by non-cytoskeletal β-catenin (β-cat) and a member of the T-cell
factor (TCF) protein family, including TCF7L2 (26). In 2006, a large scale genome-wide
association study (GWAS) revealed that certain SNPs in TCF7L2 are strongly associated with
the susceptibility of type 2 diabetes (4). This important finding was subsequently replicated
numerous times globally in different ethnic groups in the last few years (7, 27-35). Although we
are still unclear mechanistically how these SNPs located within intronic regions of TCF7L2
affect the risk of type 2 diabetes, this association, along with the recognition of the role of the
Wnt signaling in the production and function of incretin hormones and blood glucose
homeostasis, has prompted us to further investigate the function of the Wnt signaling pathway
and its effectors in the pathophysiology of type 2 diabetes and other metabolic disorders (19).
Genetic variations of several other components of the Wnt signaling pathway were also shown to
be involved in the susceptibility of diabetes or glucose homeostasis. Furthermore, the Wnt
8
signaling pathway is implicated in osteoporosis and aging via crosstalk with the forkhead box O
(FoxO) stress signaling pathway and the insulin/metabolic signaling pathway (36).
2.2.3 TCF7L2
TCF7L2 is a member of the high-mobility group (HMG) box-containing T-cell factor (TCF)
family of transcription factors. This TCF family consists of four members named T-cell factor 1,
3, and 4 (TCF-1, TCF-3, and TCF-4), as well as lymphoid enhancer-binding factor 1 (LEF1).
However, due to confusion in nomenclature with other transcription factors, the first three above
listed members were renamed to transcription factor 7, 7-like 1, and 7-like 2 (TCF7, TCF7L1,
and TCF7L2), respectively. LEF-1 is also unofficially known as transcription factor 7-like 3
(TCF7L3). Each of the four T-cell factor family members features an HMG box which permits
binding to DNA sequences carrying a consensus TCF-binding motif. In addition, a β-cat binding
domain is found at the N-terminus of all TCF members. Binding to the transcriptional co-
activator β-cat provides the transactivation domain and is thus necessary for TCF7L2 (and other
TCF members) to stimulate the transcription of Wnt target genes.
2.2.4 Wnt Signaling Pathway
In 1982, Nusse and Varmus discovered the first Wnt ligand-encoding gene, INT1, in their breast
cancer research (18). This proto-oncogene was later renamed WNT1, since it shares strong amino
acid sequence homology with the Drosophila Wingless (wg), which is important for segment
polarity of the insect (37). Today, there are 19 Wnt ligand genes identified in rodents and
humans. Wnt ligands are secreted glycoproteins which mainly exert their functions via the
9
selective interaction with more than a dozen seven-transmembrane domain Frizzled receptors as
well as the co-receptor known as low-density lipoprotein receptor-related protein 5 or 6
(LRP5/6). The Wnt ligands Wnt-1, Wnt-3a, and Wnt-8 have been established as activators of the
canonical Wnt signaling pathway whereas Wnt-5a and Wnt-11 have been shown to stimulate the
non-canonical Wnt signaling pathway instead (38-40). Wnt-4 has also been shown to exert
inhibitory effects on the canonical Wnt pathway, at least in pancreatic β-cells (41).
The key effector of the Wnt signaling pathway is the bipartite transcription factor β-cat/TCF,
formed by non-cytoskeletal β-cat and a member of the TCF family in the nucleus. The
concentration of free β-cat in the cytosol of resting cells is tightly controlled by the proteasome-
mediated degradation process through the actions of adenomatous polyposis coli (APC),
axin/conductin, as well as the serine/threonine kinases glycogen synthase kinase-3 (GSK-3) and
casein kinase Iα (CK-1α, Figure 2-1A) (42, 43). APC and axin serve as the scaffold, while GSK-
3 and CK-1α phosphorylate certain serine residues at the N-terminus of β-cat, including the
Ser33 position. Once β-cat is phosphorylated at the N-terminal positions, it is ubiquitinated and
degraded by the proteasome. Following binding of a Wnt ligand to the Frizzled receptor and
LRP5/6 co-receptor, an association is made between the Wnt receptors and Dishevelled (Dvl), an
event that triggers the disruption of the complex that contains APC, axin, GSK-3, and β-cat,
preventing the phosphorylation-dependent degradation of β-cat. This leads to the translocation of
β-cat into the nucleus, the formation of the β-cat/TCF complex, and the activation of β-cat/TCF
(or Wnt) downstream target genes (Figure 2-1B).
GSK-3 has been recognized as an important negative modulator of the Wnt signaling pathway
(44). Lithium and other inhibitors of GSK-3 can mimic the function of Wnt ligands in stimulating
the expression of Wnt downstream target genes (Figure 2-1B) (44). Furthermore, the Wnt
10
effector β-cat/TCF may also function as an effector for other signaling cascades, including
insulin, insulin-like growth factor-1 (IGF-1), glucagon-like peptide-1 (GLP-1) and a number of
other peptide hormones and neurotransmitters that use cAMP as a second messenger (36). In a
number of cell lineages, activation of protein kinase A (PKA) was shown to stimulate β-cat
phosphorylation at Ser675, an event that is positively associated with the activation of β-
cat/TCF-mediated Wnt target gene expression (45).
11
Figure 2-1. Schematic of the Canonical Wnt Signaling Pathway. (A) In the absence of Wnt ligands, β-cat is sequestered in the cytoplasm by the destruction complex consisting of APC, axin, GSK-3, and CK-1α, leading to its degradation by the proteasome. TCF and Groucho bind to the promoters of Wnt target genes and repress their expression. (B) Upon binding of a Wnt ligand to the Frizzled receptor and LRP-5/6 co-receptor, the destruction complex is disrupted by Dvl. In turn, β-cat enters the nucleus where it forms the bipartite transcription factor β-cat/TCF and stimulates Wnt target gene expression. GPCR, G-protein coupled receptor. Dvl, dishevelled. APC, adenomatous polyposis coli. GSK-3, glycogen synthase kinase-3. CK-1α, casein kinase 1α. IR, insulin receptor. HDAC, histone deacetylase. CtBP-1, C-terminal binding protein-1. H/N, hormone/neurotransmitter. PKA, protein kinase A. Ins, insulin. CBP, cAMP response element-binding (CREB) binding protein.
12
2.2.5 Genetic Association between TCF7L2 and Type 2 Diabetes Risk
GWAS have been making tremendous influences and contributions on studies of diabetes and
other genetic diseases (46-49). During the last decade, extensive GWAS have shown that 38
SNPs are associated with type 2 diabetes and an additional two dozen SNPs are associated with
glycemic traits (48). Among them, the type 2 diabetes risk SNPs located in the TCF7L2 gene are
the most exciting ones.
We have learned previously that a region on chromosome 10q is linked to type 2 diabetes
susceptibility (50, 51). In 2006, Grant et al. reported their major discovery on the linkage between
polymorphisms in TCF7L2 and the risk of type 2 diabetes (4). Briefly, they revealed that certain
SNPs within intronic regions of TCF7L2 show robust associations with type 2 diabetes (4). This
discovery has drawn global attention and the findings have been replicated by numerous groups
among different ethnic populations (7, 12, 27, 30, 31, 34, 35, 47, 49, 52-64). Figure 2-2A
summarizes the structure of the TCF7L2 gene and five SNPs that were investigated by Grant et
al. Among them, rs12255372 and rs7903146 are the most strongly associated with type 2
diabetes, and subsequent reports determined that rs7903146 has the greatest effect in Caucasian
populations. Figure 2-2A also indicates two other SNPs which are associated with type 2
diabetes risk in Han Chinese by scientists in Taiwan and Hong Kong, respectively (53, 64).
Furthermore, an alternative promoter located upstream of exon 6, named Ex1b-e and illustrated
in Figure 2-2A, has recently been discovered to generate a native dominant negative TCF7L2
protein in embryonic brain neurons (65). Figure 2-2B depicts the protein structure of TCF7L2
which consists importantly of an N-terminal β-cat binding domain that is lacking in dominant
negative TCF7L2.
13
Figure 2-2. TCF7L2 Genetic Structure, Type 2 Diabetes Risk SNP Locations, and Protein Structure. (A) The human TCF7L2 gene, located on chromosome 10q25.3, consists of 17 exons (boxes). At least five exons are alternatively spliced (white boxes). Five SNPs were originally determined to be associated with type 2 diabetes risk in a variety of ethnic backgrounds, all of which are located within the large intronic regions surrounding exon 5. Two additional type 2 diabetes risk SNPs (yellow) were subsequently identified in Han Chinese populations. The TCF7L2 gene undergoes a significant amount of alternative splicing that produces a large number of transcripts which give rise to a number of isoforms. The major isoforms of size 79 and 58 kDa result from alternative stop codons. A novel transcription start site (called Ex1b-e) was recently identified upstream of exon 6 which leads to the production of a dominant-negative TCF7L2 isoform of size 35–40 kDa. (B) The full-length TCF7L2 protein consists of two major domains including the β-cat binding domain at the N-terminal as well as the HMG-box for binding to DNA. In addition, TCF7L2 binds to a number of other factors, depicted in this figure. SNP, single nucleotide polymorphism. HMG, high-mobility group. HBP1, HMG-box transcription factor 1.
14
2.2.6 Genetic Association between Other Wnt Signaling Pathway Components and Diabetes Risk
Investigations have shown that several other Wnt pathway components are important for normal
lipid and glucose metabolism and hence the pathophysiology of metabolic disorders.
LRP-5 and LRP-6 are co-receptors for the Wnt ligands (66, 67) (Figure 2-1). The human LRP-5
gene is mapped within the insulin-dependent diabetes mellitus locus 4 (IDDM4) region, which is
linked to type 1 diabetes on chromosome 11q13 (68-70). A GWAS by Guo and colleagues
revealed that polymorphisms of LRP-5 are strongly associated with obesity phenotypes as well
(71). The homozygous LRP-5 knockout (Lrp5-/-) mice showed increased plasma cholesterol
levels after a high fat diet (HFD) challenge (72). In addition, when the Lrp5-/- mice were fed with
a normal diet, they also showed markedly impaired glucose tolerance (72). Furthermore, Lrp5-/-
mice had a significant reduction in the levels of intracellular adenosine triphosphate (ATP) and
calcium in response to high glucose treatment, along with decreased glucose-induced insulin
secretion. Finally, both Wnt-3a and Wnt-5a were able to stimulate insulin secretion in wild-type
but not Lrp5-/- mice (72). Thus, Wnt-3a and Wnt-5a rely on the function of LRP-5 to facilitate
insulin secretion.
Kanazawa and colleagues examined the association between genes encoding members of the
Wnt family and type 2 diabetes in a Japanese population (73). They assessed 40 SNPs within 11
Wnt ligand genes, and showed that six of them exhibited a significant difference in the allele
and/or genotype distributions between type 2 diabetes and control subjects. Among them, one
SNP within Wnt-5b was strongly associated with type 2 diabetes. Wnt-5b appears to be a
repressive Wnt ligand with the ability to inhibit Wnt activity and promote adipogenesis (73, 74).
In addition, Wnt-5b as well as Wnt-5a are involved in coordinating chondrocyte proliferation and
15
differentiation (75). Thus, the GWAS to date have revealed the involvement of a Wnt ligand
(Wnt-5b), Wnt co-receptor (LRP-5) and the Wnt pathway effector TCF7L2 in the development
of diabetes.
2.2.7 Role of the Wnt Signaling Pathway in Adipocytes
The Wnt signaling pathway negatively regulates adipogenesis (76). Adipose tissue‐specific over-
expression of Wnt-10b in mice led to ~50% lower adipose mass and the mice were resistant to
HFD‐induced obesity (77). Wnt-10b null mice, on the other hand, exhibited increased adipogenic
potential (78). The repressive Wnt ligand Wnt-5b, as mentioned above, was shown to promote
adipogenesis (74).
In addition to the involvement of the Wnt signaling pathway in adipogenesis, Wnt ligands
produced by adipocytes may function as paracrine or endocrine factors. Adult adipocytes express
different kinds of Wnt ligands. Schinner and colleagues found that human fat-cell-conditioned
medium (FCCM) stimulates the proliferation of a pancreatic β-cell line and primary mouse islet
cells (79). The FCCM was also shown to stimulate insulin secretion from pancreatic β-cells, and
the stimulation can be blocked by the Wnt repressor, secreted frizzled-related protein 1 (SFRP-1)
(79). However, it is not clear as to which Wnt ligands exert the stimulatory effect on insulin
secretion. Mechanisms underlying the stimulation of hormone secretion are also elusive at this
stage.
16
2.2.8 Role of the Wnt Signaling Pathway in Pancreatic Islets
An early study by Murtaugh et al. suggests that although β-cat is essential for pancreatic acinar
cell development, the loss of β-cat in a transgenic mouse model did not significantly perturb islet
endocrine cell mass or function (80). Dessimoz and colleagues utilized the Pdx1-Cre system to
delete the β-cat gene in the epithelium of the pancreas and duodenum only. They found that β-cat
mutant cells had a competitive disadvantage during development. Although there was a reduction
in the endocrine islet numbers during the developmental stages and the mice had pancreatitis
perinatally due to the disruption of the epithelial structure of acini, mice later recovered from the
pancreatitis and regenerated normal pancreas and duodenal villi from the wild-type cells that
escaped β-cat deletion (81). Heiser et al., however, found that induction of the expression of a
stabilized form of β-cat at different developmental stages results in different effects. During the
early stage of organogenesis, robust expression of stabilized β-cat (the S33Y mutant) provoked
changes in hedgehog and fibroblast growth factor 10 (FGF-10) signaling and induced the loss of
expression of Pdx1 (82), a homeobox gene that is important for the genesis of pancreatic β-cells
(83). At a later time point in pancreas development, S33Y mutant β-cat expression enhanced islet
cell proliferation and increased the size of the pancreas (82). The seemingly contradictory results
reported by the above three groups can be resolved if we assume that β-cat and the bipartite
transcription factor β-cat/TCF exert different functions in a precise dosage-dependent manner at
different developmental stages of the pancreatic islets. Later, Rulifson et al. examined the effect
of Wnt signaling in regulating pancreatic β-cell genesis and proliferation using both in vitro and
in vivo approaches (84). They found that purified Wnt-3a stimulated β-cell proliferation in both
the mouse MIN-6 cell line and primary mouse pancreatic islets, possibly through the cell cycle
regulators cyclin D1, cyclin D2 and cyclin-dependent kinase-4 (CDK-4), as well as the
17
homeobox gene Pitx2. In the three month-old bi-transgenic rat insulin promoter (RIP)-Cre and β-
cat active mice, immunohistological examinations revealed increased levels of β-cat in both the
cytoplasm and nuclei of pancreatic β-cells, along with a significant increase in β-cell mass (84).
Their observations collectively suggest that Wnt signaling is necessary and sufficient for islet
cell proliferation (84). However, it is still unclear how Wnt is mechanistically involved in the
embryonic genesis of pancreatic β-cells.
Liu and Habener examined the role of Wnt signaling in pancreatic β-cells from a different angle.
They demonstrated that both TCF7L2 and β-cat function as effectors of the incretin hormone
glucagon-like peptide-1 (GLP-1) in stimulating β-cell proliferation (85). They also showed that
mouse pancreatic cells exhibit detectable Wnt activity, demonstrated in the TOPGAL transgenic
reporter mice (86). Utilizing the same β-cat/TCF-responsive TOPGAL mouse model, Krutzfeldt
and Stoffel, however, reported that Wnt signaling is not appreciably active in the adult pancreas
(87). They suggest that abundant expression of the repressive Wnt ligand Wnt-4 is at least
partially responsible for the lack of appreciable Wnt activity in the adult pancreas (87).
Together, although the Wnt signaling pathway is important for organogenesis, clarification of its
role in pancreatic islet development requires further investigation. More importantly, canonical
Wnt signaling may not be strong in the adult rodent pancreas. This notion is important for the
exploration of the role of the type 2 diabetes risk gene TCF7L2 in mediating glucose
homeostasis. Recent studies specifically on the potential role of TCF7L2 in the pancreas are
discussed below in section 2.2.9.
18
2.2.9 Mechanistic Exploration of the Involvement of TCF7L2 in Glucose Disposal
As the TCF7L2 type 2 diabetes risk SNPs are located within intronic regions, it is difficult to
determine whether and how these SNPs affect TCF7L2 expression level or its alternative splicing
in a given tissue. Nevertheless, great efforts have been made by numerous groups to decipher the
potential role of TCF7L2 in pancreatic islets and other tissues. Figure 2-3 summarizes the
potential metabolic functions of TCF7L2 that have been reported.
Tcf7l2 knockout mice were generated by Korinek and colleagues in 1998 (26). Tcf7l2-/- mice die
shortly after birth, associated with the lack of proliferative compartments in the prospective crypt
regions between the intestinal villi (26). No examinations were performed on potential
abnormalities in pancreatic development or metabolism in these knockout mice during the
neonatal stages. Two additional TCF7L2 knockout mouse lines were generated recently by
separate groups (11, 88). The knockout mouse study by Savic et al. indicated the potential
deleterious effects of TCF7L2 on glucose metabolism (11). Briefly, neonatal Tcf7l2-/- mice
exhibited enhanced glucose tolerance, while mice harbouring various copies of Tcf7l2 were
characterized by glucose intolerance (11).
19
Figure 2-3. Summary of the Potential Metabolic Functions of TCF7L2. The beneficial versus deleterious role of TCF7L2 in the pancreas is controversial and under debate. GLP-1, glucagon-like peptide-1. GIP, gastric inhibitory polypeptide.
2.2.9.1 Controversial Observations on the Role of TCF7L2 in Pancreatic β-cells
Initial investigations on the role of TCF7L2 in pancreatic β-cells indicated potential deleterious
effects of TCF7L2. For example, Lyssenko et al. reported that the CT/TT genotypes of SNP
rs7903146 are strongly associated with the risk of type 2 diabetes in two independent cohorts (9).
They found that isolated pancreatic islets from cadaveric donors who had type 2 diabetes showed
increased mRNA levels of TCF7L2. Furthermore, the T risk allele carriers exhibited a significant
elevation of TCF7L2 mRNA expression in their pancreatic islets, associated with impaired
insulin secretion and incretin response (35). As presented above, a more recent transgenic mouse
study also demonstrated a potential deleterious role of TCF7L2 in mouse pancreatic islets (11).
These observations, however, are in contrast to multiple lines of work by Shu and colleagues that
reveal potential beneficial effects of TCF7L2 in pancreatic β-cells (7, 8, 30). They found that in
20
isolated human or mouse pancreatic islets, siRNA-mediated TCF7L2 depletion resulted in a
significant increase in β-cell apoptosis and decrease in β-cell proliferation, associated with the
attenuation of glucose-stimulated insulin secretion (7). In contrast, over-expression of TCF7L2
protected islets from glucose- and cytokine-mediated apoptosis (7). In another study, while they
showed increased Tcf7l2 mRNA expression levels in the islets of various rodent type 2 diabetes
models, they demonstrated that TCF7L2 protein levels were actually decreased (30). In parallel,
expression of TCF7L2 as well as the GLP-1 receptor (GLP-1R) and GIP receptor (GIPR) was
also decreased in islets from humans with type 2 diabetes as well as in isolated human islets
depleted of TCF7L2 via siRNA treatment (30). Furthermore, the stimulation of insulin secretion
by glucose, GLP-1, and GIP, but not potassium chloride (KCl) or cAMP, was impaired in
TCF7L2 siRNA-treated isolated human islets, while the loss of TCF7L2 resulted in decreased
GLP-1 and GIP-stimulated Akt phosphorylation, and Akt-mediated FoxO phosphorylation and
nuclear exclusion (30). Finally, over-expression of TCF7L2 induced proliferation of islet-like
cell clusters in human isolated exocrine tissue (8).
In addition, two transgenic mouse model studies have reported that β-cell-specific loss or
knockdown of Tcf7l2 leads to impaired glucose homeostasis, suggesting that TCF7L2 serves a
beneficial role in regulating pancreatic β-cell function (89, 90). da Silva Xavier et al. showed
using the Pdx1-Cre/LoxP system that selective deletion of Tcf7l2 in the pancreas causes
abnormal glucose tolerance and insulin secretion in mice (89). Similarly, Takamoto et al. very
recently demonstrated through an alternative mouse model approach in which a dominant
negative form of TCF7L2 was expressed in β-cells using the Ins2 promoter that TCF7L2 plays a
crucial role in glucose metabolism by positively regulating β-cell mass (90).
21
These findings collectively suggest that β-cell function and survival are positively regulated by
the expression of TCF7L2 in type 2 diabetes. The authors note that the earlier observations
showing increased TCF7L2 mRNA expression levels in type 2 diabetes may actually be
consistent with their findings because protein levels of TCF7L2 are oppositely regulated.
Whether the expression of TCF7L2 protein is actually decreased in type 2 diabetes patients or
carriers of risk SNPs has not been reported. Table 2-1 lists the various in vivo and in vitro studies
performed to date and categorizes them based on the tissue of study and whether it is concluded
that TCF7L2 serves a glucose-lowering or glucose-raising effect.
The picture is further complicated by a single thorough study that reported no appreciable
phenotype following tamoxifen-induced β-cell-specific loss of Tcf7l2 using the RIP-Cre-
ERT2/LoxP system (10). It is worthy of noting one fundamental difference between this mouse
model and the previously mentioned pancreatic mouse models: This study’s genetic
manipulation was induced during the adult stage whereas the other pancreatic mouse models
invoked transgene expression at least by the time of birth. It is possible that TCF7L2 may exert
its critical role at earlier developmental stages of the β-cell.
Nevertheless, the seemingly controversial conclusions made by different groups on the beneficial
versus deleterious role of TCF7L2 in pancreatic β-cells could also occur due to the expression of
different isoforms of TCF7L2 in a cell-type specific manner (7, 11, 30, 35, 56). A recent study
demonstrated that different isoforms of TCF7L2 in β-cells had opposite effects on β-cell
survival, function, and Wnt activation (91). However, no significant association has been
observed yet between type 2 diabetes risk SNPs of TCF7L2 and the alternative splicing of
TCF7L2 (92). Clearly, further investigation is warranted to clarify the role of TCF7L2 in
pancreatic islets.
22
Table 2-1. List of In Vitro and In Vivo Metabolic Functional Studies on TCF7L2. Studies are categorized by tissue and whether the proposed function of TCF7L2 contributes to lowering or raising blood glucose levels.
Organ Glucose-Lowering Glucose-Raising Whole-body N/A Savic et al., 2011 (11) Pancreas da Silva Xavier et al., 2009 (56)
da Silva Xavier et al., 2012 (89) Liu and Habener, 2008 (93) Prokunina-Olsson, 2009 (92) Shu et al., 2008 (7) Shu et al., 2009 (94) Shu et al., 2012 (8) Takamoto et al., 2014 (90)
Lyssenko et al., 2007 (9)
Liver Ip et al., 2012 (15) Neve et al., 2014 (95) Norton et al., 2011 (96) Oh et al., 2012 (97)
Boj et al., 2012 (10)
Intestine Shao et al., 2013 (98) Yi et al., 2005 (3)
N/A
2.2.9.2 Role of TCF7L2 in the Expression and Function of the Incretin Hormones
This topic will be discussed below in section 2.3.
2.2.9.3 Role of TCF7L2 in the Regulation of Hepatic Gluconeogenesis
TCF7L2 is expressed in organs other than the gut and pancreatic islets, including liver, brain,
muscle and fat tissues. As these organs are involved in mediating metabolic homeostasis as well,
it is necessary and interesting to examine the metabolic function of TCF7L2 and Wnt signaling
in those organs.
As discussed above, Lyssenko et al. found that the CT/TT genotypes of SNP rs7903146 were
also associated with enhanced rates of hepatic glucose production (35). A subsequent human
23
study also demonstrated that this risk allele was associated with elevated hepatic glucose
production, even in patients undergoing a hyper-insulinemic clamp, suggesting that the defect in
hepatic glucose production occurred at the level of the liver rather than as a secondary effect of
impaired pancreatic insulin production (12). There is also evidence of an association between the
TCF7L2 rs7903146 SNP and hepatic insulin resistance (99).
The Wnt signaling pathway is known to be important in the development and zonation of the
embryonic liver (100). However, little effort has been made to explore the hepatic role of
TCF7L2 and Wnt signaling in regulating glucose homeostasis in adulthood until very recently.
Liu et al. found that starvation induced the expression of mRNAs that encode different Wnt
isoforms in hepatocytes. They also demonstrated that partial knockdown of hepatic β-catenin via
injection of adenoviral Cre recombinase in floxed β-catenin mice resulted in reduced fasting and
fed plasma glucose levels, improved pyruvate tolerance, and reduced hepatic expression of Pck1
and G6pc, which code for the rate limiting enzymes of gluconeogenesis, phosphoenolpyruvate
carboxykinase (PEPCK) and glucose-6-phosphatase (G6P), respectively (101). Over-expression
and knockdown of β-catenin led to increased and decreased levels, respectively, of glucose
production and expression of Pck1 and G6pc in isolated primary hepatocytes from these mice
(101). Interestingly, Liu et al. found that β-catenin could physically interact with FoxO1 and that
loss of β-catenin attenuated the stimulatory effect of FoxO1 over-expression on G6pc expression
(101). An evolutionarily conserved interaction between FoxO1 and β-catenin was previously
demonstrated in other cell lineages in which FoxO proteins required β-catenin for their role in
oxidative stress (102). The observation by Liu et al. is consistent with the notion that FoxO1-
stimulated gene expression is dependent on the interaction between FoxO1 and β-catenin (101,
103, 104). The stimulatory role of β-catenin per se in hepatic gluconeogenesis was additionally
confirmed more recently (97).
24
The contribution of TCF7L2 itself to the regulation of gluconeogenesis was first identified in
vitro by Norton et al. (96). Over-expression and knockdown of TCF7L2 led to decreased and
increased levels, respectively, of glucose production as well as Pck1 and G6pc expression in the
rat H4IIE hepatoma cell line (96). They additionally detected direct binding of TCF7L2 to
multiple genes involved in glucose metabolism including Pck1. Thus, TCF7L2 is a potential
negative regulator of gluconeogenesis.
Further support of the opposite roles of TCF7L2 and β-catenin in hepatic gluconeogenesis was
presented very recently. Oh et al. demonstrated in vivo that loss of hepatic TCF7L2 via
adenovirally-delivered TCF7L2 shRNA caused impaired glucose and pyruvate tolerance and
increased hepatic glucose production and gluconeogenic gene expression (97). When they over-
expressed TCF7L2 and β-catenin simultaneously via adenoviruses in primary mouse
hepatocytes, they found that there was no effect versus control infected cells, and thus the
opposite effects of TCF7L2 and β-catenin on gluconeogenic gene expression could balance each
other (97). Importantly, they showed by chromatin immunoprecipitation that TCF7L2 could
directly inhibit gluconeogenic gene expression by binding to the promoters of Pck1 and G6pc at
positions adjacent to the FoxO1 and CREB/TORC2 binding sites, and consequently decrease the
chromatin occupancy of FoxO1, CREB, and TORC2 (97). Thus, they suggested an alternative
mechanism by which TCF7L2 can directly inhibit gluconeogenesis by blocking the promoter
binding of important transcriptional activators, independently of β-catenin interaction and
downstream Wnt signaling (97). These seemingly contradictory observations between the roles
of β-cat and TCF7L2 can be resolved by considering the crosstalk among Wnt, metabolic insulin
and the aging/stress FoxO signaling pathways (discussed in section 2.2.10).
25
Although establishment of the indirect or direct mechanisms involved in the regulation of
gluconeogenesis by TCF7L2 or β-catenin requires further study, it is becoming clear that the
Wnt signaling transcription factor TCF7L2 plays a role in negatively regulating hepatic
gluconeogenesis in response to feeding cues. While metabolic roles of TCF7L2 have also been
identified in other organs, it is likely that decreased levels and function of hepatic TCF7L2
during insulin resistance may result in elevated glucose production and thus contribute to
hyperglycemia and type 2 diabetes. The recent discoveries in this field provide further insights
into TCF7L2 as an important type 2 diabetes susceptibility gene.
2.2.9.4 Potential Metabolic Effects of TCF7L2 in Other Organs
Wnt signaling negatively regulates adipogenesis (76) and positively regulates bone formation
(105). Furthermore, Wnt ligands released by adipocytes stimulate insulin secretion (79). TCF7L2
is expressed in adipocytes and its expression can be down-regulated by insulin (106). In vitro
assays showed that insulin repressed TCF7L2 mRNA expression, and the repression can be
attenuated by insulin resistance with the addition of free fatty acids palmitate or oleate. Insulin
resistant human subjects express higher levels of TCF7L2 in subcutaneous adipose tissue (106).
Prokunina-Olsson and colleagues demonstrated that omental and subcutaneous adipose tissue
express different alternatively spliced forms of TCF7L2. However, there is no association
between the expression of alternatively spliced TCF7L2 isoforms and TCF7L2 type 2 diabetes
risk SNPs (29). TCF7L2 is also expressed in skeletal muscle, although its role in glucose uptake
or insulin signaling is currently unknown (107).
TCF7L2 is expressed in the brainstem, hypothalamus, and other areas of the brain. TCF7L2
knockout mice show abnormalities in their pituitary gland (108). Since both incretin hormones
26
and their receptors are expressed in brain neurons (109), and brain GLP-1 signaling controls
satiety and peripheral insulin signaling (109, 110), it is important to examine whether brain
TCF7L2 plays a role in energy and glucose homeostasis. Our lab recently demonstrated that
impairment of Wnt signaling in the brain through expression of dominant negative TCF7L2 in
Gcg-expressing cells caused a reduction in brain Gcg expression, impaired glucose homeostasis,
as well as impairment of feeding-mediated hypothalamic AMP-activated protein kinase (AMPK)
repression, suggesting that crosstalk between brain Wnt and GLP-1 signaling is an underlying
mechanism of the metabolic functions of central GLP-1 (98).
2.2.10 Crosstalk between Insulin, FoxO, and Wnt Signaling Pathways
It appears seemingly contradictory that TCF7L2 is a negative regulator while β-catenin is a
positive regulator of gluconeogenesis since they both function as downstream Wnt pathway
effectors. One potential explanation relies on the consideration of the crosstalk between
components of the Wnt, insulin, and FoxO1 signaling pathways, independent of downstream
Wnt target genes (13). FoxO proteins mediate the effects of stress and aging. The functions of
FoxO proteins are negatively regulated by insulin and certain growth factors (111). In the
absence of insulin or growth factors, FoxOs are mainly located within the nuclei and up-regulate
a set of target genes that promote cell cycle arrest, stress resistance, as well as apoptosis (112).
Insulin and a battery of growth factors may activate Akt [also known as protein kinase B (PKB)]
or serum- and glucocorticoid-induced protein kinase (SGK), resulting in the stimulation of FoxO
phosphorylation and nuclear exclusion (111). Essers et al. demonstrated an evolutionarily
conserved interaction between FoxOs and β-cat, suggesting the existence of crosstalk between
FoxO and Wnt signaling pathways (102). Since FoxO can be inactivated by insulin and growth
27
factors, scientists have explored the relationship among these three essential signaling cascades.
Indeed, extensive investigations have revealed that oxidative stress plays a pathogenic role in
skeletal involution, independent of aging (103, 113-117). More importantly, recent studies have
further demonstrated a novel pathophysiological role for the interaction between FoxO proteins
and β-cat in bone diseases: the reduction of β-cat/TCF-mediated gene expression. Figure 2-4
illustrates our current understanding of the crosstalk between the three signaling cascades.
Obviously, β-cat is “not just for frizzleds anymore” (118). The function of β-cat is bi-directional.
This pivotal molecule regulates many physiological and pathological events via controlling cell
cycle progression and cell growth. When teamed up with TCF, β-cat activates Wnt target gene
expression and stimulates these two processes. When it is partnered with FoxOs, β-cat stimulates
FoxO target gene expression and represses cell cycle progression and cell growth. Hence, FoxOs
and TCF factors compete for a limited pool of β-cat, such that the balance is shifted towards
FoxO activity during aging and oxidative stress. Insulin and growth factors, however, are able to
restore balance (36).
As presented above, TCF7L2 and Wnt signaling are likely negative regulators of
gluconeogenesis in hepatocytes (96). However, β-cat ablation improves glucose disposal and
inhibits gluconeogenic gene expression (119). How can one explain the opposite outcomes of
knocking-down these two effectors of the Wnt signaling pathway on hepatic gluconeogenesis?
We suggest that this involves the crosstalk among the three signaling cascades in hepatocytes.
One may speculate that free β-cat is a limiting factor of FoxO1 in up-regulating gluconeogenic
gene expression during fasting in response to the elevation of glucagon levels. Glucagon
signaling results in the up-regulation of FoxO1-mediated gene transcription to stimulate
gluconeogenesis. However, upon feeding, insulin inhibits FoxO1. We speculate that this will
then allow free β-cat to bind to TCF7L2 and contribute to the repression of gluconeogenic gene
28
expression. In the case of Wnt activation or TCF7L2 over-expression, FoxO1 may be
outcompeted by excess TCF7L2 and/or β-cat may no longer be a limiting factor. Alternatively,
TCF7L2 may utilize a yet to be explored mechanism or co-factor to exert its repressive effect on
gluconeogenic gene expression, which might not even involve Wnt signaling.
Figure 2-4. Crosstalk among Wnt, Insulin, and FoxO Signaling Cascades. TCF and FOXO compete with each other for a limited pool of free β-cat. Aging and oxidative stress shift the balance in favor of FOXO signaling via JNK to activate downstream FOXO target genes. Contrastingly, insulin and growth factors shift the balance in favor of Wnt/TCF signaling by facilitating the nuclear exclusion of FOXO via PKB/SGK as well as by activating β-cat, thus resulting in the activation of downstream Wnt target genes. PKB, protein kinase B; ROS, reactive oxygen species; JNK, c-Jun N-terminal kinase; FOXO, forkhead box O; SGK, serum- and glucocorticoid-induced protein kinase.
29
2.3 Involvement of TCF7L2 in Glucagon-Like Peptide-1 Metabolism
2.3.1 Introduction
In addition to the recently discovered roles of TCF7L2 in regulating pancreatic β-cell function
and hepatic gluconeogenesis, TCF7L2 is also involved in the production and function of the
incretin hormone glucagon-like peptide-1 (GLP-1), which has been a major focus of our lab in
the last decade (3, 98, 120, 121). GLP-1 is importantly responsible for stimulating insulin release
immediately upon food intake. This section describes the production and function of this
metabolic hormone, as well as the evidence implicating TCF7L2 as an important regulator of
both the production and function of GLP-1. Finally, I will introduce the degradation products of
GLP-1 which have recently been shown to exert metabolic function as well. Certain sub-sections
have been reproduced from a review article published by Chiang, Ip, and Jin in Frontiers in
Physiology, 2012, with modification (14).
2.3.2 Overview
In 1902, two English physiologists, Sir William Maddock Bayliss and Ernest Henry Starling
speculated that intestinal mucosa contains a hormone which stimulates endocrine secretions from
the pancreas after the ingestion of carbohydrates (122). It was observed that oral glucose
administration generates a much stronger insulin secretory response from pancreatic β-cells
compared to intravenous injection of equal amounts of glucose (122-124). In the 1930s, the
terms “incretin” or “enterogastrone” were proposed by several scientists for a hormonal extract
from the duodenum (125). Incretins were described as intestinal-derived factors that stimulate
30
insulin release and lower blood glucose in response to nutrient intake (109). This incretin effect
accounts for approximately 50-70% of insulin released from pancreatic β-cells. Hence, incretins
are defined as a group of gastrointestinal hormones that potentiate insulin release from pancreatic
islet β-cells after food ingestion, prior to the elevation of blood glucose levels. The first incretin,
gastric inhibitory polypeptide (GIP, also known as glucose-dependent insulinotropic peptide)
was discovered by Brown and colleagues in the 1970’s (126-130). About a decade later, the
cDNA encoding glucagon in fish, rodents and humans was isolated which led to the discovery of
the second incretin, GLP-1 (131-136).
GLP-1 is encoded by the proglucagon gene (Gcg) and is produced in intestinal L cells. The same
Gcg gene is also expressed in pancreatic α-cells, where it encodes the key glucose-elevating
hormone glucagon. As intestinal GLP-1 and pancreatic glucagon are encoded by the same gene
but exert opposite effects on glucose homeostasis, great efforts have been made to decipher
signaling pathways that regulate Gcg expression in a tissue-specific manner (19, 120, 137, 138).
Our group has demonstrated that the two key effectors of the Wnt signaling pathway, β-cat and
TCF7L2, specifically up-regulate Gcg mRNA expression and GLP-1 production in gut endocrine
L cells (3, 120). Shortly after we presented this finding (3, 120), TCF7L2 was identified as an
important type 2 diabetes risk gene in a large-scale GWAS (4). Interestingly, it was demonstrated
that the Wnt signaling pathway and the TCF effector also regulate the expression of Gip, the
gene encoding the other incretin GIP (139). Furthermore, recent investigations revealed that the
effectors of the Wnt signaling pathway may modulate the functions of the two incretin hormones
as well, and that TCF7L2 regulates the expression of the GLP-1 receptor (GLP-1R) and GIP
receptor (GIPR) in pancreatic β-cells (30, 85).
