The Role of the GLP-2 Receptor in Intestinal and Islet Adaptation to Changes in Nutrient Availability

by

Jasmine Bahrami

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Institute of Medical Science

University of Toronto

© Copyright by Jasmine Bahrami 2010

ii

The role of the GLP-2 receptor in intestinal and islet adaptation to changes in nutrient availability

Jasmine Bahrami

Doctor of Philosophy

Institute of Medical Science

University of Toronto

2010

ABSTRACT

GLP-2 is a potent intestinotrophic peptide that can increase mucosal growth, intestinal

blood flow, and nutrient absorption when administered exogenously. We aimed to

delineate the effects of endogenous GLP-2R signalling in conditions of nutrient

deprivation and excess. Using a mouse with a targeted genetic deletion of the Glp2r gene

(Glp2r-/-), we addressed the hypothesis that the known GLP-2R is required for intestinal

adaptation to nutrient deprivation and excess. In Chapter 2, we demonstrate that Glp2r!/!

mice fasted for 24 hours and re-fed for 24 hours failed to increase intestinal growth and

jejunal crypt cell proliferation compared to littermate Glp2r+/+ mice. Administration of

EGF to Glp2r!/! during the re-feeding period rescued this re-feeding defect. Wildtype

mice re-fed for 30, 90, and 180 minutes following a 24 hour fast displayed increased

jejunal mRNA levels of the ErbB ligands amphiregulin, epiregulin and HB-EGF.

Treatment with the pan ErbB inhibitor CI-1033 inhibited induction of these ErbB ligands

in jejunum of mice in association with prevention of crypt cell proliferation. Re-feeding

also caused an increase in jejunal p-Akt levels and treatment with CI-1033 prevented

increased p-Akt levels. Moreover, re-fed Glp2r!/! mice failed to increase ErbB ligands or

p-Akt levels 90 minutes following re-feeding when compared to Glp2r+/+ littermates.

iii

Therefore, the GLP-2R is essential for re-feeding induced intestinal adaptation by

activating the ErbB network and p-Akt to increase crypt cell proliferation. In Chapter 3,

we show that the known GLP-2R is not required for intestinal adaptation to a perceived

nutrient deprivation challenge (STZ-induced diabetes) or chronic nutrient excess (high-

fat diet induced glucose intolerance). Although exogenous GLP-2 administration has

been previously shown to stimulate glucagon secretion, glucose homeostasis was normal

in STZ-diabetic and high fat fed Glp2r!/! mice. We also developed a third model of

diabetes and glucose intolerance: ob/ob: Glp2r!/!. In the absence of GLP-2R signalling,

ob/ob mice display improved oral but impaired intraperitoneal glucose tolerance, elevated

fed and fasted glucose levels, increased circulating glucagon, decreased beta cell and

increased alpha cell mass. Taken together, these results suggest that endogenous GLP-2R

signalling is essential for intestinal and islet adaptation to conditions of nutrient

deprivation and excess.

iv

ACKNOWLEDGEMENTS

First and foremost, I am forever thankful to my supervisor Dr. Daniel Drucker for his

support, guidance, teaching, expertise, optimism and for always helping me see the

positive in difficult situations. Dr. Drucker is an exceptional supervisor and mentor who

is completely dedicated to ensuring the success of his trainees.

I would like to extend my gratitude to Dr. Bernardo Yusta for being an outstanding

teacher, for his endless encouragement and patience and for all the stimulating scientific

discussions. It has truly been an honour and privilege to work with and learn from Dr.

Yusta. I am also indebted to Dr. Laurie Baggio for her expertise, support and kindness. I

would also like to thank past and present members of the Drucker lab, including Dr.

Jackie Koehler, Dr. Holly Bates, Dr. Christine Longuet, Meghan Sauve, Dr. John Ussher,

Naim Panjwani, Xiemin Cao, Marc Angeli, Dr. Ben Lamont, Adriano Maida, Irene

Hadjiyanni, Safina Ali, Dianne Holland, Grace Flock, Dr. Jen Estall and Dr. Julie

Lovshin.

I am also grateful to my committee members, Dr. Patricia Brubaker and Dr. Khosrow

Adeli for the constructive criticism and helpful suggestions.

Finally I would like to thank my family for their endless love and support. I am grateful

to my wonderful husband David for being my tireless champion and for always believing

in me. I would also like to thank my mother Sheida for her unconditional love and

support. My interest in scientific research and diabetes is due in large part to my aunt

Shabnam who is an exceptional scientist and to my grandmother Maryam who sadly

passed away from complications of diabetes. I would like to dedicate this work to my

beloved mother, aunt, and grandmother.

v

TABLE OF CONTENTS ABSTRACT……………………………………………………………………………….i ACKNOWLDGEMENTS……………………………………………………...……….iii TABLE OF CONTENTS………………………………………...………………..……iv LIST OF FIGURES…………………………………………………………...……......vii LIST OF TABLES…………………………………………………………….…….......ix ABBREVIATIONS……………………………………………………………………....x CHAPTER 1: Introduction…………………………………..………………………….1

1.1 Proglucagon ………………………………………………………………2 1.2 Glucagon-like peptide-2…………………………………………………..6

1.2.1 Glucagon-like peptide-2 secretion ………………………………..6 1.2.2 Metabolism and clearance of GLP-2 ……………………………..9 1.2.3 Cellular mechanisms of GLP-2 action …………………………..10 1.2.4 Biological actions of GLP-2……………………………………..13 1.2.5 Therapeutic potential of GLP-2………………………………….34

1.3 Intestinal adaptation to re-feeding……………………………………….37 1.4 Glucagon…………………………………………………………………40

1.4.1 Glucagon secretion…………………………………………….…40 1.4.2 Glucagon metabolism and clearance………...…………………..44 1.4.3 Cellular mechanisms of glucagon action...………………………45 1.4.4 Biological actions of glucagon………………………….………..46

1.5 Rationale and Hypotheses……………………………………………..…48

CHAPTER 2: ErbB activity links the glucagon-like peptide-2 receptor to refeeding

induced adaptation in the murine small bowel………………………50

2.1 Research Summary………………………………………………………51 2.2 Introduction……………………………………………………………....52 2.3 Materials & methods……………………………………………………..53

2.3.1 Peptides & drugs………………………………………………...53 2.3.2 Animals…………………………………………………………..53 2.3.3 Fasting and re-feeding protocol………………………………….54 2.3.4 Collection of tissues……………………………………………..54

vi

2.3.5 Morphometry…………………………………………………….54 2.3.6 Real-time (RT) PCR……………………………………………..55 2.3.7 Western blot analysis…………………………………………….55 2.3.8 Plasma GLP-2…………………………………………………....56 2.3.9 Statistical analyses…………………………………………….…56

2.4 Results……………………………………………………………………56

2.4.1 Intestinal adaptation in the transition from fasting to refeeding is impaired in Glp2r!/! mice………………………………………..56

2.4.2 EGF but not IGF-1 rescues the refed intestinal phenotype in Glp2r!/! mice………………………………………………….…66

2.4.3 ErbB signaling controls gene expression and cell proliferation in the refed small bowel………………………………………..…...69

2.5 Discussion………………………………………………………………..75

CHAPTER 3: The glucagon-like peptide-2 receptor modulates islet adaptation to

metabolic stress in the ob/ob mouse…………………………….…….78

3.1 Research Summary………………………………………………………79 3.2 Introduction……………………………..………………………………..80

3.3 Materials & methods……………………………………………………..82

3.3.1 Peptides and reagents…………………………………………….82 3.3.2 Animals………...………………………………………………...82 3.3.3 Glucagon secretion from pancreatic islets……………….………82 3.3.4 Insulin and glucagon tolerance tests……………………………..83 3.3.5 Streptozotocin-induced diabetes…………………………………83 3.3.6 Feeding studies..………………………………………………….83 3.3.7 Immunostaining and histological analysis……………………….83 3.3.8 Real time PCR……………………………………………………84 3.3.9 Plasma and tissue metabolites and hormones……………………84 3.3.10 Statistical analyses……………………………………………….85

3.4 Results……………………………………………………………………85

3.4.1 GLP-2 does not stimulate glucagon secretion in mice………...…85 3.4.2 Glp2r!/! mice are not protected from diet-induced obesity or

glucose intolerance……………………………………………….88 3.4.3 GLP-2R signalling does not modify glucose homeostasis in lean

diabetic mice……………………………………………….…….92 3.4.4 Loss of GLP-2R signalling modifies glucose homeostasis and islet

adaptation in obese mice…………………………………………92

3.5 Discussion………………………………………………………..……..102

vii

CHAPTER 4: Discussion & Conclusions…………………………………………….105 APPENDIX…………………………………………………………………………….133 REFERENCES…………………………..…………………………………………….144

viii

LIST OF FIGURES Chapter 2: ErbB activity links the glucagon-like peptide-2 receptor to refeeding-

induced adaptation in the murine small bowel Figure 2.1. Plasma GLP-2 levels in fasted and re-fed mice………………………….57 Figure 2.2. Intestinal weight, crypt plus villus height, and villus epithelial cell number

in mice fed ad libitum, deprived of food, and refed…………………...…58 Figure 2.3. Representative histological sections of mouse jejunum stained with

hematoxylin-eosin from fasted Glp2r+/+ (a) and Glp2r!/! (c) and re-fed Glp2r+/+ (b) and Glp2r!/! (d) animals……………………………….…...59

Figure 2.4. Jejunal crypt cell proliferation during fasting and refeeding……….……61 Figure 2.5. Analysis of gene expression in the jejunum of mice deprived of food and

refed.…………………...………………………………………………...62 Figure 2.6. Jejunum protein levels of ErbB1, ErbB2, IGF-1R, and eNOS are not

different between Glp2r+/+ and Glp2r!/! mice either fasted or re-fed…....63 Figure 2.7. Analysis of gene expression in the ileum of fasted and re-fed mice...…..64 Figure 2.8. Ileum protein levels of ErbB1, ErbB2, IGF-1R, and eNOS are not different

between Glp2r+/+ and Glp2r!/! mice either fasted or re-fed………..……65 Figure 2.9. Responsiveness of the murine small bowel to exogenous EGF

administration……………………………………………………………67 Figure 2.10. Intestinal weight following 24 hours re-feeding with exogenous IGF-1

administration……………………………………………………………68 Figure 2.11. Refeeding-induced changes in jejunal gene expression are selectively

inhibited by CI-1033…………………………..…………………………71 Figure 2.12. Re-feeding selectively modulates changes in intestinal gene expression

independent of ErbB receptor activity…………………….……………..72 Figure 2.13. Jejunal crypt cell proliferation and levels of phosphorylated Akt during

fasting and refeeding in the presence of CI-1033………………………..73 Figure 2.14. Levels of ErbB ligands and phosphorylated Akt in the jejunum of Glp2r+/+

vs. Glp2r!/! mice…………………………….…………………………...74 Chapter 3: The glucagon-like peptide-2 receptor modulates islet adaptation to

metabolic stress in the ob/ob mouse Figure 3.1. Exogenous administration of GLP-2 does not stimulate glucagon secretion

in mice…………………………………………………………………....86 Figure 3.2. Proglucagon and GLP-2R gene expression…………………………...…87 Figure 3.3. Endogenous GLP-2R signaling does not modulate glycemia or glucagon

secretion during insulin or glucose tolerance tests………………………89 Figure 3.4. Endogenous GLP-2R signaling does not modify glucose homeostasis

under a high fat diet challenge…………………………………………...90

ix

Figure 3.5. Food intake, body fat composition, pancreas and small intestinal weight of high fat fed Glp2r!/! mice and controls…...…………………………..…91

Figure 3.6. Endogenous GLP-2R signalling and STZ-induced diabetes…….…..…..93 Figure 3.7. Role of GLP-2R signalling in the ob/ob mouse…………………...……..94 Figure 3.8. Food intake, body fat composition, pancreas and small intestinal weight of

ob/ob: Glp2r!/! mice and controls……..………………….……………...95 Figure 3.9. Oxymax and locomotion studies in ob/ob: Glp2r!/! mice and controls….97 Figure 3.10. Glucose tolerance and circulating glucagon levels in ob/ob: Glp2r!/!

mice………………………………………………………………………98 Figure 3.11. Plasma insulin, GLP-1 and GLP-2 levels in ob/ob: Glp2r!/! mice and

controls…………………………………………………………...……....99 Figure 3.12. GLP-2R signaling does not regulate glucagon secretion from isolated

pancreatic islets……………………………………………………..…..100 Figure 3.13. Chronic high fat feeding was carried out to induce a proinflammatory state

in ob/ob: Glp2r!/! mice and littermate ob/ob: Glp2r+/+ mice (60% high fat diet for 4 weeks)…………………………………………...……………101

Chapter 4: Discussion Figure 4.1. Signalling through the ErbB network……………..……………………111 Figure 4.2. IGF-1 and the ErbB network mediate GLP-2’s intestinotrophic actions……………..……………………………………………………………………120

x

LIST OF TABLES Table 1.1. Intestinotrophic effects of GLP-2 in healthy adult animal models ……..…. 16 Table 1.2. GLP-2 effects on intestinal nutrient absorption ……………………….……20 Table 1.3. Effects of GLP-2 in experimental models of animal disease ……………… 26 Table 4.1. Summary of studies using GLP-2/GLP-2R antagonism to address endogenous

GLP-2 effects ……………………………………………………….……. 107

xi

ABBREVIATIONS

Ab Antibody ACF Aberrant crypt foci ANOVA Analysis of variance AP-1 Activator protein-1 APC Adenomatous polyposis coli Areg Amphiregulin ATP Adenosine triphosphate AUC Area under the curve BHK Baby hamster kidney Bcl-2 B-cell lymphoma-2 bid Bis in die bp Base pairs BrDU 5`-bromo 2`-deoxy-uridine BW Body weight cAMP Cyclic 3`, 5`-adenosine monophosphate CCK Cholecystokinin cDNA Complementary DNA cIAP Cellular inhibitor of apoptosis CREB Cyclic-AMP response element binding protein CGRP Calcitonin gene-related peptide CNS Central nervous system C-terminal Carboxy-terminal DNA Deoxyribonucleic acid DPP-4 Dipeptidyl peptidase-4 DSS Dextran sulphate EDTA Ethylenediaminetetraacetate EGF Epidermal growth factor EGFR Epidermal growth factor receptor ELISA Enzyme-linked immunosorbent assay eNOS Endothelial nitric oxide synthase ereg Epiregulin ERK Extracellular signal-regulated kinase FACS Fluorescence-activated cell sorting FITC Fluorescein isothiocyanate FRIC Fetal rat intestinal cell 5-FU 5-Fluorouracil G protein Guanine nucleotide-binding protein G6Pase Glucose-6-phosphotase Gcgr Glucagon receptor Gcgr-/- Glucagon receptor knockout (homozygous) GFP Green fluorescent protein GI Gastrointestinal GIP Glucose-dependent insulinotropic peptide GLI Glucagon-like immunoreactivity

xii

GLP-1 Glucagon-like peptide-1 Glp1r Glucagon-like peptide-1 receptor (gene) GLP-1R Glucagon-like peptide-1 receptor (protein) Glp1r-/- GLP-1 receptor knockout (homozygous) GLP-2 Glucagon-like peptide-2 GLP-2(1-33) Full-length GLP-2 (amino acids 1 – 33) GLP-2(3-33) Truncated GLP-2 (amino acids 3 – 33) Glp2r Glucagon-like peptide-2 receptor (gene) GLP-2R Glucagon-like peptide-2 receptor (protein) Glp2r-/- GLP-2 receptor knockout (homozygous) GLUT-2 Glucose transporter-2 GPCR G protein-coupled receptor GRP Gastrin-realising peptide GRPP Glicentin-related polypeptide GSK-3 Glycogen-synthase kinase-3 GTT Glucose tolerance test HbA1c Glycated haemoglobin A1c HB-EGF Heparing binding-epidermal growth factor h[Gly2]GLP-2 Human GLP-2 (1-33) with Ala to Gly substitution at position 2 HRP Horseradish peroxidase IBD Inflammatory bowel disease ICV Intracerebroventricular IFN-" Interferon-" IGF-1 Insulin-like growth factor-1 Igf1-/- Insulin-like growth factor-1 knockout (homozygous) IGF-1R Insulin-like growth factor-1 receptor IGF-2 Insulin-like growth factor-2 IL Interleukin IM Intramuscular IP Intraperitoneal IP-1 Intervening peptide-1 IP-2 Intervening peptide-2 IPGTT Intraperitoneal glucose tolerance test IRS-1 Insulin receptor substrate-1 ITT Insulin tolerance test IV Intravenous kb Kilobases KGF Keratinocyte growth factor LI Large intestine LPS Lipopolysaccharide mAb Monoclonal antibody MAPK Mitogen-activated protein kinase MDF Mucin depleted foci MEK Mitogen-activated protein kinase kinase MIP Mouse insulin promoter mRNA Messenger RNA

xiii

NEP-24.11 Neutral endopeptidase 24.11 NO Nitric oxide NOD Non obese diabetic NOS Nitric oxide synthase NSAID Nonsteroidal antiinflammatory drug N-terminal Amino-terminal ob/ob obese:obese mice (homozygous for leptin deficiency) OGTT Oral glucose tolerance test P Observed significance level p-Akt Phosphorylated-Akt Pax-6 Paired box gene-6 PBS Phosphate buffered saline PC Prohormone convertase PCNA Proliferating cell nuclear antigen PCR Polymerase chain reaction PEPCK Phosphoenolpyruvate carboxykinase PGDPs Proglucagon derived peptides PI3K Phosphatidylinositol-3 kinase PKA Protein kinase A PKB Protein kinase B (also known as Akt) PKC Protein kinase C PTEN Phosphatase and tensin homologue PYY Peptide YY RIA Radioimmunoassay RNA Ribonucleic acid RT Reverse transcriptase RT-PCR Reverse-transcriptase polymerase chain reaction S Signal peptide SBS Short bowel syndrome SC Subcutaneous SD Standard deviation SEM Standard error of mean SGLT-1 Sodium-dependent glucose transporter-1 SI Small intestine siRNA Small interfering ribonucleic acid Shc Src-homology/collagen adaptor SSTR Somatostatin receptor STZ Streptozotocin TCF-4/TCF7L2 Transcription factor-7-like 2 TGF-# Transforming growth factor-# tid ter in die TNBS 2,4,6-trinitrobenzene sulphonic acid TNF-$ Tumour necrosis factor-$ TPN Total parenteral nutrition TTX Tetrodotoxin TUNEL Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end

xiv

labelling VIP Vasoactive intestinal polypeptide WT Wild-type XIAP X-linked inhibitor of apoptosis Methodological Abbreviations % percent º C degrees Celsius Da Dalton g gram h hour(s) l litres M molar (moles/l) min minute(s) mol moles sec second(s) U units wk week wt weight vol volume Prefixes k kilo- (x 103) c centi- (x 10-2) m milli- (x 10-3) µ micro- (x 10-6) n nano- (x 10-9) p pico- (x 10-12)

1

CHAPTER 1

INTRODUCTION

2

1.1 Proglucagon

Proglucagon and the proglucagon-derived peptides

The proglucagon gene encodes a 160 amino acid peptide precursor that is expressed in

pancreatic alpha cells, enteroendocrine L cells and neurons of the caudal brainstem 1-7 . The

proglucagon mRNA transcript is identical in all three tissues and it is through post-

translational processing of the proglucagon peptide precursor that the proglucagon-derived

peptides (PGDPs) are liberated 1, 2, 8. In the pancreatic alpha cells, the protease prohormone

convertase 2 (PC2) cleaves proglucagon to give rise to glucagon and the major proglucagon

fragment 9-11. In intestinal L cells and the caudal brainstem, prohormone convertase 1/3

(PC1/3) liberates the glucagon-like peptides (GLP-1 and GLP-2) as well as glicentin,

oxyntomodulin and intervening peptide-2 (IP-2) 9, 12, 13 .

Regulation of proglucagon gene expression

Pancreatic islets:

Fasting and hypoglycaemia are potent stimulators of pancreatic proglucagon gene

expression; conversely, insulin and the fed state inhibit proglucagon expression in the

pancreas 14-16. The role of glucose as a regulator of proglucagon gene expression in the

pancreas is controversial. Insulin but not phloridzin reduced pancreatic proglucagon mRNA

content as well as circulating glucagon levels in diabetic rats17. Furthermore, the

proglucagon gene contains specific insulin responsive DNA components (i.e. G3 enhancer

element) 15, lending support to a role for regulation of gene expression by insulin.

Several transcription factors have been implicated in the regulation of pancreatic

proglucagon gene expression, including Pax-2, Brn4, and HNF-3. Both Pax-2 and Brn4 can

bind enhancer elements of the proglucagon gene 18, 19. Brn4-/- mice display normal pancreatic

development and proglucagon gene expression while increased pancreatic islet number and

size are observed in adult Pax2(1NEU) mutant mice 19-21.

Members of the HNF-3/forkhead transcription family have also been shown to

stimulate proglucagon transcription through direct activation on the G1 and G2 elements as

well as inhibit expression by blocking Pax6 activation 22-25. Both Foxa1 (HNF-3 ) and

3

Foxa2 (HNF-3 ) can interact with G1 and G2 elements on the proglucagon gene 26, 27. Foxa1

null mice die postnatally due to severe hypoglycaemia resulting from defective counter-

regulatory response to such hypoglycaemia. Levels of circulating glucagon and pancreatic

glucagon mRNA were found to be extremely low in Foxa1 null mice 22, 28 suggesting an

essential role for Foxa1 in regulation of pancreatic proglucagon gene expression. Foxa2 null

mice are embryonically lethal 29 and thus significant efforts have been directed towards

generation of tissue-specific Foxa2 null mice. Beta cell-specific Foxa2 null mice exhibit

severe hypoglycaemia in association with five-fold lower plasma glucagon levels.

Interestingly, the decreased plasma glucagon level is not attributable to decreased

proglucagon gene expression but rather to defective secretion from islets 30. Deletion of

Foxa2 from the embryonic endoderm using targeted Cre-mediated deletion resulted in severe

hypoglucagonemia with a significant decrease in proglucagon gene expression. In addition,

these mice have a significantly under-developed pancreas including decreased alpha cell

number 31. Lastly, Foxa3 (HNF-3 ) has been shown to bind to the G2 promoter element of

the proglucagon gene and increase promoter activity; however, Foxa3 activity did not change

proglucagon gene expression and Foxa3 null mice had normal levels of pancreas and

intestinal proglucagon gene expression 32. Therefore, Foxa transcription factors are

important regulators of pancreatic proglucagon gene expression.

Cdx2 is another transcription factor regulating proglucagon gene expression. Cdx2

mRNA transcripts and immunoreactive cdx2 protein have been detected in islet and intestinal

tissues as well as in proglucagon-producing cell lines STC-1, GLUTag, InR1-G9, and

RIN1056A. The ability of Cdx2 to activate proglucagon promoter was shown by transfecting

BHK-fibroblasts with a proglucagon promoter-luciferase fusion gene 33. Luciferase activity

in these cells (which lack cdx-2) was low; however, co-transfection with a hamster cdx-2

cDNA significantly increased proglucagon promoter activation. Furthermore, sequential

deletion of gene sequences from the promoter region as well as EMSA experiments revealed

that cdx2 interacts with the G1 promoter element 33. Cdx-2 also increased proglucagon gene

expression in endocrine cell lines. Co-transfection of cdx-2 with a proglucagon promoter-

luciferase fusion into InR1-G9 and GLUTag cells increased luciferase activity 34. Cdx2 also

increased endogenous levels of proglucagon gene expression as observed by transient

4

transfection in InR1-G9 cells 34. Thus, a number of different transcription factors specifically

regulate proglucagon gene expression.

Enteroendocrine L cells:

Whereas fasting stimulates pancreatic proglucagon gene expression, feeding potently

stimulates proglucagon expression in the intestinal L cells. Physiological situations such as

re-feeding following a prolonged fast 35, a high-fibre diet 35 and short-chain fatty acids 36 as

well as pathophysiological situations such as intestinal resection 37, 38 have all been shown to

increase levels of proglucagon transcripts in the intestine. Activators of intracellular cAMP

accumulation such as forskolin have been shown to increase proglucagon mRNA transcripts

in cell culture studies using GLUTag and STC-1 cells 39, 40. cAMP accumulation in fetal rat

intestinal cells (FRIC) cultures also increased proglucagon gene expression and PGDP

secretion 8. In STC-1 cells, proglucagon gene expression is stimulated by PKA independent

of the cAMP response element (CRE) in the promoter region 41, suggesting that alternative

signalling pathways exist that cross-talk with PKA to stimulate proglucagon gene expression.

Cross-talk between the Wnt signalling pathway and PKA is well reported 42, 43, and indeed

PKA has been shown to inhibit GSK-3 . In cell culture studies with FRIC, GLUTag and

STC-1 cells, lithium was used to mimic PKA inhibition of GSK-3 44. Lithium increased

proglucagon gene expression and GLP-1 synthesis and both lithium and transfected �–

catenin increased proglucagon promoter activity in the absence of the CRE on the

proglucagon promoter. Interestingly, the Wnt signalling pathway was only relevant in

intestinal cell lines as lithium had no effect in the pancreatic alpha cell line InR1-G9 44.

Therefore, Wnt-activation of proglucagon gene expression may be a unique way of activating

proglucagon gene expression in the intestine vs. the pancreas.

Many of the molecules implicated for proglucagon gene expression in the pancreas

are also active in intestinal proglucagon expression; e.g. cdx2 equally contributes to G1

promoter activity of proglucagon in pancreatic and intestinal cell lines 33. However, some of

these factors have opposite effects in the intestine vs. pancreas. While insulin inhibits

proglucagon gene expression in the pancreas, it has been shown to increase proglucagon

mRNA expression in the intestine. Treatment of GLUTag cells with 100nM insulin resulted

in significantly increased proglucagon gene expression and parallel in vivo studies showed

5

that hyperinsulinemic MKR mice have significantly increased ileal proglucagon gene

expression 45. The Wnt signalling pathway mediates such actions of insulin on intestinal

proglucagon expression. Transfection of GLUTag cells with �–catenin siRNA reduced

insulin-stimulated proglucagon gene expression and assessing activity of a TCF reporter

plasmid in transfected GLUTag cells showed that TCF-4 and TCF-binding motifs in the G2

element are required for insulin to increase proglucagon gene expression 45. Therefore,

insulin significantly increases proglucagon gene expression in the intestine while it has

opposite effects in pancreatic islets.

Pax6 is another critical transcription factor for the control of proglucagon gene

expression in the intestine; mice with a dominant negative Pax6 mutation have significantly

reduced proglucagon mRNA transcript levels and display almost no GLP-1/GLP-2

immunopositive enteroendocrine cells suggesting that proglucagon-producing

enteroendocrine L cells are largely absent in this mouse 46, 47. Furthermore, heterozygote

Pax6+/- mice have reduced proglucagon mRNA expression, decreased circulating GLP-1

levels and displayed impaired glucose tolerance and glucose-stimulated insulin secretion 48.

The phenotype of this mouse was corrected by exogenous administration of the GLP-1R

agonist exendin-4 48.

6

1.2 Glucagon-like Peptide-2

1.2.1 GLP-2 secretion

GLP-2 is co-secreted along with GLP-1 in a 1:1 molar ratio from the intestinal L cell.

Therefore, studies of GLP-1 secretion likely describe the regulation of GLP-2 secretion. The

control of glucagon-like peptide (GLP) secretion is complex, involving nutrient and

neuroendocrine interactions culminating in stimulation of the intestinal L cell. The intestinal

L cell is an open-type intestinal epithelial cell that is present throughout the small and large

intestine but the majority of L cells are found in the distal ileum and proximal colon 49, 50.

PGDPs have a biphasic secretion profile in humans, with the first phase occurring 15-30 min

and the second phase occurring 60-120 min following food ingestion 51, 52. Given that

nutrients cannot reach the distal gut (the primary location of PGDP-secreting L cells) within

the time-frame of the initial secretory phase, early PGDP secretion is likely caused by

neuroendocrine signals generated in the proximal intestine that stimulate distal intestinal L

cells.

First phase PGDP secretion �– neuroendocrine control:

The neural component of this initial secretory pathway involves the vagus nerve and

muscarinic receptors. L cells express muscarinic receptors and aceylcholine has been shown

to be an important agonist for GLP-1 secretion 53. Conversely, inhibition of muscarinic

receptors with atropine reduced fat-induced GLP-1 secretion both in vivo in rats and in vitro

in FRIC cultures while treatment with bethanecol, a muscarinic agonist, increased GLP-1

secretion from the intestinal L cell line NCI-H716 54, 55. The vagus nerve is also essential for

GLP-1 secretion. Bilateral subdiaphragmatic vagotomy completely abolished the fat-induced

rise in GLP-1 secretion in rats (as assessed by decreased plasma glucagon-like

immunoreactivity) and electrical stimulation of the distal end of the celiac branch of

subdiaphragmatic vagus also stimulated GLP-1 secretion 54-56. Neural regulation of GLP-1

secretion has been observed in pigs. Electrical stimulation of periarterial nerves inhibited

GLP-1 secretion in the perfused pig ileum but unlike rodent models, an 8Hz electrical

stimulation of the vagus nerve had no effect on GLP-1 or GLP-2 secretion 57. Infusion of

7

acetylcholine in the perfused porcine ileum significantly stimulated GLP-1 secretion and this

effect was blocked by atropine 57. Studies in healthy volunteers have revealed a pulsatile

GLP-1 secretion pattern following an oral glucose load. The increased plasma GLP-1

concentration following the oral glucose load was significantly attenuated with intravenous

administration of atropine (80ng/kg BW) suggesting that GLP-1 secretion in humans is also

regulated by muscarinic receptors 58. Other neural pathways are involved in stimulating

GLP-1 secretion. Beta-adrenergic input can potently increase GLP-1 secretion as observed

by epinephrine-induced GLP-1 release from L cells of isolated perfused rat ileum 56, 59.

Neurotransmitters such as gastrin-releasing peptide (GRP) 60-62 and calcitonin gene-related

peptide (CGRP) 63 can also trigger PGDP secretion. Therefore, observations from several

animal models and human studies demonstrate that neural inputs significantly affect early

PGDP secretion.

A number of peptide hormones have been implicated in the hormonal component of

this initial secretory pathway, including GIP. Studies in rats have shown that placement of

fat into ligated duodenal segments (to prevent nutrient influx to the distal intestine) increased

circulating PGDP as well as GIP levels 64, 65. Control experiments were done with vehicle to

show that this effect was not due to gastric distension and was indeed nutrient-dependent 64,

65. Studies in isolated perfused porcine ileum have shown that GIP significantly stimulates

GLP-1 secretion 66. While contact of nutrients with the GIP-producing duodenal K cells

enhances PGDP secretion in rodents and pigs, this effect is not seen in humans. Infusion of

GIP into overnight fasted healthy volunteers failed to increase PGDP secretion 67.

Nevertheless, the hormonal component of PGDP secretion in humans may be mediated by

CCK. Intraduodenal infusion of fat in healthy volunteers significantly increased circulating

GLP-1 and CCK concentrations 68. Fat digestion was required for this effect as treatment

with the lipase inhibitor orlistat blocked fat-induced increases in GLP-1 and CCK.

Treatment with the CCK-1 receptor antagonist CCK-DOX blocked fat-induced increase in

circulating GLP-1 68. These observations suggest that in humans, CCK may be required for

fat-induced PGDP secretion.

For PGDP secretion to occur, the neural and hormonal pathways must interact in such

a way that nutrient-stimulated hormonal release activates neural/vagal afferents which in turn

stimulate the L cell. The existence of such proximal-distal loop was demonstrated by

8

infusion of physiological levels of GIP in vagotomised rats. While GIP stimulated GLP-1

secretion in control animals, its stimulatory actions on the L cell were abolished in

vagotomised rats 54. Therefore, the early rise in GLP secretion occurs as a result of a

neuroendocrine loop whereby nutrients in the proximal gut stimulate GIP secretion which in

turn activates acetylcholine-releasing vagal afferents that stimulate the L cell. The

mechanism whereby GIP activates vagal afferents remains unknown.

Second phase PGDP secretion �– luminal nutrients:

The second phase of GLP-2 secretion is likely attributable to direct contact of luminal

nutrients with the L cells. The type of nutrient is important for this second phase of

secretion.

Glucose:

PGDP secretion is significantly increased in response to enteral glucose 58, 64, 69. While most

glucose absorption occurs in the proximal intestine through specialized glucose transporters,

there is still residual glucose transport activity in the distal gut 70. However, only high

glucose concentrations have been shown to result in direct glucose-stimulated L cell

secretion ex vivo 53. L cells can directly sense glucose as demonstrated by

electrophysiological studies in GLUTag cells where glucose resulted in firing of action

potentials via closure of KATP channels 71. Glucose then stimulates GLP release via two

mechanisms. First, glucose entry via sodium-glucose cotransporters at the apical membrane

of the L cell triggers GLP-1 secretion by increasing the inward electrical Na+ current 72.

Second, the increased intracellular glucose is metabolized by glucokinase in the L-cell

leading to increased ATP and closure of KATP channels.

Protein:

Placement of fat, glucose and protein hydrosylates directly into ligated rat ileal segments

stimulated secretion of PGDP 64, 69. However, fat and glucose can cause GLP secretion when

ingested while protein cannot 73. One explanation for this could be that most protein

metabolism takes place in the proximal intestine and absorption of amino acids and di- and

tri-peptides is mediated in the jejunum by specific amino acid transporters and PEPT-1 (a di-

and tri-peptide transporter) 74-77. Nonetheless, the amino acid glutamine was shown to

stimulate GLP-1 secretion both in vitro using GLUTag cells 78, 79 as well as increase

9

circulating GLP-1 in human subjects (lean, obese non-diabetic, and obese diabetic) when

given orally 80.

Fats:

Fatty acids reach the distal intestine in high concentration and a high-fat test meal in human

subjects significantly increased circulating GLP-2 levels in a sustained manner 51. Long-

chain monounsaturated fatty acids (MUFA) are potent PGDP secretagogues 53, 81. The

intracellular mechanisms whereby fatty acids stimulate PGDP secretion are not well

understood but candidate receptors such as GPR120, GPR40, and GPR119 may mediate this

effect. Indeed, GPR119 has been detected in GLUTag, NCI-H716, and FRIC cells and

treatment of these cells with oleoylethanolamide (OEA) was shown to enhance GLP-1

secretion 82. In addition, short-chain fatty acids derived from fibre fermentation in the distal

ileum and colon are potent stimulators of GLP-2 secretion. Mice fed a high fibre diet were

found to have significantly elevated levels of proglucagon gene expression in association

with an increased gut growth 35. Others have shown that rats fed a high-fibre diet that

liberates short-chain fatty acid upon digestion in the distal gut display increased proglucagon

gene expression and enhanced GLP-1 secretion 83, 84. Therefore, luminal nutrients are potent

stimulators of PGDP secretion, both indirectly through a neuroendocrine loop and via direct

actions on the L cells.

1.2.2 Metabolism and clearance of GLP-2

GLP-2 is susceptible to rapid N-terminal degradation by the protease dipeptidyl peptidase-4

(DPP4) in humans and rats and is cleared by the kidney, resulting in a half-life of

approximately 7 minutes 85-87. DPP-4 is a cell surface protein that is expressed in the

epithelial cells of the liver, intestine and kidney and also exists as a soluble protein

sCD26/DPP4 in the circulation 88. DPP-4 cleaves a number of peptide hormones at the N-

terminus to inactivate them �– specifically, DPP-4 cleavage of GLP-2 results in removal of the

N-terminal dipeptide His-Ala to result in GLP-2 (3-33) 85, 86, 89. The metabolite GLP-2 (3-33)

has been shown to act both as an antagonist to the GLP-2R as well as a partial agonist

depending on its concentration 90, 91. Substitution of the position 2 alanine with glycine

(Gly2-GLP-2) confers DPP-4 resistance to GLP-2 85, 92. Species differences are also present

10

in the metabolism of GLP-2 by DPP-4. Rats have higher DPP-4 activity compared to mice

resulting in a significantly reduced biological response to exogenously administered GLP-2 93. Given the abundance of DPP-4 in the intestinal mucosa as well as in the circulation, the

amount of biologically active GLP-2 is determined by the balance between the amount

secreted and the amount metabolized via DPP-4.

Both GLP-2 (1-33) and GLP-2 (3-33) are subject to renal clearance as demonstrated

by increased levels of circulating GLP-2 in nephrectomised rats 87, 94 as well as patients with

chronic renal failure both before and after dialysis 95. Significant GLP-2 extraction across

the kidney of anesthetised pigs was similarly observed 96. GLP-2 is cleared by the kidney at

the same rate as glomerular filtration as detected by inulin clearance in rats. Tubular

catabolism is also thought to be involved 94. Other sites of GLP-2 clearance have been

implicated stemming from the observation that nephrectomised rats maintain a steady level

of GLP-2 clearance. These include the splanchnic bed and peripheral tissues such as the hind

limb but not the liver 96.

1.2.3. Cellular mechanisms of GLP-2 action

The GLP-2 receptor:

The actions of GLP-2 are transmitted through its receptor (GLP-2R). The GLP-2R was

cloned from rat hypothalamic and duodenum/jejunum libraries via a combination of PCR and

hybridization screening using primers/probes based on conserved motifs between GLP-

1R/glucagon receptor subfamily 97. The rat and human GLP-2R display 81.6% sequence

homology and the hGLP-2R was mapped to chromosome 17p13.3 97. The GLP-2R is a

GPCR belonging to the glucagon/secretin class B receptor family and displays a typical 7-

transmembrane topology. It contains two alternative translational initation codons at Met-1

and Met-42 97. The rGLP-2R and hGLP-2R encodes a 550 and 553 amino acid GPCR

respectively. Transient transfection of COS cells with the cloned GLP-2R and subsequent

treatment with 1nM GLP-2 resulted in a significant increase in cAMP levels. Furthermore,

the GLP-2R is highly ligand-specific as GLP-2 was the only one of the family B GPCR

ligands that caused receptor binding and activation 97. RNase protection assay for rat and

human GLP-2R revealed no alternative splice variants for these receptors.

11

The cellular localization of the GLP-2R remains controversial. GLP-2R mRNA

transcripts have been detected by Northern blot and/or PCR analysis in multiple locations

including rat, mouse and human stomach, small and large intestine 98, 99, rat hypothalamus,

brainstem, nucleus tract solitary 99-102, rat vagal afferents in the nodose ganglia, 102, rat lung 100 and in rat and human pancreatic alpha cells 103.

The localization of the GLP-2R protein has also been addressed in numerous studies.

In situ hybridization with a digoxigenin-labelled GLP-2R probe revealed the presence of the

receptor in mouse enteric neurons 104. In humans, the GLP-2R was localized to a subset of

enteroendocrine cells using immunocytochemistry with a specific GLP-2R antibody 98. Real-

time quantitative PCR was performed on total RNA extracted from laser-captured

microdissection (LCM) villus epithelium and the GLP-2R was thereby detected in porcine as

well as human enteroendocrine cells and enteric neurons 105. The GLP-2R was also detected

using immunohistochemistry with a GLP-2R antibody and in situ hybridization with a biotin-

labelled probe on subepithelial myofibroblasts in the small and large intestine of mouse, rat,

marmoset and human tissues 106. Using a polyclonal antibody raised against the N-terminus

of the rat GLP-2R, the localization of the GLP-2R was confirmed in rat enteroendocrine cells

and enteric neurons as well as localized in rat vagal afferents of the nodose ganglia 102. Thus,

the GLP-2R is not localized to crypt cells where its principal proliferative and cytoprotective

actions are known to occur and direct exposure of intestinal epithelial cells to GLP-2 in vitro

shows only modest effects on cell proliferation 107, 108. It is therefore likely that GLP-2 exerts

its actions indirectly via multiple downstream mediators.

GLP-2R signalling:

Understanding the signalling pathways downstream of GLP-2R has been hindered by lack of

available cell lines endogenously expressing the GLP-2R. Indeed, most of the studies aiming

to delineate GLP-2R signalling pathways have employed transfected cell lines. Similar to

other GPCR Class B receptors, GLP-2R activation results in dose-dependent activation of

cAMP. This has been demonstrated in BHK-GLP2R transfected cells 90, 100, 107, COS-GLP-

2R cells 97, DLD-1-GLP2R cells 109, HeLa cells 110, cultured rat astrocytes 108, isolated rat

small intestinal mucosal cells 111, rat hippocampal and brainstem preparations 112, human

intestinal epithelial cell line FHC cells (CRL-1831) 113, isolated muscle strips 114, tissue

12

extracts from hypothalamus and pituitary 115 as well as in in vivo models such as the TPN-fed

piglet 116. Of particular interest are the HeLa cells 113 as they endogenously express the GLP-

2R.

Studies in BHK cells transfected with the GLP-2R have shown that GLP-2 activates

PKA- and AP-1-dependent pathways in vitro and can stimulate the induction of immediate

early genes at high doses 107. The cytoprotective effects of GLP-2 in the murine intestine are

associated with inhibition of caspase-3, 9, 8- dependent pathways 100, 117. In HeLa cells

transfected with the GLP-2R, GLP-2 caused a significant increase in ERK1/2

phosphorylation and its downstream effector Elk-1 independent of cAMP accumulation or

EGFR transactivation. MEK but not PKA or PI3-K mediated GLP-2 activation of ERK1/2 110. Increased proliferation in HeLa cells following GLP-2 treatment was mediated by

Ras/Raf/ERK1/2 whereas the cytoprotective effects of GLP-2 in this model was ERK1/2

independent but PKA-mediated 110. Therefore, different signalling mechanisms may be

responsible for transducing the differential effects of GLP-2 on survival vs. proliferation.

Interestingly, many downstream signals of GLP-2 action are seen before the morphological

changes are observed at the level of the crypt and the villus. GLP-2 infusion in TPN-fed

piglets resulted in ERK1/2 and PKA phosphorylation and c-fos induction was observed in

small intestinal sections as early as one hour after GLP-2 infusion. GLP-2 also inhibited

apoptosis in this model by increasing the abundance of Bcl-2 and two other proteins, XIAP

and cIAP, known to inhibit caspase-3 116. GLP-2 has also been shown to increase Akt

phosphorylation in jejunum of TPN-fed piglets 118 and mice 119, 120.

GLP-2R desensitization has been described in a number of in vitro models. The

cAMP response (increase in cAMP following GLP-2 treatment) is significantly reduced in

cultured rat intestinal mucosal cells pre-treated with GLP-2 111. Pre-treatment of DLD-1-

GLP-2R cells with GLP-2 significantly reduced cAMP concentrations in response to

subsequent GLP-2 treatment and required a 2 hour recovery period 109. Desensitization of

the GLP-2R in this model was attributable to rapid dose and time-dependent internalization

as observed by disappearance of the receptor from the cell surface and was not due to

increased degradation of the GLP-2R. Unlike other GPCRs of the same family, GLP-2R

internalization was not the result of endocytosis via clathrin-coated pits but rather required

caveolin-1 lipid-rafts 109. The C-terminus of the GLP-2R was shown to be essential for cell

13

surface expression and heterologous desensitization by PKA 121. The importance of GLP-2R

desensitization in vivo is poorly understood. Long-term treatment of mice with native GLP-

2(1-33) (12 weeks, 3.9 µg/day, subcutaneously) 122 as well as high dose treatment with native

GLP-2(1-33) (43.75 µg twice a day) 123 resulted in increased intestinal growth, suggesting

that GLP-2R desensitization in vivo may not be as evident as described in in vitro studies.

Nevertheless, evidence from Phase III clinical trials in patients with short bowel syndrome

suggest that lower doses of teduglutide, a DPP-4 resistant GLP-2 analogue, at 0.05mg/kg/day

are more potent than the higher dose of 0.1mg/kg/day: 46% of patients in the lower dose

cohort saw disease improvement (e.g. reduced parenteral nutrition) vs. 25% of patients in the

higher dose cohort 124. The lower incidence of disease improvement with the higher dose of

GLP-2 may be due to receptor desensitization. Furthermore, the difference between receptor

desensitization in the mouse vs. human studies could be attributed to the different GLP-2

molecule used. Enhanced stimulation of the GLP-2R by the degradation resistant h[Gly2]-

GLP-2 may lead to receptor desensitization not observed with the native peptide. Indeed,

FRIC cultures treated with h[Gly2]-GLP-2 were shown to have increased cAMP

concentration at lower doses of h[Gly2]-GLP-2 (1nM) compared to higher doses (10 and 100

nM) 125.

1.2.4. Biological actions of GLP-2

Discovery of GLP-2

In 1971, a clinical report was published about a patient with a glucagon-secreting tumour on

her kidney that was also associated with intestinal dysfunction such as decreased motility as

well as villus hyperplasia evident from a small intestinal biopsy. Following a nephrectomy,

the abnormalities were reversed 126. Two more cases of glucagon-producing tumours

associated with intestinal hyperplasia were reported in the next decade 127, 128, leading to

speculation that glucagon-like immunoreactive (GLI) enteroglucagon was responsible for

this phenotype. In 1996, GLP-2 was identified as the proglucagon-derived peptide with

trophic actions on the gut. Nude mice carrying subcutaneous proglucagon-producing

tumours displayed small intestinal hyperplasia associated with increased mucosal cell

proliferation. Subsequent subcutaneous injection of the different peptide products of the

14

proglucagon gene (including GLP-1, GLP-2, glicentin, and intervening peptide-2) identified

GLP-2 as the PGDP with intestinotropic properties 123.

