The role of the Eph and ephrin proteins in prostate...

TheroleoftheEphandephrin

proteinsinprostatecancer

A thesis by

Jennifer Kylie McCarron

Bachelor of Applied Science (Honours)

Bachelor of Applied Science (Medical Science)

Submitted to the Faculty of Science and Technology

Queensland University of Technology

for the degree of Doctor of Philosophy (Science)

2011

Queensland University of Technology

Queensland Institute of Medical Research

i

Keywords

Eph receptor, ephrin ligand, prostate cancer, EphA2, EphA3, ephrin-A5, migration,

invasion

ii

Publications

Publications arising from work related to my thesis but not forming part of my thesis.

McCarron JK, Stringer BW, Day BW, Boyd AW (2010) Ephrin expression and

function in cancer. Future Oncology 6: 165-76

Duffy SL, Coulthard MG, Spanevello MD, Herath NI, Yeadon TM, McCarron JK,

Carter JC, Tonks ID, Kay GF, Phillips GE, Boyd AW (2008) Generation and

characterization of EphA1 receptor tyrosine kinase reporter knockout mice. Genesis

46: 553-61

Day BW, Smith FM, Chen K, McCarron JK, Herath NI, Lackmann M, Boyd AW

(2006) Eph/Ephrin membrane proteins: a mammalian expression vector pTig-BOS-

Fc allowing rapid protein purification. Protein & Peptide Letters 13: 193-6

iii

Abstract

Prostate cancer is the most commonly diagnosed malignancy and the second leading

cause of cancer related deaths in Australian men. Treatment in the early stages of the

disease involves surgery, radiation and/or hormone therapy. However, in late stages

of the disease these treatments are no longer effective and only palliative care is

available. Therefore, there is a focus on exploration of novel therapies to increase

survival and treatment efficacy. Advanced prostate cancer is characterised by bone or

other distant metastasis. Spreading of the primary tumour to a secondary location is a

complex process requiring an initial loss in cell-cell adhesion followed by increased

cell migration and invasion. One gene family that has been known to affect cell-to-

cell contact in other model systems are the Eph receptor tyrosine kinases. They are

the largest family of receptor tyrosine kinases made up of 14 vertebrate Eph

receptors that bind to nine cell membrane bound ephrin ligands. Eph-ephrin

interaction is crucial in regulating cell behaviour in developmental processes and it is

now thought that the underlying mechanisms involved in development may also be

involved in cancer. Aberrant expression has been reported in many human

malignancies including prostate cancer. Furthermore, expression has been linked

with metastasis and poor prognosis in other tumour models. This study explores the

potential role of the Eph receptor family in prostate cancer, in particular the roles of

EphA2, EphA3 and ephrin-A5.

Gene expression profiles were established for the Eph family in a series of prostate

cancer cell lines using quantitative real time RT-PCR. A smaller subset of the most

prominently expressed genes was chosen to screen a cohort of clinical samples.

Elevated levels of EphA2, EphA3 and their ligands, ephrin-A1 and ephrin-A5 were

observed in individual cell lines. Interestingly high EphA3 expression was observed

in the androgen responsive cell lines while EphA2 was more prominent in the

androgen independent cell lines. However, studies using 5-dihydrotestosterone

suggest that EphA3 expression in not regulated by androgen. Cells expressing

EphA2 showed a greater ability for migration and invasion while cells expressing

EphA3 showed poor migration and invasion. Forced expression of EphA2 in the

LNCaP cell line resulted in a more invasive phenotype while forced expression of

iv

EphA3 in the PC-3 cell line suggests a possible negative effect for EphA3 on cell

migration and invasion.

Cell signalling studies show activation of EphA2 decreases activity of proteins

thought to be involved in pathways regulating cell movement including Akt, Src and

FAK. Changes to the activation status of Rho family members, including RhoA and

Rac1, associated with reorganisation of the actin cytoskeleton, an important part of

cell migration was also observed. As a result, activation of EphA2 in PC-3 cells

resulted in a less invasive phenotype. A novel finding in this study was the discovery

of a combination of two EphA2 Mabs able to activate EphA2. Preliminary results

show a potential for this antibody combination to reduce prostate cancer invasion in

vitro.

A unique aspect of Eph-ephrin interaction is the resulting bi-directional signalling

that occurs through both the receptor and ligand. In this study a potential role for

ephrin-A5 mediated signalling in prostate cancer was observed. LNCaP cells express

high levels of EphA3 and its high affinity ligand ephrin-A5. In stripe assays, used to

study guidance cues, LNCaP cells show strong attraction/migration to EphA3-Fc

stripes but not ephrin-A5-Fc stripes suggesting ephrin-A5 mediated reverse cell

signalling is involved. Knockdown of ephrin-A5 using shRNA resulted in a decrease

in attraction/migration to EphA3-Fc stripes. Furthermore a reduction in proliferation

was also observed in vitro. A subcutaneous xenograft model using ephrin-A5 shRNA

cells versus controls showed a decrease in tumour formation.

This study demonstrates a difference in EphA2 and EphA3 function in prostate

cancer migration/invasion and a potential role for ephrin-A5 in prostate cancer cell

adhesion and growth.

v

Tableofcontents

Key words ..................................................................................................................... i

Publications .................................................................................................................. ii

Abstract ....................................................................................................................... iii

Table of contents .......................................................................................................... v

List of figures ............................................................................................................. xii

List of abbreviations ................................................................................................... xv

List of symbols ........................................................................................................ xviii

Statement of original authorship ............................................................................... xix

Statement of contribution by others .......................................................................... xix

Acknowledgements .................................................................................................... xx

Chapter 1: Literature review ........................................................................................ 1

1.1 The prostate ........................................................................................................ 1

1.2 Benign prostatic hypertrophy ............................................................................. 2

1.3 Prostatic intraepithelial neoplasia ...................................................................... 2

1.4 Prostate cancer ................................................................................................... 3

1.4.1 Diagnosis/detection ...................................................................................... 3

1.4.2 Current treatments ....................................................................................... 4

1.4.3 Risk factors .................................................................................................. 5

1.5 Biology of tumour progression .......................................................................... 6

1.5.1 Cell proliferation and apoptosis ................................................................... 6

1.5.1.1 Androgen receptor mutations ................................................................ 7

vi

1.5.1.2 Dysregulated anti-apoptotic genes ........................................................ 7

1.5.1.3 Stem cell mutations ............................................................................... 8

1.5.1.4 Altered expression of Src family kinases .............................................. 8

1.5.2 Cell adhesion ................................................................................................ 9

1.5.2.1 Cadherins/catenins ................................................................................ 9

1.5.2.2 Integrins ............................................................................................... 10

1.5.2.3 Focal adhesion kinase .......................................................................... 11

1.5.3 Cell movement ........................................................................................... 11

1.5.4 The role of proteases in cell invasion ........................................................ 12

1.5.5 Migration to distant sites ............................................................................ 13

1.5.6 Angiogenesis .............................................................................................. 13

1.6 Receptor tyrosine kinases ................................................................................. 14

1.7 Eph receptor tyrosine kinase family – general overview ................................. 14

1.8 Eph-ephrin signalling ....................................................................................... 15

1.8.1 Forward signalling ..................................................................................... 15

1.8.2 Reverse signalling ...................................................................................... 17

1.8.3 Kinase independent signalling ................................................................... 17

1.8.4 Cell adhesion versus repulsion ................................................................... 18

1.8.5 Eph-ephrin downstream signalling ............................................................ 18

1.8.5.1 Rho family ........................................................................................... 19

1.8.5.2 Ena/VASP ........................................................................................... 19

1.8.5.3 PI3K pathway ...................................................................................... 19

vii

1.8.5.4 Integrins ............................................................................................... 20

1.9 Biological functions of Ephs and ephrins ........................................................ 21

1.9.1 Early embryogenesis .................................................................................. 21

1.9.2 Circulatory system development ............................................................... 21

1.9.3 Central nervous system development ........................................................ 22

1.10 Ephs and ephrins in cancer ............................................................................. 22

1.11 Ephs and ephrins in prostate cancer ............................................................... 23

1.12 Knowledge gaps ............................................................................................. 27

1.13 Significance .................................................................................................... 27