31
2.3.3 Incretin Production
The majority of GIP is produced by intestinal endocrine K cells in the mucosa of the duodenum
and jejunum; however, the Gip gene has also been shown to be expressed in pancreatic α-cells
(140). GIP is encoded by the Gip gene and is derived from a 153 amino acid pro-hormone,
proGIP. In the gut, post-translational processing by the prohormone convertase 1/3 (PC3) leads
to the production of the biologically active hormone GIP(1-42). However, a small population of
K cells also express PC2, leading to the production of lesser amounts of GIP(1-31) and GIP(1-
31)amide (125). In pancreatic α-cells, proGIP is processed by both PC3 and PC2 to yield GIP(1-
31).
On the other hand, GLP-1 is produced by intestinal endocrine L cells throughout the entire small
intestine and colon, with highest levels generated within the distal ileum and colon (141). GLP-1
is encoded by the proglucagon gene Gcg, which is expressed in three tissues: pancreatic α-cells,
intestinal endocrine L cells, and neurons in the hypothalamus and caudal brainstem (142). While
the exact same Gcg mRNA transcript and 180 amino acid precursor protein are expressed in all
three tissues, tissue-specific post-translational proteolytic cleavages by PC2 and PC3 result in the
production of glucagon in pancreatic α-cells, while GLP-1 is produced in the intestine and brain
(143, 144). In addition, Gcg encodes glucagon-like peptide-2 (GLP-2) in the gut which functions
as a growth factor for the small intestine (145). In pancreatic α-cells, the main products generated
by the cleavage of the prohormone by PC2 and PC3 are glucagon, glicentin-related pancreatic
polypeptide (GRPP), intervening peptide-1 (IP1) and major proglucagon fragment (MPGF).
During embryonic stages or after pancreatic islets encounter stress, small amounts of GLP-1 can
be detected in pancreatic α-cells. In the intestine and brain, the post-translational products
include glicentin, GLP-1, GLP-2, intervening peptide-2 (IP2), GRPP and oxyntomodulin.
32
Intestinal endocrine L cells are located in the luminal epithelium along all regions of the small
intestine, directly contacting luminal nutrients at the apical surface and neural and vascular tissue
at the basolateral surface (146). GLP-1 is released rapidly from L cells upon oral nutrient
ingestion (carbohydrate and fat-rich meal) in a biphasic pattern, consisting of an early phase peak
(within 10-15 minutes) followed by a second phase peak (30-60 minutes) (147-150).
The vagus nerve of the autonomic nervous system is an important mediator of nutrient-induced
first-phase GLP-1 secretion as bilateral subdiaphragmatic vagotomy completely blocks fat-
induced GLP-1 secretion, while direct electrical stimulation of the celiac branches of the vagus
leads to GLP-1 secretion (151). The second phase of GLP-1 secretion, however, is caused by
direct stimulation of L cells by digested nutrients (152). Secretion of GLP-1 can be stimulated by
the activation of a number of intracellular signaling cascades including protein kinase A (PKA),
protein kinase C (PKC), calcium, and mitogen-activated protein kinase (MAPK) as well as via
glucose metabolism and potassium channel closure (153).
Negative regulation of GLP-1 is largely achieved through its rapid degradation by the ubiquitous
proteolytic enzyme dipeptidyl peptidase-4 (DPP-4), resulting in a half-life of less than 2 minutes
(154). This serine protease cleaves GLP-1 following position two, resulting in a product typically
considered inactive, either GLP-1(9-37) or GLP-1(9-36)amide (155). DPP-4 is widely expressed
throughout the body especially on the surface of intestinal endothelial cells, resulting in rapid
inactivation of the majority of GLP-1 prior to entry into the systemic circulation (156). The short
half-life of GLP-1 also prevents native GLP-1 from being used as a therapeutic drug directly.
Two new categories of type 2 diabetes drugs, however, have been developed based on the
glucose-lowering effect of GLP-1: GLP-1 analogs such as exenatide (or exendin-4) and
liraglutide, and inhibitors of DPP-4 such as sitagliptin and vildagliptin (157).
33
GLP-1 is also subject to degradation by another endopeptidase, neutral endopeptidase 24.11
(NEP 24.11) to produce the nonapeptide GLP-1(28-36)amide (158). Figure 2-5 shows the
different GLP-1 derivatives that result from the degradation of GLP-1 by DPP-4 and NEP 24.11
(Figure 2-5). GLP-1(7-37) and GLP-1(7-36)amide are typically considered the two biologically
active forms. While the peptides that result from cleavage of GLP-1 by DPP-4 or NEP 24.11
have typically been considered to be inactive, recent evidence suggests that this may not be the
case. This will be further explored in section 2.3.10.
Extensive investigations in the past two decades have revealed both overlapping and contrasting
actions of the two incretin hormones. Both GLP-1 and GIP exert their functions mainly through
their respective receptors, both of which belong to the seven-transmembrane domain G-protein
coupled receptor (GPCR) super-family (141, 159). Cyclic AMP (cAMP) and calcium have been
recognized as second messengers for both incretin hormones. Although initial studies focused on
the effects of these two hormones in pancreatic β-cells, GLP-1R and GIPR have been detected on
cells in other organs and the extra-pancreatic effects of these two hormones have been actively
investigated.
34
Figure 2-5. Amino Acid Sequences of GLP-1 and its Derivatives. GLP-1(7-37) and GLP-1(7-36)amide are typically considered the two biologically active forms. DPP-IV, dipeptidyl peptidase 4; GLP-1, glucagon-like peptide-1; NEP 24.11, neutral endopeptidase 24.11.
2.3.4 Pancreatic Functions of GLP-1
The recognition of the metabolic effects of the incretin hormones led to the creation of the term
“enteroinsular axis”, defined as the connection between the gut and pancreatic islets (160).
Pancreatic functions of GLP-1 and GIP principally involve the stimulation of insulin secretion in
a synergistic manner with glucose via the closure of ATP-sensitive K+ channels (KATP), resulting
in subsequent membrane depolarization, rise in intracellular Ca2+ level, and Ca2+-induced insulin
secretion (161, 162). Both PKA and exchange protein activated by cAMP (Epac) signaling
pathways were found to be involved in this process (163). GLP-1 and GIP were also shown to
stimulate insulin secretion via inhibiting voltage-dependent K+ channels (164). In addition, GLP-
1 as well as GIP increased insulin mRNA levels, possibly through stimulating insulin gene
transcription and mRNA stability. GLP-1 inhibits glucagon secretion from pancreatic α-cells and
stimulates the secretion of somatostatin from pancreatic δ-cells (165, 166). The stimulation of
somatostatin secretion by GLP-1 could be directly mediated by its receptor on pancreatic islet δ-
cells, while the inhibition of glucagon secretion could be indirectly mediated through the
35
inhibition of somatostatin and the stimulation of insulin secretion. Additional pancreatic effects
of GLP-1 include the sensitization of β-cells to glucose, as well as the induction of proliferation
and neogenesis of β-cells (167-169). GLP-1 and its analogue, exendin-4 (Ex-4), were also shown
by our group and others to reduce the expression level of thioredoxin-interacting protein
(TxNIP), a mediator of glucotoxicity (170, 171). This effect relies on proteasome-mediated
TxNIP degradation, involving both PKA and Epac signaling cascades (170). Thus, in pancreatic
β-cells, the beneficial effects of GLP-1 consist of its metabolic effect on stimulating insulin
secretion, its proliferative effect on stimulating β-cell growth and neogenesis, and its protective
effect on reducing glucotoxicity (172).
2.3.5 Extra-Pancreatic Functions of GLP-1
The GLP-1 receptor (GLP-1R) is expressed in tissues including pancreatic islet β- and δ-cells,
lung, stomach, heart, intestine, kidney, and certain brain neurons. Whether it is also expressed in
hepatocytes is controversial and is discussed in the next sub-section (173-176). Figure 2-6
summarizes the pancreatic and extra-pancreatic functions of GLP-1. It inhibits gastric emptying
and attenuates the postprandial rise in plasma glucose (177, 178). GLP-1 also exhibits cardio-
protective effects in experimental models of cardiac injury (179-181). In the brain, GLP-1
inhibits food intake, presumably via the activation of the GLP-1R in the hypothalamus and
brainstem (110, 182-185). In vivo treatment of Ex-4 produces effects in hepatocytes, skeletal
muscle, and adipocytes. However, since GLP-1R expression in these tissues is questionable,
indirect mechanisms may be involved in eliciting these effects (109). The GIP receptor (GIPR) is
expressed in tissues including the pancreas, stomach, small intestine, adipose tissue, heart, testis,
endothelial cells, bone, spleen, thymus, and brain neurons. GIP plays a role in neural progenitor
36
cell proliferation and behavior modification (186). It also stimulates lipogenesis and bone
formation (187). Detailed descriptions of function of these two incretin hormones have been
summarized in many excellent review articles (159, 188, 189).
Figure 2-6. Schematic Presentation of the Function of GLP-1. In the pancreas, stomach, heart, and brain, the effects of GLP-1 are likely to be mediated by its specific receptor GLP-1R. As GLP-19−37 was also shown to exert protective effects in the heart and improve cardiac function, whether there is a yet to be identified receptor is under debate.
37
2.3.6 Role of GLP-1 in Hepatic Glucose Production
The opposing functions of the pancreatic hormones insulin and glucagon on regulating hepatic
glucose production are well-established, but the contribution of GLP-1 remains unclear. The
effect of GLP-1 on hepatic glucose production was previously deemed to be indirect, attributable
to the effect of GLP-1 on elevating pancreatic insulin production (190). Nevertheless, great
efforts have been made to determine whether GLP-1 also possesses an insulin-independent effect
on hepatic glucose production.
An early report in 1994 showed that infusion of GLP-1 resulted in lower rates of hepatic glucose
production in human subjects, attributable to the pancreatic effect of GLP-1 on insulin secretion
(190). Other studies used the pancreatic clamp technique in which pancreatic hormones are
suppressed by somatostatin infusion in an attempt of ruling out the pancreatic effects of GLP-1.
Several studies could not clearly demonstrate insulin-independent effects of GLP-1 on peripheral
glucose turnover or hepatic glucose production (191-193). One study, however, showed that
GLP-1 produced a 17% decrease in glucose appearance with no significant effect on glucose
disappearance. This suggests that GLP-1 suppresses hepatic glucose production independently of
its actions on pancreatic hormones (194). Consistently, a very recent pancreatic clamp study
performed in humans demonstrated that infusion of physiological post-prandial levels of GLP-1
reduced hepatic glucose production by 27% but had no effect on whole-body glucose disposal
(195). These later studies suggest that GLP-1 possesses insulin-independent effects on hepatic
glucose production.
The mechanism by which GLP-1 exerts insulin-independent effects on the liver, if true, are also
unclear. Early investigations suggested that the GLP-1R did not exist on liver hepatocytes (109,
38
173) while a few recent studies have suggested the opposite (175, 176, 196, 197). However, a
very recent study using GLP-1R-knockout mice demonstrated that commercial antibodies used in
the previous studies to detect GLP-1R protein in the liver generate false positive signals and are
thus unreliable (198). Thus, it remains controversial to this day as to whether the GLP-1R is
present on hepatocytes and mediates hepatic insulin-independent effects of GLP-1.
2.3.7 Role of TCF7L2 in Regulating Intestinal GLP-1 Production
The effect of TCF7L2 in hormone gene expression was initially demonstrated by our group
(120). Ni et al. demonstrated that both lithium (which mimics the function of Wnt ligands) and a
constitutively-active β-cat (S33Y mutant) stimulated the activity of the Gcg promoter (120).
Lithium was also shown to stimulate endogenous Gcg mRNA expression and GLP-1 production
in the mouse intestinal GLUTag and STC-1 endocrine cell lines, as well as in fetal rat intestinal
cell (FRIC) cultures (120). It was then identified that the stimulatory effect of lithium on Gcg
expression occurred in intestinal endocrine L cells, but not in pancreatic α-cells. Activation of
Gcg promoter activity is dependent upon a TCF binding site within the G2 enhancer element of
the Gcg promoter (3). Since the G2 enhancer element has been shown by Furstenau et al. to
mediate the stimulatory effects of both cAMP and calcium on Gcg promoter activity (199), this
observation raised the question as to whether cAMP activates Gcg expression via cross-talking
with the Wnt signaling pathway. Yi et al. demonstrated with chromatin immunoprecipitation
(ChIP) that an in vivo physical interaction existed between TCF7L2 and the G2 enhancer element
(3). Western blotting, RT-PCR, and immunostaining demonstrated that TCF7L2 is abundantly
expressed in intestinal GLP-1 producing cells (3). Furthermore, dominant negative TCF7L2
39
attenuated both basal and lithium-stimulated Gcg mRNA expression and GLP-1 production in
the intestinal endocrine L cell line GLUTag (3).
In a continuation of this line of work, we recently generated a transgenic mouse model in which
the expression of dominant negative TCF7L2 is expressed under the control of the Gcg promoter
(98). Expression of dominant negative TCF7L2 Gcg-expressing cells inhibited the TCF7L2/Wnt
pathway and led to reduced expression of Gcg in both the gut and brain, but not in the pancreas,
suggesting that TCF7L2 and Wnt signaling control both gut and brain Gcg expression and
glucose homeostasis (98).
2.3.8 Role of TCF7L2 in Mediating Pancreatic GLP-1 Signaling
To explore the mechanistic role of TCF7L2 SNPs in conferring the risk of type 2 diabetes,
Schafer et al. genotyped 1100 non-diabetic German participants for the five known TCF7L2
SNPs and conducted oral glucose tolerance tests on these subjects (27). They then measured
GLP-1 secretion and performed intravenous glucose tolerance tests in a portion of the
participants. Their results confirmed that TCF7L2 SNPs are associated with reduced insulin
secretion. Plasma GLP-1 concentrations during oral glucose tolerance tests, however, were not
correlated with the status of TCF7L2 SNPs. These observations indicate that TCF7L2
polymorphisms may mainly affect the pancreatic incretin response rather than the intestinal
production of the incretin hormone. Many investigators have thus focused on assessing the
function of TCF7L2 in pancreatic β-cells, as discussed in section 2.2.9.1 (7, 30, 85).
Pancreatic β-cells are the most important targets of GLP-1 and GIP. Liu and Habaner assessed
the expression of TCF7L2 in the rat pancreatic β-cell line INS-1 and determined the presence of
40
Wnt activity in pancreatic islets using the TOPGAL transgenic mouse model. In this mouse
model, the expression of the β-galactosidase (LacZ) reporter is under the control of a regulatory
sequence consisting of three consensus TCF binding sites upstream of a minimal c-Fos gene
promoter (86). Liu and Habener found that islets from TOPGAL mice show increased LacZ
expression in response to treatment with Ex-4, although basal LacZ expression in islets was
shown to be low (85). The positive pancreatic LacZ staining in the TOPGAL mice, however,
could not be repeated by other investigators (41, 200).
Liu and Habener then showed that Ex-4 induces Wnt signaling in pancreatic β-cells (85). They
found that the expression of the two known Wnt downstream targets, cyclin D1 and c-Myc,
which are essentially involved in β-cell proliferation, can be stimulated by Ex-4. Furthermore, β-
cat Ser675 phosphorylation was stimulated by Ex-4 treatment in the INS-1 cell line. Finally, they
demonstrated the essential role of TCF7L2 in both basal and Ex-4-stimulated β-cell proliferation
utilizing both an siRNA approach and the TCF7L2 dominant negative molecule (85). This
observation suggests that β-cat/TCF, the effector of the Wnt signaling, may mediate the effect of
GLP-1 in stimulating β-cell proliferation. Thus, Wnt signaling and its effectors β-cat and TCF
proteins are important for both the production and function of the incretin hormone GLP-1 (3,
201, 202).
As presented earlier, Shu et al. established the positive relationship between the level of TCF7L2
and the levels of incretin receptors, including GLP-1R and GIPR (30). They investigated the
correlation between the pancreatic level of TCF7L2 and the levels of GLP-1R and GIPR. In the
diabetic db/db mouse model, the Vancouver Diabetic Fatty (VDF) Zucker rat and the high
fat/high sucrose diet-treated mouse model, TCF7L2 protein levels were lower in the diabetic
animals despite an increase in TCF7L2 mRNA levels in isolated islets compared to control
41
animal islets. A similar trend was also observed in pancreatic sections from patients with type 2
diabetes. In parallel, expression of GLP-1R and GIPR was also lower in islets from humans with
type 2 diabetes as well as in isolated human islets treated with TCF7L2 siRNA. Also, glucose-,
GLP-1-, and GIP-stimulated insulin secretion, but not KCl- or cAMP-stimulated insulin
secretion, was impaired in TCF7L2 siRNA-treated isolated human islets. Loss of TCF7L2
resulted in decreased GLP-1- and GIP-stimulated Akt phosphorylation, and Akt-mediated FoxO1
phosphorylation and nuclear exclusion. These findings suggest that β-cell function and survival
are positively regulated through the interplay between TCF7L2 and GLP-1R/GIPR expression
and signaling in type 2 diabetes.
2.3.9 Function of GLP-1 Metabolites
The active form of GLP-1 has typically been considered to be the GLP-1(7-36)amide and GLP-
1(7-37) “full length” peptides. As discussed in section 2.3.3, GLP-1 is efficiently cleaved by
DPP-4 to produce GLP-1(9-36)amide and GLP-1(9-37). While GLP-1(9-36)amide was
previously assumed to be inactive, more recent studies have shown protective effects of GLP-
1(9-36)amide in the heart (180, 203-207). GLP-1(9-36)amide increases myocardial glucose
uptake and improves left ventricular performance in dogs with dilated cardiomyopathy (208) and
mediates cytoprotection in cardiomyocytes through a pathway independent of GLP-1R (180,
181). In the brain, GLP-1(9-36)amide also rescues synaptic plasticity and memory deficits in a
mouse model of Alzheimer’s disease (209). In the HFD-induced obese mouse model, GLP-1(9-
36)amide was also shown to repress glucose production and inhibit body weight gain (210, 211).
The above-mentioned peptides of GLP-1 can also be cleaved by the endopeptidase NEP 24.11
near the C-terminus to produce the nonapeptide GLP-1(28-36)amide. This short peptide was
42
demonstrated to exhibit beneficial metabolic effects in the pancreas and liver (212-214). GLP-
1(28-36)amide has been shown to repress glucose production in hepatocytes as well as reduce
body weight gain and hepatic steatosis in the high fat diet-induced mouse model (213, 214). In
addition, GLP-1(28-36)amide confers protective and proliferative benefits in pancreatic β-cells
both in vitro and in the streptozotocin-induced type 1 diabetes model (215, 216).
NEP 24.11 can further cleave GLP-1 to produce an even shorter C-terminal fragment, GLP-1(32-
36)amide, a pentapeptide (217). GLP-1(32-36)amide was demonstrated to also attenuate the
development of obesity, diabetes, and hepatic steotosis, as well as increase energy expenditure in
diet-induced obese mice (217).
The recent discoveries of the biological functions of these shorter GLP-1 peptides raises the
question as to whether the “full length” GLP-1 hormone actually exerts its activity via its
degradation products. As the GLP-1R likely does not exist on hepatocytes, it is worthy of
investigating whether GLP-1 represses hepatic glucose production via the activity of its
metabolites, independently of its effect on pancreatic insulin production. Determination of the
mechanism by which these short metabolites of GLP-1 exert action on cells also requires further
investigation.
43
2.4 Hepatic Glucose Metabolism
2.4.1 Introduction
The previous sections have introduced TCF7L2 and Wnt signaling as regulators of hepatic
gluconeogenesis as well as the potential insulin-independent effects of GLP-1 in regulating
hepatic glucose production. The following section describes how the liver contributes to
maintaining glucose homeostasis with a focus on the process of hepatic gluconeogenesis.
2.4.2 Overview
Maintaining glucose homeostasis in the body is a challenge met through the coordinated actions
of fasting and feeding cues that balance the production and utilization of plasma glucose. The
liver is one such organ in the body that plays an essential role in energy metabolism (218). While
several metabolic organs such as muscle possess the capability to utilize fat or protein for energy
in addition to glucose, the brain relies largely on glucose as a source of energy. The liver has the
unique ability to produce and secrete free glucose into the bloodstream through the processes of
glycogenolysis (breakdown of glycogen) and gluconeogenesis (de novo production of glucose) to
help fulfil the requirements of other organs, especially the brain, during high energy demand or
starvation.
The processes responsible for maintaining glucose homeostasis in the liver as well as those that
occur in other metabolic organs to similarly alter glucose storage or utilization are coordinated
by the hormones glucagon and insulin in response to the availability of glucose. During the
fasting state, when glucose levels are low, glucagon is secreted by pancreatic α-cells and acts on
44
the hepatocyte to increase levels of glycogenolysis and gluconeogenesis while decreasing
glycogenesis and glycolysis (219). The end result of glucagon action is to increase plasma levels
of glucose to provide other organs such as the brain and muscle with energy and prevent
hypoglycemia. On the other hand, high glucose levels after feeding stimulate pancreatic β-cell
secretion of insulin which inhibits gluconeogenesis and glycogenolysis while promoting
glycogenesis and glycolysis in the liver (220). Insulin action results in the hepatic storage of
excess glucose as glycogen such that it can be mobilized at a later time point when energy is
required. When glycogen stores reach their maximum, glucose is further stored as fat in the form
of triglycerides primarily. Additional hormonal cues for gluconeogenesis include epinephrine
and glucocorticoids which stimulate the production of glucose primarily during severe glucose
deficits. Gluconeogenesis thus plays an important metabolic role as its activity is finely adjusted
in order to provide enough energy for the brain and other organs based on demand in response to
the appropriate fasting or feeding cues. This is achieved through complex regulatory mechanisms
in the cell that modulate the expression of gluconeogenic genes appropriately. When the
regulation of gluconeogenesis is perturbed, such as during insulin resistance, it can lead to
hyperglycemia and type 2 diabetes.
2.4.3 Gluconeogenesis
Gluconeogenesis is the process by which free glucose is produced from non-carbohydrate
energy-possessing molecules such as pyruvate, lactate, glycerol, and certain amino acids (Figure
2-7). While this process primarily occurs in the liver, the kidney also provides a smaller
contribution to overall gluconeogenesis (221). The canonical gluconeogenic pathway includes a
series of eleven anabolic reactions that convert pyruvate to glucose and is thus essentially the
45
reverse pathway of glycolysis (Figure 2-7). While many of the steps of glycolysis are reversible,
three reactions are irreversible and thus four additional enzymes are required to carry out
gluconeogenesis, namely pyruvate carboxylase (PC), phosphoenolpyruvate carboxykinase
(PEPCK), fructose-1,6-bisphosphatase (FBP), and glucose-6-phosphatase (G6P), coded by the
Pc, Pck1, Fbp1, and G6pc genes respectively. Regulation of the individual components of this
pathway through the actions of hormonal cues
allows for the adjustment of glucose production.
Figure 2-7. Gluconeogenesis. Gluconeogenesis is the process by which pyruvate is converted into free glucose. FBP, fructose-1,6-bisphosphatase; G6P, glucose-6-phosphatase; PC, pyruvate carboxylase; PEPCK, phosphoenolpyruvate carboxykinase.
46
The first committed step of gluconeogenesis is the conversion of pyruvate to oxaloacetate by PC
in the mitochondria. Although the expression of PC is ubiquitous since it is also required for
biosynthetic pathways besides gluconeogenesis including the citric acid cycle, higher expression
levels have been observed in the liver and kidney, suggesting that its role in these tissues is to
participate in gluconeogenesis (222, 223). The expression of Pc is transcriptionally regulated by
both glucagon and insulin (224).
Oxaloacetate is then converted into phosphoenolpyruvate by a rate-limiting step catalyzed by
PEPCK, either via its mitochondrial or cytoplasmic form (225). Unlike the majority of enzymes,
PEPCK is not subject to any post-translational modifications and thus its activity is governed by
its expression. Studies of the promoter of the Pck1 gene have identified numerous response
elements responsible for mediating the regulatory effects of hormones including glucagon,
epinephrine, glucocorticoids, and insulin on its transcription (226, 227). It is well established that
the levels of PEPCK expression correlate with glucose production and is thus often measured to
indicate the levels of gluconeogenesis (228).
After a series a steps in the reverse of glycolysis to convert phosphoenolpyruvate to fructose-1,6-
bisphosphate, FBP catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate.
There are two FBP genes, Fbp1 and Fbp2, which have been identified. While FBP2 may be
implicated in the muscle, FBP1 is primarily expressed in the liver and is subject to negative
allosteric regulation by fructose-2,6-bisphosphate, an indicator of energy availability via
glycolysis (229). Unlike the Pck1 promoter, little is known about the transcriptional regulation of
Fbp1 (230).
The terminal step of gluconeogenesis occurs after isomerization of fructose-6-phosphate to
glucose-6-phosphate, where G6P hydrolyzes glucose-6-phosphate to glucose in the endoplasmic
47
reticulum, allowing glucose to be secreted into the circulation. Expression of G6P is readily
detectable in the liver and kidney, but can also be seen at lower levels in the intestine (231). The
transcriptional regulation of the G6pc gene is very similar to that of Pck1 as its promoter
possesses a similar array of transcription factor binding sites for hormonal regulation while the
G6P protein is also devoid of any post-translational modifications (232).
2.4.4 Transcriptional Regulation of Gluconeogenesis
The regulation of gluconeogenesis is critical as it would both be undesirable to produce excess
glucose during energy surplus as well as to produce insufficient glucose during starvation. The
amount of gluconeogenesis occurring in a given hepatocyte is fine-tuned by the levels of
expression of the rate-limiting gluconeogenic enzymes, especially PEPCK and G6P (233). The
hormones glucagon, insulin, epinephrine, and glucocorticoids utilize a multitude of downstream
mediators and transcription factors to achieve regulation of gluconeogenesis by modulating
gluconeogenic gene transcription. Below, I will discuss several important transcription factors
and co-activators that have been implicated in the regulation of gluconeogenic gene expression.
2.4.4.1 cAMP Response Element-Binding Protein (CREB)
CREB is a helix-loop-helix leucine zipper transcription factor that is universally expressed and
activated during starvation (234). CREB binds to the cAMP response element (CRE) on its target
gene promoters upon activation (235). Glucagon and epinephrine both activate G-protein
coupled receptors on the cell membrane of hepatocytes that stimulate the activation of adenylyl
cyclase which catalyzes the conversion of ATP to cAMP. Increased cytoplasmic cAMP activates
PKA which in turn phosphorylates CREB at Ser133 to activate it. Activated CREB, along with
48
the co-activators p300 and CREB-binding protein (CBP), can bind to CRE on the promoters of
Pck1 and G6pc to stimulate gluconeogenic gene transcription (235, 236). Transgenic expression
of a dominant negative form of CREB in mice led to impaired Pck1, G6pc, and Pc gene
expression (236).
2.4.4.2 CREB-Regulated Transcription Co-Activator 2 (CRTC2/TORC2)
It has been demonstrated that CREB also requires the participation of the co-activator CRTC2
(237). While CRTC2 is normally sequestered in the cytoplasm in the fed state, it is
dephosphorylated upon fasting which facilitates its nuclear entry and allows it to enhance CREB-
dependent transcription (237). Upon insulin release during feeding, the serine/threonine kinase
Sik2 phosphorylates CRTC2, leading to its nuclear exclusion (238). Deficiency of CRTC2 in
mice resulted in reduced levels of Pck1, G6pc, and Pc expression and reduced glucose
production (237, 239). Interestingly, in the presence of high glucose levels, O-glycosylation of
CRTC2 at Ser70 and Ser171 by O-glycosyl transferase prevents its phosphorylation by Sik2,
promoting its retention in the nucleus and the stimulation of gluconeogenic gene expression
(240). This mechanism has been linked to the development of type 2 diabetes (240).
CRTC2 activity is also regulated by a fasting-inducible co-activator switch consisting of the
histone acetyltransferase p300 and the nutrient-sensing deacetylase sirtuin 1 (Sirt1) (241). During
fasting, increased glucagon-stimulated cAMP signaling leads to p300-mediated acetylation of
CRTC2, which prevents its ubiquitination and degradation and thus increases its activity.
However, when cAMP decreases upon feeding, Sirt1 deacetylates CRTC2 and promotes its
degradation to reduce gluconeogenesis (241). Liver-specific Sirt1 knockout mice exhibit
49
increased CRTC2 activity and hepatic glucose production (241). Thus, CRTC2 can be regulated
by its subcellular localization (phosphorylation) as well as its stability (acetylation).
2.4.4.3 Forkhead Box O1 (FoxO1)
FoxO1 belongs to the forkhead box O (FoxO) family of transcription factors, which regulate a
number of biological and metabolic activities including cell proliferation, aging, stress, and
energy expenditure (242). FoxO1 is the principal form in the liver which regulates hepatic
gluconeogenesis and is responsive to insulin (243-245). FoxO1 binds to DNA via its N-terminal
forkhead domain that recognizes a motif at the insulin-responsive element (IRE). In the absence
of insulin, FoxO1 is localized in the nucleus and cooperates with other transcriptional activators
including CREB, CBP, and peroxisome proliferator-activated receptor-γ co-activator 1α (PGC-
1α, see below) to stimulate gluconeogenic gene expression during fasting. Upon insulin
signaling, phosphorylation of FoxO1 by Akt leads to its nuclear exclusion, thus preventing its
stimulatory effect on gluconeogenesis (246).
The significance of FoxO1-regulated gluconeogenesis was realized in a study in diet-induced
obese mice where anti-sense oligonucleotide therapy to specifically inhibit FoxO1 expression led
to reduced glucose production and Pck1 and G6pc expression concomitant with improvements in
plasma glucose levels, glucose tolerance, and insulin sensitivity, suggesting that FoxO1 could be
a potential therapeutic target for improving insulin resistance (247). In addition, expression of a
dominant negative form of FoxO1 in the liver led to a reduction in both Pck1 and G6pc
expression, associated with lower fasting and fed glucose levels (248). A targeted deletion of
FoxO1 specifically in the liver reduced fasting glucose levels and Pck1 and G6pc expression,
significantly blunted the stimulatory effect of cAMP on gluconeogenesis, and significantly
50
attenuated the inhibitory effect of insulin on glucose production during the hyperinsulinemic
euglycemic clamp (249). Furthermore, loss of hepatic FoxO1 rescued insulin-receptor knockout
mice from excessive hepatic glucose production as well as neonatal diabetes and hepatic
steatosis, underscoring the important role of FoxO1 in hepatic insulin signaling (249).
Consistently, over-expression of a constitutively active form of FoxO1 led to increased Pck1 and
G6pc expression (250). These data collectively suggest that FoxO1 serves as a critical control
point in the regulation of hepatic gluconeogenesis by coordinating the downstream effects of
both glucagon and insulin.
2.4.4.4 Peroxisome Proliferator-Activated Receptor-γ Co-Activator 1α (PGC-1α)
Although originally identified for its role as a transcriptional co-activator for peroxisome
proliferator-activated receptor-γ, PGC-1α is also a co-activator for the transcription of
gluconeogenic genes including Pck1 and G6pc. It was demonstrated that the expression of PGC-
1α, along with Pck1 and G6pc, is up-regulated in the mouse liver upon fasting and induced by
cAMP and glucocorticoids (251). Over-expression of PGC-1α in primary hepatocytes or in vivo
via adenovirus increased the expression of Pck1 and G6pc as well as glucose production,
identifying its role in the regulation of gluconeogenesis (251). Further analysis showed that
PGC-1α is a direct target of CREB in vivo and that over-expression of PGC-1α could rescue the
deleterious effects of CREB deficiency in mice (236). Suppression of PGC-1α by siRNA in
hepatocytes or by liver-specific deletion in mice resulted in impaired fasting-induced Pck1 and
G6pc expression (252, 253). These studies highlight the important role of PGC-1α in the
stimulation of gluconeogenesis during the fasting state as a downstream target of glucagon-
stimulated cAMP signaling.
51
Additionally, it was found that PGC-1α acts in concert with the insulin-sensitive transcription
factor FoxO1 to synergistically activate gluconeogenic gene expression (254). It was
demonstrated that PGC-1α physically binds to and activates FoxO1 (254). FoxO1 is required for
the stimulatory effect of PGC-1α as PGC-1α is unable to induce gluconeogenesis in FoxO1-
deficient hepatocytes, while the cAMP response is severely blunted (249). As FoxO1 is inhibited
by insulin via phosphorylation-dependent nuclear exclusion, insulin suppresses PGC-1α-
stimulated gluconeogenesis (254). Interestingly, hepatic PGC-1α and gluconeogenic gene
expression is also elevated in several models of insulin action deficiency, including
streptozotocin-induced diabetic mice, ob/ob obese mice, and liver-specific insulin receptor
knockout mice, suggesting that PGC-1α is reduced by insulin (251). Indeed, insulin suppresses
PGC-1α expression via Akt-dependent inhibition of FoxO1, which also binds to and activates the
promoter for the Ppargc1a gene itself (236, 255). Thus, PGC-1α is also importantly involved,
together with FoxO1, in the down-regulation of gluconeogenesis upon feeding by insulin.
2.4.4.5 CCAAT Enhancer-Binding Protein (C/EBP)
C/EBP transcription factors (C/EBPα or C/EBPβ) are found in the liver and function as central
regulators of energy homeostasis. C/EBP regulates gluconeogenesis via occupying the C/EBP
binding motifs/sites on the Pck1 promoter. The C/EBP binding sites (for both α and β) and CRE
sites together constitute the cAMP-responsive unit (CRU) as deletion of any single binding site
prevents the induction of an artificial Pck1 reporter construct by cAMP in vitro (256). Systemic
deletion of either C/EBPα or C/EBPβ in mice results in neonatal lethality due to hypoglycemia,
with undetectable levels of Pck1 mRNA (257-259). Liver-specific deletion of C/EBPα, while not
lethal, results in reduced levels of Pck1 and G6pc expression (260, 261). In addition, when
C/EBPα was knocked down in the livers of db/db mice, which normally exhibit elevated Pck1
52
expression, the levels of Pck1 and G6pc expression as well as glucose production were reduced
(262). The study by Yang et al. also suggested that C/EBPα may play more of a role in basal
gluconeogenesis but is not required for cAMP-induced gluconeogenesis as cAMP could still
stimulate Pck1 and G6pc in the liver-specific C/EBPα knockout mouse, likely due to
compensation by C/EBPβ or CREB (261). Nevertheless, it is clear that C/EBP plays an important
role in the transcriptional regulation of gluconeogenic genes.
2.4.4.6 Hepatocyte Nuclear Factors (HNF)
As their name implies, HNFs are transcriptional factors typically expressed in the liver and are
responsible for regulating a number of liver-specific genes involved in liver development and
function. While HNF1, HNF3, HNF4, and HNF6 have all been implicated in the regulation of
gluconeogenesis, HNF4α has proven to play an essential role. Liver-specific deletion of HNF4α
in mice leads to drastically reduced levels of Pck1 and G6pc expression (263). Multiple HNF4α
binding sites have been located on the promoters of both Pck1 and G6pc (264, 265). It was
demonstrated that HNF4α is necessary for cAMP-stimulated gluconeogenesis as deletion of any
HNF4α binding site abolished the stimulatory effect of cAMP/PKA on the activity of a G6pc
reporter construct (266). Thus, it appears that the binding sites for HNF4α tightly coordinate with
the CRU as both are required for the response to cAMP signaling (266).
HNF4α-mediated transcription of gluconeogenic genes can be inhibited by the nuclear co-
repressors small heterodimer partner (SHP) and dosage-sensitive sex reversal adrenal hypoplasia
congenital critical region on the X chromosome gene 1 (DAX-1). SHP blocks the interaction of
HNF4α with the co-activator CBP while DAX-1 competes with binding to PGC-1α to inhibit
53
gluconeogenic gene expression (267, 268). Thus, HNF4α presents as another important
transcription factor to add to the complexity of the transcription of gluconeogenic genes.
2.4.4.7 Glucocorticoid Receptor (GR)
Glucocorticoids are steroid hormones, secreted by the adrenal cortex during stress or starvation,
which stimulate the transcription of Pck1 and G6pc in the liver. Following the binding of
glucocorticoids to the cytoplasmic GR, the glucocorticoid-GR complex translocates into the
nucleus where it can then bind to the glucocorticoid responsive elements (GRE) on the Pck1 and
G6pc promoters. The sequence containing the GREs along with several accessory binding sites is
called the glucocorticoid responsive unit (GRU).
Mutation of any GRE in either the Pck1 or G6pc promoter caused a significant reduction in the
activity of their respective reporter constructs in response to glucocorticoid stimulation (269-
271). In addition, it was demonstrated that glucocorticoids act cooperatively with other
gluconeogenic activators including HNF4α and FoxO1 (272, 273).
2.4.4.8 Summary of Regulation
Clearly, the transcriptional regulation of gluconeogenic gene expression is extremely complex,
but can be summarized as follows. During fasting, glucagon increases cAMP and the
phosphorylation of CREB via PKA. Activated CREB binds to CRE on the Pck1 and G6pc gene
promoters, together with CRTC2, to stimulate gluconeogenic gene transcription and thus elevate
glucose production. CREB/CRTC2 also up-regulates PGC-1α which, in turn, interacts with
FoxO1 to increase gluconeogenic gene transcription. In addition, glucocorticoids are secreted as
part of the counter-regulatory hormone response to severe hypoglycemia and bind to GRE via
54
GR to also stimulate gluconeogenic gene transcription. Upon feeding, the effects of glucagon and
cAMP signaling are removed, while insulin activates the PI3K/Akt signaling pathway. Akt
phosphorylates FoxO1 to exclude it from the nucleus, preventing FoxO1/PGC-1α-mediated
transcription of gluconeogenic genes, while the expression of PGC-1α is limited by the reduction
in CREB/CRTC2 activity on its promoter. These events result in the repression of Pck1 and
G6pc gene transcription and thus reduced glucose production.