GLP-2 action in healthy adult animal models

Intestinal growth:

GLP-2 is a growth factor for the small and large intestine. The trophic effects of GLP-2 are

most pronounced in the mid small intestine and least pronounced in the colon in association

with decreased GLP-2R distribution from mid to distal intestine 97, 98. In healthy adult animal

models, GLP-2 significantly increases small intestinal weight, villus height and crypt depth

and to lesser extent colon weight and crypt depth (Table 1).

GLP-2 exerts its growth-enhancing actions on the intestinal epithelium by increasing

proliferation and decreasing apoptosis. In animal models, GLP-2 treatment has been shown

to significantly increase crypt cell proliferation as demonstrated by increased incidence of

Ki-67 114, BrdU 123, 129-131 or PCNA positive cells 122, 123, 132-135. Increased proliferation of

epithelial cells results in longer villi and deeper crypts. Further evidence for GLP-2�’s effect

on bowel hyperplasia stem from observations of increased intestinal DNA content 136-138.

The mechanisms whereby GLP-2 increases crypt cell proliferation are poorly understood. In

an elegant study by Bjerknes and Cheng, GLP-2 was shown to preferentially increase the

number of stem cells and enterocytes rather than mucous cells 104. GLP-2 also increased the

number of Musashi-1 positive cells as well as increased Musashi-1 RNA and protein

expression in intestinal epithelium of healthy mice 125. Increasing the number of progenitor

stem cells in the intestinal epithelium may be one of the mechanisms whereby GLP-2

increases proliferation. While GLP-2 can result in bowel hyperplasia evidenced by

increased proliferation and DNA content, it may also lead to epithelial cell hypertrophy.

Indeed, GLP-2 treatment of healthy rodent models has been shown to increase protein

content of intestinal sections 136-139. In addition, GLP-2 can increase microvillus length.

Mice treated with h[Gly2]-GLP-2 for 10 days (5 µg) exhibited longer and narrower

microvilli compared to saline treated controls. Supplementation of TPN with native GLP-2

(20 µg/kg BW/ day) in rats with intestinal resection resulted in increased microvillus height,

surface area and cell density but not cell width compared to rats receiving TPN alone 140.

15

GLP-2 is also able to decrease apoptosis in the crypts as observed by decreased

incidence of caspase-3 114, 141 or TUNEL 122, 132, 133 positive cells, although the cytoprotective

effects of GLP-2 are more evident in the setting of intestinal injury (e.g. inhibition of

apoptosis in experimental models of murine colitis or chemotherapy-induced enteritis).

Nevertheless, several studies have described a dose-dependent effect of GLP-2 on

stimulation of proliferation vs. inhibition of apoptosis. In TPN-fed piglets, infusing

2.5nmol/kg/day of GLP-2 resulted in a circulating GLP-2 concentration of approximately

166 pM 118, which mimics post-prandial circulating GLP-2 levels in enterally fed piglets (50-

100 pM) 142, 143. A high dose infusion of GLP-2 (10nmol/kg/day) resulted in significantly

elevated levels of circulating GLP-2 (~650 pM). The low dose GLP-2 infusion was

associated with promotion of cell survival (as observed by decreased caspase-3 and 6

activities) whereas only the high dose GLP-2 infusion was linked to increased proliferation

of jejunal epithelial cells (higher incidence of BrdU+ cells) 118. A dose-dependent effect of

GLP-2 has also been described in mice where administration of rat GLP-2(1-33) ranging

from 0.25-5 g (sc bid, 14 days) resulted in an incremental increase in small intestinal growth

and crypt + villus height with maximal effects observed in the jejunum 144.

16

Table 1.1. Intestinotrophic effects of GLP-2 in healthy adult animal models. SC: subcutaneous, IP: intraperitoneal, IM: intramuscular, TPN: total parenteral nutrition. * indicates the GLP-2 molecule used was not specified in publication. Target

GLP-2 action molecule Route Animal Model

native GLP-2(1-33)

TPN

SC

SC

IP IM

TPN rats 136, 145-147, 131* rats93, 137 mice93, 122, 123, 132, 134,

139, 144, 148, 149 mice144 mice144

SI weight

increased

h[Gly2]-GLP-2

SC SC

rats 85 mice114, 133, 134, 149, 150

increased

native GLP-2(1-33)

TPN SC SC

TPN rats145 rats93 mice122

SI length

increased no change

h[Gly2]-GLP-2

SC SC

mice93, 150 mice132, 133

SI DNA content

increased native GLP-2(1-33) TPN SC

minipump SC

TPN rats 136 rats137 rats138 mice139

SI protein content

increased native GLP-2(1-33) TPN SC

minipump SC

TPN rats 136 rats137 rats138 mice139

native GLP-2(1-33)

TPN

SC

SC

IP IM

TPN rats145, 147, 131* rats93, 129, 137 mice93, 122, 123, 144 mice144 mice144

SI crypt depth

increased

h[Gly2]-GLP-2

SC SC

rats 85, 129 mice114, 132, 133

17

native GLP-2(1-33)

TPN

SC

SC

IP IM

TPN rats 136, 145, 147, 131* rats 93, 137 mice93, 122, 123, 139, 144,

149 mice144 mice144

SI villus height

increased

h[Gly2]-GLP-2

SC SC

rats 85, 129 mice114, 132, 133, 149

muscularis growth

no change native GLP-2(1-33) SC mice114, 122

stem cell population

increased h[Gly2]-GLP-2 SC mice104

no change

native GLP-2(1-33)

TPN SC

TPN rats 136, 145-147 mice139

LI weight

increased

h[Gly2]-GLP-2

SC

mice132, 134, 150

LI length increased no change

native GLP-2(1-33) h[Gly2]-GLP-2

SC TPN

mice132, 150 TPN rats145

LI DNA content

no change native GLP-2(1-33)

TPN SC

TPN rats 136 mice139

LI protein content

no change native GLP-2(1-33)

TPN SC

TPN rats 136 mice139

increased

native GLP-2(1-33)

SC

mice132, 150

LI crypt depth

no change

h[Gly2]-GLP-2

TPN TPN rats147

18

Intestinal nutrient absorption:

One of the well described roles of GLP-2 is enhancement of intestinal nutrient absorption in

animal models and humans during health and disease (Table 2). The most rapid effect of

GLP-2 is increasing intestinal hexose transport. Vascular infusion of GLP-2 in anesthetised

rats increased jejunum glucose transport rate by increasing the abundance of SGLT-1 protein

at the brush border membrane 151 as well as increasing the abundance of GLUT2 at the

basolateral membrane 152, 153. Therefore GLP-2 promotes maximal hexose transport by

promoting transport activity both into the enterocyte at the brush border membrane and

subsequently into the circulation at the basolateral membrane. Such rapid changes at the

level of the enterocyte are also reflected in parameters such as circulating glucose levels and

glucose flux in vivo. In TPN-fed piglets, GLP-2 resulted in increased arterial and portal

glucose and galactose concentrations, whole body glucose flux 154, as well as overall increase

of glucose absorptive capacity along the small intestine 155.

Absorption of other nutrients such as lipids and amino acids are also enhanced by

GLP-2 treatment. In mice, administration of GLP-2 for 10 days enhanced plasma appearance

of leucine following a duodenal nutrient load 148. In pre-term piglets, vascular GLP-2

infusion increased lysine absorption in intact tissue prepared from the small intestine 156.

Other studies have verified the ability of GLP-2 to enhance amino acid absorption in rats 138

and TPN-fed piglets 155, 157 (Table 2). GLP-2 also acutely increases lipid absorption in mice,

hamsters, and humans. Hamsters and mice treated with GLP-2 exhibited significantly

increased plasma appearance of lipids, increased apoB48 secretion, as well as increased

plasma triglyceride and cholesterol concentrations following an oral fat load 158. Elegant in

vivo biotinylation studies on isolated jejunal enterocytes revealed that CD36 glycosylation

was significantly increased following acute GLP-2 treatment. Furthermore, CD36 was

shown to be essential for GLP-2-mediated increase in lipid absorption as such GLP-2 effects

were lost in Cd36-/- mice 158. The ability of GLP-2 to enhance lipid absorption has also been

demonstrated in studies with healthy human volunteers where acute intravenous GLP-2

infusion (2 pmol/kg/min) significantly increased postprandial plasma appearance of free fatty

acids and triglycerides 159.

GLP-2 may increase activity and/or expression of digestive enzymes. Treatment of

mice with GLP-2 for 10 days resulted in an increase in brush-border disaccharidase and

19

peptidase activity, and enhanced fat and amino acid transport ability 148. GLP-2 treatment

also increased sucrase-isomaltase activity in sham-operated and resected rats (21d regimen) 137 as well as in TPN-fed rats (7d regimen) 145. The caveat to these observations is that

increased digestive enzyme activity has only been reported following chronic GLP-2

treatment and therefore may be simply a result of increased intestinal wet weight. Indeed,

normalization of enzyme activity to protein content reveals no GLP-2 effect on digestive

enzyme activity 148.

GLP-2 may also increase intestinal nutrient absorption via other indirect

mechanisms. GLP-2 has been shown to increase blood flow to the proximal intestine, where

GLP-2�’s trophic actions are maximal 105, 157, 160-163. This increased blood flow may facilitate

mucosal growth and proliferation by maximizing nutrient delivery to the gut.

20

Table 1.2. GLP-2 effects on intestinal nutrient absorption. SC: subcutaneous, TPN: total parenteral nutrition, VI: vascular infusion, MP: minipump. Target

GLP-2 action molecule Route Animal Model

Digestive enzymes

enzyme activity native GLP-2(1-33) SC SC

TPN

mice148 rats137, 145 rats145

GLUT2, SGLT1

galactose absorption

glucose transport rate

glucose absorption

native GLP-2(1-33)

SC VI

MP

VI

TPN TPN

mice148 rats151, 153 rats138 rats151-153, 164 resected rats140 piglets157

fructose absorption

glucose absorption

galactose absorption

SGLT-1 protein

GLUT5 protein

glucose absorption

GLP-2 (not specified)

SC

SC

TPN

TPN

TPN

TPN

VI

postweanling rats135,

165, suckling rats165-167, weanling rats 167 piglets154, 155 piglets154 rats131, 140 rats140 preterm pigs156

Hexose absorption

SGLT1 abundance hGly2-GLP-2 SC rats129

triolein absorption

lipid absorption, chylomicron production

lipid absorption

native GLP-2(1-33)

SC

IP

IV

mice148 hamster158 healthy humans159

Lipid absorption

lipid absorption

h[Gly2]-GLP-2 IV mice158

21

leucine absorption glycine absorption

lysine absorption indispensible aa

absorption

native GLP-2(1-33)

SC MP

TPN

mice148 rats138 piglets157

Amino acid absorption

lysine absorption

leucine, proline absorption

leucine, proline absorption

GLP-2 (not specified)

VI

TPN

TPN

preterm pigs156 piglets155 piglets155 preterm pigs156

22

GLP-2 action in experimental models of disease

Total parenteral nutrition (TPN): TPN replaces enteral feeding in a number of disease

models or following major trauma 168. In animal models of TPN, significant intestinal

atrophy is observed, including decreased mucosal weight, increased intestinal permeability,

as well as increased bacterial translocation 169-172. Prolonged TPN feeding in humans has

also been associated with bowel hypoplasia 173. Loss of mucosal mass and function during

TPN feeding may be due to lack of release of nutrient-stimulated hormones such as GLP-2.

Indeed, exogenous GLP-2 administration has been shown to ameliorate TPN-induced

mucosal atrophy.

In rats, co-infusion of GLP-2 with TPN resulted in prevention of decreased mucosal

mass, DNA and protein content 73, 136. Circulating levels of endogenous GLP-2 were found

to be increased in rats on TPN following 70% midjejunoileal resection 174, suggesting an

adaptive mechanism may be in place to increase intestinal function by upregulation of gut

growth factors. Furthermore, exogenous GLP-2 administration to rats maintained on TPN

following 90% small intestinal resection improved nutrient absorption, intestinal

permeability, and gut growth 175. In piglets, GLP-2 infusion resulted in stimulation of

intestinal growth by suppressing proteolysis as well as apoptosis 143 and also increased the

activity of digestive enzymes involved in hexose and lactose metabolism but not to the same

extent as enteral nutrition 155, 156, 176. The improvement of intestinal function and digestive

capacities (e.g. prevention of gut hypoplasia, increased glucose absorption) resulting from

GLP-2 treatment eased the transition from TPN to enteral feeding in the piglet 154.

In addition to preventing TPN-induced bowel hypoplasia, GLP-2 has also been shown

to improve nutrient absorption in this setting. In TPN-fed piglets, GLP-2 infusion

(500pmol/kg/hour, 4hours) significantly enhanced portal drained-visceral glucose and

essential amino acid uptake in a nitric oxide-dependent manner 157. Nutrient absorptive

capacity (glucose, proline, leucine, and lysine) was also significantly improved in GLP-

2+TPN-fed (12.5 nmol/kg/day, 6 days) piglets compared to TPN-fed piglets 155. In contrast

to these observations, at least one study has demonstrated decreased expression of amino acid

transporters in response to GLP-2 in TPN-fed rats 172. The discrepancy between these

observations could be attributable to continuous infusion vs. single bolus GLP-2 treatment,

23

acute vs. chronic treatment, and/or species differences. While TPN feeding maintains overall

nutritional status, the enterocytes increase amino acid absorptive capacity for their own use.

Thus, by decreasing proteolysis in mucosal cells 157, GLP-2 may reduce the requirement for

increased amino acid uptake by these cells. Therefore, GLP-2 can significantly enhance

positive energy balance in animal models of TPN.

Enteritis: GLP-2 has been shown to improve intestinal function in several experimental

models of enteritis. In mice, enteritis induced by the nonsteroidal anti-inflammatory drug

(NSAID) indomethacin was significantly reduced by administration of GLP-2 (2.5 g bid) 133. GLP-2 improved survival of mice when administered before, during or after induction of

intestinal injury using indomethacin and also reduced disease activity index and bacterial

translocation 133. In rats, induction of enteritis by the chemotherapeutic agent 5-fluorouracil

(5-FU) resulted in severe body weight and intestinal weight loss. Administration of GLP-2

after but not before initiation of chemotherapy improved intestinal wet weight and

crypt+villus height 177, 178. GLP-2 also significantly suppressed mucosal ulceration and

thickening of the intestinal wall following radiation-induced enteritis in rats 179. Enteritis

induced by 2,4,6-trinitrobenzene sulphonic acid (TNBS) in rats was also significantly

improved when GLP-2 was administered during or after the commencement of ileitis (50

g/kg bid) 141. In this model, the effects were more pronounced when GLP-2 was

administered 2 days following ileitis induction rather than immediately following. This

observation suggests that GLP-2 has maximal anti-inflammatory effects when the tissue is

most inflamed. Others have shown that the number of GLP-2 immunoreactive cells

increased in the colon but not ileum of guinea pigs with TNBS-induced ileitis 180, 181. The

descriptive nature of such observations prevents categorical conclusions about GLP-2�’s

effects in TNBS ileitis. Nevertheless, the colon may compensate for a decrease in GLP-2

immunopositive cells in the ileum by increasing GLP-2 immunoreactive cells in the colon

and evidence from studies where pharmacological administration of GLP-2 significantly

improved enteritis suggest that GLP-2 can improve positive energy balance in experimental

models of enteritis.

24

Colitis: In multiple animal models of inflammatory bowel disease, GLP-2 reduced

inflammation. In a mouse model of dextran sulphate (DSS)-induced colitis, GLP-2 (750ng

bid) administration was associated with increased colonic wet weight and crypt depth,

decreased body weight loss and reduced inflammatory response via downregulation of

cytokine expression in the colonic mucosa 132. In rats, GLP-2 (50 g/kg bid, 3 days)

treatment was linked to significantly improved DSS-induced colitis stemming from

observations of increased mucosal wet weight, increased colonic crypt cell proliferation, and

reduced myeloperoxidase (MPO) activity and levels of inflammatory cytokines (IL-10, TNF-

) 141. When colitis was induced by intrarectal TNBS administration, GLP-2 treatment was

associated with improved colonic inflammation score, increased colonic crypt depth, reduced

colonic crypt cell apoptosis, and suppressed cytokine induction (IL-10, IL-1 , IFN- , TNF- ) 141. In these models, GLP-2 treatment improved colitis once inflammation had already been

initiated.

Several studies have attempted to delineate the effects of non-pharmacological levels

of GLP-2 in improving colitis, though significant limitations in the nature of these studies

prevent conclusive statements about the role of endogenous GLP-2. In a mouse model of

colitis where CD4+ T cells from Balb/c mice were transferred to large intestine of SCID

mice, the total amount of colonic immunoreactive GLP-2 was found to be significantly

decreased compared to non-inflamed controls 182. A number of studies have also addressed

the effects of DPP-4 activity in experimental models of colitis. Dpp4-/- mice displayed no

protective effects to DSS-colitis 183 but chemical inhibition of DPP-4 ameliorated histological

parameters in mice with DSS-induced colitis compared to untreated controls 184. In humans

with inflammatory bowel disease (IBD), circulating levels of total GLP-2 as well as the

proportion of active GLP-2 (1-33) relative to the degradation product GLP-2 (3-33) were

significantly increased compared to control subjects with no IBD 185. Activity of DPP-4 was

also reduced in patients with both Crohn�’s disease and ulcerative colitis 185. Tissue (ileum

and colon) levels of GLP-2 was not different between IBD patients and control subjects 186.

Lack of reagents to study endogenous GLP-2 effects, by either chemical or genetic ablation,

makes interpretation of these observations in the context of GLP-2 physiology unfeasible. In

light of the interest in GLP-2 as a therapeutic for the treatment of IBD 124, future studies

using immunoneutralizing GLP-2 antisera, chemical antagonism of the GLP-2R or mice with

25

targeted deletion of the Glp2r should be fostered in order to delineate the role of endogenous

GLP-2 in improving colitis.

Short bowel syndrome (SBS): Given the potent intestinotropic effects of GLP-2, its

potential as a therapy for SBS patients has been explored. Several studies have reported

changes in circulating GLP-2 in patients with SBS. In ileal resected short-bowel patients, an

impairment in meal-stimulated GLP-2 secretion was observed 187. Patients who had

undergone an ileal resection with a preserved colon had elevated circulating levels of fasting

and post-prandial GLP-1 and GLP-2 188. On the other hand, SBS patients with no colon

exhibited a defective post-prandial GLP-2 response. In these patients, a 35 day treatment

regimen with GLP-2(1-33) (400 g/day bid), increased circulating GLP-2 levels, improved

carbohydrate and protein absorption from the intestine, delayed gastric emptying and

increased crypt+villus height 189. In a similar study, a 21 day treatment with teduglutide, a

DPP-4-resistant GLP-2 analogue, in patients with SBS significantly reduced faecal wet

weight and increased wet weight absorption 173. Intestinal biopsies from these patients

revealed increased crypt+villus height following teduglutide treatment.

GLP-2 promotes positive energy balance in animal models of SBS. In rat models of

intestinal resection, increases in body weight, wet intestinal weight and nutrient absorption

were correlated with elevated systemic GLP-2 levels 190. GLP-2 administration to rats on

TPN following 60-80% jejunoileal resection resulted in improved nutrient absorption,

increased body weight, intestinal wet weight and crypt cell proliferation 140, 175, 191.

Experimental SBS models involve intestinal resection with remnant ileum; nevertheless at

least one study has examined intestinal adaptation using remnant jejunum rather than ileum.

In this model, GLP-2 supplementation of TPN was linked to decreased intestinal

permeability, increased glucose absorption, increased intestinal weight, crypt+villus height

and crypt cell proliferation. No changes in the number of caspase-3 positive cells nor SGLT-

1 and GLUT5 protein levels were observed 140. For details, please refer to Table 1.3.

26

Table 1.3. Effects of GLP-2 in experimental models of animal disease. * indicates where GLP-2 molecule used was not specified.

Disease Model

GLP-2 effect molecule Route Animal Model

SI & LI weight, length DNA & protein content crypt + villus height digestive enzyme activity BW and barrier function

native GLP-2(1-33) TPN TPN rats 136, 145-

147, 131*

TPN

SI & LI weight, length DNA & protein content crypt + villus height

blood flow to the

intestine nutrient absorption

native GLP-2(1-33)

native GLP-2(1-33)

TPN

TPN

piglets118, 143 piglets157, 160

mortality, lesions SI weight, length proliferation, apoptosis cytokine induction,

bacteremia

h[Gly2]-GLP-2 SC mice133 (NSAID)

BW weight SI weight, length

h[Gly2]-GLP-2 SC rats177 (5-FU)

mucosal ulcerations thickening of intestinal

wall intestinal wet weight

h[Gly2]-GLP-2 SC rats179 (radiation)

Enteritis

BW weight mucosal inflammation cytokine induction neutrophil infiltration

native GLP-2(1-33) SC rats141 (TNBS)

BW weight SI & LI weight jej crypt+villus height colonic crypt depth

h[Gly2]-GLP-2

SC mice132 (DSS)

BW weight colonic crypt depth colonic cell proliferation neutrophil infiltration

native GLP-2(1-33) SC

rats141 (DSS)

Colitis

colonic crypt depth colonic cell proliferation neutrophil infiltration

native GLP-2(1-33) SC

rats141 (TNBS)

27

BW weight SI weight crypt+villus height crypt cell proliferation glucose absorption permeability

native GLP-2(1-33)

TPN rats140 (80% distal intestinal resection)

BW weight SI weight villus height crypt cell proliferation permeability

native GLP-2(1-33)

TPN rats175 (80% distal intestinal resection)

Short bowel syndrome

BW weight SI weight DNA, protein content crypt+villus height SI sucrase activity

GLP-2 (not specified)

TPN rats191 (60% jejunoileal resection)

SI tissue ion conductance paracellular permeability transcellular permeability

h[Gly2]-GLP-2 OR

native GLP-2(1-33)

SC mice149

SI tissue resistance bacterial translocation

h[Gly2]-GLP-2

SC

rats192 (pancreatitis)

ion secretion in response to antigen

paracellular permeability inflammatory cells

h[Gly2]-GLP-2

SC mice193 (food allergy)

Intestinal permeability

SI, LI tissue conductance transcellular permeability SI bacterial penetration inflammatory cells

h[Gly2]-GLP-2

SC mice194 (stress)

nutrient absorption DNA content

h[Gly2]-GLP-2

osmotic pump

rats195

protein, DNA content

h[Gly2]-GLP-2

osmotic pump

rats196

intestinal damage score MLN bacteria count endotoxin, IL-6, TNF-

GLP-2 (not specified)

IP rats197

Ischemia / Reperfusion

intestinal damage score MLN bacteria count

GLP-2 (not specified)

IP mice198

28

Intestinal Permeability: GLP-2 has been shown to modulate intestinal barrier function

under basal conditions as well as in several disease models. Treatment of mice with GLP-2

(5 g) for 10 days resulted in a decrease in intestinal conductance as well as a reduction in

transport of 51Cr-EDTA and HRP, markers of paracellular and transcellular permeability

respectively 149. Acute pancreatitis provides an experimental model to study intestinal

permeability as it is associated with decreased barrier function and increased bacterial

translocation. Administration of GLP-2 for 3 days following onset of acute pancreatitis in

rats resulted in improvement of intestinal barrier function by decreasing ileal transepithelial

resistance and bacterial translocation 192.

Food allergy provides another experimental model for studying intestinal

permeability. Immediate hypersensitivity was studied in jejunum tissues from mice treated

acutely with h[Gly2]-GLP-2 (4 hours, 5 g) and measuring ion secretion and macromolecule

uptake in response to challenge with the HRP antigen in Ussing chambers. In this setting,

GLP-2 decreased ion secretion in response to antigen challenge and reduced transepithelial

uptake of HRP 193. Late phase reaction was also studied. Following 4 hour treatment with

GLP-2, mice were gavaged with HRP sensitizing antigen. Ussing chamber studies were

carried out as described above. Sensitizing mice with the antigen decreased jejunal

permeability as assessed by 51Cr-EDTA flux, increased number of eosinophils and

mononuclear cells as well as HRP flux. Treatment with GLP-2 was linked with significant

improvement of all of these parameters 193, suggesting that exogenous GLP-2 administration

can improve the mucosal barrier function in mice in the setting of food allergy.

GLP-2 also reduced the impairment of intestinal barrier function associated with

stress in mice. Mice exposed to water avoidance stress displayed increased intestinal tissue

conductance, macromolecule uptake and intestinal bacterial penetration; these changes were

significantly decreased when GLP-2 was given prior to the stress test 194. Type 1 diabetes is

also associated with increased intestinal permeability 199-203. While acute GLP-2 treatment

decreased transepithelial permeability in the non-obese diabetic (NOD) mouse, a mouse

model of type 1 diabetes, chronic treatment (14 days, 5 g) failed to stop the onset of

diabetes 204. No basal differences were observed in paracellular permeability (as measured

by FITC-dextran flux) between NOD mice and controls. This suggests that while GLP-2

may acutely decrease gut permeability, impaired intestinal barrier function may not be the

29

principal cause of diabetes onset in this mouse model. Obesity is another disease model

associated with decreased barrier function in the intestine 205-208. The ob/ob mouse displays

significantly increased intestinal permeability 205, which is exacerbated under a high fat diet 206. Chronic treatment with GLP-2(1-33) (25 g, bid) decreased intestinal permeability in the

ob/ob mouse, as assessed by an in vivo FITC-dextran oral gavage and FITC recovery in

plasma 209. Furthermore, a prebiotic diet was also able to improve intestinal barrier function

in the ob/ob mouse which was linked to increased intestinal proglucagon mRNA expression

as well as elevated circulating GLP-2 levels. To establish causative GLP-2 effects on

improving gut barrier function, ob/ob mice were treated with the GLP-2R antagonist, GLP-

2(3-33). Administration of GLP-2(3-33) prevented the prebiotic-induced improvement in gut

barrier function 209, suggesting that beneficial effects of a prebiotic-diet on improving

intestinal permeability are mediated by endogenous GLP-2 actions. The mechanisms

whereby GLP-2 alters intestinal permeability are not fully understood. Nevertheless,

regulation of tight junction integrity may be involved as observed by increased mRNA

expression and higher cellular localization of the tight junction proteins ZO-1 and occludin-1

at the apical border of enterocytes in the prebiotic diet fed-ob/ob mouse 206.

Ischemia/reperfusion: Several studies have linked GLP-2 treatment with beneficial effects

in the setting of ischemia/reperfusion. Rats underwent occlusion of the superior mesenteric

artery (SMA) for 40 minutes using a double-looped ligature followed by systemic infusion of

either GLP-2 or saline. GLP-2 infusion was linked with an increase in the only two

parameters measured in this study: DNA and protein content 196. Pre-treatment of rats with

GLP-2 for 3 days prior to undergoing a 60 min occlusion of the SMA followed by 120 min

reperfusion was associated with decreased serum endotoxin and intestinal TNF- and IL-6

levels and decreased bacterial translocation 197. Continuation of treatment following the I/R

was linked to further improvement compared to mice receiving GLP-2 pre-treatment only 197.

In mice, pretreatment with GLP-2 before exposure to ischemia (30 min)/reperfusion (1 hr)

injury improved crypt+villus height, intestinal damage score, decreased bacterial

translocation and increased expression of uncoupling protein 2 (UCP2) 198. Therefore, GLP-

2 treatment may improve intestinal recovery in the setting of I/R.

30

Extra-intestinal actions of GLP-2

Brain: The glucagon-like peptides are produced in the caudal brainstem and hypothalamus 1,

7, 210. The GLP-2R has been localized in different regions of the central nervous system using

RT-PCR and in-situ hybridization techniques. The GLP-2R has been cloned from

hypothalamic cDNA libraries and has been shown to be expressed in the brain

(hypothalamus, brainstem, nucleus tract solitary, hippocampus) 97, 98, 112. In rat hypothalamic

and pituitary membranes, GLP-2 activated adenylate cyclase 115. GLP-2 immunoreactive

fibers are known to project from the brainstem to the hypothalamus, thalamus, cortex and

pituitary 7, 101. A GLP-2R-LacZ transgene directed -galactosidase staining to multiple CNS

regions including cerebellum, amygdala, hippocampus, and dentate gyrus 99.

Given the localization of GLP-2 positive fibres and GLP-2R in the hypothalamus, its

role in the regulation of food intake was explored. ICV administration of 10 g GLP-2(1-33)

in rats inhibited food intake through a GLP-1R mediated pathway, as administration of the

GLP-1R antagonist exendin(9-39) abrogated the anorectic effects of GLP-2 101. In mice, ICV

administration of 50 g h[Gly2]-GLP-2 also inhibited food intake; however, chemical

inhibition of the GLP-1R using exendin(9-39) and genetic ablation of the GLP-1R (Glp1r-/-)

did not block the anorectic effects of GLP-2 in this model 99. Therefore, the mechanism of

action of GLP-2 on satiety may be species-dependent. In humans, peripheral GLP-2

administration had no effects on food intake 189, 211, 212. Finally, GLP-2 may have a

cytoprotective role in the CNS. In cultured hyppocampal cells, GLP-2 protected against

glutamate-induced apoptosis in a PKA-dependent manner 112.

Bone: A five week GLP-2 treatment regimen in patients with small intestinal resection and

no colon resulted in significant improvements in spinal bone mineral density and increase in

intestinal calcium uptake 213. In postmenopausal women, a single subcutaneous injection of

GLP-2 in the morning resulted in decreased bone resorption with no changes in bone

formation 214 while injection in the evening resulted in a dose-dependent decrease in bone

resorption and increased bone formation, as observed by decreased serum CTX and increased

serum osteocalcin levels following GLP-2 treatment 215. The cellular mechanisms underlying

31

changes in bone formation are yet unknown but likely involve indirect regulation by GLP-2

as the GLP-2R is not expressed in bone 216.

Endogenous GLP-2 action:

To date, most of the known biological actions of GLP-2 stem from pharmacological studies

where exogenous GLP-2 administration has been used to study the peptide�’s function in vivo

and in vitro. Recent evidence suggests that the growth-enhancing actions of GLP-2,

increasing mucosal cell proliferation vs. inhibiting cell death, are dose-dependent in TPN-fed

piglets: at physiological circulating levels, GLP-2 enhances cell survival by inhibiting

caspase-3 activity whereas at pharmacological concentrations, GLP-2 stimulates cell

proliferation and protein synthesis 116. Studies of endogenous GLP-2 action have been

carried out using immunoneutralization of circulating GLP-2 or the use of a GLP-2R

antagonist. Immunoneutralization of circulating plasma GLP-2 was shown to reduce the

intestinal bowel hyperplasia associated with experimental diabetes in rats, thus suggesting a

role for endogenous GLP-2 in intestinal adaptation 217. The GLP-2 metabolite, GLP-2(3-33)

has also been used as an antagonist for studies of endogenous GLP-2 action. GLP-2(3-33)

was shown to block the intestinal adaptive response to re-feeding after a 24 hour fast in mice.

Small bowel weight, crypt + villus height, and crypt cell proliferation rates all increased in

response to re-feeding but administration of GLP-2(3-33) attenuated this adaptive response 91. Studies of endogenous GLP-2 action in the gut highlight the importance of the peptide in

the context of intestinal adaptation; however, significant limitations are associated with

previous experimental approaches. Immunoneutralization only partially antagonizes

circulating GLP-2 and is not feasible for use in chronic studies of endogenous GLP-2 action

while the GLP-2 metabolite, GLP-2(3-33) is a weak antagonist and has been shown to act as

a partial agonist depending on the dosage used 90, 91.

Mediators of GLP-2 action in the intestine:

The GLP-2R is not present on intestinal crypt cells yet the proliferative and anti-apoptotic

actions of GLP-2 on these cells are well described. It has therefore been postulated that

GLP-2 exerts its actions indirectly via activation of multiple downstream mediators. No

single �“master-regulator�” of GLP-2 action in the intestine has been identified to date. Rather,

32

a number of different molecules and growth factors have been shown to mediate the diverse

actions of GLP-2 along the intestine and in different disease models. Keratinocyte growth

factor (KGF) has been implicated as a potential mediator of GLP-2�’s intestinotropic actions

in the colon 106 and insulin-like growth factor-1 (IGF-1) has been implicated as mediating

intestinotropic actions of GLP-2 in the small and large intestine 119, 125. GLP-2 receptors

were co-localized with KGF on subepithelial myofibroblasts in the rat, mouse, marmoset and

human small intestine. Treatment of mice with GLP-2 for 10 days resulted in increased

small and large intestinal weight whereas treatment with GLP-2 + KGF monoclonal

antibodies blocked the trophic actions of GLP-2 on the colon 106. These observations suggest

that KGF is an essential mediator of GLP-2�’s effect on colonic growth.

In the small intestine, IGF-1 has been shown to be essential for mediating GLP-2�’s

intestinotrophic actions. Treatment of FRIC cultures with h[Gly2]-GLP-2 (1-100 nM)

increased IGF-1 mRNA expression while treatment with a GLP-2 neutralizing antibody

reduced IGF-1 content in the media 125. Parallel in vivo studies demonstrated that treatment

of mice with GLP-2 (1.6 g, bid, 10 days) was associated with increased ileal IGF-1

expression, small intestinal growth and increased incidence of Musashi-1 positive cells 125.

To directly link GLP-2�’s intestinotrophic effect to IGF-1, mice with targeted genetic

disruption of Igf-1 (Igf1-/-) were treated with low or high dose GLP-2 (0.1 or 1 g/g BW, 10

days). Abrogation of Igf1 prevented the intestinotrophic effects of GLP-2 in vivo as observed

in parameters such as small intestinal weight, jejunal and ileal crypt+villus height, and

incidence of Ki67+ cells that were comparable to saline-treated mice 125. These observations

suggest that the intestinotrophic actions of GLP-2 in vivo are critically mediated by

downstream IGF-1 activity. The molecular mechanisms whereby IGF-1 conveys GLP-2�’s

intestinotrophic effects have been investigated. Both GLP-2 and IGF-1 induced parallel

activation of the Wnt signalling pathway by increasing -catenin nuclear translocation,

increasing c-myc and sox9 mRNA expression, and increasing Akt phosphorylation in the

small intestinal mucosa 119. Chemical ablation of IGF-1R signalling with the inhibitor NVP-

AEW5411 prevented GLP-2-induced increase in crypt beta-catenin+ cells and increased

jejunal Akt phosphorylation 119. However, Igf1-/- mice exhibited increased jejunal p-Akt

levels with both GLP-2 and IGF-1 treatment. These observations suggest that stimulation of

33

the Wnt/beta-catenin pathway and increased p-Akt in the jejunum by GLP-2 are IGF-1R-

dependent but IGF-1 independent.

Recent evidence suggests that ErbB ligands are also downstream of GLP-2�’s

intestinotrophic actions. Selective ErbB ligands (epiregulin and neuregulin but not EGF,

TGF- or betacellulin) were upregualted in jejunum of mice following acute GLP-2

treatment (1 and 4 hours) 120. Both EGF and GLP-2 increased intestinal mRNA expression

of amphiregulin, epiregulin and HB-EGF, as well as the immediate early genes c-fos, phlda-1

and egr-1 as early as 30 minutes following GLP-2 administration. IGF-1 or KGF failed to

induce an increase in ErbB ligand expression. GLP-2 treatment was associated with

activation of signalling molecules downstream of the ErbB network. Both EGF and GLP-2

induced activation of Akt, egr-1 and c-fos as well as increased c-fos and egr-1 nuclear

positivity within jejunal and colonic epithelial mucosa 120. Furthermore, GLP-2 induction of

ErbB ligands occurred independent of ligand ectodomain shedding as the metalloprotease

inhibitor GM6001 failed to suppress ErbB ligand upregulation in the jejunum and colon.

However, administration of the pan ErbB inhibitor CI-1033 blocked GLP-2-induced

expression of amphiregulin, epiregulin and HB-EGF as well as c-fos, egr-1 and phlda-1 120.

GLP-2�’s intestinotrophic actions (increased crypt cell proliferation, small intestinal growth,

crypt+villus height) were also blocked by pre-treatment with the pan-ErbB inhibitor CI-1033 120, suggesting that ErbB receptor activation is essential for GLP-2-mediated intestinal

growth.

GLP-2 has been shown to increase blood flow to the intestine via eNOS and VIP-

producing enteric neurons 105. In mouse models of experimental colitis, GLP-2 was shown to

reduce intestinal inflammation via activation of VIP-producing neurons 141. GLP-2 treatment

increased the number of VIP+ neurons. In the setting of TNBS-ileitis, both GLP-2 and VIP

improved weight loss and MPO activity and treatment with the VIP antagonist (VIP hybrid)

partially prevented such effects. Furthermore, delayed GLP-2 administration in this model

decreased crypt cell proliferation and apoptosis in the inflamed tissue and reduced cytokine

expression (TNF- , IL-1 , IFN- and IL-10), all of which was completely blocked by co-

administration of VIP hybrid 141. These observations demonstrate an essential role for VIP in

mediating GLP-2�’s anti-inflammatory actions in the intestine.

34

GLP-2 is believed to stimulate the release of each mediator following activation of its

receptor on the subepithelial myofibroblast (e.g. KGF, IGF-1 release) or on enteric neurons

(e.g. VIP, eNOS-positive neurons). Each of the described actions of GLP-2 is likely

mediated by a different molecule to ensure specificity.

1.2.5 Therapeutic potential of GLP-2

The therapeutic potential of GLP-2 as a cytoprotective and pro-absorptive molecule has been

demonstrated in several animal models of intestinal injury, including chemotherapy 117, 177, 179

and inflammatory bowel disease 132, 133, 141. Therefore, there is now interest in developing

GLP-2-based therapeutics to treat patients with a variety of intestinal disorders. Thus far,

human studies have been promising. The majority of human studies involved examination of

GLP-2�’s effects in patients with short bowel syndrome. These studies 173, 187-189 have been

discussed in the SBS section above.

Results from Phase III clinical trials using low dose (0.05mg/kg/day) or high dose

(0.1mg/kg/day) teduglutide for 24 weeks in patients with SBS were released in 2007 by NPS

Pharmaceuticals. Teduglutide reduced the need for parenteral nutrition in many SBS patients

(46% of low dose, 25% of high dose) 124. Furthermore, teduglutide is well tolerated with

only minor side effects likely not related to the drug itself (e.g. lower extremity edema,

localized swelling of the jejunostemy) 124, 218, 219.

The specificity of the intestinotrophic actions of GLP-2 make it a much more

attractive therapeutic candidate compared to other known gut growth factors, such as IGF-1,

that are also trophic for other tissues. However, as with other growth factors, questions arise

about potential carcinogenic properties of GLP-2 and such questions have been addressed

using cell lines as well as animal models. Studies have been carried out in two human colon

cancer cell lines, SW480 and HT29. The GLP-2R was expressed in these two colon cancer

cell lines, detected by flow cytometry using a GLP-2R specific antibody and confirmed by

immunoblotting using the same antibody. Using a 3 dimensional cell migration assay, GLP-

2 was shown to increase migratory activity of SW480 cells in a dose-dependent manner and

to a lesser extent in HT29 cells 220. Incubation of GLP-2 with a DPP-4 inhibitor (P32/98)

further increased migratory activity in these cells. Doubling time also decreased from 2.4 to

35

1.5 days with GLP-2 treatment with a further decrease following DPP4 inhibition 220.

Therefore, the use of GLP-2 along with a DPP4 inhibitor led to increased proliferation and

migratory activity of these cancerous cells in vitro.

A number of animal studies have also aimed to address potential carcinogenic effects

of chronic GLP-2 treatment. Studies in tumour-bearing rats maintained on TPN for 8 days

showed that while GLP-2 improved markers of mucosal atrophy, it had no effects on tumour

growth 73. In contrast, studies in mice showed that GLP-2 promotes tumour growth. Colonic

tumours were induced in mice via a methylating carcinogen and two months after cancer

induction, mice were treated with native GLP-2(1-33), h[Gly2]-GLP-2 or given no treatment

for either 10 days or 1 month. While there was no difference in survival among the groups,

GLP-2 increased the number of colonic polyps significantly compared to the control group 221. Specifically, h[Gly2]-GLP-2 and to a lesser extent GLP-2(1-33) ncreased the number of

small, medium, and large polyps following 1 month of treatment. In this study, small polyps

were described as �“aberrant crypt foci�” (ACF) and medium/large polyps were described as

pedunculated non-malignant adenocarcinomas 221. All tumours were confined to the mucosa

with no penetration of the lamina muscularis.

There also exists evidence that GLP-2 does not modulate tumour growth/initiation in

vitro or in vivo. While the GLP-2R was detected in a number of colon cancer cell lines (e.g.

DLD-1, SW480), GLP-2 treatment of stable colon cancer cell lines transfected with the GLP-

2R (DLD-1:hGLP2R and SW480:hGLP-2R) did not affect doubling time nor cell survival 222. Injection of these stable cell lines subcutaneously into nude mice followed by treatment

with GLP-2(1-33) (bid 5 g) did not affect tumour growth nor did GLP-2 treatment affect

tumour number in Apcmin/+ or Apcmin/+:Glp2r-/- mice 222. While tumour initiation was not

affected by GLP-2, others have demonstrated that tumour progression can be exacerbated by

chronic GLP-2 treatment. Chronic treatment of mice with h[Gly2]-GLP-2 (bid, 1 g, 4

weeks) resulted in increased small and large intestinal weight while treatment with the GLP-

2 antagonist, GLP-2(3-33) (bid, 30 or 60ng, 4 weeks) significantly decreased small and large

intestinal weight 223. Potential carcinogenic effects of GLP-2 were studied in mice treated

with azoxymethane for 4 weeks and allowed to recover for 2 weeks. A 4 week treatment

regimen with h[Gly2]-GLP-2 followed by a 4 or 40 week recovery period significantly

increased the total number of ACF and mucin-depleted foci (MDF) in the colon. Treatment

36

with GLP-2(3-33) prevented tumour initiation and resulted in even lower ACF compared to

PBS-treated controls. Examination of GLP-2�’s effect on tumour progression revealed that

GLP-2 treatment after a 12 week recovery from azoxymethane resulted in an increaseD

number of colonic ACF 223. Thus, in the setting of azoxymethane-induced colon cancer,

h[Gly2]-GLP-2 increases tumour initiation and progression. Given that teduglutide is a

DPP4-resistant analogue of GLP-2, the importance of long-term safety studies is evident.

Nevertheless, the many beneficial effects of GLP-2 in the gastrointestinal system and the

positive results obtained in human studies make the development of GLP-2 analogues a

promising therapeutic target.

37

1.3 Intestinal Adaptation to Re-Feeding

Nutrient deprivation causes severe atrophy of the small intestinal mucosa; however, the gut

displays remarkable adaptability as observed by the almost complete reversal of this

deterioration after re-feeding 224, 225. Fasting causes destruction of villus tips, shortening of

the villi, reduction in total epithelial cell number, and reduction of bowel mass 224-226. The

mechanism whereby these changes occur involves a decrease in proliferation and an increase

in apoptosis of intestinal epithelial cells 226. The python is a well studied model organism for

intestinal adaptation to fasting and re-feeding. Following a prolonged fasting period, the

python will feed on a prey almost equivalent to its own size 227. Such extreme nutrient

deprivation and replenishment requires the intestine to undergo rapid and efficient adaptation

in order to meet nutritional demand. First, the oxygen consumption rate of the python

increases significantly following feeding 228, 229. The weight of major organs such as lung,

heart, liver, kidney, as well as the small intestine increased significantly following feeding,

presumably to enhance digestion and nutrient uptake. Indeed, when absorption of specific

nutrients was studied, amino acid and glucose uptake rates were significantly enhanced all

along the intestine 228. Amino acid and glucose uptake as well as increased oxygen

consumption increase in the python in proportion to the size of the meal consumed 229. The

activity of pancreatic enzymes trypsin and amylase as well as digestive enzymes maltase and

aminopeptidase increased with feeding 230. Feeding promoted an increase in intestinal

mucosal thickness, longer villi and microvilli, and increased intercellular space between villi

to increase paracellular transport 227. Feeding also resulted in an increase in enterocyte width

until digestion was complete approximately 14 days following meal consumption 231. The

expansion of enterocytes increased the length of villi. Surprisingly, neither apoptosis nor

proliferation of epithelial cells was found to change in the intestine of the python following

feeding. Proliferation was found to be maximal when small intestinal weight had passed its

maximal weight 227. Such observations have given rise to the �“pay-before-pump�” theory: the

python maintains a fully functional intestine with active enterocytes in anticipation of a large

meal and only upregulates cell proliferation to replace deteriorated enterocytes that have

reached maximal absorptive capacity.