1.14 Hypothesis ...................................................................................................... 28

1.15 Aims ............................................................................................................... 28

Chapter 2: Materials and methods ............................................................................. 29

2.1 Cell culture ....................................................................................................... 29

2.2 Antibodies ........................................................................................................ 29

2.3 RNA isolation and cDNA synthesis ................................................................. 30

2.4 Quantitative real time PCR .............................................................................. 31

2.5 Agarose gel electrophoresis ............................................................................. 31

2.6 Flow cytometry ................................................................................................ 31

2.7 Western blotting ............................................................................................... 34

2.8 Immunocytochemistry ...................................................................................... 34

2.9 Adhesion assay ................................................................................................. 35

2.10 Wound assay .................................................................................................. 35

viii

2.11 Invasion assay ................................................................................................ 36

2.12 MTS assay ...................................................................................................... 37

2.13 Effect of drugs on cell proliferation ............................................................... 37

2.14 Transfections .................................................................................................. 37

2.15 Statistical analysis .......................................................................................... 38

Chapter 3: Eph and ephrin expression in prostate cancer .......................................... 39

3.1 Introduction ...................................................................................................... 39

3.2 Materials and methods ..................................................................................... 41

3.2.1 Patient characteristics ................................................................................. 41

3.2.2 Tissue samples for Q-PCR screen.............................................................. 41

3.2.3 Tissue samples for immunohistochemistry ................................................ 41

3.2.4 Quantitative real time PCR ........................................................................ 42

3.2.5 Immunohistochemistry .............................................................................. 42

3.3 Results .............................................................................................................. 43

3.3.1 Eph and ephrin expression in prostate cancer cell lines ............................ 43

3.3.1.1 Eph and ephrin mRNA expression in human prostate cancer cell lines

......................................................................................................................... 43

3.3.1.2 Eph and ephrin protein expression in human prostate cancer cell lines

......................................................................................................................... 45

3.3.1.3 Immunocytochemistry ......................................................................... 47

3.3.2 Eph and ephrin expression in human tissue samples ................................. 49

3.3.2.1 Eph and ephrin mRNA expression in human clinical samples ........... 49

3.3.2.2 Eph and ephrin protein expression in human clinical samples ........... 51

ix

3.3.3 Downstream signalling .................................................................................. 58

3.3.3.1 Rho family ........................................................................................... 58

3.3.3.2 Integrin subunits .................................................................................. 60

3.3.3.3 Src family kinases ............................................................................... 62

3.4 Discussion ........................................................................................................ 64

Chapter 4 – EphA2 and EphA3 .................................................................................. 68

4.1 Introduction ...................................................................................................... 68

4.2 Materials and methods ..................................................................................... 70

4.2.1 Androgen stimulation studies .................................................................... 70

4.2.2 EphA2 and EphA3 constructs .................................................................... 70

4.2.3 Short hairpin RNA (shRNA) ..................................................................... 70

4.2.4 Transwell migration assay ......................................................................... 71

4.2.5 EphA2/EphA3 activation studies ............................................................... 71

4.3 Results .............................................................................................................. 72

4.3.1 Regulation of EphA2 and EphA3 expression by androgen ....................... 72

4.3.2 EphA2/EphA3 over expression or knockdown ......................................... 75

4.3.2.1 Establishment of stable EphA2 expressing LNCaP cells .................... 75

4.3.2.2 Establishment of stable EphA3 expressing PC-3 cells ....................... 76

4.3.2.3 Establishment of stable EphA3 knockdown in LNCaP cells .............. 77

4.3.2.4 Stable EphA2 knockdown could not be established in PC-3 cells ...... 78

4.3.2.5 Co-localisation of EphA2 and EphA3 ................................................. 78

4.3.3 Effect of EphA2 and EphA3 modulation on cell morphology .................. 80

x

4.3.4 EphA2 and EphA3 expression do not affect cell proliferation .................. 83

4.3.5 EphA2 expressing cells show enhanced migration and invasion compared

to EphA3 expressing cells ................................................................................... 83

4.3.6 Integrin mediated cell adhesion ................................................................. 90

4.3.7 EphA2/EphA3 downstream signalling ...................................................... 92

4.3.8 EphA2 activation results in rounded morphology ..................................... 96

4.3.9 EphA2 activation results in activation of Rho kinase ................................ 97

4.3.10 EphA2 activation results in decreased invasion ....................................... 98

4.3.11 Investigation of Dasatinib as a potential therapy for prostate cancer .... 100

4.3.11.1 Dasatinib and PP2 decrease PC-3 cell proliferation ........................ 101

4.3.11.2 Dasatinib and PP2 decrease PC-3 cell migration and invasion ....... 101

4.4 Discussion ...................................................................................................... 104

Chapter 5 – ephrin-A5 .............................................................................................. 110

5.1 Introduction .................................................................................................... 110

5.2 Materials and methods ................................................................................... 112

5.2.1 Stripe assay .............................................................................................. 112

5.2.2 Short hairpin RNA (shRNA) ................................................................... 112

5.2.3 Staining using Fc constructs .................................................................... 113

5.2.4 Western blot analysis of detergent insoluble protein ............................... 113

5.2.5 PI cell cycle analysis ................................................................................ 113

5.2.6 Soft agar colony formation assay ............................................................. 114

5.2.7 In vivo experiments .................................................................................. 114

xi

5.2.8 RNA isolation of mouse xenografts ........................................................ 114

5.2.9 Statistical analysis .................................................................................... 115

5.3 Results ............................................................................................................ 116

5.3.1 Ephrin-A5 promotes strong adhesion to EphA3 ...................................... 117

5.3.2 Src kinases ............................................................................................... 119

5.3.3 The effect of signalling by ephrin-A5 on Src kinases ............................. 120

5.3.4 Production of ephrin-A5 knockdown in LNCaP cells ............................. 121

5.3.5 Reduced ephrin-A5 results in reduced adhesion to EphA3 ..................... 121

5.3.6 Ephrin-A5 expression does not affect cell morphology, migration or

invasion in LNCaP cells ................................................................................... 124