2.4.5 Glycogen
The liver has the ability to store excess glucose as the polysaccharide glycogen. During the fed
state, glycogen accumulates in hepatocytes as a physiological response to insulin called
glycogenesis. The key rate-limiting enzyme of glycogen synthesis is glycogen synthase (GS),
which catalyzes the biochemical reaction in which a UDP-glucose monomer is added to a
growing chain of glycogen through α-1,4-glycosidic bonds. GS is encoded by the Gys2 gene in
the liver, while a distinct isoform exists in muscle and other tissues encoded by the Gys1 gene
(274). The activity of GS is tightly controlled through phosphorylation. Dephosphorylation of
GS by phosphatases leads to its activation whereas phosphorylation by kinases inactivates GS.
Glycogen synthase kinase 3 (GSK-3) phosphorylates and inactivates GS (275). Insulin
importantly stimulates glycogen synthesis via Akt-mediated phosphorylation and deactivation of
GSK-3, thus relieving the amount of phosphorylation of GS. In addition, insulin increases the
activity of protein phosphatase 1 (PP-1) which dephosphorylates and activates GS, while
deactivating glycogen phosphorylase (GP, see below).
On the other hand, during starvation, glycogen is broken down into glucose in response to
glucagon by a process termed glycogenolysis in order to supply the rest of the body with free
55
glucose. GP is critically responsible for the breakdown of glycogen in glycogenolysis. In the
rate-limiting step of glycogenolysis, GP releases glucose-1-phosphate from the glycogen chain
by breaking the terminal α-1,4-glycosydic bond. Like GS, GP is regulated by phosphorylation.
Glucagon stimulates the cAMP/PKA signaling pathway, leading to the phosphorylation of
phospholipase C (PLC) and release of calcium from the endoplasmic reticulum into the cytosol.
The elevated calcium levels activate glycogen phosphorylase kinase which, in turn,
phosphorylates GP to activate it.
2.4.6 Fatty Acids
In addition to glucose and glycogen, fatty acids also serve as important energy molecules. The
liver plays an integral role in the maintenance of lipid homeostasis by carrying out the functions
of both the production and metabolism of lipids. During nutrient excess, glycogen stores become
saturated and excess glucose is diverted to the lipogenesis pathway to produce lipids which are
stored as triglycerides in adipose tissue as well as in the liver itself for long-term usage. The
content of triglycerides in hepatocytes is balanced by the input of lipids via fatty acid uptake,
fatty acid synthesis, and esterification with the output of lipids via fatty acid oxidation and export
of triglycerides. Free fatty acids, also known as non-esterified fatty acids, in the blood are
imported by hepatocytes in proportion to their concentration. De novo lipogenesis is stimulated
by a high carbohydrate diet and is controlled by both insulin and glucagon as well as nutrient
levels (276) (see section 2.4.7).
Triglycerides are produced through the successive esterification of three acyl-CoA chains,
derived from free fatty acids, to glycerol-3-phosphate through the sequential actions of
glycerophosphate acyltransferase, lysophosphatidase acyltransferase, and diacylglycerol
56
acyltransferase, which lead to the addition of three fatty acids to the glycerol backbone. The
triglycerides are then stored in the cytosol such that they can be mobilized via lipolysis when
necessary (277).
In conditions of energy deficit, fatty acids could be oxidized in the mitochondria to produce more
energy per unit weight than through the metabolism of either glucose or protein. In β-oxidation,
fatty acids are oxidized to form acetyl-CoA, which can then be shuttled into the Kreb’s cycle and
electron transport chain to produce ATP.
An important energetic role of the liver is the secretion of lipoproteins. Synthesized triglycerides
are packaged into very low-density lipoproteins (VLDL) together with cholesterol and
apolipoproteins for secretion into the bloodstream (278). Triglycerides bind to apoprotein B100,
a key component which controls the rate of VLDL production, via the microsomal
triacylglycerol transfer protein (279).
2.4.7 Lipogenesis
Lipogenesis is primarily performed in the cytosol of hepatocytes to convert excess glucose into
fatty acids. The main enzymes involved along the lipogenic pathway are glucokinase (GK), L-
pyruvate kinase (L-PK), ATP citrate lyase, acetyl CoA carboxylase (ACC), fatty acid synthase
(FAS), and stearoyl-CoA desaturase (SCD) (276). GK and L-PK are enzymes of glycolysis and
contribute to the metabolism of glucose into pyruvate. ATP citrate lyase is importantly
responsible for the conversion of citrate to acetyl-CoA in the cytosol, a step which precedes
lipogenesis. ACC performs a rate limiting step in which acetyl-CoA is converted into malonyl-
CoA, which is considered the main substrate used to extend fatty acid chains. FAS then catalyzes
57
the synthesis of fatty acids, using malonyl-CoA as building blocks. Starting from acetyl-CoA,
two carbons are successively added to the growing alkanoic chain through a series of
decarboxylative condensation reactions. The double bond in unsaturated fatty acids is generated
through the action of SCD. These enzymes are regulated on a long-term basis at the
transcriptional level by the transcription factors sterol regulatory element binding protein-1c
(SREBP-1c) and carbohydrate response element binding protein (ChREBP) (280-285). SREBP-
1c is typically considered to be the major lipogenic transcription factor activated by insulin
(281), while ChREBP is responsible for the lipogenic response to high glucose levels (285).
SREBP-1c and ChREBP enter the nucleus and bind to the sterol regulatory element and
carbohydrate response element respectively on target lipogenic gene promoters to stimulate gene
expression.
58
2.5 Thesis Aims and Hypothesis
As it is unclear how TCF7L2 regulates hepatic glucose metabolism and overall glucose
homeostasis, the primary aim of this thesis is to examine the role of TCF7L2 and Wnt signaling
in hepatic glucose metabolism using both in vitro and in vivo approaches. A secondary aim is to
assess the effect of the GLP-1 metabolite GLP-1(28-36)amide on the activation of the Wnt
signaling component β-cat and the regulation of hepatic gluconeogenesis. Overall, this thesis
seeks to shed light on the hepatic role of the type 2 diabetes risk gene TCF7L2 and the Wnt
signaling pathway as well as to enhance the understanding of novel mechanisms underlying the
regulation of hepatic glucose production.
The specific hypotheses tested are the following:
1) Hepatic TCF7L2 expression is regulated by nutrient availability and TCF7L2 and Wnt
signaling repress hepatic gluconeogenesis (Chapter 3).
2) Liver-specific expression of dominant negative TCF7L2 in mice causes increased hepatic
glucose production and impaired glucose and lipid homeostasis (Chapter 4).
3) The GLP-1 metabolite GLP-1(28-36)amide activates β-cat/Wnt and represses hepatic
gluconeogenic gene expression (Chapter 5).
59
Chapter 3: The Wnt Signaling Pathway Effector TCF7L2 is Up-Regulated by Insulin and Represses Hepatic Gluconeogenesis
This chapter is modified from the following:
Ip, W., Shao, W., Chiang, Y.A., and Jin, T. (2012) The Wnt signaling pathway effector TCF7L2 is up-regulated by insulin and represses hepatic gluconeogenesis. Am J Physiol Endocrinol Metab. 303(9): E1166-76.
60
3.1 Abstract
Certain single nucleotide polymorphisms (SNPs) in transcription factor 7-like 2 (TCF7L2) are
strongly associated with the risk of type 2 diabetes. TCF7L2 and β-catenin (β-cat) form the
bipartite transcription factor β-cat/TCF in stimulating Wnt target gene expression. β-cat/TCF
may also mediate the effect of other signaling cascades including that of cAMP and insulin in
cell-type specific manners. As carriers of TCF7L2 type 2 diabetes risk SNPs demonstrated
increased hepatic glucose production, we aimed to determine whether TCF7L2 expression is
regulated by nutrient availability and whether TCF7L2 and Wnt regulate hepatic
gluconeogenesis. We examined hepatic Wnt activity in the TOPGAL transgenic mouse, assessed
hepatic TCF7L2 expression in mice upon feeding, determined the effect of insulin on TCF7L2
expression and β-cat Ser675 phosphorylation, and investigated the effect of Wnt activation and
TCF7L2 knockdown on gluconeogenic gene expression and glucose production in hepatocytes.
Wnt activity was observed in pericentral hepatocytes in the TOPGAL mouse, while TCF7L2
expression was detected in human and mouse hepatocytes. Insulin and feeding stimulated hepatic
TCF7L2 expression in vitro and in vivo respectively. In addition, insulin activated β-cat Ser675
phosphorylation. Wnt activation by intraperitoneal lithium injection repressed hepatic
gluconeogenic gene expression in vivo, while lithium or Wnt-3a reduced gluconeogenic gene
expression and glucose production in hepatic cells in vitro. Small interfering RNA-mediated
TCF7L2 knockdown increased glucose production and gluconeogenic gene expression in
cultured hepatocytes. These observations suggest that Wnt signaling and TCF7L2 are negative
regulators of hepatic gluconeogenesis, and TCF7L2 is among the downstream effectors of insulin
in hepatocytes.
61
3.2 Introduction
Transcription factor 7-like 2 (TCF7L2) belongs to the T-cell factor (TCF) family of high
mobility group box transcription factors and is a major effector of the canonical Wnt signaling
pathway (defined as Wnt pathway hereafter unless further clarification is necessary) (1, 26).
Upon stimulation by Wnt ligands, a TCF protein binds to nuclear β-catenin (β-cat) to form a
bipartite transcription factor β-cat/TCF, leading to the stimulation of Wnt target gene expression
(36). β-cat/TCF may also serve as an effector of other signaling molecules, including certain
peptide hormones that utilize cAMP as a second messenger, IGF-1, insulin, and the lipid
metabolite lysophosphatidic acid (LPA) (19, 36, 200, 286, 287). Previous studies have
established the fundamental role of TCF7L2 and Wnt in embryogenesis and tumorigenesis. The
involvement of Wnt signaling and TCF7L2 in hormone gene expression and metabolic
homeostasis has, however, been recognized only recently (3, 19, 96, 120, 288).
During the past few years, extensive genome-wide association studies have revealed that certain
single nucleotide polymorphisms (SNPs) within intronic regions of TCF7L2 are strongly
associated with the risk of type 2 diabetes (33). This finding fueled many efforts to investigate
the role of TCF7L2 and Wnt signaling in pancreatic beta cells (7, 30, 35). Several studies have
demonstrated the beneficial effect of TCF7L2 on beta cell proliferation, insulin secretion, and the
expression of incretin hormone receptors (7, 30, 56). These findings, however, are in
contradiction with the suggestion that TCF7L2 exerts deleterious effects on beta cells by other
investigations (11, 35). It has also been demonstrated that TCF7L2 type 2 diabetes risk SNPs are
associated with elevated hepatic glucose production in individuals even during a
hyperinsulinaemic-euglycemic clamp, as well as hepatic insulin resistance (12, 35, 289).
Moreover, hepatic β-cat deficiency in mice resulted in alterations in glucose production and
62
expression of the key rate-limiting gluconeogenic enzymes, including PEPCK and glucose-6-
phosphatase (G6Pase) (119). These observations prompted us to assess whether TCF7L2 is
regulated by nutrient availability as well as the role of TCF7L2 and Wnt signaling in hepatic
glucose production.
We show here the detection of hepatic Wnt activity in the TOPGAL Wnt/TCF-reporter
transgenic mouse and the expression of TCF7L2 in both human and mouse hepatic cells. We
have also found that insulin and feeding stimulated TCF7L2 expression in vitro and in vivo,
respectively, and that insulin is able to stimulate the activity of β-cat, the partner of TCF7L2 in
mediating Wnt activity. Moreover, we have defined the repressive effect of both the Wnt ligand
Wnt-3a and TCF7L2 on hepatic glucose production.
63
3.3 Materials and Methods
3.3.1 Cell Culture and Treatment
Human HepG2 and mouse Hepa1-6 hepatoma cell lines (ATCC, USA) were cultured in DMEM
(Sigma-Aldrich, USA) supplemented with 10% fetal bovine serum (Gibco, USA). Mouse
primary hepatocytes were isolated by liver perfusion of 12 week old C57BL/6 mice as previously
described (290). Hepatocytes or hepatic cell lines were starved of serum overnight prior to
treatment with 100 nM insulin (Eli Lilly, USA), 10 µM forskolin (Sigma, USA), 10 nM
glucagon (Sigma, USA), 10 mM lithium chloride (Bioshop, Canada), or 2.5 nM Wnt ligand,
either Wnt-11 or Wnt-3a (R&D Systems, USA) for the indicated times. The chemical inhibitor
Akti1/2 (10 µM) was obtained from Sigma (USA) while the inhibitors LY294002 (50 µM) and
PD98059 (50 µM) were obtained from Calbiochem (USA). Transfection of 5 nM small
interfering RNA (siRNA) recognizing either a scrambled sequence or TCF7L2 (Ambion, USA)
was achieved using Lipofectamine RNAiMAX (Invitrogen, USA) as per manufacturer’s
instructions. Transfection of luciferase (LUC) reporter plasmids (2.0 µg per well in a 12 well
plate) was achieved using 3 μg polyethylenimine (Sigma, USA).
3.3.2 Animals
Twelve week old male C57BL/6 mice (Jackson, USA) were fasted overnight prior to re-feeding
or a defined treatment. Mice were intraperitoneally (i.p.) injected with lithium chloride (Bioshop,
Canada) at a final dosage of 3 mmol per kg body weight or PBS as the control, 4 hr prior to
extraction of liver tissue for reverse transcription PCR (RT-PCR) or Western blot analysis.
64
TOPGAL transgenic mice (86) were purchased from Jackson (004623, Tg-Fos-lacZ-34Efu/J,
USA). β-galactosidase (LacZ) staining was performed as described previously (200). All animal
procedures were approved by the Animal Resource Centre, Toronto General Research Institute,
University Health Network.
3.3.3 RNA Isolation, RT-PCR, and Real-Time RT-PCR
Total RNA was isolated from HepG2, Hepa1-6, mouse primary hepatocytes, or liver tissue using
TRI reagent (Sigma, USA) and reverse transcribed using a complimentary DNA reverse
transcription kit (Applied Biosystems, USA) following the instructions of the manufacturers. For
RT-PCR detection of TCF7, LEF1, TCF7L1, TCF7L2, and Wnt-3a, specific transcript sequences
were amplified by Taq DNA polymerase (New England BioLabs, USA) using the S1000
Thermal Cycler (Bio-Rad) as per the instructions of the manufacturers. A reaction lacking any
DNA template served as a negative control. For quantitative real-time RT-PCR analysis, specific
transcript sequences were amplified using iTaq SYBR Green (Bio-rad) and the Rotor-Gene 3000
machine (Corbett, USA) as per the instructions of the manufacturers. 18S or β-actin genes served
as normalizing controls. Relative quantification was calculated using the 2-ΔΔCT method. Each
sample was analyzed in triplicate. Primers used for RT-PCR or real-time RT-PCR were
synthesized by ACGT Corporation (Canada) and are presented in Table 3-1.
65
Table 3-1. RT-PCR Primers. TCF7, transcription factor 7; TCF7L1, transcription factor 7-like 1; TCF7L2, transcription factor 7-like 2; PEPCK, phosphoenolpyruvate carboxykinase; G6Pase, glucose-6-phosphatase. Species Gene Sequence Size (bp) Human TCF7 Sense: 5’-AAGGCCTGAAGGCCCCGGAGT-3’
Anti-sense: 5’-GAGAGAGAGTTGGGGGACACCGT-3’ 173
LEF1 Sense: 5’-TCACACCCGTCACACATCCCA-3’ Anti-sense: 5’-GGGTTGCCTGAATCCACCCGT-3’
180
TCF7L1 Sense: 5’-AAGCCGCGGGACTATTTCGC-3’ Anti-sense: 5’-CGCTGGAGGGGACATCGAGGA-3’
196
TCF7L2 Sense: 5’-TCGCCTGGCACCGTAGGACA-3’ Anti-sense: 5’-GGATGCGGAATGCCCGTCGT-3’
200
PEPCK Sense: 5’-AGAATAAGCCAGATGTAATCAGGG-3’ Anti-sense: 5’-TAGCTACTACCCAGTGTTCTGTGG-3’
206
G6Pase Sense: 5’-AACAACCATGCCAGGGATT-3’ Anti-sense: 5’-TACGTGATATGGCACCTCC-3’
201
Wnt-3a Sense: 5’-TTCTTACTCCTCTGCAGCCTGA-3’ Anti-sense: 5’-GCCAATCTTGATGCCCTCGG-3’
201
18S Sense: 5’-GTAACCCGTTGAACCCCATT-3’ Anti-sense: 5’-CCATCCAATCGGTAGTAGCG-3’
151
Mouse TCF7 Sense: 5’-AGGTCAGATGGGTTGGACTG-3’ Anti-sense: 5’-AGGGTGCACACTGGGTTTAG-3’
412
LEF1 Sense: 5’-TCCGGGATCCCACCCGTCAC-3’ Anti-sense: 5’-GATCTGTCCAACGCCGCCCG-3’
124
TCF7L1 Sense: 5’-GAGTGCGAAATCCCCAGTTA-3’ Anti-sense: 5’-ATGCATGGCTTCTTGCTCTT-3’
384
TCF7L2 Sense: 5’-GCATCCCTCACCCGGCCATC-3’ Anti-sense: 5’-GCCACCTGCGCCCGAGAATC-3’
243
PEPCK Sense: 5’-CATAACGGTCTGGACTTCTCTGC-3’ Anti-sense: 5’-GAATGGGATGACATACATGGTGCG-3’
417
G6Pase Sense: 5’-CTCTGGGTGGCAGTGGTCGG-3’ Anti-sense: 5’-AGGACCCACCAATACGGGCGT-3’
83
Wnt-3a Sense: 5’-GCTGTGGGACCCCAGTACTC-3’ Anti-sense: 5’-GTGGTGCAGTTCCAACGCC-3’
191
18S Sense: 5’-GTAACCCGTTGAACCCCATT-3’ Anti-sense: 5’-CCATCCAATCGGTAGTAGCG-3’
151
Human + Mouse
β-actin Sense: 5’-TCATGAAGTGTGACGTTGACA-3’ Anti-sense: 5’-CCTAGAAGCATTTGCGGTG-3’
285
66
3.3.4 Western Blotting and Antibodies
Methods for whole-cell lysate preparation and Western blotting have been previously described
(121). Protein samples (30 μg per sample) were separated by SDS-PAGE and transferred to
nitrocellulose membrane. Antibodies for TCF7L2, phosphorylated GSK-3β (Ser9), and
phosphorylated CREB (Ser133) were acquired from Cell Signaling (USA). Antibodies for
phosphorylated β-cat (Ser675), β-cat, β-actin, cyclin D1, Akt, and phosphorylated ERK1
(Tyr204) were purchased from Santa Cruz Biotechnology (USA). The antibody for
phosphorylated Akt (Ser473) was the product of Signalway Antibody (USA), and for PEPCK
was that of Abcam (USA).
3.3.5 Luciferase Reporter Analysis
The generation of the TCF7L2 (3.1 kbp)-LUC fusion gene construct was described previously
(291). The rat PEPCK (-595 bp to +67 bp)-LUC construct was generated first by PCR
amplification of the PEPCK promoter sequence from rat genomic DNA (Forward, 5’-
CGGACGCGTTTACAATCACCCCTCCCTCT-3’; Reverse, 5’-
ACCTTTCTTCCTCCTTTTGG-3’) followed by insertion into the pGL3-basic vector (Promega,
USA) via MluI/BglII restriction sites. LUC reporter analyses were performed as previously
described (3).
67
3.3.6 Glucose Production Assay
Mouse primary hepatocytes and hepatoma cell lines were cultured in six-well plates (1.0 x 106
cells/well) in DMEM and starved of serum and glucose overnight. Cells were then washed three
times with PBS and incubated in glucose production buffer (DMEM without glucose, serum, or
phenol red, and supplemented with 2 mM sodium pyruvate and 20 mM sodium lactate, Sigma,
USA). After 4 hr, the medium was collected and assayed for glucose content using a colorimetric
glucose assay kit (Sigma, USA). Glucose content was normalized to total protein content
measured in whole-cell lysates.
3.3.7 Statistical Analysis
All experiments were performed independently as a minimum of three replicates or mice.
Quantitative results are expressed as the mean ± standard error of the mean relative to the
indicated control group. Statistical analyses were performed using the two-tailed Student’s t test
or one-way ANOVA as appropriate for single or multiple comparisons respectively. Differences
were considered significant when p<0.05.
68
3.4 Results
3.4.1 Detection of Wnt Signaling and TCF7L2 Expression in Hepatocytes
To assess Wnt activity in hepatocytes, we took advantage of the availability of TOPGAL
transgenic mice (86). In this mouse model, β-galactosidase (LacZ) expression is driven by the
Wnt/TCF-responsive promoter element (Figure 3-1A, top panel). As shown in Figure 3-1A,
positive LacZ staining was observed in hair follicles (positive control) (86) and adult mouse
pericentral hepatocytes. Pericentral hepatocytes are typically associated with reduced levels of
gluconeogenesis but elevated levels of lipogenesis (292). We then determined by RT-PCR that
both the human HepG2 cell line and mouse hepatocytes [Hepa1-6 cell line, mouse liver tissue
(MLT) and mouse primary hepatocytes (MPH)] express TCF7L2 and three other members of the
TCF family (Figure 3-1B). Western blotting showed that the human HepG2 cell line and mouse
hepatic cells primarily express two isoforms of TCF7L2 of sizes approximately 78 and 58 kDa
(Figure 3-1C).
69
Figure 3-1. Active Wnt signaling and transcription factor 7-like 2 (TCF7L2) expression are present in hepatocytes. (A) Depiction of the TOPGAL mouse transgene (top panel). β-galactosidase (LacZ) staining showing active Wnt activity in pericentral hepatocytes of the adult TOPGAL mouse liver (n = 3) (bottom panel). Hair follicle serves as a positive control. (B) Detection of TCF7, LEF1, TCF7L1, and TCF7L2 by RT-PCR in human HepG2 and mouse Hepa1-6 hepatic cell lines, C57BL/6 mouse liver tissue (MLT), and mouse primary hepatocytes (MPH). (C) Detection of TCF7L2 by Western blotting in human HepG2 and mouse Hepa1-6 hepatic cell lines, MLT, and MPH. n.s.*, non-specific or the identity is not yet known. P, promoter.
70
3.4.2 Feeding Stimulates TCF7L2 Expression
To determine whether hepatic TCF7L2 expression levels can be modulated by nutritional
availability, we compared TCF7L2 expression levels in the livers of fasted or re-fed C57BL/6
mice. As shown in Figures 3-2A and 3-2B, re-fed animals showed substantially increased hepatic
TCF7L2 protein levels (both 78 and 58 kDa isoforms) compared to fasted mice. Increased
TCF7L2 expression was associated with elevated expression of cyclin D1, a known downstream
target of the Wnt signaling pathway (Figure 3-2A, 3-2C).
Figure 3-2. Feeding stimulates TCF7L2 expression. (A) Effect of fasting and re-feeding (4 hr) on hepatic TCF7L2 expression in C57BL/6 mice by Western blotting. Cyclin D1, a known downstream target of the Wnt signaling pathway. Representative blot (n = 6 per group). (B) Densitometric analysis of TCF7L2 bands and (C) Cyclin D1 bands in panel A. Values are presented as mean ± SEM; *p<0.05, **p<0.01 vs. fasted mouse group. n.s.*, non-specific or the identity is not yet known.
71
3.4.3 Insulin Stimulates TCF7L2 Expression and β-cat Ser675 Phosphorylation
As feeding increases plasma insulin levels and insulin is the principle hormone involved in
repressing gluconeogenesis in response to feeding, we directly assessed the effect of 4 hr insulin
treatment on TCF7L2 expression in human HepG2 and mouse Hepa1-6 cell lines in vitro. As
anticipated, insulin treatment stimulated the phosphorylation of Akt (Ser473), GSK-3β (Ser9)
and ERK1 (Tyr204) (Figure 3-3A, 3-3B). This treatment also increased TCF7L2 protein levels in
both cell lines, associated with elevated cyclin D1 levels (Figure 3-3A, 3-3B). In addition, 4 hr
insulin treatment was shown to increase TCF7L2 mRNA levels in these two cell lines, detected
by real-time RT-PCR (Figure 3-3C, 3-3D). Furthermore, when a TCF7L2-LUC fusion gene
plasmid (291) was transfected into either HepG2 or Hepa1-6 cells, 4 hr insulin treatment
moderately but significantly increased LUC reporter activity (Figure 3-3E, 3-3F).
72
Figure 3-3. Insulin stimulates TCF7L2 expression in two hepatic cell lines. (A) Effect of 100 nM insulin (4 hr) on TCF7L2 expression assessed by Western blotting in HepG2 and (B) Hepa1-6 cells and (C) by qRT-PCR in HepG2 and (D) Hepa1-6 cells. (E) Effect of 100 nM insulin (4 hr) on TCF7L2(3.1kb)-LUC reporter expression in HepG2 and (F) Hepa1-6 cell lines. Blots shown are representative of at least three independent experiments. In panels C, D, E, and F, values in each independent experiment were normalized to the control group (defined as one-fold) then presented as mean ± SEM (n ≥ 3); *p<0.05, **p<0.01 vs. control.
73
β-cat is the essential partner of TCF members in stimulating Wnt downstream target gene
expression. β-cat Ser675 phosphorylation in response to PKA activation was demonstrated in
other cell lineages to be positively correlated with the transcriptional activity of β-cat/TCF (45).
We have also shown previously the activation of β-cat Ser675 phosphorylation by insulin in gut
cells (121, 286). In the current study, we have first of all determined that in the mouse Hepa1-6
cell line, both cAMP/PKA activators forskolin and glucagon were able to stimulate CREB
phosphorylation, associated with β-cat Ser675 phosphorylation (Figure 3-4A). As anticipated,
these two agents also increased de novo glucose synthesis in this cell line (data not shown). We
then assessed the effect of insulin on β-cat Ser675 phosphorylation in the two hepatic cell lines.
As shown in Figures 3-4B and 3-4C, insulin was able to stimulate β-cat Ser675 phosphorylation.
In the Hepa1-6 cell line, this stimulation could be attenuated by inhibition of either
phosphoinositide 3-kinase (PI3K) or mitogen-activated extracellular signal-regulated kinase
(MEK), but not by the inhibition of protein kinase B (PKB/Akt) (Figure 3-4D). MEK inhibition
also markedly repressed basal levels of Ser675 β-cat but did not affect insulin-stimulated Akt
Ser473 phosphorylation. Inhibition of PI3K or Akt led to the loss of Akt phosphorylation at
Ser473 as expected, although phosphorylation of GSK-3β at Ser9 could still be observed likely
due to the involvement of multiple kinases (293). Insulin-stimulated expression of cyclin D1 was
attenuated by either Akt or PI3K inhibition (Figure 3-4D). This is likely due to the involvement
of Akt in regulating protein translation via mTOR activation (286). These observations
collectively suggest that in hepatocytes, insulin is able to cross-talk with the Wnt signaling
pathway by both increasing TCF7L2 expression levels and stimulating β-cat Ser675
phosphorylation. The activation of β-cat Ser675 phosphorylation by insulin appears to be an Akt-
independent phenomenon, as we have observed previously in gut endocrine L cells (121).
74
Figure 3-4. Insulin stimulates β-cat Ser675 phosphorylation in two hepatic cell lines. (A) Effect of forskolin (10 μM) or glucagon (10 nM) treatment on β-cat Ser675 phosphorylation in Hepa1-6. (B) Effect of 100 nM insulin for the indicated time points on β-cat Ser675 phosphorylation in HepG2 and (C) Hepa1-6 cell lines. (D) Effect of protein kinase B (10 μM Akti1/2), phosphoinositide 3-kinase (50 μM LY294002), and mitogen-activated extracellular signal-regulated kinase (50 μM PD98059) inhibition on insulin-stimulated (1 hr) β-cat Ser675 phosphorylation (top panel), with accompanying densitometric analysis (bottom panel). Treatment with inhibitors was performed 45 min prior to treatment with insulin. Blots shown are representative of at least three independent experiments. In panel D, values in each independent experiment were normalized to the control untreated group (defined as one-fold) then presented as mean ± SEM (n ≥ 3); *p<0.05 between indicated groups.
75
3.4.4 Wnt Activation by Lithium Reduces Gluconeogenesis
We examined the contribution of Wnt activation on gluconeogenesis in vivo. As an inhibitor of
GSK-3, lithium has been widely utilized to mimic the activation of Wnt via increasing nuclear
levels of β-cat (3, 44). We found it has no appreciable effect on TCF7L2 expression or β-cat
Ser675 phosphorylation in hepatocytes in vitro (data not shown). Male C57BL/6 mice at the age
of 12 weeks were i.p. injected with lithium chloride (3 mmol per kg body weight). Four hr after
injection, mice were sacrificed, followed by extraction of liver tissue for RNA as well as protein
isolation. In fasted animals, this short-term Wnt activation by lithium injection significantly
reduced hepatic expression of PEPCK mRNA (Figure 3-5A, left panel) and generated a trend of
reducing the level of G6Pase mRNA (Figure 3-5A, right panel), although the effect did not reach
statistical significance. As expected, feeding reduced hepatic PEPCK and G6Pase mRNA levels
(294) although lithium injection in fed animals generated no additive reduction (Figure 3-5A).
As shown in Figure 3-5B, lithium injection also reduced hepatic PEPCK protein level in animals
during fasting. Feeding reduced PEPCK protein level and lithium injection generated no further
reduction (data not shown).
We then assessed the effect of lithium in the HepG2 cell line in vitro. Forskolin (mimics the
effect of glucagon on cAMP elevation) treatment significantly stimulated PEPCK and G6Pase
mRNA levels, while insulin or lithium treatment significantly reduced the expression of these
two gluconeogenic genes (Figure 3-5C). To assess whether the repressive effect of lithium on
PEPCK expression occurs at the transcriptional level, we obtained the PEPCK promoter
sequence (from -595 bp to +67 bp) by PCR and constructed a LUC reporter. As anticipated, this
fusion gene construct can be positively regulated by PKA activation (data not shown). When this
construct was transfected into the HepG2 cell line, lithium treatment was shown to modestly but
76
reproducibly reduce its expression (Figure 3-5D). Finally, lithium treatment was found to
significantly reduce relative glucose output in mouse primary hepatocytes (Figure 3-5E).
Although the in vitro glucose production assay utilized here alone cannot eliminate the potential
involvement of glycogenolysis, our observation that lithium represses gluconeogenic gene
expression (Figure 3-5A, 3-5B, 3-5C) indicates that the Wnt pathway activator lithium represses
gluconeogenesis.
77
Figure 3-5. Wnt activation represses hepatic gluconeogenesis. (A) Effect of Wnt activation by i.p. lithium injection (3 mmol per kg body weight) on hepatic PEPCK (left panel) and G6Pase (right panel) mRNA levels assessed 4 hr following injection by real-time RT-PCR (n = 3 per each of four groups of animals). Levels in the fasted PBS-treated mouse were defined as one-fold. (B) Effect of i.p. lithium injection on hepatic PEPCK protein levels in fasted animals assessed 4 hr following injection by Western blotting (left panel) with accompanying densitometric analysis (right panel). (C) Effect of 4 hr lithium treatment (10 mM) on PEPCK and G6Pase mRNA levels in HepG2 cells. (D) Effect of 4 hr lithium treatment (10 mM) on the expression of a rat PEPCK-LUC fusion gene construct in HepG2 cells. (E) Effect of 4 hr lithium treatment on glucose output in mouse primary
hepatocytes. In panels C, D, and E, values in each independent experiment were normalized to the control group (defined as one-fold) then presented as mean ± SEM (n ≥ 3); *p<0.05, **p<0.01, ***p<0.001 vs. control group or fasted PBS control mouse.
78
3.4.5 Wnt-3a Reduces Gluconeogenesis
To verify the repressive effect of Wnt activation on gluconeogenesis in vitro, we directly utilized
the canonical Wnt ligand Wnt-3a, along with the non-canonical Wnt ligand Wnt-11 as a negative
control. Wnt-3a is known to be differentially expressed at critical stages of human liver
development in vivo (295) and is commonly used as a canonical Wnt ligand. In addition, we
detected the expression of Wnt-3a in human and mouse hepatocytes via RT-PCR (Figure 3-6A),
consistent with a previous study demonstrating its expression in the mouse liver (119). As shown
in Figure 3-6B, treatment of HepG2 cells with Wnt-3a, but not with Wnt-11, significantly
reduced the levels of PEPCK and G6Pase mRNA. Wnt-3a, but not Wnt-11, was also found to
reduce glucose output in mouse primary hepatocytes (Figure 3-6C). Wnt-3a, however, could not
further reduce gluconeogenic gene expression upon insulin treatment (Figure 3-6D). These
observations suggest that Wnt signaling is a negative regulator of hepatic gluconeogenic gene
expression and glucose production.
79
Figure 3-6. Wnt ligand Wnt-3a represses hepatic gluconeogenesis. (A) Detection of Wnt-3a in the human HepG2 and the mouse Hepa1-6 cell lines, mouse liver tissue (MLT), and mouse primary hepatocytes (MPH) by RT-PCR. (B) Effect of 2.5 nM Wnt-11 or Wnt-3a treatment (4 hr) on PEPCK and G6Pase mRNA expression in HepG2 and (C) glucose production in mouse primary hepatocytes. (D) Effect of 4 hr treatment of 100 nM insulin, 2.5 nM Wnt-3a, or both insulin and Wnt-3a on PEPCK (left panel) and G6Pase (right panel) mRNA levels in HepG2, compared to a vehicle control. Values in each independent experiment were normalized to the control group (defined as one-fold) then presented as mean ± SEM relative to the control group (n ≥ 3); *p<0.05, **p<0.01 , ***p<0.001 vs. control.
80
3.4.6 TCF7L2 Negatively Regulates Gluconeogenesis
Norton et al. have shown that knockdown of TCF7L2 in the rat hepatoma cell line H4IIE
significantly increased glucose production in the presence or absence of insulin or metformin
treatment (96). Here we have established the methodology to knockdown TCF7L2 in both
human and mouse hepatocytes using small interfering RNA (siRNA) and directly assessed the
contribution of TCF7L2 in regulating gluconeogenic gene expression and glucose output. Figure
3-7A shows the RNA sequence of two TCF7L2 siRNA oligonucleotides used in this study.
These two siRNA sequences would collectively recognize and knockdown major isoforms of
TCF7L2 in both human and mouse. Knockdown of TCF7L2 resulted in a significant elevation of
PEPCK and G6Pase mRNA levels (Figure 3-7B), associated with increased glucose output in the
mouse Hepa1-6 cell line and mouse primary hepatocytes (Figure 3-7C). However, the repressive
effect of insulin on gluconeogenic gene expression was still present after silencing of TCF7L2
(Figure 3-7D), consistent with the report by Norton et al. in the rat H4IIE hepatoma cell line
(96).
81
Figure 3-7. Knockdown of TCF7L2 up-regulates hepatic gluconeogenesis. (A) RNA sequences of TCF7L2 siRNA oligonucleotides utilized in this study. The human TCF7L2 sequence is recognized by siRNA-s74838 while the mouse sequence is recognized by both siRNA-s74838 and s74839. Knockdown was confirmed by Western blotting in panels B and C. (B) Effect of TCF7L2 silencing on PEPCK and G6Pase mRNA levels in the HepG2 cell line. (C) Effect of TCF7L2 silencing on glucose output in the Hepa1-6 cell line (left panel) and mouse primary hepatocytes (right panel). (D) Effect of TCF7L2 silencing and 100 nM insulin treatment (4 hr) on PEPCK and G6Pase levels in the HepG2 cell line. Values in each independent experiment were normalized to the control group (defined as one-fold) then presented as mean ± SEM (n ≥ 3); *p<0.05, **p<0.01 between indicated groups.
82
3.5 Discussion
TCF7L2 has been recognized as the most prominent type 2 diabetes risk gene due to the robust
association between its selected SNPs and the risk of type 2 diabetes (27, 33). However, the
functional role of TCF7L2 in pancreatic islets remains unclear and controversial (7, 11, 30, 35,
41, 56). As TCF7L2 is also expressed in organs other than pancreatic islets, including liver,
brain, muscle and fat tissues, which are likewise important in metabolic homeostasis, it is
necessary to define the function of TCF7L2 and further study the metabolic function of Wnt
signaling in each of those organs. Although it is well known that Wnt signaling is important for
the development and zonation of the embryonic liver (100), little effort has been made to explore
the potential hepatic role of TCF7L2 and Wnt signaling in mediating glucose homeostasis in
adulthood until recently. Liu et al. found that starvation induced the expression of mRNAs
encoding different Wnt isoforms. They have also demonstrated with gain- and loss-of-function
models the role of β-cat in hepatic glucose production (119). This group, however, did not
directly assess the contribution of TCF7L2 in gluconeogenesis. Norton and colleagues
demonstrated that TCF7L2 silencing led to increased basal levels of hepatic glucose production
in the rat hepatic cell line H4IIE, associated with the over-expression of gluconeogenic genes
including PEPCK and G6Pase (96). Utilizing chromatin-immunoprecipitaiton (ChIP) combined
with massively parallel DNA sequencing (ChIP-Seq), Norton and colleagues detected more than
2000 potential binding events across the genome (96). They suggested that TCF7L2 may affect
fasting and postprandial hyperglycemia in carriers of type 2 diabetes risk SNPs of TCF7L2 (96).