38

In contrast to the python, other species display a severe decrease in cell proliferation

during fasting and significant increase following re-feeding. In rats 225, 232-234, mice 91, 235 and

humans 236 , the starvation-induced decrease in crypt cell proliferation was reversed by

feeding. Starvation also led to increased number of apoptotic cells in the intestinal villi of

rats 237 and mice 91, a phenomenon that was reversed by re-feeding.

Fasting has been associated with a paradoxical increase in nutrient transport per mg

of intestine 238. Although the presence of luminal nutrients is the major signal for increased

nutrient transport, it appears that under fasted conditions other regulatory mechanisms result

in an increase of glucose and amino acid uptake 238. For example, a decrease in intracellular

sodium concentration increases the driving force for intestinal sodium-dependent glucose

transport in fasting rats 238, 239. In fasting rats, the abundance of Pept-1 is increased in the

base and mid-villus regions whereas Pept-1 was not present in villus base of controls 77.

Given that fasting destroys the villus tips 225, the presence of nutrient transporters in the base

of villi may be an adaptive mechanism to nutrient deprivation. Because of mucosal atrophy

under fasting, the ratio of absorptive to non-absorptive enterocytes increases and glucose and

amino acid transport per mg of tissue is increased 238. However, fasting has been shown to

reduce the overall nutrient transport ability of the intestine. The fasting-induced mucosal

atrophy resulted in a decrease in the membrane fluidity of rat enterocytes and a subsequent

decrease in the turnover rate of existing transporters 240. Furthermore, if the loss of mucosal

mass associated with fasting exceeds this paradoxical increase in absorptive capacity per mg

of tissue, an overall decrease in nutrient absorption will occur.

Gut hormones may also be involved in the adaptive response to fasting/re-feeding.

Due to its intestinotrophic and pro-absorptive actions in the gut, GLP-2 has been implicated

as a key peptide involved in the regulation of the adaptive response to fasting and re-feeding.

Administration of the known GLP-2R antagonist, GLP-2 (3-33) (3 or 30 ng), to mice that

were re-fed for 24 hours after a 24 hour fast prevented the adaptive increase in small

intestinal growth seen with re-feeding in control mice 91. Fasting resulted in a 2-fold increase

in the number of TUNEL-positive apoptotic villus cells but no significant changes were

observed in the number of proliferating cells. During re-feeding, the number of Ki-67-

positive proliferating cells increased significantly and the incidence of apoptosis in the villi

was reduced by 70% as a means to reverse the fasting-induced mucosal atrophy.

39

Administration of GLP-2(3-33) prevented this adaptive response in the small intestine of

mice 91. These findings suggest a role for endogenous GLP-2 in the adaptive response to re-

feeding; however, as discussed earlier, the use of the GLP-2 metabolite, GLP-2 (3-33), as an

antagonist has major limitations.

40

1.4 Glucagon

1.4.1 Glucagon secretion

Glucagon is a 29 amino acid peptide hormone secreted by pancreatic alpha cells 241.

Posttranslational processing of proglucagon in alpha cells by prohormone convertase 2

liberates glucagon. Regulation of glucagon secretion is achieved by specific electrical

machinery in the alpha cell (ion channels) that is activated by stimuli such as glucose and

leads to the exocytosis of glucagon.

The alpha cell contains tetrodotoxin (TTX)-sensitive Na+ channels and low-voltage

activated (T-type) and high-voltage activated (L- or N-type) Ca2+ channels. Under basal

conditions, these channels are electrically silent but under hypoglycaemic conditions, they

are able to generate actions potentials leading to the release of glucagon 242. Glucose enters

the alpha cell through the glucose transporter SLC2A1 and is metabolized to ATP. This ATP

is in turn used to drive KATP channels which set the resting membrane potential for the cell.

Under low glucose conditions, there is a decrease in ATP/ADP ratio which in turn decreases

the KATP channel activity, leading to a membrane potential of ~60mV. At this voltage, T-

type Ca2+ channels open leading to a membrane potential that opens the N-type Ca2+ and Na+

channels. The influx of Ca2+ triggers an action potential and the exocytosis of glucagon

granules. The membrane repolarizes as A-type K+ channels open. Paradoxically, high

glucose concentrations have also been shown to increase glucagon secretion. In FACS-

purified rat alpha cells, high glucose caused an increase in glucagon secretion 243, 244. While

physiological concentrations of glucose (7 mM) inhibited glucagon secretion in isolated

mouse islets, supraphysiological concentrations (30 mM) resulted in stimulation of glucagon

secretion 245. This paradoxical stimulation of glucagon secretion by glucose could be

attributed to the in vitro nature of the studies and their isolation from other paracrine factors,

namely insulin, which are known to modulate alpha cell secretion. While high glucose alone

could stimulate glucagon secretion from the alpha cell, insulin is a critical factor in inhibiting

glucagon secretion under hyperglycaemic conditions. Interestingly, in type 1 diabetic

patients where beta-cell function is lost, intravenous or oral glucose can also stimulate

glucagon secretion 246 lending support to the hypothesis that insulin modulation is critical.

41

The architecture of islets allows for insulin to have maximal effect on alpha cell

secretion. Alpha cells are downstream of beta cells in the context of microcirculation and

beta cell secretions are carried out from the core of the islet towards the alpha cells 241.

Therefore, the alpha cells are exposed directly to any insulin secreted by beta cells. Even in

humans where beta cells are scattered throughout the islet rather than lay at the core such as

in rodents, the directionality of the microvasculature suggests beta alpha 247, 248. The

insulin receptor and its signalling machinery are highly abundant in alpha cells. In In-R1-G9

cells (a pancreatic alpha cell line), insulin caused increased phosphorylation of IRS-1 and

PI3K and reduced glucagon mRNA levels 249. These effects were abolished by the PI3K

inhibitor wortmannin 249. Insulin can reduce proglucagon mRNA expression in normal rats

subjected to hyperglycemia 14, STZ-diabetic rats 14, and in In-R1-G9 cells 16. Insulin can also

activate Akt kinase which phosphorylates and translocates GABAAR to the cell surface 250.

This allows for GABA co-released with insulin from beta cells to be more effective and in

turn inhibit glucagon secretion by hyperpolarizing the alpha cell 250. Insulin can also

decrease glucagon secretion by desensitizing alpha cell KATP channels. While the density of

KATP channels is comparable between alpha and beta cells, alpha cell KATP channels are five

times more sensitive to ATP inhibition compared to beta-cell KATP channels 251. Using alpha

cells isolated from mice expressing green fluorescent protein (GFP) under the control of the

mouse insulin promoter (MIP), it was shown that insulin increased KATP channel opening by

decreasing the sensitivity of these channels to ATP in a PI3K-dependent manner 252.

Therefore insulin can inhibit glucagon secretion by desensitizing KATP channels and thereby

hyperpolerizing the alpha cell.

Another important regulator of glucagon secretion is zinc. Zinc is secreted from beta-

cells during hyperglycaemic conditions 253. It accumulates in secretory granules where it co-

crystallizes with insulin 254. As zinc is co-secreted with insulin during hyperglycaemic

conditions, it was hypothesized that it also had a role in the regulation of alpha cell glucagon

release. When a zinc chelator (calcium EDTA) was added to the perfused rat pancreas, the

mitochondrial substrate monomethyl-succinate turned from an inhibitor to a stimulator of

glucagon secretion without affecting insulin secretion 255. Zinc was further shown to inhibit

glucagon secretion via its action on KATP channels. First, zinc was shown to modulate the

excitability of an insulinoma cell line (RINm5f) by binding to protein subunits of KATP

42

channels as well as voltage-gated Ca2+ channels 256. Second, zinc was shown to be an

endogenous KATP channel activator by acting on sulfonylurea receptors 254. Finally, zinc

inhibited glucose and pyruvate-induced glucagon secretion from FACS-sorted alpha cells 243.

Arginine-induced glucagon secretion, which is known to occur independently of KATP

channel activation 257, was not blocked by zinc 243 providing further evidence that zinc

suppression of glucagon secretion occurs via actions on KATP channels.

Somatostatin is another peptide hormone produced in the endocrine pancreas. To

date, there are five identified somatostatin receptors (SSTR) of which SSTR2 is expressed on

alpha cells and SSTR5 is expressed on beta cells 242. SSTR activation in alpha cells can

activate G protein coupled K+ channels which results in hyperpolarization of the cell and

thereby inhibition of glucagon exocytosis 258, 259. SSTR activation can also inhibit the

pathway by which PKA stimulates glucagon secretion: somatostatin decreases adenylate

cyclase activity resulting in decreased cAMP 260. Immunoneutralization of somatostatin

potentiated the secretion of glucagon in cultured neonatal rat islets at low, medium and high

glucose concentrations 261 and in isolated perfused human pancreas at low glucose

concentrations 262. The actions of somatostatin on islet alpha cells seems to be directly linked

to SSTR2 activation, as an agonist for this receptor was shown to selectively inhibit glucagon

release from islets with no effects on insulin release 263 and studies in isolated pancreatic

islets of Sstr2-/- mice have shown that glucagon release stimulated by arginine is

significantly increased 264.

Glucagon-like peptide-1 (GLP-1) has also been shown to modulate glucagon

secretion. GLP-1 is secreted from intestinal L cells and activates its receptor (GLP-1R) on

beta-cells where it enhances glucose-stimulated insulin secretion. In healthy human

volunteers, GLP-1 has been shown to decrease glucagon secretion. When GLP-1 was

infused at levels mimicking post-prandial physiological levels, it stimulated insulin and

suppressed glucagon secretion 265. GLP-1 was also able to reduce fasting glucose and

glucagon levels in healthy volunteers 266. Several studies have also shown that GLP-1 can

further reduce circulating glucagon post-prandially (in association with a reduction in blood

glucose) in healthy volunteers given a standardized mixed meal 267, 268 and obese patients 269.

Clamp studies provide further evidence for the role of GLP-1 in modulating glucagon

release. Using a stepwise hyperglycaemic clamp in healthy human volunteers, it was shown

43

that GLP-1 infusion and glucose infusion significantly reduced plasma glucagon

concentrations whereas a mixed meal test increased glucagon concentrations 270. During a

stepwise hypoglycaemic clamp, GLP-1 suppressed glucagon levels at euglycemia but not

during hypoglycaemic conditions 271. Similarly, the GLP-1R agonist exenatide reduced

plasma glucagon levels during euglycemia but not hypoglycaemia 272. The diabetic alpha

cell has also been shown to be responsive to GLP-1. Type 2 diabetic patients given GLP-1

subcutaneously directly before a standard meal had significantly reduced post-prandial blood

glucose levels with an associated increase in insulin and decrease in glucagon concentrations 273. More chronic studies with GLP-1 treatment (t.i.d. for 3 weeks, sc before a meal) have

shown similar results 274. Several other studies have confirmed GLP-1 effects on glucagon

release in type 2 diabetics 275-279. GLP-1 has also been shown to suppress glucagon release in

type 1 diabetic patients during fasting hyperglycemia 280, post-prandially 281 and in response

to a hyperglycaemic clamp 282. It has been recently proposed that GLP-1�’s stimulatory effect

on beta cell insulin secretion and inhibition of alpha cell glucagon release are equally

important for glycemic regulation in diabetic patients 279. Animal studies have also revealed

suppression of glucagon release by GLP-1. For example, in random fed rats, GLP-1 reduced

blood glucose levels with an associated increase in plasma insulin and decrease in glucagon

levels. In response to hypoglycaemia in fasted rats, GLP-1 was still able to reduce glycemia

and increase insulin levels though it no longer caused changes in glucagon release 283. These

observations suggest that while GLP-1 is an insulin secretagogue able to reduce glycemia,

protective mechanisms exist to shield the animal against severe hypoglycaemia. Thus GLP-1

may only exert its effects on glucagon suppression under non-hypoglycemic conditions.

Recent evidence also suggests that the inhibitory effects of GLP-1 on glucagon secretion are

mediated by the SSTR2. Administration of somatostatin antibodies to the perfused rat

pancreas significantly attenuated GLP-1 induced suppression of glucagon release 284.

Infusion of an SSTR2 antagonist, PRL-2903, significantly increased glucagon release from

the perfused rat pancreas while infusion of GLP-1 alone decreased glucagon release. Co-

infusion of PRL-2903 with GLP-1 prevented the inhibitory effects of GLP-1 on glucagon

secretion 284. These observations suggest that GLP-1-induced suppression of glucagon

release is mediated by the SSTR2.

44

The mechanisms via which GLP-1 regulates glucagon secretion in vivo are still being

elucidated. Evidence for the presence of GLP-1R on pancreatic alpha cells is somewhat

controversial. GLP-1R mRNA was detected by RT-PCR in both isolated rat islets as well as

isolated single alpha cells and immunofluorescent staining with a GLP-1R antibody localized

a subset of alpha cells positive for the GLP-1R 285. However, others failed to detect GLP-1R

mRNA and protein on alpha cells 286. Therefore, whether GLP-1 exerts a direct effect on

alpha cells remains to be elucidated. Given the recent observations on the role of SSTR2 in

mediating GLP-1-induced suppression of glucagon release, it is likely that GLP-1�’s effects

on the islet alpha cells are indirect.

Glucagon-like peptide-2 has recently been implicated in controlling glucagon

secretion. Unlike GLP-1, GLP-2 has no effect on beta cells as it did not stimulate insulin

secretion from either rat isolated islets 287 or pig isolated perfused pancreas 288. However,

pharmacological doses of GLP-2 have been shown to stimulate glucagon secretion. Infusion

of native GLP-2(3-33) in healthy human volunteers resulted in an increase in plasma

glucagon levels both during the fasting and fed state with no changes in plasma glucose

levels 159, 212. Furthermore, infusion of GLP-2 in isolated rat pancreas resulted in a

significant increase in glucagon concentrations with no changes in insulin or somatostatin

levels. Co-administration of GLP-1 and GLP-2 to the rat pancreas abolished the glucagon-

lowering effects of GLP-1 given alone 103. The GLP-2R was also detected in islets of rats by

real-time PCR as well as on pancreas sections from rats and humans by

immunohistochemistry using a GLP-2R specific antibody 103. Therefore, in humans and rats

GLP-2 can stimulate glucagon secretion with no changes to circulating glucose levels

perhaps via a mechanism involving activation of its receptor on alpha cells.

1.4.2 Glucagon metabolism and clearance

Degradation and clearance of glucagon in vivo is not well understood. The half-life of

glucagon is approximately 3 minutes. The membrane-bound zinc metallopeptidase neutral

endopeptidase 24.11 (NEP 24.11) has been shown to metabolize glucagon. Glucagon, and

GLP-1(7-36amide) were shown to be good substrates for NEP 24.11 289. In anesthetized

pigs, an inhibitor of NEP was shown to increase circulating levels of endogenous glucagon (3

45

fold increase) and also significantly increase the half life of glucagon administered

exogenously 290. Therefore, NEP 24.11 is important for glucagon metabolism in vivo. DPP-

4 has also been shown to metabolize glucagon, however its effect is mostly observed in vitro.

Incubation of glucagon with DPP-4 resulted in degradation of the peptide and ablation of its

biological activity as observed by lack of hyperglycaemic development following injection of

the metabolized product to normal rats 291.

Glucagon is cleared by the kidney. Studies have shown glucagon clearance involves

hydrolysis by enzymes at the brush border membrane of the proximal tubule followed by re-

uptake of resulting amino acid and small peptide metabolites at this site 292, 293. Renal

clearance of glucagon also involves glomerular filtration 294.

1.4.3 Cellular mechanisms of glucagon action

The glucagon receptor:

Glucagon exerts its actions by binding to its receptor (Gcgr) on multiple target tissues. Gcgr

is a G protein-coupled receptor. Upon activation, Gcgr can activate G s and thereby

adenylate cyclase, cAMP and PKA. In the liver, activation of the PKA pathway is the main

way through which glucagon regulates glucose metabolism. PKA in the liver activates

CREB and PGC-1 which then turns on gene transcription to increase levels of key

gluconeogenic enzymes glucose-6-phosphotase (G6Pase) and phosphoenolpyruvate

carboxikinase (PEPCK). Gcgr activation can also recruit Gq proteins causing

phosopholipase C activation and Ca2+ release 295. Given that the main biological activity of

glucagon is to induce hepatic glucose production during the fasting state, it is not surprising

to find a high concentration of Gcgr localized to the liver. Glucagon receptor mRNA has

also been detected in kidney, heart, adipose tissue, spleen, thymus, adrenal gland, pancreas,

brain and the gut 296-298.

46

1.4.4 Biological actions of glucagon

Glucose homeostasis:

The main biological action of glucagon is to oppose the actions of insulin and to protect

against hypoglycaemia. Glucagon increases gluconeogenesis and glycogenolysis. Glucagon

is released from islets in a pulsatile manner which helps enhance its actions on hepatic

glucose production compared to continuous infusion 299. As outlined above, glucagon

functions via the activation of its receptor on the liver. One of the major roles of glucagon in

glucose homeostasis is stimulation of glycogenolysis. The molecular mechanisms whereby

this is achieved involve activation of PKA due to Gcgr activation and increased cAMP

levels. PKA in turn phosphorylates glycogen phosphorylate kinase which itself

phosphorylates glycogen phosphorylase. Glycogen phosphorylase then phosphorylates

glycogen leading to its breakdown and release of glucose-6-phosphate. PKA simultaneously

stimulates G6Pase production as described above which results in release of glucose from the

now high levels of glucose-6-phosphate. Glucagon also inhibits hepatic glycogenesis by

phosphorylating and thereby inactivating glycogen synthase. PKA has been shown to be one

of the kinases that phosphorylates glycogen synthase. Glucagon also potentiates

gluconeogenesis by increasing expression levels of the rate-limiting enzyme PEPCK 300, 301.

Glucagon also inhibits glycolysis by reducing levels of fructose(2,6)bisphosphate. Gcgr

activation in the liver results in activation of fructose(1,6)bisphosphatase and inhibition of

phosphofructokinase which results in conversion of fructose(2,6)bisphosphate into

fructose(6)phosphate. While this stimulates gluconeogenesis by feeding more

fructose(6)phosphate into the pathway, it also reduces glycolysis by removing one of its key

substrates. Glucagon also inhibits the last step of the glycolysis pathway by inhibiting

pyruvate kinase. PKA phosphorylates and thereby inactivates pyruvate kinase and glucagon

can also reduce mRNA levels of pyruvate kinase 302.

Actions on the endocrine pancreas:

Gcgr are expressed on islet beta cells and Gcgr activation has been associated with a

suppression of insulin release from these cells. Specific binding sites for 125I-glucagon have

been detected in hamster beta cell tumours 303 as well as purified beta cells 304. Glucagon

47

binding to Gcgr on beta cells also activates adenylate cyclase 303 as well as cAMP 286, 305.

However, glucagon-stimulated insulin secretion was less potent than GLP-1-stimulated

insulin release 303. Glucagon can also activate Gcgr on alpha cell and stimulate its own

release in an autocrine manner. Gcgr signalling in alpha cells stimulated cAMP generation

and exocytosis 306. This was blocked by a glucagon receptor antagonist but not by a GLP-1R

antagonist. Furthermore, exocytosis from alpha cells was induced by glucagon and forskolin

as well as an experimental rise in intracellular cAMP concentration 306. Glucagon signalling

also autoregulates alpha cell proliferation as mice unable to produce glucagon by targeted

deletion of PC2 307 as well as Gcgr-/- mice 308 display alpha cell hyperplasia.

Endogenous glucagon actions:

Gcgr-/- mice are viable and born in expected Mendelian frequency and have a number of

unique phenotypes. Gcgr-/- mice display mild fasting hypoglycaemia, increased pancreas

weight, islet alpha cell hyperplasia, as well as significantly elevated levels of GLP-1 and

glucagon 308, 309. Following an extreme fasting period (24 hours), Gcgr-/- mice developed

severe hypoglycaemia demonstrating the importance of glucagon for glucose homeostasis

during fasting 308. Gcgr-/- also exhibit lower perigonadal white adipose tissue and

interscapular brown adipose tissue weight compared to their littermate controls resulting in

increased lean body mass. Gcgr-/- mice are resistant to streptozotocin-induced beta cell

destruction and high fat diet-induced obesity and hepatic steatosis 310. Glucose tolerance and

insulin sensitivity is also improved in Gcgr-/- mice 308-311. Many of the observed phenotypes

in Gcgr-/- mice are likely due to elevated GLP-1 levels. For example, the enhanced insulin

response to glucose administration was blocked by a GLP-1R antagonist in vivo 311.

Furthermore, improved glucose tolerance, decreased gastric emptying, and decreased

adiposity are all phenotypes associated with increased GLP-1 action in vivo.

48

1.5 Rationale & Hypotheses The intestinotropic peptide GLP-2 has been shown to stimulate intestinal nutrient absorption

as well as enhance intestinal adaptation in a number of physiological (fasting and re-feeding)

and pathophysiological conditions (experimental diabetes). GLP-2 has also been recently

implicated in stimulation of glucagon secretion 103, 159. Given that the majority of GLP-2�’s

described biological actions are of a pharmacological nature, I have aimed to delineate the

role of endogenous GLP-2R signalling in intestinal and islet adaptation. Using a mouse with

a targeted genetic disruption of the known GLP-2R, I have addressed the general hypothesis

that GLP-2R signalling is essential for intestinal and islet adaptation to conditions of nutrient

deprivation (e.g. prolonged fasting and re-feeding and the diabetic intestine) and nutrient

excess (e.g. chronic high fat feeding).

Is the GLP-2R required for intestinal adaptation to re-feeding?

GLP-2 exerts proliferative and anti-apoptotic effects in the intestinal mucosa and exogenous

GLP-2 treatment has been shown to promote intestinal growth and adaptation in conditions

of nutrient deprivation (e.g. intestinal hypoplasia associated with TPN feeding 136, 143).

Moreover, endogenous GLP-2 was shown to be essential for intestinal growth during 24

hours of re-feeding following a 24 hour fast as treatment with a GLP-2R antagonist, GLP-

2(3-33), inhibited crypt cell proliferation 91. Based on these reported actions of GLP-2, I

carried out studies in Chapter 2 to address the hypothesis that endogenous GLP-2R

signalling is required for intestinal adaptation to 24 hours of re-feeding following a 24

hour fast. I also aimed to delineate the molecular pathways downstream of intestinal

adaptation to re-feeding and the contribution of GLP-2R signalling in modulating these

pathways.

Is GLP-2R signalling required for intestinal and islet adaptation to diabetes and glucose

intolerance?

Experimental diabetes is associated with increased gut growth 312, 313 as well as elevated

circulating levels of GLP-2 12. Immunoneutralization of circulating GLP-2 resulted in

49

decreased diabetic intestinal growth in rats 217, suggesting that endogenous GLP-2 may be

responsible for bowel hyperplasia in experimental diabetes. Furthermore, GLP-2 treatment

in rats 103 and humans 159 stimulated glucagon secretion, potentially through a direct

mechanism involving an alpha cell GLP-2R. In Chapter 3, I used the Glp2r / mouse model

to address the hypothesis that the GLP-2R is essential for intestinal and islet adaptation to

diabetes and glucose intolerance. I aimed to study the role of GLP-2R signalling in three

different models of diabetes and/or glucose intolerance using a chemical model of diabetes

(STZ-induced diabetes), a diet-induced model of glucose intolerance (high fat feeding), and a

genetic model of diabetes and glucose intolerance (the ob/ob mouse). Using these diabetic

mouse models, I addressed the role of endogenous GLP-2R signalling in intestinal adaptation

as well as glucose homeostasis and glucagon secretion.

50

CHAPTER 2

ErbB activity links the glucagon-like peptide-2 receptor to refeeding-induced adaptation in the murine small bowel

The work presented in this chapter corresponds to the following publication:

Bahrami J., Yusta B., Drucker D.J. Gastroenterology (2010) 138(7):2447-56

Author contributions:

B. Yusta contributed to the design, execution, and analysis of experiments examining ErbB ligand

induction in wildtype mice and Glp2r-/- mice, and experiments performed with CI-1033 (Figures

2.4c, 2.5, 2.6, 2.7, 2.14).

51

2.1 Research Summary

Background & Aims: The small bowel mucosa is highly sensitive to nutrients and

undergoes rapid adaptation to nutrient deprivation and refeeding through changes in

apoptosis and cell proliferation, respectively. Although peptides such as glucagon-like

peptide-2 (GLP-2) exert trophic effects on the gut and circulating levels increase with

refeeding, mechanisms linking GLP-2 action to mucosal adaptation to refeeding remain

unclear.

Methods: Fasting and refeeding were studied in wild-type (WT) and Glp2r / mice and in

WT mice treated with the pan ErbB inhibitor CI-1033. Experimental endpoints included

intestinal weights, histomorphometry, gene and protein expression, and crypt cell

proliferation.

Results: Fasting was associated with significant reductions in small bowel mass

predominantly in the jejunum, decreased crypt plus villus height, and reduced crypt cell

proliferation. Refeeding in normal mice increased plasma levels of GLP-2, reversed fasting-

induced small bowel atrophy, increased villus height and cell number, and stimulated jejunal

crypt cell proliferation. In contrast, refeeding failed to increase small bowel weight, crypt cell

proliferation, or villus cell number in Glp2r / mice. Levels of mRNA transcripts for egf, kgf,

and igfr were lower in fasted Glp2r / mice. Epidermal growth factor but not insulin-like

growth factor-1 restored the normal intestinal adaptive response to refeeding in Glp2r /

mice. Furthermore, CI-1033 prevented adaptive crypt cell proliferation, Akt activation, and

induction of ErbB ligand gene expression after refeeding in WT mice. Up-regulation of ErbB

ligand expression and intestinal Akt phosphorylation were also significantly diminished in

refed Glp2r / mice.

Conclusions: These findings identify Glp2r and ErbB pathways as essential components of

the signalling network regulating the adaptive mucosal response to refeeding in the mouse

intestine.

52

2.2 Introduction

Absorption of nutrients from the small intestine is critical for survival and energy

homeostasis. The epithelial lining of the small bowel is particularly sensitive to energy

deprivation because withdrawal of nutrients leads to rapid development of mucosal atrophy 314. Destruction of villus tips, shortening of villi, reduction in total epithelial cell number,

and reduction of bowel mass are consequences of a prolonged fasting state 225, 226, 315, 316.

However, the gut displays remarkable adaptability as observed by the almost complete and

rapid reversal of abnormalities in mucosal ultrastructure after refeeding 315. The

mechanism(s) whereby these changes occur during fasting involves a decrease in

proliferation and an increase in apoptosis of intestinal epithelial cells. The presence of

luminal nutrients is the main signal for increased nutrient transport and intestinal growth

during refeeding. However, the interplay between luminal nutrients and gut growth and

survival factors facilitates the adaptation, repair, and growth observed during refeeding after

a prolonged fasting period. A number of gut growth factors have been implicated as

important modulators for this adaptive response. Circulating and tissue levels of insulin-like

growth factor-1 (IGF-1) increase in correlation with jejunal tissue mass in refed rats 317, 318.

In suckling rats, refeeding after an 8-hour deprivation of food was correlated with an increase

in epidermal growth factor (EGF) content in the gastrointestinal tract 319. Administration of

the peptide hormone neurotensin prevents the mucosal hypoplasia associated with an

elemental diet 320. More recently, glucagon-like peptide-2 (GLP-2) has been implicated as a

gut growth factor involved in regulation of the adaptive response to fasting and refeeding 91.

GLP-2 is a 3 amino acid peptide product of the proglucagon gene that is co-secreted

with GLP-1 from the intestinal L cell 321. The main stimulus for GLP-2 release is presence of

nutrients, specifically fats and carbohydrates, in the intestinal lumen. Exogenous

administration of GLP-2 results in significant growth of the intestinal epithelial mucosa,

increased nutrient absorption, decreased intestinal permeability, and inhibition of gastric

emptying 123, 322. To date, our understanding of GLP-2 biology stems primarily from studies

that used exogenous administration of pharmacologic amounts of the peptide. In contrast, the

role of the endogenous GLP-2:GLP-2 receptor (GLP-2R) axis for the health and function of

the normal gut mucosa has not been extensively studied.

53

Immunoneutralization of circulating GLP-2 with polyclonal GLP-2 antisera

attenuated the adaptive intestinal hyperplasia that developed in rats with experimental

diabetes 217. GLP-2(3-33) is generated from intact GLP-2(1-33) and functions as both a

weak antagonist and a partial agonist at the murine GLP-2R 91. In the setting of fasting and

refeeding, exogenous administration of GLP-2(3-33) significantly attenuated the adaptive

growth observed in response to refeeding in mice 91. However, whether GLP-2(3-33) acts as

a specific antagonist for the GLP-2R has not been defined, and the mechanisms through

which GLP-2R signaling modulates the adaptive mucosal response to nutrient repletion

remain poorly understood 91. We have now determined the role of endogenous GLP-2R

signaling for the adaptive mucosal response to deprivation of food and refeeding through

studies of the Glp2r / mouse. The Glp2r / mouse intestine is unresponsive to GLP-2

administration and provides a useful genetic model for studies of the importance of

disrupting GLP-2R�–dependent pathways 120. Here, we show that basal GLP-2R signaling

modulates the adaptation to fasting/refeeding by a mechanism that depends on ErbB activity.

2.3 Materials and Methods

2.3.1 Peptides & drugs

Recombinant mouse EGF was purchased from Bachem, Inc (Torrance, CA). Human IGF-1

was purchased from GroPep (Adelaide, Australia). CI-1033 was a kind gift from Pfizer

Global Research Inc (Ann Arbor, MI).

2.3.2 Animals

Wild-type (WT) C57BL/6 mice were obtained from Taconic (Germantown, NY). Glp2r /

mice were generated in the C57BL/6 background by replacing 2.45 kilobases of the Glp2r

gene, including exons 7�–9, with a neomycin resistance cassette (inGenious Targeting

Laboratory Inc, Stonybrook, NY). Genotyping was done as previously described by

polymerase chain reaction (PCR) on tail DNA 120. All studies used male littermates aged 10�–

12 weeks that were bred and housed at the Toronto General Hospital Animal Resource

54

Centre or the Toronto Centre for Phenogenomics. All animal protocols were approved by the

University of Toronto Animal Care Committee.

2.3.3 Fasting and re-feeding protocol

Mice were housed in single cages lined with a plastic grid instead of bedding for the duration

of the experiments. All mice had free access to water, but access to food was restricted at

specific time points as indicated. Fasted mice had no access to chow beginning at 8:00�–9:00

am for 24 hours. Refed mice were deprived of food for 24 hours followed by a 24-hour

refeeding period with free access to food. In the EGF/IGF-1 rescue experiments, 3 injections

of EGF (0.5 g/g of body weight [BW]) or IGF-1 (2 g/g of BW) were administered

subcutaneously to mice during the refeeding period, 8 hours apart starting at 0, 8, and 16

hours after food replacement. To assess the role of ErbB receptor-dependent signaling during

the refeeding period, WT mice were deprived of food for 24 hours and refed for 30, 90, or

180 minutes in the presence of either vehicle (water) or the pan ErbB inhibitor CI-1033 given

subcutaneously at 30 mg/kg of BW 30 minutes before refeeding. All mice received an

injection of bromodeoxyuridine (BrdU) injection (100 g/g of BW) 1 hour before killing.

2.3.4 Collection of tissues

Small and large intestines were removed from killed mice, and luminal content was gently

removed by flushing with phosphate-buffered saline (pH 7.4). Total weight of the small and

large intestines was measured and recorded. Jejunum (10�–20 cm distal to the pylorus) and

ileum (10 cm immediately proximal to the ileocecal junction) were weighed, and 2-cm

segments were collected for protein, RNA, and histologic analyses. Intestinal segments were

fixed in 10% neutral-buffered formalin, paraffin embedded, and cut into 3 cross-sections. For

analysis of RNA and protein, segments of intestine were snap-frozen in liquid nitrogen and

stored at 80°C.

2.3.5 Morphometry

Crypt plus villus height as well as number of cells per villus were measured on jejunal cross-

sections stained with H&E with the use of a Leica Q500MC image Analysis System (Leica

Inc, Cambridge, United Kingdom). An average of 22 well-oriented villi and 55 well-oriented

55

crypts from 3 different cross-sections was analyzed per mouse. Immunohistochemistry was

carried out for BrdU with the use of rat monoclonal anti-BrdU (Abcam Inc, Cambridge, MA;

catalog no. ab6326). Cell positional BrdU analysis was performed by counting the number of

positively stained cells along well-oriented half-crypts beginning at cell 0 (base crypt) up to

cell 25 (along the crypt-villus axis). An average of 12 half-crypts was analyzed per mouse.

2.3.6 Real-time (RT)-PCR

Total RNA was isolated from a 2-cm section of jejunum or ileum with the use of TRI reagent

(Sigma-Aldrich, St Louis, MO) according to the manufacturer's instructions and quantified

with ultraviolet absorbance at 260 nm. RNA from each tissue was then subjected to reverse

transcription with the use of Supercript II and random hexamers (Invitrogen, Carlsbad, CA).

Real-time quantitative PCR was performed with the use of an ABI Prism 7900 Sequence

Detection System with TaqMan Gene Expression Assays (Applied Biosystems, Foster City,

CA) for egf (Mm00438696_m1), egfr (Mm00433023_m1), igf-1 (Mm00439559_m1), igf-1r

(Mm00802831_m1), kgf (Mm00433291_m1), endothelial nitric oxide synthase (eNOS;

Mm00435204_m1), proglucagon (Mm00801712_m1), epiregulin (Mm00514794_m1),

amphiregulin (Mm00437583_m1), c-fos (Mm00487425_m1), hb-egf (Mm00439307_m1),

phlda-1 (Mm00456345_g1), pepck (Mm00440636_m1), tgf- (Mm00446231_m1), egr-1

(Mm00656724_m1), and 18S. Relative mRNA expression levels were quantified with the 2�–

CT method, using 18S ribosomal RNA as the endogenous control for each tissue.

2.3.7 Western blot analysis

Whole jejunum and ileum segments (2 cm) were homogenized in ice-cold RIPA buffer (1%

Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate in phosphate-

buffered saline) supplemented by protease and phosphatase inhibitors (Sigma-Aldrich), 5

mmol/L sodium fluoride, 5 mmol/L -glycerophosphate, and 200 mol/L sodium

orthovanadate. Protein (35�–40 g) was used for Western blot analysis as previously

described 120. Rabbit polyclonal antibodies for ErbB2 (1:500 dilution), eNOS (1:200

dilution), and phosphorylated ErbB2 (tyr-1248, 1:1000 dilution) were from Santa Cruz

Biotechnologies, Santa Cruz, CA; the rabbit polyclonal ErbB1 antibody (1:1000 dilution)

was from Rockland Immunochemicals Inc, Gilbertsville, PA; and the rabbit polyclonal

56

antibodies against IGF-1R ( -subunit, 1:1000 dilution), phospho-ErbB1 (Tyr-1068, 1:1000

dilution), phospho-Shc (Tyr-239/240, 1:1000 dilution), phospho-Erk1/2 (Thr-202/Tyr-204,

1:1000 dilution), and phospho-Akt (Ser-473, 1:1000) were from Cell Signaling

Technologies, Beverley, MA. A mouse monoclonal antibody against heat shock protein 90

(BD Biosciences, Mississauga, ON, Canada) was used as a loading control at a 1:2000

dilution.

2.3.8 Plasma GLP-2

Quantification of plasma GLP-2 was carried out with the use of the ALPCO enzyme

immunoassay kit for mouse GLP-2 (Alpco, Salem, NH) according to the manufacturer's

instructions.

2.3.9 Statistical analyses

All results are expressed as mean ± standard error. The Prism software package (Version 4;

GraphPad Software, La Jolla, CA) was used for statistical analyses. Statistical significance

was established by Student's t test or 2-way analysis of variance with a Bonferroni post-hoc

analysis as appropriate. Statistical significance was defined as P < .05.

2.4 Results

2.4.1 Intestinal adaptation in the transition from fasting to refeeding is impaired in

Glp2r / mice

We first assessed whether fasting-refeeding was associated with a significant increase in

levels of GLP-2 in the mouse. Consistent with data from human studies 51, GLP-2 levels rose

significantly after refeeding in both WT and Glp2r / mice (Figure 2.1). Deprivation of food

was associated with a significant decrease in small intestinal weight that was quantitatively

similar in Glp2r+/+ vs. Glp2r / mice (Figure 2.2.a). In contrast, refeeding for 24 hours

increased small bowel weight in Glp2r+/+ but not in Glp2r / mice (Figure 2.2.a). Changes in

small intestinal weight in response to fasting and refeeding predominantly reflected

differences in jejunal but not ileal weights (Figure 2.2.b and 2.2.c). To identify specific

Glp2r+/+Glp2r-/-

0' 5' 15'

30' 0' 5' 15

'30

'0.0

0.4

0.8

1.2

* ****

* * *

Time (min)

Plas

ma

GLP

-2 (n

g/m

l)

Figure 2.1. Plasma GLP-2 levels in fasted and re-fed mice. Plasma GLP-2 levels were measured by a mouse GLP-2 enzyme-linked immunoassay in Glp2r+/+ and Glp2r-/- mice fasted for 24 hours (0�’) and re-fed for 5, 15 or 30 minutes as indicated (n=8-19). *=p<0.05, **=p<0.01 vs. fasted control 11

57

(a) Small Intestinal Weight (b) Jejunum Weight

Figure 2.2. Intestinal weight, crypt plus villus height, and villus epithelial cell number in mice fed ad libitum, deprived of food, and refed. (a) Small intestinal, (b) jejunum, and (c) ileum weight of 10- to 12-week-old Glp2r / mice and Glp2r+/+ littermate controls fed ad libitum on normal chow (n = 10 Glp2r+/+; n = 12 Glp2r / ) or deprived of food for 24 hours (n = 10 Glp2r+/+; n = 19 Glp2r / ) or refed for 24 hours after a 24-hour period of nonfeeding (n = 8 Glp2r+/+, n = 12 Glp2r / ). (d) Crypt plus villus height in Glp2r+/+ and Glp2r / mice deprived of food for 24 hours and refed for 24 hours. (e) Total number of epithelial cells per villus in jejunal sections of fasted and refed mice (n = 7 fasted Glp2r+/+; n = 8 refedGlp2r+/+; n = 11 fasted Glp2r / ; n=12 refed Glp2r / for d and e). There were no significant changes in final body weights of Glp2r+/+ and Glp2r / mice in each of the groups fed ad libitum, deprived of food, or refed. All values are expressed as the percentage of body weight (% BW). *P < .05; ***P < .001, as indicated and for (d) and (e), vs fasted.

(c) Ileum Weight

Fasted

Re-fed

Fed

(d) Crypt + Villus height (e) Villus epithelial cell number

Glp2r +/+ Glp2r -/-0.00.51.01.52.02.53.03.54.04.5 ** *

*

% B

W

Glp2r +/+ Glp2r -/-0

1

2

3 *****

*

% B

W

Glp2r +/+ Glp2r -/-0.0

0.2

0.4

0.6

0.8

1.0

1.2

% B

W

Glp2r +/+ Glp2r -/-0

100

200

300

400 ***

*

leng

th (u

m)

Glp2r +/+ Glp2r -/-0

40

80

120 ****

# of

cel

ls

58

(a) (b)

(c) (d)

Fasted Re-fed

Glp2r+/+

Glp2r-/-

Figure 2.3. Representative histological sections of mouse jejunum stained with hematoxylin-eosin from fasted Glp2r+/+ (a) and Glp2r-/- (c) and re-fed Glp2r+/+ (b) and Glp2r-/- (d) animals.

59

60

intestinal compartments responsive to nutrient-dependent signals, we analyzed jejunal crypt

and villus height in fasted and refed Glp2r+/+ and Glp2r / littermate control mice. A

significant increase in crypt plus villus height was detected in refed Glp2r+/+ mice (Figure

2.2.d; Figure 2.3.a,b); in contrast, although basal crypt plus villus height in the fasting state

was modestly greater, refeeding was not associated with an increase in crypt plus villus

height in Glp2r / mice (Figure 2.2.d; Figure 2.3.c,d). We next determined whether

refeeding-associated expansion of the gut epithelium reflects changes in the number and/or

size of cells. The total number of cells within villi increased significantly after refeeding in

Glp2r+/+ but not in Glp2r / mice (Figure 2.2.d).

To assess whether the failure to increase crypt plus villus height and cell number after

refeeding in Glp2r / mice reflected defective feeding-associated up-regulation of crypt cell

proliferation, we quantified proliferating BrdU+ cells along the crypt-villus axis. Most

proliferating cells were found in the crypt compartment along cell positions 5�–15 (Figure

2.4.a,b). The number of BrdU+ cells was significantly increased along the crypt plus villus

axis of refed Glp2r+/+ mice (P < .001 for cell positions 5�–15; Figure 2.4.a,c). In contrast,

refeeding was not associated with changes in the number of BrdU+ cells along the crypt-

villus axis in Glp2r / mice (Figure 2.4.b,c).

To identify candidate mediators underlying defective up-regulation of crypt cell

proliferation in the Glp2r / intestine, we analyzed the expression of genes encoding

previously identified downstream targets of GLP-2 action 106, 120, 125, 157. Basal levels of egf,

igf1r, kgf, and eNOS mRNA transcripts were significantly (P < .05) lower in the jejunum of

fasted Glp2r / mice compared with littermate Glp2r+/+ controls (Figure 2.5.a). Levels of

these transcripts remained unchanged or decreased in the refed state. Furthermore, the levels

of mRNA transcripts for egfr, kgf, igf-1, and epiregulin were significantly lower in the refed

Glp2r / intestine compared with refed Glp2r+/+ littermate controls (P < .05) (Figure 2.5). In

contrast, we did not observe changes in jejunum protein levels of ErbB1, ErbB2, IGF-1R, or

eNOS between Glp2r+/+ and Glp2r / mice in either the fasted or refed state (Figure 2.6).

Furthermore, no changes in mRNA or protein levels of egf, egfr, igf-1, and igf-1r were

detected in ileum of refed Glp2r+/+ vs. Glp2r / mice (Figures 2.7, 2.8).

Figure 2.4. Jejunal crypt cell proliferation during fasting and refeeding. (a and b) Positional analysis of BrdU+ cells along the crypt-villus axis in fasted and refed Glp2r+/+ (a) and Glp2r / (b) mice. Position 1 is designated as the first cell at the bottom of the crypt. (c) Total number of BrdU+ cells counted in positions 5�–15 along the crypt-villus axis. (n = 6 fasted Glp2r+/+; n = 8 refed Glp2r+/+; n = 8 fasted Glp2r / ; n = 9 refed Glp2r / ). ***P < .001 vs fasted control.

(c)

(a) (b)

Glp2r+/+

0 5 10 15 20 250.0

0.2

0.4

0.6

0.8

FastedRefed

Cell Position

Inci

denc

e of

Brd

U+

cells

Glp2r-/-

0 5 10 15 20 250.0

0.2

0.4

0.6

0.8

FastedRefed

Cell Position

Inci

denc

e of

Brd

U+

cells

Position 5-15

Glp2r+/+ Glp2r-/-0

20

40

60

80

*

***

Tota

l num

ber

of B

rdU

+ce

lls

Fasted

Re-fed

61

Figure 2.5. Analysis of gene expression in the jejunum of mice deprived of food and refed.Levels of mRNA transcripts normalized to levels of 18S are shown for jejunal RNA from fasted and refed Glp2r+/+ and Glp2r / mice as determined by real-time PCR. egf, epidermal growth factor; egf-r, epidermal growth factor receptor, igf-1, insulin-like growth factor-1; igf-1r, insulin-like growth factor-1 receptor; kgf, keratinocyte growth factor; eNOS, endothelial nitric oxide synthase; and ereg, epiregulin (n = 8 fasted Glp2r+/+; n = 8 refed Glp2r+/+; n = 12 fasted Glp2r / ; n = 12 refed Glp2r / ). *P < .05, **P < .01 vs fasted control; #P < .05, as indicated.

igf-1r

Glp2r+/+ Glp2r-/-0

10

20

30

*

#

Rel

ativ

e m

RN

A le

vels

ereg

Glp2r+/+ Glp2r-/-0

3

6

9#

Rel

ativ

e m

RN

A le

vels

igf-1

Glp2r+/+ Glp2r-/-0.0

0.2

0.4

0.6

#R

elat

ive

mR

NA

leve

ls

eNOS

Glp2r+/+ Glp2r-/-0.0

1.0

2.0

**

#

Rel

ativ

e m

RN

A le

vels

kgf

Glp2r+/+ Glp2r-/-0.0

2.5

5.0

7.5#

#

Rel

ativ

e m

RN

A le

vels

egf

Glp2r+/+ Glp2r-/-0.00

0.10

0.20

0.30

*

#R

elat

ive

mR

NA

leve

ls

egfr

Glp2r+/+ Glp2r-/-

#

Fasted

Re-fed

0

25

50

75

62

ErbB1

Glp2r+/+ Glp2r-/-0.0

2.5

5.0

7.5

10.0

12.5

15.0

17.5

Arb

itrar

y un

its

ErbB2

Glp2r+/+ Glp2r-/-0123456789

Arb

itrar

y un

its

IGF-1R

Glp2r+/+ Glp2r-/-0

1

2

3

4

5

Arb

itrar

y un

its

eNOS

Glp2r+/+ Glp2r-/-0

10

20

30

40

50

60

Arb

itrar

y un

its

Figure 2.6. Jejunum protein levels of ErbB1, ErbB2, IGF-1R, and eNOS are not different between Glp2r+/+ and Glp2r-/- mice either fasted or re-fed. (a) Hsp90 is shown as the loading control (n=3 mice per group) (b) Densitometric quantification of the Western blots shown.