5.3.7 Ephrin-A5 knockdown does not affect integrin mediated cell adhesion in

LNCaP cells ...................................................................................................... 124

5.3.8 Ephrin-A5 knockdown reduces prostate cancer cell proliferation .......... 127

5.3.9 Effect of ephrin-A5 knockdown on tumour growth in vivo .................... 130

5.4 Discussion ...................................................................................................... 132

Chapter 6: Conclusions and future directions .......................................................... 135

6.1 EphA2 and EphA3 function ........................................................................... 135

6.2 Ligand dependent versus independent signalling .......................................... 136

6.3 Ephrin-A5 in prostate cancer adhesion and proliferation .............................. 137

6.4 Other Eph family members ............................................................................ 138

References ................................................................................................................ 139

xii

Listoffigures

Figure 1.1: Structure of Eph receptors and ephrin ligands ......................................... 16

Table 2.1: Oligonucleotides used for quantitative real time RT-PCR ....................... 32

Figure 3.1: Eph and ephrin mRNA expression in prostate cancer cell lines .............. 44

Figure 3.2: Eph and ephrin protein expression in prostate cancer (PCa) cell lines .... 46

Figure 3.3: Cellular localisation of EphA2, EphA3, ephrin-A1 and ephrin-A5 ........ 48

Figure 3.4: Eph and ephrin mRNA expression in PCa tissue .................................... 50

Figure 3.5: EphA2 protein expression in BPH and PCa samples .............................. 52

Figure 3.6: EphA3 protein expression in BPH and PCa samples .............................. 53

Figure 3.7: ephrin-A1 and ephrin-A5 protein expression in BPH and PCa samples . 54

Figure 3.8: EphA2 and EphA3 IHC for PCa samples ................................................ 56

Figure 3.9: ephrin-A1 and ephrin-A5 IHC for PCa tissue samples ........................... 57

Figure 3.10: Rho family mRNA expression in prostate cancer cell lines .................. 58

Figure 3.11: Rho family protein expression in prostate cancer cell lines .................. 59

Figure 3.12: Integrin mRNA and protein expression in prostate cancer cell lines .... 61

Figure 3.13: Src family kinase mRNA and protein expression .................................. 63

Figure 4.1: DHT does not regulate EphA2 or EphA3 mRNA expression ................. 74

Figure 4.2: EphA2 expression in transfected LNCaP cells ........................................ 75

Figure 4.3: EphA3 expression in transfected PC-3 cells ............................................ 76

Figure 4.4: EphA3 knockdown in LNCaP cells ......................................................... 77

Figure 4.5: EphA2 and EphA3 co-localisation .......................................................... 79

Figure 4.6: Cell morphology of parental cell lines ..................................................... 80

xiii

Figure 4.7: Cell morphology of LNCaP EphA2 transfected cells ............................. 81

Figure 4.8: Cell morphology of EphA3 and EphA3 shRNA transfected cell lines ... 82

Figure 4.9: Prostate cancer cell proliferation ............................................................. 84

Figure 4.10: Prostate cancer cell migration and invasion .......................................... 85

Figure 4.11: EphA2 transfected LNCaP cell migration and invasion ........................ 87

Figure 4.12: Effect of EphA3 expression on cell migration and invasion ................. 89

Figure 4.13: Cell adhesion in prostate cancer cell lines ............................................. 91

Figure 4.14: EphA2 and EphA3 activation ................................................................ 92

Figure 4.15: Akt is dephosphorylated after EphA2 but not EphA3 activation .......... 93

Figure 4.16: Src, FAK and integrin signalling ........................................................... 95

Figure 4.17: EphA2 activation results in PC-3 cell rounding .................................... 96

Figure 4.18: Rho family signalling in response to EphA2 activation ........................ 97

Figure 4.19: EphA2 activation reduces PC-3 cell invasiveness ................................. 98

Figure 4.20: EphA2 activation, by EphA2 antibodies, results in reduced PC-3 cell

invasiveness ............................................................................................................... 99

Figure 4.21: Dasatinib reduces EphA2 phosphorylation in PC-3 cells .................... 100

Figure 4.22: Effect of Dasatinib and Src kinase inhibitor, PP2, on PC-3 cell

proliferation .............................................................................................................. 102

Figure 4.23: Effect of Dasatinib and PP2 on migration and invasion in PC-3 cells 103

Figure 4.24: Possible mechanisms involved in EphA2 signalling ........................... 107

Figure 5.1: LNCaP cell adhesion to EphA3-Fc ....................................................... 116

Figure 5.2: Stripe assays .......................................................................................... 118

Figure 5.3: Src inhibitor, PP2, reduces LNCaP attraction to EphA3-Fc stripes ...... 119

xiv

Figure 5.4: Activation of Src downstream of ephrin-A5 ......................................... 120

Figure 5.5: ephrin-A5 knockdown in LNCaP cells .................................................. 122

Figure 5.6: ephrin-A5 knockdown cells lose strong attraction to EphA3-Fc ........... 123

Figure 5.7: ephrin-A5 expression does not affect LNCaP cell morphology, migration

or invasion ................................................................................................................ 125

Figure 5.8: ephrin-A5 expression does not affect LNCaP cell adhesion to

extracellular matrix proteins ..................................................................................... 126

Figure 5.9: Cell proliferation and cell cycle analysis ............................................... 128

Figure 5.10: ephrin-A5 expression affects colony size ............................................ 129

Figure 5.11: Reduced ephrin-A5 expression leads to reduced tumour growth in vivo

.................................................................................................................................. 131

xv

Listofabbreviations

Ab antibody

ARE androgen response element

Bcl-2 B-cell lymphoma 2

BPH benign prostatic hypertrophy

BSA bovine serum albumin

cDNA complementary deoxyribonucleic acid

CML chronic myelogenous leukaemia

DAB 3, 3’ - diaminobenzidine

DEPC diethyl pyrocarbonate

DHT dihydrotestosterone

DMSO dimethyl sulfoxide

DNA deoxyribonucleic acid

DTT dithiothreitol

ECL enhanced chemiluminescence

ECM extracellular matrix

EDTA ethylenediaminetetraacetic acid

EGF epidermal growth factor

Eph erythropoietin-producing hepatocellular

FACS fluorescence activated cell sorting

FAK focal adhesion kinase

FBS fetal bovine serum

xvi

g g-force

GAPDH glyceraldehyde 3 phosphate dehydrogenase

GDP guanosine diphosphate

GFP green fluorescent protein

GPI glycophosphatidylinositol

GST glutathione S transferase

GTP guanosine triphosphate

HGF hepatocyte growth factor

IHC immunohistochemistry

IRES internal ribosomal entry site

kb kilobase

kDa kilodalton

L litres

Mab monoclonal antibody

MMP matrix metalloproteinase

mRNA messenger ribonucleic acid

MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-

sulfophenyl)-2H-tetrazolium)

MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)