This group, however, did not assess whether TCF7L2 expression can be regulated by nutrient
availability or a metabolic hormone. In our study, we present direct evidence for the first time
that hepatic TCF7L2 expression can be stimulated by feeding in vivo, and that insulin is able to
83
stimulate β-cat/TCF activity by increasing TCF7L2 expression as well as facilitating β-cat
Ser675 phosphorylation. We then presented novel evidence of the involvement of both TCF7L2
and the canonical Wnt ligand (Wnt-3a) in repressing gluconeogenesis. Both lithium and Wnt-3a
were shown to repress, while TCF7L2 knockdown was shown to increase gluconeogenic gene
expression and glucose output. Taken together, our results led us to suggest that Wnt signaling
and TCF7L2 negatively regulate gluconeogenesis and that TCF7L2 and β-catenin are
downstream effectors of insulin in hepatocytes.
It has been well-established that within the liver lobule, a functional gradient lies along the axis
between the portal triad and the central vein (292). On the one hand, periportal hepatocytes,
which receive incoming more aerobic blood, are specialized for oxidative functions such as
gluconeogenesis and express higher amounts of gluconeogenic genes (292). On the other hand,
in pericentral hepatocytes, which typically receive outgoing oxygen-depleted blood, processes
including gluconeogenesis are down-regulated. The strong LacZ staining that we have observed
in pericentral hepatocytes in the TOPGAL transgenic mice is consistent with a previous report
from a different research angle (296). This observation further supports our suggestion that Wnt
signaling is a negative regulator of gluconeogenesis. It will be interesting to assess whether the
expression of TCF7L2 or Wnt ligands varies across the liver lobule gradient. Since pericentral
hepatocytes are also specialized in lipogenesis (292), whether Wnt signaling functions as a
positive regulator of lipogenesis deserves a systematic further examination.
In many other cell lineages, β-cat/TCF has been shown to serve as an effector for a variety of
signaling molecules including insulin, IGF-1, several peptides hormones that use cAMP as a
second messenger, and the lipid metabolite LPA (19, 36, 200, 286, 287). Insulin and Wnt inhibit
GSK-3 activity via different mechanisms to carry out distinct downstream signaling events such
84
that stimulation by insulin may not result in free β-cat accumulation while stimulation by Wnt
does (297). We show in this study that in hepatocytes, insulin is able to stimulate TCF7L2
transcription and activate β-cat Ser675 phosphorylation, which may account for the observed
stimulation of Wnt reporter activity by insulin in other systems (287). In addition, feeding
substantially increased hepatic TCF7L2 protein level. These observations, along with the fact
that insulin is a strong inhibitor of hepatic gluconeogenesis in response to food intake, revealed a
novel physiological application of the cross-talk between insulin and the Wnt signaling
pathways. The metabolic hormone insulin, in response to food intake, may utilize the Wnt
signaling effector β-cat/TCF7L2 as a mediator in repressing gluconeogenic gene expression and
glucose production. Knockdown of TCF7L2, however, did not diminish the repressive effect of
insulin on gluconeogenic gene expression, assessed by Norton et al. in a rat cell line (96) and by
this study in a human cell line (Figure 7). A potential explanation is that insulin can also repress
gluconeogenesis via attenuating the effect of the transcription factor forkhead box O (FoxO), a
known positive regulator of gluconeogenesis (249). This effect is presumably independent of the
stimulatory effect of insulin on TCF7L2 expression.
The regulation of TCF7L2 expression by insulin has been recognized in several investigations
across various tissues. While it has been demonstrated that insulin up-regulated TCF7L2
expression in intestinal cells, other studies have shown that insulin can down-regulate the
expression of TCF7L2 in adipocytes or pancreatic cells (106, 121, 200, 291). These seemingly
controversial occurrences could manifest as a result of tissue-specific applications of the cross-
talk between insulin and TCF7L2. In intestinal endocrine L cells, insulin stimulates the
expression of the proglucagon gene (Gcg) and production of the incretin hormone glucagon-like
peptide-1 via TCF7L2 and β-cat (121). Insulin, however, is known to be a potent inducer of
adipocyte differentiation, while Wnt signaling inhibits adipogenesis (76, 106, 298). Down-
85
regulation of TCF7L2 by insulin in adipocytes may mediate the stimulation of adipogenesis by
insulin. Indeed, insulin has been shown to up- and down-regulate the expression of specific
genes in cell-type specific manners. For example, insulin is known to repress pancreatic Gcg
expression (299), in contrast to its stimulatory effect on Gcg expression in the gut (121).
Understanding of the detailed molecular mechanisms underlying the cell-type specific regulation
of TCF7L2 expression by insulin requires further investigation.
Liu et al. found that β-cat depletion led to reduced hepatic glucose production (119).
Observations made by Norton et al. (96) and by the current study, however, indicated that
TCF7L2 and Wnt are negative regulators of gluconeogenesis. Explanation for these seemingly
contradictory findings may rely on the fact that β-cat also serves as a co-factor for FoxO
transcription factors (102). Figure 3-8 is a simplified illustration which summarizes our current
understanding of the role of signaling pathways in regulating hepatic gluconeogenesis. FoxO1 is
a positive regulator of gluconeogenic gene expression, while its activity is positively and
negatively regulated by glucagon and insulin, respectively. Glucagon-stimulated cAMP signaling
leads to FoxO1-mediated increases in gluconeogenic gene expression while insulin-stimulated
PI3K/Akt signaling leads to the phosphorylation and nuclear exclusion of FoxO1, thereby
attenuating gluconeogenic gene expression. The observations made in our current study suggest
that elevated insulin in response to feeding can also up-regulate Wnt activity via increasing
TCF7L2 expression and β-cat Ser675 phosphorylation. Increased levels of TCF7L2 may
compete with FoxO1 for β-cat, and hence attenuate gluconeogenesis. However, insulin also
increases the levels of active β-cat (Ser675) (Figure 3-4B, 3-4C, 3-4D). This led us to speculate
that β-cat/TCF7L2 may possess an intrinsic repressive effect on gluconeogenic gene expression.
This speculation is further supported by our observation that both Wnt-3a and lithium can repress
gluconeogenesis independently of the insulin signaling pathway (Figure 3-5, 3-6, 3-7).
86
Figure 3-8. A schematic presentation of the role of Wnt signaling and TCF7L2 in hepatic gluconeogenesis. Feeding up-regulates plasma insulin levels, which leads to β-cat Ser675 phosphorylation and TCF7L2 expression. Increased levels of TCF7L2 may repress gluconeogenesis via competing with FoxO for β-cat (A). In addition, β-cat/TCF7L2, as the effector of the Wnt signaling pathway, may possess an intrinsic repressive effect on gluconeogenesis (B).
In conclusion, we have obtained evidence that insulin cross-talks with the Wnt signaling pathway
via up-regulating TCF7L2 expression and β-cat Ser675 phosphorylation in hepatocytes, that the
extra-cellular canonical Wnt ligand Wnt-3a down-regulates gluconeogenesis, and that TCF7L2
knockdown up-regulates gluconeogenesis in primary hepatocytes. We speculate that insulin may
partially utilize the Wnt signaling pathway effector β-cat/TCF7L2 in negatively regulating
gluconeogenesis. How TCF7L2 and Wnt signaling down-regulate hepatic gluconeogenesis via
modulating the expression of a network of Wnt downstream target genes deserves further
investigation.
87
Chapter 4: Liver-Specific Expression of Dominant Negative TCF7L2 Causes Impaired Glucose and Lipid Homeostasis in Mice
This chapter is modified from the following:
Ip, W., Shao, W., Song, Z.E., Chen, Z., and Jin, T. (2014) Liver-Specific Expression of Dominant Negative Transcription Factor 7-like 2 Causes Progressive Impairment in Glucose Homeostasis. (submitted to Diabetes)
88
4.1 Abstract
Investigations on the metabolic role of hepatic TCF7L2 have generated controversial
suggestions. Here, we generated the LTCFDN transgenic mouse model in which dominant
negative TCF7L2 (TCF7L2DN) is expressed under the liver-specific albumin promoter.
LTCFDN mice expressed TCF7L2DN exclusively in the liver, leading to a reduction in the
hepatic expression of a Wnt target gene Axin2. These mice exhibited a progressive impairment in
pyruvate and glucose tolerance, while LTCFDN hepatocytes showed elevated glucose production
and attenuation of Wnt-3a-induced repression of glucose production. Adenovirus-mediated
expression of TCF7L2DN, but not wild type TCF7L2, increased glucose production and
gluconeogenic gene expression in C57BL/6 hepatocytes. A physical interaction between β-cat
and FoxO1 was detected, while LTCFDN hepatocytes exhibited increased binding of β-cat and
FoxO1 to the Pck1 promoter. Although wild type TCF7L2 did not activate TOPflash,
constitutively-active S33Y β-cat stimulated TOPflash activity, while S33Y β-cat and Wnt-3a
exhibited opposite effects on Pck1 promoter activity. LTCFDN mice also presented with
elevated serum and liver triglyceride contents and increased hepatic fat accumulation, while
TCF7L2DN expression caused increased expression of the lipogenic genes Fasn, Acaca, and
Ehhadh. Together, our results using TCF7L2DN as a unique in vivo and in vitro tool suggest that
Wnt signaling serves a beneficial role in suppressing hepatic gluconeogenesis.
89
4.2 Introduction
Following the recognition of TCF7L2 as a risk gene of type 2 diabetes mellitus by extensive
genome wide association studies (4), great efforts have been made to explore the metabolic role
of this Wnt signaling pathway effector in pancreatic β-cells and elsewhere (7, 8, 10, 11, 15, 27,
35, 56, 89, 96-98). Although a number of investigations have suggested that TCF7L2 as well as
Wnt signaling negatively regulate hepatic glucose production (HGP) (15, 95-97), one recent
study reported that liver-specific knockout of TCF7L2 reduced HGP, while hepatic over-
expression of TCF7L2 increased HGP (10). As a result, the controversial issues on the metabolic
function of TCF7L2 have been extended from pancreatic β-cells into hepatocytes (7, 8, 11, 56,
89, 300, 301). In addition, while several studies have implicated other components of the Wnt
signaling pathway in the regulation of lipid metabolism in humans and rodents (71, 302-304),
hepatic triglyceride content and the expression of genes involved in lipid metabolism were
reduced in the livers of newborn whole-body Tcf7l2-/- mice (10).
TCF7L2 or other TCF members (TCFs) interact with β-catenin (β-cat), forming the bipartite
transcription factor β-cat/TCF, which serves as the important effector of the Wnt signaling
pathway. The role of Wnt signaling has been intensively studied in many tissues including the
liver using various transgenic animal models. Although over-expression of a given Wnt ligand or
the expression of constitutively-active S33Y mutant β-cat has provided solid evidence for the
involvement of Wnt signaling in liver development, zonation, proliferation, tumorigenesis and
the susceptibility to oxidative stress (305-310), the hepatic role of Wnt signaling in metabolic
homeostasis remains unclear. The complexity of the Wnt signaling pathway is reflected by the
existence of multiple ligands, receptors, and various modulating elements. Furthermore, the
function of TCFs can be bi-directional, depending on the availability and phosphorylation status
90
of their co-factor β-cat. Finally, β-cat may also interact with FoxOs, key effectors of the stress
and aging signaling pathway (102). The patho-physiological contribution of the interaction
between FoxOs and β-cat was demonstrated previously in bone diseases (105, 311) and recently
in mediating hepatic gluconeogenesis (101). Thus, the function of TCFs is not only directly
controlled by β-cat, but also indirectly by the stress signaling pathway effector FoxO.
Here, we generated the transgenic mouse model LTCFDN in which the expression of dominant
negative TCF7L2 (TCF7L2DN) is driven by a hepatocyte-specific albumin promoter construct
(312). The observations that LTCFDN mice exhibit progressive impairment of pyruvate and
glucose tolerance along with the up-regulation of the gluconeogenic gene program and glucose
output in hepatocytes expressing TCF7L2DN but not wild type TCF7L2 suggest that Wnt
signaling negatively regulates hepatic gluconeogenesis.
91
4.3 Materials and Methods
4.3.1 Animals
The LTCFDN mouse model was generated by cloning the mouse serum albumin 2.4 kb
promoter/enhancer construct (kindly provided by Dr. Richard Palmiter) upstream of the 1.6 kb
human TCF7L2DN long isoform cDNA sequence (3, 98, 312). FVB mouse zygote pronuclear
microinjection of the linearized DNA construct and implantation into pseudopregnant recipients
were then performed by the Toronto Centre for Phenogenomics Transgenic Core. Male
heterozygous LTCFDN mice were always bred with female wild-type FVB mice to produce
heterozygous mice (labelled LTCFDN) and control wild-type littermates (labelled WT). Male
C57BL/6 mice were purchased from Harlan Laboratories. All mice were housed on a 12:12 h
light-dark cycle at ambient room temperature with free access to normal chow diet and water.
Mice were euthanized using CO2 prior to blood collection by cardiac puncture and collection of
tissues. For the collection of blood in newborn mice, individual mice were euthanized by
decapitation which then allowed blood to be collected from the severed vessels. Tissues were
flash-frozen in liquid nitrogen and subsequently stored at -80 °C until further processing. All
animal protocols were approved by the Institutional Animal Care and Use Committee of the
University Health Network.
92
4.3.2 Genotyping
LTCFDN mice were genotyped by PCR for presence of the transgene using human TCF7L2
forward primer 5’-TCGCCTGGCACCGTAGGACA-3’ and reverse primer 5’-
GGATGCGGAATGCCCGTCGT-3’ and the Mouse Genotyping Kit (KAPA).
4.3.3 In Vivo Tolerance Tests and Glucose Production Assay
Mice were fasted for 16, 16, or 6 h prior to intraperitoneal injection of pyruvate (2 g/kg body
weight), glucose (2 g/kg body weight), or insulin (0.75 – 1.0 U/kg body weight), respectively
(16). The method for glucose production assay has been previously described (16).
4.3.4 Insulin Measurement
Serum insulin levels were measured using the Rat Insulin Radioimmunoassay Kit (Millipore)
according to the manufacturer’s instructions.
4.3.5 Isolation of Mouse Primary Hepatocytes and Cell Culture
Primary hepatocytes were isolated as previously described, with minor modifications (16).
Briefly, the hepatic portal vein was cannulated with a 25G Vacutainer butterfly needle (BD
Biosciences) in anaesthetized (5% isofluorine) 8-12 week old chow-fed male C57BL/6 or
LTCFDN mice. Anterograde perfusion of the liver using a peristaltic pump (Fisher Scientific)
with Hank’s Balanced Salt Solution was followed by perfusion with digestion medium (DMEM)
containing 5.5 mmol/l glucose, 15 mmol/L HEPES, 1% penicillin/streptomycin, and type IV
93
collagenase (100 collagen digestion units/ml, Sigma). Hepatocytes were extracted from digested
livers, filtered through a 200 micron membrane, washed three times in DMEM, and re-suspended
in DMEM containing 25 mmol/l glucose, 1 mmol/l sodium lactate, 15 mmol/l HEPES, 1%
penicillin/streptomycin, 100 nmol/l dexamethasone, and 10% fetal bovine serum (FBS) prior to
seeding 500,000 cells per well in 6-well Primaria plates (BD Biosciences). After 1 h, the media
were replaced with FBS-free DMEM containing 10 mmol/l sodium lactate, 5 mmol/l glucose, 5
mmol/l HEPES, 1% penicillin/streptomycin, and 10 nmol/l dexamethasone. All experiments
were performed on the following day after seeding. Hepa1-6 cells were cultured as described
previously (15).
4.3.6 Adenovirus Experiments
The Ad-GFP, Ad-TCF7L2WT, and Ad-TCF7L2DN adenoviruses were generated using the
AdEasy XL Adenoviral Vector System (Agilent Technologies). Briefly, the TCF7L2WT and
TCF7L2DN cDNA sequences were amplified by PCR with the Q5 High-Fidelity DNA
Polymerase (New England Biolabs), following directions of the manufacturer, using primers to
append NotI and XhoI restriction sites at the 5’ and 3’ ends, respectively: TCF7L2WT-F, 5’-
CGCGCGGCCGCAAAATGCCGCAGCTGAACG-3’; TCF7L2WT-R, 5’-
CGGCTCGAGTTCTAAAGACTTGGTGACGAGC-3’; TCF7L2DN-F, 5’-
CGCGCGGCCGCAAAATGGAAACGAATCAAAACAGCTCCTC-3’; TCF7L2DN-R, 5’-
CGGCTCGAGTTCTAAAGACTTGGTGACGAGC-3’. The PCR products were separated by
agarose gel electrophoresis and purified by the Gel/PCR DNA Extraction Kit (FroggaBio). The
purified DNA products were A-tailed with Taq Polymerase (New England Biolabs) according to
the manufacturer’s protocol, followed by ligation using T4 DNA Ligase (Promega) into the
94
pGEM-T Easy vector (Promega) and routine amplification in bacteria. Clones possessing
accurate sequences were identified by DNA sequencing (ACGT Corporation). The TCF7L2WT
and TCF7L2DN were then subcloned into the pShuttle-IRES-hrGFP-2 vector (Agilent
Technologies) via the NotI/XhoI sites using T4 DNA Ligase (New England Biolabs). The PmeI-
linearized TCF7L2WT, TCF7L2DN, and empty shuttle constructs were then recombined into the
pAdEasy-1 vector through transformation into BJ5183-AD-1 cells (Agilent Technologies) and
subsequent homologous recombination. Recombinant DNA was then amplified in XL10-Gold
cells (Agilent Technologies), linearized with PacI (New England Biolabs), then transfected into
AD-293 cells (Agilent Technologies) by Lipofectamine 2000 (Life Technologies). Primary virus
particles were harvested once cells exhibited cytopathic effects three weeks following
transfection through four cycles of freeze-thaw and were subsequently used to infect AD-293
cells for further amplification. After three successive rounds of virus amplification, adenovirus
particles were purified using the Vivapure AdenoPACK 20 (Sartorius) and diluted in PBS.
Adenovirus titers were measured by absorbance at 260 nm. Virus infection efficiency was
monitored by GFP expression using the IX71 fluorescence microscope (Olympus) and Retiga
EXi Fast 1394 camera system (QImaging).
4.3.7 Western Blotting
Whole cell lysates were prepared from mouse tissue or cultured hepatocytes and subjected to
SDS-PAGE as previously described (16). Protein concentration was measured using the Bio-Rad
Protein Assay. The antibodies for TCF7L2 (clone C48H11), FoxO1, β-actin, phosphorylated β-
catenin (S675), phosphorylated β-catenin (S522), and total Akt were purchased from Cell
Signaling Technology while the total β-catenin antibody was obtained from Santa Cruz
95
Biotechnology. The antibody recognizing phosphorylated Akt (S473) was provided by
Signalway Antibody. The antibodies for γ-tubulin (Sigma) and HA tag (Covance) were generous
gifts of Dr. Tony Lam and Dr. Michael Wheeler, respectively. Densitometric analysis was
performed using ImageJ software.
4.3.8 RNA Isolation, Reverse Transcription, and Quantitative PCR
Isolation of RNA, cDNA synthesis by reverse transcription, and real-time PCR were performed
as previously described (16). Briefly, RNA was isolated from tissue or cultured cells using TRI
reagent (Sigma). One microgram of RNA was reverse transcribed to cDNA using the High
Capacity cDNA Synthesis Kit (Applied Biosystems). Real-time PCR was performed using the
Power SYBR Green Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System
(Applied Biosystems). Non-quantitative PCR was performed using the Fast DNA Polymerase
PCR Mix (KAPA) followed by agarose gel electrophoresis. Specific genes were quantified by
amplification using specific primers as listed in Table 4-1. All instructions of the manufacturers
were followed.
96
Table 4-1. RT-PCR Primers. Gene (Mouse) Sequence (5’ to 3’) Product Size (bp) Acaca Forward: CACTCCTTAGAGAGGGGTCA 330
Reverse: TAACTTCCCAGCAGACGGTG Acadl Forward: TGCCCTATATTGCGAATTACG 184
Reverse: AACACCTTGCTTCCATTGAG Actb Forward: TCATGAAGTGTGACGTTGACA 285
Reverse: CCTAGAAGCATTTGCGGTG Axin2 Forward: TGTCCAGCAAAACTCTTC 82
Reverse: CTTCTCTTGAAGGACCTGA Ehhadh Forward: TTGCTCAGACGGTTATAGG 160
Reverse: ACTGAACGGACACAAGTC Fasn Forward: AGAAGTGCAGCAAGTGTCCA 257
Reverse: GGTCGATGAGGGCAATCTGG Fbp1 Forward: GTAACATCTACAGCCTTAATGAG 153
Reverse: CCAGAGTGCGGTGAATATC G6pc Forward: TGAGACCGGACCAGGAAGTC 195
Reverse: GCAAGGTAGATCCGGGACAG Gys2 Forward: TTGTCGGTGACATCCCTTGG 140
Reverse: TTGGCCTTGGTCTGGATCAC Mlxipl Forward: CTGGGGACCTAAACAGGAGC 166
Reverse: GAAGCCACCCTATAGCTCCC Pck1 Forward: AGGGTGGCTGGCGGAGCATA 362
Reverse: GGGCCAGCGGCTCATCGATG Ppargc1a Forward: GTCCTTCCTCCATGCCTGAC 103
Reverse: TAGCTGAGCTGAGTGTTGGC Srebf1 Forward: TAGAGCATATCCCCCAGGTG 245
Reverse: GGTACGGGCCACAAGAAGTA Tcf7 Forward: AGGTCAGATGGGTTGGACTG 412
Reverse: AGGGTGCACACTGGGTTTAG Tcf7l1 Forward: GAGTGCGAAATCCCCAGTTA 384
Reverse: ATGCATGGCTTCTTGCTCTT Tcf7l2 Forward: GCATCCCTCACCCGGCCATC 243
Reverse: GCCACCTGCGCCCGAGAATC TCF7L2 (human) Forward: TCGCCTGGCACCGTAGGACA 200
Reverse: GGATGCGGAATGCCCGTCGT
97
4.3.9 Co-Immunoprecipitation
Whole cell lysates were prepared from mouse hepatic Hepa1-6 cells in RIPA buffer. Two
micrograms of either β-catenin, FoxO1, or control IgG antibody (Santa Cruz Biotechnology)
were mixed with 500 μg lysates overnight at 4 °C with agitation followed by incubation with
Protein A/G PLUS-Agarose beads (Santa Cruz Biotechnology) for 2 hr at 4 °C with agitation.
Beads were washed four times in RIPA buffer by centrifugation and removal of supernatant then
suspended in 50 μl 1x sample buffer and boiled for 5 min. Samples were then subjected to SDS-
PAGE for Western blotting. Lysates not subjected to the immunoprecipitation procedure were
used as the input controls.
4.3.10 Chromatin Immunoprecipitation (ChIP)
The ChIP procedure has been described in our previous publication (313). Briefly, formaldehyde
was added to hepatocytes isolated from WT or LTCFDN mice at a final concentration of 1% to
cross-link the chromatin and nuclear regulatory proteins. After a sonication procedure, the
appropriate antibody was added to precipitate the cross-linked sheared chromatin. Following a
reverse cross-link procedure, one-tenth of the final precipitated DNA (2 μl) was used in each
PCR. Following ChIP, PCR was performed using primers recognizing the Pck1 promoter
surrounding the FoxO binding site (Figure 4-5D): Pck1-FoxO-Forward, 5’-
GTGAGGTAACACACCCCAGC-3’; Pck1-FoxO-Reverse, 5′-AACTGCAGGCTCTTGCCTTA-
3’. The primers used to recognize Intron 1, which contains no FoxO binding site, are: Pck1-
Intron-Forward, 5’-GGGCCCACTCATGTTCTTTAC-3’, Pck1-Intron-Reverse, 5’-
98
ACCTTGGCAGAGAAATCCAG-3’. Real-time PCR was performed using Power SYBR Green
Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems).
4.3.11 Plasmid DNA Transfection and LUC Reporter Analysis
The methods for plasmid DNA transfection and LUC reporter analyses of TOPflash and Pck1(-
595/+67)-LUC were described previously (3, 15).
4.3.12 Triglyceride, Free Fatty Acid, Cholesterol, and Glycogen Measurement
To measure triglycerides, liver tissue (10 mg) or serum (25 μl) was lysed and saponified in
ethanolic potassium hydroxide at 55 °C overnight, followed by neutralization with MgCl2 (314).
Glycerol was then measured using the Free Glycerol Reagent (Sigma) and results were expressed
in equivalent triglyceride quantities. Free fatty acids were quantified in liver tissue (10 mg) or
serum (2 μl) using the Free Fatty Acid Quantification Kit (Sigma), following the directions of the
manufacturer. Total cholesterol was measured in serum (2 μl) using the Total Cholesterol E
Assay (Wako Diagnostics), following the manufacturer’s instructions. For the measurement of
hepatic glycogen content, 20 mg of liver tissue was homogenized in 2 mol/l HCl and boiled for
one hour followed by neutralization with NaOH. Hydrolyzed glycogen was then determined by
measuring glucose using the Glucose (GO) Assay Kit (Sigma). Background glucose was
determined by processing equivalent tissue samples boiled in 2 mol/l NaOH and neutralized with
HCl, which was then subtracted from the glycogen content amount.
99
4.3.13 Oil Red O Staining
Liver tissue was flash frozen in OCT and processed for oil red O staining and analysis by the
Toronto Centre for Phenogenomics Pathology Core Laboratory. Briefly, frozen tissues were
sectioned and mounted on slides, followed by fixation in 10% formalin, staining with a 0.5% oil
red O solution, and counter-staining with hematoxylin.
4.3.14 Statistical Analysis
Data are presented as means ± SEM. Significance was determined using the Student’s t-test or
one-way ANOVA followed by Bonferroni post hoc test as appropriate for single or multiple
comparisons respectively. Differences were considered statistically significant when p < 0.05.
100
4.4 Results
4.4.1 Generation of the LTCFDN Mouse Model
The Alb-TCF7L2DN fusion gene (Figure 4-1A) was constructed in which the expression of
human TCF7L2DN (98) is driven by a mouse albumin promoter/enhancer construct, kindly
provided by Dr. Richard Palmiter (312). Lacking the β-cat interaction domain (Figure 4-1A),
TCF7L2DN acts as a dominant negative molecule to block, in theory, the function of any
TCF7L2 isoforms and other TCFs such as TCF7 and TCF7L1 in the Wnt signaling pathway
which are expressed in hepatocytes (15). This fusion gene was used to generate the LTCFDN
mouse model. Among the five transgene-positive founders (Figure 4-1B), the offspring of
founder C demonstrated germ-line transmission and substantial adult hepatic TCF7L2DN protein
expression (Figure 4-1C, 4-1D) and were thus used for all further studies. Liver-specific
expression of TCF7L2DN was confirmed as this exogenous protein was not detected in other
adult organs (Figure 4-1E). While TCF7L2DN was also expressed in the liver of 2 wk old
LTCFDN mice, it was undetectable in the liver of newborn mice (Figure 4-1F). Curiously, both
wild type (WT) and LTCFDN newborn mice lacked endogenous hepatic TCF7L2 protein
expression (Figure 4-1F), although the expression of three TCF members was detectable at the
mRNA level (Figure 4-1G). In LTCFDN hepatocytes, the expression of Axin2, a known Wnt
target gene, was reduced (Figure 4-1H). The majority of our study was performed in adult male
mice. For newborn and 2 wk old mice, gender was ignored.
101
Figure 4-1. LTCFDN Mice Express TCF7L2DN Exclusively in the Adult Liver. (A) Schematic representation of the Albumin-TCF7L2DN transgene. (B) Genotyping PCR of eight founder mice. (C) Detection of TCF7L2DN protein in the offspring of one of five positive founder mice. (D) Detection of TCF7L2DN protein in adult LTCFDN mouse liver tissue but (E) not in other organs. (F) Detection of TCF7L2DN in 2 wk old but not newborn LTCFDN mice. (G) RT-PCR of exogenous human TCF7L2 as well as endogenous mouse TCFs in wild type 12 wk old liver (WT), newborn LTCFDN liver (NB), 2 wk old LTCFDN liver (2W), 12 wk old LTCFDN liver (12W), and 12 wk old LTCFDN hepatocytes (HE). (H) Axin2 mRNA expression in LTCFDN hepatocytes. HMG, high mobility group. RT-PCR, Reverse transcription polymerase chain reaction. *p < 0.05. Values represent mean + SEM.
102
4.4.2 LTCFDN Mice Exhibit Increased Hepatic Glucose Production
We initiated examination of the LTCFDN mice. On chow diet, LTCFDN 12 wk old mice showed
no significant alterations in body weight (Figure 4-2A) or fasted or fed glucose and insulin levels
(Figure 4-2B, 4-2C), but exhibited modest but significant elevations in liver weight (Figure 4-
2D). Up to an age of 42 wks on chow diet, no differences in body weight were observed (Figure
4-2A). At the 9-11 wk age, LTCFDN displayed a significant impairment in tolerance to an i.p
injection of pyruvate, a major substrate of gluconeogenesis (Figure 4-3A), although the
responses to glucose and insulin injections were comparable with that of control littermates
(Figure 4-3B, 4-3C). Further impairment in pyruvate tolerance and development of glucose
intolerance was observed at the age of 23-24 wks (Figure 4-3D, 4-3E). Pyruvate intolerance was
sustained when the mice reached 40 wks old (Figure 4-3F). Hepatocytes isolated from LTCFDN
mice produced higher levels of glucose from gluconeogenic precursors (Figure 4-3G).
Furthermore, the ability of Wnt-3a to repress glucose production in WT hepatocytes was absent
in LTCFDN hepatocytes (Figure 4-3H).
Figure 4-2. Basic Parameters of LTCFDN Mice. (A) Body weights at different ages. (B) Fasted and fed glucose levels, (C) insulin levels, and (D) liver weights of 12 wk old mice. *p < 0.05. Values represent mean + SEM.
103
Figure 4-3. LTCFDN Mice Exhibit Increased Hepatic Glucose Production. (A) Nine to 11 week old LTCFDN mice are pyruvate intolerant, but have normal (B) glucose and (C) insulin tolerance. (D) Twenty-three to 24 wk old LTCFDN mice possess further impairment in pyruvate tolerance and (E) develop impaired glucose tolerance. (F) Forty wk old LTCFDN mice maintain pyruvate intolerance. (G) LTCFDN hepatocytes show increased basal glucose production and (H) attenuation of Wnt-3a-mediated repression. AUCs for all tolerance tests are included. AU, arbitrary units; AUC, area under curve; GTT, glucose tolerance test; ITT, insulin tolerance test; PTT, pyruvate tolerance test. For G and H, p values were calculated by one-way ANOVA followed by the Bonferroni post-hoc test. *p < 0.05; **p < 0.01; ***p < 0.001. Values represent mean + SEM.
104
4.4.3 Adenovirus-Mediated Expression of TCF7L2DN but not WT TCF7L2 Increases Glucose Production In Vitro
We generated adenoviruses to elicit expression of WT TCF7L2 (Ad-TCF7L2WT), TCF7L2DN
(Ad-TCF7L2DN), or green fluorescent protein only (Ad-GFP) as a control (Figure 4-4A, 4-4B).
Primary hepatocytes infected by Ad-TCF7L2DN, but not Ad-TCF7L2WT, showed increased
glucose production and expression of a panel of gluconeogenic genes including Pck1 and G6pc
which code for the rate-limiting enzymes, as well as Fbp1 and Ppargc1a (Figure 4-4C, 4-4D).
Figure 4-4. Expression of TCF7L2DN but not WT TCF7L2 Increases Glucose Production. (A) Detection of exogenous WT TCF7L2 and TCF7L2DN in hepatocytes following adenovirus infection. (B) Brightfield and green fluorescence views of C57BL/6 hepatocytes showing greater than 95% efficiency of infection with the labelled adenoviruses. (C) Ad-TCF7L2DN but not Ad-TCF4WT infection increased glucose production and (D) gluconeogenic gene expression in primary hepatocytes. *p < 0.05. Values represent mean + SEM.
105
4.4.4 Increased Binding of the β-cat/FoxO1 Complex to the Pck1 Promoter in LTCFDN Hepatocytes
The function of TCFs is largely determined by their partner β-cat. Peptide hormones such as
GLP-1 and insulin may stimulate β-cat S675 phosphorylation and hence increase β-cat/TCF
activity (93, 315). We found previously that feeding increases hepatic TCF7L2 expression while
in vitro insulin treatment increases β-cat S675 phosphorylation in hepatocytes (15). We show
here that feeding also increased hepatic β-cat S675 and S552 phosphorylation (Figure 4-5A, 4-
5B), further supporting the notion that β-cat/TCF mediates the hepatic function of peptide
hormones in response to food consumption (15). The function of TCFs is also controlled by the
competition between TCFs and FoxOs for a limited reservoir of their common co-factor, β-cat.
We found that FoxO1 interacts with β-cat in mouse hepatocytes as precipitation of either β-cat or
FoxO1 pulled down both β-cat and FoxO1 in Hepa1-6 cells (Figure 4-5C). We then tested the in
vivo binding of FoxO1 and β-cat to the Pck1 promoter by chromatin immunoprecipitation
(ChIP). An evolutionarily conserved FoxO binding site within the Pck1 proximal promoter
region has been located (Figure 4-5D). We detected binding of β-cat and FoxO1 to the Pck1
promoter, but not within an intron, in both WT and LTCFDN hepatocytes (Figure 4-5E).
Importantly, the interactions of FoxO1 and β-cat with the Pck1 promoter were increased in
LTCFDN hepatocytes (Figure 4-5F). We suggest that TCF7L2DN-mediated inhibition of Wnt
signaling causes preferential interaction of β-cat to FoxO1 and binding to the Pck1 FoxO binding
site, resulting in the stimulation of Pck1 expression.
106
Figure 4-5. Increased Binding of the β-cat/FoxO1 Complex to Pck1 Promoter in LTCFDN Hepatocytes. (A) Increased β-cat S675 and S552 phosphorylation in the livers of fed C57BL/6 mice, with (B) densitometric quantification. (C) β-cat and FoxO1 co-immunoprecipitate in Hepa1-6 cells. (D) Schematic showing the mouse Pck1 promoter, conserved FoxO binding site, and design of PCR primers used following ChIP. (E) ChIP PCR showing binding of β-cat or FoxO1 to the Pck1 FoxO binding site region but not the Pck1 intron 1 region. (F) The interaction of β-cat and FoxO1 with the FoxO binding site on the Pck1 promoter is increased in LTCFDN hepatocytes. ChIP, chromatin immunoprecipitation. *p < 0.05. Values represent mean + SEM.
107
4.4.5 Wnt-3a and β-cat Exert Opposite Effects on Pck1 Gene Transcription
We found previously that the GSK3-inhibitor lithium inhibits Pck1 promoter activity while Wnt-
3a represses glucose production and Pck1 mRNA levels in mouse hepatocytes (15). These two
Wnt pathway activators are known to increase free β-cat levels but may possess no direct effect
on FoxO1 expression or signaling. We hence hypothesize that Wnt signaling possesses an
intrinsic repressive effect on Pck1. On the other hand, the lack of appreciable effects of Ad-
TCF7L2WT on glucose production and gluconeogenic gene expression prompted us to speculate
that β-cat but not TCFs is a limiting factor in exerting Wnt signaling in hepatocytes, at least in
certain physiological settings. Treatment of Hepa1-6 cells with Wnt-3a increased the activity of
the Wnt reporter construct, TOPflash (Figure 4-6A). In the absence of S33Y β-cat co-
transfection, Ad-TCF7L2WT or Ad-TCF7L2DN generated no significant effects on TOPflash
activity (Figure 4-6B). S33Y β-cat co-transfection significantly stimulated TOPflash activity,
while this effect was attenuated in cells expressing TCF7L2DN but not in cells expressing wild
type TCF7L2 (Figure 4-6B). Finally, S33Y β-cat expression increased Pck1 promoter activity
more than 20-fold (Figure 4-6C), likely due to the stimulatory effect of β-cat/FoxO (101). Wnt-
3a, however, repressed Pck1 promoter activity (Figure 4-6D), indicating that, in addition to
increasing free β-cat, Wnt ligands exert a yet to be identified molecular event that represses Pck1
transcription. Together, these observations illustrate the repressive effect of Wnt signaling and β-
cat/TCF on gluconeogenesis, involving the competition between TCF and FoxO for their
common co-factor β-cat and a yet to be determined intrinsic property (Figure 4-6E).
108
Figure 4-6. Wnt-3a and β-cat Exert Opposite Effects on Pck1 Gene Transcription. (A) TOPflash promoter activity in Hepa1-6 cells upon Wnt-3a ligand treatment, or (B) infection with adenoviruses and co-transfection with S33Y β-cat. (C) Pck1(-595/+67)-LUC activity is increased by S33Y β-cat and (D) reduced by Wnt-3a. (E) Schematic representation of the role of β-cat, TCF7L2, FoxO1, and Wnt ligands in regulating gluconeogenic gene expression. *p < 0.05. Values represent mean + SEM.