FastedRe-fed

(a)

(b)

63

Figure 2.7. Analysis of gene expression in the ileum of fasted and re-fed mice. Levels of mRNA transcripts normalized to levels of 18S are shown for RNA from fasted and re-fed Glp2r+/+ and Glp2r-/- mice as determined by Real Time PCR. egf (epidermal growth factor), egf-r (epidermal growth factor receptor), erbb2, igf-1 (insulin-like growth factor-1), igf-1r (insulin-like growth factor-1 receptor). (n=8 per group). #=p<0.05 vs. fasted control as indicated

egf

Glp2r+/+ Glp2r-/-0.0

0.3

0.6

0.9

1.2

#

rela

tive

mR

NA

exp

ress

ion

leve

l

egfr

Glp2r+/+ Glp2r-/-0

5

10

15

20

25 #

rela

tive

mR

NA

exp

ress

ion

leve

l

igf-1

Glp2r+/+ Glp2r-/-0.0

0.2

0.4

0.6

0.8

1.0

rela

tive

mR

NA

exp

ress

ion

leve

l

igf-1r

Glp2r+/+ Glp2r-/-0

3

6

9

12

15

#

rela

tive

mR

NA

exp

ress

ion

leve

l

erbb2

Glp2r+/+ Glp2r-/-0

20

40

60

80

#

rela

tive

mR

NA

exp

ress

ion

leve

lFastedRe-fed

64

Figure 2.8. Ileum protein levels of ErbB1, ErbB2, IGF-1R, and eNOS are not different between Glp2r+/+ and Glp2r-/- mice either fasted or re-fed. (a) Protein levels of ErbB1, ErbB2, IGF-1R, and eNOS in fasted and re-fed Glp2r+/+ mice and Glp2r-/- littermates. Hsp90 is shown as the loading control. (n=3 mice per group) (b) Data correspond to the densitometric quantification of the Western blots shown.

ErbB1

Glp2r+/+ Glp2r-/-0

50

100

150

200

Arb

itrar

y un

its

ErbB2

Glp2r+/+ Glp2r-/-0

50

100

150

200

250A

rbitr

ary

units

IGF-1R

Glp2r+/+ Glp2r-/-0

50

100

150

Arb

itrar

y un

its

eNOS

Glp2r+/+ Glp2r-/-0

5

10

15

20

25

Arb

itrar

y un

itsFastedRe-fed

(a)

(b)

65

66

2.4.2 EGF but not IGF-1 rescues the refed intestinal phenotype in Glp2r / mice

Because EGF and IGF-1 have been implicated in the control of GLP-2�–dependent small

bowel growth 120, 125, we hypothesized that intestinal adaptation to refeeding occurs by GLP-

2 through the EGF and/or IGF-1 signaling pathways. To test this hypothesis, we administered

EGF and IGF-1 to separate groups of Glp2r / mice and littermate controls during the 24-

hour refeeding period. Administration of EGF had no effect on refed intestinal or jejunal

weights in Glp2r+/+ mice (Figure 2.9.a,b). In contrast, exogenous EGF rescued the adaptive

response to refeeding in the small bowel of Glp2r / mice (Figure 2.9). The trophic effects of

EGF were observed in the jejunum (Figure 2.9.b) but not the ileum (data not shown) of refed

Glp2r / mice. Moreover, the increase in small bowel and jejunal weights in EGF-treated

Glp2r / mice was nearly comparable to the small intestinal and jejunal weights of refed

Glp2r+/+ mice (Figure 2.9).

Unlike the actions of EGF, exogenous IGF-1 was unable to increase intestinal weight

in refed Glp2r / mice (Figure 2.10). The ability of EGF but not IGF-1 to enhance feeding-

associated mucosal adaptation was not due to differences in expression of receptors for these

ligands because IGF-1R and ErbB receptor levels were comparable in Glp2r+/+ vs. Glp2r /

mice (Figure 2.6). To ascertain whether the ErbB pathway, including downstream targets, is

actually functional and dynamically responsive to activation in Glp2r / mice, we treated

fasted Glp2r+/+ and Glp2r / mice with EGF. Levels of phosphorylated ErbB1, ErbB2, Shc,

Akt, and ERK1/2 were significantly increased to comparable levels in Glp2r / and Glp2r+/+

mice after EGF treatment, showing that the ErbB signaling network is intact and functional

despite the absence of GLP-2R signaling (Figure 2.9.c).

Small Intestinal Weight

Glp2r+/+ Glp2r-/-0

1

2

3

4* * *

% B

W

Jejunum Weight

Glp2r+/+ Glp2r-/-0

1

2

3* *

*

% B

W

Figure 2.9. Responsiveness of the murine small bowel to exogenous EGF administration. Small intestinal (a) and jejunum (b) weight for Glp2r+/+ and Glp2r / mice deprived of food for 24 hours, refed for 24 hours, or refed for 24 hours with exogenous EGF administered every 8 hours (n = 8 fasted Glp2r+/+; n = 8 refed Glp2r+/+; n = 12 fasted Glp2r / ; n = 12 refed Glp2r / ). All values are expressed as the percentage of body weight (% BW). *P < .05 vs fasted control. (c) Levels of ErbB-1, phospho-ErbB1, phospho-ErbB2, phospho-Shc, phospho-Akt, phospho-Erk1/2, and heat shock protein 90 (HSP90) in jejunal extracts from Glp2r+/+ and Glp2r / mice fasted for 24 hours then treated with vehicle or EGF for 15 minutes (1 g/g of BW subcutaneously, n = 2 mice per group, 2 independent experiments).

(a) (c)

(b)

Fasted

Re-fed

Re-fed + EGF

67

Small Intestinal Weight

Glp2r +/+ Glp2r -/-0

1

2

3

4

*****

% B

W

Jejunum Weight

Glp2r +/+ Glp2r -/-0

1

2

3

*

% B

W

Figure 2.10. Intestinal weight following 24 hours re-feeding with exogenous IGF-1 administration. Small intestinal (a) and jejunum (b) weight for Glp2r+/+ and Glp2r-/- mice re-fed for 24 hours or re-fed for 24 hours with exogenous IGF-1 administered t.i.d. 8 hours apart . (re-fed Glp2r+/+ n=8, re-fed Glp2r-/- n=17, IGF-1 treated re-fed Glp2r+/+ n=10; IGF-1 treated re-fed Glp2r-/- n=7). All values are expressed as percent body weight (%BW). *=p<0.05, **=p<0.01, ***=p<0.001 vs. re-fed control

Re-fedRe-fed + IGF-1

(a) (b)

68

69

2.4.3 ErbB signaling controls gene expression and cell proliferation in the refed small

bowel

The results of the above studies show that exogenous EGF is sufficient for restoration of the

adaptive intestinal response to refeeding in Glp2r / mice. To determine the importance of

endogenous basal ErbB signaling in the intestinal adaptation to refeeding, we examined gene

expression and mucosal adaptation in WT mice deprived of food for 24 hours and refed in

the presence or absence of the pan ErbB inhibitor CI-1033 120, 323. Fasting selectively

reduced mRNA levels for amphiregulin, hb-egf, and the immediate early genes phlda-1 and

c-fos (Figure 2.11, time 0). After refeeding a significant induction of mRNA transcripts for

amphiregulin, epiregulin, hb-egf, phlda-1, and c-fos was observed in WT mice.

Administration of CI-1033 before refeeding prevented the up-regulation of these genes

(Figure 2.11). Changes in gene expression during the refeeding time course were selective

for specific ErbB ligands because no changes were detected in the mRNA levels of egf, tgf- ,

igf-1, proglucagon, and kgf (Figure 2.11; Figure 2.12). As a positive control for the fasting

and refeeding experiment itself, we assessed levels of the nutrient sensitive enzyme pepck,

known to increase in the fasted small intestine and decrease during the refeeding period 324.

Consistent with previously results, pepck mRNA levels rose during the fasting period

followed by a decrease with refeeding (Figure 2.12). Together, these findings suggest that

expression of components of the ErbB signaling network is altered during fasting and

refeeding and treatment with CI-1033 selectively inhibits ErbB-related gene expression in the

refed state.

To assess whether defective regulation of ErbB-associated gene expression was

associated with detectable abnormalities in cell growth, we assessed crypt cell proliferation

in mice fed ad libitum or deprived of food for 24 hours and refed for 3 hours in the absence

or presence of CI-1033. Deprivation of food resulted in a decrease in the crypt cell

proliferation rate, and refeeding for 3 hours significantly increased the number of

proliferating (BrdU+) cells in WT mice (Figure 2.13.a,b). The refeeding-associated increase

in crypt cell proliferation was markedly attenuated in mice treated with CI-1033 (Figure

2.13.a,b). We also observed a significant increase in levels of phosphorylated Akt, a protein

known to be important for growth factor�–induced intestinal proliferation 325, in vehicle-

treated mice that was completely abrogated in CI-1033�–treated mice (Figure 2.13.c).

70

We next assessed whether loss of the GLP-2R was associated with defective

refeeding-associated expression of ErbB ligands. Levels of amphiregulin, hb-egf, and

epiregulin failed to increase in refed Glp2r / mice (Figure 2.14.a). Furthermore, refeeding-

induced activation of the downstream Erb target Akt was significantly attenuated in Glp2r /

vs. Glp2r+/+ mice (Figure 2.14.b). Taken together, these findings show the importance of

basal GLP-2R signaling coupled to ErbB activation for the intestinal adaptive response to

nutrient repletion.

Figure 2.11. Refeeding-induced changes in jejunal gene expression are selectively inhibited by CI-1033. Analysis of mRNA transcript levels of ErbB ligands (amphiregulin, epiregulin, hb-egf) and immediate early genes (c-fos, phlda-1) in jejunum of WT mice fed ad libitum (ad lib), after 24 hours of fasting (time 0, fasted), or after refeeding for 30, 90, or 180 minutes in the presence or absence of the pan ErbB inhibitor CI-1033 (n = 5 per group). *P < .05, **P < .01 vehicle vsCI-1033; ##P < .01 ad libitum fed vs fasted; $P < .05, $$P < .01 fasted vs refed.

ereg

ad lib 0 0.5 1.5 3.00.00

0.05

0.10

0.15

*

**$$

Time (hours)

Rel

ativ

e m

RN

A le

vels

c-fos

ad lib 0 0.5 1.5 3.00.00

0.05

0.10

0.15 ** *$$ $$

##

Time (hours)

Rel

ativ

e m

RN

A le

vels

hb-egf

ad lib 0 0.5 1.5 3.00.000

0.005

0.010

0.015

0.020

0.025

*

**$$

$$

##

Time (hours)

Rel

ativ

e m

RN

A le

vels

phlda-1

ad lib 0 0.5 1.5 3.00.000

0.005

0.010

0.015

0.020

0.025

**

***$

##

Time (hours)

Rel

ativ

e m

RN

A le

vels

areg

ad lib 0 0.5 1.5 3.00.00

0.04

0.08

0.12VehCI-1033

*

*

*

##

$$

$

Time (hours)

Rel

ativ

e m

RN

A le

vels

71

pepck

ad lib 0 0.5 1.5 3.00.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

Time (hours)

Rel

ativ

e m

RN

A le

vels

tgf-a

ad lib 0 0.5 1.5 3.00.0000

0.0025

0.0050

0.0075

Time (hours)

Rel

ativ

e m

RN

A le

vels

Figure 2.12. Re-feeding selectively modulates changes in intestinal gene expression independent of ErbB receptor activity(a-c). Analysis of mRNA transcript levels of pepck (a), tgf-alpha (b), and proglucagon (c), egf (d), Igf-1 (e),and kgf (f) in wildtype mice fed ad libitum, after 24 hours fasting (time 0), or following re-feeding for 30, 90 min, or 180 min in the presence or absence of the pan-ErbB inhibitor CI-1033. (n=5 per group)

proglucagon

ad lib 0 0.5 1.5 3.00.00

0.01

0.02

0.03

0.04

0.05 VehCI-1033

Time (hours)

Rel

ativ

e m

RN

A le

vels

(a) (b)

(c)egf

ad lib 0 0.5 1.5 3.00.000

0.001

0.002

0.003

VehCI-1033

Time (hours)

Rel

ativ

e m

RN

A le

vels

igf-1

ad lib 0 0.5 1.5 3.00.000

0.002

0.004

0.006

Time (hours)

Rel

ativ

e m

RN

A le

vels

kgf

ad lib 0 0.5 1.5 3.00.00

0.01

0.02

0.03

Time (hours)

Rel

ativ

e m

RN

A le

vels

(d)

(e) (f)

72

Figure 2.13. Jejunal crypt cell proliferation and levels of phosphorylated Akt during fasting and refeeding in the presence of CI-1033. (a) Positional cell analysis of BrdU+ cells along the crypt-villus axis and (b) incidence of BrdU positivity along position 5�–15 in mice fed ad libitum, deprived of food for 24 hours, and refed for 180 minutes with or without CI-1033. For clarity, standard error has been omitted for the data (a). Coefficients of variation were 33% (n = 4�–5) *P < .05; **P < .01, as indicated. (c) Jejunal levels of phosphorylated Akt (P-AKT) in mice fed ad libitum, after 24 hours of fasting (time 0), or after refeeding with or without CI-1033 for the indicated time periods (n = 4�–6 mice for ad lib and vehicle-treated groups; n = 3 mice for CI-1033�–treated group). A representative Western blot is shown. **P < .01, ***P < .001 vehicle vs. CI-1033�–treated mice.

BrdU Cell positional analysis

0 5 10 15 200.0

0.2

0.4

0.6

0.8

1.0

ad libitumFastedRefed 180'Refed 180' + CI-1033

Cell position

Inci

denc

e of

Brd

U+

cells

Position 5-15

0

20

40

60

80ad libFastedRefed 180'Refed 180' + CI-1033

*** p=0.0681

Tota

l num

ber

of B

rdU

+ce

lls

(a)

(b)

-30 0 30 90 1800

100

200

300

VehicleCI-1033

400500600700

Ad lib

*******

TIME (min)

P-A

KT

(arb

itrar

y un

its)

(c)

73

Amphiregulin

0 30 90 1800.00

0.01

0.02

Glp2r+/+Glp2r-/-0.02

0.040.060.08

Time (min)

Rel

ativ

e m

RN

A le

vels

Epiregulin

0 30 90 1800.00

0.02

0.04

0.06

Time (min)

Rel

ativ

e m

RN

A le

vels

hb-egf

0 30 90 1800.00

0.03

0.06

0.09

Time (min)

Rel

ativ

e m

RN

A le

vels

0 90 0 900

5

10

15

20Glp2r+/+Glp2r-/-

**

Time (min)

P-A

KT

(arb

itrar

y un

its)

Re-feeding

GLP-2R

ErbB network

p-Akt

Crypt cell proliferation

Intestinal mucosal growth

(a)

(b) (c)

ErbB inhibitionCI-1033

Glp2r-/-mice

Figure 2.14. Levels of ErbB ligands and phosphorylated Akt in the jejunum of Glp2r+/+ vsGlp2r / mice. (a) mRNA levels of amphiregulin, hb-egf, and epiregulin in mice of the indicated genotype fasted for 24 hours (time 0) and refed for 30, 90, and 180 minutes (n = 6�–8 per group). (b) Levels of phospho-Akt (P-AKT) in mice fasted for 24 hours and refed for 90 minutes (n = 4�–6 per group). **P < .01 Glp2r+/+ vs Glp2r / . A representative Western blot is shown. (c) Summary figure depicting the role of GLP-2R/ErbB signaling in refeeding-induced mucosal adaptation.

74

75

2.5 Discussion

The gut epithelium is a metabolically active organ with a high rate of cell proliferation that is

exquisitely sensitive to nutrient availability, reflecting in part energy requirements needed to

sustain the proliferation, migration, and differentiated functions of the gut mucosa.

Withdrawal of nutrients has been shown to be associated with a rapid reduction in the mass

of the small bowel, with concomitant evidence for increased apoptosis and a reduction in the

number and size of crypt units 224. A large number of changes occur in gene expression

networks in response to fasting, particularly in those linked to energy production and

utilization, cell growth, and apoptosis 326. Although complex changes in the expression of

genes also occur in the transition from fasting to refeeding 327, the molecular mediators

essential for control of intestinal adaptation remain poorly defined. Our data elucidate an

essential role for the GLP-2R in the control of the adaptive response to refeeding and

implicate the ErbB network as an important nutrient-sensitive pathway capable of restoring

defective intestinal adaptation that occurs in the refed Glp2r / mouse.

The observation that the GLP-2R is expressed on subsets of enteroendocrine cells 98,

102, 105, enteric neurons 102, 104, 105, and subepithelial myofibroblasts 106 has fostered efforts

directed at elucidating secondary mediators of GLP-2 action, with a predominant focus on

molecules with growth factor-like activity 328. The rapid expansion of the jejunal mucosa

after refeeding strongly implicates a role for 1 growth factors in the adaptive process.

Moreover, we have now shown that Glp2r / mice exhibit a profound defect in refeeding-

associated crypt cell proliferation. Hence, it seems logical to focus on candidate mediators of

GLP-2 action, principally keratinocyte growth factor (KGF), IGF-1, and EGF, to further

understand how loss of GLP-2R signaling results in defective intestinal adaptation. Although

exogenous KGF promotes intestinal growth in refed rats, the effects of KGF are prominent in

the colon, whereas KGF did not alter parameters of small bowel growth in rats deprived of

food 329. Similarly, although circulating IGF-1 and intestinal levels of IGF-1 mRNA

transcripts are reduced in the fasted state317, and the GLP-2 antagonist GLP-2(3-33) reduced

the plasma levels of IGF-1 in rats after refeeding 318, our data clearly show that exogenous

administration of IGF-1 did not rescue the defect in small bowel growth in fasted Glp2r /

mice.

76

In contrast several lines of evidence implicate an essential role for EGF/ErbB

signaling as an important component of the adaptive intestinal response to refeeding. First,

refeeding selectively induced intestinal expression of specific ErbB ligands. Furthermore,

inhibiting ErbB receptor activity with CI-1033 prevented the refeeding-associated induction

of epiregulin, amphiregulin, and hb-egf as well as their downstream target genes such as c-

fos, phlda-1,and Akt. Up-regulation of ErbB activity during refeeding appears to be critical

for crypt cell proliferation because treatment with the ErbB inhibitor CI-1033 significantly

reduced the number of BrdU+ cells. Strikingly, not only are key ErbB ligands (amphiregulin,

epiregulin, and hb-egf) upregulated in refed WT mice, the levels of these genes fail to

increase in refed Glp2r / mice. We previously demonstrated that pharmacologic GLP-2

administration increases expression of amphiregulin, epiregulin, and hb-egf. Our current

findings show that genetic disruption of the Glp2r results in defective up-regulation of these

genes during refeeding, in association with significantly reduced crypt cell proliferation.

Moreover, exogenous EGF rescues this refeeding associated in Glp2r / mice. Our data

highlighting the role of endogenous intestinal ErbB signaling in the transition from the fasted

to the refed state are consistent with data implicating exogenous luminal EGF in the

prevention of starvation-associated mucosal atrophy in the small bowel of rats deprived of

food 330.

Previous studies have shown that pharmacologic GLP-2 administration leads to Akt

activation in the porcine 118 and murine119 gut. We extend these findings by demonstrating

that refeeding is associated with pronounced Akt activation and that inhibition of ErbB

activity with CI-1033 significantly attenuated the refeeding-associated Akt activation in the

murine small bowel (Figure 2.13.c). Furthermore, Glp2r / mice have an impaired up-

regulation of intestinal Akt activity after refeeding. These findings are consistent with the

essential role of the phosphoinositol-3 kinase/Akt pathway in the control of normal and

neoplastic intestinal cell growth 325, 331 and provide further evidence linking endogenous

basal GLP-2R and ErbB activity to downstream signaling pathways regulating intestinal cell

growth (Figure 2.14.c).

Our recent studies have shown that both EGF and GLP-2, but not IGF-1 or KGF,

regulate an overlapping set of ErbB ligands and immediate early genes in the murine gut 120.

Intriguingly, exogenous administration of EGF has also been shown to increase the

77

circulating levels of enteroglucagon, and by implication GLP-2, in parenterally fed rats 332.

Hence, it is tempting to speculate that GLP-2 and 1 ErbB ligands represent components of a

nutrient-sensitive network functioning to maintain the mucosal epithelium in an optimized

state to enhance the capacity for nutrient absorption. Given the evolving complexity of GLP-

2 action, it seems likely that additional as yet unidentified mediators of GLP-2 action

contribute to maintenance of epithelial growth and function in the normal and adaptive small

bowel.

78

CHAPTER 3

The glucagon-like peptide-2 receptor modulates islet adaptation to metabolic stress in the ob/ob mouse

The work presented in this chapter corresponds to the following publication:

Bahrami J., Longuet C., Baggio L., Li K.K, Drucker D.J. Gastroenterology (2010) in press

Author contributions:

C. Longuet contributed to the design, execution, and analysis of experiments examining glucagon secretion in wildtype and Glp2r-/- mice, high fat fed Glp2r-/- mice, and detection of Glp2r in islets (Figures 3.1, 3.2, 3.3, 3.7, 3.8, 3.9). L. Baggio contributed to the design and execution of experiments involving ob/ob:Glp2r-/- mice (Figure 3.5b, 3.10d). K.K. Li contributed to the design, execution and analysis of experiments examining glucagon secretion in wildtype mice (Figure 3.1a-c).

79

3.1 Research Summary

Background & Aims: GLP-2 is a gut hormone that increases gut growth, reduces mucosal

cell death and augments mesenteric blood flow and nutrient absorption. Exogenous GLP-

2(1-33) also stimulates glucagon secretion and enhances gut barrier function with

implications for susceptibility to systemic inflammation and subsequent metabolic

dysregulation. We examined the importance of GLP-2R signalling for glucose homeostasis in

multiple models of metabolic stress, diabetes and obesity.

Methods: The importance of GLP-2 action was studied in wildtype, high fat fed, lean

diabetic, Glp2r / and ob/ob: Glp2r / mice as well as in isolated pancreatic islets. Fasted

and fed plasma glucagon and glycaemia, glucose tolerance, and pancreatic histology were

assessed.

Results: GLP-2 did not stimulate glucagon secretion from isolated pancreatic islets in vitro,

and exogenous GLP-2 had no effect on the glucagon response to insulin-induced

hypoglycaemia in vivo. Glp2r / mice exhibit no change in glycaemia and plasma glucagon

levels were similar in Glp2r / vs. Glp2r+/+ mice following hypoglycaemia or following oral

or intraperitoneal glucose challenge. Moreover, glucose homeostasis was comparable in

Glp2r / vs. Glp2r+/+ mice fed a high fat diet for 5 months or following induction of

streptozotocin-induced diabetes. In contrast, loss of the GLP-2R leads to increased glucagon

secretion and -cell mass, impaired intraperitoneal glucose tolerance, hyperglycaemia,

reduced -cell mass, and decreased islet proliferation in ob/ob: Glp2r / mice.

Conclusions: Our results demonstrate that although the GLP-2R is not critical for the

stimulation or suppression of glucagon secretion or glucose homeostasis in normal or lean

diabetic mice, elimination of GLP-2R signalling in obese mice impairs the normal islet

adaptive response required to maintain glucose homeostasis

80

3.2 Introduction

The control of glucose homeostasis is a tightly regulated process involving the interplay of

gut and pancreatic hormones, gastric motility, insulin sensitivity, neural signals and

regulation of hepatic glucose production. The gastrointestinal tract plays a key role in

glucose homeostasis in both the fasted and fed states. During fasting, the gut may act as a

gluconeogenic organ and contribute upwards of 20% of endogenous glucose production. In

the postprandial state, the gut contributes to the regulation of glucose homeostasis by

releasing multiple hormones, including the incretins glucagon-like peptide-1 (GLP-1) and

glucose-dependent insulinotropic peptide (GIP) 333. Both GLP-1 and GIP stimulate insulin

secretion yet exert contrasting effects on the pancreatic -cell and the regulation of glucagon

secretion. GLP-1 is a potent inhibitor of glucagon secretion in normal subjects under

euglycemic but not hypoglycemic conditions 271. GLP-1 also decreases glucagon levels in

patients with type 1 and 2 diabetes. While GLP-1 regulates glucagon secretion in vivo, the

mechanisms through which GLP-1 regulates -cell function may be indirect, as the presence

of the GLP-1 receptor (GLP-1R) on pancreatic -cells remains controversial 334, 335.

Moreover, recent studies implicate a role for somatostatin as a mediator of the GLP-1-

mediated inhibition of glucagon secretion via the somatostatin-2 receptor 336.

Glucagon-like peptide-2 (GLP-2) is a 33 amino acid proglucagon-derived peptide

structurally related to GLP-1. Exogenous administration of GLP-2 expands the surface area

of the intestinal mucosal epithelium via stimulation of crypt cell proliferation and inhibition

of apoptosis 337. Additional actions of GLP-2 include the rapid stimulation of hexose

transport 338, inhibition of gastric emptying and acid secretion 339, 340, and augmentation of

mesenteric blood flow 160, 162. The majority of GLP-2 actions appear to be indirect, as GLP-2

receptor (GLP-2R) expression has been localized to rare subsets of enteroendocrine cells,

enteric neurons, and intestinal myofibroblasts 102, 104-106, 341. The ability of GLP-2 to expand

mucosal surface area and enhance nutrient absorption has prompted clinical evaluation of

native GLP-2 and GLP-2 analogues in patients with enteral nutrient malabsorption due to

short bowel syndrome. The available data suggest that GLP-2-treated subjects exhibit

enhanced nutrient absorption without detectable changes in glucose homeostasis 173, 342.

81

Unlike GLP-1, GLP-2 has not been reported to modulate insulin secretion 343, 344.

However, recent studies demonstrated that GLP-2 infusion results in stimulation of glucagon

secretion in vivo. In healthy human volunteers, GLP-2(1-33) increased circulating glucagon

levels in the fasted and fed state 159 and perfusion of isolated rat pancreas with GLP-2

resulted in increased glucagon secretion with no effect on insulin or somatostatin secretion 103. Consistent with a direct effect of GLP-2 in islets, GLP-2R mRNA transcripts were

detected by real-time PCR and GLP-2R immunoreactivity was detected in rat and human

pancreatic -cells 103. Surprisingly, despite an increase in plasma glucagon levels, plasma

glucose levels were unchanged following GLP-2 administration to normal healthy human

subjects 159, 345. Thus, in humans and rats, acute GLP-2 infusion increases glucagon

secretion without changes in glucose homeostasis.

GLP-2 has also been implicated as a mediator of gut permeability that in turn impacts

the extent of endotoxemia and inflammation in mice with metabolic stress. Prebiotic

treatment of high fat fed ob/ob mice reduced multiple parameters of inflammation, reduced

gut permeability, and increased levels of GLP-2 346. Remarkably, a GLP-2R antagonist

reversed many of the beneficial metabolic actions of the prebiotic, whereas therapy with

GLP-2 reduced systemic and hepatic inflammation in ob/ob mice 346. Taken together, these

findings suggest that GLP-2 may be important for metabolic homeostasis and glucose

metabolism either through regulation of glucagon secretion and/or control of inflammation

and insulin action in models exemplified by the ob/ob mouse. Accordingly, we have now

examined the role of the GLP-2R in normal, glucose-intolerant and diabetic mice. We show

that endogenous GLP-2R signalling is not essential for control of glucagon secretion or

glucose homeostasis in normal chow or high fat fed mice or in mice with streptozotocin-

induced experimental diabetes. However, ob/ob: Glp2r / mice exhibited elevated levels of

glucagon, ambient hyperglycaemia, impaired intraperitoneal glucose tolerance and abnormal

allocation of - and -cell lineages. Taken together, these findings suggest that the

endogenous GLP-2R is required for the adaptation of the endocrine pancreas to metabolic

stress.

82

Materials and Methods

3.3.1 Peptides & Reagents

Exendin-4 was purchased from California Peptide Research Inc. (Napa, CA). Humulin R

insulin was from Eli Lilly (Toronto, ON). Synthetic human [Gly2] glucagon-like peptide-2

(h[Gly2]GLP-2) acetate was from Pepceuticals Ltd. (Nottingham, UK). Native GLP-2 was

purchased from Bachem Inc. (Torrance, CA). Streptozotocin (STZ), Hanks Balanced Salt

Solution (HBSS), Diprotin A, arginine, and TRI reagent were from Sigma (St. Louis, MO).

The 45% kcal high fat diet was obtained from Research Diets (New Brunswick, NJ).

3.3.2 Animals

Wildtype (WT) C57BL/6 mice were obtained from Taconic (Germantown, NY). Glp2r /

mice and littermate controls were generated at the Toronto General Hospital Animal

Resource Centre and genotyped as previously described 347, 348. Ob/ob: Glp2r / mice and

littermate controls were generated at the Toronto Centre for Phenogenomics by mating

heterozygote ob/+ mice (Jackson Laboratories, Bar Harbor, Maine) to homozygote Glp2r /

mice. Mice were genotyped using PCR from tail snip DNA for the Glp2r locus 347, 348 and

for leptin using two PCR reactions, one mutant-specific and one wildtype-specific as

previously described 349. Fat and lean mass were assessed using a whole body magnetic

resonance analyzer (Echo Medical Systems, Houston, Texas). All animals were maintained

under a 12 hour light/dark cycle and had free access to water and standard rodent chow

unless otherwise specified. All animal protocols were approved by the Toronto General

Hospital and Toronto Centre for Phenogenomics Animal Care Committee.

3.3.3 Glucagon secretion from pancreatic islets

Mouse islets were isolated from wildtype mice as described 350. Following isolation,

pancreatic islets were stabilized for 2 hours in HBSS containing 8.3 mM glucose and

stimulated with h[Gly2]GLP-2 (20 nM) or arginine (20 mM) for 30 minutes in the presence

of 2.8, 8.3, or 16.8 mM glucose. Glucagon levels were measured using a Lincoplex

endocrine assay (Millipore, Billerica, MA). Isolated pancreatic islets were obtained

separately for RNA analysis.

83

3.3.4 Insulin and glucose tolerance tests

Insulin tolerance tests (ITT) were carried out in mice following a 5 hour fast using 1.2 U

insulin/kg BW administered intraperitoneally. Glycaemia was monitored for 4 hours

following insulin administration from tail vein blood samples using a Contour glucometer

(Bayer, Mississauga, ON). Blood samples for measurement of plasma glucagon were

collected prior to, 20 min and 40 min after insulin injection. Oral and IP glucose tolerance

(OGTT, IPGTT) tests were carried out following an overnight fast and administration of

glucose (15% glucose, 1.5 mg/g body weight). Plasma samples were collected for

measurement of plasma glucagon prior to glucose administration and 15 min (OGTT) or 20

min (IPGTT) after glucose challenge.

3.3.5 Streptozotocin-induced diabetes

Diabetes was induced in Glp2r / mice and littermate controls via a single injection of

streptozotocin (STZ - 200mg/kg BW by intraperitoneal injection). STZ was prepared fresh

directly before injections to mice in a 0.1M sodium citrate solution pH 5.5. Control mice

were given 0.1M sodium citrate as the vehicle.

3.3.6 Feeding studies

For studies in high fat fed and STZ-diabetic mice, pre-weighed food was given to mice in

individual cages and re-weighed 24 hours later. For the ob/ob:Glp2r experiments, mice were

fasted overnight and food was then weighed 1, 2, 4, 8 and 24 hours following re-feeding.

3.3.7 Immunostaining and histological analysis

The pancreas was rapidly removed and a small fragment was immediately homogenized in

TRI reagent and frozen for RNA analysis. The remainder was cut into approximately 10

pieces, fixed in 10% formalin for 48 hours and embedded in paraffin for histological

analysis. Immunostaining was performed using a rabbit anti-insulin primary antibody (1:30

dilution; Dako, Glostrup, Denmark) followed by a biotinylated goat antirabbit secondary

antibody (1:200 dilution; Vector Laboratories, Burlingame, CA) or rabbit anti-glucagon

primary antibody (1:100 dilution, Cell Signalling, Beverley, MA) followed by an alkaline-

84

phosphatase conjugated goat anti-rabbit secondary antibody (1:100 dilution, Zymed).

Immunostained sections were scanned using the Scanscope Imagescope system at 20X

magnification (Aperio Technologies, Vista, CA). The number of positive pixels indicative of

insulin or glucagon staining was summed using an optimized positive pixel count algorithm

and normalized per total islet area (square millimeters) for each mouse. Alpha or beta cell

mass was then calculated by multiplying this value by the weight of the total pancreas. Cell

proliferation in the pancreas was determined by counting the number of Ki-67+ cells per

pancreatic islet and normalizing to the islet area ( m2) calculated using the Aperio software.

3.3.8 Real-time RT-PCR

Total RNA was isolated using TRI reagent according to the manufacturer�’s instructions and

subjected to reverse transcription using Supercript II and random hexamers (Invitrogen,

Carlsbad, CA). Real-time quantitative PCR was performed with the ABI Prism 7900

Sequence Detection System using TaqMan Gene Expression Assays (Applied Biosystems,

Foster City, CA) for proglucagon (Mm00801712_m1) and Glp2r (Mm01328477_m1).

Relative mRNA expression was quantified using the 2�– CT method, and18S ribosomal RNA

was analyzed as an endogenous control. RNA from islets was isolated using the RNeasy

mini kit according to the manufacturer�’s instructions (Qiagen, Mississauga, ON) and

subjected to reverse transcription as described above. The sequence for the 5�’ and 3�’ GLP-

2R primers were as follows: [CTTCCTCGCCCTGCTTCT] and

[CTCTCTTCCAGAATCTCCTCCA]. The generated PCR product was transferred to a

nylon membrane after gel electrophoresis and hybridization was carried out using an internal

primer [GCACACGCAATTACATCCAC] under standard conditions.

3.3.9 Plasma and tissue metabolites and hormones

Blood samples were collected by cardiac puncture or tail vein. For plasma preparation, blood

samples were supplemented with trasylol, EDTA and diprotin A and centrifuged at 6,000

rpm at 4°C for 5 min. Quantification of plasma GLP-2 was carried out using the ALPCO

enzyme immunoassay kit for mouse GLP-2 (Alpco Diagnostics, Salem, NH) according to the

manufacturer�’s instructions. Quantification of active GLP-1, glucagon and insulin from

endpoint cardiac bleedings was carried out using a Meso Scale endocrine assay

85

(Gaithersburg, Maryland) according to manufacturer�’s instructions. Glucagon levels in

plasma collected during ITT, OGTT and IPGTT, or supernatant from islets were measured

using a Lincoplex endocrine assay (Millipore, Billerica, MA). Pancreatic insulin content was

measured as previously described 351.

3.3.10 Statistical Analyses

All results are expressed as mean + standard error of the mean. The Prism software package

(version 4; GraphPad Software, La Jolla, CA) was used for statistical analyses. Statistical

significance was established by student�’s t-test or two-way ANOVA with a Bonferroni post-

hoc analysis as appropriate. Statistical significance was defined as p<0.05.

3.4 Results

3.4.1 GLP-2 does not stimulate glucagon secretion in mice

We first assessed whether activation of GLP-2R signalling under conditions of

hypoglycaemia would further enhance glucagon secretion and lead to a more rapid or

exaggerated glycemic recovery from insulin-induced hypoglycaemia. Acute administration

of the DPP-4-resistant GLP-2 receptor agonist h[Gly2]GLP-2 85 did not alter glucose

excursion (Fig 3.1.a) or plasma glucagon levels (Fig 3.1.b) during an insulin tolerance test

(ITT) in wildtype mice. In contrast, the GLP-1R agonist exendin-4 blunted the recovery of

glucose and attenuated the plasma glucagon response to hypoglycaemia (Figure 3.1.a,b).

Concomitant administration of h[Gly2]-GLP-2 had no effect on levels of glucose or glucagon

in the presence or absence of exendin-4 (Figure 3.1.a,b). We next determined whether

chronic GLP-2R activation leads to changes in levels of glucose or glucagon by

administering native GLP-2(1-33) to WT mice twice daily for 7 weeks. Plasma glucose

levels increased significantly in GLP-2-treated mice (Figure 3.1.c), however plasma

glucagon levels were decreased in GLP-2-treated mice (Figure 3.1.d). No significant changes

in proglucagon or GLP-2R mRNA transcripts were observed in pancreas (Figure 3.1.e,f) or

jejunum of GLP-2-treated WT mice (Figure 3.2).

(a)

(b)

0123456789

10

-10 40 90 140 190 240

PBSGLP-2Ex-4Ex-4 + GLP-2

***

Min

Glu

cose

(mM

)

(c)

012345678

PBSGLP-2 *

Glu

cose

(mM

)(d)

0102030405060

*

Plas

ma

gluc

agon

(p

mol

/L)

(e)

0

10

20

30

40

50 Pancreas

Prog

luca

gon

mR

NA

ex

pres

sion

(rel

ativ

e to

18S

)

(f)

0.0

0.1

0.2

0.3

0.4

0.5 Pancreas

GLP

2R m

RN

A e

xpre

ssio

n(r

elat

ive

to 1

8S)

020406080

100120140160180

PBSEx-4GLP-2Ex-4 + GLP-2

-10 0 20 40

**

* *

Min

Plas

ma

gluc

agon

(pm

ol/L

)

Figure 3.1. Exogenous administration of GLP-2 does not stimulate glucagon secretion in mice. Glycemia (a) and glucagon levels (b) during an insulin tolerance test (1.2 U insulin /kg) in wildtype mice fasted for 5 h. Exendin-4 (24 nmol/kg) and/or h[Gly2]GLP-2 (0.25 mg/kg) were administered IP 10 minutes prior to insulin. (n=12). (c-f) Wildtype mice were injected with native GLP-2 for 7 weeks (5 g/mouse twice daily). Glycemia (c) and plasma glucagon levels (d) were measured 15 minutes after the last peptide injection. Proglucagon (e) and GLP2R mRNA levels (f) were measured in whole pancreas using real time PCR and 18S as a control gene. (n=5-6) * = p<0.05, *** = p<0.001 compared to PBS-treatedcontrol.

86

0

5

10

15

20

25

30Jejunum

Prog

luca

gon

mR

NA

le

vels

(rel

ativ

e to

18S

)

0

200

400

600

800

1000Jejunum

GLP

2R m

RN

A le

vels

(rel

ativ

e to

18S

)

Figure 3.2. Proglucagon and GLP-2R gene expression. Proglucagon (a) and GLP-2R (b) mRNA expression levels in jejunum of wildtype mice treated with PBS (white bars) or native GLP-2 (black bars) for 7 weeks.

(a) (b)

87

88

To examine whether the absence of the endogenous GLP-2 receptor was associated

with changes in the acute regulation of glucagon secretion, we studied glucose homeostasis

under conditions of hypo-or hyperglycaemia in Glp2r / mice. Glucose excursion was

comparable following an ITT, OGTT, or IPGTT in Glp2r / vs. Glp2r+/+ littermate control

mice (Figure 3.3.a,c,e). Plasma glucagon levels were higher 20 and 40 minutes following

insulin challenge in Glp2r / compared to Glp2r+/+ mice (Figure 3.3.b) but these trends failed

to reach statistical significance. In contrast, plasma glucagon levels were similar in Glp2r /

vs. Glp2r+/+ mice after oral or intraperitoneal glucose challenge (Figure 3.3.d,f). Hence, loss

of basal GLP-2R signalling does not perturb the control of glucagon secretion under a range

of glucose levels.

3.4.2 Glp2r / mice are not protected from diet-induced obesity or glucose intolerance

As GLP-2 regulates barrier function and gut microbiota-associated systemic inflammation

following high fat feeding in obese mice 346, we hypothesized that loss of the GLP-2R may

predispose mice to enhanced inflammation and insulin resistance. To determine whether

elimination of the murine Glp2r gene leads to abnormalities in glucose homeostasis in mice

with metabolic stress 352, we fed Glp2r / and Glp2r+/+ littermate control mice a 45% kCal

high fat diet (HFD) or a standard chow diet for 5 months. Body weight (Figure 3.4.a) and fat

mass (Figure 3.5.b) were significantly increased and food intake and lean body mass were

decreased (Figure 3.5.b,c) in HFD mice, but no genotypic differences were observed in

Glp2r+/+ vs. Glp2r / mice. Despite prolonged high fat feeding and expansion of adipose

tissue mass, there was no difference in oral glucose tolerance in Glp2r+/+ vs. Glp2r / mice

after 3 months on the standard vs. high fat diet (Figure 3.4.b,c). Furthermore, although

ambient glycaemia was increased in high fat fed mice (compare Figure 3.4.d with 3.4.e),

ambient, fed and fasted glucose levels measured after 4 months of HFD were comparable in

Glp2r / vs. Glp2r+/+ mice (Figure 3.4.e). Similarly, although -cell mass increased as a result

of high fat feeding, no differences were observed in -cell mass (Figure 3.4.f), or pancreatic

or intestinal weights (Figure 3.5.d,e) in Glp2r+/+ vs. Glp2r / mice on a HFD.

(a)

Figure 3.3. Endogenous GLP-2R signaling does not modulate glycemia or glucagon secretion during insulin or glucose tolerance tests. Glycemia (a) and glucagon levels (b) during an insulin tolerance test (1.2 U insulin /kg) in Glp2r-/- mice and Glp2r+/+ littermate controls fasted for 5h. Glycemia (c, e) and glucagon levels (d, f) during an intraperitoneal (c, d) or oral (e, f) glucose tolerance test in Glp2r-/- mice and littermate controls fasted overnight for 16 hours (n=3-6). No significant differences were observed between genotypes.

02468

10121416

0 20 40 60 80 100 120

Glp2r+/+Glp2r-/-

Min

Glu

cose

(mM

)

012345678

0 40 80 120 160 200 240Min

Glp2r+/+Glp2r-/-

Glu

cose

(mM

)

02468

1012141618

0 20 40 60 80 100 120

Glp2r+/+Glp2r-/-

Min

Glu

cose

(mM

)

020406080

100120140160

Glp2r+/+Glp2r-/-

Min 0 20 40

Plas

ma

gluc

agon

(pm

ol/L

)

0

5

10

15

20

Min 0 15Plas

ma

gluc

agon

(pm

ol/L

)

0

5

10

15

20

Min 0 20Plas

ma

gluc

agon

(pm

ol/L

)

(c)

(e)

(d)

(f)

(g)

89

0

5

10

15

0 20 40 60 80 100 120

Standard chow

Glp2r+/+Glp2r-/-

0

5

10

15

0 20 40 60 80 100 120

High fat diet

Glp2r+/+Glp2r-/-

(a)

(b) (c)

Figure 3.4. Endogenous GLP-2R signaling does not modify glucose homeostasis under a high fat diet challenge. Glp2r-/- mice and littermate controls were fed a high fat (45% kcal from fat) or a standard chow diet for 5 months, starting at the age of 16 weeks. (a) Body weight is shown for up to 25 weeks on standard chow or high fat diet. Oral glucose tolerance was assessed in mice fed a standard rodent chow diet for 3 months (b) and in age-matched mice fed a high fat diet (c). Ambient, overnight fasted, and 1 hour re-fed glycemia of mice on standard chow diet (d) or high fat diet (e). (f) Beta cell mass for Glp2r-/- and littermate controls on standard chow or high fat diet. * = p<0.05, ** = p<0.01, *** = p<0.001 compared to standard chow fed mice.

Min Min

Glu

cose

(mM

)

Glu

cose

(mM

)

0

10

20

30

40

50

0 5 10 15 20 25Wks on diet

Glp2r+/+Glp2r+/+Glp2r-/-Glp2r-/-

High fat diet

***

Bod

y w

eigh

t (g)

Standard chow

High fat dietStandard chow

0

2

4

6

8

10

12

Ambient Fast Refed

Glp2r+/+Glp2r-/-

Ambient Fast Refed

(d) (e)

0

2

4

6

8

10

12 Glp2r+/+Glp2r-/-

*

* *

*** ** **

Glu

cose

(mM

)

Glu

cose

(mM

)

Standard chow High fat diet

Standard chow High fat diet

Bet

a ce

ll m

ass

(mg)

01234567

Glp2r+/+Glp2r-/-

(f)

90

Figure 3.5. Food intake, body fat composition, pancreas and small intestinal weight of high fat fed Glp2r-/- mice and controls. Food intake (a), body fat composition (b,c), pancreas (d) and small intestinal (e) weight in Glp2r-/- and Glp2r+/+ mice fed a 45% kCal high fat diet or standard chow for 5 months. *=p<0.05, **=p<0.01 *** = p<0.001, vs standard chow fed group of same genotype.