NaF sodium fluoride

nm nanometer

nM nanomolar

xvii

OD optical density

pAb phospho antibody

PBS phosphate buffered saline

PCa prostate cancer

PCR polymerase chain reaction

PDGF platelet derived growth factor

PDZ postsynaptic density protein-95, drosophila disc large tumour

suppressor, zonula occludens-1 protein

PDZ-RGS3 PDZ regulator of heterotrimeric G-protein signalling

PFA paraformaldehyde

PI propidium iodide

PIN prostatic intraepithelial neoplasia

PSA prostate specific antigen

PTyr phospho-tyrosine

Q-PCR quantitative real time polymerase chain reaction

RPMI Roswell Park Memorial Institute

RTK receptor tyrosine kinase

s.d. standard deviation

SAM sterile alpha motif

SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electrophoresis

shRNA short hairpin RNA

siRNA small interfering RNA

xviii

TAE tris acetate EDTA

TURP transurethral resection of the prostate

Tyr tyrosine

VEGF vascular endothelial growth factor

Listofsymbols

α alpha

β beta

µg micrograms

µm micrometer

µM micromolar

# number

% percentage

xix

Statementoforiginalauthorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature

Date

Statementofcontributionbyothers

Chapter 5: The mouse xenograft experiment was performed in collaboration with Dr

Bryan Day, Kathleen Ensbey and Paul Jamieson. My contribution consisted of

preparing cells for injection, RNA preparation and Q-PCR on individual tumours and

analysis of tumour growth.

xx

Acknowledgements

First and foremost I would like to thank my two supervisors, Professor Andrew Boyd

and Professor Adrian Herington. Thank you both for your patience and guidance

both throughout my honours and my PhD and for always taking the time to talk

through ideas for this project. Thank you for always challenging me and for sharing

your knowledge.

I would also like to thank the members of the Leukaemia Foundation Laboratory,

both past and present, for providing a great working environment. A special thank

you goes to Dr Nirmitha Herath for your guidance and friendship. You helped me

early on to develop my writing skills and to plan the direction of my experiments. I

would also like to thank Fiona Smith, who originally taught me many techniques in

the lab. Thank you to Dr Bryan Day, Dr Michael Ting, Dr Brett Stringer and Dr

Mark Spanevello for your support and friendship. Brett, I appreciate the time you

took to read over my work.

Thank you also to Paula Hall and Grace Chojnowski for your technical assistance on

the imaging microscopes and cell sorter.

Lastly, I would like to thank my family for your constant support and interest in this

journey. A very special thank you to my husband Byron, without your support this

would have been a much harder journey.

Chapter 1: Literature review

1

Chapter1:Literaturereview

The Eph (erythropoietin-producing hepatocellular) receptors are an important family

of tyrosine kinases that bind to cell membrane bound ephrin ligands. Eph-ephrin

interaction results in unique bi-directional signalling that has been shown to be

important in key physiological processes during embryogenesis such as vascular and

neuronal development. In the adult they are involved in tissue homeostasis but are

also known to play major, but often contrasting, roles in the progression and/or

suppression of many human epithelial cancers. Their role in cancer is not yet

understood as some tumours present with elevated levels of expression while others

show a decrease in expression. The differing levels of expression may reflect

differences in tumour type, grade, stage or differentiation. Expression has been

shown to predict metastasis and in a number of cancers has been linked with patient

survival. Prostate cancer is the most common cancer affecting Australian men. In

contrast to other cancers, little is known about the expression, regulation and roles of

the Eph/ephrin axis in this disease. This thesis aims to address these important

questions and the following literature review summarises the relevant background

information regarding prostate cancer and the Eph/ephrin axis.

1.1Theprostate

The prostate is a walnut sized gland of the male reproductive system. It is located

below the bladder and completely surrounds the urethra. Its main function is to store

and secrete an alkaline fluid that makes up part of the seminal fluid. Androgenic

hormones play a role in the development of the prostate and continue to be required

throughout life to maintain normal prostatic function (Agoulnik & Weigel, 2006).

The human prostate gland is divided into four zones - the peripheral, central,

transition and the anterior-fibro muscular zone. The peripheral zone, located at the

back of the prostate is the largest of the four zones comprising approximately 75% of

the normal prostate. The majority of prostate cancers originate in this zone (McNeal

et al, 1988). The transition zone accounts for approximately 5% of the normal


2

prostate and consists of two lobes surrounding the urethra. It is the main site of

benign prostatic hypertrophy (BPH) (McNeal, 1981; McNeal et al, 1988).

The prostate is made up of epithelial and stromal cells. There are three main types of

epithelial cells (secretory, basal and neuroendocrine) that form small glands within

the prostate (Hudson, 2004). The secretory cells are located along the lumen and

produce, among other proteins, prostate specific antigen and prostatic acid

phosphatase. They are separated from the basement membrane by a layer of basal

cells. Neuroendocrine cells are rare and are scattered throughout the prostate.

Stromal cells including smooth muscle cells and fibroblasts surround the prostatic

glands (Hudson, 2004).

1.2Benignprostatichypertrophy

Benign prostatic hypertrophy (BPH) is an enlargement of the prostate gland caused

by the formation of benign nodules. This enlargement is commonly associated with

lower urinary tract symptoms and can lead to complete obstruction of the urethra

(Emberton et al, 2008). The prevalence of BPH increases with age, with greater than

80% of men in their 80s showing histological signs of this condition (Franks, 1953).

Depending on the severity of symptoms treatment includes watchful waiting,

medications that inhibit prostate growth (such as anti-androgens e.g. 5- reductase

inhibitors) and surgery (Edwards, 2008). Surgery traditionally consisted of

transurethral resection of the prostate (TURP) however minimally invasive surgical

therapies are becoming more common (Harkaway & Issa, 2006). BPH is not

considered to be a precursor to prostate cancer (Miller & Torkko, 2001).

1.3Prostaticintraepithelialneoplasia

Prostatic intraepithelial neoplasia (PIN) is characterised by abnormal cellular

proliferation within the glandular structures of the prostate. It is divided into two

grades: low and high. Similar to BPH the prevalence of PIN increases with age

(Ayala & Ro, 2007). High grade PIN is an accepted pre-cursor lesion to prostate


3

adenocarcinoma (Bostwick et al, 2004) and is a strong predictive marker for the

development/presence of prostate adenocarcinoma (Davidson et al, 1995).

1.4Prostatecancer

Prostate cancer (PCa) is the most common cancer affecting Australian men with

19,403 new cases diagnosed in 2007 (AIHW, 2010). The staging of prostate cancer is

complex but in essence the disease progresses through four stages. In stage 1 the

tumour is not detectable clinically other than by biopsy and is relatively well

differentiated. In stage 2 the tumour is more extensive and shows more poorly

differentiated morphology. In stage 3 the tumour has invaded the prostatic capsule

and shows limited, local spread to immediately adjacent structures. Stage 4 includes

tumours that show extensive local spread within the pelvis or spread to lymph nodes

or distant sites (metastasis) (Bracarda et al, 2005). In stages 1 and 2 the tumour is

contained within the prostate gland and may be treated with “watchful waiting”,

surgery or radiation therapy. However, in advanced prostate cancer, stages 3 and 4,

these treatments are no longer effective.

The Gleason system is used to grade the architectural pattern of the glands in prostate

adenocarcinoma. Grades range from 1 (well differentiated) to 5 (undifferentiated).