109
4.4.6 LTCFDN Mice Possess Impaired Lipid Homeostasis
To determine whether TCF7L2 also contributes to the maintenance of lipid homeostasis, we
examined lipid parameters in LTCFDN mice. In 12 wk old LTCFDN mice, hepatic triglyceride
(TG) content was elevated (Figure 4-7A), although free fatty acid (FFA) content remained
comparable with control littermates (Figure 4-7B). Serum TG levels were elevated after fasting
but not after feeding (Figure 4-7C), while serum FFA levels were increased after feeding with
modest elevation after fasting (Figure 4-7D). Serum total cholesterol levels were comparable in
LTCFDN and WT mice (Figure 4-7E). Consistently, Ad-TCF7L2DN, but not Ad-TCF7L2WT-
infected hepatocytes showed increased mRNA levels of the lipogenic genes Acaca, Fasn, and
Ehhadh in comparison to Ad-GFP-infected cells (Figure 4-7F). Lipid accumulation in liver
sections of adult LTCFDN mice was greatly increased (Figure 4-7G, 4-7H). In addition, we
found that adult LTCFDN mice possessed modestly elevated hepatic glycogen content (Figure 4-
8A), while Gys2 expression was significantly increased in mouse hepatocytes infected by Ad-
TCF7L2DN (Figure 4-8B), implying that TCF7L2 may also regulate glycogen metabolism.
110
Figure 4-7. LTCFDN Mice Possess Impaired Lipid Homeostasis. (A) Hepatic triglyceride content, (B) hepatic free fatty acid content, (C) serum triglycerides, (D) serum free fatty acids, and (E) serum total cholesterol levels in adult LTCFDN mice. (F) Higher lipogenic gene expression in hepatocytes infected with Ad-TCF7L2DN. (G) HE and oil red O staining in adult LTCFDN liver sections. Scale bar, 100 μm. (H) Quantification of oil red O staining. HE, hematoxylin and eosin; ORO, oil red O. *p < 0.05; **p < 0.01. Values represent mean + SEM.
111
Figure 4-8. TCF7L2DN Expression Causes Increased Glycogen Synthesis. (A) Hepatic glycogen content in 12 wk old LTCFDN mice. (B) Higher mRNA expression of Gys2 in hepatocytes infected with Ad-TCF7L2DN. *p < 0.05. Values represent mean + SEM.
4.4.7 Defects in Lipid Homeostasis are Present at a Young Age in LTCFDN Mice
To determine age-dependent effects of TCF7L2DN expression, we examined the lipid profiles of
newborn and 2 wk mice. Newborn LTCFDN mice, which do not express the transgene, showed
no abnormalities in body weight, ambient glucose, or serum TG levels, which were measured in
individual mice (Figure 4-9A, 4-9B, 4-9C). While there were no differences in body weight,
random glucose, serum TG, serum FFA, serum cholesterol, and liver weight in 2 wk old mice
(Figure 4-10A, 4-10B, 4-10C, 4-10D, 4-10E, 4-10F), LTCFDN mice had significantly elevated
hepatic TG content and a trend of increased hepatic FFA content (Figure 4-10G, 4-10H).
Figure 4-9. Parameters of Newborn LTCFDN Mice. (A) Body weight, (B) random glucose levels, and (C) serum triglyceride levels in newborn LTCFDN mice. Values represent mean + SEM.
112
Figure 4-10. Parameters of Two Week Old LTCFDN Mice. (A) Body weight, (B) random glucose levels, (C) serum triglyceride levels, (D) serum free fatty acid levels, (E) serum cholesterol levels, and (F) liver weights in 2 wk old LTCFDN mice. (G) Hepatic triglyceride and (H) free fatty acid content in 2 wk old LTCFDN mice. *p < 0.05. Values represent mean + SEM.
4.4.8 LTCFDN Mice Exhibit Normal Insulin Sensitivity
Although whole body insulin tolerance was comparable between LTCFDN and WT mice (Figure
4-3C), we examined whether hepatic insulin resistance could be a factor contributing to elevated
hepatic glucose production in LTCFDN mice. However, no observable defects in insulin-
113
stimulated Akt S473 phosphorylation were detected in the livers of LTCFDN mice (Figure 4-
11A, 4-11B). There was also no difference in insulin-stimulated Akt S473 phosphorylation in
epididymal fat (Figure 4-11C) or skeletal muscle (Figure 4-11D), ruling out the development of
hepatic or whole body insulin resistance in these transgenic animals. The early onset of increased
hepatic lipid content and the absence of insulin resistance indicate that the defects in lipid
metabolism in LTCFDN are directly caused by hepatic TCF7L2DN expression rather than as a
secondary effect of impaired glucose homeostasis.
Figure 4-11. LTCFDN Mice Exhibit Normal Insulin Sensitivity. (A) Insulin-stimulated Akt S473 phosphorylation in LTCFDN mouse livers with (B) densitometric quantification. (C) No difference in insulin-stimulated Akt S473 phosphorylation in epididymal fat, or (D) skeletal muscle between LTCFDN and WT mice. *p < 0.05. Values represent mean + SEM.
114
4.5 Discussion
The LTCFDN mice generated in this study developed a progressive impairment in pyruvate and
glucose tolerance in the absence of whole body or hepatic insulin resistance, suggesting that
TCF7L2DN expression causes elevated HGP. Based on these results and those from the use of
adenoviruses to express WT TCF7L2 or TCF7L2DN in primary hepatocytes, we suggest that the
Wnt signaling pathway effector β-cat/TCF negatively regulates HGP. This negative regulation
represents a novel mechanism by which metabolic hormones control hepatic glucose
metabolism. During fasting, while hepatic TCF7L2 levels are lower (15, 97), glucagon stimulates
the stress signaling effector FoxO1 and gluconeogenic gene expression. It is worthy of noting
that hepatic β-cat S675 phosphorylation can also be elevated by glucagon (15). In response to
food intake, insulin not only inactivates FoxO1, but also increases the expression of TCF7L2 and
β-cat S675 and S552 phosphorylation, leading to the repression of HGP (Figure 4-6E).
Following the recognition of TCF7L2 as an important type 2 diabetes risk gene, the metabolic
function of TCF7L2 has been intensively investigated. Initial studies were primarily conducted in
pancreatic β-cells, many of which suggest beneficial effects of TCF7L2 on β-cell proliferation,
viability, and insulin secretion (7, 8, 27, 56, 90, 94). However, it was recently demonstrated that
β-cell-specific deletion of Tcf7l2 in mice generates no deleterious effect on these parameters, in
contrast to another study which similarly generated β-cell-specific Tcf7l2 knockout mice but
showed an impairment in glucose homeostasis and β-cell function (10, 89). This discrepancy can
be attributed to subtle experimental details, such as the usage of different β-cell-specific
promoters (Pdx1 versus Ins2) to drive Cre recombinase-mediated excision of LoxP-flanked
Tcf7l2 sequences in β-cell lineages. We, however, cannot exclude the possibility that due to the
extreme complexity of Wnt signaling, knockout or over-expression of a given TCF member may
115
not be sufficient to reveal the true function of this signaling pathway. TCF7L2 and other TCFs
may possess certain compensatory functions, as they all carry similar DNA binding and β-cat
interaction domains. On the other hand, the TCF7L2DN molecule circumvents potential
compensation by other TCF members through the ability to inhibit the function of not only
TCF7L2 but also other TCF members via occupying the common TCF-binding sites on target
gene promoters. We have previously taken advantage of TCF7L2DN in demonstrating the role of
Wnt signaling in mediating both gut and brain GLP-1 production and function (98). Furthermore,
a transgenic mouse model was very recently generated in which the short isoform of TCF7L2DN
(58 kDa) was driven by the Ins2 promoter (90). These mice showed impaired glucose
homeostasis, reduced β-cell mass, and reduced insulin secretion, further supporting the notion
that TCF7L2 and Wnt signaling possess beneficial functions in pancreatic β-cells (90). Thus,
TCF7L2DN represents a powerful alternative approach to assess the metabolic functions of
β-cat/TCF and Wnt signaling.
We and others have investigated the metabolic function of hepatic TCF7L2. Norton et al.
initially found that silencing TCF7L2 in hepatocytes induced a marked increase in basal HGP,
associated with increased gluconeogenic gene expression, while TCF7L2 over-expression
reversed this phenotype and reduced HGP (96). An in vivo study then suggested a crucial role of
TCF7L2 in reducing HGP (97). We demonstrated the expression of three TCFs in hepatocytes
and revealed that hepatic TCF7L2 expression can be stimulated in mice by feeding or in
hepatocytes by insulin treatment in vitro, while Wnt-3a represses gluconeogenesis (15). Most
recently, the repressive effect of TCF7L2 on gluconeogenic gene expression was additionally
confirmed (95). On the other hand, the liver-specific Tcf7l2 knockout mice generated by Boj et
al. showed reduced HGP while over-expression of TCF7L2 in the liver caused increased glucose
production (10). Their suggestion that TCF7L2 is a positive regulator of gluconeogenesis is in
116
contrast to the other four liver studies (10, 15, 95-97). Evidence from the current study using the
LTCFDN mouse model and adenovirally-delivered TCF7L2DN expression further prompts us to
conclude that the Wnt signaling pathway and β-cat/TCF are repressors of hepatic
gluconeogenesis and execute their physiological action in hepatocytes primarily in response to
nutrient intake.
Our results also suggest that the co-factor β-cat, but not TCFs, serves as a limiting factor in
regulating hepatic Wnt activity, at least in certain settings. In the absence of S33Y β-cat co-
transfection, over-expression of either WT TCF7L2 or TCF7L2DN generated no appreciable
effects on TOPflash activity. The stimulatory effect of S33Y β-cat and the repressive effect of
Wnt-3a on Pck1 promoter activity further indicate that β-cat cooperates with FoxO1 in
stimulating hepatic gluconeogenesis while Wnt activation exerts an intrinsic repressive effect on
gluconeogenesis. Indeed, starvation reduced the interaction between TCF7L2 and β-cat and
reduced the expression of a panel of Wnt target genes (101). In further support of this notion, we
demonstrated that both FoxO1 and β-cat were greatly enriched at the FoxO binding site on the
Pck1 promoter in LTCFDN hepatocytes (Figure 4-5F).
LTCFDN mice also exhibited impaired lipid homeostasis characterized by increased hepatic
storages and serum levels of lipids. TCF7L2DN expression in hepatocytes caused an elevation of
several lipogenic genes. Although fat content and lipogenic gene expression were reduced in the
livers of newborn whole-body Tcf7l2-/- mice (10), previous studies using liver-specific Tcf7l2
knockout approaches in adult mice did not report any defects in lipid metabolism (10, 97). It can
be reasonably speculated that other TCF members could compensate for deficiencies in Tcf7l2,
thus masking the functions of TCF7L2. Our observations indicate that TCF7L2 and the Wnt
signaling pathway serve a beneficial role in suppressing lipogenesis. While the mechanism
117
remains unclear, it is likely that the up-regulation of lipogenic genes does not occur as a result of
an up-regulation of the transcription of Srebf1 or Mlxipl, which encode two key lipogenic
transcription factors sterol regulatory element-binding protein-1c (SREBP-1c) and carbohydrate-
responsive element-binding protein (ChREBP).
In support of our results, it was very recently demonstrated that mice deficient in the Wnt co-
receptor, LRP6, suffer from hyperlipidemia and fatty liver as a result of elevated lipogenesis as
well as lipid and cholesterol biosynthesis (303). In addition, this phenotype could be at least
partially reversed by Wnt-3a treatment, suggesting a beneficial role of Wnt signaling in lipid
homeostasis (303). IGF1 has been shown to stimulate the Akt and mTOR signaling pathways
independently of the insulin receptor substrate 1, leading to the elevation of hepatic lipogenesis
(316). Go et al. further showed in LRP6-deficient mice that plasma IGF1 levels and IGF1
receptor protein expression were increased along with the phosphorylation of Akt. The IGF1
receptor is normally ubiquitinated by LRP6 (317). In addition, IGF1 is transcriptionally regulated
by Sp1 (318, 319), while canonical Wnt signaling up-regulates Sp5 which is a suppressor of Sp1
activity (320). Sp5 expression was reduced while Sp1 and Srebf1 expression were increased in
hepatocytes from LRP6-deficient mice (303). Thus, it is likely that Wnt signaling activation
inhibits Sp1 resulting in the reduction in IGF1 levels. A potential mechanism underlying our
observation of increased lipids in LTCFDN mice implicates TCF7L2 as an important mediator of
Wnt-stimulated inhibition of hepatic IGF1. Inhibition of the Wnt pathway via TCF7L2DN
expression may potentially result in increased hepatic IGF1 and lipogenesis. Although we did not
observe any changes in Srebf1 expression, we did not assess whether the activity of SREBP-1c is
altered in LTCFDN mice via post-translational modifications. Whether hepatic TCF7L2
regulates Sp1 and IGF1 is also worthy of further investigation.
118
Taken together, we suggest that hepatic Wnt signaling and its effector β-cat/TCF serve as
important mediators of metabolic homeostasis, while chronic defects in this pathway due to
TCF7L2DN expression lead to impaired glucose and lipid metabolism. It is worthy of examining
whether high fat diet challenge may amplify these defects.
119
Chapter 5: GLP-1-Derived Nonapeptide GLP-1(28-36)amide Represses Hepatic Gluconeogenic Gene Expression and Improves Pyruvate Tolerance in High Fat Diet-Fed Mice
This chapter is modified from the following:
Ip, W., Shao, W., Chiang, Y.A., and Jin, T. (2013) GLP-1-derived nonapeptide GLP-1(28-36)amide represses hepatic gluconeogenic gene expression and improves pyruvate tolerance in high fat diet fed mice. Am J Physiol Endocrinol Metab. 305(11): E1348-58.
120
5.1 Abstract
Certain cleavage products of GLP-1 were found to possess beneficial effects on metabolic
homeostasis. Here, we investigated the function of the C-terminal fragment of GLP-1, the
nonapeptide GLP-1(28-36)amide, in hepatic glucose metabolism. C57BL/6 mice fed with high
fat diet (HFD) for 13 wks were i.p. injected with GLP-1(28-36)amide for 6 wks. A significant
reduction in body weight gain in response to HFD feeding was observed in GLP-1(28-36)amide-
treated mice. GLP-1(28-36)amide administration moderately improved glucose disposal during
glucose tolerance test but more drastically attenuated glucose production during pyruvate
tolerance test, associated with reduced hepatic expression of gluconeogenic genes Pck1, G6pc,
and Ppargc1a. Mice treated with GLP-1(28-36)amide exhibited increased phosphorylation of
PKA targets including cAMP response element-binding protein, ATF-1, and β-catenin. In
primary hepatocytes, GLP-1(28-36)amide reduced glucose production and expression of Pck1,
G6pc, and Ppargc1a, associated with increased cAMP content and PKA target phosphorylation.
These effects were attenuated by PKA inhibition. We suggest that GLP-1(28-36)amide represses
hepatic gluconeogenesis involving the activation of components of the cAMP/PKA signaling
pathway. This study further confirmed that GLP-1(28-36)amide possesses therapeutic potential
for diabetes and other metabolic disorders.
121
5.2 Introduction
The incretin hormone glucagon-like peptide-1 (GLP-1) is secreted by intestinal endocrine L cells
upon food intake and hormone regulation (109, 321, 322). GLP-1 stimulates insulin secretion in
a glucose concentration-dependent manner and positively regulates pro-insulin gene expression
(323), β-cell survival, as well as proliferation of pancreatic β-cells (109, 157, 321). Extra-
pancreatic effects of GLP-1 have also been recognized including the induction of satiety (110),
central regulation of metabolism (184), improvement in cardiac and vascular function (181, 324),
reduction in gastric emptying (177), and repression of hepatic glucose production (194), as
reviewed in detail elsewhere (109, 157). Owing to its important function in controlling blood
glucose homeostasis, two new categories of anti-diabetic drugs have been developed in the past
decade, namely GLP-1 receptor (GLP-1R) agonists and dipeptidyl peptidase-4 (DPP-4)
inhibitors, which both act to increase the activity of GLP-1 signaling to lower plasma glucose
levels (109, 157).
The active form of GLP-1 is typically considered to be the GLP-1(7-36)amide and GLP-1(7-37)
peptides, which are produced from the prohormone proglucagon via the cleavage by the
prohormone convertase PC1/3 (193, 325). In the circulation, GLP-1(7-36)amide and GLP-1(7-
37) have a very short half-life of around 2 minutes as they are rapidly degraded by DPP-4 to
GLP-1(9-36)amide or GLP-1(9-37). However, extensive recent studies have demonstrated that
the previously considered inactive peptide, GLP-1(9-36)amide, may exert protective effects in
the heart via both GLP-1R-dependent and -independent pathways (181, 203). Adding further to
the complexity, GLP-1(7-36)amide or GLP-1(7-37) as well as GLP-1(9-36)amide or GLP-1(9-
37) can also be cleaved by another peptidase, namely neutral endopeptidase (NEP) 24.11, near
the C-terminal end to produce the nonapeptide GLP-1(28-36)amide [defined as GLP-1(28-36)a
122
hereafter] (158). We and others have recently revealed the beneficial effects of GLP-1(28-36)a
on pancreatic β-cells in vivo and in vitro (215, 216). In addition, this short fragment of GLP-1
was shown to mitigate the development of obesity and hepatic steatosis in mice in response to
high fat diet (HFD) consumption (213). Furthermore, GLP-1(28-36)a was suggested to target to
mitochondria and to attenuate glucose production in mouse primary hepatocytes, although the
underlying mechanisms of these beneficial effects are currently unclear (214).
In the current study, we aimed to determine the biological effects of GLP-1(28-36)a in the liver
using the HFD-induced obese mouse model and investigate the mechanism by which GLP-1(28-
36)a represses hepatic glucose production and gluconeogenic gene expression both in vivo and in
isolated mouse primary hepatocytes.
123
5.3 Materials and Methods
5.3.1 Reagents
The nonapeptide GLP-1(28-36)amide (Sequence: FIAWLVKGR-amide) was synthesized by
Biomatik Corporation (Wilmington, DE, USA) and assessed to be >98% valid peptide by HPLC
and mass spectrometry analyses (216). The adenylyl cyclase activator forskolin and the protein
kinase A (PKA) inhibitor H89 were obtained from Sigma-Aldrich (St. Louis, MO, USA).
5.3.2 Animals
Male C57BL/6 mice were purchased from Charles River (St. Laurent, Quebec, Canada) and
housed on 12 h light/dark cycle at ambient room temperature with free access to food and water.
At the age of 8 weeks, mice were separated into individual cages and placed on a high fat diet
(Bio-Serv, Frenchtown, NJ, USA) consisting of 60% calories derived from fat. Following a HFD
feeding period of 13 weeks, administration of PBS (vehicle) or GLP-1(28-36)a (18.5 nmol/kg
body weight) was commenced via i.p. injections daily between 4 and 6 pm while maintaining
HFD feeding. Body weight and food weight were measured weekly for 4 weeks. Food weight
was converted into energy using the indicated conversion factor of 5.49 kcal/g. Feeding
efficiency was calculated as a ratio of body weight gain to energy consumption. At 4 and 5
weeks following the commencement of injections, the intraperitoneal glucose and pyruvate
tolerance tests were performed, respectively. Mice were sacrificed for collection of tissues 6
weeks following the beginning of injections. The final i.p. injections were administered the day
before sacrifice. All animal experiments were performed in accordance with the Guide for Care
124
and Use of Experimental Animals (University Health Network), and all experimental animal
protocols were approved by the Institutional Animal Care and Use Committee of the University
Health Network.
5.3.3 Intraperitoneal Glucose and Pyruvate Tolerance Tests
Mice were fasted for 16 h or 6 h prior to i.p. injection of glucose (1 g/kg body weight) or sodium
pyruvate (2 g/kg body weight) respectively (326). Plasma glucose was measured in blood
samples collected from the tail vein by glucometer (Roche Accu-Chek, QC, Canada).
5.3.4 Insulin Measurement
Plasma insulin levels were measured using the Ultra Sensitive Mouse Insulin ELISA Kit (Crystal
Chem Inc, Downers Grove, IL, USA) according to the manufacturer’s instructions.
5.3.5 Isolation of Mouse Primary Hepatocytes and Cell Culture
Primary hepatocytes were generated according to the method described with some minor
modifications (327). Briefly, the hepatic portal vein was cannulated with a 25G Vacutainer
butterfly needle in anaesthetized (5% isofluorine) 6-8 week old chow-fed male C57BL/6 mice.
Anterograde perfusion of the liver with Hank’s Balanced Salt Solution was performed using a
peristaltic pump (Fisher Scientific, Toronto, ON, Canada) followed by digestion with DMEM
containing 5.5 mmol/l glucose, 15 mmol/L HEPES, 1% penicillin/streptomycin, and type IV
collagenase (100 collagen digestion units/ml, Sigma/Aldrich). Hepatocytes were extracted from
digested livers, filtered through a 70 micron membrane, washed three times in DMEM, and re-
125
suspended in DMEM containing 25 mmol/l glucose, 1 mmol/l sodium lactate, 15 mmol/l
HEPES, 1% penicillin/streptomycin, 100 nmol/l dexamethasone, and 10% fetal bovine serum
(FBS) prior to seeding 240,000 cells per well in 12-well plates coated with type I collagen (BD
Biosciences, Franklin Lakes, NJ, USA). After 4 h, the media were replaced with FBS-free
DMEM containing 10 mmol/l sodium lactate, 5 mmol/l glucose, 5 mmol/l HEPES, 1%
penicillin/streptomycin, and 10 nmol/l dexamethasone. All experiments were performed on the
following day after seeding. The human hepatic carcinoma cell line HepG2 was cultured in
normal DMEM containing 25 mmol/l glucose, 1% penicillin/streptomycin, and 10% FBS as
previously described (15).
5.3.6 Real-time RT-PCR Analysis
Total RNA isolation and cDNA synthesis were performed as described previously (15). Real-
time RT-PCR analysis was performed using the iTaq Universal SYBR Green Supermix (Bio-
Rad, Hercules, CA, USA) and the 7900HT Real-Time PCR System (Applied Biosystems, Foster
City, CA, USA). Specific primers for RT-PCR in this study are listed as follows: Actb-F 5’-
TCATGAAGTGTGACGTTGACA-3’; Actb-R 5’-CCTAGAAGCATTTGCGGTG-3’; Pck1-F
5’-CATAACGGTCTGGACTTCTCTGC-3’; Pck1-R 5’-
GAATGGGATGACATACATGGTGCG-3’; G6pc-F 5’-CTCTGGGTGGCAGTGGTCGG-3';
G6pc-R 5’-AGGACCCACCAATACGGGCGT-3’; Creb1-F 5’-
GTGACGGAGGAGCTTGTACC-3’; Creb1-R 5’-ACCTGGGCTAATGTGGCAAT-3’;
Ppargc1a-F 5’-GTCCTTCCTCCATGCCTGAC-3’; Ppargc1a-R 5’-
TAGCTGAGCTGAGTGTTGGC-3’.
126
5.3.7 Western Blotting and Antibodies
Whole cell lysates were prepared from liver tissue or cultured cells and subjected to SDS-PAGE
as described previously (15). Protein concentration was measured using the Bio-Rad Protein
Assay. The PEPCK antibody was purchased from Abcam (Cambridge, MA, USA). Antibodies
for p-CREB (Ser133), p-β-catenin (Ser675), CREB, and β-actin originated from Cell Signaling
Technology (Danvers, MA, USA). Anti-rabbit and mouse horseradish peroxidase-conjugated
secondary antibodies were also purchased from Cell Signaling Technology. The Pierce ECL
Western Blotting Substrate (Thermo Scientific, Rockford, IL, USA) was used for
chemiluminescent detection. Densitometric analysis was performed using ImageJ.
5.3.8 Glucose Production Assay
Primary hepatocytes were depleted of glycogen by incubating in glucose-free DMEM for 2 h.
Cells were then washed with PBS and incubated in glucose production buffer (DMEM without
glucose, FBS, or phenol red, and supplemented with 10 mmol/l HEPES, 10 nmol/l
dexamethasone, 1% streptomycin/penicillin, 2 mmol/l sodium pyruvate and 20 mmol/l sodium
lactate) for 2 h. The medium was collected for the measurement of glucose using a glucose assay
kit provided by Sigma-Aldrich, followed by normalization to cellular protein content.
127
5.3.9 cAMP Assay
The collection and measurement of cAMP from hepatocytes was performed using the Cyclic
AMP Enzyme Immunoassay Kit (Cayman Chemical, Ann Arbor, MI, USA) following the
directions of the manufacturer (216).
5.3.10 Luciferase (LUC) Reporter Analysis
Transfection of 2 µg per well of PEPCK(-595 to +67 bp)-LUC plasmid DNA construct (15) was
achieved using 3 µg of polyethylenimine (Sigma) in 12-well plates. LUC reporter analyses were
performed using firefly luciferin substrate (BioShop, Burlington, ON, Canada) as previously
described (3).
5.3.11 Statistical Analysis
Quantitative results are expressed as the mean ± SEM. Significance was determined using the
Student’s t-test or one-way ANOVA with Bonferroni post-hoc test as appropriate for single or
multiple comparisons. Differences were considered statistically significant when p<0.05.
128
5.4 Results
5.4.1 GLP-1(28-36)a Reduces Body Weight Gain in Response to HFD Feeding
Thirteen weeks after the onset of HFD feeding, the body weight of mice surpassed 40 grams
(Figure 5-1A). These HFD-induced obese mice were then subjected to either PBS vehicle or
GLP-1(28-36)a i.p. injection. In agreement with a previous report by Tomas et al. (213), mice
treated with GLP-1(28-36)a were lower in body weight after 4 weeks of treatment compared to
their vehicle control-injected counterparts, although the difference was not statistically
significant (Figure 5-1A). Body weight gain, however, was significantly reduced with GLP-1(28-
36)a treatment (Figure 5-1B). In our study setting, a difference in energy consumption between
the two groups of mice was not observed (Figure 5-1C, 5-1D), which is in contrast to the report
by Tomas et al. in which GLP-1(28-36)a was administrated via osmotic pumps 4-7 weeks after
HFD feeding (213). A reduced gain in body weight despite similar intake of energy demonstrates
the lower feeding efficiency of the GLP-1(28-36)a-treated mice (Figure 5-1E). Thus, GLP-1(28-
36)a administration rendered the mice resistant to the further development of obesity in response
to HFD consumption.
129
Figure 5-1. GLP-1(28-36)a reduces body weight gain in response to HFD feeding. (A) Male C57BL/6 were fed a HFD (60% calories) for 13 weeks followed by daily i.p. injection of PBS vehicle (n=4) or GLP-1(28-36)a (n=3) for 6 weeks while maintaining HFD for measurement of weekly body weight and (C) energy intake throughout the first 4 weeks. (B) After 4 weeks of treatment, body weight gain, (D) total energy intake, and (E) feeding efficiency were calculated. *p<0.05.
130
5.4.2 GLP-1(28-36)a Improves Pyruvate Tolerance in HFD Fed Mice
To determine whether GLP-1(28-36)a administration affects carbohydrate metabolism in the
diet-induced mouse model of type 2 diabetes, we have performed two tolerance tests. Mice
treated with GLP-1(28-36)a showed significantly reduced plasma glucose levels 10 min after
delivering an i.p glucose challenge (glucose tolerance test) (Figure 5-2A). However, there was no
significant difference in the glucose area under the curve (AUC) within the 90 min experimental
period, arguing against the existence of an effect of GLP-1(28-36)a on modulating whole-body
glucose disposal, under the dosage, route, and period parameters of GLP-1(28-36)a
administration used in current study (Figure 5-2B). On the other hand, we observed a profound
effect of GLP-1(28-36)a on the tolerance of obese mice to a challenge of pyruvate, a major
substrate for hepatic gluconeogenesis, as the mice treated with GLP-1(28-36)a displayed
significantly reduced plasma glucose levels at both the 10 and 90 min time points following
pyruvate challenge (Figure 5-2C). Thus, the time at which we terminated the experiment
represents a point when GLP-1(28-36)a exerts its repressive effect on hepatic glucose production
ahead of its overall effect on glucose homeostasis, observed by Tomas et al. in long-term
treatment (213). As plasma insulin levels in these two groups of mice were comparable, the
improvement in pyruvate tolerance by GLP-1(28-36)a administration in this HFD-induced obese
mouse model is unlikely due to a secondary effect in pancreatic β-cells (Figure 5-2D).
131
Figure 5-2. GLP-1(28-36)a improves pyruvate tolerance in HFD fed mice. (A) Mice treated with either PBS vehicle (n=4) or GLP-1(28-36)a (n=3) were starved for 16 h or 6 h prior to i.p injection of glucose (1 g/kg) or (C) pyruvate (2 g/kg) for glucose and (C) pyruvate tolerance tests after 4 and 5 weeks of treatment, respectively, with (B) AUC for glucose tolerance test shown. (D) Fasting plasma insulin levels were measured. *p<0.05.
132
5.4.3 GLP-1(28-36)a Represses Hepatic Gluconeogenesis
Improved pyruvate tolerance in GLP-1(28-36)a-injected mice suggests that this nonapeptide may
repress hepatic glucose production. We hence assessed the expression of hepatic gluconeogenic
genes in the two groups of mice following 6 weeks of i.p. injections. Indeed, the mRNA levels of
Pck1 and G6pc, which encode the two rate-limiting enzymes of gluconeogenesis, were
significantly lower in the livers of mice treated with GLP-1(28-36)a compared to mice receiving
vehicle treatment (Figure 5-3A). We have also observed a reduction in protein levels of PEPCK,
the product of Pck1 (Figure 5-3B, 5-3C).
We then conducted in vitro assessments of the effect of GLP-1(28-36)a on hepatic
gluconeogenesis. Mouse primary hepatocytes were isolated from adult chow-fed C57BL/6 mice,
followed by vehicle (acetonitrile) or GLP-1(28-36)a treatment. Hepatocytes treated with GLP-
1(28-36)a for 4 h secreted significantly less glucose into the surrounding media (Figure 5-3D). In
addition, we observed a significant reduction of Pck1 and G6pc mRNA levels following GLP-
1(28-36)a treatment (Figure 5-3E), in agreement with our in vivo findings (Figure 5-3A). The
profound repressive effect of GLP-1(28-36)a on Pck1 and G6pc mRNA expression as well as
PEPCK levels was also evident when we performed the same examinations in the human hepatic
HepG2 cell line (Figure 5-3F, 5-3G). In addition, GLP-1(28-36)a repressed the expression of the
PEPCK-Luciferase fusion reporter gene construct (15) when it was transfected into HepG2 cells
(Figure 5-3H). Furthermore, GLP-1(28-36)a treatment attenuated forskolin-stimulated
gluconeogenic gene expression in primary hepatocytes (Figure 5-3I). The repressive effect of
GLP-1(28-36)a on gluconeogenesis observed in the in vitro setting further supports the notion for
the existence of a direct effect of this nonapeptide in hepatocytes, independent of insulin or
extra-hepatic mechanisms.
133
Figure 5-3. GLP-1(28-36)a reduces hepatic gluconeogenic gene expression. (A) Liver tissue was collected following 6 weeks of treatment of either PBS vehicle (n=4) or GLP-1(28-36)a (n=3) for measurement of Pck1 and G6pc levels by real-time RT-PCR and (B) PEPCK levels by Western blotting. (C) Densitometric quantification of PEPCK normalized to β-actin. (D) Primary hepatocytes isolated from chow-fed C57BL/6 mice were treated with acetonitrile (vehicle) or 100 nmol/l GLP-1(28-36)a (n≥3) followed by measurement of glucose output after 4 h or (E) Pck1 and G6pc mRNA expression after 8 h. (F) HepG2 cells were treated with acetonitrile (vehicle) or 100 nmol/l GLP-1(28-36)a (n≥3) for 8 h, followed by measurement of Pck1 and G6pc mRNA expression by real-time RT-PCR and (G) for measurement of PEPCK protein levels by Western blotting. (H) HepG2 cells were transfected with the PEPCK(-593 to +67 bp)-luciferase reporter construct. Forty-eight h after the transfection, cells were treated with acetonitrile (vehicle) or 100 nmol/l GLP-1(28-36)a for 4 h (n≥3), followed by cell harvesting and luciferase activity assessment. (I) Mouse primary hepatocytes were treated with acetonitrile (vehicle), or 100 nmol/l GLP-1(28-36)a, or 25 µmol/l forskolin (FSK), or both GLP-1(28-36)a and FSK for 8 h (n≥3), followed by RNA extraction and the measurement of Pck1 and G6pc expression by real time RT-PCR. *p<0.05.
134
5.4.4 GLP-1(28-36)a Activates cAMP/PKA Signaling
In pancreatic β-cells, GLP-1 is known to exert its incretin effect via cAMP/PKA activation. In
hepatocytes, the cAMP/PKA signaling pathway is also importantly involved in the regulation of
gluconeogenesis in response to fasting and fed cues in which the activation of cAMP/PKA
typically leads to a stimulation, but not the repression, of hepatic gluconeogenesis (328). Here we
assessed the effect of GLP-1(28-36)a on the cAMP/PKA signaling cascade. Increased levels of
the phosphorylation of known targets of PKA including cAMP response element-binding protein
(CREB) (Ser133), activating transcription factor 1 (ATF-1) (Ser63), and β-catenin (Ser675) were
observed in the livers of mice treated with GLP-1(28-36)a (Figure 5-4A, 5-4B). Moreover,
protein levels of total CREB were also increased significantly following GLP-1(28-36)a
administration (Figure 5-4A, 5-4B), although we did not detect appreciable changes in Creb1
mRNA levels (Figure 5-4C). Nevertheless, phosphorylated-CREB (Ser133) levels remained
significantly enhanced when normalized to total CREB levels (Figure 5-4D).
135
Figure 5-4. GLP-1(28-36)a stimulates the cAMP/PKA signaling pathway in HFD fed mice. (A) Whole cell lysates were extracted from liver tissue collected following 6 weeks administration of PBS vehicle (n=4) or GLP-1(28-36)a (n=3) for analysis of PKA target phosphorylation by Western blotting. (B) Quantification of protein phosphorylation from panel A normalized to β-actin. (C) RNA was extracted from liver tissue for measurement of Creb1 by real-time RT-PCR. (D) Quantification of phosphorylated-CREB (Ser133) normalized to total CREB. *p<0.05.
136
We then determined the direct in vitro effect of GLP-1(28-36)a on cAMP/PKA signaling in
mouse primary hepatocytes. Indeed, 4 h treatment of GLP-1(28-36)a stimulated the
phosphorylation of CREB (Ser133), ATF-1 (Ser63), and β-catenin (Ser675) in primary
hepatocytes (Figure 5-5A, 5-5B), although the stimulation on CREB and ATF-1 phosphorylation
was less substantial when compared to the effect of forskolin, a chemical commonly utilized as
an activator of adenylyl cyclase. Furthermore, we noticed a repressive effect of forskolin on total
CREB levels, which was not observed upon GLP-1(28-36)a treatment (Figure 5-5A, 5-5B).
When CREB Ser133 phosphorylation levels were normalized to total CREB levels, the
activations by forskolin and GLP-1(28-36)a were 9.4 and 1.6 fold respectively (Figure 5-5C).
Again, we did not observe any effect of GLP-1(28-36)a on Creb1 mRNA levels (Figure 5-5D).
Surprisingly, the stimulatory effects of forskolin and GLP-1(28-36)a on cytoplasmic cAMP
levels in primary hepatocytes were comparable (Figure 5-5E). In the HepG2 cell line, the
phosphorylation of CREB (Ser133), ATF-1 (Ser63), and β-catenin (Ser675) was elevated in a
time-dependent manner following GLP-1(28-36)a treatment, with statistical significance
observed at the 120 and 240 min time points (Figure 5-5F, 5-5G). No notable differences in the
phosphorylation status of FoxO1 (Ser256), AMPK (Thr172), Akt (Ser473), or GSK3α/β
(Ser21/9) could be detected in primary hepatocytes upon treatment with GLP-1(28-36)a (data not
shown).
137
Figure 5-5. GLP-1(28-36)a stimulates the cAMP/PKA signaling pathway in primary hepatocytes. (A) Primary hepatocytes isolated from chow-fed C57BL/6 mice were treated with acetonitrile (vehicle), 25 µmol/l forskolin (FSK), or 100 nmol/l GLP-1(28-36)a for 4 h (n≥3) for analysis of PKA target phosphorylation in whole cell lysates by Western blotting. (B) Quantification of protein phosphorylation in panel A normalized to β-actin. (C) Quantification of phosphorylated-CREB (Ser133) normalized to total CREB. (D) Mouse primary hepatocytes were cultured and treated for 8 h (n≥3) followed by measurement of Creb1 mRNA expression. (E) Mouse primary hepatocytes were treated with PBS, FSK, or GLP-1(28-36)a for 1 h (n≥3) for measurement of cytoplasmic cAMP levels. (F) HepG2 cells were treated with 100 nmol/l GLP-1(28-36)a for the indicated times (n≥3). Cells were harvested for measurement of PKA target phosphorylation by Western blotting, with indicated antibodies. (G) Quantification of protein phosphorylation in panel F normalized to β-actin. *p<0.05.
138
5.4.5 GLP-1(28-36)a Represses the Expression of Peroxisome Proliferator-Activated Receptor Gamma Co-Activator 1-Alpha (PGC-1α)
PGC-1α can be up-regulated by CREB-mediated cAMP signaling, and it serves as a
transcriptional co-activator for PEPCK and glucose-6-phosphatase in concert with CREB and
FoxO1 (236). We found that the mRNA level of the gene for PGC-1α, Ppargc1a, was
significantly lower in the livers of GLP-1(28-36)a injected mice when compared to that of the
vehicle treated mice (Figure 5-6A). This down-regulatory effect of GLP-1(28-36)a on Ppargc1a
mRNA levels was then verified in vitro in mouse primary hepatocytes (Figure 5-6B). In contrast,
forskolin stimulated Ppargc1a mRNA expression levels in primary hepatocytes, while GLP-
1(28-36)a attenuated the stimulatory effect of forskolin (Figure 5-6B). These observations
collectively suggest that GLP-1(28-36)a may down-regulate hepatic gluconeogenesis via a
mechanism upstream of Ppargc1a.