(a)

0

1

2

3

4

5

High fat dietStandard chow

***

Food

(g)

Glp2r+/+Glp2r-/-

0%

10%

20%

30%

40%

50%

Glp2r+/+Glp2r-/-

High fat dietStandard chow

******

Fat m

ass

(% B

W)

0%

20%

40%

60%

80%

100% Glp2r+/+Glp2r-/-

High fat dietStandard chow

*** ***

Lean

mas

s (%

BW

)

0.0%

0.2%

0.4%

0.6%

0.8%

1.0%

1.2%

High fat diet

Glp2r+/+Glp2r-/-

Standard chowPa

ncre

as w

eigh

t (%

BW

)

0%

1%

2%

3%

4%

High fat diet

Glp2r+/+

Glp2r-/-

*** **

Standard chow

Smal

l bow

el w

eigh

t (%

BW

)

(d)

(b)

(c)

(e)

91

92

3.4.3 GLP-2R signalling does not modify glucose homeostasis in lean diabetic mice

As the presence or absence of GLP-1R signalling modifies the susceptibility to apoptosis and

the severity of hyperglycaemia following STZ administration 353, we assessed whether -cell

injury and the severity of experimental diabetes would be modified by the loss of the GLP-

2R. A single administration of STZ caused a rapid increase in blood glucose (fed and fasted)

(Figure 3.6.a,b), a decrease in body weight (Figure 3.6.c), and an increase in food intake

(Figure 3.6.d). However no differences in these parameters were detected in Glp2r+/+ vs.

Glp2r / mice. As partial attenuation of GLP-2 activity reduced intestinal adaptation to

experimental diabetes in rats 217, we assessed intestinal and pancreatic mass in diabetic mice.

Intestinal and pancreas weight increased significantly in STZ-treated mice compared to

vehicle-treated non-diabetic controls but these parameters were comparable in Glp2r+/+ vs.

Glp2r / mice (Figure 3.6.e,f).

3.4.4 Loss of GLP-2R signalling modifies glucose homeostasis and islet adaptation in

obese mice

As STZ-induced diabetes is characterized by -cell destruction associated with insulin

deficiency and weight loss, we examined whether basal levels of GLP-2R signalling

modified glucose homeostasis and glucagon secretion in a genetic model of obesity,

inflammation, and insulin resistance via generation and analysis of obese ob/ob: Glp2r /

mice. Body weight (Figure 3.7.a), lean and fat mass (Figure 3.8.a,b), food intake (Figure

3.8.c), energy expenditure and locomotion (Figures 3.9) were not different between ob/ob:

Glp2r / mice and littermate controls. Despite similar body weight (Figure 3.7.a), fasting and

fed glucose levels were significantly increased in ob/ob: Glp2r / vs. ob/ob: Glp2r+/+ mice

(Figure 3.7.b) in association with modest increases in plasma glucagon in ob/ob: Glp2r /

mice (Figure 3.7.c). Furthermore, pancreas weight was significantly increased in ob/ob:

Glp2r / mice (Figure 3.8.d). To understand the mechanism(s) contributing to increased

glycaemia and glucagon levels in ob/ob: Glp2r / mice, we quantified - and -cell mass in

mice of different genotypes. Histological analysis revealed significant increases in -cell

mass and decreased -cell mass in ob/ob: Glp2r / mice (Figure 3.7.d,e).

1 7 1317.5

20.0

22.5

25.0

27.5

Day

Bod

y w

eigh

t (g)

Figure 3.6. Endogenous GLP-2R signaling and STZ-induced diabetes. Morning blood glucose (a), fasting blood glucose (b), body weight (c), 24 hour food intake (d) and small intestine (e) and pancreas (f) weight of diabetic Glp2r-/- and Glp2r+/+ littermate controls. (n=6-9). * = p<0.05, *** = p<0.001 vs. vehicle-treated control.

(a)

Glp2r +/+ Glp2r -/-0

3

6

9*** ***

24 h

our

food

inta

ke (g

)

Glp2r +/+ Glp2r -/-0.0

2.5

5.0

7.5 ******

Smal

l Int

estin

al w

eigh

t(%

BW

)

Glp2r +/+ Glp2r -/-0.0

0.3

0.6

0.9

1.2 **

Panc

reas

wei

ght

(% B

W)

Glp2r +/+ Glp2r -/-0

5

10

15

20

VehSTZ

****

Fast

ing

gluc

ose

(mM

)

(c)

(e)

(d)

(b)

(f)

1 3 5 7 9 11 130

5

10

15

20

25

30

35Glp2r+/+ & VehGlp2r+/+ & STZ

Glp2r-/- & VehGlp2r-/- & STZ

Day

Glu

cose

(mM

)

93

Figure 3.7. Role of GLP-2R signaling in the ob/ob mouse. Body weight (a), fasted and endpoint fed blood glucose levels (b), and plasma glucagon levels (c) are shown for 8-12 week old ob/ob:Glp2r-/- mouse and littermate controls. Alpha and beta cell mass (d), histology (e) and incidence of Ki-67+ cells (f) in islets of ob/ob:Glp2r-/- mouse and littermate ob/ob:Glp2r+/+ controls. (n=11-30). * = p<0.05, ** = p<0.01 vs. ob/ob:Glp2r+/+ control.

(a)

**

050

100150200250300350

Plas

ma

gluc

agon

(pg/

mL)

Glu

cose

(mM

)

Fasted Fed5

10

15

20 ob/ob:Glp2r+/+ob/ob:Glp2r+/-ob/ob:Glp2r-/-

*

*

ob/ob:Glp2r+/+ob/ob:Glp2r-/-

0.00.10.20.30.40.50.6

Alpha cells Beta cells0

2

4

6

8

10

Alp

ha c

ell m

ass

(mg) B

eta cell mass (m

g)

**

Ob/ob:Glp2r+/+

Ob/ob:Glp2r-/-

Insulin Glucagon

8 9 10 11 1237.540.042.545.047.550.052.555.057.5

ob/ob:Glp2r+/+ob/ob:Glp2r+/-ob/ob:Glp2r-/-

Weeks

Bod

y w

eigh

t (g)

0.00000

0.00001

0.00002

0.00003

0.00004

0.00005

0.00006

0.00007

*

ki-6

7+ c

ells

/ um

2 are

a

(d)(c)

(e)

(f)

(b)

94

ob/ob:Glp2r+/+ob/ob:Glp2r+/-ob/ob:Glp2r-/-

0

10

20

30

40

Lean

Mas

s (%

BW

)

0

10

20

30

40

50

Fat M

ass

(% B

W)

Hours 1 2 4 8 240.00

0.02

0.04

0.06

0.08

0.10

0.12

ob/ob:Glp2r+/+ob/ob:Glp2r+/-ob/ob:Glp2r-/-

Food

inta

ke (g

food

/gB

W)

0.00

0.25

0.50

0.75*

Panc

reas

wei

ght

(% B

W)

Figure 3.8. Food intake, body fat composition, pancreas and small intestinal weight of ob/ob:Glp2r-/- mice and controls. Body composition (a,b), 24 hour food intake (c), pancreas weight (d), and small intestinal weight (e) in ob/ob:Glp2r-/- mice and littermate controls. *=p<0.05, vs. ob/ob:Glp2r+/+ littermate control.

0.0

0.5

1.0

1.5

2.0

2.5

Smal

l int

estin

al w

eigh

t(%

BW

)

(a)

(b)

(d)

(c)

(e)

95

96

Immunohistochemistry for Ki-67, a marker of cell proliferation, demonstrated impaired islet

cell proliferation despite the stimulus of more severe hyperglycaemia in ob/ob: Glp2r / mice

(Figure 3.7.f).

To further assess the functional metabolic phenotype of the ob/ob: Glp2r / mouse,

we performed glucose and insulin tolerance tests. Surprisingly, oral glucose tolerance was

improved (Figure 3.10.a) in association with increased levels of plasma insulin (Figure

3.11.a) and GLP-1 (Figure 3.11.b) in ob/ob:GLP-2R-/- vs. ob/ob: Glp2r+/+ mice. Plasma

glucagon levels did not change or trended lower after oral glucose with no genotype

differences (Figure 3.10.b). In contrast, and consistent with observations of ambient and

fasting hyperglycaemia and hyperglucagonemia (Figure 3.10.d), intraperitoneal glucose

tolerance was impaired (Figure 3.10.c) without significant differences in levels of plasma

insulin (Figure 3.11c) or glucagon (Figure 3.10.d) across genotypes. No difference in

glucose excursion or recovery from hypoglycaemia was detected following insulin tolerance

testing, an indirect index of insulin sensitivity, in ob/ob: Glp2r / vs. ob/ob: Glp2r+/+ mice

(Figure 3.10.e). Intriguingly, plasma levels of GLP-1 (Figure 3.11.b), and GLP-2 (Figure

3.11.d) were significantly elevated in random fed ob/ob: Glp2r / mice. Taken together,

these findings demonstrate that GLP-2R signalling is important for control of islet cell

proliferation, - and -cell mass and glucose homeostasis in the ob/ob genetic background.

We next examined whether activation of the GLP-2 receptor directly modulates

glucagon secretion from isolated pancreatic islets. h[Gly2]GLP-2 had no effect on glucagon

release from murine islets cultured at 2.8, 8.3 or 16.8 mM glucose, whereas glucagon

secretion was significantly increased following exposure to arginine (Figure 3.12.a).

Moreover, Glp2r mRNA transcripts were undetectable in RNA from wild-type mouse islets

(Figure 3.12.b), whereas GLP-1R mRNA transcripts were abundant in the same islet RNA

samples (Figure 3.7.b-right panel). Reverse-transcriptase PCR using RNA from isolated

pancreatic islets of wildtype and ob/ob mice followed by hybridization of the PCR products

with a Glp2r-specific oligonucleotide probe did not detect Glp2r RNA transcripts in any of

the samples (Figure 3.12.c) while the GLP-1R was easily detected in the same islet samples

(Figure 3.12.d).

Figure 3.9. Oxymax and locomotion studies in ob/ob:Glp2r-/- mice and controls. Oxygen consumption (a), carbon dioxide output (b), and locomotor activity (c,d) in ob/ob:Glp2r-/- mice and littermate controls.

11 13 15 17 19 21 23 1 3 5 7 9

1500

2000

2500

3000

ob/ob:Glp2r+/+ob/ob:Glp2r-/-

Time of Day

oxyg

en c

onsu

mpt

ion

(mL/

kg B

w/h

)

1000

1500

2000

2500

3000 ob/ob:Glp2r+/+ob/ob:Glp2r-/-

CO

2 ou

tput

(mL/

kg B

w/h

)

11 13 15 17 19 21 23 1 3 5 7 9Time of Day

0

1000

2000

3000ob/ob:Glp2r+/+ob/ob:Glp2r-/-

Tota

l act

ivity

(C

ount

s/h)

11 13 15 17 19 21 23 1 3 5 7 9Time of Day

0

500

1000

1500 ob/ob:Glp2r+/+ob/ob:Glp2r-/-

Am

bula

tory

act

ivity

(C

ount

s/h)

11 13 15 17 19 21 23 1 3 5 7 9Time of Day

(a)

(b)

(d)

(c)

97

Figure 3.10. Glucose tolerance and circulating glucagon levels in ob/ob:Glp2r-/- mice. Glycemia (a) and plasma glucagon levels (b) during an oral glucose tolerance test in ob/ob:Glp2r-/- mice and littermate controls. Area under the curve (AUC, 0-120 min) for ob/ob:Glp2r+/+ mice = 1708.6 and for ob/ob:Glp2r-/- = 1279.1, p=0.017 as assessed by student�’s t-test. Glycemia (c), and plasma glucagon levels (d) following an intraperitoneal glucose tolerance test in ob/ob:Glp2r-/- mice and littermate controls. Area under the curve (AUC, 0-120min) for ob/ob:Glp2r+/+ mice = 2102.3 and for ob/ob:Glp2r-/- = 2749.2, p=0.012 as assessed by student�’s t-test. Insulin tolerance test (e) in ob/ob:Glp2r-/- mice and littermate controls. (n=11-30). *=p<0.05, **=p<0.01 vs. ob/ob:Glp2r+/+ control

(b)OGTT

0 20 40 60 80 100 1200

5

10

15

20

25

30

35

ob/ob:Glp2r+/+

ob/ob:Glp2r+/-

ob/ob:Glp2r-/-

***

**

Min

Glu

cose

(mM

)

0

500

1000

1500

2000

**

AU

C (0

-120

min

)0 10 30

0

25

50

75 ob:Glp2r+/+ob:Glp2r+/-ob:Glp2r-/-

Min

Plas

ma

gluc

agon

(pM

)

IPGTT

0 20 40 60 80 100 1200

10

20

30

40

*

* *

Min

Glu

cose

(mM

)

0

1000

2000

3000 *

AU

C (0

-120

min

)

0 10 300

50

100

150

200

*

Min

Plas

ma

gluc

agon

(pM

)

ITT

0 20 40 60 80 100 1205

10

15

20

*

Min

Glu

cose

(mM

)

(c)

(e)

(d)

(a)

98

Figure 3.11. Plasma insulin, GLP-1 and GLP-2 levels in ob/ob:Glp2r-/- mice and controls.Plasma insulin during an oral (a) and IP (b) glucose tolerance test at time 0, 10 and 30 min following glucose load. Plasma active GLP-1 (c) and GLP-2 (d) levels from mice (n=2-30) *=p<0.05, ***=p<0.001 vs. ob/ob:Glp2r+/+ controls.

0 10 300

500

1000

1500

Ob/ob:Glp2r+/+Ob/ob:Glp2r+/-Ob/ob:Glp2r-/- *

Min

Plas

ma

insu

lin (p

M)

0 10 300

1000

2000

3000

Min

Plas

ma

insu

lin (p

M)

0

1

2

3 *

Plas

ma

GLP

-2 (n

g/m

L)

0

50

100

150

200

250 ***

Plas

ma

GLP

-1 (a

ctiv

e)pg

/mL

(a)

(b)

(c)

(d)

99

Figure 3.12. GLP-2R signaling does not regulate glucagon secretion from isolated pancreatic islets.(a) Mouse islets were cultured for 2h in HBSS containing 8.3 mM glucose, then stimulated with Gly2-GLP-2 (20 nM) or arginine (20 mM) for 30 min in the presence of 2.8, 8.3 or 16.8 mMglucose. Glucagon levels in the supernatant were measured using a Lincoplex assay. (b) GLP2R mRNA levels measured in jejunum, whole pancreas, and islets and GLP-1R RNA was measured in islets prepared from wildtype mice. 18S was used as an internal control gene. (n=3) (c) RT-PCR followed by hybridization of PCR products with a Glp2r-specific oligonucleotide probe for RNA from ob/ob islets (lanes 1 and 2), WT islets (lane 3), mouse jejunum RNA (lanes 4 and 5) and a Glp2r-/- jejunum RNA sample (lane 6). (d) RT-PCR for the mouse GLP-1 receptor (mGLP-1R) using RNA from ob/ob islets (lanes 1 and 2) or WT islets (lane 3) or negative control (lane 4). *=p<0.05, **= p<0.01 compared to control untreated islets.

0

5

10

15

20

25

30Control GLP2 Arginine

Glucose (mM) 2.8 8.3 16.8

*

*

**

Glu

cago

n (p

mol

/L/1

0 is

lets

/30m

in)

0

1

2

3

4

5

GLP

2R m

RN

A e

xpre

ssio

n(r

elat

ive

to 1

8S)

050

100150200250300350

GLP1R

mR

NA

expression(relative to 18S)

4 51 2 3 6

1.5 kb mGLP-2R

1 2 3 4

mGLP1R RT-PCR1.5 kb

(a)

(b)

(c)

(d)

100

FITC

1 40

50

100

150

200

250

300

350

ob/ob:Glp2r+/+ob/ob:Glp2r-/-

Time (hours)

FITC

ng

n=11n=5

Figure 3.13. Chronic high fat feeding was carried out to induce a proinflammatory state in ob/ob:Glp2r-/- mice and littermate ob/ob:Glp2r+/+ mice (60% high fat diet for 4 weeks). After 2 weeks on the high fat diet, in vivo gut permeability was assessed by gavaging fasted mice with fluorescent dextran-FITC (500mg/kg BW) and measuring dextran-FITC in plasma collected at 1 and 4 hours following oral gavage. No detectable changes in plasma levels of FITC dextran were observed between ob/ob:Glp2r+/+ and ob/ob:Glp2r-/- mice at either time point.

101

102

3.5 Discussion

The majority of studies of GLP-2 action have focused on its intestinotrophic and

cytoprotective actions in the gastrointestinal tract. More recent experiments have suggested

that GLP-2 receptor signalling may also influence glucose metabolism and insulin action.

Studies in humans demonstrated that acute exogenous administration of native GLP-2(1-33)

was associated with increased circulating levels of plasma glucagon 159, 345. Exogenous

administration of GLP-2(1-33) in healthy human volunteers increased circulating glucagon

levels in both the fasting and postprandial state, with associated increases in levels of

triglycerides and free fatty acids 159 but without changes in gastric emptying. Moreover,

GLP-2(1-33) increased glucagon levels in healthy humans without changes in circulating

GLP-1, GIP, insulin or glucose 345. In contrast, there is no information about the effects of

degradation-resistant GLP-2 analogs on glucagon secretion, and whether chronic GLP-2

administration perturbs glucagon or glucose homeostasis in humans has not been carefully

examined.

The mechanisms underlying the GLP-2-dependent stimulation of glucagon secretion

in human subjects remains unclear. The GLP-2 receptor was localized using

immunohistochemistry to human and rat -cells, and perfusion of rat islets with GLP-2(1-33)

increased glucagon secretion, without changes in levels of somatostatin or insulin 103.

Furthermore, GLP-2 attenuated the glucagonostatic actions of co-administered GLP-1 in

perfused rat islets. In contrast, we were unable to detect GLP-2R mRNA transcripts in mouse

islets, and h[Gly2]GLP-2 did not modify the inhibitory effects of exendin-4 on glucagon

secretion in vivo. Hence, these observations illustrate differences in the actions of structurally

distinct GLP-2 peptides in the mouse vs. the rat endocrine pancreas.

In an attempt to unmask a potential effect of enhanced or diminished GLP-2R

signalling on the control of glucagon secretion, we studied glucagon levels and glucose

homeostasis in lean and obese diabetic and non-diabetic mice under a diverse range of

conditions, including chronic GLP-2(1-33) administration to normal mice, and during acute

administration of h[Gly2]GLP-2 during oral and intraperitoneal glucose challenge, and

insulin-induced hypoglycaemia. Our experimental results demonstrated a lack of effect of

acute exogenous h[Gly2]GLP-2 or chronic GLP-2(1-33) administration on murine glucagon

103

secretion under conditions of hypoglycaemia, normoglycemia, or hyperglycaemia. Taken

together, these findings are consistent with our lack of detection of the GLP-2R in murine

islets and provide evidence that acute or chronic GLP-2R activation does not modify murine

glucagon secretion.

As previous studies examined the consequences of acute GLP-2(1-33) administration

on glucagon secretion, we have now ascertained the putative importance of endogenous basal

GLP-2 signalling for islet function through analysis of glucose homeostasis and glucagon

secretion in normal, high fat fed, and obese Glp2r+/+ and Glp2r / mice. Our findings reveal

normal glucose tolerance, preservation of appropriate responses to hypoglycaemia, and no

evidence of abnormal glucagon secretion under conditions of hypo-or hyperglycaemia in

Glp2r / mice. Furthermore, induction of metabolic stress either through STZ-mediated -cell

destruction resulting in diabetes, weight loss and insulin deficiency, or via a high fat diet that

classically induces insulin resistance 352, failed to unmask abnormalities in glucose

homeostasis or glucagon secretion in Glp2r / mice. Hence, the available experimental

evidence does not support a role for endogenous basal GLP-2R signalling in the control of

glucose homeostasis or islet function under normal or diabetic conditions.

To further evaluate the metabolic importance of endogenous GLP-2R action, we

generated ob/ob: Glp2r / mice. Recent studies of high fat fed ob/ob mice have implicated an

essential role for GLP-2 in the transduction of bacteria-derived inflammatory signals to the

systemic circulation via the control of gut permeability and barrier function 346. Prebiotic fed

mice exhibited reduced permeability, increased levels of GLP-2, reduced systemic and

hepatic inflammation, decreased circulating levels of LPS, and decreased markers of

macrophage tissue infiltration. Furthermore, treatment of prebiotic-fed ob/ob mice with the

GLP-2(3-33) antagonist diminished the prebiotic-induced reduction of endotoxemia 346.

Conversely, treatment of ob/ob mice for 12 days with GLP-2(1-33) reduced plasma LPS and

decreased levels of circulating proinflammatory cytokines as well as tissue markers of

oxidative stress and macrophage inflammation, although insulin sensitivity and plasma levels

of glucose, insulin or glucagon were not reported in these studies 346.

Hence, we wanted to determine whether loss of endogenous GLP-2R signalling

predisposed mice to increased inflammation, and perhaps a reduction in insulin sensitivity

leading to deterioration in glucose control. Genetic disruption of GLP-2R signalling in lean

104

or ob/ob mice was not associated with significant changes in body weight and insulin

sensitivity was comparable in ob/ob Glp2r+/+ vs. ob/ob: Glp2r / mice. Nevertheless, ob/ob:

Glp2r / mice exhibited significant increases in both fed and fasting blood glucose, and

glucagon levels were significantly increased in ob/ob mice in the absence of the GLP-2R.

Moreover, -cell mass and islet cell proliferation were significantly reduced and -cell mass

was significantly increased in ob/ob: Glp2r / mice.

Although we did not detect definitive evidence for significant changes in gut

permeability after 4 weeks of high fat feeding (Figure 3.13) or in circulating markers of

inflammation in ob/ob: Glp2r / mice (data not shown), we cannot exclude the possibility

that developmental adaptation to loss of the GLP-2R may lead to upregulation of

compensatory factors that maintain gut integrity and barrier function. Alternatively subtle

differences in diet composition or the intestinal microbiome may also account for differences

between our data and the findings reported by Cani et al 346. Intriguingly, recent evidence

implicates systemic and islet inflammation in the pathophysiology of -cell loss and

dysfunction 354, and it remains possible that low grade systemic or localized islet

inflammation contributed to the pathophysiology of reduced -cell mass in ob/ob: Glp2r /

mice. Similarly, the increase in pancreatic -cell mass detected in ob/ob: Glp2r / mice may

also reflect increased pro-inflammatory signals, as the proinflammatory cytokine interleukin-

6 has been implicated in the pathophysiology of -cell proliferation and enhanced glucagon

secretion in experimental models of metabolic stress and diabetes 355.

In conclusion, although exogenous GLP-2 has no effect on glucagon secretion under

normal conditions in normoglycemic, high fat fed or lean diabetic mice, loss of the GLP-2R

leads to islet dysfunction characterized by exaggerated glucagon secretion, increased -cell

mass, hyperglycaemia, reduced -cell mass, and decreased islet proliferation in ob/ob:

Glp2r / mice. Our findings are consistent with emerging evidence implicating a role for

GLP-2 in the regulation of systemic and tissue inflammation 141, 346, and suggest that further

assessment of the link between the consequences of localized or systemic inflammation and

GLP-2R signalling is clearly warranted.

105

CHAPTER 4

DISCUSSION & CONCLUSIONS

106

The initial study describing GLP-2 as the proglucagon-derived peptide with significant

intestinotrophic properties has fostered substantial efforts towards outlining GLP-2�’s

multiple actions on the intestine, including effects on mucosal growth, nutrient absorption,

blood flow, permeability (Table 1.1, 1.2) as well as GLP-2�’s ability to aid in intestinal

adaptation to injury, inflammation, and disease (Table 1.3). The majority of these studies

describe pharmacological actions of GLP-2 and only a few studies have employed a GLP-2

antagonist or immunoneutralizing antisera to address the importance of endogenous GLP-2

action. The limitations of these agents to study endogenous GLP-2 effects were discussed in

detail in Chapter 1. A summary of studies employing GLP-2(3-33) or polyclonal GLP-2

antibodies to study endogenous GLP-2 effects is outlined in Table 4.1 below. In this thesis, I

have addressed the role of endogenous GLP-2R signalling in several models of intestinal

adaptation using the Glp2r / mouse. This thesis addresses the role of the known GLP-2

receptor in the adaption to physiological or pathophysiological situations of nutrient

deprivation or excess. In Chapter 2, we aimed to delineate how the Glp2r / mouse responds

to a physiologically relevant challenge: fasting and re-feeding. We further defined the role of

specific downstream signalling mechanisms mediating GLP-2�’s essential actions in mucosal

protection and adaptation. In Chapter 3, we sought to identify how the Glp2r / mouse

adapts to pathophysiological situations of perceived nutrient deprivation (diabetes) or excess

(high fat diet) and whether GLP-2R signalling is required for glucose homeostasis and

control of glucagon secretion in such situations. Together, these studies demonstrate for the

first time the importance of endogenous GLP-2R signalling for intestinal adaptation, and the

metabolic and islet responses to experimental obesity

107

Table 4.1. Summary of studies using GLP-2/GLP-2R antagonism to address endogenous GLP-2 effects. Method

Species Model Effect

Polyclonal GLP-2 antibodies 217

Rats STZ-induced intestinal hyperplasia

Rats receiving GLP-2 specific antibodies exhibited (compared to controls receiving non-specific antibodies):

cross-sectional mucosal area cross-sectional area of muscular layer

GLP-2(3-33) - acute (24hours) 91

Mice 24 hours of re-feeding following a 24 hours fast

Re-fed mice receiving GLP-2(3-33) exhibited (compared to controls):

small intestinal weight crypt+villus height incidence of Ki-67+ proliferating cells incidence of cleaved caspase-3+

apoptotic cells

GLP-2(3-33) - acute (48hours) 318

Rats 48 hours of re-feeding following a 48 hours fast

Re-fed rats receiving GLP-2(3-33) exhibited (compared to controls):

small intestinal weight small intestine protein & DNA content

GLP-2(3-33) - chronic (4 wks) 209

Ob/ob mice

Prebiotic diet-induced reduction of gut permeability/ endotoxemia

Mice receiving pre-biotic diet + GLP-2(3-33) exhibited (compared to controls on pre-biotic diet no antagonist):

plasma LPS levels macrophage infiltration (CD68,

TLR4) mRNA levels of tight junction

markers Zo-1 and occludin-1

GLP-2(3-33) - chronic (4 wks) 223

Mice Intestinal growth studies in wildtype mice

Mice receiving GLP-2(3-33) (30 ng or 60 ng) exhibited (compared to control mice receiving PBS):

small intestinal weight colon weight (30ng group only)

108

Is endogenous GLP-2R signalling required for intestinal adaptation to nutrient

deprivation and excess?

The gut displays a striking ability to adapt to nutrient replenishment following a prolonged

fasting period. The presence of nutrients triggers increased growth and repair of the fasted

intestine resulting in rapid reversal of the fasting-induced atrophy. Gut growth factors are

attractive candidates as mediators of this adaptive response. In Chapter 2, we have shown

that the GLP-2R is critical for adaptation to re-feeding in the mouse. The Glp2r / mouse

failed to increase small intestinal growth as measured by small intestinal and jejunal weight

as well as jejunal crypt+villus height after 24 hours of re-feeding following a 24 hour fasting

period. We further showed that this defective adaptive response was due to decreased

mucosal epithelial cell proliferation as assessed by the decreased number of BrdU+ cells in

the jejunum. While re-feeding adaptation was clearly dependent on GLP-2R signalling,

there were no changes in fasted small intestinal weights between Glp2r / and Glp2r+/+ mice.

Such observations were surprising as the literature would predict a role for endogenous GLP-

2 in preservation of the gut epithelium during fasting and in re-feeding associated mucosal

growth. First, circulating GLP-2 levels are significantly decreased during fasting periods in

healthy volunteers 51, 86, 95, 186, 356 and rats95, 318. While the levels of a number of growth

factors and molecules change in response to fasting, lower levels of GLP-2 (with its known

intestinotrophic properties) may contribute to the fasting-induced bowel hypoplasia. Second,

evidence from humans, pigs, and rats on TPN suggest that exogenous administration of GLP-

2 can prevent mucosal hypoplasia. Rats maintained on TPN for 6 days exhibited

significantly decreased mucosal protein and DNA content and small intestinal weight. These

parameters were significantly ameliorated when GLP-2 was co-infused with TPN 136.

Similarly, co-infusion of GLP-2 with TPN in premature piglets prevented mucosal

hypoplasia (i.e. intestinal protein and DNA content, protein and DNA accretion, intestinal

weight, crypt+villus height) 143. While TPN does not represent complete nutrient

deprivation, absence of intestinal nutrients results in comparable mucosal hypoplasia.

Furthermore, the studies outlined above delineate pharmacological effects of GLP-2 while

our study focused on endogenous GLP-2R signalling. Nevertheless, based on these reports,

one might predict the Glp2r / mouse to exhibit increased mucosal atrophy compared to its

109

littermate control. On the contrary, as demonstrated in Chapter 2, small intestinal weight is

comparable between the Glp2r / and Glp2r+/+ mice. In fact, we observed increased

crypt+villus height in fasted Glp2r / mice compared to Glp2r+/+ mice. This may be due to a

gut compensatory response to lack of GLP-2R signalling. Circulating or tissue levels of

other gut growth factors were not measured but further analysis may provide evidence of

increased levels of gut growth factors (e.g. IGF-1 or EGF) or enhanced activity of locally

activated signalling pathways that would compensate for lack of GLP-2R signalling by

preservation of the intestinal epithelium in the fasted state.

Following the observation that the Glp2r / mouse intestine fails to adapt to nutrient

replenishment, we aimed to delineate the downstream signalling pathways regulating GLP-2-

mediated adaptation to re-feeding. Given that GLP-2 exerts its pleiotropic actions via

multiple downstream mediators (discussed in Chapter 1), we first assessed jejunal and ileal

tissue mRNA levels of egf, igf-1, kgf and their receptors as well as eNOS. These molecules

have been previously implicated to be downstream of GLP-2 action 106, 120, 125. Jejunal

mRNA levels of egf, igf-1r and eNOS were lower in fasted Glp2r-/- mice and did not

increase following re-feeding compared to Glp2r+/+ mice. Relative mRNA levels of egfr, igf-

1, kgf and epiregulin were lower in re-fed Glp2r / animals compared to littermate controls.

While there were clear differences in mRNA levels of these molecules, jejunum protein

levels of EGFR (ErbB1), ErbB2, IGF-1R and eNOS were not different between Glp2r / and

Glp2r+/+ mice. The significance of these observations is limited as the analyses were carried

out at a single time-point. It is possible that changes in gene expression may not have been

reflected by changes at the protein level. Furthermore, we did not measure levels of

activated receptors or signalling molecules at this 24 hour re-feeding time-point, further

limiting the value of our observations. Our measurements were made from whole jejunum

tissue extract, thus changes in RNA or protein levels in different cellular compartments

would have been indistinguishable in our analysis. Nevertheless, based on the relative

mRNA levels measured in whole jejunum tissue extracts, we asked whether administration of

EGF or IGF-1 normalizes the re-feeding intestinal phenotype of the Glp2r / mouse. To

address this question, we transiently administered EGF or IGF-1 to Glp2r / mice and

littermate controls during the re-feeding period and assessed small intestinal growth. IGF-1

administration did not rescue the phenotype of the Glp2r / mouse. Whether IGF-1 is

110

required for intestinal adaptation to re-feeding remains unclear. Several studies in the

literature imply a possible role for IGF-1 in such adaptation. Circulating IGF-1 levels

decrease in response to a prolonged fast and increase during the re-feeding period in

weanling pigs 357 and rats 317, 318, 358. In rats, increased levels of circulating IGF-1 and

increased jejunal IGF-1 mRNA levels during the re-feeding period were associated with

increased intestinal growth 317. Jejunal IGF-1R mRNA levels do not change with fasting;

however, re-feeding results in significantly increased jejunal IGF-1R expression levels 358.

These changes may reflect a mechanism for increased IGF-1 action on the intestine following

re-feeding. At least one study has addressed parallel effects of GLP-2 and IGF-1 in

adaptation to re-feeding. Rats fasted for 48 hours and allowed to re-feed for 2 days ad

libitum (but not when food was administered intravenously or intragastrically) exhibited

increased circulating levels of IGF-1 in association with increased small intestinal mass,

DNA and protein content 318. Administration of the GLP-2R antagonist, GLP-2(3-33),

prevented re-feeding induced mucosal growth in rats (measured by DNA, protein content and

intestinal weight) and circulating IGF-1 levels of rats re-fed for 48 hours following a 48 hour

fast (~30nM) were comparable to fasting circulating levels (~25nM) 318. It is difficult to

conclude whether prevention of re-feeding induced intestinal growth following GLP-2R

antagonism is due to downstream IGF-1 effects. The authors of this study failed to assess

other possible downstream mediators of GLP-2 action, such as KGF or ErbB ligands.

Nevertheless, this study brings to light interesting correlations between GLP-2 and IGF-1 in

the setting of fasting and re-feeding. Recently, the intestinal epithelial (i.e.) IGF-1R was

shown to be essential for the adaptive response to re-feeding. Mice with targeted genetic

deletion of the ieIGF-1R exhibited lack of intestinal growth as measured by small intestinal

weight, crypt+villus height, and incidence of Ki67+ cells following re-feeding compared to

their littermate controls 359. Whether IGF-1 is required for GLP-2 mediated intestinal growth

during the re-feeding period remains poorly understood.

111

Figure 4.1. Signalling through the ErbB network. (A) The ErbB network is comprised of four ErbB receptors (ErbB1,2,3,4) and 13 ErbB ligands. ErbB ligands are membrane-bound until cleaved by the ADAM family of metalloproteases. EGF, TGF- , and amphiregulin uniquely bind ErbB1 (EGFR). ErbB2 does not bind any ligands but is the preferred heterodimeric partner of the other ErbB receptors. ErbB3 is a kinase-defective receptor but can bind neuregulin-1 and neuregulin-2; neuroglycan C uniquely binds ErbB3. Neuregulin-3 uniquely binds ErbB4. The ErbB ligands HB-EGF, betacellulin, epiregulin and epigene can bind both ErbB1 and ErbB4. (B) For the purposes of this thesis, an oversimplified schematic of ErbB signalling has been provided. Activation of ErbB receptors following ErbB ligand binding leads to recruitment of adaptor molecules (such as Grb2 and Shc) which in turn leads to activation of various signalling cascades. These pathways in turn lead to gene expression via activation of different transcriptions factors. Various combinations of transcriptions factors and cell context lead to modulation of cell behaviour (e.g. proliferation, differentiation). For a more comprehensive review please see Reference 360.

112

In contrast to data we obtained with IGF-1, exogenous administration of EGF rescued

the re-feeding defect in Glp2r / mice. Thus EGF administration in Glp2r / mice mimics the

actions of a functional GLP-2R in wildtype littermates. Upon activation by EGF, ErbB1 can

undergo ligand-induced heterodimerization with ErbB2 which in turn can heterodimerize

with the other ErbB receptors, thus activating the entire ErbB network 360-362. Thus, EGF

administration results in activation of the ErbB network.

The ErbB family consists of four tyrosine kinase receptors. ErbB1 (EGF-R) is a

target for EGF, TGF- , amphiregulin, and epigene. In the gut, the majority of ErbB1

receptors are found on the basolateral surface of enterocytes 363. ErbB2 lacks a known

endogenous ligand while ErbB3 lacks intrinsic tyrosine kinase activity 364. The ligands

betacellulin, HB-EGF, and epiregulin can bind either EGFR or ErbB4. EGFR ligands are

synthesized as class I transmembrane proteins which are subjected to ectodomain cleavage

by specific metalloproteases following insertion in the plasma membrane (See Figure 4.1).

The intestinal ErbB network is essential for mucosal integrity and adaptation to intestinal

injury. Specifically, the EGFR plays a unique role in intestinal adaptation to injury. The

waved-2 mouse has been used to study the importance of endogenous EGFR signalling due

to a naturally occurring spontaneous point mutation (T G) in the EGFR gene resulting in

severe but not complete loss of tyrosine kinase activity. Waved-2 mice are healthy and fertile

but are distinguishable from wildtype littermates due to their wavy fur and whiskers 365.

Following a 50% small intestinal resection, waved-2 mice developed severe diarrhea,

significant weight loss, failed to increase ileal DNA and protein content, crypt+villus height

and ileal BrdU+ proliferating cells compared to wildtype controls 366. Conversely,

exogenous administration of EGF (50 g/kg/day, oral gavage, bid 3 days) improved several

markers of intestinal adaptation following small bowel resection, including decreased

number of apoptotic cells, and increased ratio of bax:bcl-w 367. Following small bowel

resection in rats, treatment with EGF (150 g/kg/day, osmotic pump, 28 days) was associated

with increased small intestinal weight, ileal crypt depth, DNA, and protein content 368.

Analysis of isolated enterocytes from rats that had undergone small bowel resection showed

that infusion of EGF (60 g/kg/day, 7 days) was associated with increased total DNA content

of isolated enterocytes and increased enterocyte SGLT1 expression 369. In rabbits, EGF

infusion (0.3 g/kg/hr, 7 days) following small bowel resection was associated with

113

increased intestinal wet and dry weight as well as augmented maltase activity and glutamine

uptake 370, 371. Another well-studied model of intestinal adaptation is TPN-induced intestinal

hypoplasia. In rats, co-infusion of EGF with TPN was associated with increased small

intestinal crypt depth and crypt cell proliferation 372. Subcutaneous injection of EGF (0.1

g/g BW, bid, 2 weeks) to rats receiving TPN was linked to increased circulating and small

intestinal glutamine levels as well as gut glutamine extraction 373 suggesting that EGF can

increase absorptive capacity in this model of intestinal hypoplasia. A similar study in rats

demonstrated that EGF treatment (0.1 g/g BW, bid, 2 weeks) resulted in increased

glutaminase and glutamine synthase activity 374, suggesting that EGF can increase glutamine

utilization and uptake from the small intestine during TPN nutrition. EGF treatment can also

increase intestinal growth in this model. Rats receiving TPN + EGF (15 g/day, IV, 7 days)

displayed increased jejunum and ileal mucosal thickness and crypt + villus height compared

to rats receiving TPN alone 375. Furthermore, rats receiving TPN + EGF exhibited decreased

enteric bacterial flora translocation to mesenteric lymph nodes and blood 375. Thus EGF not

only decreases TPN-induced mucosal hypoplasia but also decreases intestinal permeability in

this model. All of these studies suggest that EGF administration may stimulate intestinal

growth and increase digestive/absorptive capacity when administered in models of intestinal

adaptation (small bowel resection or TPN-induced gut hypoplasia). While EGF effects have

not been studied in other models of intestinal adaptation (e.g. fasting and re-feeding), the

above reports could be extrapolated to suggest a broader role for EGF in stimulating

intestinal growth in models of gut hypoplasia. Our findings of increased intestinal growth

following exogenous administration of EGF to re-fed Glp2r / mice would then be consistent

with known actions of EGF in enhancing intestinal adaptation. Furthermore, the study using

waved-2 mice 366 would also suggest that endogenous EGFR signalling is essential for

intestinal growth in models of gut adaptation and may suggest a role for endogenous EGFR

signalling in other models of bowel hypoplasia (such as the fasting intestine). While our

study is the first to address the role of exogenous EGF administration in intestinal adaptation

to re-feeding, our findings are consistent with a role for EGF as a gut growth factor aiding in

intestinal adaptation.

Is the ErbB network essential for re-feeding induced intestinal growth in the Glp2r /

mouse? To address this question, we first assessed whether levels of ErbB ligands are

114

increased during re-feeding following a 24 hour fast in wildtype mice. Mice re-fed for 30, 90

and 180 minutes following a 24 hour fast displayed increased jejunum mRNA levels of

amphiregulin, epiregulin, and hb-egf as well as immediate early genes c-fos and phlda-1. We

observed a specificity in ErbB ligand induction as the relative mRNA levels of egf and tgf-

were unaffected by re-feeding. Our observations are consistent with those of Yusta et al. 120.

Yusta et al. reported that mice treated acutely with GLP-2 (0.2mg/kg, 1 hr) displayed

increased jejunum mRNA levels of the ErbB ligands amphiregulin, epiregulin and HB-EGF

as well as the immediate early genes c-fos, egr-1 and phlda-1 whereas GLP-2 treatment had

no effect on mRNA levels of other ErbB ligands EGF, TGF- or betacellulin 120. These

effects required a functional GLP-2R as treatment of Glp2r / mice with GLP-2 did not result

in induction of any of the above ligands despite normal levels of ErbB ligand mRNA

transcripts in these mice. The increased jejunal mRNA levels of amphiregulin, epiregulin

and HB-EGF were observed as early as 30 minutes following GLP-2 injection 120

demonstrating rapid induction of these ligands by GLP-2 treatment. These results are highly

relevant in the context of our study as we also observed a rapid and selective induction of the

ErbB ligands amphiregulin, epiregulin, and HB-EGF in response to re-feeding following a

prolonged fast.

We next asked whether inhibition of ErbB receptor activity would block the re-

feeding induced upregulation of ErbB ligands and whether this would lead to decreased

intestinal growth. To answer this question, we used the pan-ErbB inhibitor CI-1033 to block

ErbB receptor activity. CI-1033 is a tyrosine kinase inhibitor that rapidly and irreversibly

inhibits phosphorylation of the ErbB receptors 376. Given that aberrant expression of ErbB

receptors has been implicated in the development and progression of a number of tumour

types including breast and colorectal cancer, CI-1033 has been under investigation as an anti-

cancer therapeutic 377, 378. Using this molecule, we inhibited ErbB receptor activity during

the re-feeding period of mice. In Chapter 2 we show that pre-treatment of wildtype mice

with CI-1033 followed by re-feeding for 30, 90 and 180 minutes prevented upregulation of

the ErbB ligands amphiregulin, epiregulin, HB-EGF, as well as the immediate early genes c-

fos and phlda-1. Furthermore, chemical inhibition of ErbB receptor tyrosine kinase activity

with CI-1033 decreased the number of proliferating BrdU+ cells in the jejunum of mice re-

fed for 180 minutes compared to control mice re-fed for 180 minutes receiving vehicle.

115

These results conclusively demonstrate that the ErbB network is essential for re-feeding

induced intestinal adaptation in mice. Our findings differ from those of Yusta et al. since

their study did not detect an effect of CI-1033 alone on crypt cell proliferation rate 120.

However, our experiments did not address effects of CI-1033 on basal crypt cell proliferation

but rather focused on BrdU incorporation in a model of intestinal adaptation. A stressed

intestine may require activation of the ErbB network to induce crypt cell proliferation

whereas in the basal state the presence of other stimulatory signals (e.g. IGF-1R or KGFR

signalling) may be sufficient.

Having demonstrating that ErbB network activation is essential for re-feeding

induced intestinal adaptation (i.e. increased crypt cell proliferation) in mice, we next aimed to

determine whether this pathway is downstream of GLP-2R signalling. We hypothesized that

elimination of the known GLP-2R in mice would attenuate the re-feeding induced

upregulation of ErbB ligands. To address this hypothesis, we fasted Glp2r / mice and

littermate controls for 24 hours followed by re-feeding for 30, 90 or 180 minutes (as done in

experiments using CI-1033). In Chapter 2, we demonstrate that the intestine of the re-fed

Glp2r / fails to upregulate amphiregulin, epiregulin and HB-EGF following re-feeding.

These findings suggest that a functional GLP-2R is required for induction of ErbB ligands in

the re-feeding state. Such observations are consistent with previously described actions of

exogenous GLP-2 on ErbB ligand induction and crypt cell proliferation. In mice, CI-1033

pre-treatment prior to acute GLP-2 administration (0.2mg/kg, 2 injections 3 hours apart)

significantly decreased the number of BrdU+ proliferating cells in the jejunum compared to

mice pre-treated with vehicle 120. Furthermore, a more chronic treatment with GLP-2

(0.2mg/kg daily, 9 days) + CI-1033 pre-treatment attenuated the intestinotrophic effects of

GLP-2, as observed by decreased small intestinal weight and reduced crypt+villus height

compared to mice pre-treated with vehicle 120. These results suggest that at least part of

GLP-2�’s intestinotrophic effects are mediated by ErbB network activation. While the Yusta

et al. study demonstrates pharmacological effects of GLP-2 in normal mice, our experiments

focused on physiological effects of endogenous GLP-2R signalling in the adapting intestine.

Nevertheless, our results confirm our hypothesis and are consistent with GLP-2R-mediated

effects on intestinal growth via activation of the ErbB network. Abrogation of GLP-2R

signalling in the re-fed intestine results in failure to acutely upregulate ErbB ligands in

116

response to re-feeding and decreased intestinal growth and crypt cell proliferation rate (24

hours following re-feeding). A limitation of our study is that we did not assess whether

ectodomain shedding is essential for induction of ErbB ligands in the re-fed intestine.