The Gleason score is a sum of two grades representing the most prevalent and second

most prevalent pattern (Bracarda et al, 2005). For example, a tumour with mainly

grade 4, but elements of grade 3 disease, would have a score of 7 (also written as 4 +

3).

1.4.1Diagnosis/detection

Detection of prostate cancer is usually made by digital rectal examination (DRE),

prostate specific antigen serum levels or transrectal ultrasound. Early detection is

essential for increased survival and treatment efficacy.


4

Prostate specific antigen (PSA) is a member of the kallikrein family of serine

proteases (Watt et al, 1986). It is also known as kallikrein 3 and is secreted by the

prostate in both normal and malignant conditions. Measurement of levels of PSA in

the serum is commonly used as a screening method for prostate cancer in

combination with DRE. However, benign conditions such as BPH can also lead to

elevated levels of PSA, demonstrating a lack of specificity for this test to detect

prostate cancer (Botchorishvili et al, 2009). A study by Catalona et al showed that

33% of men with elevated PSA levels (> 4 g/l) in combination with an abnormal

DRE/ultrasonography had prostate cancer, confirmed by prostate biopsy.

Alternatively 21% of men with prostate cancer had PSA levels below 4 g/l. While

this study showed that PSA was the best predictor of prostate cancer compared to

DRE or ultrasonography there is still much inconsistency with this test to detect

prostate cancer even in combination with DRE/ultrasonography (Catalona et al,

1991). There is also controversy over whether PSA results contribute to over

treatment in men with indolent disease (Nogueira et al, 2009). Therefore additional

biomarkers might aid treatment choices.

1.4.2Currenttreatments

In the early stages of prostate cancer the tumour is contained within the prostatic

capsule and prostatectomy and/or radiation are effective treatments. In later stages,

where the tumour shows local and/or distant spread, androgen deprivation therapies

are commonly used (Kohli & Tindall, 2010). While an initial response is often seen,

the tumour becomes hormone refractory as the disease progresses/recurs, being able

to grow in an androgen independent manner (Bracarda et al, 2005). Treatment at this

stage is with palliative chemotherapy which yields only modest improvements in

symptoms, quality of life and survival, and may be associated with side-effects,

sometimes severe (Kohli & Tindall, 2010; Tannock et al, 2004). Thus, in late stage

prostate cancer there is a need for more efficacious therapies.


5

1.4.3Riskfactors

Risk factors for prostate cancer include increasing age, race, family history, genetic

factors and diet. Of those listed, age is one of the most important factors. Prostate

cancer is not commonly diagnosed in men before the age of 50 (Haas & Sakr, 1997).

After this age incidence and mortality rates increase progressively. Over 65% of all

cases of prostate cancer are diagnosed in men over the age of 65 (2007). Prostate

cancer incidence is also higher in African American men than in Caucasian men. The

incidence rates for 1999-2003 were 243 per 100,000 for African American men and

156 per 100,000 for Caucasian men (2007). Men with a family history of prostate

cancer are also at a higher risk. Steinberg et al found that the risk of prostate cancer

increased with increasing family members affected. Men with one, two or three

family members affected had an increased risk of two, five or eleven fold

respectively (Steinberg et al, 1990).

Certain genetic alterations have also been implicated in the risk of developing

prostate cancer. Molecular studies show that at the time of diagnosis prostate cancer

is a genetically heterogeneous disease involving a number of genetic abnormalities

including chromosomal deletions at 6q, 8p, 13q and 16q and insertions in 7q, 8q and

Xq (Strohmeyer et al, 2004). Genome wide association studies have identified

numerous susceptibility loci and studies to link candidate genes to these loci are

being conducted. Possible candidate genes include ELAC2, 2’-5’-oligoadenylate-

dependent ribonuclease L (RNAseL), macrophage scavenger receptor-1 (MSR1)

(Simard et al, 2002), kallikrein 2 and kallikrein 3 (Guy et al, 2009).

Recent studies have reported over-representation of 8q24 to be associated with

prostate cancer progression where the oncogene c-myc is the likely target (Tsuchiya

et al, 2002), whilst deletions at 13q14 are suggested to be associated with

angiogenesis in prostate cancer (Strohmeyer et al, 2004). A number of epigenetic

alterations such as methylation of the retinoic acid receptor β2 gene, a known tumour

suppressor gene, have also been observed (Jeronimo et al, 2004). Mutations to the

well-known tumour suppressor gene, BRCA2, have also been identified in prostate

cancer (Strohmeyer et al, 2004). The Breast Cancer Linkage Consortium estimated


6

that the relative risk of developing prostate cancer among BRCA2 carriers was

increased by 4.65-fold (1999).

1.5Biologyoftumourprogression

Cancer is a somatic genetic disease that occurs as a result of dysregulation of normal

cellular function including changes in control of cell growth, division and apoptosis

(Forbes et al, 2008; Greenman et al, 2007). Genes controlling these processes often

exhibit genetic changes including mutation, deletion or amplification (Futreal et al,

2004; Hanahan & Weinberg, 2000). In particular, oncogenes are subject to changes

that increase their expression by gene amplification, chromosomal translocation or

mutation, which results in either gain of function of the resulting gene product or

changes of transcriptional regulation of the gene which causes altered expression

(Beroukhim et al, 2010; Gazdar, 1992; Hanahan & Weinberg, 2000). Tumour

suppressor genes are subject to whole or partial gene deletion or gene mutations that

result in loss of function (Gao & Honn, 1995). Loss of expression due to epigenetic

silencing is increasingly recognised as another mechanism of suppressor gene

inactivation (Merlo et al, 1995).

There are many processes involved in the formation, progression and spread of

prostate cancer including changes in cell proliferation, adhesion and movement, loss

of susceptibility to apoptosis, cell invasion and angiogenesis.

1.5.1Cellproliferationandapoptosis

The normal prostate maintains a balance between cell proliferation and cell death

through the regulatory effects of androgenic hormones. Proliferation is dependent on

the presence of androgen and when cells are deprived of this stimulus they undergo

apoptosis (Denmeade et al, 1996). However, in advanced prostate cancer, following

androgen deprivation therapy, cells are able to overcome this restraint and grow in an

apparent androgen independent manner (Agoulnik & Weigel, 2006). This is known

as castrate resistant prostate cancer. Potential mechanisms involved in the transition


7

from androgen dependent to castrate resistant prostate cancer include mutations to

the androgen receptor and dysregulation to apoptotic genes. Interestingly, a recent

study demonstrated the ability of prostate tumours to synthesise androgens

suggesting that de novo androgen synthesis may play an important role in the

progression to castrate resistant disease (Locke et al, 2008). Studies are now also

focusing on the possibility that mutations in a putative prostatic epithelial stem cell

as well as deregulation to signalling pathways involved in cell proliferation play a

key role in androgen independent prostate cancer. Thus the following changes may

contribute to prostate carcinogenesis.