Figure 5-6. GLP-1(28-36)a down-regulates the expression of gluconeogenic transcriptional co-activator PGC-1α. (A) Liver tissue from mice administered PBS vehicle (n=4) or GLP-1(28-36)a (n=3) for 6 weeks was extracted for measurement of mRNA expression of the gene for PGC-1α, Ppargc1a, via real-time RT-PCR. (B) Mouse primary hepatocytes were treated with acetonitrile (vehicle), 100 nmol/l GLP-1(28-36)a, 25 µmol/l forskolin (FSK), or both GLP-1(28-36)a and FSK for 8 h (n≥3) for measurement of Ppargc1a mRNA. *: p<0.05.
139
5.4.6 Inhibition of PKA Attenuates the Effect of GLP-1(28-36)a on Gluconeogenic Gene Expression
To further explore the involvement of cAMP/PKA signaling in mediating the repressive effect of
GLP-1(28-36)a on hepatic gluconeogenic gene expression, we assessed the effect of PKA
inhibition in mouse primary hepatocytes. Pre-treating primary hepatocytes with the PKA
inhibitor H89 attenuated the ability of 4 h treatment of GLP-1(28-36)a or forskolin to stimulate
CREB (Ser133), ATF-1 (Ser63), and β-catenin (Ser675) phosphorylation (Figure 5-7A, 5-7B).
The pre-treatment of primary hepatocytes with the same dosage of H89 also blocked or
significantly attenuated the repressive effect of GLP-1(28-36)a on Pck1 and Ppargc1a
expression levels, while the effect on restoring G6pc expression was not significant (Figure 5-
7C). In the HepG2 cell line, inhibition of PKA also blunted the stimulatory effect of GLP-1(28-
36)a on PKA target phosphorylation (Figure 5-7D).
140
Figure 5-7. PKA inhibition attenuates the effects of GLP-1(28-36)a on gluconeogenic gene expression. (A) Primary hepatocytes isolated from chow-fed C57BL/6 mice were pre-treated with 10 µmol/l H89 for 45 min followed by treatment with acetonitrile (vehicle), 25 µmol/l forskolin (FSK), or 100 nmol/l GLP-1(28-36)a for 4 h (n≥3) for analysis of PKA target phosphorylation by Western blotting. (B) Quantification of protein phosphorylation from panel A normalized to β-actin. (C) Mouse primary hepatocytes were pre-treated with H89 for 45 min followed by treatment with acetonitrile (vehicle), 25 µmol/l FSK, or 100 nmol/l GLP-1(28-36)a for 8 h (n≥3) for measurement of mRNA expression
by real-time RT-PCR. *p<0.05. (D) HepG2 cells were pre-treated with 10 µmol/l H89 for 45 min, followed by treatment with acetonitrile (vehicle, V), 10 µmol/l forskolin (F), or 100 nmol/l GLP-1(28-36)a (G) for 4 h (n≥3). Whole cell lysates were prepared for analysis of PKA target phosphorylation by Western blotting.
141
5.5 Discussion
Although NEP 24.11 has been known for nearly two decades to cleave GLP-1 into GLP-1(28-
36)a (158), the potential biological function or “pharmacological” effect of this nonapeptide has
not been assessed until very recently (213, 214, 216). Investigations have shown that GLP-1(28-
36)a prevented obesity and hepatic steatosis in the HFD-induced diabetic mouse model (214).
The present study characterized the biological actions and initiated the exploration of the
underlying mechanism of GLP-1(28-36)a in hepatocytes. We verified its effect on attenuating
body weight gain, and revealed for the first time the improvement of tolerance to a challenge of
pyruvate. While we cannot exclude the potential contribution of reduced adipose tissue to a
reduction in hepatic glucose production, we assessed the direct effect of GLP-1(28-36)a on
hepatic gluconeogenic gene expression. In both in vivo and in vitro settings, GLP-1(28-36)a
repressed the expression of two gluconeogenic enzymes and the gluconeogenic transcriptional
co-activator, PGC-1α.
In spite of great technical difficulty, effort has been made to determine whether the incretin
hormone GLP-1 also possesses an insulin-independent effect on hepatic glucose production. An
early report in 1994 showed that infusion of GLP-1 resulted in lower rates of hepatic glucose
production in human subjects (190). This outcome was, however, entirely attributed to the
incretin effect of GLP-1 (190). Other studies attempted to rule out the pancreatic effects of GLP-
1 by utilizing the pancreatic clamp technique in which somatostatin is co-infused. When the
pancreatic effects of GLP-1 were eliminated, insulin-independent effects of GLP-1 on peripheral
glucose turnover could not be clearly demonstrated in several investigations (191-193). One
study, however, showed that GLP-1 produced a 17% decrease in glucose appearance with no
significant effect on glucose disappearance, suggesting that GLP-1 suppresses hepatic glucose
142
production independent of its action on pancreatic hormones (194). In accordance with this
report, a very recent human pancreatic clamp study demonstrated that infusion of physiological
post-prandial levels of GLP-1 reduced hepatic glucose production by 27% but had no effect on
whole-body glucose disposal (195). The in vivo and in vitro repressive effect of GLP-1(28-36)a
on hepatic gluconeogenic gene expression observed in the current study supports the intriguing
notion that a cleavage product of GLP-1, GLP-1(28-36)a, may possess the ability to reduce
hepatic gluconeogenesis.
Another interesting question is whether GLP-1 reduces hepatic glucose production via direct
activation of its receptor on hepatocytes, or indirectly through a neural-mediated pathway, or via
a yet to be determined alternative mechanism. Early investigations indicated the lack of GLP-1R
in the liver (109, 173) while a few recent studies suggested the existence of a functional GLP-1R
on hepatocytes (175, 176, 196, 197). A very recent study pointed out that antibodies utilized for
GLP-1R detection are unreliable as they generated false positive signals (198). Regardless of
these controversies, we present here evidence that GLP-1(28-36)a represses hepatic
gluconeogenic gene expression directly in primary hepatocytes, leading to reduced glucose
output. Administration of this peptide in diet-induced obese mice reduced hepatic gluconeogenic
gene expression.
NEP 24.11 efficiently cleaves GLP-1(7-36)amide or GLP-1(9-36)amide into GLP-1(28-36)a
(158) or the even smaller C-terminal peptide GLP-1(32-36)amide (217). When the NEP 24.11
inhibitor candoxatril was administered in pigs undergoing GLP-1 infusion, glucose tolerance
improved, likely through the improvement of GLP-1 pharmacokinetics (329). NEP 24.11
inhibition also led to improved vascular and neural complications in HFD-induced and
streptozotocin-induced diabetic rats (330-332). These observations collectively suggest that the
143
prevention of NEP 24.11-mediated GLP-1 degradation confers benefits to glucose homeostasis,
which is conceptually in contradiction to the notion that GLP-1(28-36)a exerts beneficial effects
in glucose metabolism. A potential explanation would be that the full-length GLP-1 and its
“degradation” C-terminal fragments execute their beneficial function via different molecular
mechanisms, with and without the involvement of GLP-1R. This could be due to the utilization
of a yet to be identified receptor or receptor-independent mechanism, such as mitochondrial
targeting (214). As the method for specific detection of circulating endogenous GLP-1(28-36)a
has yet to be developed, we may only propose that GLP-1(28-36)a possesses pharmacological
effects. Determination of the physiological function of GLP-1 C-terminal fragments requires
further investigations.
Numerous studies have revealed that degradation products of GLP-1 do exert biological
activities. GLP-1(9-36)amide increases myocardial glucose uptake and improves left ventricular
performance in dogs with dilated cardiomyopathy (208), and mediates cytoprotection in
cardiomyocytes through a pathway independent of GLP-1R (180, 181). In the brain, GLP-1(9-
36)amide rescues synaptic plasticity and memory deficits in a mouse model of Alzheimer’s
disease (209). In HFD-induced obese mouse model, GLP-1(9-36)amide was also shown to
repress glucose production and inhibit body weight gain (210, 211). To date, GLP-1(28-36)a has
been shown to reduce body weight gain and hepatic steatosis in HFD-induced mouse model
(213, 214), and confer protective and proliferative benefits in pancreatic β-cells both in vitro and
in the streptozotocin-induced type 1 diabetes model (215, 216). We have suggested that in
pancreatic β-cells, the beneficial effect of GLP-1(28-36)a is at least partially due to the activation
of cAMP/PKA/β-catenin signaling pathway (216). As a co-factor of the stress signaling pathway
effector FoxO, β-catenin is considered a positive stimulator of hepatic gluconeogenesis (101). As
144
a co-factor of the Wnt signaling pathway effector TCF7L2, β-catenin activation may lead to the
repression of hepatic gluconeogenesis, suggested by a few recent studies (15, 96, 97).
Glucagon is secreted during fasting to enhance hepatic glucose production for energy supply to
the rest of the body. Glucagon exerts its function by activating the cAMP/PKA signaling
cascade, leading to the activation of CREB, which then serves to up-regulate gluconeogenic gene
expression in concert with TORC2, CBP, FoxO1, PGC-1α, and others (333). We show here that
GLP-1(28-36)a activates the same cAMP/PKA/CREB pathway as glucagon but exerts opposite
effect on gluconeogenesis. Nevertheless, we found that GLP-1(28-36)a inhibited PGC-1α
expression level, in contrast with the known stimulatory effect of glucagon and forskolin on
PGC-1α expression (Figure 5-6B) (251). The mechanism by which the hepatocyte differentiates
between the signals from glucagon and GLP-1 or GLP-1(28-36)a is worthy of further
investigation. Activation of a plasma membrane G-protein coupled receptor by glucagon or GLP-
1 typically results in PKA target phosphorylation within 5-30 minutes (197). The relatively slow
stimulation of PKA target phosphorylation by GLP-1(28-36)a which we observed in HepG2 cells
(Figure 5-5F, 5-5G) leads us to speculate that the nonapeptide may activate a compartmentalized
cAMP pathway in the mitochondria (197, 334). It is possible that activation of the cAMP
pathway by glucagon at the plasma membrane may result in increased gluconeogenesis, while
activation of the cAMP pathway in the mitochondrial matrix by GLP-1(28-36)a may result in
decreased gluconeogenesis (214, 334). In addition, although we did not observe any effect of
GLP-1(28-36)a on AMPK phosphorylation, we cannot completely exclude the possibility that
GLP-1(28-36)a increases phosphorylated CREB via AMPK activation (335).
In summary, we have verified the repressive effect of GLP-1(28-36)a on body weight gain in the
diet-induced obese model, and revealed for the first time that this is associated with improved
145
tolerance to pyruvate challenge in vivo. Our in vitro analyses suggest that GLP-1(28-36)a
activates the cAMP/PKA/CREB signaling pathway, but has the unique ability of repressing
gluconeogenic gene expression and glucose output. These observations further support the notion
that the nonapeptide GLP-1(28-36)a possesses therapeutic potential for diabetes and other
metabolic disorders (213-215).
146
Chapter 6: Concluding Summary, General Discussion, and Future Directions
147
6.1 Concluding Summary
Common single nucleotide polymorphisms (SNPs) in the human transcription factor 7-like 2
(TCF7L2) gene are strongly associated with type 2 diabetes risk as well as increased hepatic
glucose production (4, 12). The primary aim of this thesis was to examine the metabolic function
of TCF7L2 and the Wnt signaling pathway in hepatocytes.
We started our investigations by assessing the hepatic expression of TCF7L2 at the adult stage
and whether it could be regulated by nutrient availability. All four members of the T-cell factor
(TCF) family were shown to be expressed in the mouse liver. In addition, the TOPGAL
Wnt/TCF-reporter mouse demonstrated that Wnt signaling was especially active in hepatocytes
surrounding the central hepatic veins, which are typically associated with decreased levels of
gluconeogenesis. More interestingly, TCF7L2 protein levels were increased in the livers of fed
mice, while insulin treatment of hepatocytes up-regulated TCF7L2 transcription. Since a major
function of insulin is the repression of hepatic gluconeogenesis, we then assessed whether
TCF7L2 and the Wnt signaling pathway regulate gluconeogenesis. Knockdown of TCF7L2
increased while treatment with the Wnt ligand Wnt-3a decreased glucose production and
expression of the gluconeogenic genes Pck1 and G6pc in hepatocytes.
Based on these findings, we have generated the liver-specific dominant negative TCF7L2
(TCF7L2DN) mouse model called LTCFDN which allowed us to examine the in vivo role of
TCF7L2 and the Wnt signaling pathway in hepatic glucose metabolism. As we expected,
LTCFDN mice exhibited substantial intolerance to pyruvate, a major substrate for
gluconeogenesis, and progressively developed impaired glucose tolerance. Consistently,
LTCFDN hepatocytes produced more glucose while Wnt-3a failed to repress gluconeogenesis
148
due to the inhibition of Wnt signaling by TCF7L2DN. Adenovirally-delivered expression of
TCF7L2DN in C57BL/6 mouse primary hepatocytes, but not wild type TCF7L2, showed that
inhibition of the Wnt signaling pathway leads to increased expression of gluconeogenic genes
including Pck1, G6pc, Fbp1, and Ppargc1a. Interestingly, we observed that transfection of the
constitutively active S33Y β-cat mutant generated a positive effect whereas Wnt-3a treatment
generated a negative effect on the activity of the Pck1 promoter. β-cat physically interacted with
the gluconeogenic transcriptional activator forkhead box O1 (FoxO1), and this complex was
enriched on the Pck1 promoter in LTCFDN hepatocytes, suggesting that β-cat functions bi-
directionally and is likely a limiting factor for which FoxO1 and TCF7L2 both compete.
LTCFDN mice were also characterized by impaired lipid homeostasis as they possessed
increased fat accumulation in the liver, owing to greater storages of triglycerides and free fatty
acids. TCF7L2DN expression in hepatocytes revealed an up-regulation of lipogenic genes Acaca,
Fasn, and Ehhadh. These results suggest that TCF7L2 and the Wnt signaling pathway serve
beneficial roles in maintaining both glucose and lipid homeostasis by suppressing
gluconeogenesis and lipogenesis.
The secondary aim of this thesis was to examine the potential effect of the glucagon-like peptide-
1 (GLP-1) metabolite, GLP-1(28-36)amide, on hepatic glucose production via the Wnt signaling
pathway. Evidence has accumulated recently that GLP-1 represses hepatic glucose production
independently of its effect on insulin production (194, 195). As both GLP-1 production and
function are regulated by TCF7L2 and the Wnt signaling pathway, we assessed whether GLP-
1(28-36)amide treatment regulated hepatic gluconeogenesis in mice. GLP-1(28-36)amide
administration improved pyruvate tolerance and reduced the hepatic expression of gluconeogenic
genes Pck1, G6pc, and Ppargc1a in diet-induced obese mice. In addition, GLP-1(28-36)amide
treatment activated the cAMP/PKA signaling pathway and led to increased levels of Ser675
149
phosphorylation of β-catenin. Inhibition of this pathway in vitro attenuated the repressive effects
of GLP-1(28-36)amide on gluconeogenesis in hepatocytes.
Taken together, this thesis identifies two novel regulators of hepatic glucose production: TCF7L2
and the GLP-1 metabolite GLP-1(28-36)amide.
150
6.2 General Discussion
In 2006, it was discovered that common SNPs in the TCF7L2 gene are strongly associated with
the risk of type 2 diabetes development (4). This finding was replicated by numerous genome-
wide association studies across many different ethnic backgrounds, defining TCF7L2 as the gene
with the most robust association with type 2 diabetes risk (5, 6). It was well known that TCF7L2,
as a downstream effector of the Wnt signaling pathway, is pivotal in organogenesis and
tumourigenesis. However, little was known about the role of TCF7L2 in metabolic homeostasis
besides the involvement of TCF7L2 in regulating intestinal GLP-1 production, discovered by our
group (3). Many investigators then examined the potential functions of TCF7L2 in mediating
pancreatic β-cell survival and function. While at the onset of this thesis research in 2009, there
were already a number of reports demonstrating the molecular metabolic functions of TCF7L2 in
pancreatic β-cells, none such studies existed in hepatocytes. As the human genetic studies also
showed an association between TCF7L2 diabetes risk SNPs and elevated hepatic glucose
production (9, 12, 99), we chose to investigate the function of TCF7L2 in hepatocytes. The
overall conclusion from my work that TCF7L2 is a negative regulator of hepatic gluconeogenesis
implies that the human TCF7L2 risk alleles could potentially represent loss-of-function alleles, as
risk SNP carriers exhibited increased hepatic glucose production (9, 12).
Prior to the publication of the first study exemplifying the role of TCF7L2 in hepatic
gluconeogenesis by Norton et al. (96), both the lead author of this study as well as I
simultaneously orally presented our respective unpublished results on the repressive effect of
TCF7L2 on hepatic gluconeogenesis at the American Diabetes Association Scientific Meeting in
2011. Soon after, Norton et al. published these findings on TCF7L2 as well as the identification
of numerous metabolic genes which TCF7L2 was detected to bind to, including a site located
151
proximally downstream of the Pck1 gene, by a chromatin immunoprecipitation method
combined with massively parallel DNA sequencing (ChIP-Seq) (96). We expanded this line of
work by demonstrating that treatment with a canonical Wnt ligand, Wnt-3a, repressed hepatic
gluconeogenic gene expression, indicating that TCF7L2 likely acts as a repressor of
gluconeogenesis via its role as a downstream effector of the Wnt signaling pathway (15). In
addition, we showed for the first time that TCF7L2 expression is regulated by nutrient
availability as the protein levels of TCF7L2 were elevated in the livers of fed C57BL/6 mice. As
insulin treatment in vitro produced similar results in hepatocytes, our results suggested that
insulin could at least partially repress hepatic glucose production via the Wnt signaling pathway
effectors β-cat/TCF in the fed state.
Very shortly after, Oh et al. published similar evidence that confirmed the effect of feeding on
the up-regulation of hepatic TCF7L2 protein levels, while also adding that TCF7L2 was down-
regulated in the livers of obese mice, which are insulin-resistant (97). This group used in vivo
loss-of- and gain-of-function models for the first time to demonstrate the repressive effect of
TCF7L2 on hepatic glucose production in mice. Liver-specific knockdown of TCF7L2 via
adenovirally-delivered shRNA caused increased hepatic gluconeogenesis and impaired glucose
tolerance in the mice, while adenovirally-delivered over-expression of TCF7L2 induced the
opposite effects (97). Mechanistically, the authors suggested that TCF7L2 binds to the promoters
of gluconeogenic genes at putative T-cell factor (TCF)-binding sites and inhibits the activity of
transcriptional activators including CREB, CRTC2, and FoxO1 through competitive inhibition at
the promoter sites (97).
Our in vivo results, however, demonstrate that TCF7L2DN expression causes increased hepatic
glucose production. As TCF7L2DN still possesses the DNA-binding domain known as the high
152
mobility group box, but produced effects opposite to that which were reported by Oh et al. upon
over-expression of wild type TCF7L2, our results are inconsistent with the mechanism proposed
by Oh et al. (97). Interestingly, our infection with the Ad-TCF7L2WT virus did not produce any
statistically significant effects on gluconeogenesis, despite causing greater than 95% infection of
hepatocytes. Our results then suggest that β-cat serves as the limiting factor in regulating hepatic
gluconeogenesis by acting as a co-factor for both FoxO1 and TCF7L2. This phenomenon of
competition for β-cat has been previously demonstrated in models of bone disease and suggested
recently in hepatocytes (101-104). With a limited pool of nuclear β-cat, the over-expression of
TCF7L2 alone may not have any further effect on repressing gluconeogenesis as all β-cat
molecules are already occupied during this state. In the fasting state, β-cat pairs with FoxO1 in
stimulating gluconeogenesis. During the fed state, however, FoxO1 is excluded from the nucleus
by the action of insulin, allowing β-cat to then interact with TCF7L2 in repressing
gluconeogenesis. As transfection of β-cat S33Y mutant and treatment with Wnt-3a produced
opposite effects on Pck1 transcription, we propose that the Wnt signaling pathway possesses a
yet to be determined intrinsic repressive effect on gluconeogenesis.
Consistent with the suggestion that TCF7L2 is a repressor of hepatic gluconeogenesis, Neve et
al. very recently reported that knockdown of TCF7L2 leads to an elevation in the transcription of
gluconeogenic genes (95). They also confirmed our previous findings that insulin stimulates the
expression of TCF7L2 in hepatocytes. Neve et al. also noted in human livers that the expression
of certain transcripts of TCF7L2 was elevated in individuals with type 2 diabetes as well as in
those carrying the TCF7L2 SNP rs7903146 (95). This finding, however, contradicts with the
notions that TCF7L2 SNPs are associated with increased hepatic glucose production while
TCF7L2 represses gluconeogenesis. It is worthy of performing systematic examinations to
determine exactly how the SNPs in TCF7L2 affect the expression and function of TCF7L2.
153
We have also demonstrated for the first time that hepatic TCF7L2 and Wnt signaling regulate
lipid homeostasis in adulthood. It has been previously shown that newborn TCF7L2 systemic
knockout mice had alterations in hepatic lipid storage and expression of genes related to lipid
metabolism, but no effects in adult liver-specific TCF7L2 knockout mice were reported (10). A
potential explanation is that, in the context of lipid metabolism, the effect of knockout of
TCF7L2 alone could be compensated for by other TCF members, thus masking the role of
TCF7L2. In our study, we inhibited the entire Wnt signaling pathway via expressing TCF7L2DN
and were able to identify a role of the Wnt signaling pathway in repressing hepatic lipogenesis.
LTCFDN possessed drastically increased lipid accumulation in the liver. Our findings are
complemented by a recent report by Go et al., which demonstrated the ability of Wnt-3a
administration to rescue mice possessing a mutation in the Wnt co-receptor Lrp6 from combined
hyperlipidemia (303). Go et al. also demonstrated an up-regulation of the hepatic IGF1 system in
these LRP6-mutant mice, identifying a potential mechanism by which Wnt signaling may inhibit
lipogenesis via a pathway involving Sp5, Sp1, IGF1, and Akt/mTOR signaling (303). Moreover,
as FoxO1 is an inhibitor of lipogenesis via repressing lipogenic genes including Srebf1 (250), it
is probable that TCF7L2’s involvement in repressing lipogenic genes is via a mechanism distinct
from the competition between TCF7L2 and FoxO1 for β-cat that more likely involves an
intrinsic role of TCF7L2 in regulating Wnt target gene expression.
While insulin and glucagon are the principle hormones which regulate hepatic glucose
production, there is increasing evidence that GLP-1 also importantly regulates this process
independently of its effects on pancreatic hormones (194, 195). In addition, there is an
increasing number of reports demonstrating that the previously assumed inactive “degradation”
products of GLP-1 do in fact possess biological activity, which they exert via GLP-1R-
independent pathways (180, 181, 211, 214, 216, 217). As TCF7L2 at least partially mediates the
154
actions of GLP-1 on pancreatic β-cells (93) and metabolites of GLP-1 have been shown to reduce
glucose output from hepatocytes (210, 214), it is interesting to determine whether GLP-1
represses hepatic glucose production via its metabolite, the nonapeptide GLP-1(28-36)amide,
and whether GLP-1(28-36)amide represses gluconeogenesis via β-cat/TCF7L2 and activating the
Wnt signaling pathway. However, our initial data (not shown) gave no indication that GLP-1(28-
36)amide stimulated downstream Wnt activity or up-regulated the expression of TCF7L2 in
hepatocytes. Although we observed an increase in the phosphorylation of β-cat at Ser675 by
GLP-1(28-36)amide treatment, we suggest that this phosphorylation event occurs as a result of
the increased activity of PKA, which has been shown to phosphorylate this residue of β-cat (45,
336). PKA activation along with β-cat Ser675 phosphorylation are known to importantly mediate
the insulinomimetic effect of GLP-1 (93). Thus, we suggest that GLP-1(28-36)amide instead
exerts its function alternatively via the cAMP/PKA/β-cat signaling pathway. Interestingly, we
showed also that feeding in mice and insulin treatment of hepatocytes both led to increased β-cat
Ser675 phosphorylation as well as increased Wnt activity. We therefore cannot exclude the
involvement of the Wnt signaling pathway in mediating the effects of GLP-1(28-36)amide
without further detailed study. At this point, it is unclear how the increase in Ser675
phosphorylation of β-cat by GLP-1(28-36)amide administration may affect the dynamic of the
interactions between β-cat and FoxO1, between β-cat and TCF7L2, as well as between these
complexes and the promoters of gluconeogenic genes. Previous studies, however, do indicate
that increased Ser675 phosphorylation of β-cat is associated with enhanced downstream Wnt
activity (45, 336).
155
6.3 Future Directions
6.3.1 Further Characterization of LTCFDN Mice
In our study, we have assessed hepatic glucose production in LTCFDN mice by performing
pyruvate tolerance tests and measuring glucose output ex vivo in isolated hepatocytes. It would
be interesting to measure in vivo hepatic glucose production in this mouse model using the
hyperinsulinemic-euglycemic clamp procedure which, if the results are consistent, would further
substantiate our conclusions. In addition, it would be beneficial to examine the metabolic effects
of TCF7L2DN expression in mice with C57BL/6 genetic background, as the FVB background
used in our study is not optimal for the study of metabolism, especially with high fat diet feeding.
To this end, we are currently conducting successive back-crosses of the LTCFDN strain to the
C57BL/6 background. Furthermore, while we observed defects in both glucose and lipid
homeostasis in the LTCFDN mice, whether the observed phenotype would be amplified after a
high fat diet challenge, which causes hepatic insulin resistance, is worthy of a systematic
investigation.
6.3.2 Further Mechanistic Studies
Although we have demonstrated using various in vitro and in vivo approaches that TCF7L2 and
the Wnt signaling pathway are negative regulators of hepatic gluconeogenesis, clarification of
the precise molecular mechanisms underlying this effect is still required to move this research
area forward. To this date, three liver-specific TCF7L2 mouse models have been reported,
including this thesis, which have produced some controversial suggestions. Oh et al. suggest that
156
TCF7L2 inhibits gluconeogenesis by sterically blocking positive transcriptional regulators from
binding to the promoters of gluconeogenic genes (97). Boj et al. suggest that TCF7L2 stimulates
gluconeogenesis by binding to gene promoters and increasing their transcription (10). We,
however, based on our observations, propose that TCF7L2 inhibits gluconeogenesis via two
mechanisms. Firstly, TCF7L2 competes with the gluconeogenic transcriptional activator FoxO1
for their common co-factor β-cat, and secondly, TCF7L2 possesses an intrinsic repressive effect
on gluconeogenesis by regulating gluconeogenic genes. The later situation could occur via an
effect of TCF7L2 directly on gluconeogenic genes or indirectly by regulating other factors which
then repress gluconeogenic gene expression. To examine the competition between TCF7L2 and
FoxO1, it would be interesting to determine using real-time RT-PCR and qChIP whether
elevation of TCF7L2 leads to a reduction in the expression of downstream FoxO1 target genes
and binding of FoxO1/β-cat to their promoters, while elevation of FoxO1 leads to a reduction in
downstream Wnt target gene expression and binding of TCF7L2/β-cat to Wnt target gene
promoters.
6.3.3 Role of Other TCF Members
In Chapter 4, we circumvented the possibility that other TCF members may compensate for the
loss of TCF7L2 in knockout models by taking advantage of the TCF7L2DN molecule. To this
date, there have been no reports of other TCF members, such as TCF7, TCF7L1, and LEF-1,
being involved in regulating metabolism in the liver or elsewhere. It would be important to
determine whether other TCF members also regulate hepatic gluconeogenesis since they also
function as downstream effectors of Wnt signaling, bind to β-cat, and are expressed in
hepatocytes (15).
157
6.3.4 Effect of TCF7L2 SNPs on the Function and Expression of TCF7L2
Many investigators have reported metabolic functions of TCF7L2 in the pancreas, gut, brain,
adipose tissue, and liver, yet we still do not know how the common SNPs in the human TCF7L2
gene have any effect on either the function or expression of TCF7L2. The SNPs are single
nucleotide variations that are all located within intronic regions of the gene and thus would not
be expected to affect the amino acid sequence of the TCF7L2 protein. It is more likely that the
polymorphisms affect the expression of different TCF7L2 isoforms or the alternative splicing of
the pre-mRNA sequence, although this has not been confirmed. It was very recently reported that
the strongest TCF7L2 risk allele (rs7903146) positively correlated with TCF7L2 expression in
the livers of normoglycemic individuals (95). In addition, it has been shown that different
isoforms of TCF7L2 can exert different and even opposite functions in regulating glucose
homeostasis, at least in pancreatic β-cells (91). It would be extremely relevant to determine in
hepatocytes whether different isoforms have alternative functions, and whether their specific
expressions are affected by the risk alleles.
158
References
1. Morin, P.J., Sparks, A.B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K.W. 1997. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275:1787-1790.
2. Moon, R.T., Brown, J.D., and Torres, M. 1997. WNTs modulate cell fate and behavior during vertebrate development. Trends Genet 13:157-162.
3. Yi, F., Brubaker, P.L., and Jin, T. 2005. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by beta-catenin and glycogen synthase kinase-3beta. J Biol Chem 280:1457-1464.
4. Grant, S.F., Thorleifsson, G., Reynisdottir, I., Benediktsson, R., Manolescu, A., Sainz, J., Helgason, A., Stefansson, H., Emilsson, V., Helgadottir, A., et al. 2006. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet 38:320-323.
5. Voight, B.F., Scott, L.J., Steinthorsdottir, V., Morris, A.P., Dina, C., Welch, R.P., Zeggini, E., Huth, C., Aulchenko, Y.S., Thorleifsson, G., et al. 2010. Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. Nat Genet 42:579-589.
6. Saxena, R., Elbers, C.C., Guo, Y., Peter, I., Gaunt, T.R., Mega, J.L., Lanktree, M.B., Tare, A., Castillo, B.A., Li, Y.R., et al. 2012. Large-scale gene-centric meta-analysis across 39 studies identifies type 2 diabetes loci. Am J Hum Genet 90:410-425.
7. Shu, L., Sauter, N.S., Schulthess, F.T., Matveyenko, A.V., Oberholzer, J., and Maedler, K. 2008. Transcription factor 7-like 2 regulates beta-cell survival and function in human pancreatic islets. Diabetes 57:645-653.
8. Shu, L., Zien, K., Gutjahr, G., Oberholzer, J., Pattou, F., Kerr-Conte, J., and Maedler, K. 2012. TCF7L2 promotes beta cell regeneration in human and mouse pancreas. Diabetologia 55:3296-3307.
9. Lyssenko, V., Lupi, R., Marchetti, P., Del Guerra, S., Orho-Melander, M., Almgren, P., Sjogren, M., Ling, C., Eriksson, K.F., Lethagen, A.L., et al. 2007. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest 117:2155-2163.
10. Boj, S.F., van Es, J.H., Huch, M., Li, V.S., Jose, A., Hatzis, P., Mokry, M., Haegebarth, A., van den Born, M., Chambon, P., et al. 2012. Diabetes Risk Gene and Wnt Effector Tcf7l2/TCF4 Controls Hepatic Response to Perinatal and Adult Metabolic Demand. Cell 151:1595-1607.
11. Savic, D., Ye, H., Aneas, I., Park, S.Y., Bell, G.I., and Nobrega, M.A. 2011. Alterations in TCF7L2 expression define its role as a key regulator of glucose metabolism. Genome research 21:1417-1425.
12. Pilgaard, K., Jensen, C.B., Schou, J.H., Lyssenko, V., Wegner, L., Brons, C., Vilsboll, T., Hansen, T., Madsbad, S., Holst, J.J., et al. 2009. The T allele of rs7903146 TCF7L2 is associated with impaired insulinotropic action of incretin hormones, reduced 24 h profiles of plasma insulin and glucagon, and increased hepatic glucose production in young healthy men. Diabetologia 52:1298-1307.
13. Ip, W., Chiang, Y.T., and Jin, T. 2012. The involvement of the wnt signaling pathway and TCF7L2 in diabetes mellitus: The current understanding, dispute, and perspective. Cell & bioscience 2:28.
159
14. Chiang, Y.T., Ip, W., and Jin, T. 2012. The role of the Wnt signaling pathway in incretin hormone production and function. Front Physiol 3:273.
15. Ip, W., Shao, W., Chiang, Y.T., and Jin, T. 2012. The Wnt signaling pathway effector TCF7L2 is upregulated by insulin and represses hepatic gluconeogenesis. Am J Physiol Endocrinol Metab 303:E1166-1176.
16. Ip, W., Shao, W., Chiang, Y.T., and Jin, T. 2013. GLP-1-derived nonapeptide GLP-1(28-36)amide represses hepatic gluconeogenic gene expression and improves pyruvate tolerance in high fat diet fed mice. Am J Physiol Endocrinol Metab.
17. Peifer, M., and Polakis, P. 2000. Wnt signaling in oncogenesis and embryogenesis--a look outside the nucleus. Science 287:1606-1609.
18. Nusse, R., and Varmus, H.E. 1982. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31:99-109.
19. Jin, T., and Liu, L. 2008. The Wnt signaling pathway effector TCF7L2 and type 2 diabetes mellitus. Mol Endocrinol 22:2383-2392.
20. Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease. Cell 127:469-480.
21. Rachner, T.D., Khosla, S., and Hofbauer, L.C. 2011. Osteoporosis: now and the future. Lancet 377:1276-1287.
22. Naito, A.T., Shiojima, I., and Komuro, I. 2010. Wnt signaling and aging-related heart disorders. Circ Res 107:1295-1303.
23. MacDonald, B.T., Tamai, K., and He, X. 2009. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17:9-26.
24. Yang, Y. 2012. Wnt signaling in development and disease. Cell Biosci 2:14. 25. Gordon, M.D., and Nusse, R. 2006. Wnt signaling: multiple pathways, multiple receptors,
and multiple transcription factors. J Biol Chem 281:22429-22433. 26. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P.J., and
Clevers, H. 1998. Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat Genet 19:379-383.
27. Schafer, S.A., Tschritter, O., Machicao, F., Thamer, C., Stefan, N., Gallwitz, B., Holst, J.J., Dekker, J.M., t Hart, L.M., Nijpels, G., et al. 2007. Impaired glucagon-like peptide-1-induced insulin secretion in carriers of transcription factor 7-like 2 (TCF7L2) gene polymorphisms. Diabetologia 50:2443-2450.
28. Saxena, R., Gianniny, L., Burtt, N.P., Lyssenko, V., Giuducci, C., Sjogren, M., Florez, J.C., Almgren, P., Isomaa, B., Orho-Melander, M., et al. 2006. Common single nucleotide polymorphisms in TCF7L2 are reproducibly associated with type 2 diabetes and reduce the insulin response to glucose in nondiabetic individuals. Diabetes 55:2890-2895.
29. Prokunina-Olsson, L., Kaplan, L.M., Schadt, E.E., and Collins, F.S. 2009. Alternative splicing of TCF7L2 gene in omental and subcutaneous adipose tissue and risk of type 2 diabetes. PLoS One 4:e7231.
30. Shu, L., Matveyenko, A.V., Kerr-Conte, J., Cho, J.H., McIntosh, C.H., and Maedler, K. 2009. Decreased TCF7L2 protein levels in type 2 diabetes mellitus correlate with downregulation of GIP- and GLP-1 receptors and impaired beta-cell function. Hum Mol Genet 18:2388-2399.
31. Groves, C.J., Zeggini, E., Minton, J., Frayling, T.M., Weedon, M.N., Rayner, N.W., Hitman, G.A., Walker, M., Wiltshire, S., Hattersley, A.T., et al. 2006. Association analysis of 6,736 U.K. subjects provides replication and confirms TCF7L2 as a type 2
160
diabetes susceptibility gene with a substantial effect on individual risk. Diabetes 55:2640-2644.
32. Guo, T., Hanson, R.L., Traurig, M., Muller, Y.L., Ma, L., Mack, J., Kobes, S., Knowler, W.C., Bogardus, C., and Baier, L.J. 2007. TCF7L2 is not a major susceptibility gene for type 2 diabetes in Pima Indians: analysis of 3,501 individuals. Diabetes 56:3082-3088.
33. Grant, S.F., Hakonarson, H., and Schwartz, S. 2010. Can the genetics of type 1 and type 2 diabetes shed light on the genetics of latent autoimmune diabetes in adults? Endocr Rev 31:183-193.
34. Lyssenko, V., Jonsson, A., Almgren, P., Pulizzi, N., Isomaa, B., Tuomi, T., Berglund, G., Altshuler, D., Nilsson, P., and Groop, L. 2008. Clinical risk factors, DNA variants, and the development of type 2 diabetes. N Engl J Med 359:2220-2232.
35. Lyssenko, V., Lupi, R., Marchetti, P., Del Guerra, S., Orho-Melander, M., Almgren, P., Sjogren, M., Ling, C., Eriksson, K.F., Lethagen, A.L., et al. 2007. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest 117:2155-2163.
36. Jin, T., George Fantus, I., and Sun, J. 2008. Wnt and beyond Wnt: multiple mechanisms control the transcriptional property of beta-catenin. Cellular signalling 20:1697-1704.
37. Rijsewijk, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D., and Nusse, R. 1987. The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell 50:649-657.
38. Du, S.J., Purcell, S.M., Christian, J.L., McGrew, L.L., and Moon, R.T. 1995. Identification of distinct classes and functional domains of Wnts through expression of wild-type and chimeric proteins in Xenopus embryos. Mol Cell Biol 15:2625-2634.