Though Yusta et al. have shown that treatment with the broad-spectrum metalloprotease

inhibitor GM6001 did not attenuate acute induction of ErbB ligands by GLP-2, the adapting

intestine may require metalloprotease-induced ErbB ligand shedding to increase levels of

ErbB ligands

Thus far, we have established that during re-feeding, GLP-2R activation leads to

induction of the ErbB network which in turn results in increased crypt cell proliferation to

stimulate intestinal adaptation. We next aimed to delineate the molecular mechanisms

downstream of ErbB network activation leading to increased crypt cell proliferation. A

candidate molecule that appears to be activated by both ErbB ligands and GLP-2R agonists is

phosophorylated Akt (p-Akt). Exposure of mice to a clear liquid-only diet consisting solely

of 5% glucose (i.e. lack of luminal nutrients) for 72 hours resulted in significant reduction of

proliferating jejunal PCNA+ cells and decreased ileal Akt phosphorylation whereas

replacement of solid food resulted in reversal of all these parameters, including significantly

increased ileal p-Akt levels compared to non-fasted control mice 325. Moreover, inhibition of

PI3K activity with LY-294002 during solid food replacement following a 72 hour exposure

to the liquid-only diet attenuated the re-feeding-induced increased Akt phosphorylation and

also inhibited re-feeding-induced increases in jejunal proliferating PCNA+ cells 325. These

findings suggest that lack of luminal nutrients leads to decreased Akt phosophorylation and

that increased p-Akt levels are essential for re-feeding-induced induction of jejunal crypt cell

proliferation. Based on such observations, we hypothesized that increased Akt

phosphorylation downstream of ErbB network activation leads to the re-feeding induced

increase in crypt cell proliferation. To address this hypothesis, we assessed p-Akt levels in

our fasted and re-fed wildtype mice pre-treated with either vehicle or CI-1033. As described

in Chapter 2, solid food replacement for 30, 90 and 180 minutes following a 24 hour fast

resulted in significantly increased jejunal p-Akt levels. This effect was attenuated when mice

were pre-treated with CI-1033, suggesting that ErbB network activation is essential for

increased p-Akt levels in this model. These results are consistent with the report from Sheng

et al. 325 (decreased p-Akt levels resulted in decreased number of jejunal proliferating cells in

117

the re-feeding state). Our results also demonstrated that CI-1033 treatment blocked re-

feeding induced increases in the number of proliferating cells. We can conclude then that

ErbB network activation in the intestine is essential for re-feeding induced increases in

jejunal p-Akt levels which in turn lead to increased jejunal crypt cell proliferation.

The next question we asked is whether GLP-2R signalling is required for nutrient-

induced activation of the above series of events (ErbB network activation increased p-Akt

increased crypt cell proliferation). To address this question, we assessed p-Akt levels in

the jejunum of Glp2r / mice and littermate controls fasted for 24 hours and re-fed for 30, 90,

and 180 minutes. As described in Chapter 2, 90 minutes following re-feeding intestinal p-

Akt are significantly lower in Glp2r / mice compared to littermate controls. Given that we

have also demonstrated that Glp2r / mice fail to upregulate the ErbB ligands amphiregulin,

epiregulin, and HB-EGF during the re-feeding period (90 and 180 minutes) and also fail to

increase the number of proliferating BrdU+ cells (24 hours after food replacement), we

conclude that GLP-2R activation is essential for re-feeding induced intestinal adaptation

through activation of the intestinal ErbB network which in turn increases jejunal p-Akt levels

leading to increased jejunal crypt cell proliferation. Thus, we have shown that the re-fed

Glp2r / intestine behaves, at the molecular level, in a similar manner to the intestine of a re-

fed mouse pre-treated with CI-1033.

Our results on GLP-2R-induced Akt phosphorylation are consistent with other reports

in the literature implicating p-Akt as a requirement for GLP-2 induced intestinal growth. In

TPN-fed piglets, infusion of GLP-2 (2.5-10 nmol/kg/day) increased intestinal p-Akt levels

with a parallel increase in small intestinal crypt cell proliferation at the highest dose 118.

Treatment of mice with 1 µg of GLP-2 resulted in increased p-Akt levels as early as 30

minutes post-injection 119. This effect was preserved in the Igf1-/- mouse but lost in mice

pre-treated with the IGF-1R inhibitor NVP-AEW541 suggesting that in normal mice,

increased p-Akt following GLP-2 treatment is IGF-1-independent but IGF-1R-dependent.

Treatment with NVP-AEW541 blocks IGF-1R signalling induced by both IGF-1R ligands,

IGF-1 and IGF-2. Therefore, IGF-2 but not IGF-1 may be the required ligand for IGF-1R-

induced Akt phosphorylation. Our study also demonstrates that GLP-2R effects on re-

feeding are independent of IGF-1. While exogenous GLP-2 may activate Akt via an IGF-1R

independent pathway in normal mice, our current model using re-fed Glp2r / mice is

118

considerably different. It is likely that in our model, the increased jejunal p-Akt levels during

re-feeding are achieved through a different signalling pathway. Indeed, both EGF and GLP-

2 induced parallel increases in p-Akt levels in mice as early as 30 minutes following

treatment 120.

We have demonstrated that the ErbB network but not IGF-1 is required for intestinal

adaptation to re-feeding in the Glp2r / mouse. Nevertheless, both ErbB ligands 120 and IGF-

1 125 have been shown to be required for GLP-2�’s intestinotrophic actions. Our results focus

on endogenous GLP-2R actions rather than pharmacological administration of GLP-2.

Furthermore, we studied mice under a physiological challenge �– adaptation to re-feeding.

Therefore it is possible that while IGF-1 and ErbB ligands are required for GLP-2�’s

intestinotrophic effects, only the ErbB ligands are essential for mediating endogenous GLP-2

actions on crypt cell proliferation in the setting of re-feeding. Indeed, we observed no

changes in igf-1 mRNA expression in the jejunum of mice re-fed after 30, 90 or 180 minutes

while ErbB ligands were significantly upregulated and EGF but not IGF-1 rescued the re-

feeding defect associated with Glp2r / mice. Nevertheless, both IGF-1 and the ErbB

ligands are likely required for transducing GLP-2�’s intestinotrophic actions. We propose the

following model to incorporate these observations (Figure 4.2).

Following GLP-2 release from L cells, the GLP-2R is activated on target cells (e.g.

subepithelial myofibroblasts, enteric neurons, enteroendocrine cells). This results in the

release of IGF-1 which in turn activates the IGF-1R on mucosal epithelial cells resulting in

stimulation of mitogenic signalling pathways and intestinal growth. It is unlikely that ErbB

ligands are released from GLP-2R target cells following activation of the GLP-2R as the

broad-spectrum matrix metalloprotease inhibitor GM6001 failed to inhibit ErbB ligand

induction following GLP-2 treatment 120. Therefore, it still remains unclear whether the

induction of ErbB ligands following exogenous GLP-2 treatment leads to local ErbB receptor

activation on epithelial cells. Activation of ErbB receptors stimulates a positive feedback

loop whereby ErbB ligands are produced following activation of their receptors 361. This

gives rise to the question of how ErbB receptors are activated on epithelial cells following

GLP-2 treatment. One potential explanation is cross-talk between IGF-1R and ErbB

receptors. In vitro studies in a variety of cell lines have demonstrated such cross-talk. IGF-1

treatment of COS-7 cells resulted in tyrosine phosphorylation of both the IGF-1R beta

119

subunit as well as the EGFR while treatment with an EGFR kinase inhibitor (tyrophostin

AG1478) blocked IGF-1-induced phosphophorylation of the EGFR 379. It was further shown

that cross-talk between the IGF-1 and EGFR was mediated by matrix metalloprotease

shedding of HB-EGF in COS-7 379 and HEK-293 cells 380. IGF-1 treatment also resulted in

EGFR phosphorylation in mammary fibroblasts 381. Treatment with an EGFR inhibitor

(ZD1839) blocked IGF-1 induced ERK1/2 activation suggesting that ERK activation by IGF-

1 requires the EGFR. However, treatment with the broad-spectrum matrix metalloprotease

inhibitor GM6001 and an HB-EGF inhibitor (CRM-197) had no effect on IGF-1-induced

ERK activation 381 suggesting that in these cells IGF-1 transactivates the EGFR independent

of ErbB ligand ectodomain shedding. IGF-1 transactivation of EGFR was shown to be

critical for cell surival in mammary epithelial cells �– treatment of cells with IGF-1 improved

cell survival by reducing phosphorylation of the pro-apoptotic molecule Bad but this effect

was blocked when cells were treated with ZD1839 382. These studies demonstrate that

activation of the IGF-1R can result in transactivation of ErbB receptors. Cross-talk between

IGF-1R and ErbB receptors could also occur via heterodimerization of these receptors. In

normal mammary fibroblasts, EGFR co-precipitated with IGF-1R suggesting that these two

receptors are able to heterodimerize 382. In the context of our proposed model, cross-talk

between the IGF-1R and ErbB receptors may be a critical element in mediating GLP-2�’s

intestinotrophic actions. This hypothesis is supported by studies showing that inhibition of

one receptor abrogates GLP-2�’s effects on intestinal growth. For example, inhibition of IGF-

1R signalling using NVP-AEW541119 or inhibition of pan-ErbB activity using CI-1033120

prior to GLP-2 treatment resulted in inhibition of intestinal growth in mice.

ErbB receptor activation on epithelial cells may also occur from cross-talk with other

receptors. Following GLP-2R activation on target cells (e.g. subepithelial myofibroblasts),

other yet unidentified molecules may be released which would then activate their receptors

on the intestinal epithelium. These receptors may in turn transactivate the ErbB receptor

leading to induction of ErbB ligands and stimulation of cell proliferation. While the cross-

talk between receptor tyrosine kinases is well documented, it has also been recently shown

that GPCRs can heterodimerize with ErbB receptors 383 opening many more possibilities for

the ways in which the ErbB network could be activated following GLP-2R activation.

GLP-2R target cell

Mucosal epithelial cell

GLP-2R

GLP-2

IGF-1IGF-1R

Other yet unidentified molecules

ErbB receptor

Unidentified receptor

Cross-talk

Transactivation

proliferation

Figure 4.2. IGF-1 and the ErbB network mediate GLP-2’s intestinotrophic actions.Following GLP-2 release from L cells, the GLP-2R is activated on target cells (e.g. subepithelial myofibroblasts, enteric neurons, enteroendocrine cells) resulting in the release of multiple mediators including IGF-1, KGF, ErbB ligands and VIP which in turn bind to their receptors on mucosal epithelial cells. Activation of IGF-1R may directly activate mitogenic pathways as well as do so indirectly via cross-talk with ErbB receptors leading to increased cell proliferation. This cross-talk may involve signalling through p-Akt. Other yet unidentified molecules released from GLP-2R target cells may also activate their respective receptors on epithelial cell leading to stimulation of mitogenicpathways.

KGF

ErbB ligands

VIP

KGFR

VPAC1/2

120

121

Is endogenous GLP-2R signalling required for adaptation to nutrient deprivation and

excess in the diabetic setting?

In Chapter 3, we addressed the role of endogenous GLP-2R signalling in adaptation to

conditions of perceived nutrient deprivation: the diabetic intestine. Due to lack of insulin

action, the diabetic animal is in a perceived state of nutrient deprivation as it is unable to

utilize glucose/nutrients efficiently. Therefore, in animal models of experimental diabetes, a

paradoxical increase in intestinal weight has been observed 12, 312, 313, 384-387 which is thought

to be a mechanism to compensate for this perceived nutrient deficiency. Several studies have

linked increased diabetic gut growth with increased circulating levels of PGDPs, including

GLP-2. Circulating and ileal tissue levels of GLI-peptides were significantly elevated in the

STZ-diabetic rat as early as 8 days following induction of diabetes 388. Circulating levels of

GLP-1, GLP-2 and GLI-peptides were also significantly increased in STZ-diabetic rats 3

weeks after induction of diabetes with a parallel increase in intestinal growth as measured by

small intestinal wet and dry weight, and crypt+villus height 12. Immunoneutralization of

circulating GLP-2 using specific GLP-2 antibodies (antisera raised against synthetic human

GLP-2 in rabbits) attenuated the STZ-induced increase in intestinal growth in the rat (35%

increase in mucosal area vs. 66% increase in mucosal area in mice treated with non-specific

antibodies) 217, suggesting that endogenous GLP-2 is required for the increased diabetic

intestinal growth. In Chapter 3, we address the role of endogenous GLP-2R signalling in

diabetes/glucose intolerance using several models: STZ-induced diabetes, high fat diet-

induced glucose intolerance, and a genetic model of diabetes (ob/ob mouse). We further

study whether endogenous GLP-2R signalling contributes to regulation of glucagon secretion

in these settings.

Induction of diabetes using an acute high dose STZ injection in Glp2r / mice and

littermate controls resulted in decreased body weight, increased plasma glucose, increased

food intake, and increased small intestinal weight. Surprisingly, there were no differences in

small intestinal weight in the STZ-diabetic Glp2r / vs. Glp2r+/+ mice. These results suggest

endogenous GLP-2R signaling is not required for diabetic intestinal growth in mice. While

immunoneutralization of circulating GLP-2 may have attenuated the diabetic intestinal

growth in rats, genetic ablation of the Glp2r in mice had no effect on this phenotype.

122

Furthermore, there were no differences in body weight, glucose tolerance, or small intestinal

weight in the high fat fed Glp2r / mice vs. littermate controls providing further evidence that

endogenous GLP-2R signaling is not required for diabetic intestinal growth. The

discrepancy between our observations using the genetic deletion of Glp2r and the reports

using immunoneutralization of circulating GLP-2 may be explained by potential

compensatory mechanisms developed in our Glp2r-/- mice that would result in increased

diabetic intestinal growth in the absence of GLP-2 action. In normal mice, GLP-2 may be a

molecule used to aid in intestinal adaptation to injury or stress (such as diabetes) and acute

disruption of GLP-2 action may not allow sufficient time for upregulation of other

compensatory mechanisms, thereby revealing a critical role for GLP-2. However, the

Glp2r / mice may have evolved other compensatory mechanisms (e.g. increased levels of

other intestinal growth factors) to deal with intestinal injury or stress. Unpublished data from

our lab suggests that after an overnight fast, jejunum mRNA levels of eNOS, EGF, IGF-1

and VIP levels are comparable between Glp2r / and Glp2r+/+ mice. There was a non-

significant trend toward increased jejunum mRNA levels of KGF in Glp2r / mice compared

to littermate controls. These observations are limited as they were derived from analysis of a

single tissue at one timepoint and under fasted conditions. Future studies should focus on

measuring fasted and fed levels of these molecules along the jejunum and ileum at the RNA

and protein levels as well as circulating levels of these growth factors. Measuring the

receptor activation state of the receptors transducing the effects of these molecules in the

Glp2r / mice vs. Glp2r+/+ under basal conditions as well as in the stressed/injured intestine

would be informative and help us understand if there are any compensatory mechanisms

which would contribute to maintaining a normal phenotype in the diabetic Glp2r / intestine.

We further used our diabetic Glp2r / mouse models to study glucagon secretion in

vivo. Several lines of evidence have suggested that exogenous GLP-2 administration can

increase glucagon levels in rats 103 and humans 159, 212. Infusion of 10 nM GLP-2(1-33) in the

isolated perfused rat pancreas resulted in an increase in glucagon concentration in the venous

effluent whereas GLP-2 had no effect on insulin or somatostatin output 103. When GLP-1

and GLP-2 were co-infused in equimolar concentrations (10nM), GLP-2 markedly attenuated

the inhibitory effect of GLP-1 on glucagon secretion 103. The Glp2r was also detected in

RNA from isolated rat islets via real-time PCR as well as on paraffin-embedded rat and

123

human pancreas sections by immunohistochemistry using the GLP-2R antibody 99077 103.

In healthy volunteers, infusion of GLP-2(1-33) (25 pmol/kg/hr) resulted in an increase in

circulating glucagon levels with no changes in plasma glucose or insulin 212. Likewise,

infusion of GLP-2(1-33) (2 pmol/kg/min) in fasted healthy volunteers was associated with a

significant increase in circulating levels of glucagon with no changes in plasma glucose and a

modest increase in insulin at two timepoints 159. Infusion of the same dose of GLP-2 into

healthy volunteers during administration of a standard test-meal was also associated with

increased plasma glucagon levels but no changes in glucose or insulin compared to

volunteers receiving placebo 159. Taken together, these studies suggest that pharmacological

administration of GLP-2 stimulates glucagon secretion in rats and humans perhaps via a

direct mechanism requiring the known GLP-2R and led to our hypothesis that genetic

ablation of the GLP-2R would result in decreased glucagon secretion in mice under basal

conditions as well as under STZ-diabetic and high-fat diet-induced glucose intolerant

conditions.

We first set out to determine whether observations in rats and humans that exogenous

GLP-2 stimulates glucagon secretion could also be confirmed in mice. Wildtype mice were

treated with PBS, h[Gly2]-GLP-2, exendin-4 or h[Gly2]-GLP-2 + exendin-4 during a

hypoglycaemic challenge (insulin tolerance test). Blood glucose was monitored for 3 hours

and plasma glucagon levels were measured at -10, 0, 20 and 40 minutes following insulin

injection. Treatment with the GLP-1R agonist exendin-4 resulted in a significant decrease in

blood glucose levels as well as significantly lower plasma glucagon levels at 20 and 40

minutes following induction of hypoglycaemia. Mice treated with GLP-2 had comparable

glycaemia and circulating glucagon levels to PBS-treated mice while co-administration of

GLP-2 with exendin-4 did not change the glucagonostatic effects of exendin-4. Chronic

treatment of wildtype mice with GLP-2(1-33) (7 weeks, 5 g/mouse bid) resulted in a modest

increase in blood glucose levels and a modest decrease in plasma glucagon levels. Finally,

treatment of pancreatic islets isolated from wildtype mice with GLP-2 did not stimulate

glucagon secretion while arginine significantly increased glucagon levels. Thus, contrary to

studies in rats and humans, exogenous treatment of mice with GLP-2 does not stimulate

glucagon secretion. The discrepancy could be attributable to species-specific phenotypes.

Our studies also differed in that we used the DPP-4 resistant h[Gly2]-GLP-2 while Meier et

124

al. 159 and deHeer et al. 103 used the native GLP-2(1-33) peptide. There are currently no

studies describing the effects of the degradation resistant GLP-2 analog on glucose

homeostasis as all the studies examining such effects have employed the native GLP-2(1-33)

peptide 103, 159, 287. Thus our observations could be the first to examine whether h[Gly2]-

GLP-2 regulates glucose homeostasis.

Our next aim was to address whether the endogenous GLP-2R is required for

glucagon secretion in normal mice. Insulin and glucose (oral and intraperitoneal) tolerance

tests were performed in Glp2r / mice and littermate controls. Glycemic excursions

following an oral or IP glucose challenge were comparable between Glp2r / and Glp2r+/+

mice. Likewise, insulin tolerance tests revealed no differences in glycaemia or circulating

glucagon levels between Glp2r / vs. Glp2r+/+ mice. These observations suggest that the

endogenous GLP-2R is not required for glucose homeostasis and glucagon secretion in mice.

Our findings are inconsistent with our predicted hypothesis based on the reports of Meier et

al. 159 and deHeer et al. 103. While their observations describe pharmacological actions of

GLP-2, our findings address the physiological relevance of endogenous GLP-2R signalling.

Therefore, physiological circulating GLP-2 levels (fasting or postprandial) may not be

sufficient to regulate glucagon secretion in the mouse. Likewise, other glucagonotropic

mechanisms may exist to compensate for ablation of GLP-2R signalling in the mouse under

hypo or hyperglycaemic conditions.

We also aimed to clarify whether the GLP-2R is expressed in mouse pancreatic islets.

We failed to detect the known GLP-2R in isolated mouse pancreatic islets using real-time

PCR with a GLP-2R primer (spanning exons 3-4) while the GLP-2R was detected in mouse

jejunum samples (our positive control). We next performed RT-PCR with mouse GLP-2R

primers spanning the full length of the GLP-2R gene (please see Chapter 3) followed by

transfer of the resulting PCR product to a nylon membrane and hybridization using a Glp2r

specific oligonucleotide probe. Using this second method, we were still unable to detect the

GLP-2R in isolated mouse islets while a strong signal was detected from mouse jejunum

samples. Thus, mouse islets do not express the known GLP-2R. While deHeer et al. 103

report detection of the Glp2r in rat and human islets, they employed real-time PCR primers

that do not span the entire full length of the rat Glp2r. Consequently, the amplicon detected

may not be translated into a fully functional GLP-2R. In contrast, we used two different

125

methods to assess the presence of the GLP-2R on mouse islets, including RT-PCR using

primers specifically designed to span the full length region of the Glp2r gene. Whether the

pharmacological effects of GLP-2 on glucagon secretion in rats and humans are direct

(mediated by an alpha cell GLP-2R) remains unclear. The presence of the known GLP-2R

on rat and human islets remains controversial. Nevertheless, GLP-2 administration ex vivo in

the perfused rat pancreas had no effect on somatostatin or insulin secretion. This is contrast

with reports on indirect GLP-1 effects on glucagon secretion via release of somatostatin and

activation of the somatostatin receptor SSTR2 (discussed in Chapter 1) 284. Therefore, while

the current information on GLP-2�’s effect on glucagon secretion is incomplete, the available

evidence suggests that GLP-2 may exert its actions on the endocrine pancreas via a direct

mechanism. The possibility that a second yet unidentified GLP-2R exists that could mediate

such GLP-2 effects cannot be excluded. While the current evidence for an existing second

GLP-2R is weak, at least two studies have demonstrated proliferative effects of GLP-2 in cell

lines lacking the known GLP-2R. Treatment of Caco-2 and T84 cells with GLP-2 (10-

1000nM, 3 days) resulted in significantly increased DNA synthesis as measured by [3H]-

thymidine incorporation 389, 390. Acute GLP-2 treatment (5 min) of Caco-2 cells resulted in

induction of the signalling molecules ERK1 and ERK2 whereas treatment with a general

tyrosine kinase inhibitor (Genistein), PI3K inhibitor (LY294002) or MAPK inhibitor (PD

098059) inhibited GLP-2�’s proliferative actions on Caco-2 cells 389. The known GLP-2R

was not detected in Caco-2 or T84 cell lines using RT-PCR with Glp2r-specific primers 113.

These observations suggest that in these cell lines, GLP-2 may induce its proliferative actions

via a yet unidentified GLP-2R. Therefore, it is feasible that a second yet unidentified GLP-

2R exists that may transduce GLP-2�’s effects on glucagon secretion.

Since endogenous GLP-2R signalling was not essential for glucagon release in mice

under normal conditions, we asked whether the GLP-2R was required for glucose

homeostasis and glucagon secretion under conditions of glucose intolerance or diabetes. To

address this question, we generated both glucose-intolerant and diabetic Glp2r / mouse

models. There were no differences in oral glucose tolerance, ambient, fasted and fed blood

glucose levels between high fat fed Glp2r / and Glp2r+/+ mice. Mice treated with STZ

displayed increased morning blood glucose levels, elevated fasting glucose, decreased body

weight and increased 24 hour food intake but no genotype differences were observed

126

between Glp2r / vs. Glp2r+/+ mice. These observations suggest that endogenous GLP-2R

signalling is not required for glucose homeostasis under STZ-induced diabetes or high fat

diet-induced glucose intolerant conditions.

Since no differences were noted in lean diabetic (STZ-induced diabetes) or high fat

diet-induced obese Glp2r / mice compared to their littermate controls, we asked whether

glucose homeostasis and glucagon secretion was altered in the absence of the known GLP-

2R in a genetic model of diabetes/obesity: the ob/ob mouse. A (C T) point mutation in the

obese (ob) gene of the ob/ob mouse results in the change of an arginine to a stop codon at

position 105 and failure to produce leptin 391. The inability of the ob/ob mouse to produce

leptin results in severe hyperphagia 392-394, obesity, insulin resistance and diabetes 395-398.

Ob/ob mice also have abnormally enlarged pancreatic islets (up to 3 fold bigger than lean

littermates) but possess comparable total islet numbers 399. Islet hyperplasia in the ob/ob

mouse is likely not a result of deficient leptin actions on islets, but more likely due to

increased insulin demand in the face of hyperglycaemia 398. The majority of cells in these

enlarged islets are -cells 398, 400 and no changes in -cell area have been detected between

ob/ob mice compared to lean littermates 401. Nevertheless, circulating levels of glucagon are

elevated in ob/ob mice 402. Immunoneutralization of circulating glucagon using a

monoclonal anti-glucagon antibody (Glu-001) acutely reduced glucose excursion and

increased liver glycogen concentrations following an oral glucose challenge and decreased

hepatic glucose output 403. A chronic treatment regimen (5 days) of ob/ob mice with Glu-001

was associated with decreased plasma glucose and triglyceride levels 403. These observations

suggest that elevated glucagon levels in the ob/ob mouse contribute to the poor glucose

homeostasis and diabetic phenotype of the mice.

Given the above-described diabetic phenotype of the ob/ob mouse, we asked whether

elimination of GLP-2R signalling in this genetic mouse model would alter glucose

homeostasis and glucagon secretion. To address this question, we generated an ob/ob:

Glp2r / mouse (as described in Chapter 3). Body weight, fat and lean mass were

comparable between ob/ob: Glp2r / mice and littermate ob/ob controls. Fasted and fed

blood glucose levels were significantly higher in ob/ob: Glp2r / vs. ob/ob littermates in

association with an increase in plasma glucagon levels. We also observed a modest

improvement in oral glucose tolerance while intraperitoneal glucose tolerance was impaired

127

in the ob/ob: Glp2r / mice vs. ob/ob littermates. The improvement in oral glucose tolerance

may be due to increased levels of insulin perhaps reflecting increased circulating levels of

GLP-1 in the double knockout mice compared to ob/ob littermates. Analysis of plasma

metabolites and hormones revealed that ob/ob: Glp2r / mice have elevated circulating levels

of GLP-1 and GLP-2 (plasma obtained from endpoint cardiac bleedings) as well as increased

levels of insulin 30 minutes following oral glucose challenge. These observations may

explain the improved oral glucose tolerance of the ob/ob: Glp2r / mice as insulin is an

obvious candidate molecule to lower blood glucose and GLP-1 is a known stimulator of

glucose-induced insulin secretion 333. The impaired intraperitoneal glucose tolerance may

reflect the absence of increased levels of GLP-1 (therefore GLP-1-stimulated increase in

insulin levels) under conditions where glucose administration bypasses the gut. Consistent

with this possibility, insulin levels were not significantly different 0, 10 and 30 minutes

following an IP glucose challenge between ob/ob: Glp2r / mice and littermate controls.

To better understand the mechanisms leading to increased glucagon levels and

hyperglycaemia in the ob/ob: Glp2r / mice, we assessed alpha and beta cell mass. First, we

observed that endpoint pancreas weight was significantly higher in ob/ob: Glp2r / mice

compared to ob/ob littermates. Analysis of islet cell types revealed a modest decrease in beta

cell mass but an increase in alpha cell mass in ob/ob: Glp2r / vs. ob/ob mice. Given that

exogenous GLP-2 administration has been shown to stimulate glucagon secretion in rats and

humans 103, 159, we hypothesized that ablation of GLP-2R signalling would result in decreased

glucagon secretion. Yet our ob/ob: Glp2r / mouse shows the opposite phenotype with

increased circulating levels of glucagon and increased alpha cell mass. This discrepancy may

be explained by increased islet inflammation in ob/ob mice.

Several studies have assessed the importance of inflammation in contributing to the

diabetic phenotype. Obesity and type 2 diabetes have been linked to low grade systemic

inflammation 354, 404 and local inflammation in the pancreatic islet also contributes

significantly to the diabetic phenotype. IL-1 has been implicated in the modulation of beta

cell mass in type 2 diabetes. Laser-captured cell sections from 10 type 2 diabetic patients

revealed increased mRNA expression levels of IL-1 compared to 9 normoglycemic patients 405. Mouse models of obesity (ob/ob mouse) and glucose intolerance (high fat fed mouse)

also exhibit significantly increased IL-1 expression in adipose (epididymal) tissue co-

128

relating with an increase in insulin resistance (measured by the HOMA-1R test) 406. These

observations are in accordance with reports on the role of adipose tissue as an endocrine

organ that can contribute to insulin resistance by secreting macrophages/cytokines 407. More

concrete evidence stems from studies using IL-1 antagonism to demonstrate effects on beta

cell function. In type 2 diabetic subjects, a 13 week treatment with IL-1Ra, an IL-1

antagonist, significantly improved glycated haemoglobin levels (a decrease in HbA1c by

0.33% in treatment group compared to an increase by 0.13% in placebo group) and improved

cell secretory function (decreased proinsulin:insulin ratio in treatment vs. placebo group,

increased AUC for C-peptide after oral and IV glucose challenge) 408. Similarly, in a rat

model of diabetes (GK rat), IL-1 mRNA expression levels were found to be increased 16

fold in the isolated pancreatic islets vs. control Wistar rats 409. Treatment of GK rats with IL-

1Ra reduced hyperglycaemia, increased proinsulin to insulin processing, reduced insulin

resistance (measured by HOMA-1R test) and improved insulin sensitivity 409. Therefore, IL-

1 contributes to beta cell dysfunction in diabetes and obesity and may thus contribute to loss

of functional beta cell mass.

It is likely then, that our ob/ob: Glp2r / mouse develops increased islet inflammation,

including increased IL-1 , which could potentially explain the decreased beta cell mass.

Indeed, hyperglycaemic conditions have been shown to result in increased IL-1 expression

in RNA isolated from TC-6 cells as well as increased mature IL-1 levels assessed by

Western blot in association with increased apoptosis of this cell line 410. We show in

Chapter 3 that the number of Ki-67+ cells is reduced in islets of ob/ob: Glp2r / mice. In

vitro experiments with rat islets have demonstrated that exogenous treatment with IL-1

significantly reduced cell proliferation and that at concentrations above 50U/mL IL-1

treatment was associated with increased cell apoptosis 411. Given that IL-1 levels are

elevated in diabetes/obesity, increased levels of IL-1 could be one of the possible

contributors to the decreased islet cell proliferation and decreased mass observed in our

ob/ob: Glp2r / mouse. While the importance of basal GLP-2R signalling in modulating IL-

1 expression has not been studied, exogenous GLP-2 administration significantly reduced

IL-1 levels in models of intestinal inflammation. GLP-2 treatment reduced IL-1 levels in

mucosal scrapings from Il10-/- mice with colitis 412, as well as in mice with TNBS-induced

ileitis and colitis 141. Accordingly, one could speculate that disruption of GLP-2R signalling

129

may lead to increased inflammation by increasing levels of pro-inflammatory cytokines such

as IL-1 in the setting of the already inflamed ob/ob islet leading to decreased beta cell mass.

The increased alpha cell mass could likewise be explained in terms of an increased

inflammatory response. IL-6 has been implicated in stimulation of glucagon secretion from

the pancreatic islet. The islet -cell expresses the IL-6 receptor and treatment of isolated

mouse and human pancreatic islets with IL-6 significantly increased proglucagon mRNA

levels as well as glucagon secretion with no significant effects on insulin mRNA or secretion 355. In vivo injection of IL-6 in fasted mice also resulted in increased circulating glucagon

levels as early as 2 hours post-injection 355. Furthermore, treatment of isolated human and

mouse pancreatic islets with IL-6 for 4 days was associated with significantly increased

incidence of Ki-67+ islet cells (human) and increased BrdU+ alpha cells (mouse) 355

suggesting that IL-6 may enhance alpha cell proliferation. Parallel loss of function studies in

high fat fed Il6-/- mice demonstrated lower circulating glucagon levels, impaired glucose

tolerance and significantly decreased alpha cell mass 355 suggesting that endogenous IL-6 is

required for glucose homeostasis and islet function in vivo. Such observations may provide

clues to explain why our mouse model ob/ob: Glp2r / exhibits increased alpha cell mass and

glucagon secretion. Indeed, the ob/ob mouse has increased circulating levels of IL-6 and also

exhibits increased IL-6 secretion from isolated white adipocytes in response to 12 hour

treatment with LPS 413. Given the anti-inflammatory function of exogenous GLP-2 in the

setting of systemic and local inflammation, it could be hypothesized that the ob/ob mouse

may have an increased inflammatory phenotype in the absence of endogenous GLP-2R

signalling. While we did not measure either IL-6 or IL-1 in our ob/ob: Glp2r / mice,

further studies could address the contribution of these inflammatory cytokines to increased

glucagon secretion and decreased alpha cell mass in this mouse.

Conclusions and Future Directions

In Chapter 2, we show that endogenous GLP-2R signalling is essential for intestinal

adaptation to re-feeding by activating the ErbB network and in turn p-Akt. While others

have previously shown that endogenous GLP-2 is essential for re-feeding induced intestinal

adaptation 91, 318, our study is the first to demonstrate that activation of the ErbB network is

130

also required for this adaptive response. These unique observations need to be further

explored on their own as well as in the context of GLP-2. Will inhibition of specific ErbB

receptors result in impaired intestinal adaptation to re-feeding? To address this question,

fasting and re-feeding could be studied in waved-2 mice as well as using specific ErbB

inhibitors (e.g. inhibition of ErbB2 using trastuzumab, inhibition of ErbB1 and ErbB2 using

lapatinib, etc). Future studies should also focus on assessing molecules downstream of p-Akt

�– what happens to levels (mRNA and protein) of cyclin D1 and mTOR in our wildtype mice

+ CI-1033 re-feeding timecourse as well as in our re-feeding timecourse with Glp2r / mice?

These data will help elucidate the molecular pathways regulating GLP-2 and ErbB network

activated effects during the re-feeding state. Moreover, our experiments in Chapter 2 are

focused on proliferative effects of GLP-2 and ErbB ligands. Future efforts should be

directed on studying anti-apoptotic effects of endogenous GLP-2R signalling in mediating re-

feeding adaptation. It has been previously shown that infusion of exogenous GLP-2 at doses

meant to mimic �“physiological�” levels results in promotion of cell survival rather than

stimulation of proliferation (discussed in detail in Chapter 1) 118. Incidence of apoptotic cells

(cleaved caspase-3+ cells) along the crypt-villus axis of re-fed Glp2r / mice as well as mice

treated with CI-1033 should be assessed. Furthermore, levels of pro-apoptotic molecules

(e.g. cleaved caspase-3, bad) should be assessed in jejunum tissue from Glp2r / mice and

wildtype mice treated with CI-1033. These studies will help clarify the importance of GLP-

2R activation of proliferation vs. apoptosis in the setting of fasting and re-feeding.

In Chapter 3, we show that the known GLP-2R is not essential for diabetic intestinal

growth. Our observations are contrary to published reports on the role of endogenous GLP-2

in modulating diabetic intestinal growth 217. Therefore, (as discussed above) the role of

potential compensatory mechanisms in the Glp2r / should be studied. Several methods

could be used to address whether other gut growth factors and their downstream signalling

molecules are upregulated or downregulated in the Glp2r / intestine. Circulating and tissue

(duodenum, jejunum, ileum, and colon) expression and protein levels of key nutrient-

regulated and GLP-2-regulated molecules should be assessed in fasted, fed, and diabetic

Glp2r / mice and littermate controls. Microarray studies can also help reveal differences in

gene expression of a number of different (GLP-2-regulated) molecules in Glp2r / vs.

Glp2r+/+ mice. In Chapter 3 we also show that glucose homeostasis and glucagon secretion is

131

significantly altered in the ob/ob: Glp2r / mouse. We have discussed a number of potential

mechanisms that could lead to decreased beta cell mass and increased alpha cell mass,

including contribution of local and systemic inflammation and cytokines such as IL-1 and

IL-6. Preliminary data from our lab has revealed no differences in intestinal permeability (as

assessed by FITC-dextran oral gavage and recovery in plasma, see Chapter 3). Nevertheless,

circulating and tissue (intestinal, adipose, and islet) levels of inflammatory cytokines should

be assessed in ob/ob: Glp2r / mice and littermate ob/ob controls as well as Glp2r / and

Glp2r+/+ mice. These data will help elucidate whether systemic or local inflammation in the

ob/ob mouse is exacerbated in the absence of GLP-2R signalling. Future experiments could

also focus on chemical inhibition of IL-1 or IL-6 in the ob/ob: Glp2r / mouse and whether

these treatments would lead to changes in glucose homeostasis and beta/alpha cell mass.

Future studies should also focus on the role of GLP-2 (physiological and

pharmacological) on nutrient absorption under basal conditions. It has been previously

shown that exogenous GLP-2 administration stimulates duodenal absorption of amino acids

(leucine) and fat (triolein) in mice 148 with no effects on maltose or glucose absorption.

Preliminary unpublished data from our lab confirms that exogenous GLP-2 administration

(2.5 g) stimulates absorption of all of the essential amino acids while parallel loss of

function studies demonstrate that genetic ablation of GLP-2R signalling decreases lysine

absorption in vivo. Future studies should focus on delineation of the downstream mediators

and signalling pathways involved in GLP-2 mediated regulation of intestinal nutrient

absorption. Such findings will help pave the way to understand the molecular pathways that

regulate GLP-2�’s actions in situations of nutrient deprivation or excess (such as the

experiments performed in this thesis).

In conclusion, disruption of GLP-2R signalling significantly affects adaptation in

models of nutrient deprivation and excess. In Chapter 2, we demonstrated that intestinal

adaptation to re-feeding following a prolonged fast requires the GLP-2R in order to activate

the ErbB network and Akt phosphorylation leading to intestinal growth. In Chapter 3, we

demonstrated that while the GLP-2R is not required for intestinal adaptation to perceived

nutrient deprivation (i.e. STZ-induced diabetes) or excess (i.e. high fat feeding), it is required

for glucose homeostasis and normal glucagon secretion in the ob/ob mouse. These studies

132

demonstrate for the first time that endogenous GLP-2R signalling is important for nutrient-

regulated adaptation of the gut and pancreas.

133

References 1. Drucker DJ, Asa S. Glucagon gene expression in vertebrate brain. J Biol Chem

1988;263:13475-8. 2. Mojsov S, Heinrich G, Wilson IB, Ravazzola M, Orci L, Habener JF. Preproglucagon

gene expression in pancreas and intestine diversifies at the level of post-translational processing. J Biol Chem 1986;261:11880-9.

3. Heinrich G, Gros P, Habener JF. Glucagon gene sequence. Four of six exons encode separate functional domains of rat pre-proglucagon. J Biol Chem 1984;259:14082-7.

4. Lund PK, Goodman RH, Dee PC, Habener JF. Pancreatic preproglucagon cDNA contains two glucagon-related coding sequences arranged in tandem. Proc Natl Acad Sci U S A 1982;79:345-9.

5. Lund PK, Goodman RH, Habener JF. Pancreatic pre-proglucagons are encoded by two separate mRNAs. J Biol Chem 1981;256:6515-8.

6. Lund PK, Goodman RH, Habener JF. Intestinal glucagon mRNA identified by hybridization to a cloned islet cDNA encoding a precursor. Biochem Biophys Res Commun 1981;100:1659-66.

7. Larsen PJ, Tang-Christensen M, Holst JJ, Orskov C. Distribution of glucagon-like peptide-1 and other preproglucagon-derived peptides in the rat hypothalamus and brainstem. Neuroscience 1997;77:257-70.

8. Drucker DJ, Brubaker PL. Proglucagon gene expression is regulated by a cyclic AMP-dependent pathway in rat intestine. Proc Natl Acad Sci U S A 1989;86:3953-7.

9. Rothenberg ME, Eilertson CD, Klein K, Zhou Y, Lindberg I, McDonald JK, Mackin RB, Noe BD. Processing of mouse proglucagon by recombinant prohormone convertase 1 and immunopurified prohormone convertase 2 in vitro. J Biol Chem 1995;270:10136-46.

10. Rouille Y, Westermark G, Martin SK, Steiner DF. Proglucagon is processed to glucagon by prohormone convertase PC2 in alpha TC1-6 cells. Proc Natl Acad Sci U S A 1994;91:3242-6.

11. Rouille Y, Martin S, Steiner DF. Differential processing of proglucagon by the subtilisin-like prohormone convertases PC2 and PC3 to generate either glucagon or glucagon-like peptide. J Biol Chem 1995;270:26488-96.

12. Fischer KD, Dhanvantari S, Drucker DJ, Brubaker PL. Intestinal growth is associated with elevated levels of glucagon-like peptide 2 in diabetic rats. Am J Physiol 1997;273:E815-20.

13. Dhanvantari S, Seidah NG, Brubaker PL. Role of prohormone convertases in the tissue-specific processing of proglucagon. Mol Endocrinol 1996;10:342-55.

14. Chen L, Komiya I, Inman L, McCorkle K, Alam T, Unger RH. Molecular and cellular responses of islets during perturbations of glucose homeostasis determined by in situ hybridization histochemistry. Proc Natl Acad Sci U S A 1989;86:1367-71.

15. Philippe J. Insulin regulation of the glucagon gene is mediated by an insulin-responsive DNA element. Proc Natl Acad Sci U S A 1991;88:7224-7.

16. Philippe J. Glucagon gene transcription is negatively regulated by insulin in a hamster islet cell line. J Clin Invest 1989;84:672-7.

134

17. Dumonteil E, Magnan C, Ritz-Laser B, Meda P, Dussoix P, Gilbert M, Ktorza A, Philippe J. Insulin, but not glucose lowering corrects the hyperglucagonemia and increased proglucagon messenger ribonucleic acid levels observed in insulinopenic diabetes. Endocrinology 1998;139:4540-6.

18. Ritz-Laser B, Estreicher A, Gauthier B, Philippe J. The paired homeodomain transcription factor Pax-2 is expressed in the endocrine pancreas and transactivates the glucagon gene promoter. J Biol Chem 2000;275:32708-15.

19. Heller RS, Stoffers DA, Liu A, Schedl A, Crenshaw EB, 3rd, Madsen OD, Serup P. The role of Brn4/Pou3f4 and Pax6 in forming the pancreatic glucagon cell identity. Dev Biol 2004;268:123-34.

20. Flock G, Drucker DJ. Pax-2 activates the proglucagon gene promoter but is not essential for proglucagon gene expression or development of proglucagon-producing cell lineages in the murine pancreas or intestine. Mol Endocrinol 2002;16:2349-59.

21. Zaiko M, Estreicher A, Ritz-Laser B, Herrera P, Favor J, Meda P, Philippe J. Pax2 mutant mice display increased number and size of islets of Langerhans but no change in insulin and glucagon content. Eur J Endocrinol 2004;150:389-95.

22. Kaestner KH, Katz J, Liu Y, Drucker DJ, Schutz G. Inactivation of the winged helix transcription factor HNF3alpha affects glucose homeostasis and islet glucagon gene expression in vivo. Genes Dev 1999;13:495-504.

23. Philippe J, Morel C, Prezioso VR. Glucagon gene expression is negatively regulated by hepatocyte nuclear factor 3 beta. Mol Cell Biol 1994;14:3514-23.

24. Diedrich T, Furstenau U, Knepel W. Glucagon gene G3 enhancer: evidence that activity depends on combination of an islet-specific factor and a winged helix protein. Biol Chem 1997;378:89-98.

25. Gauthier BR, Schwitzgebel VM, Zaiko M, Mamin A, Ritz-Laser B, Philippe J. Hepatic nuclear factor-3 (HNF-3 or Foxa2) regulates glucagon gene transcription by binding to the G1 and G2 promoter elements. Mol Endocrinol 2002;16:170-83.

26. Philippe J. Hepatocyte-nuclear factor 3 beta gene transcripts generate protein isoforms with different transactivation properties on the glucagon gene. Mol Endocrinol 1995;9:368-74.

27. Sharma SK, Leinemann U, Ratke R, Oetjen E, Blume R, Dickel C, Knepel W. Characterization of a novel Foxa (hepatocyte nuclear factor-3) site in the glucagon promoter that is conserved between rodents and humans. Biochem J 2005;389:831-41.

28. Shih DQ, Navas MA, Kuwajima S, Duncan SA, Stoffel M. Impaired glucose homeostasis and neonatal mortality in hepatocyte nuclear factor 3alpha-deficient mice. Proc Natl Acad Sci U S A 1999;96:10152-7.

29. Ang SL, Rossant J. HNF-3 beta is essential for node and notochord formation in mouse development. Cell 1994;78:561-74.

30. Sund NJ, Vatamaniuk MZ, Casey M, Ang SL, Magnuson MA, Stoffers DA, Matschinsky FM, Kaestner KH. Tissue-specific deletion of Foxa2 in pancreatic beta cells results in hyperinsulinemic hypoglycemia. Genes Dev 2001;15:1706-15.

31. Lee CS, Sund NJ, Behr R, Herrera PL, Kaestner KH. Foxa2 is required for the differentiation of pancreatic alpha-cells. Dev Biol 2005;278:484-95.

135

32. Liu Y, Shen W, Brubaker PL, Kaestner KH, Drucker DJ. Foxa3 (HNF-3gamma) binds to and activates the rat proglucagon gene promoter but is not essential for proglucagon gene expression. Biochem J 2002;366:633-41.

33. Jin T, Drucker DJ. Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3. Mol Cell Biol 1996;16:19-28.

34. Jin T, Trinh DK, Wang F, Drucker DJ. The caudal homeobox protein cdx-2/3 activates endogenous proglucagon gene expression in InR1-G9 islet cells. Mol Endocrinol 1997;11:203-9.