1.5.1.1Androgenreceptormutations

The androgen receptor (AR) is a member of the nuclear hormone receptor

superfamily (Agoulnik & Weigel, 2006). It consists of a central DNA binding

domain connected to a C-terminal ligand binding domain via a hinge region. Upon

androgen binding the receptor complex dimerises, translocates into the nucleus and

binds to specific DNA sequences called androgen response elements that regulate

(activation or suppression) genes involved in cell proliferation and apoptosis

(Agoulnik & Weigel, 2006; Gelmann, 2002). Many studies have found mutations in

the androgen receptor in prostate cancer samples (Gottlieb et al, 2004). These

mutations occur at a higher incidence in hormone refractory disease (Agoulnik &

Weigel, 2006). Mutations that occur in the ligand binding domain may allow the

androgen receptor to be activated by non androgen ligands. This was first discovered

in LNCaP cells where a missense mutation in the ligand binding domain allowed

other steroid hormones (progesterone) and anti-androgens (hydroxyflutamide) to

activate the androgen receptor (Veldscholte et al, 1990).

1.5.1.2Dysregulatedanti‐apoptoticgenes

Up-regulation of anti-apoptotic genes may also play a role in cell survival in

androgen-deprived environments. Members of the Bcl-2 family are key regulators of

apoptosis. They are divided into two groups, anti-apoptotic and pro-apoptotic. Bcl-2


8

is an anti-apoptotic protein expressed exclusively in basal cells in the normal prostate

(Hockenbery et al, 1991). Several studies have demonstrated over expression of Bcl-

2 in prostate adenocarcinomas. There is increasing evidence to suggest that Bcl-2

expression may be associated with prostate cancer progression (Krajewska et al,

1996). McDonnell et al reported a higher incidence of Bcl-2 expression in androgen

independent cancers as opposed to androgen dependent cancers (McDonnell et al,

1992). Interestingly, androgen dependent LNCaP cells transfected with Bcl-2 showed

resistance to apoptotic stimuli and were able to form androgen independent tumours

in mice (Raffo et al, 1995).

1.5.1.3Stemcellmutations

There is increasing evidence to support a prostate stem cell population. Prostate stem

cells are thought to reside in the basal layer (Lawson et al, 2010; Robinson et al,

1998). Secretory cells are androgen dependent while basal and neuroendocrine cells

are androgen independent (Abate-Shen & Shen, 2000). Previous studies in rats have

demonstrated that as a result of castration the luminal secretory cells undergo

apoptosis while basal cells remain relatively unaffected. When the remaining basal

cells are exposed to androgen they are able to produce secretory luminal cells

regenerating the prostate to its original size (English et al, 1987; Evans & Chandler,

1987; Isaacs & Coffey, 1981; Verhagen et al, 1988). Mutations to these cells may

lead to an androgen independent progeny (Hudson, 2004).

1.5.1.4AlteredexpressionofSrcfamilykinases

There is emerging evidence that Src activity may be involved in hormone resistant

growth (Lee et al, 2004; Unni et al, 2004). Src family kinases are a group of non-

receptor tyrosine kinases involved in the regulation of cell shape, growth and

migration. There are nine family members in vertebrates and these include Src, Fyn,

Lyn, Lck, Hck, Yes, Fgr, Blk and Yrk (Yeatman, 2004). Src was the first member

identified and its role in cancer has been studied extensively. Activated Src was

increased in hormone resistant tumours compared to matched tumours taken prior to


9

hormone deprivation therapy (Tatarov et al, 2009). Furthermore, patients with

increased activated Src had a poorer overall survival. A number of Src inhibitors

have been developed as therapeutic agents and are currently in various stages of

clinical trials (Johnson et al, 2010; Lara et al, 2009). Dasatinib, a multi target kinase

inhibitor that targets Src, was originally approved for use in the treatment of chronic

myelogenous leukaemia (CML) and is now being tested in clinical trials for prostate

cancer (Brave et al, 2008; Edwards, 2010; Talpaz et al, 2006). Other members of the

Src family have also been implicated in prostate cancer. A previous study reported

amplification of Fgr in hormone resistant tumours compared to matched pre-

hormone resistant tumours (Edwards et al, 2003) while Lyn derived peptides

decreased tumour volume in the androgen resistant DU145 mouse xenograft model

(Goldenberg-Furmanov et al, 2004). Understanding the signalling pathways involved

in the development of hormone resistant prostate cancer may lead to new beneficial

targeted therapies.

1.5.2Celladhesion

Formation of a three dimensional tumour mass, as opposed to a two dimensional

epithelial surface, and spread of the tumour to a secondary site are complex

processes involving altered cell-cell adhesion. During the metastatic stage of tumour

progression, loss of adhesion allows individual tumour cells to move away from the

primary tumour, to enter the blood or lymph and to eventually lodge in the

microvasculature at a distant site, transmigrate through the endothelium and establish

a secondary tumour mass.

1.5.2.1Cadherins/catenins

One group of cell adhesion molecules that have been shown to play a part in prostate

cancer progression are the cadherins. Cadherins are a group of calcium dependent

glycoproteins involved in cell-to-cell adhesion (Umbas et al, 1992). They consist of

an extracellular domain with five cadherin repeats, a transmembrane domain and an

intracellular domain. The intracellular domain interacts with a group of cytoplasmic


10

proteins, the catenins, which anchor the cadherin to the actin filaments of the

cytoskeleton. There are three types of catenins , and (Morton et al, 1995). The

cadherin/catenin complex is fundamental to the normal structure of many epithelial

tissues. Inactivation of this complex in cancers facilitates early invasion into

surrounding tissues resulting in local invasion and metastases. Altered levels of

expression of cadherin or catenin proteins have been found in numerous cancers. E-

cadherin function appears to be lost in most human epithelial cancers and decreased

expression was shown to correlate with prostate tumour progression (Umbas et al,

1992). Previous immunohistochemical studies report aberrant/decreased E-cadherin

in prostate carcinoma tissues with high Gleason score (Contreras et al, 2010; Musial

et al, 2007). Furthermore, aberrant E-cadherin expression was associated with poorer

survival (van Oort et al, 2007). Aberrant expression of the three types of catenins has

also been correlated with high Gleason score (Morita et al, 1999).

1.5.2.2Integrins

Another important group of proteins involved in cell adhesion is the Integrin family.

Integrins are heterodimeric cell surface receptors, comprised of an alpha and a beta

chain, that mediate the attachment of epithelial cells to the basement membrane

(Hynes, 1987). In the normal prostate, basal cells express alpha 2, 3, 4, 5, 6 and v and

beta 1 and 4 (Cress et al, 1995). The basal cells adhere to the major components of

the basement membrane, collagen (IV, VII) and laminin (5, 10/11), through

interaction with integrins 21, 64, and 31. In invasive prostate cancer

expression of the integrin subunits tends to be either decreased or lost (Cress et al,

1995). Numerous immunohistochemical studies also reveal a decrease or loss in

expression of integrin subunits in prostate cancer as reviewed by Goel et al (Goel et

al, 2008). However, some subunits including β1 are up-regulated in prostate

carcinoma samples (Murant et al, 1997) and display an altered distribution compared

to normal cells (Knox et al, 1994). Interestingly, expression of the β1 splice variant,

β1A, was shown to be required for prostate cancer cell anchorage independent

growth (Goel et al, 2005).