39. Kuhl, M. 2002. Non-canonical Wnt signaling in Xenopus: regulation of axis formation and gastrulation. Semin Cell Dev Biol 13:243-249.
40. Baarsma, H.A., Konigshoff, M., and Gosens, R. 2013. The WNT signaling pathway from ligand secretion to gene transcription: molecular mechanisms and pharmacological targets. Pharmacol Ther 138:66-83.
41. Krutzfeldt, J., and Stoffel, M. 2010. Regulation of wingless-type MMTV integration site family (WNT) signalling in pancreatic islets from wild-type and obese mice. Diabetologia 53:123-127.
42. Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H., Woodgett, J., and He, X. 2005. A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature 438:873-877.
43. Dierick, H., and Bejsovec, A. 1999. Cellular mechanisms of wingless/Wnt signal transduction. Curr Top Dev Biol 43:153-190.
44. Stambolic, V., Ruel, L., and Woodgett, J.R. 1996. Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol 6:1664-1668.
45. Hino, S., Tanji, C., Nakayama, K.I., and Kikuchi, A. 2005. Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase stabilizes beta-catenin through inhibition of its ubiquitination. Mol Cell Biol 25:9063-9072.
46. Frayling, T.M. 2007. Genome-wide association studies provide new insights into type 2 diabetes aetiology. Nat Rev Genet 8:657-662.
47. Florez, J.C. 2007. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr Metab Care 10:391-396.
48. Billings, L.K., and Florez, J.C. 2010. The genetics of type 2 diabetes: what have we learned from GWAS? Ann N Y Acad Sci 1212:59-77.
49. Groop, L. 2010. Open chromatin and diabetes risk. Nat Genet 42:190-192.
161
50. Duggirala, R., Blangero, J., Almasy, L., Dyer, T.D., Williams, K.L., Leach, R.J., O'Connell, P., and Stern, M.P. 1999. Linkage of type 2 diabetes mellitus and of age at onset to a genetic location on chromosome 10q in Mexican Americans. Am J Hum Genet 64:1127-1140.
51. Reynisdottir, I., Thorleifsson, G., Benediktsson, R., Sigurdsson, G., Emilsson, V., Einarsdottir, A.S., Hjorleifsdottir, E.E., Orlygsdottir, G.T., Bjornsdottir, G.T., Saemundsdottir, J., et al. 2003. Localization of a susceptibility gene for type 2 diabetes to chromosome 5q34-q35.2. Am J Hum Genet 73:323-335.
52. Cauchi, S., Meyre, D., Choquet, H., Dina, C., Born, C., Marre, M., Balkau, B., and Froguel, P. 2006. TCF7L2 variation predicts hyperglycemia incidence in a French general population: the data from an epidemiological study on the Insulin Resistance Syndrome (DESIR) study. Diabetes 55:3189-3192.
53. Chang, Y.C., Chang, T.J., Jiang, Y.D., Kuo, S.S., Lee, K.C., Chiu, K.C., and Chuang, L.M. 2007. Association study of the genetic polymorphisms of the transcription factor 7-like 2 (TCF7L2) gene and type 2 diabetes in the Chinese population. Diabetes 56:2631-2637.
54. Alibegovic, A.C., Sonne, M.P., Hojbjerre, L., Hansen, T., Pedersen, O., van Hall, G., Holst, J.J., Stallknecht, B., Dela, F., and Vaag, A. 2010. The T-allele of TCF7L2 rs7903146 associates with a reduced compensation of insulin secretion for insulin resistance induced by 9 days of bed rest. Diabetes 59:836-843.
55. Cornelis, M.C., Qi, L., Kraft, P., and Hu, F.B. 2009. TCF7L2, dietary carbohydrate, and risk of type 2 diabetes in US women. Am J Clin Nutr 89:1256-1262.
56. da Silva Xavier, G., Loder, M.K., McDonald, A., Tarasov, A.I., Carzaniga, R., Kronenberger, K., Barg, S., and Rutter, G.A. 2009. TCF7L2 regulates late events in insulin secretion from pancreatic islet beta-cells. Diabetes 58:894-905.
57. Dabelea, D., Dolan, L.M., D'Agostino, R., Jr., Hernandez, A.M., McAteer, J.B., Hamman, R.F., Mayer-Davis, E.J., Marcovina, S., Lawrence, J.M., Pihoker, C., et al. 2011. Association testing of TCF7L2 polymorphisms with type 2 diabetes in multi-ethnic youth. Diabetologia 54:535-539.
58. Duan, Q.L., Dube, M.P., Frasure-Smith, N., Barhdadi, A., Lesperance, F., Theroux, P., St-Onge, J., Rouleau, G.A., and McCaffery, J.M. 2007. Additive effects of obesity and TCF7L2 variants on risk for type 2 diabetes among cardiac patients. Diabetes Care 30:1621-1623.
59. Florez, J.C. 2008. Newly identified loci highlight beta cell dysfunction as a key cause of type 2 diabetes: where are the insulin resistance genes? Diabetologia 51:1100-1110.
60. Florez, J.C., Jablonski, K.A., Bayley, N., Pollin, T.I., de Bakker, P.I., Shuldiner, A.R., Knowler, W.C., Nathan, D.M., and Altshuler, D. 2006. TCF7L2 polymorphisms and progression to diabetes in the Diabetes Prevention Program. N Engl J Med 355:241-250.
61. Gjesing, A.P., Kjems, L.L., Vestmar, M.A., Grarup, N., Linneberg, A., Deacon, C.F., Holst, J.J., Pedersen, O., and Hansen, T. 2011. Carriers of the TCF7L2 rs7903146 TT genotype have elevated levels of plasma glucose, serum proinsulin and plasma gastric inhibitory polypeptide (GIP) during a meal test. Diabetologia 54:103-110.
62. Gloyn, A.L., Braun, M., and Rorsman, P. 2009. Type 2 diabetes susceptibility gene TCF7L2 and its role in beta-cell function. Diabetes 58:800-802.
63. Gonzalez-Sanchez, J.L., Martinez-Larrad, M.T., Zabena, C., Perez-Barba, M., and Serrano-Rios, M. 2008. Association of variants of the TCF7L2 gene with increases in the risk of type 2 diabetes and the proinsulin:insulin ratio in the Spanish population. Diabetologia 51:1993-1997.
162
64. Ng, M.C., Park, K.S., Oh, B., Tam, C.H., Cho, Y.M., Shin, H.D., Lam, V.K., Ma, R.C., So, W.Y., Cho, Y.S., et al. 2008. Implication of genetic variants near TCF7L2, SLC30A8, HHEX, CDKAL1, CDKN2A/B, IGF2BP2, and FTO in type 2 diabetes and obesity in 6,719 Asians. Diabetes 57:2226-2233.
65. Vacik, T., Stubbs, J.L., and Lemke, G. 2011. A novel mechanism for the transcriptional regulation of Wnt signaling in development. Genes & development 25:1783-1795.
66. Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J.P., and He, X. 2000. LDL-receptor-related proteins in Wnt signal transduction. Nature 407:530-535.
67. Wehrli, M., Dougan, S.T., Caldwell, K., O'Keefe, L., Schwartz, S., Vaizel-Ohayon, D., Schejter, E., Tomlinson, A., and DiNardo, S. 2000. arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature 407:527-530.
68. Hey, P.J., Twells, R.C., Phillips, M.S., Yusuke, N., Brown, S.D., Kawaguchi, Y., Cox, R., Guochun, X., Dugan, V., Hammond, H., et al. 1998. Cloning of a novel member of the low-density lipoprotein receptor family. Gene 216:103-111.
69. Twells, R.C., Mein, C.A., Payne, F., Veijola, R., Gilbey, M., Bright, M., Timms, A., Nakagawa, Y., Snook, H., Nutland, S., et al. 2003. Linkage and association mapping of the LRP5 locus on chromosome 11q13 in type 1 diabetes. Hum Genet 113:99-105.
70. Twells, R.C., Mein, C.A., Phillips, M.S., Hess, J.F., Veijola, R., Gilbey, M., Bright, M., Metzker, M., Lie, B.A., Kingsnorth, A., et al. 2003. Haplotype structure, LD blocks, and uneven recombination within the LRP5 gene. Genome Res 13:845-855.
71. Guo, Y.F., Xiong, D.H., Shen, H., Zhao, L.J., Xiao, P., Guo, Y., Wang, W., Yang, T.L., Recker, R.R., and Deng, H.W. 2006. Polymorphisms of the low-density lipoprotein receptor-related protein 5 (LRP5) gene are associated with obesity phenotypes in a large family-based association study. J Med Genet 43:798-803.
72. Fujino, T., Asaba, H., Kang, M.J., Ikeda, Y., Sone, H., Takada, S., Kim, D.H., Ioka, R.X., Ono, M., Tomoyori, H., et al. 2003. Low-density lipoprotein receptor-related protein 5 (LRP5) is essential for normal cholesterol metabolism and glucose-induced insulin secretion. Proc Natl Acad Sci U S A 100:229-234.
73. Kanazawa, A., Tsukada, S., Sekine, A., Tsunoda, T., Takahashi, A., Kashiwagi, A., Tanaka, Y., Babazono, T., Matsuda, M., Kaku, K., et al. 2004. Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes. Am J Hum Genet 75:832-843.
74. van Tienen, F.H., Laeremans, H., van der Kallen, C.J., and Smeets, H.J. 2009. Wnt5b stimulates adipogenesis by activating PPARgamma, and inhibiting the beta-catenin dependent Wnt signaling pathway together with Wnt5a. Biochem Biophys Res Commun 387:207-211.
75. Yang, Y., Topol, L., Lee, H., and Wu, J. 2003. Wnt5a and Wnt5b exhibit distinct activities in coordinating chondrocyte proliferation and differentiation. Development 130:1003-1015.
76. Ross, S.E., Hemati, N., Longo, K.A., Bennett, C.N., Lucas, P.C., Erickson, R.L., and MacDougald, O.A. 2000. Inhibition of adipogenesis by Wnt signaling. Science 289:950-953.
77. Longo, K.A., Wright, W.S., Kang, S., Gerin, I., Chiang, S.H., Lucas, P.C., Opp, M.R., and MacDougald, O.A. 2004. Wnt10b inhibits development of white and brown adipose tissues. J Biol Chem 279:35503-35509.
78. Vertino, A.M., Taylor-Jones, J.M., Longo, K.A., Bearden, E.D., Lane, T.F., McGehee, R.E., Jr., MacDougald, O.A., and Peterson, C.A. 2005. Wnt10b deficiency promotes
163
coexpression of myogenic and adipogenic programs in myoblasts. Mol Biol Cell 16:2039-2048.
79. Schinner, S., Ulgen, F., Papewalis, C., Schott, M., Woelk, A., Vidal-Puig, A., and Scherbaum, W.A. 2008. Regulation of insulin secretion, glucokinase gene transcription and beta cell proliferation by adipocyte-derived Wnt signalling molecules. Diabetologia 51:147-154.
80. Murtaugh, L.C., Law, A.C., Dor, Y., and Melton, D.A. 2005. Beta-catenin is essential for pancreatic acinar but not islet development. Development 132:4663-4674.
81. Dessimoz, J., Bonnard, C., Huelsken, J., and Grapin-Botton, A. 2005. Pancreas-specific deletion of beta-catenin reveals Wnt-dependent and Wnt-independent functions during development. Curr Biol 15:1677-1683.
82. Heiser, P.W., Lau, J., Taketo, M.M., Herrera, P.L., and Hebrok, M. 2006. Stabilization of beta-catenin impacts pancreas growth. Development 133:2023-2032.
83. Offield, M.F., Jetton, T.L., Labosky, P.A., Ray, M., Stein, R.W., Magnuson, M.A., Hogan, B.L., and Wright, C.V. 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995.
84. Rulifson, I.C., Karnik, S.K., Heiser, P.W., ten Berge, D., Chen, H., Gu, X., Taketo, M.M., Nusse, R., Hebrok, M., and Kim, S.K. 2007. Wnt signaling regulates pancreatic beta cell proliferation. Proc Natl Acad Sci U S A 104:6247-6252.
85. Liu, Z., and Habener, J.F. 2008. Glucagon-like peptide-1 activation of TCF7L2-dependent Wnt signaling enhances pancreatic beta cell proliferation. J Biol Chem 283:8723-8735.
86. DasGupta, R., and Fuchs, E. 1999. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126:4557-4568.
87. Krutzfeldt, J., and Stoffel, M. 2009. Regulation of wingless-type MMTV integration site family (WNT) signalling in pancreatic islets from wild-type and obese mice. Diabetologia.
88. Angus-Hill, M.L., Elbert, K.M., Hidalgo, J., and Capecchi, M.R. 2011. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A 108:4914-4919.
89. da Silva Xavier, G., Mondragon, A., Sun, G., Chen, L., McGinty, J.A., French, P.M., and Rutter, G.A. 2012. Abnormal glucose tolerance and insulin secretion in pancreas-specific Tcf7l2-null mice. Diabetologia 55:2667-2676.
90. Takamoto, I., Kubota, N., Nakaya, K., Kumagai, K., Hashimoto, S., Kubota, T., Inoue, M., Kajiwara, E., Katsuyama, H., Obata, A., et al. 2014. TCF7L2 in mouse pancreatic beta cells plays a crucial role in glucose homeostasis by regulating beta cell mass. Diabetologia 57:542-553.
91. Le Bacquer, O., Shu, L., Marchand, M., Neve, B., Paroni, F., Kerr Conte, J., Pattou, F., Froguel, P., and Maedler, K. 2011. TCF7L2 splice variants have distinct effects on beta-cell turnover and function. Hum Mol Genet 20:1906-1915.
92. Prokunina-Olsson, L., Welch, C., Hansson, O., Adhikari, N., Scott, L.J., Usher, N., Tong, M., Sprau, A., Swift, A., Bonnycastle, L.L., et al. 2009. Tissue-specific alternative splicing of TCF7L2. Hum Mol Genet 18:3795-3804.
93. Liu, Z., and Habener, J.F. 2008. Glucagon-like peptide-1 activation of TCF7L2-dependent Wnt signaling enhances pancreatic beta cell proliferation. J Biol Chem 283:8723-8735.
164
94. Shu, L., Matveyenko, A.V., Kerr-Conte, J., Cho, J.H., McIntosh, C.H., and Maedler, K. 2009. Decreased TCF7L2 protein levels in type 2 diabetes mellitus correlate with downregulation of GIP- and GLP-1 receptors and impaired beta-cell function. Hum Mol Genet 18:2388-2399.
95. Neve, B., Le Bacquer, O., Caron, S., Huyvaert, M., Leloire, A., Poulain-Godefroy, O., Lecoeur, C., Pattou, F., Staels, B., and Froguel, P. 2014. Alternative human liver transcripts of TCF7L2 bind to the gluconeogenesis regulator HNF4alpha at the protein level. Diabetologia 57:785-796.
96. Norton, L., Fourcaudot, M., Abdul-Ghani, M.A., Winnier, D., Mehta, F.F., Jenkinson, C.P., and Defronzo, R.A. 2011. Chromatin occupancy of transcription factor 7-like 2 (TCF7L2) and its role in hepatic glucose metabolism. Diabetologia 54:3132-3142.
97. Oh, K.J., Park, J., Kim, S.S., Oh, H., Choi, C.S., and Koo, S.H. 2012. TCF7L2 modulates glucose homeostasis by regulating CREB- and FoxO1-dependent transcriptional pathway in the liver. PLoS genetics 8:e1002986.
98. Shao, W., Wang, D., Chiang, Y.T., Ip, W., Zhu, L., Xu, F., Columbus, J., Belsham, D.D., Irwin, D.M., Zhang, H., et al. 2013. The Wnt signaling pathway effector TCF7L2 controls gut and brain proglucagon gene expression and glucose homeostasis. Diabetes 62:789-800.
99. Wegner, L., Hussain, M.S., Pilgaard, K., Hansen, T., Pedersen, O., Vaag, A., and Poulsen, P. 2008. Impact of TCF7L2 rs7903146 on insulin secretion and action in young and elderly Danish twins. J Clin Endocrinol Metab 93:4013-4019.
100. Gebhardt, R., and Hovhannisyan, A. 2010. Organ patterning in the adult stage: the role of Wnt/beta-catenin signaling in liver zonation and beyond. Developmental dynamics : an official publication of the American Association of Anatomists 239:45-55.
101. Liu, H., Fergusson, M.M., Wu, J.J., Rovira, II, Liu, J., Gavrilova, O., Lu, T., Bao, J., Han, D., Sack, M.N., et al. 2011. Wnt signaling regulates hepatic metabolism. Science signaling 4:ra6.
102. Essers, M.A., de Vries-Smits, L.M., Barker, N., Polderman, P.E., Burgering, B.M., and Korswagen, H.C. 2005. Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 308:1181-1184.
103. Almeida, M., Han, L., Martin-Millan, M., O'Brien, C.A., and Manolagas, S.C. 2007. Oxidative stress antagonizes Wnt signaling in osteoblast precursors by diverting beta-catenin from T cell factor- to forkhead box O-mediated transcription. J Biol Chem 282:27298-27305.
104. Hoogeboom, D., Essers, M.A., Polderman, P.E., Voets, E., Smits, L.M., and Burgering, B.M. 2008. Interaction of FOXO with beta-catenin inhibits beta-catenin/T cell factor activity. J Biol Chem 283:9224-9230.
105. Manolagas, S.C., and Almeida, M. 2007. Gone with the Wnts: beta-catenin, T-cell factor, forkhead box O, and oxidative stress in age-dependent diseases of bone, lipid, and glucose metabolism. Mol Endocrinol 21:2605-2614.
106. Ahlzen, M., Johansson, L.E., Cervin, C., Tornqvist, H., Groop, L., and Ridderstrale, M. 2008. Expression of the transcription factor 7-like 2 gene (TCF7L2) in human adipocytes is down regulated by insulin. Biochem Biophys Res Commun 370:49-52.
107. Prokunina-Olsson, L., Welch, C., Hansson, O., Adhikari, N., Scott, L.J., Usher, N., Tong, M., Sprau, A., Swift, A., Bonnycastle, L.L., et al. 2009. Tissue-specific alternative splicing of TCF7L2. Hum Mol Genet 18:3795-3804.
165
108. Brinkmeier, M.L., Potok, M.A., Davis, S.W., and Camper, S.A. 2007. TCF4 deficiency expands ventral diencephalon signaling and increases induction of pituitary progenitors. Dev Biol 311:396-407.
109. Baggio, L.L., and Drucker, D.J. 2007. Biology of incretins: GLP-1 and GIP. Gastroenterology 132:2131-2157.
110. Turton, M.D., O'Shea, D., Gunn, I., Beak, S.A., Edwards, C.M., Meeran, K., Choi, S.J., Taylor, G.M., Heath, M.M., Lambert, P.D., et al. 1996. A role for glucagon-like peptide-1 in the central regulation of feeding. Nature 379:69-72.
111. Greer, E.L., and Brunet, A. 2005. FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene 24:7410-7425.
112. Accili, D., and Arden, K.C. 2004. FoxOs at the crossroads of cellular metabolism, differentiation, and transformation. Cell 117:421-426.
113. Basu, S., Michaelsson, K., Olofsson, H., Johansson, S., and Melhus, H. 2001. Association between oxidative stress and bone mineral density. Biochem Biophys Res Commun 288:275-279.
114. Almeida, M., Han, L., Ambrogini, E., Weinstein, R.S., and Manolagas, S.C. 2011. Glucocorticoids and tumor necrosis factor alpha increase oxidative stress and suppress Wnt protein signaling in osteoblasts. J Biol Chem 286:44326-44335.
115. Almeida, M., Ambrogini, E., Han, L., Manolagas, S.C., and Jilka, R.L. 2009. Increased lipid oxidation causes oxidative stress, increased peroxisome proliferator-activated receptor-gamma expression, and diminished pro-osteogenic Wnt signaling in the skeleton. J Biol Chem 284:27438-27448.
116. Almeida, M. 2011. Unraveling the role of FoxOs in bone--insights from mouse models. Bone 49:319-327.
117. Manolagas, S.C., and Almeida, M. 2007. Gone with the Wnts: beta-catenin, T-cell factor, forkhead box O, and oxidative stress in age-dependent diseases of bone, lipid, and glucose metabolism. Mol Endocrinol 21:2605-2614.
118. Malbon, C.C. 2005. Beta-catenin, cancer, and G proteins: not just for frizzleds anymore. Sci STKE 2005:pe35.
119. Liu, H., Fergusson, M.M., Wu, J.J., Rovira, II, Liu, J., Gavrilova, O., Lu, T., Bao, J., Han, D., Sack, M.N., et al. 2011. Wnt signaling regulates hepatic metabolism. Sci Signal 4:ra6.
120. Ni, Z., Anini, Y., Fang, X., Mills, G., Brubaker, P.L., and Jin, T. 2003. Transcriptional activation of the proglucagon gene by lithium and beta-catenin in intestinal endocrine L cells. J Biol Chem 278:1380-1387.
121. Yi, F., Sun, J., Lim, G.E., Fantus, I.G., Brubaker, P.L., and Jin, T. 2008. Cross talk between the insulin and Wnt signaling pathways: evidence from intestinal endocrine L cells. Endocrinology 149:2341-2351.
122. Bayliss, W.M., and Starling, E.H. 1902. The mechanism of pancreatic secretion. J Physiol 28:325-353.
123. McIntyre, N., Holdsworth, C.D., and Turner, D.S. 1964. New Interpretation of Oral Glucose Tolerance. Lancet 2:20-21.
124. Elrick, H., Stimmler, L., Hlad, C.J., Jr., and Arai, Y. 1964. Plasma Insulin Response to Oral and Intravenous Glucose Administration. J Clin Endocrinol Metab 24:1076-1082.
125. Cho, Y.M., and Kieffer, T.J. 2010. K-cells and glucose-dependent insulinotropic polypeptide in health and disease. Vitam Horm 84:111-150.
126. Dupre, J., Ross, S.A., Watson, D., and Brown, J.C. 1973. Stimulation of insulin secretion by gastric inhibitory polypeptide in man. J Clin Endocrinol Metab 37:826-828.
166
127. Brown, J.C., Dryburgh, J.R., Ross, S.A., and Dupre, J. 1975. Identification and actions of gastric inhibitory polypeptide. Recent Prog Horm Res 31:487-532.
128. Ross, S.A., Brown, J.C., and Dupre, J. 1977. Hypersecretion of gastric inhibitory polypeptide following oral glucose in diabetes mellitus. Diabetes 26:525-529.
129. Brown, J.C. 1971. A gastric inhibitory polypeptide. I. The amino acid composition and the tryptic peptides. Can J Biochem 49:255-261.
130. Brown, J.C., and Dryburgh, J.R. 1971. A gastric inhibitory polypeptide. II. The complete amino acid sequence. Can J Biochem 49:867-872.
131. Bell, G.I., Sanchez-Pescador, R., Laybourn, P.J., and Najarian, R.C. 1983. Exon duplication and divergence in the human preproglucagon gene. Nature 304:368-371.
132. Bell, G.I., Santerre, R.F., and Mullenbach, G.T. 1983. Hamster preproglucagon contains the sequence of glucagon and two related peptides. Nature 302:716-718.
133. Philippe, J., Mojsov, S., Drucker, D.J., and Habener, J.F. 1986. Proglucagon processing in a rat islet cell line resembles phenotype of intestine rather than pancreas. Endocrinology 119:2833-2839.
134. Scott, J., Selby, M., Urdea, M., Quiroga, M., Bell, G.I., and Rutter, W.J. 1983. Isolation and nucleotide sequence of a cDNA encoding the precursor of mouse nerve growth factor. Nature 302:538-540.
135. Lund, P.K., Goodman, R.H., Dee, P.C., and Habener, J.F. 1982. Pancreatic preproglucagon cDNA contains two glucagon-related coding sequences arranged in tandem. Proc Natl Acad Sci U S A 79:345-349.
136. Lund, P.K., Goodman, R.H., Montminy, M.R., Dee, P.C., and Habener, J.F. 1983. Anglerfish islet pre-proglucagon II. Nucleotide and corresponding amino acid sequence of the cDNA. J Biol Chem 258:3280-3284.
137. Lu, F., Jin, T., and Drucker, D.J. 1996. Proglucagon gene expression is induced by gastrin-releasing peptide in a mouse enteroendocrine cell line. Endocrinology 137:3710-3716.
138. Jin, T., Trinh, D.K., Wang, F., and Drucker, D.J. 1997. The caudal homeobox protein cdx-2/3 activates endogenous proglucagon gene expression in InR1-G9 islet cells. Mol Endocrinol 11:203-209.
139. Garcia-Martinez, J.M., Chocarro-Calvo, A., Moya, C.M., and Garcia-Jimenez, C. 2009. WNT/beta-catenin increases the production of incretins by entero-endocrine cells. Diabetologia 52:1913-1924.
140. Fujita, Y., Wideman, R.D., Asadi, A., Yang, G.K., Baker, R., Webber, T., Zhang, T., Wang, R., Ao, Z., Warnock, G.L., et al. 2010. Glucose-dependent insulinotropic polypeptide is expressed in pancreatic islet alpha-cells and promotes insulin secretion. Gastroenterology 138:1966-1975.
141. Hansotia, T., and Drucker, D.J. 2005. GIP and GLP-1 as incretin hormones: lessons from single and double incretin receptor knockout mice. Regul Pept 128:125-134.
142. Drucker, D.J., and Asa, S. 1988. Glucagon gene expression in vertebrate brain. J Biol Chem 263:13475-13478.
143. Rouille, Y., Martin, S., and Steiner, D.F. 1995. Differential processing of proglucagon by the subtilisin-like prohormone convertases PC2 and PC3 to generate either glucagon or glucagon-like peptide. J Biol Chem 270:26488-26496.
144. Rothenberg, M.E., Eilertson, C.D., Klein, K., Zhou, Y., Lindberg, I., McDonald, J.K., Mackin, R.B., and Noe, B.D. 1995. Processing of mouse proglucagon by recombinant prohormone convertase 1 and immunopurified prohormone convertase 2 in vitro. J Biol Chem 270:10136-10146.
167
145. Drucker, D.J., Erlich, P., Asa, S.L., and Brubaker, P.L. 1996. Induction of intestinal epithelial proliferation by glucagon-like peptide 2. Proc Natl Acad Sci U S A 93:7911-7916.
146. Mortensen, K., Christensen, L.L., Holst, J.J., and Orskov, C. 2003. GLP-1 and GIP are colocalized in a subset of endocrine cells in the small intestine. Regul Pept 114:189-196.
147. Brubaker, P.L. 2006. The glucagon-like peptides: pleiotropic regulators of nutrient homeostasis. Ann N Y Acad Sci 1070:10-26.
148. Herrmann, C., Goke, R., Richter, G., Fehmann, H.C., Arnold, R., and Goke, B. 1995. Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma levels in response to nutrients. Digestion 56:117-126.
149. Elliott, R.M., Morgan, L.M., Tredger, J.A., Deacon, S., Wright, J., and Marks, V. 1993. Glucagon-like peptide-1 (7-36)amide and glucose-dependent insulinotropic polypeptide secretion in response to nutrient ingestion in man: acute post-prandial and 24-h secretion patterns. J Endocrinol 138:159-166.
150. Rask, E., Olsson, T., Soderberg, S., Johnson, O., Seckl, J., Holst, J.J., and Ahren, B. 2001. Impaired incretin response after a mixed meal is associated with insulin resistance in nondiabetic men. Diabetes Care 24:1640-1645.
151. Rocca, A.S., and Brubaker, P.L. 1999. Role of the vagus nerve in mediating proximal nutrient-induced glucagon-like peptide-1 secretion. Endocrinology 140:1687-1694.
152. Roberge, J.N., and Brubaker, P.L. 1991. Secretion of proglucagon-derived peptides in response to intestinal luminal nutrients. Endocrinology 128:3169-3174.
153. Reimann, F., and Gribble, F.M. 2002. Glucose-sensing in glucagon-like peptide-1-secreting cells. Diabetes 51:2757-2763.
154. Deacon, C.F., Nauck, M.A., Toft-Nielsen, M., Pridal, L., Willms, B., and Holst, J.J. 1995. Both subcutaneously and intravenously administered glucagon-like peptide I are rapidly degraded from the NH2-terminus in type II diabetic patients and in healthy subjects. Diabetes 44:1126-1131.
155. Deacon, C.F., Johnsen, A.H., and Holst, J.J. 1995. Degradation of glucagon-like peptide-1 by human plasma in vitro yields an N-terminally truncated peptide that is a major endogenous metabolite in vivo. J Clin Endocrinol Metab 80:952-957.
156. Hansen, L., Deacon, C.F., Orskov, C., and Holst, J.J. 1999. Glucagon-like peptide-1-(7-36)amide is transformed to glucagon-like peptide-1-(9-36)amide by dipeptidyl peptidase IV in the capillaries supplying the L cells of the porcine intestine. Endocrinology 140:5356-5363.
157. Wideman, R.D., and Kieffer, T.J. 2009. Mining incretin hormone pathways for novel therapies. Trends Endocrinol Metab 20:280-286.
158. Hupe-Sodmann, K., McGregor, G.P., Bridenbaugh, R., Goke, R., Goke, B., Thole, H., Zimmermann, B., and Voigt, K. 1995. Characterisation of the processing by human neutral endopeptidase 24.11 of GLP-1(7-36) amide and comparison of the substrate specificity of the enzyme for other glucagon-like peptides. Regul Pept 58:149-156.
159. Brubaker, P.L., and Drucker, D.J. 2004. Minireview: Glucagon-like peptides regulate cell proliferation and apoptosis in the pancreas, gut, and central nervous system. Endocrinology 145:2653-2659.
160. Unger, R.H., and Eisentraut, A.M. 1969. Entero-insular axis. Arch Intern Med 123:261-266.
161. MacDonald, P.E., El-Kholy, W., Riedel, M.J., Salapatek, A.M., Light, P.E., and Wheeler, M.B. 2002. The multiple actions of GLP-1 on the process of glucose-stimulated insulin secretion. Diabetes 51 Suppl 3:S434-442.
168
162. Light, P.E., Manning Fox, J.E., Riedel, M.J., and Wheeler, M.B. 2002. Glucagon-like peptide-1 inhibits pancreatic ATP-sensitive potassium channels via a protein kinase A- and ADP-dependent mechanism. Mol Endocrinol 16:2135-2144.
163. Kwan, E.P., Gao, X., Leung, Y.M., and Gaisano, H.Y. 2007. Activation of exchange protein directly activated by cyclic adenosine monophosphate and protein kinase A regulate common and distinct steps in promoting plasma membrane exocytic and granule-to-granule fusions in rat islet beta cells. Pancreas 35:e45-54.
164. MacDonald, P.E., Salapatek, A.M., and Wheeler, M.B. 2002. Glucagon-like peptide-1 receptor activation antagonizes voltage-dependent repolarizing K(+) currents in beta-cells: a possible glucose-dependent insulinotropic mechanism. Diabetes 51 Suppl 3:S443-447.
165. Komatsu, R., Matsuyama, T., Namba, M., Watanabe, N., Itoh, H., Kono, N., and Tarui, S. 1989. Glucagonostatic and insulinotropic action of glucagonlike peptide I-(7-36)-amide. Diabetes 38:902-905.
166. D'Alessio, D.A., Fujimoto, W.Y., and Ensinck, J.W. 1989. Effects of glucagonlike peptide I-(7-36) on release of insulin, glucagon, and somatostatin by rat pancreatic islet cell monolayer cultures. Diabetes 38:1534-1538.
167. Xu, G., Stoffers, D.A., Habener, J.F., and Bonner-Weir, S. 1999. Exendin-4 stimulates both beta-cell replication and neogenesis, resulting in increased beta-cell mass and improved glucose tolerance in diabetic rats. Diabetes 48:2270-2276.
168. Tourrel, C., Bailbe, D., Meile, M.J., Kergoat, M., and Portha, B. 2001. Glucagon-like peptide-1 and exendin-4 stimulate beta-cell neogenesis in streptozotocin-treated newborn rats resulting in persistently improved glucose homeostasis at adult age. Diabetes 50:1562-1570.
169. Li, Y., Hansotia, T., Yusta, B., Ris, F., Halban, P.A., and Drucker, D.J. 2003. Glucagon-like peptide-1 receptor signaling modulates beta cell apoptosis. J Biol Chem 278:471-478.
170. Shao, W., Yu, Z., Fantus, I.G., and Jin, T. 2010. Cyclic AMP signaling stimulates proteasome degradation of thioredoxin interacting protein (TxNIP) in pancreatic beta-cells. Cell Signal 22:1240-1246.
171. Chen, J., Couto, F.M., Minn, A.H., and Shalev, A. 2006. Exenatide inhibits beta-cell apoptosis by decreasing thioredoxin-interacting protein. Biochem Biophys Res Commun 346:1067-1074.
172. Yu, Z., and Jin, T. 2010. New insights into the role of cAMP in the production and function of the incretin hormone glucagon-like peptide-1 (GLP-1). Cell Signal 22:1-8.
173. Bullock, B.P., Heller, R.S., and Habener, J.F. 1996. Tissue distribution of messenger ribonucleic acid encoding the rat glucagon-like peptide-1 receptor. Endocrinology 137:2968-2978.
174. Pedersen, J., and Holst, J.J. 2011. Glucagon like-peptide 1 receptor and the liver. Liver Int 31:1243-1245.
175. Ding, X., Saxena, N.K., Lin, S., Gupta, N.A., and Anania, F.A. 2006. Exendin-4, a glucagon-like protein-1 (GLP-1) receptor agonist, reverses hepatic steatosis in ob/ob mice. Hepatology 43:173-181.
176. Gupta, N.A., Mells, J., Dunham, R.M., Grakoui, A., Handy, J., Saxena, N.K., and Anania, F.A. 2010. Glucagon-like peptide-1 receptor is present on human hepatocytes and has a direct role in decreasing hepatic steatosis in vitro by modulating elements of the insulin signaling pathway. Hepatology 51:1584-1592.
177. Meier, J.J., Gallwitz, B., Salmen, S., Goetze, O., Holst, J.J., Schmidt, W.E., and Nauck, M.A. 2003. Normalization of glucose concentrations and deceleration of gastric emptying
169
after solid meals during intravenous glucagon-like peptide 1 in patients with type 2 diabetes. J Clin Endocrinol Metab 88:2719-2725.
178. Wettergren, A., Schjoldager, B., Mortensen, P.E., Myhre, J., Christiansen, J., and Holst, J.J. 1993. Truncated GLP-1 (proglucagon 78-107-amide) inhibits gastric and pancreatic functions in man. Dig Dis Sci 38:665-673.
179. Sokos, G.G., Nikolaidis, L.A., Mankad, S., Elahi, D., and Shannon, R.P. 2006. Glucagon-like peptide-1 infusion improves left ventricular ejection fraction and functional status in patients with chronic heart failure. J Card Fail 12:694-699.
180. Ban, K., Kim, K.H., Cho, C.K., Sauve, M., Diamandis, E.P., Backx, P.H., Drucker, D.J., and Husain, M. 2010. Glucagon-like peptide (GLP)-1(9-36)amide-mediated cytoprotection is blocked by exendin(9-39) yet does not require the known GLP-1 receptor. Endocrinology 151:1520-1531.
181. Ban, K., Noyan-Ashraf, M.H., Hoefer, J., Bolz, S.S., Drucker, D.J., and Husain, M. 2008. Cardioprotective and vasodilatory actions of glucagon-like peptide 1 receptor are mediated through both glucagon-like peptide 1 receptor-dependent and -independent pathways. Circulation 117:2340-2350.
182. Hayes, M.R., Skibicka, K.P., and Grill, H.J. 2008. Caudal brainstem processing is sufficient for behavioral, sympathetic, and parasympathetic responses driven by peripheral and hindbrain glucagon-like-peptide-1 receptor stimulation. Endocrinology 149:4059-4068.
183. Hayes, M.R., Bradley, L., and Grill, H.J. 2009. Endogenous hindbrain glucagon-like peptide-1 receptor activation contributes to the control of food intake by mediating gastric satiation signaling. Endocrinology 150:2654-2659.
184. Knauf, C., Cani, P.D., Perrin, C., Iglesias, M.A., Maury, J.F., Bernard, E., Benhamed, F., Gremeaux, T., Drucker, D.J., Kahn, C.R., et al. 2005. Brain glucagon-like peptide-1 increases insulin secretion and muscle insulin resistance to favor hepatic glycogen storage. J Clin Invest 115:3554-3563.
185. Knauf, C., Cani, P.D., Ait-Belgnaoui, A., Benani, A., Dray, C., Cabou, C., Colom, A., Uldry, M., Rastrelli, S., Sabatier, E., et al. 2008. Brain glucagon-like peptide 1 signaling controls the onset of high-fat diet-induced insulin resistance and reduces energy expenditure. Endocrinology 149:4768-4777.
186. Nyberg, J., Anderson, M.F., Meister, B., Alborn, A.M., Strom, A.K., Brederlau, A., Illerskog, A.C., Nilsson, O., Kieffer, T.J., Hietala, M.A., et al. 2005. Glucose-dependent insulinotropic polypeptide is expressed in adult hippocampus and induces progenitor cell proliferation. J Neurosci 25:1816-1825.
187. Zhong, Q., Itokawa, T., Sridhar, S., Ding, K.H., Xie, D., Kang, B., Bollag, W.B., Bollag, R.J., Hamrick, M., Insogna, K., et al. 2007. Effects of glucose-dependent insulinotropic peptide on osteoclast function. Am J Physiol Endocrinol Metab 292:E543-548.