35. Nian M, Gu J, Irwin DM, Drucker DJ. Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression. Am J Physiol Regul Integr Comp Physiol 2002;282:R173-83.

36. Drozdowski LA, Dixon WT, McBurney MI, Thomson AB. Short-chain fatty acids and total parenteral nutrition affect intestinal gene expression. JPEN J Parenter Enteral Nutr 2002;26:145-50.

37. Fuller PJ, Beveridge DJ, Taylor RG. Ileal proglucagon gene expression in the rat: characterization in intestinal adaptation using in situ hybridization. Gastroenterology 1993;104:459-66.

38. Taylor RG, Verity K, Fuller PJ. Ileal glucagon gene expression: ontogeny and response to massive small bowel resection. Gastroenterology 1990;99:724-9.

39. Drucker DJ, Jin T, Asa SL, Young TA, Brubaker PL. Activation of proglucagon gene transcription by protein kinase-A in a novel mouse enteroendocrine cell line. Mol Endocrinol 1994;8:1646-55.

40. Gajic D, Drucker DJ. Multiple cis-acting domains mediate basal and adenosine 3',5'-monophosphate-dependent glucagon gene transcription in a mouse neuroendocrine cell line. Endocrinology 1993;132:1055-62.

41. Lu F, Jin T, Drucker DJ. Proglucagon gene expression is induced by gastrin-releasing peptide in a mouse enteroendocrine cell line. Endocrinology 1996;137:3710-6.

42. Yusta B, Estall J, Drucker DJ. Glucagon-like peptide-2 receptor activation engages bad and glycogen synthase kinase-3 in a protein kinase A-dependent manner and prevents apoptosis following inhibition of phosphatidylinositol 3-kinase. J Biol Chem 2002;277:24896-906.

43. Fujino H, West KA, Regan JW. Phosphorylation of glycogen synthase kinase-3 and stimulation of T-cell factor signaling following activation of EP2 and EP4 prostanoid receptors by prostaglandin E2. J Biol Chem 2002;277:2614-9.

44. Ni Z, Anini Y, Fang X, Mills G, Brubaker PL, Jin T. Transcriptional activation of the proglucagon gene by lithium and beta-catenin in intestinal endocrine L cells. J Biol Chem 2003;278:1380-7.

45. Yi F, Sun J, Lim GE, Fantus IG, Brubaker PL, Jin T. Cross talk between the insulin and Wnt signaling pathways: evidence from intestinal endocrine L cells. Endocrinology 2008;149:2341-51.

46. Hill ME, Asa SL, Drucker DJ. Essential requirement for Pax6 in control of enteroendocrine proglucagon gene transcription. Mol Endocrinol 1999;13:1474-86.

47. Trinh DK, Zhang K, Hossain M, Brubaker PL, Drucker DJ. Pax-6 activates endogenous proglucagon gene expression in the rodent gastrointestinal epithelium. Diabetes 2003;52:425-33.

136

48. Ding J, Gao Y, Zhao J, Yan H, Guo SY, Zhang QX, Li LS, Gao X. Pax6 haploinsufficiency causes abnormal metabolic homeostasis by down-regulating glucagon-like peptide 1 in mice. Endocrinology 2009;150:2136-44.

49. Eissele R, Goke R, Willemer S, Harthus HP, Vermeer H, Arnold R, Goke B. Glucagon-like peptide-1 cells in the gastrointestinal tract and pancreas of rat, pig and man. Eur J Clin Invest 1992;22:283-91.

50. Tolhurst G, Reimann F, Gribble FM. Nutritional regulation of glucagon-like peptide-1 secretion. J Physiol 2009;587:27-32.

51. Xiao Q, Boushey RP, Drucker DJ, Brubaker PL. Secretion of the intestinotropic hormone glucagon-like peptide 2 is differentially regulated by nutrients in humans. Gastroenterology 1999;117:99-105.

52. Herrmann C, Goke R, Richter G, Fehmann HC, Arnold R, Goke B. Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma levels in response to nutrients. Digestion 1995;56:117-26.

53. Rocca AS, Brubaker PL. Stereospecific effects of fatty acids on proglucagon-derived peptide secretion in fetal rat intestinal cultures. Endocrinology 1995;136:5593-9.

54. Anini Y, Hansotia T, Brubaker PL. Muscarinic receptors control postprandial release of glucagon-like peptide-1: in vivo and in vitro studies in rats. Endocrinology 2002;143:2420-6.

55. Anini Y, Brubaker PL. Muscarinic receptors control glucagon-like peptide 1 secretion by human endocrine L cells. Endocrinology 2003;144:3244-50.

56. Claustre J, Brechet S, Plaisancie P, Chayvialle JA, Cuber JC. Stimulatory effect of beta-adrenergic agonists on ileal L cell secretion and modulation by alpha-adrenergic activation. J Endocrinol 1999;162:271-8.

57. Hansen L, Lampert S, Mineo H, Holst JJ. Neural regulation of glucagon-like peptide-1 secretion in pigs. Am J Physiol Endocrinol Metab 2004;287:E939-47.

58. Balks HJ, Holst JJ, von zur Muhlen A, Brabant G. Rapid oscillations in plasma glucagon-like peptide-1 (GLP-1) in humans: cholinergic control of GLP-1 secretion via muscarinic receptors. J Clin Endocrinol Metab 1997;82:786-90.

59. Herrmann-Rinke C, Voge A, Hess M, Goke B. Regulation of glucagon-like peptide-1 secretion from rat ileum by neurotransmitters and peptides. J Endocrinol 1995;147:25-31.

60. Roberge JN, Gronau KA, Brubaker PL. Gastrin-releasing peptide is a novel mediator of proximal nutrient-induced proglucagon-derived peptide secretion from the distal gut. Endocrinology 1996;137:2383-8.

61. Persson K, Gingerich RL, Nayak S, Wada K, Wada E, Ahren B. Reduced GLP-1 and insulin responses and glucose intolerance after gastric glucose in GRP receptor-deleted mice. Am J Physiol Endocrinol Metab 2000;279:E956-62.

62. Brubaker PL. Regulation of intestinal proglucagon-derived peptide secretion by intestinal regulatory peptides. Endocrinology 1991;128:3175-82.

63. Dumoulin V, Dakka T, Plaisancie P, Chayvialle JA, Cuber JC. Regulation of glucagon-like peptide-1-(7-36) amide, peptide YY, and neurotensin secretion by neurotransmitters and gut hormones in the isolated vascularly perfused rat ileum. Endocrinology 1995;136:5182-8.

137

64. Roberge JN, Brubaker PL. Regulation of intestinal proglucagon-derived peptide secretion by glucose-dependent insulinotropic peptide in a novel enteroendocrine loop. Endocrinology 1993;133:233-40.

65. Roberge JN, Brubaker PL. Secretion of proglucagon-derived peptides in response to intestinal luminal nutrients. Endocrinology 1991;128:3169-74.

66. Hansen L, Holst JJ. The effects of duodenal peptides on glucagon-like peptide-1 secretion from the ileum. A duodeno--ileal loop? Regul Pept 2002;110:39-45.

67. Nauck MA, Bartels E, Orskov C, Ebert R, Creutzfeldt W. Additive insulinotropic effects of exogenous synthetic human gastric inhibitory polypeptide and glucagon-like peptide-1-(7-36) amide infused at near-physiological insulinotropic hormone and glucose concentrations. J Clin Endocrinol Metab 1993;76:912-7.

68. Beglinger S, Drewe J, Schirra J, Goke B, D'Amato M, Beglinger C. Role of fat hydrolysis in regulating glucagon-like Peptide-1 secretion. J Clin Endocrinol Metab;95:879-86.

69. Cordier-Bussat M, Bernard C, Levenez F, Klages N, Laser-Ritz B, Philippe J, Chayvialle JA, Cuber JC. Peptones stimulate both the secretion of the incretin hormone glucagon-like peptide 1 and the transcription of the proglucagon gene. Diabetes 1998;47:1038-45.

70. Ray EC, Avissar NE, Sax HC. Growth factor regulation of enterocyte nutrient transport during intestinal adaptation. Am J Surg 2002;183:361-71.

71. Reimann F, Gribble FM. Glucose-sensing in glucagon-like peptide-1-secreting cells. Diabetes 2002;51:2757-63.

72. Gribble FM, Williams L, Simpson AK, Reimann F. A novel glucose-sensing mechanism contributing to glucagon-like peptide-1 secretion from the GLUTag cell line. Diabetes 2003;52:1147-54.

73. Chance WT, Sheriff S, Foley-Nelson T, Thomas I, Balasubramaniam A. Maintaining gut integrity during parenteral nutrition of tumor-bearing rats: effects of glucagon-like peptide 2. Nutr Cancer 2000;37:215-22.

74. Romeo E, Dave MH, Bacic D, Ristic Z, Camargo SM, Loffing J, Wagner CA, Verrey F. Luminal kidney and intestine SLC6 amino acid transporters of B0AT-cluster and their tissue distribution in Mus musculus. Am J Physiol Renal Physiol 2006;290:F376-83.

75. Dave MH, Schulz N, Zecevic M, Wagner CA, Verrey F. Expression of heteromeric amino acid transporters along the murine intestine. J Physiol 2004;558:597-610.

76. Mosckovitz R, Yan N, Heimer E, Felix A, Tate SS, Udenfriend S. Characterization of the rat neutral and basic amino acid transporter utilizing anti-peptide antibodies. Proc Natl Acad Sci U S A 1993;90:4022-6.

77. Terada T, Shimada Y, Pan X, Kishimoto K, Sakurai T, Doi R, Onodera H, Katsura T, Imamura M, Inui K. Expression profiles of various transporters for oligopeptides, amino acids and organic ions along the human digestive tract. Biochem Pharmacol 2005;70:1756-63.

78. Reimann F, Williams L, da Silva Xavier G, Rutter GA, Gribble FM. Glutamine potently stimulates glucagon-like peptide-1 secretion from GLUTag cells. Diabetologia 2004;47:1592-601.

138

79. Gameiro A, Reimann F, Habib AM, O'Malley D, Williams L, Simpson AK, Gribble FM. The neurotransmitters glycine and GABA stimulate glucagon-like peptide-1 release from the GLUTag cell line. J Physiol 2005;569:761-72.

80. Greenfield JR, Farooqi IS, Keogh JM, Henning E, Habib AM, Blackwood A, Reimann F, Holst JJ, Gribble FM. Oral glutamine increases circulating glucagon-like peptide 1, glucagon, and insulin concentrations in lean, obese, and type 2 diabetic subjects. Am J Clin Nutr 2009;89:106-13.

81. Brubaker PL, Schloos J, Drucker DJ. Regulation of glucagon-like peptide-1 synthesis and secretion in the GLUTag enteroendocrine cell line. Endocrinology 1998;139:4108-14.

82. Lauffer LM, Iakoubov R, Brubaker PL. GPR119 is essential for oleoylethanolamide-induced glucagon-like peptide-1 secretion from the intestinal enteroendocrine L-cell. Diabetes 2009;58:1058-66.

83. Zhou J, Martin RJ, Tulley RT, Raggio AM, McCutcheon KL, Shen L, Danna SC, Tripathy S, Hegsted M, Keenan MJ. Dietary resistant starch upregulates total GLP-1 and PYY in a sustained day-long manner through fermentation in rodents. Am J Physiol Endocrinol Metab 2008;295:E1160-6.

84. Reimer RA, McBurney MI. Dietary fiber modulates intestinal proglucagon messenger ribonucleic acid and postprandial secretion of glucagon-like peptide-1 and insulin in rats. Endocrinology 1996;137:3948-56.

85. Drucker DJ, Shi Q, Crivici A, Sumner-Smith M, Tavares W, Hill M, DeForest L, Cooper S, Brubaker PL. Regulation of the biological activity of glucagon-like peptide 2 in vivo by dipeptidyl peptidase IV. Nat Biotechnol 1997;15:673-7.

86. Hartmann B, Harr MB, Jeppesen PB, Wojdemann M, Deacon CF, Mortensen PB, Holst JJ. In vivo and in vitro degradation of glucagon-like peptide-2 in humans. J Clin Endocrinol Metab 2000;85:2884-8.

87. Tavares W, Drucker DJ, Brubaker PL. Enzymatic- and renal-dependent catabolism of the intestinotropic hormone glucagon-like peptide-2 in rats. Am J Physiol Endocrinol Metab 2000;278:E134-9.

88. Boonacker E, Van Noorden CJ. The multifunctional or moonlighting protein CD26/DPPIV. Eur J Cell Biol 2003;82:53-73.

89. Lambeir AM, Proost P, Scharpe S, De Meester I. A kinetic study of glucagon-like peptide-1 and glucagon-like peptide-2 truncation by dipeptidyl peptidase IV, in vitro. Biochem Pharmacol 2002;64:1753-6.

90. Thulesen J, Knudsen LB, Hartmann B, Hastrup S, Kissow H, Jeppesen PB, Orskov C, Holst JJ, Poulsen SS. The truncated metabolite GLP-2 (3-33) interacts with the GLP-2 receptor as a partial agonist. Regul Pept 2002;103:9-15.

91. Shin ED, Estall JL, Izzo A, Drucker DJ, Brubaker PL. Mucosal adaptation to enteral nutrients is dependent on the physiologic actions of glucagon-like peptide-2 in mice. Gastroenterology 2005;128:1340-53.

92. Booth C, Booth D, Williamson S, Demchyshyn LL, Potten CS. Teduglutide ([Gly2]GLP-2) protects small intestinal stem cells from radiation damage. Cell Prolif 2004;37:385-400.

93. Hartmann B, Thulesen J, Kissow H, Thulesen S, Orskov C, Ropke C, Poulsen SS, Holst JJ. Dipeptidyl peptidase IV inhibition enhances the intestinotrophic effect of glucagon-like peptide-2 in rats and mice. Endocrinology 2000;141:4013-20.

139

94. Ruiz-Grande C, Pintado J, Alarcon C, Castilla C, Valverde I, Lopez-Novoa JM. Renal catabolism of human glucagon-like peptides 1 and 2. Can J Physiol Pharmacol 1990;68:1568-73.

95. Brubaker PL, Crivici A, Izzo A, Ehrlich P, Tsai CH, Drucker DJ. Circulating and tissue forms of the intestinal growth factor, glucagon-like peptide-2. Endocrinology 1997;138:4837-43.

96. Hansen L, Hare KJ, Hartmann B, Deacon CF, Ugleholdt RK, Plamboeck A, Holst JJ. Metabolism of glucagon-like peptide-2 in pigs: role of dipeptidyl peptidase IV. Regul Pept 2007;138:126-32.

97. Munroe DG, Gupta AK, Kooshesh F, Vyas TB, Rizkalla G, Wang H, Demchyshyn L, Yang ZJ, Kamboj RK, Chen H, McCallum K, Sumner-Smith M, Drucker DJ, Crivici A. Prototypic G protein-coupled receptor for the intestinotrophic factor glucagon-like peptide 2. Proc Natl Acad Sci U S A 1999;96:1569-73.

98. Yusta B, Huang L, Munroe D, Wolff G, Fantaske R, Sharma S, Demchyshyn L, Asa SL, Drucker DJ. Enteroendocrine localization of GLP-2 receptor expression in humans and rodents. Gastroenterology 2000;119:744-55.

99. Lovshin J, Estall J, Yusta B, Brown TJ, Drucker DJ. Glucagon-like peptide (GLP)-2 action in the murine central nervous system is enhanced by elimination of GLP-1 receptor signaling. J Biol Chem 2001;276:21489-99.

100. Yusta B, Boushey RP, Drucker DJ. The glucagon-like peptide-2 receptor mediates direct inhibition of cellular apoptosis via a cAMP-dependent protein kinase-independent pathway. J Biol Chem 2000;275:35345-52.

101. Tang-Christensen M, Larsen PJ, Thulesen J, Romer J, Vrang N. The proglucagon-derived peptide, glucagon-like peptide-2, is a neurotransmitter involved in the regulation of food intake. Nat Med 2000;6:802-7.

102. Nelson DW, Sharp JW, Brownfield MS, Raybould HE, Ney DM. Localization and activation of glucagon-like peptide-2 receptors on vagal afferents in the rat. Endocrinology 2007;148:1954-62.

103. de Heer J, Pedersen J, Orskov C, Holst JJ. The alpha cell expresses glucagon-like peptide-2 receptors and glucagon-like peptide-2 stimulates glucagon secretion from the rat pancreas. Diabetologia 2007;50:2135-42.

104. Bjerknes M, Cheng H. Modulation of specific intestinal epithelial progenitors by enteric neurons. Proc Natl Acad Sci U S A 2001;98:12497-502.

105. Guan X, Karpen HE, Stephens J, Bukowski JT, Niu S, Zhang G, Stoll B, Finegold MJ, Holst JJ, Hadsell D, Nichols BL, Burrin DG. GLP-2 receptor localizes to enteric neurons and endocrine cells expressing vasoactive peptides and mediates increased blood flow. Gastroenterology 2006;130:150-64.

106. Orskov C, Hartmann B, Poulsen SS, Thulesen J, Hare KJ, Holst JJ. GLP-2 stimulates colonic growth via KGF, released by subepithelial myofibroblasts with GLP-2 receptors. Regul Pept 2005;124:105-12.

107. Yusta B, Somwar R, Wang F, Munroe D, Grinstein S, Klip A, Drucker DJ. Identification of glucagon-like peptide-2 (GLP-2)-activated signaling pathways in baby hamster kidney fibroblasts expressing the rat GLP-2 receptor. J Biol Chem 1999;274:30459-67.

108. Velazquez E, Ruiz-Albusac JM, Blazquez E. Glucagon-like peptide-2 stimulates the proliferation of cultured rat astrocytes. Eur J Biochem 2003;270:3001-9.

140

109. Estall JL, Yusta B, Drucker DJ. Lipid raft-dependent glucagon-like peptide-2 receptor trafficking occurs independently of agonist-induced desensitization. Mol Biol Cell 2004;15:3673-87.

110. Koehler JA, Yusta B, Drucker DJ. The HeLa cell glucagon-like peptide-2 receptor is coupled to regulation of apoptosis and ERK1/2 activation through divergent signaling pathways. Mol Endocrinol 2005;19:459-73.

111. Walsh NA, Yusta B, DaCambra MP, Anini Y, Drucker DJ, Brubaker PL. Glucagon-like peptide-2 receptor activation in the rat intestinal mucosa. Endocrinology 2003;144:4385-92.

112. Lovshin JA, Huang Q, Seaberg R, Brubaker PL, Drucker DJ. Extrahypothalamic expression of the glucagon-like peptide-2 receptor is coupled to reduction of glutamate-induced cell death in cultured hippocampal cells. Endocrinology 2004;145:3495-506.

113. Sams A, Hastrup S, Andersen M, Thim L. Naturally occurring glucagon-like peptide-2 (GLP-2) receptors in human intestinal cell lines. Eur J Pharmacol 2006;532:18-23.

114. Anini Y, Izzo A, Oudit GY, Backx PH, Brubaker PL. Role of phosphatidylinositol-3 kinase-gamma in the actions of glucagon-like peptide-2 on the murine small intestine. Am J Physiol Endocrinol Metab 2007;292:E1599-606.

115. Hoosein NM, Gurd RS. Human glucagon-like peptides 1 and 2 activate rat brain adenylate cyclase. FEBS Lett 1984;178:83-6.

116. Burrin DG, Stoll B, Guan X, Cui L, Chang X, Hadsell D. GLP-2 rapidly activates divergent intracellular signaling pathways involved in intestinal cell survival and proliferation in neonatal piglets. Am J Physiol Endocrinol Metab 2007;292:E281-91.

117. Boushey RP, Yusta B, Drucker DJ. Glucagon-like peptide (GLP)-2 reduces chemotherapy-associated mortality and enhances cell survival in cells expressing a transfected GLP-2 receptor. Cancer Res 2001;61:687-93.

118. Burrin DG, Stoll B, Guan X, Cui L, Chang X, Holst JJ. Glucagon-like peptide 2 dose-dependently activates intestinal cell survival and proliferation in neonatal piglets. Endocrinology 2005;146:22-32.

119. Dube PE, Rowland KJ, Brubaker PL. Glucagon-like peptide-2 activates beta-catenin signaling in the mouse intestinal crypt: role of insulin-like growth factor-I. Endocrinology 2008;149:291-301.

120. Yusta B, Holland D, Koehler JA, Maziarz M, Estall JL, Higgins R, Drucker DJ. ErbB signaling is required for the proliferative actions of GLP-2 in the murine gut. Gastroenterology 2009;137:986-96.

121. Estall JL, Koehler JA, Yusta B, Drucker DJ. The glucagon-like peptide-2 receptor C terminus modulates beta-arrestin-2 association but is dispensable for ligand-induced desensitization, endocytosis, and G-protein-dependent effector activation. J Biol Chem 2005;280:22124-34.

122. Tsai CH, Hill M, Asa SL, Brubaker PL, Drucker DJ. Intestinal growth-promoting properties of glucagon-like peptide-2 in mice. Am J Physiol 1997;273:E77-84.

123. Drucker DJ, Erlich P, Asa SL, Brubaker PL. Induction of intestinal epithelial proliferation by glucagon-like peptide 2. Proc Natl Acad Sci U S A 1996;93:7911-6.

124. Mardini HE, de Villiers WJ. Teduglutide in intestinal adaptation and repair: light at the end of the tunnel. Expert Opin Investig Drugs 2008;17:945-51.

141

125. Dube PE, Forse CL, Bahrami J, Brubaker PL. The essential role of insulin-like growth factor-1 in the intestinal tropic effects of glucagon-like peptide-2 in mice. Gastroenterology 2006;131:589-605.

126. Gleeson MH, Bloom SR, Polak JM, Henry K, Dowling RH. An endocrine tumour in kidney affecting small bowel structure, motility, and function. Gut 1970;11:1060.

127. Jones B, Fishman EK, Bayless TM, Siegelman SS. Villous hypertrophy of the small bowel in a patient with glucagonoma. J Comput Assist Tomogr 1983;7:334-7.

128. Stevens FM, Flanagan RW, O'Gorman D, Buchanan KD. Glucagonoma syndrome demonstrating giant duodenal villi. Gut 1984;25:784-91.

129. Ramsanahie AP, Berger UV, Zinner MJ, Whang EE, Rhoads DB, Ashley SW. Effect of glucagon-like peptide-2 (GLP-2) on diurnal SGLT1 expression. Dig Dis Sci 2004;49:1731-7.

130. van't Land B, van Beek NM, van den Berg JJ, M'Rabet L. Lactoferrin reduces methotrexate-induced small intestinal damage, possibly through inhibition of GLP-2-mediated epithelial cell proliferation. Dig Dis Sci 2004;49:425-33.

131. Kaji T, Tanaka H, Holst JJ, Redstone H, Wallace L, de Heuval E, Sigalet DL. The effects of variations in dose and method of administration on glucagon like peptide-2 activity in the rat. Eur J Pharmacol 2008;596:138-45.

132. Drucker DJ, Yusta B, Boushey RP, DeForest L, Brubaker PL. Human [Gly2]GLP-2 reduces the severity of colonic injury in a murine model of experimental colitis. Am J Physiol 1999;276:G79-91.

133. Boushey RP, Yusta B, Drucker DJ. Glucagon-like peptide 2 decreases mortality and reduces the severity of indomethacin-induced murine enteritis. Am J Physiol 1999;277:E937-47.

134. L'Heureux MC, Brubaker PL. Glucagon-like peptide-2 and common therapeutics in a murine model of ulcerative colitis. J Pharmacol Exp Ther 2003;306:347-54.

135. Drozdowski LA, Iordache C, Clandinin MT, Todd ZS, Gonnet M, Wild G, Uwiera RR, Thomson AB. Dexamethasone and GLP-2 administered to rat dams during pregnancy and lactation have late effects on intestinal sugar transport in their postweaning offspring. J Nutr Biochem 2008;19:49-60.

136. Chance WT, Foley-Nelson T, Thomas I, Balasubramaniam A. Prevention of parenteral nutrition-induced gut hypoplasia by coinfusion of glucagon-like peptide-2. Am J Physiol 1997;273:G559-63.

137. Scott RB, Kirk D, MacNaughton WK, Meddings JB. GLP-2 augments the adaptive response to massive intestinal resection in rat. Am J Physiol 1998;275:G911-21.

138. Kato Y, Yu D, Schwartz MZ. Glucagonlike peptide-2 enhances small intestinal absorptive function and mucosal mass in vivo. J Pediatr Surg 1999;34:18-20; discussion 20-1.

139. Litvak DA, Hellmich MR, Evers BM, Banker NA, Townsend CM, Jr. Glucagon-like peptide 2 is a potent growth factor for small intestine and colon. J Gastrointest Surg 1998;2:146-50.

140. Sigalet DL, Bawazir O, Martin GR, Wallace LE, Zaharko G, Miller A, Zubaidi A. Glucagon-like peptide-2 induces a specific pattern of adaptation in remnant jejunum. Dig Dis Sci 2006;51:1557-66.

142

141. Sigalet DL, Wallace LE, Holst JJ, Martin GR, Kaji T, Tanaka H, Sharkey KA. Enteric neural pathways mediate the anti-inflammatory actions of glucagon-like peptide 2. Am J Physiol Gastrointest Liver Physiol 2007;293:G211-21.

142. van Goudoever JB, Stoll B, Hartmann B, Holst JJ, Reeds PJ, Burrin DG. Secretion of trophic gut peptides is not different in bolus- and continuously fed piglets. J Nutr 2001;131:729-32.

143. Burrin DG, Stoll B, Jiang R, Petersen Y, Elnif J, Buddington RK, Schmidt M, Holst JJ, Hartmann B, Sangild PT. GLP-2 stimulates intestinal growth in premature TPN-fed pigs by suppressing proteolysis and apoptosis. Am J Physiol Gastrointest Liver Physiol 2000;279:G1249-56.

144. Tsai CH, Hill M, Drucker DJ. Biological determinants of intestinotrophic properties of GLP-2 in vivo. Am J Physiol 1997;272:G662-8.

145. Kitchen PA, Fitzgerald AJ, Goodlad RA, Barley NF, Ghatei MA, Legon S, Bloom SR, Price A, Walters JR, Forbes A. Glucagon-like peptide-2 increases sucrase-isomaltase but not caudal-related homeobox protein-2 gene expression. Am J Physiol Gastrointest Liver Physiol 2000;278:G425-8.

146. Ghatei MA, Goodlad RA, Taheri S, Mandir N, Brynes AE, Jordinson M, Bloom SR. Proglucagon-derived peptides in intestinal epithelial proliferation: glucagon-like peptide-2 is a major mediator of intestinal epithelial proliferation in rats. Dig Dis Sci 2001;46:1255-63.

147. Kitchen PA, Goodlad RA, FitzGerald AJ, Mandir N, Ghatei MA, Bloom SR, Berlanga-Acosta J, Playford RJ, Forbes A, Walters JR. Intestinal growth in parenterally-fed rats induced by the combined effects of glucagon-like peptide 2 and epidermal growth factor. JPEN J Parenter Enteral Nutr 2005;29:248-54.

148. Brubaker PL, Izzo A, Hill M, Drucker DJ. Intestinal function in mice with small bowel growth induced by glucagon-like peptide-2. Am J Physiol 1997;272:E1050-8.

149. Benjamin MA, McKay DM, Yang PC, Cameron H, Perdue MH. Glucagon-like peptide-2 enhances intestinal epithelial barrier function of both transcellular and paracellular pathways in the mouse. Gut 2000;47:112-9.

150. Drucker DJ, DeForest L, Brubaker PL. Intestinal response to growth factors administered alone or in combination with human [Gly2]glucagon-like peptide 2. Am J Physiol 1997;273:G1252-62.

151. Cheeseman CI. Upregulation of SGLT-1 transport activity in rat jejunum induced by GLP-2 infusion in vivo. Am J Physiol 1997;273:R1965-71.

152. Cheeseman CI, O'Neill D. Basolateral D-glucose transport activity along the crypt-villus axis in rat jejunum and upregulation induced by gastric inhibitory peptide and glucagon-like peptide-2. Exp Physiol 1998;83:605-16.

153. Au A, Gupta A, Schembri P, Cheeseman CI. Rapid insertion of GLUT2 into the rat jejunal brush-border membrane promoted by glucagon-like peptide 2. Biochem J 2002;367:247-54.

154. Cottrell JJ, Stoll B, Buddington RK, Stephens JE, Cui L, Chang X, Burrin DG. Glucagon-like peptide-2 protects against TPN-induced intestinal hexose malabsorption in enterally refed piglets. Am J Physiol Gastrointest Liver Physiol 2006;290:G293-300.

143

155. Sangild PT, Tappenden KA, Malo C, Petersen YM, Elnif J, Bartholome AL, Buddington RK. Glucagon-like peptide 2 stimulates intestinal nutrient absorption in parenterally fed newborn pigs. J Pediatr Gastroenterol Nutr 2006;43:160-7.

156. Sangild PT, Malo C, Schmidt M, Petersen YM, Elnif J, Holst JJ, Buddington RK. Glucagon-like peptide 2 has limited efficacy to increase nutrient absorption in fetal and preterm pigs. Am J Physiol Regul Integr Comp Physiol 2007;293:R2179-84.

157. Guan X, Stoll B, Lu X, Tappenden KA, Holst JJ, Hartmann B, Burrin DG. GLP-2-mediated up-regulation of intestinal blood flow and glucose uptake is nitric oxide-dependent in TPN-fed piglets 1. Gastroenterology 2003;125:136-47.

158. Hsieh J, Longuet C, Maida A, Bahrami J, Xu E, Baker CL, Brubaker PL, Drucker DJ, Adeli K. Glucagon-like peptide-2 increases intestinal lipid absorption and chylomicron production via CD36. Gastroenterology 2009;137:997-1005, 1005 e1-4.

159. Meier JJ, Nauck MA, Pott A, Heinze K, Goetze O, Bulut K, Schmidt WE, Gallwitz B, Holst JJ. Glucagon-like peptide 2 stimulates glucagon secretion, enhances lipid absorption, and inhibits gastric acid secretion in humans. Gastroenterology 2006;130:44-54.

160. Stephens J, Stoll B, Cottrell J, Chang X, Helmrath M, Burrin DG. Glucagon-like peptide-2 acutely increases proximal small intestinal blood flow in TPN-fed neonatal piglets. Am J Physiol Regul Integr Comp Physiol 2006;290:R283-9.

161. Deniz M, Bozkurt A, Kurtel H. Mediators of glucagon-like peptide 2-induced blood flow: responses in different vascular sites. Regul Pept 2007;142:7-15.

162. Bremholm L, Hornum M, Henriksen BM, Larsen S, Holst JJ. Glucagon-like peptide-2 increases mesenteric blood flow in humans. Scand J Gastroenterol 2009;44:314-9.

163. Bremholm L, Hornum M, Andersen UB, Holst JJ. The effect of glucagon-like peptide-2 on arterial blood flow and cardiac parameters. Regul Pept;159:67-71.

164. Cheeseman CI, Tsang R. The effect of GIP and glucagon-like peptides on intestinal basolateral membrane hexose transport. Am J Physiol 1996;271:G477-82.

165. Drozdowski L, Iordache C, Clandinin MT, Wild G, Todd Z, Thomson AB. Dexamethasone and GLP-2 given to lactating rat dams influence glucose uptake in suckling and postweanling offspring. JPEN J Parenter Enteral Nutr 2009;33:433-9.

166. Drozdowski LA, Iordache C, Clandinin MT, Todd Z, Gonnet M, Wild G, Uwiera RR, Thomson AB. Maternal dexamethasone and GLP-2 have early effects on intestinal sugar transport in their suckling rat offspring. J Nutr Biochem 2009;20:771-82.

167. Drozdowski LA, Iordache C, Clandinin MT, Wild G, Todd Z, Thomson AB. A combination of dexamethasone and glucagon-like peptide-2 increase intestinal morphology and glucose uptake in suckling rats. J Pediatr Gastroenterol Nutr 2006;42:32-9.

168. Johnson LR, Copeland EM, Dudrick SJ, Lichtenberger LM, Castro GA. Structural and hormonal alterations in the gastrointestinal tract of parenterally fed rats. Gastroenterology 1975;68:1177-83.

169. Alverdy JC, Aoys E, Moss GS. Total parenteral nutrition promotes bacterial translocation from the gut. Surgery 1988;104:185-90.

170. Alverdy JC, Burke D. Total parenteral nutrition: iatrogenic immunosuppression. Nutrition 1992;8:359-65.

171. Alverdy J, Chi HS, Sheldon GF. The effect of parenteral nutrition on gastrointestinal immunity. The importance of enteral stimulation. Ann Surg 1985;202:681-4.

144

172. Howard A, Goodlad RA, Walters JR, Ford D, Hirst BH. Increased expression of specific intestinal amino acid and peptide transporter mRNA in rats fed by TPN is reversed by GLP-2. J Nutr 2004;134:2957-64.

173. Jeppesen PB, Sanguinetti EL, Buchman A, Howard L, Scolapio JS, Ziegler TR, Gregory J, Tappenden KA, Holst J, Mortensen PB. Teduglutide (ALX-0600), a dipeptidyl peptidase IV resistant glucagon-like peptide 2 analogue, improves intestinal function in short bowel syndrome patients. Gut 2005;54:1224-31.

174. Peterson CA, Gillingham MB, Mohapatra NK, Dahly EM, Adamo ML, Carey HV, Lund PK, Ney DM. Enterotrophic effect of insulin-like growth factor-I but not growth hormone and localized expression of insulin-like growth factor-I, insulin-like growth factor binding protein-3 and -5 mRNAs in jejunum of parenterally fed rats. JPEN J Parenter Enteral Nutr 2000;24:288-95.

175. Martin GR, Wallace LE, Sigalet DL. Glucagon-like peptide-2 induces intestinal adaptation in parenterally fed rats with short bowel syndrome. Am J Physiol Gastrointest Liver Physiol 2004;286:G964-72.

176. Petersen YM, Elnif J, Schmidt M, Sangild PT. Glucagon-like peptide 2 enhances maltase-glucoamylase and sucrase-isomaltase gene expression and activity in parenterally fed premature neonatal piglets. Pediatr Res 2002;52:498-503.

177. Tavakkolizadeh A, Shen R, Abraham P, Kormi N, Seifert P, Edelman ER, Jacobs DO, Zinner MJ, Ashley SW, Whang EE. Glucagon-like peptide 2: a new treatment for chemotherapy-induced enteritis. J Surg Res 2000;91:77-82.

178. Tavakkolizadeh A, Shen R, Abraham P, Kormi N, Seifert P, Edelman ER, Jacobs DO, Zinner MJ, Ashley SW, Whang EE. Glucagonlike peptide 2 (glp-2) promotes intestinal recovery following chemotherapy-induced enteritis. Curr Surg 2000;57:502.

179. Torres S, Thim L, Milliat F, Vozenin-Brotons MC, Olsen UB, Ahnfelt-Ronne I, Bourhis J, Benderitter M, Francois A. Glucagon-like peptide-2 improves both acute and late experimental radiation enteritis in the rat. Int J Radiat Oncol Biol Phys 2007;69:1563-71.

180. O'Hara JR, Lomax AE, Mawe GM, Sharkey KA. Ileitis alters neuronal and enteroendocrine signalling in guinea pig distal colon. Gut 2007;56:186-94.

181. O'Hara JR, Ho W, Linden DR, Mawe GM, Sharkey KA. Enteroendocrine cells and 5-HT availability are altered in mucosa of guinea pigs with TNBS ileitis. Am J Physiol Gastrointest Liver Physiol 2004;287:G998-1007.

182. Schmidt PT, Hartmann B, Bregenholt S, Hoist JJ, Claesson MH. Deficiency of the intestinal growth factor, glucagon-like peptide 2, in the colon of SCID mice with inflammatory bowel disease induced by transplantation of CD4+ T cells. Scand J Gastroenterol 2000;35:522-7.

183. Geier MS, Tenikoff D, Yazbeck R, McCaughan GW, Abbott CA, Howarth GS. Development and resolution of experimental colitis in mice with targeted deletion of dipeptidyl peptidase IV. J Cell Physiol 2005;204:687-92.

184. Yazbeck R, Howarth GS, Geier MS, Demuth HU, Abbott CA. Inhibiting dipeptidyl peptidase activity partially ameliorates colitis in mice. Front Biosci 2008;13:6850-8.

185. Xiao Q, Boushey RP, Cino M, Drucker DJ, Brubaker PL. Circulating levels of glucagon-like peptide-2 in human subjects with inflammatory bowel disease. Am J Physiol Regul Integr Comp Physiol 2000;278:R1057-63.

145

186. Schmidt PT, Ljung T, Hartmann B, Hare KJ, Holst JJ, Hellstrom PM. Tissue levels and post-prandial secretion of the intestinal growth factor, glucagon-like peptide-2, in controls and inflammatory bowel disease: comparison with peptide YY. Eur J Gastroenterol Hepatol 2005;17:207-12.

187. Jeppesen PB, Hartmann B, Hansen BS, Thulesen J, Holst JJ, Mortensen PB. Impaired meal stimulated glucagon-like peptide 2 response in ileal resected short bowel patients with intestinal failure. Gut 1999;45:559-63.

188. Jeppesen PB, Hartmann B, Thulesen J, Hansen BS, Holst JJ, Poulsen SS, Mortensen PB. Elevated plasma glucagon-like peptide 1 and 2 concentrations in ileum resected short bowel patients with a preserved colon. Gut 2000;47:370-6.

189. Jeppesen PB, Hartmann B, Thulesen J, Graff J, Lohmann J, Hansen BS, Tofteng F, Poulsen SS, Madsen JL, Holst JJ, Mortensen PB. Glucagon-like peptide 2 improves nutrient absorption and nutritional status in short-bowel patients with no colon. Gastroenterology 2001;120:806-15.

190. Topstad D, Martin G, Sigalet D. Systemic GLP-2 levels do not limit adaptation after distal intestinal resection. J Pediatr Surg 2001;36:750-4.

191. Liu X, Nelson DW, Holst JJ, Ney DM. Synergistic effect of supplemental enteral nutrients and exogenous glucagon-like peptide 2 on intestinal adaptation in a rat model of short bowel syndrome. Am J Clin Nutr 2006;84:1142-50.

192. Kouris GJ, Liu Q, Rossi H, Djuricin G, Gattuso P, Nathan C, Weinstein RA, Prinz RA. The effect of glucagon-like peptide 2 on intestinal permeability and bacterial translocation in acute necrotizing pancreatitis. Am J Surg 2001;181:571-5.

193. Cameron HL, Yang PC, Perdue MH. Glucagon-like peptide-2-enhanced barrier function reduces pathophysiology in a model of food allergy. Am J Physiol Gastrointest Liver Physiol 2003;284:G905-12.

194. Cameron HL, Perdue MH. Stress impairs murine intestinal barrier function: improvement by glucagon-like peptide-2. J Pharmacol Exp Ther 2005;314:214-20.

195. Rajeevprasad R, Alavi K, Schwartz MZ. Glucagonlike peptide-2 analogue enhances intestinal mucosal mass and absorptive function after ischemia-reperfusion injury. J Pediatr Surg 2000;35:1537-9.

196. Prasad R, Alavi K, Schwartz MZ. Glucagonlike peptide-2 analogue enhances intestinal mucosal mass after ischemia and reperfusion. J Pediatr Surg 2000;35:357-9.

197. Zhang W, Zhu W, Zhang J, Li N, Li J. Protective effects of glucagon-like peptide 2 on intestinal ischemia-reperfusion rats. Microsurgery 2008;28:285-90.

198. Guan L, Gong D, Tian N, Zou Y. Uncoupling protein 2 involved in protection of glucagon-like peptide 2 in small intestine with ischemia-reperfusion injury in mice. Dig Dis Sci 2005;50:554-60.

199. Watts T, Berti I, Sapone A, Gerarduzzi T, Not T, Zielke R, Fasano A. Role of the intestinal tight junction modulator zonulin in the pathogenesis of type I diabetes in BB diabetic-prone rats. Proc Natl Acad Sci U S A 2005;102:2916-21.

200. Neu J, Reverte CM, Mackey AD, Liboni K, Tuhacek-Tenace LM, Hatch M, Li N, Caicedo RA, Schatz DA, Atkinson M. Changes in intestinal morphology and permeability in the biobreeding rat before the onset of type 1 diabetes. J Pediatr Gastroenterol Nutr 2005;40:589-95.

201. Sapone A, de Magistris L, Pietzak M, Clemente MG, Tripathi A, Cucca F, Lampis R, Kryszak D, Carteni M, Generoso M, Iafusco D, Prisco F, Laghi F, Riegler G, Carratu

146

R, Counts D, Fasano A. Zonulin upregulation is associated with increased gut permeability in subjects with type 1 diabetes and their relatives. Diabetes 2006;55:1443-9.

202. Bosi E, Molteni L, Radaelli MG, Folini L, Fermo I, Bazzigaluppi E, Piemonti L, Pastore MR, Paroni R. Increased intestinal permeability precedes clinical onset of type 1 diabetes. Diabetologia 2006;49:2824-7.

203. Lee AS, Gibson DL, Zhang Y, Sham HP, Vallance BA, Dutz JP. Gut barrier disruption by an enteric bacterial pathogen accelerates insulitis in NOD mice. Diabetologia;53:741-8.

204. Hadjiyanni I, Li KK, Drucker DJ. Glucagon-like peptide-2 reduces intestinal permeability but does not modify the onset of type 1 diabetes in the nonobese diabetic mouse. Endocrinology 2009;150:592-9.

205. Brun P, Castagliuolo I, Di Leo V, Buda A, Pinzani M, Palu G, Martines D. Increased intestinal permeability in obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis. Am J Physiol Gastrointest Liver Physiol 2007;292:G518-25.

206. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, Burcelin R. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008;57:1470-81.

207. Farhadi A, Gundlapalli S, Shaikh M, Frantzides C, Harrell L, Kwasny MM, Keshavarzian A. Susceptibility to gut leakiness: a possible mechanism for endotoxaemia in non-alcoholic steatohepatitis. Liver Int 2008;28:1026-33.

208. Cani PD, Neyrinck AM, Fava F, Knauf C, Burcelin RG, Tuohy KM, Gibson GR, Delzenne NM. Selective increases of bifidobacteria in gut microflora improve high-fat-diet-induced diabetes in mice through a mechanism associated with endotoxaemia. Diabetologia 2007;50:2374-83.

209. Cani PD, Possemiers S, Van de Wiele T, Guiot Y, Everard A, Rottier O, Geurts L, Naslain D, Neyrinck AM, Lambert DM, Muccioli GG, Delzenne NM. Changes in gut microbiota control inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut permeability. Gut 2009.

210. Han VK, Hynes MA, Jin C, Towle AC, Lauder JM, Lund PK. Cellular localization of proglucagon/glucagon-like peptide I messenger RNAs in rat brain. J Neurosci Res 1986;16:97-107.

211. Schmidt PT, Naslund E, Gryback P, Jacobsson H, Hartmann B, Holst JJ, Hellstrom PM. Peripheral administration of GLP-2 to humans has no effect on gastric emptying or satiety. Regul Pept 2003;116:21-5.

212. Sorensen LB, Flint A, Raben A, Hartmann B, Holst JJ, Astrup A. No effect of physiological concentrations of glucagon-like peptide-2 on appetite and energy intake in normal weight subjects. Int J Obes Relat Metab Disord 2003;27:450-6.

213. Haderslev KV, Jeppesen PB, Hartmann B, Thulesen J, Sorensen HA, Graff J, Hansen BS, Tofteng F, Poulsen SS, Madsen JL, Holst JJ, Staun M, Mortensen PB. Short-term administration of glucagon-like peptide-2. Effects on bone mineral density and markers of bone turnover in short-bowel patients with no colon. Scand J Gastroenterol 2002;37:392-8.

147

214. Henriksen DB, Alexandersen P, Bjarnason NH, Vilsboll T, Hartmann B, Henriksen EE, Byrjalsen I, Krarup T, Holst JJ, Christiansen C. Role of gastrointestinal hormones in postprandial reduction of bone resorption. J Bone Miner Res 2003;18:2180-9.

215. Henriksen DB, Alexandersen P, Byrjalsen I, Hartmann B, Bone HG, Christiansen C, Holst JJ. Reduction of nocturnal rise in bone resorption by subcutaneous GLP-2. Bone 2004;34:140-7.

216. Horst DA, Sedenquist, M., Stoll, B., Burrin, D.G. Glucagon-like peptide 2 decreases a marker of bone resorption in tpn-fed neonatal piglets, In Pediatric Academic Society Meeting. Pediatric Research, Washington, DC, 2005.

217. Hartmann B, Thulesen J, Hare KJ, Kissow H, Orskov C, Poulsen SS, Holst JJ. Immunoneutralization of endogenous glucagon-like peptide-2 reduces adaptive intestinal growth in diabetic rats. Regul Pept 2002;105:173-9.

218. Marier JF, Beliveau M, Mouksassi MS, Shaw P, Cyran J, Kesavan J, Wallens J, Zahir H, Wells D, Caminis J. Pharmacokinetics, safety, and tolerability of teduglutide, a glucagon-like peptide-2 (GLP-2) analog, following multiple ascending subcutaneous administrations in healthy subjects. J Clin Pharmacol 2008;48:1289-99.