11

1.5.2.3Focaladhesionkinase

Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that localises to sites

of focal adhesion (Schaller et al, 1992). FAK is a key mediator of integrin signalling

and therefore is important in cell adhesion and migration. Activated integrins have no

intrinsic enzymatic activity and therefore rely on recruitment of adaptor proteins such

as FAK and Src. FAK becomes phosphorylated at Tyr 397 upon association with the

cytoplasmic tail of activated integrin and this provides a docking site for Src (Calalb

et al, 1995). Src then phosphorylates multiple sites on FAK including Tyr 407, 576,

577 and 861 that lead to increased FAK activity (Calalb et al, 1995; Calalb et al,

1996). Studies investigating expression of FAK in prostate carcinoma are not

consistent, with one study reporting increased expression in metastatic compared to

localised prostate carcinoma samples (Tremblay et al, 1996) while another reports

similar expression levels for both (Rovin et al, 2002). In vivo studies, using the

transgenic adenocarcinoma of mouse prostate (TRAMP) model in which FAK was

inhibited, showed FAK expression was important in the progression to androgen

independent carcinoma (Slack-Davis et al, 2009).

Increasing evidence suggests a potential role for FAK in prostate cancer adhesion

and growth. Dephosphorylation of FAK suppresses adhesion of prostate cancer cells

to ECM components (Lu et al, 2001b; Miao et al, 2000). Furthermore, over

expression of FAK in PC-3 cells led to an increase in soft agar colony formation

while knockdown of FAK using small interfering RNA (siRNA) decreased soft agar

colony formation (Johnson et al, 2008).

1.5.3Cellmovement

Migration of cells through the extracellular matrix is an important step of metastasis.

This involves changes in cell adhesion, cell motility and the elaboration of cellular

proteases that allow movement through the extracellular matrix and cell junctions.

Many factors have been shown to affect cell migration in prostate cancer including

growth factors, hormones, proteases, membrane receptors and signalling proteins

(Frankenberry et al, 2004; Gao et al, 2010; Zhong et al, 2010). The receptor tyrosine


12

kinase, c-Met, is over-expressed in prostate cancer (Wells et al, 2005). Activation of

the receptor by its ligand, hepatocyte growth factor (HGF) leads to activation of

downstream signalling pathways involved in cell migration. A study by Wells et al

found members of the Rho family were activated in HGF stimulated prostate cells

(Wells et al, 2005). The Rho family is a group of small GTPases that act as

molecular switches by promoting the exchange of GDP with GTP (Poliakov et al,

2004). They play a key role in reorganisation of the actin cytoskeleton, an important

part of cell migration. Family members include RhoA, Cdc42 and Rac1. RhoA is

involved in the redistribution of actin stress fibers while Cdc42 and Rac1 control the

formation of filopodia and lamellipodia respectively (Nobes & Hall, 1995; Poliakov

et al, 2004). DU145 cells stimulated with HGF showed an increase in activity of all

three family members (Wells et al, 2005).

1.5.4Theroleofproteasesincellinvasion

Degradation of the extracellular matrix is an important step in tumour cell migration

into the surrounding tissue. The matrix metalloproteinases (MMP) are a group of

enzymes belonging to the metzincin superfamily that are able to degrade

extracellular matrix components such as collagen IV, laminin, fibronectin and

vitronectin (Ross et al, 2003). MMPs are produced as zymogens and require

cleavage of the pro-domain for activation. They play a role in normal physiological

processes such as tissue repair and angiogenesis (Armstrong & Jude, 2002; Collen et

al, 2003). Several studies have reported increased expression of certain MMPs, in

particular MMP-2, in prostate cancer and that their increased expression may be

associated with malignant progression (Ross et al, 2003). Interestingly Stearns et al

reported increased expression of activated MMP-2 associated with prostate cancer

progression and lymph node metastasis (Stearns & Stearns, 1996).

Another member of the metzincin superfamily thought to play a role in cell invasion

is ADAM 10. The ADAMs (a disintegrin and metalloprotease) are a group of

multifunctional transmembrane proteins implicated in cell-to-cell and cell-to-matrix

interactions. They consist of an extracellular domain containing an N-terminal

metalloprotease, followed by a disintegrin, a cysteine rich region, an epidermal


13

growth factor (EGF)-like domain, a transmembrane and a cytoplasmic domain (Wu

et al, 1997). ADAM 10 has been shown to have a substrate specificity overlap with

the matrix metalloproteinases allowing it to cleave collagen IV (Millichip et al,

1998). Expression of ADAMs 9, 10, 11, 15 and 17 have previously been detected in

prostate cancer cell lines (McCulloch et al, 2000). ADAM 10 expression in benign

glands is localised to the membrane while prostate cancer samples show nuclear

localisation (McCulloch et al, 2004). Furthermore, nuclear staining intensity

correlated with Gleason score (Arima et al, 2007).

1.5.5Migrationtodistantsites

Following invasion through the extracellular matrix, cells enter the circulation and

travel to distant sites. The cells lodge in the microvasculature at these sites by

adhering to the blood vessel wall and subsequently penetrate the endothelial barrier

and invade into the extracellular matrix. In advanced prostate cancer approximately

90% of patients will develop metastases in the bone (Bubendorf et al, 2000). Many

studies are focusing on this area to determine why prostate cancer cells preferentially

metastasise to bone.

1.5.6Angiogenesis

A critical aspect of tumour biology is the formation of tumour vasculature. Thus,

angiogenesis, the process of new blood vessel formation by capillary sprouting from

pre-existing vessels, plays a key role in the formation of both primary and metastatic

tumours (van Moorselaar & Voest, 2002). Angiogenesis plays an important role in

normal physiological processes such as vascular remodelling during embryogenesis,

homeostasis in the female reproductive tract, tissue maintenance and wound healing

(van Moorselaar & Voest, 2002). This process is highly regulated by receptor

tyrosine kinases including vascular endothelial growth factor (VEGF) receptor and

Eph receptor tyrosine kinases (Brantley-Sieders & Chen, 2004; Brantley et al, 2002;

Cheng et al, 2002). Recent studies have suggested a role for the largest family of


14

receptor tyrosine kinases (RTK), Eph receptors and their ligands, ephrins, in prostate

cancer progression.

1.6Receptortyrosinekinases

Receptor tyrosine kinases (RTKs) are a group of transmembrane receptors that

mediate a number of physiological processes. They are made up of an extracellular

region that contains the specific ligand binding domain, a transmembrane domain

and an intracellular region that contains the defining tyrosine kinase catalytic

domain. Ligand binding results in autophosphorylation of tyrosine residues located in

the intracellular catalytic domain (Hubbard, 1999). To date there are 58 receptor

tyrosine kinases with some of the most well known being EGF, Eph, PDGF, and

VEGF. They are divided into 20 subfamilies defined principally by the possession of

a particular ligand binding specificity (structurally and functionally) (Robinson et al,

2000). The Eph family is the largest subfamily of receptor tyrosine kinases, the

extracellular domains showing a highly conserved pattern of protein domains (Tuzi

& Gullick, 1994).