188. Ussher, J.R., and Drucker, D.J. 2012. Cardiovascular Biology of the Incretin System. Endocr Rev.
189. Estall, J.L., and Drucker, D.J. 2006. Glucagon and glucagon-like peptide receptors as drug targets. Curr Pharm Des 12:1731-1750.
190. Hvidberg, A., Nielsen, M.T., Hilsted, J., Orskov, C., and Holst, J.J. 1994. Effect of glucagon-like peptide-1 (proglucagon 78-107amide) on hepatic glucose production in healthy man. Metabolism 43:104-108.
191. Toft-Nielson, M., Madsbad, S., and Holst, J.J. 1996. The effect of glucagon-like peptide I (GLP-I) on glucose elimination in healthy subjects depends on the pancreatic glucoregulatory hormones. Diabetes 45:552-556.
170
192. Larsson, H., Holst, J.J., and Ahren, B. 1997. Glucagon-like peptide-1 reduces hepatic glucose production indirectly through insulin and glucagon in humans. Acta Physiol Scand 160:413-422.
193. Orskov, C., Wettergren, A., and Holst, J.J. 1993. Biological effects and metabolic rates of glucagonlike peptide-1 7-36 amide and glucagonlike peptide-1 7-37 in healthy subjects are indistinguishable. Diabetes 42:658-661.
194. Prigeon, R.L., Quddusi, S., Paty, B., and D'Alessio, D.A. 2003. Suppression of glucose production by GLP-1 independent of islet hormones: a novel extrapancreatic effect. Am J Physiol Endocrinol Metab 285:E701-707.
195. Seghieri, M., Rebelos, E., Gastaldelli, A., Astiarraga, B.D., Casolaro, A., Barsotti, E., Pocai, A., Nauck, M., Muscelli, E., and Ferrannini, E. 2013. Direct effect of GLP-1 infusion on endogenous glucose production in humans. Diabetologia 56:156-161.
196. Svegliati-Baroni, G., Saccomanno, S., Rychlicki, C., Agostinelli, L., De Minicis, S., Candelaresi, C., Faraci, G., Pacetti, D., Vivarelli, M., Nicolini, D., et al. 2011. Glucagon-like peptide-1 receptor activation stimulates hepatic lipid oxidation and restores hepatic signalling alteration induced by a high-fat diet in nonalcoholic steatohepatitis. Liver Int 31:1285-1297.
197. Aviv, V., Meivar-Levy, I., Rachmut, I.H., Rubinek, T., Mor, E., and Ferber, S. 2009. Exendin-4 promotes liver cell proliferation and enhances the PDX-1-induced liver to pancreas transdifferentiation process. J Biol Chem 284:33509-33520.
198. Panjwani, N., Mulvihill, E.E., Longuet, C., Yusta, B., Campbell, J.E., Brown, T.J., Streutker, C., Holland, D., Cao, X., Baggio, L.L., et al. 2013. GLP-1 receptor activation indirectly reduces hepatic lipid accumulation but does not attenuate development of atherosclerosis in diabetic male ApoE(-/-) mice. Endocrinology 154:127-139.
199. Furstenau, U., Schwaninger, M., Blume, R., Jendrusch, E.M., and Knepel, W. 1999. Characterization of a novel calcium response element in the glucagon gene. J Biol Chem 274:5851-5860.
200. Columbus, J., Chiang, Y., Shao, W., Zhang, N., Wang, D., Gaisano, H.Y., Wang, Q., Irwin, D.M., and Jin, T. 2010. Insulin treatment and high-fat diet feeding reduces the expression of three Tcf genes in rodent pancreas. J Endocrinol 207:77-86.
201. Gustafson, B., and Smith, U. 2008. WNT signalling is both an inducer and effector of glucagon-like peptide-1. Diabetologia 51:1768-1770.
202. Garcia-Jimenez, C. 2010. Wnt and incretin connections. Vitam Horm 84:355-387. 203. Nikolaidis, L.A., Elahi, D., Hentosz, T., Doverspike, A., Huerbin, R., Zourelias, L.,
Stolarski, C., Shen, Y.T., and Shannon, R.P. 2004. Recombinant glucagon-like peptide-1 increases myocardial glucose uptake and improves left ventricular performance in conscious dogs with pacing-induced dilated cardiomyopathy. Circulation 110:955-961.
204. Zhao, T., Parikh, P., Bhashyam, S., Bolukoglu, H., Poornima, I., Shen, Y.T., and Shannon, R.P. 2006. Direct effects of glucagon-like peptide-1 on myocardial contractility and glucose uptake in normal and postischemic isolated rat hearts. J Pharmacol Exp Ther 317:1106-1113.
205. Ban, K., Hui, S., Drucker, D.J., and Husain, M. 2009. Cardiovascular consequences of drugs used for the treatment of diabetes: potential promise of incretin-based therapies. J Am Soc Hypertens 3:245-259.
206. Noyan-Ashraf, M.H., Momen, M.A., Ban, K., Sadi, A.M., Zhou, Y.Q., Riazi, A.M., Baggio, L.L., Henkelman, R.M., Husain, M., and Drucker, D.J. 2009. GLP-1R agonist liraglutide activates cytoprotective pathways and improves outcomes after experimental myocardial infarction in mice. Diabetes 58:975-983.
171
207. Cho, Y.M., and Kieffer, T.J. 2011. New aspects of an old drug: metformin as a glucagon-like peptide 1 (GLP-1) enhancer and sensitiser. Diabetologia 54:219-222.
208. Nikolaidis, L.A., Elahi, D., Shen, Y.T., and Shannon, R.P. 2005. Active metabolite of GLP-1 mediates myocardial glucose uptake and improves left ventricular performance in conscious dogs with dilated cardiomyopathy. Am J Physiol Heart Circ Physiol 289:H2401-2408.
209. Ma, T., Du, X., Pick, J.E., Sui, G., Brownlee, M., and Klann, E. 2012. Glucagon-like peptide-1 cleavage product GLP-1(9-36) amide rescues synaptic plasticity and memory deficits in Alzheimer's disease model mice. J Neurosci 32:13701-13708.
210. Tomas, E., Stanojevic, V., and Habener, J.F. 2010. GLP-1 (9-36) amide metabolite suppression of glucose production in isolated mouse hepatocytes. Horm Metab Res 42:657-662.
211. Tomas, E., Wood, J.A., Stanojevic, V., and Habener, J.F. 2011. Glucagon-like peptide-1(9-36)amide metabolite inhibits weight gain and attenuates diabetes and hepatic steatosis in diet-induced obese mice. Diabetes Obes Metab 13:26-33.
212. Habener, J.F., Stanojevic, V., Brindamour, L.J., and Liu, Z. 2012. GLP-1-Derived Nonapeptide GLP-1(28-36)amide Protects Pancreatic Beta Cells From Gluco-lipotoxicity. J Endocrinol.
213. Tomas, E., Wood, J.A., Stanojevic, V., and Habener, J.F. 2011. GLP-1-derived nonapeptide GLP-1(28-36)amide inhibits weight gain and attenuates diabetes and hepatic steatosis in diet-induced obese mice. Regul Pept 169:43-48.
214. Tomas, E., Stanojevic, V., and Habener, J.F. 2011. GLP-1-derived nonapeptide GLP-1(28-36)amide targets to mitochondria and suppresses glucose production and oxidative stress in isolated mouse hepatocytes. Regul Pept 167:177-184.
215. Liu, Z., Stanojevic, V., Brindamour, L.J., and Habener, J.F. 2012. GLP1-derived nonapeptide GLP1(28-36)amide protects pancreatic beta-cells from glucolipotoxicity. J Endocrinol 213:143-154.
216. Shao, W., Wang, Z., Ip, W., Chiang, Y.T., Xiong, X., Chai, T., Xu, C., Wang, Q., and Jin, T. 2013. GLP-1(28-36) improves beta-cell mass and glucose disposal in streptozotocin induced diabetes mice and activates PKA-beta-catenin signaling in beta-cells in vitro. Am J Physiol Endocrinol Metab.
217. Tomas, E., Stanojevic, V., Laudone, R., and Habener, J.F. 2012. GLP-1-Derived Pentapeptide GLP-1(32-36)amide Attenuates the Development of Obesity, Diabetes, Hepatic Steatosis and Increases Energy Expenditure in Diet-Induced Obese Mice. Diabetes 61 [Suppl 1]:1915-P (Abstract).
218. Rui, L. 2014. Energy metabolism in the liver. Compr Physiol 4:177-197. 219. Jiang, G., and Zhang, B.B. 2003. Glucagon and regulation of glucose metabolism. Am J
Physiol Endocrinol Metab 284:E671-678. 220. Saltiel, A.R., and Kahn, C.R. 2001. Insulin signalling and the regulation of glucose and
lipid metabolism. Nature 414:799-806. 221. Gerich, J.E., Meyer, C., Woerle, H.J., and Stumvoll, M. 2001. Renal gluconeogenesis: its
importance in human glucose homeostasis. Diabetes Care 24:382-391. 222. Jitrapakdee, S., Walker, M.E., and Wallace, J.C. 1996. Identification of novel
alternatively spliced pyruvate carboxylase mRNAs with divergent 5'-untranslated regions which are expressed in a tissue-specific manner. Biochem Biophys Res Commun 223:695-700.
172
223. Rothman, D.L., Magnusson, I., Katz, L.D., Shulman, R.G., and Shulman, G.I. 1991. Quantitation of hepatic glycogenolysis and gluconeogenesis in fasting humans with 13C NMR. Science 254:573-576.
224. Jitrapakdee, S., Gong, Q., MacDonald, M.J., and Wallace, J.C. 1998. Regulation of rat pyruvate carboxylase gene expression by alternate promoters during development, in genetically obese rats and in insulin-secreting cells. Multiple transcripts with 5'-end heterogeneity modulate translation. J Biol Chem 273:34422-34428.
225. Hanson, R.W., and Reshef, L. 1997. Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Biochem 66:581-611.
226. Yang, J., Reshef, L., Cassuto, H., Aleman, G., and Hanson, R.W. 2009. Aspects of the control of phosphoenolpyruvate carboxykinase gene transcription. J Biol Chem 284:27031-27035.
227. O'Brien, R.M., Lucas, P.C., Forest, C.D., Magnuson, M.A., and Granner, D.K. 1990. Identification of a sequence in the PEPCK gene that mediates a negative effect of insulin on transcription. Science 249:533-537.
228. Chakravarty, K., Cassuto, H., Reshef, L., and Hanson, R.W. 2005. Factors that control the tissue-specific transcription of the gene for phosphoenolpyruvate carboxykinase-C. Crit Rev Biochem Mol Biol 40:129-154.
229. O'Brien, R.M., and Granner, D.K. 1996. Regulation of gene expression by insulin. Physiol Rev 76:1109-1161.
230. Herzog, B., Waltner-Law, M., Scott, D.K., Eschrich, K., and Granner, D.K. 2000. Characterization of the human liver fructose-1,6-bisphosphatase gene promoter. Biochem J 351 Pt 2:385-392.
231. Mithieux, G. 1997. New knowledge regarding glucose-6 phosphatase gene and protein and their roles in the regulation of glucose metabolism. Eur J Endocrinol 136:137-145.
232. Hutton, J.C., and O'Brien, R.M. 2009. Glucose-6-phosphatase catalytic subunit gene family. J Biol Chem 284:29241-29245.
233. Postic, C., Dentin, R., and Girard, J. 2004. Role of the liver in the control of carbohydrate and lipid homeostasis. Diabetes Metab 30:398-408.
234. Mayr, B., and Montminy, M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2:599-609.
235. Chrivia, J.C., Kwok, R.P., Lamb, N., Hagiwara, M., Montminy, M.R., and Goodman, R.H. 1993. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855-859.
236. Herzig, S., Long, F., Jhala, U.S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., et al. 2001. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413:179-183.
237. Koo, S.H., Flechner, L., Qi, L., Zhang, X., Screaton, R.A., Jeffries, S., Hedrick, S., Xu, W., Boussouar, F., Brindle, P., et al. 2005. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437:1109-1111.
238. Dentin, R., Liu, Y., Koo, S.H., Hedrick, S., Vargas, T., Heredia, J., Yates, J., 3rd, and Montminy, M. 2007. Insulin modulates gluconeogenesis by inhibition of the coactivator TORC2. Nature 449:366-369.
239. Le Lay, J., Tuteja, G., White, P., Dhir, R., Ahima, R., and Kaestner, K.H. 2009. CRTC2 (TORC2) contributes to the transcriptional response to fasting in the liver but is not required for the maintenance of glucose homeostasis. Cell Metab 10:55-62.
240. Dentin, R., Hedrick, S., Xie, J., Yates, J., 3rd, and Montminy, M. 2008. Hepatic glucose sensing via the CREB coactivator CRTC2. Science 319:1402-1405.
173
241. Liu, Y., Dentin, R., Chen, D., Hedrick, S., Ravnskjaer, K., Schenk, S., Milne, J., Meyers, D.J., Cole, P., Yates, J., 3rd, et al. 2008. A fasting inducible switch modulates gluconeogenesis via activator/coactivator exchange. Nature 456:269-273.
242. Nakae, J., Oki, M., and Cao, Y. 2008. The FoxO transcription factors and metabolic regulation. FEBS Lett 582:54-67.
243. Hall, R.K., Yamasaki, T., Kucera, T., Waltner-Law, M., O'Brien, R., and Granner, D.K. 2000. Regulation of phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein-1 gene expression by insulin. The role of winged helix/forkhead proteins. J Biol Chem 275:30169-30175.
244. Schmoll, D., Walker, K.S., Alessi, D.R., Grempler, R., Burchell, A., Guo, S., Walther, R., and Unterman, T.G. 2000. Regulation of glucose-6-phosphatase gene expression by protein kinase Balpha and the forkhead transcription factor FKHR. Evidence for insulin response unit-dependent and -independent effects of insulin on promoter activity. J Biol Chem 275:36324-36333.
245. Nakae, J., Kitamura, T., Silver, D.L., and Accili, D. 2001. The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. J Clin Invest 108:1359-1367.
246. Barthel, A., Schmoll, D., and Unterman, T.G. 2005. FoxO proteins in insulin action and metabolism. Trends Endocrinol Metab 16:183-189.
247. Samuel, V.T., Choi, C.S., Phillips, T.G., Romanelli, A.J., Geisler, J.G., Bhanot, S., McKay, R., Monia, B., Shutter, J.R., Lindberg, R.A., et al. 2006. Targeting foxo1 in mice using antisense oligonucleotide improves hepatic and peripheral insulin action. Diabetes 55:2042-2050.
248. Altomonte, J., Richter, A., Harbaran, S., Suriawinata, J., Nakae, J., Thung, S.N., Meseck, M., Accili, D., and Dong, H. 2003. Inhibition of Foxo1 function is associated with improved fasting glycemia in diabetic mice. Am J Physiol Endocrinol Metab 285:E718-728.
249. Matsumoto, M., Pocai, A., Rossetti, L., Depinho, R.A., and Accili, D. 2007. Impaired regulation of hepatic glucose production in mice lacking the forkhead transcription factor Foxo1 in liver. Cell Metab 6:208-216.
250. Zhang, W., Patil, S., Chauhan, B., Guo, S., Powell, D.R., Le, J., Klotsas, A., Matika, R., Xiao, X., Franks, R., et al. 2006. FoxO1 regulates multiple metabolic pathways in the liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression. J Biol Chem 281:10105-10117.
251. Yoon, J.C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C.R., Granner, D.K., et al. 2001. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413:131-138.
252. Koo, S.H., Satoh, H., Herzig, S., Lee, C.H., Hedrick, S., Kulkarni, R., Evans, R.M., Olefsky, J., and Montminy, M. 2004. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med 10:530-534.
253. Handschin, C., Lin, J., Rhee, J., Peyer, A.K., Chin, S., Wu, P.H., Meyer, U.A., and Spiegelman, B.M. 2005. Nutritional regulation of hepatic heme biosynthesis and porphyria through PGC-1alpha. Cell 122:505-515.
254. Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon, J.C., Oriente, F., Kitamura, Y., Altomonte, J., Dong, H., Accili, D., et al. 2003. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 423:550-555.
174
255. Daitoku, H., Yamagata, K., Matsuzaki, H., Hatta, M., and Fukamizu, A. 2003. Regulation of PGC-1 promoter activity by protein kinase B and the forkhead transcription factor FKHR. Diabetes 52:642-649.
256. Liu, J.S., Park, E.A., Gurney, A.L., Roesler, W.J., and Hanson, R.W. 1991. Cyclic AMP induction of phosphoenolpyruvate carboxykinase (GTP) gene transcription is mediated by multiple promoter elements. J Biol Chem 266:19095-19102.
257. Wang, N.D., Finegold, M.J., Bradley, A., Ou, C.N., Abdelsayed, S.V., Wilde, M.D., Taylor, L.R., Wilson, D.R., and Darlington, G.J. 1995. Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269:1108-1112.
258. Croniger, C., Trus, M., Lysek-Stupp, K., Cohen, H., Liu, Y., Darlington, G.J., Poli, V., Hanson, R.W., and Reshef, L. 1997. Role of the isoforms of CCAAT/enhancer-binding protein in the initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth. J Biol Chem 272:26306-26312.
259. Croniger, C.M., Millward, C., Yang, J., Kawai, Y., Arinze, I.J., Liu, S., Harada-Shiba, M., Chakravarty, K., Friedman, J.E., Poli, V., et al. 2001. Mice with a deletion in the gene for CCAAT/enhancer-binding protein beta have an attenuated response to cAMP and impaired carbohydrate metabolism. J Biol Chem 276:629-638.
260. Lee, Y.H., Sauer, B., Johnson, P.F., and Gonzalez, F.J. 1997. Disruption of the c/ebp alpha gene in adult mouse liver. Mol Cell Biol 17:6014-6022.
261. Yang, J., Croniger, C.M., Lekstrom-Himes, J., Zhang, P., Fenyus, M., Tenen, D.G., Darlington, G.J., and Hanson, R.W. 2005. Metabolic response of mice to a postnatal ablation of CCAAT/enhancer-binding protein alpha. J Biol Chem 280:38689-38699.
262. Qiao, L., MacLean, P.S., You, H., Schaack, J., and Shao, J. 2006. knocking down liver ccaat/enhancer-binding protein alpha by adenovirus-transduced silent interfering ribonucleic acid improves hepatic gluconeogenesis and lipid homeostasis in db/db mice. Endocrinology 147:3060-3069.
263. Rhee, J., Inoue, Y., Yoon, J.C., Puigserver, P., Fan, M., Gonzalez, F.J., and Spiegelman, B.M. 2003. Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc Natl Acad Sci U S A 100:4012-4017.
264. Boustead, J.N., Stadelmaier, B.T., Eeds, A.M., Wiebe, P.O., Svitek, C.A., Oeser, J.K., and O'Brien, R.M. 2003. Hepatocyte nuclear factor-4 alpha mediates the stimulatory effect of peroxisome proliferator-activated receptor gamma co-activator-1 alpha (PGC-1 alpha) on glucose-6-phosphatase catalytic subunit gene transcription in H4IIE cells. Biochem J 369:17-22.
265. Hall, R.K., Sladek, F.M., and Granner, D.K. 1995. The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci U S A 92:412-416.
266. Gautier-Stein, A., Mithieux, G., and Rajas, F. 2005. A distal region involving hepatocyte nuclear factor 4alpha and CAAT/enhancer binding protein markedly potentiates the protein kinase A stimulation of the glucose-6-phosphatase promoter. Mol Endocrinol 19:163-174.
267. Yamagata, K., Daitoku, H., Shimamoto, Y., Matsuzaki, H., Hirota, K., Ishida, J., and Fukamizu, A. 2004. Bile acids regulate gluconeogenic gene expression via small heterodimer partner-mediated repression of hepatocyte nuclear factor 4 and Foxo1. J Biol Chem 279:23158-23165.
175
268. Nedumaran, B., Hong, S., Xie, Y.B., Kim, Y.H., Seo, W.Y., Lee, M.W., Lee, C.H., Koo, S.H., and Choi, H.S. 2009. DAX-1 acts as a novel corepressor of orphan nuclear receptor HNF4alpha and negatively regulates gluconeogenic enzyme gene expression. J Biol Chem 284:27511-27523.
269. Vander Kooi, B.T., Onuma, H., Oeser, J.K., Svitek, C.A., Allen, S.R., Vander Kooi, C.W., Chazin, W.J., and O'Brien, R.M. 2005. The glucose-6-phosphatase catalytic subunit gene promoter contains both positive and negative glucocorticoid response elements. Mol Endocrinol 19:3001-3022.
270. Imai, E., Stromstedt, P.E., Quinn, P.G., Carlstedt-Duke, J., Gustafsson, J.A., and Granner, D.K. 1990. Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 10:4712-4719.
271. Imai, E., Miner, J.N., Mitchell, J.A., Yamamoto, K.R., and Granner, D.K. 1993. Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353-5356.
272. Stafford, J.M., Wilkinson, J.C., Beechem, J.M., and Granner, D.K. 2001. Accessory factors facilitate the binding of glucocorticoid receptor to the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 276:39885-39891.
273. Cassuto, H., Kochan, K., Chakravarty, K., Cohen, H., Blum, B., Olswang, Y., Hakimi, P., Xu, C., Massillon, D., Hanson, R.W., et al. 2005. Glucocorticoids regulate transcription of the gene for phosphoenolpyruvate carboxykinase in the liver via an extended glucocorticoid regulatory unit. J Biol Chem 280:33873-33884.
274. Gomis, R.R., Cid, E., Garcia-Rocha, M., Ferrer, J.C., and Guinovart, J.J. 2002. Liver glycogen synthase but not the muscle isoform differentiates between glucose 6-phosphate produced by glucokinase or hexokinase. J Biol Chem 277:23246-23252.
275. Rylatt, D.B., Aitken, A., Bilham, T., Condon, G.D., Embi, N., and Cohen, P. 1980. Glycogen synthase from rabbit skeletal muscle. Amino acid sequence at the sites phosphorylated by glycogen synthase kinase-3, and extension of the N-terminal sequence containing the site phosphorylated by phosphorylase kinase. Eur J Biochem 107:529-537.
276. Postic, C., Dentin, R., Denechaud, P.D., and Girard, J. 2007. ChREBP, a transcriptional regulator of glucose and lipid metabolism. Annual review of nutrition 27:179-192.
277. Gibbons, G.F., Islam, K., and Pease, R.J. 2000. Mobilisation of triacylglycerol stores. Biochim Biophys Acta 1483:37-57.
278. Adeli, K., Taghibiglou, C., Van Iderstine, S.C., and Lewis, G.F. 2001. Mechanisms of hepatic very low-density lipoprotein overproduction in insulin resistance. Trends Cardiovasc Med 11:170-176.
279. White, D.A., Bennett, A.J., Billett, M.A., and Salter, A.M. 1998. The assembly of triacylglycerol-rich lipoproteins: an essential role for the microsomal triacylglycerol transfer protein. Br J Nutr 80:219-229.
280. Foufelle, F., and Ferre, P. 2002. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c. Biochem J 366:377-391.
281. Foretz, M., Guichard, C., Ferre, P., and Foufelle, F. 1999. Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci U S A 96:12737-12742.
282. Koo, S.H., Dutcher, A.K., and Towle, H.C. 2001. Glucose and insulin function through two distinct transcription factors to stimulate expression of lipogenic enzyme genes in liver. J Biol Chem 276:9437-9445.
176
283. Horton, J.D., Bashmakov, Y., Shimomura, I., and Shimano, H. 1998. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc Natl Acad Sci U S A 95:5987-5992.
284. Dentin, R., Pegorier, J.P., Benhamed, F., Foufelle, F., Ferre, P., Fauveau, V., Magnuson, M.A., Girard, J., and Postic, C. 2004. Hepatic glucokinase is required for the synergistic action of ChREBP and SREBP-1c on glycolytic and lipogenic gene expression. J Biol Chem 279:20314-20326.
285. Yamashita, H., Takenoshita, M., Sakurai, M., Bruick, R.K., Henzel, W.J., Shillinglaw, W., Arnot, D., and Uyeda, K. 2001. A glucose-responsive transcription factor that regulates carbohydrate metabolism in the liver. Proc Natl Acad Sci U S A 98:9116-9121.
286. Sun, J., Khalid, S., Rozakis-Adcock, M., Fantus, I.G., and Jin, T. 2009. P-21-activated protein kinase-1 functions as a linker between insulin and Wnt signaling pathways in the intestine. Oncogene 28:3132-3144.
287. Desbois-Mouthon, C., Cadoret, A., Blivet-Van Eggelpoel, M.J., Bertrand, F., Cherqui, G., Perret, C., and Capeau, J. 2001. Insulin and IGF-1 stimulate the beta-catenin pathway through two signalling cascades involving GSK-3beta inhibition and Ras activation. Oncogene 20:252-259.
288. Locke, J.M., Da Silva Xavier, G., Rutter, G.A., and Harries, L.W. 2011. An alternative polyadenylation signal in TCF7L2 generates isoforms that inhibit T cell factor/lymphoid-enhancer factor (TCF/LEF)-dependent target genes. Diabetologia 54:3078-3082.
289. Wegner, L., Hussain, M.S., Pilgaard, K., Hansen, T., Pedersen, O., Vaag, A., and Poulsen, P. 2008. Impact of TCF7L2 rs7903146 on insulin secretion and action in young and elderly Danish twins. J Clin Endocrinol Metab 93:4013-4019.
290. Xi, L., Xiao, C., Bandsma, R.H., Naples, M., Adeli, K., and Lewis, G.F. 2011. C-reactive protein impairs hepatic insulin sensitivity and insulin signaling in rats: role of mitogen-activated protein kinases. Hepatology 53:127-135.
291. Sun, J., Wang, D., and Jin, T. 2010. Insulin alters the expression of components of the Wnt signaling pathway including TCF-4 in the intestinal cells. Biochim Biophys Acta 1800:344-351.
292. Jungermann, K., and Katz, N. 1989. Functional specialization of different hepatocyte populations. Physiological reviews 69:708-764.
293. Sugden, P.H., Fuller, S.J., Weiss, S.C., and Clerk, A. 2008. Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis. Br J Pharmacol 153 Suppl 1:S137-153.
294. Kahn, C.R., Lauris, V., Koch, S., Crettaz, M., and Granner, D.K. 1989. Acute and chronic regulation of phosphoenolpyruvate carboxykinase mRNA by insulin and glucose. Molecular endocrinology 3:840-845.
295. Hay, D.C., Fletcher, J., Payne, C., Terrace, J.D., Gallagher, R.C., Snoeys, J., Black, J.R., Wojtacha, D., Samuel, K., Hannoun, Z., et al. 2008. Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci U S A 105:12301-12306.
296. Hu, M., Kurobe, M., Jeong, Y.J., Fuerer, C., Ghole, S., Nusse, R., and Sylvester, K.G. 2007. Wnt/beta-catenin signaling in murine hepatic transit amplifying progenitor cells. Gastroenterology 133:1579-1591.
297. Ding, V.W., Chen, R.H., and McCormick, F. 2000. Differential regulation of glycogen synthase kinase 3beta by insulin and Wnt signaling. J Biol Chem 275:32475-32481.
298. Schinner, S. 2009. Wnt-signalling and the metabolic syndrome. Horm Metab Res 41:159-163.
177
299. Philippe, J. 1991. Insulin regulation of the glucagon gene is mediated by an insulin-responsive DNA element. Proc Natl Acad Sci U S A 88:7224-7227.
300. McCarthy, M.I., Rorsman, P., and Gloyn, A.L. 2013. TCF7L2 and Diabetes: A Tale of Two Tissues, and of Two Species. Cell Metab 17:157-159.
301. Nobrega, M.A. 2013. TCF7L2 and Glucose Metabolism: Time to Look Beyond the Pancreas. Diabetes 62:706-708.
302. Fujino, T., Asaba, H., Kang, M.J., Ikeda, Y., Sone, H., Takada, S., Kim, D.H., Ioka, R.X., Ono, M., Tomoyori, H., et al. 2003. Low-density lipoprotein receptor-related protein 5 (LRP5) is essential for normal cholesterol metabolism and glucose-induced insulin secretion. Proc Natl Acad Sci U S A 100:229-234.
303. Go, G.W., Srivastava, R., Hernandez-Ono, A., Gang, G., Smith, S.B., Booth, C.J., Ginsberg, H.N., and Mani, A. 2014. The Combined Hyperlipidemia Caused by Impaired Wnt-LRP6 Signaling Is Reversed by Wnt3a Rescue. Cell Metab 19:209-220.
304. Kanazawa, A., Tsukada, S., Sekine, A., Tsunoda, T., Takahashi, A., Kashiwagi, A., Tanaka, Y., Babazono, T., Matsuda, M., Kaku, K., et al. 2004. Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes. Am J Hum Genet 75:832-843.
305. Lehwald, N., Tao, G.Z., Jang, K.Y., Sorkin, M., Knoefel, W.T., and Sylvester, K.G. 2011. Wnt-beta-catenin signaling protects against hepatic ischemia and reperfusion injury in mice. Gastroenterology 141:707-718, 718 e701-705.
306. Lehwald, N., Tao, G.Z., Jang, K.Y., Papandreou, I., Liu, B., Pysz, M.A., Willmann, J.K., Knoefel, W.T., Denko, N.C., and Sylvester, K.G. 2012. beta-Catenin regulates hepatic mitochondrial function and energy balance in mice. Gastroenterology 143:754-764.
307. Tao, G.Z., Lehwald, N., Jang, K.Y., Baek, J., Xu, B., Omary, M.B., and Sylvester, K.G. 2013. Wnt/beta-catenin signaling protects mouse liver against oxidative stress-induced apoptosis through the inhibition of forkhead transcription factor FoxO3. J Biol Chem 288:17214-17224.
308. Zhang, X.F., Tan, X., Zeng, G., Misse, A., Singh, S., Kim, Y., Klaunig, J.E., and Monga, S.P. 2010. Conditional beta-catenin loss in mice promotes chemical hepatocarcinogenesis: role of oxidative stress and platelet-derived growth factor receptor alpha/phosphoinositide 3-kinase signaling. Hepatology 52:954-965.
309. Debies, M.T., Gestl, S.A., Mathers, J.L., Mikse, O.R., Leonard, T.L., Moody, S.E., Chodosh, L.A., Cardiff, R.D., and Gunther, E.J. 2008. Tumor escape in a Wnt1-dependent mouse breast cancer model is enabled by p19Arf/p53 pathway lesions but not p16 Ink4a loss. The Journal of clinical investigation 118:51-63.
310. Nejak-Bowen, K., Kikuchi, A., and Monga, S.P. 2013. Beta-catenin-NF-kappaB interactions in murine hepatocytes: a complex to die for. Hepatology 57:763-774.
311. Iyer, S., Ambrogini, E., Bartell, S.M., Han, L., Roberson, P.K., de Cabo, R., Jilka, R.L., Weinstein, R.S., O'Brien, C.A., Manolagas, S.C., et al. 2013. FOXOs attenuate bone formation by suppressing Wnt signaling. The Journal of clinical investigation 123:3409-3419.
312. Pinkert, C.A., Ornitz, D.M., Brinster, R.L., and Palmiter, R.D. 1987. An albumin enhancer located 10 kb upstream functions along with its promoter to direct efficient, liver-specific expression in transgenic mice. Genes Dev 1:268-276.
313. Wang, P., Wang, Q., Sun, J., Wu, J., Li, H., Zhang, N., Huang, Y., Su, B., Li, R.K., Liu, L., et al. 2009. POU homeodomain protein Oct-1 functions as a sensor for cyclic AMP. J Biol Chem 284:26456-26465.
178
314. Norris, A.W., Chen, L., Fisher, S.J., Szanto, I., Ristow, M., Jozsi, A.C., Hirshman, M.F., Rosen, E.D., Goodyear, L.J., Gonzalez, F.J., et al. 2003. Muscle-specific PPARgamma-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones. J Clin Invest 112:608-618.
315. Jin, T. 2008. The WNT signalling pathway and diabetes mellitus. Diabetologia 51:1771-1780.
316. Araki, E., Lipes, M.A., Patti, M.E., Bruning, J.C., Haag, B., 3rd, Johnson, R.S., and Kahn, C.R. 1994. Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 372:186-190.
317. Singh, R., De Aguiar, R.B., Naik, S., Mani, S., Ostadsharif, K., Wencker, D., Sotoudeh, M., Malekzadeh, R., Sherwin, R.S., and Mani, A. 2013. LRP6 enhances glucose metabolism by promoting TCF7L2-dependent insulin receptor expression and IGF receptor stabilization in humans. Cell Metab 17:197-209.
318. Li, T., Chen, Y.H., Liu, T.J., Jia, J., Hampson, S., Shan, Y.X., Kibler, D., and Wang, P.H. 2003. Using DNA microarray to identify Sp1 as a transcriptional regulatory element of insulin-like growth factor 1 in cardiac muscle cells. Circ Res 93:1202-1209.
319. Zhu, J.L., Kaytor, E.N., Pao, C.I., Meng, X.P., and Phillips, L.S. 2000. Involvement of Sp1 in the transcriptional regulation of the rat insulin-like growth factor-1 gene. Mol Cell Endocrinol 164:205-218.
320. Fujimura, N., Vacik, T., Machon, O., Vlcek, C., Scalabrin, S., Speth, M., Diep, D., Krauss, S., and Kozmik, Z. 2007. Wnt-mediated down-regulation of Sp1 target genes by a transcriptional repressor Sp5. J Biol Chem 282:1225-1237.
321. Mojsov, S., Weir, G.C., and Habener, J.F. 1987. Insulinotropin: glucagon-like peptide I (7-37) co-encoded in the glucagon gene is a potent stimulator of insulin release in the perfused rat pancreas. J Clin Invest 79:616-619.
322. Anini, Y., and Brubaker, P.L. 2003. Muscarinic receptors control glucagon-like peptide 1 secretion by human endocrine L cells. Endocrinology 144:3244-3250.
323. Skoglund, G., Hussain, M.A., and Holz, G.G. 2000. Glucagon-like peptide 1 stimulates insulin gene promoter activity by protein kinase A-independent activation of the rat insulin I gene cAMP response element. Diabetes 49:1156-1164.
324. Chai, W., Dong, Z., Wang, N., Wang, W., Tao, L., Cao, W., and Liu, Z. 2012. Glucagon-like peptide 1 recruits microvasculature and increases glucose use in muscle via a nitric oxide-dependent mechanism. Diabetes 61:888-896.
325. Dhanvantari, S., Seidah, N.G., and Brubaker, P.L. 1996. Role of prohormone convertases in the tissue-specific processing of proglucagon. Mol Endocrinol 10:342-355.
326. Yu, Z., Shao, W., Chiang, Y., Foltz, W., Zhang, Z., Ling, W., Fantus, I.G., and Jin, T. 2011. Oltipraz upregulates the nuclear factor (erythroid-derived 2)-like 2 [corrected](NRF2) antioxidant system and prevents insulin resistance and obesity induced by a high-fat diet in C57BL/6J mice. Diabetologia 54:922-934.
327. Zhande, R., Zhang, W., Zheng, Y., Pendleton, E., Li, Y., Polakiewicz, R.D., and Sun, X.J. 2006. Dephosphorylation by default, a potential mechanism for regulation of insulin receptor substrate-1/2, Akt, and ERK1/2. J Biol Chem 281:39071-39080.
328. Altarejos, J.Y., and Montminy, M. 2011. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals. Nat Rev Mol Cell Biol 12:141-151.
329. Plamboeck, A., Holst, J.J., Carr, R.D., and Deacon, C.F. 2005. Neutral endopeptidase 24.11 and dipeptidyl peptidase IV are both mediators of the degradation of glucagon-like peptide 1 in the anaesthetised pig. Diabetologia 48:1882-1890.
179
330. Davidson, E.P., Coppey, L.J., Dake, B., and Yorek, M.A. 2011. Effect of Treatment of Sprague Dawley Rats with AVE7688, Enalapril, or Candoxatril on Diet-Induced Obesity. J Obes 2011.
331. Oltman, C.L., Davidson, E.P., Coppey, L.J., Kleinschmidt, T.L., Dake, B., and Yorek, M.A. 2011. Role of the effect of inhibition of neutral endopeptidase on vascular and neural complications in streptozotocin-induced diabetic rats. Eur J Pharmacol 650:556-562.
332. Davidson, E.P., Coppey, L.J., Holmes, A., and Yorek, M.A. 2012. Effect of inhibition of angiotensin converting enzyme and/or neutral endopeptidase on vascular and neural complications in high fat fed/low dose streptozotocin-diabetic rats. Eur J Pharmacol 677:180-187.
333. Matsumoto, M., and Accili, D. 2006. The tangled path to glucose production. Nat Med 12:33-34; discussion 34.
334. Ryu, H., Lee, J., Impey, S., Ratan, R.R., and Ferrante, R.J. 2005. Antioxidants modulate mitochondrial PKA and increase CREB binding to D-loop DNA of the mitochondrial genome in neurons. Proc Natl Acad Sci U S A 102:13915-13920.
335. Thomson, D.M., Herway, S.T., Fillmore, N., Kim, H., Brown, J.D., Barrow, J.R., and Winder, W.W. 2008. AMP-activated protein kinase phosphorylates transcription factors of the CREB family. J Appl Physiol 104:429-438.
336. Taurin, S., Sandbo, N., Qin, Y., Browning, D., and Dulin, N.O. 2006. Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase. J Biol Chem 281:9971-9976.