219. Marier JF, Mouksassi MS, Gosselin NH, Beliveau M, Cyran J, Wallens J. Population pharmacokinetics of teduglutide following repeated subcutaneous administrations in healthy participants and in patients with short bowel syndrome and Crohn's disease. J Clin Pharmacol;50:36-49.

220. Masur K, Schwartz F, Entschladen F, Niggemann B, Zaenker KS. DPPIV inhibitors extend GLP-2 mediated tumour promoting effects on intestinal cancer cells. Regul Pept 2006;137:147-55.

221. Thulesen J, Hartmann B, Hare KJ, Kissow H, Orskov C, Holst JJ, Poulsen SS. Glucagon-like peptide 2 (GLP-2) accelerates the growth of colonic neoplasms in mice. Gut 2004;53:1145-50.

222. Koehler JA, Harper W, Barnard M, Yusta B, Drucker DJ. Glucagon-like peptide-2 does not modify the growth or survival of murine or human intestinal tumor cells. Cancer Res 2008;68:7897-904.

223. Iakoubov R, Lauffer LM, Trivedi S, Kim YI, Brubaker PL. Carcinogenic effects of exogenous and endogenous glucagon-like peptide-2 in azoxymethane-treated mice. Endocrinology 2009;150:4033-43.

224. Dunel-Erb S, Chevalier C, Laurent P, Bach A, Decrock F, Le Maho Y. Restoration of the jejunal mucosa in rats refed after prolonged fasting. Comp Biochem Physiol A Mol Integr Physiol 2001;129:933-47.

225. Habold C, Chevalier C, Dunel-Erb S, Foltzer-Jourdainne C, Le Maho Y, Lignot JH. Effects of fasting and refeeding on jejunal morphology and cellular activity in rats in relation to depletion of body stores. Scand J Gastroenterol 2004;39:531-9.

226. Chappell VL, Thompson MD, Jeschke MG, Chung DH, Thompson JC, Wolf SE. Effects of incremental starvation on gut mucosa. Dig Dis Sci 2003;48:765-9.

227. Starck JM, Beese K. Structural flexibility of the intestine of Burmese python in response to feeding. J Exp Biol 2001;204:325-35.

228. Secor SM, Diamond J. Adaptive responses to feeding in Burmese pythons: pay before pumping. J Exp Biol 1995;198:1313-25.

229. Secor SM, Diamond J. Effects of meal size on postprandial responses in juvenile Burmese pythons (Python molurus). Am J Physiol 1997;272:R902-12.

148

230. Cox CL, Secor SM. Matched regulation of gastrointestinal performance in the Burmese python, Python molurus. J Exp Biol 2008;211:1131-40.

231. Lignot JH, Helmstetter C, Secor SM. Postprandial morphological response of the intestinal epithelium of the Burmese python (Python molurus). Comp Biochem Physiol A Mol Integr Physiol 2005;141:280-91.

232. Goodlad RA, Al-Mukhtar MY, Ghatei MA, Bloom SR, Wright NA. Cell proliferation, plasma enteroglucagon and plasma gastrin levels in starved and refed rats. Virchows Arch B Cell Pathol Incl Mol Pathol 1983;43:55-62.

233. Goodlad RA, Plumb JA, Wright NA. Epithelial cell proliferation and intestinal absorptive function during starvation and refeeding in the rat. Clin Sci (Lond) 1988;74:301-6.

234. Holt PR, Yeh KY. Small intestinal crypt cell proliferation rates are increased in senescent rats. J Gerontol 1989;44:B9-14.

235. Goodlad RA, Wright NA. The effects of starvation and refeeding on intestinal cell proliferation in the mouse. Virchows Arch B Cell Pathol Incl Mol Pathol 1984;45:63-73.

236. Biasco G, Callegari C, Lami F, Minarini A, Miglioli M, Barbara L. Intestinal morphological changes during oral refeeding in a patient previously treated with total parenteral nutrition for small bowel resection. Am J Gastroenterol 1984;79:585-8.

237. Boza JJ, Moennoz D, Vuichoud J, Jarret AR, Gaudard-de-Weck D, Fritsche R, Donnet A, Schiffrin EJ, Perruisseau G, Ballevre O. Food deprivation and refeeding influence growth, nutrient retention and functional recovery of rats. J Nutr 1999;129:1340-6.

238. Ferraris RP, Carey HV. Intestinal transport during fasting and malnutrition. Annu Rev Nutr 2000;20:195-219.

239. Gupta PD, Waheed AA. Effect of starvation on glucose transport and membrane fluidity in rat intestinal epithelial cells. FEBS Lett 1992;300:263-7.

240. Waheed AA, Yasuzumi F, Gupta PD. Lipid and fatty acid composition of brush border membrane of rat intestine during starvation. Lipids 1998;33:1093-7.

241. Bansal P, Wang Q. Insulin as a physiological modulator of glucagon secretion. Am J Physiol Endocrinol Metab 2008;295:E751-61.

242. Quesada I, Tuduri E, Ripoll C, Nadal A. Physiology of the pancreatic alpha-cell and glucagon secretion: role in glucose homeostasis and diabetes. J Endocrinol 2008;199:5-19.

243. Franklin I, Gromada J, Gjinovci A, Theander S, Wollheim CB. Beta-cell secretory products activate alpha-cell ATP-dependent potassium channels to inhibit glucagon release. Diabetes 2005;54:1808-15.

244. Olsen HL, Theander S, Bokvist K, Buschard K, Wollheim CB, Gromada J. Glucose stimulates glucagon release in single rat alpha-cells by mechanisms that mirror the stimulus-secretion coupling in beta-cells. Endocrinology 2005;146:4861-70.

245. Salehi A, Vieira E, Gylfe E. Paradoxical stimulation of glucagon secretion by high glucose concentrations. Diabetes 2006;55:2318-23.

246. Greenbaum CJ, Prigeon RL, D'Alessio DA. Impaired beta-cell function, incretin effect, and glucagon suppression in patients with type 1 diabetes who have normal fasting glucose. Diabetes 2002;51:951-7.

149

247. Samols E, Stagner JI, Ewart RB, Marks V. The order of islet microvascular cellular perfusion is B----A----D in the perfused rat pancreas. J Clin Invest 1988;82:350-3.

248. Nyman LR, Ford E, Powers AC, Piston DW. Glucose-dependent blood flow dynamics in murine pancreatic islets in vivo. Am J Physiol Endocrinol Metab;298:E807-14.

249. Kaneko K, Shirotani T, Araki E, Matsumoto K, Taguchi T, Motoshima H, Yoshizato K, Kishikawa H, Shichiri M. Insulin inhibits glucagon secretion by the activation of PI3-kinase in In-R1-G9 cells. Diabetes Res Clin Pract 1999;44:83-92.

250. Xu E, Kumar M, Zhang Y, Ju W, Obata T, Zhang N, Liu S, Wendt A, Deng S, Ebina Y, Wheeler MB, Braun M, Wang Q. Intra-islet insulin suppresses glucagon release via GABA-GABAA receptor system. Cell Metab 2006;3:47-58.

251. Leung YM, Ahmed I, Sheu L, Tsushima RG, Diamant NE, Hara M, Gaisano HY. Electrophysiological characterization of pancreatic islet cells in the mouse insulin promoter-green fluorescent protein mouse. Endocrinology 2005;146:4766-75.

252. Leung YM, Ahmed I, Sheu L, Gao X, Hara M, Tsushima RG, Diamant NE, Gaisano HY. Insulin regulates islet alpha-cell function by reducing KATP channel sensitivity to adenosine 5'-triphosphate inhibition. Endocrinology 2006;147:2155-62.

253. Gromada J, Franklin I, Wollheim CB. Alpha-cells of the endocrine pancreas: 35 years of research but the enigma remains. Endocr Rev 2007;28:84-116.

254. Prost AL, Bloc A, Hussy N, Derand R, Vivaudou M. Zinc is both an intracellular and extracellular regulator of KATP channel function. J Physiol 2004;559:157-67.

255. Ishihara H, Maechler P, Gjinovci A, Herrera PL, Wollheim CB. Islet beta-cell secretion determines glucagon release from neighbouring alpha-cells. Nat Cell Biol 2003;5:330-5.

256. Bloc A, Cens T, Cruz H, Dunant Y. Zinc-induced changes in ionic currents of clonal rat pancreatic -cells: activation of ATP-sensitive K+ channels. J Physiol 2000;529 Pt 3:723-34.

257. Smith PA, Sakura H, Coles B, Gummerson N, Proks P, Ashcroft FM. Electrogenic arginine transport mediates stimulus-secretion coupling in mouse pancreatic beta-cells. J Physiol 1997;499 ( Pt 3):625-35.

258. Gromada J, Hoy M, Olsen HL, Gotfredsen CF, Buschard K, Rorsman P, Bokvist K. Gi2 proteins couple somatostatin receptors to low-conductance K+ channels in rat pancreatic alpha-cells. Pflugers Arch 2001;442:19-26.

259. Yoshimoto Y, Fukuyama Y, Horio Y, Inanobe A, Gotoh M, Kurachi Y. Somatostatin induces hyperpolarization in pancreatic islet alpha cells by activating a G protein-gated K+ channel. FEBS Lett 1999;444:265-9.

260. Fehmann HC, Strowski M, Goke B. Functional characterization of somatostatin receptors expressed on hamster glucagonoma cells. Am J Physiol 1995;268:E40-7.

261. Patel YC, Pierzchala I, Amherdt M, Orci L. Effects of cysteamine and antibody to somatostatin on islet cell function in vitro. Evidence that intracellular somatostatin deficiency augments insulin and glucagon secretion. J Clin Invest 1985;75:1249-55.

262. Brunicardi FC, Kleinman R, Moldovan S, Nguyen TH, Watt PC, Walsh J, Gingerich R. Immunoneutralization of somatostatin, insulin, and glucagon causes alterations in islet cell secretion in the isolated perfused human pancreas. Pancreas 2001;23:302-8.

150

263. Rossowski WJ, Coy DH. Specific inhibition of rat pancreatic insulin or glucagon release by receptor-selective somatostatin analogs. Biochem Biophys Res Commun 1994;205:341-6.

264. Strowski MZ, Parmar RM, Blake AD, Schaeffer JM. Somatostatin inhibits insulin and glucagon secretion via two receptors subtypes: an in vitro study of pancreatic islets from somatostatin receptor 2 knockout mice. Endocrinology 2000;141:111-7.

265. Kreymann B, Williams G, Ghatei MA, Bloom SR. Glucagon-like peptide-1 7-36: a physiological incretin in man. Lancet 1987;2:1300-4.

266. Ritzel R, Orskov C, Holst JJ, Nauck MA. Pharmacokinetic, insulinotropic, and glucagonostatic properties of GLP-1 [7-36 amide] after subcutaneous injection in healthy volunteers. Dose-response-relationships. Diabetologia 1995;38:720-5.

267. Ahren B, Holst JJ, Mari A. Characterization of GLP-1 effects on beta-cell function after meal ingestion in humans. Diabetes Care 2003;26:2860-4.

268. Nauck MA, Niedereichholz U, Ettler R, Holst JJ, Orskov C, Ritzel R, Schmiegel WH. Glucagon-like peptide 1 inhibition of gastric emptying outweighs its insulinotropic effects in healthy humans. Am J Physiol 1997;273:E981-8.

269. Flint A, Raben A, Ersboll AK, Holst JJ, Astrup A. The effect of physiological levels of glucagon-like peptide-1 on appetite, gastric emptying, energy and substrate metabolism in obesity. Int J Obes Relat Metab Disord 2001;25:781-92.

270. Vilsboll T, Krarup T, Madsbad S, Holst JJ. Both GLP-1 and GIP are insulinotropic at basal and postprandial glucose levels and contribute nearly equally to the incretin effect of a meal in healthy subjects. Regul Pept 2003;114:115-21.

271. Nauck MA, Heimesaat MM, Behle K, Holst JJ, Nauck MS, Ritzel R, Hufner M, Schmiegel WH. Effects of glucagon-like peptide 1 on counterregulatory hormone responses, cognitive functions, and insulin secretion during hyperinsulinemic, stepped hypoglycemic clamp experiments in healthy volunteers. J Clin Endocrinol Metab 2002;87:1239-46.

272. Degn KB, Brock B, Juhl CB, Djurhuus CB, Grubert J, Kim D, Han J, Taylor K, Fineman M, Schmitz O. Effect of intravenous infusion of exenatide (synthetic exendin-4) on glucose-dependent insulin secretion and counterregulation during hypoglycemia. Diabetes 2004;53:2397-403.

273. Gutniak MK, Linde B, Holst JJ, Efendic S. Subcutaneous injection of the incretin hormone glucagon-like peptide 1 abolishes postprandial glycemia in NIDDM. Diabetes Care 1994;17:1039-44.

274. Todd JF, Wilding JP, Edwards CM, Khan FA, Ghatei MA, Bloom SR. Glucagon-like peptide-1 (GLP-1): a trial of treatment in non-insulin-dependent diabetes mellitus. Eur J Clin Invest 1997;27:533-6.

275. Gutniak MK, Larsson H, Sanders SW, Juneskans O, Holst JJ, Ahren B. GLP-1 tablet in type 2 diabetes in fasting and postprandial conditions. Diabetes Care 1997;20:1874-9.

276. Gutniak MK, Svartberg J, Hellstrom PM, Holst JJ, Adner N, Ahren B. Antidiabetogenic action of glucagon-like peptide-1 related to administration relative to meal intake in subjects with type 2 diabetes. J Intern Med 2001;250:81-7.

277. Willms B, Werner J, Holst JJ, Orskov C, Creutzfeldt W, Nauck MA. Gastric emptying, glucose responses, and insulin secretion after a liquid test meal: effects of

151

exogenous glucagon-like peptide-1 (GLP-1)-(7-36) amide in type 2 (noninsulin-dependent) diabetic patients. J Clin Endocrinol Metab 1996;81:327-32.

278. Nauck MA, Kleine N, Orskov C, Holst JJ, Willms B, Creutzfeldt W. Normalization of fasting hyperglycaemia by exogenous glucagon-like peptide 1 (7-36 amide) in type 2 (non-insulin-dependent) diabetic patients. Diabetologia 1993;36:741-4.

279. Hare KJ, Vilsboll T, Asmar M, Deacon CF, Knop FK, Holst JJ. The Glucagonostatic and Insulinotropic Effects of Glucagon-Like Peptide-1 Contribute Equally to its Glucose-Lowering Action. Diabetes.

280. Creutzfeldt WO, Kleine N, Willms B, Orskov C, Holst JJ, Nauck MA. Glucagonostatic actions and reduction of fasting hyperglycemia by exogenous glucagon-like peptide I(7-36) amide in type I diabetic patients. Diabetes Care 1996;19:580-6.

281. Behme MT, Dupre J, McDonald TJ. Glucagon-like peptide 1 improved glycemic control in type 1 diabetes. BMC Endocr Disord 2003;3:3.

282. Kielgast U, Asmar M, Madsbad S, Holst JJ. Effect of Glucagon-Like Peptide-1 on {alpha}- and {beta}-Cell Function in C-Peptide-Negative Type 1 Diabetic Patients. J Clin Endocrinol Metab.

283. Van Dijk G, Lindskog S, Holst JJ, Steffens AB, Ahren B. Effects of glucagon-like peptide-I on glucose turnover in rats. Am J Physiol 1996;270:E1015-21.

284. de Heer J, Rasmussen C, Coy DH, Holst JJ. Glucagon-like peptide-1, but not glucose-dependent insulinotropic peptide, inhibits glucagon secretion via somatostatin (receptor subtype 2) in the perfused rat pancreas. Diabetologia 2008;51:2263-70.

285. Heller RS, Kieffer TJ, Habener JF. Insulinotropic glucagon-like peptide I receptor expression in glucagon-producing alpha-cells of the rat endocrine pancreas. Diabetes 1997;46:785-91.

286. Moens K, Heimberg H, Flamez D, Huypens P, Quartier E, Ling Z, Pipeleers D, Gremlich S, Thorens B, Schuit F. Expression and functional activity of glucagon, glucagon-like peptide I, and glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells. Diabetes 1996;45:257-61.

287. Schmidt WE, Siegel EG, Creutzfeldt W. Glucagon-like peptide-1 but not glucagon-like peptide-2 stimulates insulin release from isolated rat pancreatic islets. Diabetologia 1985;28:704-7.

288. Orskov C, Holst JJ, Nielsen OV. Effect of truncated glucagon-like peptide-1 [proglucagon-(78-107) amide] on endocrine secretion from pig pancreas, antrum, and nonantral stomach. Endocrinology 1988;123:2009-13.

289. Hupe-Sodmann K, McGregor GP, Bridenbaugh R, Goke R, Goke B, Thole H, Zimmermann B, Voigt K. Characterisation of the processing by human neutral endopeptidase 24.11 of GLP-1(7-36) amide and comparison of the substrate specificity of the enzyme for other glucagon-like peptides. Regul Pept 1995;58:149-56.

290. Trebbien R, Klarskov L, Olesen M, Holst JJ, Carr RD, Deacon CF. Neutral endopeptidase 24.11 is important for the degradation of both endogenous and exogenous glucagon in anesthetized pigs. Am J Physiol Endocrinol Metab 2004;287:E431-8.

152

291. Pospisilik JA, Hinke SA, Pederson RA, Hoffmann T, Rosche F, Schlenzig D, Glund K, Heiser U, McIntosh CH, Demuth H. Metabolism of glucagon by dipeptidyl peptidase IV (CD26). Regul Pept 2001;96:133-41.

292. Peterson DR, Green EA, Oparil S, Hjelle JT. Transport and hydrolysis of glucagon in the proximal nephron. Am J Physiol 1986;251:F460-7.

293. Carone FA, Peterson DR, Flouret G. Renal tubular processing of small peptide hormones. J Lab Clin Med 1982;100:1-14.

294. Bastl C, Finkelstein FO, Sherwin R, Hendler R, Felig P, Hayslett JP. Renal extraction of glucagon in rats with normal and reduced renal function. Am J Physiol 1977;233:F67-71.

295. Mayo KE, Miller LJ, Bataille D, Dalle S, Goke B, Thorens B, Drucker DJ. International Union of Pharmacology. XXXV. The glucagon receptor family. Pharmacol Rev 2003;55:167-94.

296. Hansen LH, Abrahamsen N, Nishimura E. Glucagon receptor mRNA distribution in rat tissues. Peptides 1995;16:1163-6.

297. Svoboda M, Tastenoy M, Vertongen P, Robberecht P. Relative quantitative analysis of glucagon receptor mRNA in rat tissues. Mol Cell Endocrinol 1994;105:131-7.

298. Dunphy JL, Taylor RG, Fuller PJ. Tissue distribution of rat glucagon receptor and GLP-1 receptor gene expression. Mol Cell Endocrinol 1998;141:179-86.

299. Weigle DS, Goodner CJ. Evidence that the physiological pulse frequency of glucagon secretion optimizes glucose production by perifused rat hepatocytes. Endocrinology 1986;118:1606-13.

300. Sasaki K, Cripe TP, Koch SR, Andreone TL, Petersen DD, Beale EG, Granner DK. Multihormonal regulation of phosphoenolpyruvate carboxykinase gene transcription. The dominant role of insulin. J Biol Chem 1984;259:15242-51.

301. Beale E, Andreone T, Koch S, Granner M, Granner D. Insulin and glucagon regulate cytosolic phosphoenolpyruvate carboxykinase (GTP) mRNA in rat liver. Diabetes 1984;33:328-32.

302. Jiang G, Zhang BB. Glucagon and regulation of glucose metabolism. Am J Physiol Endocrinol Metab 2003;284:E671-8.

303. Goldfine ID, Roth J, Birnbaumer L. Glucagon receptors in -cells. Binding of 125 I-glucagon and activation of adenylate cyclase. J Biol Chem 1972;247:1211-8.

304. Van Schravendijk CF, Foriers A, Hooghe-Peters EL, Rogiers V, De Meyts P, Sodoyez JC, Pipeleers DG. Pancreatic hormone receptors on islet cells. Endocrinology 1985;117:841-8.

305. Moens K, Flamez D, Van Schravendijk C, Ling Z, Pipeleers D, Schuit F. Dual glucagon recognition by pancreatic beta-cells via glucagon and glucagon-like peptide 1 receptors. Diabetes 1998;47:66-72.

306. Ma X, Zhang Y, Gromada J, Sewing S, Berggren PO, Buschard K, Salehi A, Vikman J, Rorsman P, Eliasson L. Glucagon stimulates exocytosis in mouse and rat pancreatic alpha-cells by binding to glucagon receptors. Mol Endocrinol 2005;19:198-212.

307. Vincent M, Guz Y, Rozenberg M, Webb G, Furuta M, Steiner D, Teitelman G. Abrogation of protein convertase 2 activity results in delayed islet cell differentiation and maturation, increased alpha-cell proliferation, and islet neogenesis. Endocrinology 2003;144:4061-9.

153

308. Gelling RW, Du XQ, Dichmann DS, Romer J, Huang H, Cui L, Obici S, Tang B, Holst JJ, Fledelius C, Johansen PB, Rossetti L, Jelicks LA, Serup P, Nishimura E, Charron MJ. Lower blood glucose, hyperglucagonemia, and pancreatic alpha cell hyperplasia in glucagon receptor knockout mice. Proc Natl Acad Sci U S A 2003;100:1438-43.

309. Parker JC, Andrews KM, Allen MR, Stock JL, McNeish JD. Glycemic control in mice with targeted disruption of the glucagon receptor gene. Biochem Biophys Res Commun 2002;290:839-43.

310. Conarello SL, Jiang G, Mu J, Li Z, Woods J, Zycband E, Ronan J, Liu F, Roy RS, Zhu L, Charron MJ, Zhang BB. Glucagon receptor knockout mice are resistant to diet-induced obesity and streptozotocin-mediated beta cell loss and hyperglycaemia. Diabetologia 2007;50:142-50.

311. Sorensen H, Winzell MS, Brand CL, Fosgerau K, Gelling RW, Nishimura E, Ahren B. Glucagon receptor knockout mice display increased insulin sensitivity and impaired beta-cell function. Diabetes 2006;55:3463-9.

312. Miller DL, Hanson W, Schedl HP, Osborne JW. Proliferation rate and transit time of mucosal cells in small intestine of the diabetic rat. Gastroenterology 1977;73:1326-32.

313. Norrby K, Bergstrom S, Druvefors P. Hyperplasia and growth of the true mesentery in the diabetic rat. Acta Pathol Microbiol Immunol Scand A 1983;91:195-202.

314. Levine GM, Deren JJ, Steiger E, Zinno R. Role of oral intake in maintenance of gut mass and disaccharide activity. Gastroenterology 1974;67:975-82.

315. Gorostiza E, Poullain MG, Marche C, Gobert JG, Broyart JP, Macry J, Cezard JP. [Effect of fasting and refeeding on the adaptation of the small intestine in rats. A model for physiopathologic studies]. Gastroenterol Clin Biol 1985;9:790-6.

316. Tsujikawa T, Bamba T, Hosoda S. The trophic effect of epidermal growth factor on morphological changes and polyamine metabolism in the small intestine of rats. Gastroenterol Jpn 1990;25:328-34.

317. Winesett DE, Ulshen MH, Hoyt EC, Mohapatra NK, Fuller CR, Lund PK. Regulation and localization of the insulin-like growth factor system in small bowel during altered nutrient status. Am J Physiol 1995;268:G631-40.

318. Nelson DW, Murali SG, Liu X, Koopmann MC, Holst JJ, Ney DM. Insulin-like growth factor I and glucagon-like peptide-2 responses to fasting followed by controlled or ad libitum refeeding in rats. Am J Physiol Regul Integr Comp Physiol 2008;294:R1175-84.

319. Grimes J, Schaudies P, Davis D, Williams C, Curry BJ, Walker MD, Koldovsky O. Effect of short-term fasting/refeeding on epidermal growth factor content in the gastrointestinal tract of suckling rats. Proc Soc Exp Biol Med 1992;199:75-80.

320. Evers BM, Izukura M, Townsend CM, Jr., Uchida T, Thompson JC. Neurotensin prevents intestinal mucosal hypoplasia in rats fed an elemental diet. Dig Dis Sci 1992;37:426-31.

321. Drucker DJ. Glucagon-like peptide 2. J Clin Endocrinol Metab 2001;86:1759-64. 322. Estall JL, Drucker DJ. Glucagon-like Peptide-2. Annu Rev Nutr 2006;26:391-411. 323. Smaill JB, Rewcastle GW, Loo JA, Greis KD, Chan OH, Reyner EL, Lipka E,

Showalter HD, Vincent PW, Elliott WL, Denny WA. Tyrosine kinase inhibitors. 17. Irreversible inhibitors of the epidermal growth factor receptor: 4-

154

(phenylamino)quinazoline- and 4-(phenylamino)pyrido[3,2-d]pyrimidine-6-acrylamides bearing additional solubilizing functions. J Med Chem 2000;43:1380-97.

324. Habold C, Foltzer-Jourdainne C, Le Maho Y, Lignot JH, Oudart H. Intestinal gluconeogenesis and glucose transport according to body fuel availability in rats. J Physiol 2005;566:575-86.

325. Sheng H, Shao J, Townsend CM, Jr., Evers BM. Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells. Gut 2003;52:1472-8.

326. Sokolovic M, Wehkamp D, Sokolovic A, Vermeulen J, Gilhuijs-Pederson LA, van Haaften RI, Nikolsky Y, Evelo CT, van Kampen AH, Hakvoort TB, Lamers WH. Fasting induces a biphasic adaptive metabolic response in murine small intestine. BMC Genomics 2007;8:361.

327. Hodin RA, Graham JR, Meng S, Upton MP. Temporal pattern of rat small intestinal gene expression with refeeding. Am J Physiol 1994;266:G83-9.

328. Dube PE, Brubaker PL. Frontiers in glucagon-like peptide-2: multiple actions, multiple mediators. Am J Physiol Endocrinol Metab 2007;293:E460-5.

329. Fernandez-Estivariz C, Gu LH, Gu L, Jonas CR, Wallace TM, Pascal RR, Devaney KL, Farrell CL, Jones DP, Podolsky DK, Ziegler TR. Trefoil peptide expression and goblet cell number in rat intestine: effects of KGF and fasting-refeeding. Am J Physiol Regul Integr Comp Physiol 2003;284:R564-73.

330. Ulshen MH, Raasch RH. Luminal epidermal growth factor preserves mucosal mass of small bowel in fasting rats. Clin Sci (Lond) 1996;90:427-31.

331. He XC, Yin T, Grindley JC, Tian Q, Sato T, Tao WA, Dirisina R, Porter-Westpfahl KS, Hembree M, Johnson T, Wiedemann LM, Barrett TA, Hood L, Wu H, Li L. PTEN-deficient intestinal stem cells initiate intestinal polyposis. Nat Genet 2007;39:189-98.

332. Playford RJ, Boulton R, Ghatei MA, Bloom SR, Wright NA, Goodlad RA. Comparison of the effects of transforming growth factor alpha and epidermal growth factor on gastrointestinal proliferation and hormone release. Digestion 1996;57:362-7.

333. Baggio LL, Drucker DJ. Biology of incretins: GLP-1 and GIP. Gastroenterology 2007;132:2131-57.

334. Heller RS, Kieffer TJ, Habener JF. Insulinotropic glucagon-like peptide I receptor expression in glucagon-producing alpha-cells of the rat endocrine pancreas. Diabetes 1997;46:785-791.

335. Moens K, Heimberg H, Flamez D, Huypens P, Quartier E, Ling Z, Pipeleers D, Gremlich S, Thorens B, Schuit F. Expression and functional activity of glucagon, glucagon-like peptide 1 and glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells. Diabetes 1996;45:257-261.

336. de Heer J, Rasmussen C, Coy DH, Holst JJ. Glucagon-like peptide-1, but not glucose-dependent insulinotropic peptide, inhibits glucagon secretion via somatostatin (receptor subtype 2) in the perfused rat pancreas. Diabetologia 2008.

337. Drucker DJ, Ehrlich P, Asa SL, Brubaker PL. Induction of intestinal epithelial proliferation by glucagon-like peptide 2. Proc Natl Acad Sci USA 1996;93:7911-7916.

338. Cheeseman CI, Tsang R. The effect of gastric inhibitory polypeptide and glucagon like peptides on intestinal hexose transport. Am J Physiol Gastrointest Liver Physiol 1996;271:G477-G482.

155

339. Wojdemann M, Wettergren A, Hartmann B, Holst JJ. Glucagon-like peptide-2 inhibits centrally induced antral motility in pigs. Scand J Gastroenterol 1998;33:828-832.

340. Wojdemann M, Wettergren A, Hartmann B, Hilsted L, Holst JJ. Inhibition of sham feeding-stimulated human gastric acid secretion by glucagon-like peptide-2. J Clin Endocrinol Metab 1999;84:2513-7.

341. Yusta B, Huang L, Munroe D, Wolff G, Fantaske R, Sharma S, Demchyshyn L, Asa SL, Drucker DJ. Enteroendocrine localization of GLP-2 receptor expression. Gastroenterology 2000;119:744-755.

342. Jeppesen PB, Hartmann B, Thulesen J, Graff J, Lohmann J, Hansen BS, Tofteng F, Poulsen SS, Madsen JL, Holst JJ, Mortensen PB. Glucagon-like Peptide 2 Improves Nutrient Absorption and Nutritional Status in Short-Bowel Patients With No Colon. Gastroenterology 2001;120:806-815.

343. Schmidt WE, Siegel EG, Creutzfeldt W. Glucagon-like peptide-1 but not glucagon-like peptide-2 stimulates insulin release from isolated rat pancreatic islets. Diabetologia 1985;28:704-707.

344. Orskov C, Holst JJ, Nielsen OV. Effect of truncated glucagon-like peptide-1 [proglucagon-(78-107) amide] on endocrine secretion from pig pancreas, antrum, and nonantral stomach. Endocrinology 1988;123:2009-2013.

345. Sorensen LB, Flint A, Raben A, Hartmann B, Holst JJ, Astrup A. No effect of physiological concentrations of glucagon-like peptide-2 on appetite and energy intake in normal weight subjects( dagger ). Int J Obes Relat Metab Disord 2003;27:450-456.

346. Cani PD, Possemiers S, Van de Wiele T, Guiot Y, Everard A, Rottier O, Geurts L, Naslain D, Neyrinck A, Lambert DM, Muccioli GG, Delzenne NM. Changes in gut microbiota control inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut permeability. Gut 2009;58:1091-103.

347. Koehler JA, Harper W, Barnard M, Yusta B, Drucker DJ. Glucagon-like peptide-2 does not modify the growth or survival of murine or human intestinal tumor cells. Cancer Research 2008;68:7897-7904.

348. Yusta B, Holland D, Koehler JA, Maziarz M, Estall JL, Higgins R, Drucker DJ. ErbB signaling is required for the proliferative actions of GLP-2 in the murine gut. Gastroenterology 2009;173:986-96.

349. Anand A, Chada K. In vivo modulation of Hmgic reduces obesity. Nat Genet 2000;24:377-80.

350. Maida A, Lovshin JA, Baggio LL, Drucker DJ. The glucagon-like peptide-1 receptor agonist oxyntomodulin enhances {beta}-cell function but does not inhibit gastric emptying in mice. Endocrinology 2008;149:5670-8.

351. Maida A, Hansotia T, Longuet C, Seino Y, Drucker DJ. Differential Importance of GIP Versus GLP-1 Receptor Signaling for Beta Cell Survival in Mice. Gastroenterology 2009;137:2146-57.

352. Winzell MS, Ahren B. The high-fat diet-fed mouse: a model for studying mechanisms and treatment of impaired glucose tolerance and type 2 diabetes. Diabetes 2004;53 Suppl 3:S215-9.

353. Li Y, Hansotia T, Yusta B, Ris F, Halban PA, Drucker DJ. Glucagon-like peptide-1 receptor signaling modulates beta cell apoptosis. J Biol Chem 2003;278:471-478.

156

354. Donath MY, Boni-Schnetzler M, Ellingsgaard H, Ehses JA. Islet inflammation impairs the pancreatic beta-cell in type 2 diabetes. Physiology (Bethesda) 2009;24:325-31.

355. Ellingsgaard H, Ehses JA, Hammar EB, Van Lommel L, Quintens R, Martens G, Kerr-Conte J, Pattou F, Berney T, Pipeleers D, Halban PA, Schuit FC, Donath MY. Interleukin-6 regulates pancreatic alpha-cell mass expansion. Proc Natl Acad Sci U S A 2008;105:13163-8.

356. Orskov C, Holst JJ. Radio-immunoassays for glucagon-like peptides 1 and 2 (GLP-1 and GLP-2). Scand J Clin Lab Invest 1987;47:165-74.

357. Salfen BE, Carroll JA, Keisler DH. Endocrine responses to short-term feed deprivation in weanling pigs. J Endocrinol 2003;178:541-51.

358. Ziegler TR, Almahfouz A, Pedrini MT, Smith RJ. A comparison of rat small intestinal insulin and insulin-like growth factor I receptors during fasting and refeeding. Endocrinology 1995;136:5148-54.

359. Rowland K.J. TS, Brubaker P.L. The intestinal epithelial insulin-like growth factor-1 receptor is required for acute intestinal adaptive growth effects but not activation of canonical Wnt signaling by glucagon-like peptide-2, In Digestive Disease Week, Chicago, IL, Gastroenterology, 2009.

360. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2001;2:127-37.

361. Citri A, Yarden Y. EGF-ERBB signalling: towards the systems level. Nat Rev Mol Cell Biol 2006;7:505-16.

362. Sanderson MP, Dempsey PJ, Dunbar AJ. Control of ErbB signaling through metalloprotease mediated ectodomain shedding of EGF-like factors. Growth Factors 2006;24:121-36.

363. Playford RJ, Hanby AM, Gschmeissner S, Peiffer LP, Wright NA, McGarrity T. The epidermal growth factor receptor (EGF-R) is present on the basolateral, but not the apical, surface of enterocytes in the human gastrointestinal tract. Gut 1996;39:262-6.

364. Fiske WH, Threadgill D, Coffey RJ. ERBBs in the gastrointestinal tract: recent progress and new perspectives. Exp Cell Res 2009;315:583-601.

365. Luetteke NC, Phillips HK, Qiu TH, Copeland NG, Earp HS, Jenkins NA, Lee DC. The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev 1994;8:399-413.

366. Helmrath MA, Erwin CR, Warner BW. A defective EGF-receptor in waved-2 mice attenuates intestinal adaptation. J Surg Res 1997;69:76-80.

367. Knott AW, Juno RJ, Jarboe MD, Zhang Y, Profitt SA, Thoerner JC, Erwin CR, Warner BW. EGF receptor signaling affects bcl-2 family gene expression and apoptosis after massive small bowel resection. J Pediatr Surg 2003;38:875-80.

368. Chaet MS, Arya G, Ziegler MM, Warner BW. Epidermal growth factor enhances intestinal adaptation after massive small bowel resection. J Pediatr Surg 1994;29:1035-8; discussion 1038-9.

369. Dunn JC, Parungo CP, Fonkalsrud EW, McFadden DW, Ashley SW. Epidermal growth factor selectively enhances functional enterocyte adaptation after massive small bowel resection. J Surg Res 1997;67:90-3.

370. Swaniker F, Guo W, Fonkalsrud EW, Diamond J. The effect of epidermal growth factor on mucosal function after ileal resection. J Surg Res 1995;58:565-9.

157

371. Swaniker F, Guo W, Diamond J, Fonkalsrud EW. Delayed effects of epidermal growth factor after extensive small bowel resection. J Pediatr Surg 1996;31:56-9; discussion 59-60.

372. Goodlad RA, Lee CY, Wright NA. Cell proliferation in the small intestine and colon of intravenously fed rats: effects of urogastrone-epidermal growth factor. Cell Prolif 1992;25:393-404.

373. Wang JY, Zhang LH, Song WL. Epidermal growth factor regulates intestinal glutamine uptake during total parenteral nutrition. Clin Nutr 1996;15:21-3.

374. Zhang GX, Lai JH, Jia TW, Wang WZ, Wang JY. Effect of epidermal growth factor on glutamine metabolic enzymes in small intestine and skeletal muscle of parenterally fed rats. Nutrition 1997;13:652-5.

375. McAndrew HF, Lloyd DA, Rintala R, van Saene HK. The effects of intravenous epidermal growth factor on bacterial translocation and central venous catheter infection in the rat total parenteral nutrition model. Pediatr Surg Int 2000;16:169-73.

376. Nyati MK, Maheshwari D, Hanasoge S, Sreekumar A, Rynkiewicz SD, Chinnaiyan AM, Leopold WR, Ethier SP, Lawrence TS. Radiosensitization by pan ErbB inhibitor CI-1033 in vitro and in vivo. Clin Cancer Res 2004;10:691-700.

377. Ocana A, Amir E. Irreversible pan-ErbB tyrosine kinase inhibitors and breast cancer: current status and future directions. Cancer Treat Rev 2009;35:685-91.

378. Rocha-Lima CM, Soares HP, Raez LE, Singal R. EGFR targeting of solid tumors. Cancer Control 2007;14:295-304.

379. Roudabush FL, Pierce KL, Maudsley S, Khan KD, Luttrell LM. Transactivation of the EGF receptor mediates IGF-1-stimulated shc phosphorylation and ERK1/2 activation in COS-7 cells. J Biol Chem 2000;275:22583-9.

380. El-Shewy HM, Kelly FL, Barki-Harrington L, Luttrell LM. Ectodomain shedding-dependent transactivation of epidermal growth factor receptors in response to insulin-like growth factor type I. Mol Endocrinol 2004;18:2727-39.

381. Ahmad T, Farnie G, Bundred NJ, Anderson NG. The mitogenic action of insulin-like growth factor I in normal human mammary epithelial cells requires the epidermal growth factor receptor tyrosine kinase. J Biol Chem 2004;279:1713-9.

382. Gilmore AP, Valentijn AJ, Wang P, Ranger AM, Bundred N, O'Hare MJ, Wakeling A, Korsmeyer SJ, Streuli CH. Activation of BAD by therapeutic inhibition of epidermal growth factor receptor and transactivation by insulin-like growth factor receptor. J Biol Chem 2002;277:27643-50.

383. Negro A, Brar BK, Gu Y, Peterson KL, Vale W, Lee KF. erbB2 is required for G protein-coupled receptor signaling in the heart. Proc Natl Acad Sci U S A 2006;103:15889-93.

384. Schedl HP, Schwartz J, Wilson HD. Increased intestinal growth in the streptozotocin-diabetic rat occurs prior to changes in hormone secretion. Digestion 1988;39:137-43.

385. Jervis EL, Levin RJ. Anatomic adaptation of the alimentary tract of the rat to the hyperphagia of chronic alloxan-diabetes. Nature 1966;210:391-3.

386. Pillion DJ, Jenkins RL, Atchison JA, Stockard CR, Clements RS, Jr., Grizzle WE. Paradoxical organ-specific adaptations to streptozotocin diabetes mellitus in adult rats. Am J Physiol 1988;254:E749-55.

387. Schedl HP, Wilson HD. Effects of diabetes on intestinal growth in the rat. J Exp Zool 1971;176:487-95.

158

388. Brubaker PL, So DC, Drucker DJ. Tissue-specific differences in the levels of proglucagon-derived peptides in streptozotocin-induced diabetes. Endocrinology 1989;124:3003-9.

389. Jasleen J, Shimoda N, Shen ER, Tavakkolizadeh A, Whang EE, Jacobs DO, Zinner MJ, Ashley SW. Signaling mechanisms of glucagon-like peptide 2-induced intestinal epithelial cell proliferation. J Surg Res 2000;90:13-8.

390. Jasleen J, Ashley SW, Shimoda N, Zinner MJ, Whang EE. Glucagon-like peptide 2 stimulates intestinal epithelial proliferation in vitro. Dig Dis Sci 2002;47:1135-40.

391. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-32.

392. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, et al. The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 1995;377:530-2.

393. Schwartz MW, Woods SC, Porte D, Jr., Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature 2000;404:661-71.

394. Wilding JP, Gilbey SG, Bailey CJ, Batt RA, Williams G, Ghatei MA, Bloom SR. Increased neuropeptide-Y messenger ribonucleic acid (mRNA) and decreased neurotensin mRNA in the hypothalamus of the obese (ob/ob) mouse. Endocrinology 1993;132:1939-44.

395. Cuendet GS, Loten EG, Jeanrenaud B, Renold AE. Decreased basal, noninsulin-stimulated glucose uptake and metabolism by skeletal soleus muscle isolated from obese-hyperglycemic (ob/ob) mice. J Clin Invest 1976;58:1078-88.

396. Dubuc PU. The development of obesity, hyperinsulinemia, and hyperglycemia in ob/ob mice. Metabolism 1976;25:1567-74.

397. Medina-Gomez G, Yetukuri L, Velagapudi V, Campbell M, Blount M, Jimenez-Linan M, Ros M, Oresic M, Vidal-Puig A. Adaptation and failure of pancreatic beta cells in murine models with different degrees of metabolic syndrome. Dis Model Mech 2009;2:582-92.

398. Lindstrom P. beta-cell function in obese-hyperglycemic mice [ob/ob Mice]. Adv Exp Med Biol;654:463-77.

399. Bock T, Pakkenberg B, Buschard K. Increased islet volume but unchanged islet number in ob/ob mice. Diabetes 2003;52:1716-22.

400. Baetens D, Stefan Y, Ravazzola M, Malaisse-Lagae F, Coleman DL, Orci L. Alteration of islet cell populations in spontaneously diabetic mice. Diabetes 1978;27:1-7.

401. Kharouta M, Miller K, Kim A, Wojcik P, Kilimnik G, Dey A, Steiner DF, Hara M. No mantle formation in rodent islets -- the prototype of islet revisited. Diabetes Res Clin Pract 2009;85:252-7.

402. Dubuc PU, Mobley PW, Mahler RJ, Ensinck JW. Immunoreactive glucagon levels in obese-hyperglycemic (ob/ob) mice. Diabetes 1977;26:841-6.

403. Sorensen H, Brand CL, Neschen S, Holst JJ, Fosgerau K, Nishimura E, Shulman GI. Immunoneutralization of endogenous glucagon reduces hepatic glucose output and improves long-term glycemic control in diabetic ob/ob mice. Diabetes 2006;55:2843-8.

404. Kolb H, Mandrup-Poulsen T. The global diabetes epidemic as a consequence of lifestyle-induced low-grade inflammation. Diabetologia;53:10-20.

159

405. Boni-Schnetzler M, Thorne J, Parnaud G, Marselli L, Ehses JA, Kerr-Conte J, Pattou F, Halban PA, Weir GC, Donath MY. Increased interleukin (IL)-1beta messenger ribonucleic acid expression in beta -cells of individuals with type 2 diabetes and regulation of IL-1beta in human islets by glucose and autostimulation. J Clin Endocrinol Metab 2008;93:4065-74.

406. Lagathu C, Yvan-Charvet L, Bastard JP, Maachi M, Quignard-Boulange A, Capeau J, Caron M. Long-term treatment with interleukin-1beta induces insulin resistance in murine and human adipocytes. Diabetologia 2006;49:2162-73.

407. Feve B, Bastard JP. The role of interleukins in insulin resistance and type 2 diabetes mellitus. Nat Rev Endocrinol 2009;5:305-11.

408. Larsen CM, Faulenbach M, Vaag A, Volund A, Ehses JA, Seifert B, Mandrup-Poulsen T, Donath MY. Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N Engl J Med 2007;356:1517-26.

409. Ehses JA, Lacraz G, Giroix MH, Schmidlin F, Coulaud J, Kassis N, Irminger JC, Kergoat M, Portha B, Homo-Delarche F, Donath MY. IL-1 antagonism reduces hyperglycemia and tissue inflammation in the type 2 diabetic GK rat. Proc Natl Acad Sci U S A 2009;106:13998-4003.

410. Venieratos PD, Drossopoulou GI, Kapodistria KD, Tsilibary EC, Kitsiou PV. High glucose induces suppression of insulin signalling and apoptosis via upregulation of endogenous IL-1beta and suppressor of cytokine signalling-1 in mouse pancreatic beta cells. Cell Signal;22:791-800.

411. Estil les E, Tellez N, Soler J, Montanya E. High sensitivity of beta-cell replication to the inhibitory effects of interleukin-1beta: modulation by adenoviral overexpression of IGF2 in rat islets. J Endocrinol 2009;203:55-63.

412. Ivory CP, Wallace LE, McCafferty DM, Sigalet DL. Interleukin-10-independent anti-inflammatory actions of glucagon-like peptide 2. Am J Physiol Gastrointest Liver Physiol 2008;295:G1202-10.

413. Harkins JM, Moustaid-Moussa N, Chung YJ, Penner KM, Pestka JJ, North CM, Claycombe KJ. Expression of interleukin-6 is greater in preadipocytes than in adipocytes of 3T3-L1 cells and C57BL/6J and ob/ob mice. J Nutr 2004;134:2673-7.