1.7Ephreceptortyrosinekinasefamily–generaloverview

The first Eph receptor was cloned from a human erythropoietin-producing

hepatocellular carcinoma cell line (Hirai et al, 1987). Subsequently, the other Eph

receptors were isolated from various cDNA libraries (Cerretti & Nelson, 1998) and

cell lines (Bennett et al, 1995). In vertebrates the fourteen Eph receptors (EphA1-8,

10 and EphB1-4, 6) interact with nine ephrin ligands (ephrin-A1-6 and ephrin-B1-3).

The Eph receptors are divided into two distinct groups, A and B, based on sequence

homology and their binding affinities to A or B class ephrin ligands (Brantley-

Sieders & Chen, 2004; Pasquale, 2005). Generally, EphA receptors interact with the

glycophosphatidylinositol (GPI) linked ephrin-A ligands, while the EphB receptors

interact with the transmembrane linked ephrin-B ligands. However, it has been

shown that Eph and ephrin interaction occurs with some degree of promiscuity, with


15

some Ephs being able to bind to ligands of the other class (Brantley-Sieders & Chen,

2004; Himanen et al, 2004). An example is the ability of EphA4 to bind to both

ephrin-A and ephrin-B ligands (Pasquale, 2004). The promiscuity of Eph-ephrin

interaction provides a molecular basis for partial functional redundancy. For

example, individual EphB2 and EphB3 knockout mice show reduced errors in retinal

ganglion cell axon path finding (mild phenotype) compared to double knockout mice

(severe phenotype) (Birgbauer et al, 2000).

1.8Eph‐ephrinsignalling

Eph-ephrin interaction initiates unique bi-directional signalling. Forward signalling is

signalling initiated from the Eph receptor while reverse signalling is initiated from

the ephrin ligand (Himanen et al, 2004; Pasquale, 2005).

1.8.1Forwardsignalling

Activation of the Eph receptor occurs when the receptor on one cell is bound to the

membrane-anchored ephrin ligand of an opposing cell (i.e. in trans). In some cases

where single cells express both receptor and ligand, Eph-ephrin interaction

potentially could occur within the same cell (i.e. in cis). However, this type of

interaction does not reportedly result in activation of the Eph receptor (Carvalho et

al, 2006; Yin et al, 2004). This may reflect the dependence for Eph receptor

activation on binding to membrane-bound or clustered ligand (Davis et al, 1994)

which is sterically unlikely in cis interaction. In this regard, crystal structure studies

revealed that binding of the ligand induces receptor dimerisation, resulting in a

circular tetrameric complex arranged so that each receptor interacts with two ligands

(Himanen et al, 2001). Furthermore, interactions between neighbouring receptors

results in higher order signalling clusters (Himanen et al, 2010). The two receptors in

the tetrameric complex are able to transphosphorylate several tyrosine residues

located in their juxtamembrane and kinase domains which provide docking sites for

downstream signalling molecules (Cheng et al, 2002; Himanen et al, 2001; Wimmer-

Kleikamp et al, 2004).


16

ephrin-B

ligand

PDZ-binding motif

Cell membrane

ephrin-A

ligand

GPI-anchor

Ephrin-binding domain

Fibronectin-type III repeats

Juxtamembrane region

Kinase domain

SAM domain

PDZ-binding motif

Cysteine rich region

Eph

receptor

P

P

P

P

Cell membrane

P

Figure 1.1: Structure of Eph receptors and ephrin ligands

The Eph receptors contain an extracellular ligand binding domain followed by a

cysteine rich region, two fibronectin type III repeats and a transmembrane region.

The intracellular signalling portion includes a juxtamembrane region followed by a

kinase, SAM and PDZ-binding domain. The Eph receptors interact with the

glycophosphatidylinositol anchored ephrin-A ligands and the transmembrane bound

ephrin-B ligands. Image adapted from (McCarron et al, 2010).


17

1.8.2Reversesignalling

Due to the difference in structure between group A and B ligands initiation of

signalling events occurs via different mechanisms (Gauthier & Robbins, 2003).

Signalling via the GPI anchored ephrin-A ligands is complex and there is still much

to learn about the processes involved. Upon binding of the Eph receptor, ephrin-A

ligands recruit adaptor proteins, such as Src family kinases, into lipid-rich

microdomains. Ephrin-A5 has been reported to be localised to “caveolae-like”

microdomains and upon binding of its receptor induces compartmentalised signalling

(Davy et al, 1999). The transmembrane bound ephrin-B ligands have a cytoplasmic

domain that contains five tyrosine residues that become phosphorylated upon Eph

receptor binding resulting in recruitment of Src (Bruckner et al, 1997; Holland et al,

1996; Palmer et al, 2002). The phosphorylated ephrin-B ligand provides docking

sites for adaptor proteins containing Src homology 2 (SH2) domains (Cowan &

Henkemeyer, 2001). Alternatively, ephrin-B ligands have been reported to signal via

their C-terminal PDZ-binding motif by interacting with proteins, such as PDZ RGS3,

that contain a PDZ domain (Lin et al, 1999; Lu et al, 2001a).

1.8.3Kinaseindependentsignalling

Two members of the Eph receptor tyrosine kinase family, EphB6 and EphA10, are

thought to have non-functional kinase domains (Aasheim et al, 2005; Gurniak &

Berg, 1996; Pasquale, 2005). A study by Matsuoka et al identified several

alterations in the kinase domain of EphB6 (Matsuoka et al, 1997). However, EphB6

has been shown to mediate forward signalling by cross talk with other Eph receptors.

Stimulation with ephrin-B1 resulted in phosphorylation of EphB6 induced by cross

talk with EphB1 (Freywald et al, 2002). Several studies have demonstrated a role for

kinase independent signalling in cell migration using Eph kinase deficient mutants

(Miao et al, 2005; Taddei et al, 2009). Alternatively, expression of EphA7 splice

variants that lack kinase domains, turn the response of EphA7-ephrin-A5 interaction

from repulsion to adhesion (Holmberg et al, 2000). Furthermore, individual Eph

receptors with functional kinase domains, including EphA2 and EphA4, have been

reported to have kinase independent function (Kullander et al, 2001b; Taddei et al,


18

2009). Thus, while evidence suggests a role for kinase independent signalling the

underlying mechanisms are not yet understood.

1.8.4Celladhesionversusrepulsion

Eph receptors and their ephrin ligands are membrane bound and require an initial cell

to cell contact for binding to occur. The resulting high affinity Eph-ephrin interaction

acts as a molecular tether between opposing cells (Janes et al, 2005). Depending on

the level of Eph/ephrin expression, signalling pathways involved downstream of this

interaction and cross-talk with other signalling pathways, the overall cellular

response can be either cell adhesion or cell repulsion (Arvanitis & Davy, 2008;

Halloran & Wolman, 2006). Cell adhesion occurs when signals favour focal adhesion

and cell attachment while cell repulsion occurs when bi-directional signals trigger

cytoskeletal collapse, loss of cell adhesion and altered cell motility (Carter et al,

2002; Lawrenson et al, 2002). In order for cell repulsion to occur the high affinity

Eph-ephrin interaction needs to be broken. Previous studies have shown that ephrin-

A ligands have the ability to form a stable complex with ADAM proteases that

become activated upon EphA-ephrin-A signalling. This results in cleavage of the

ephrin and termination of signalling leading to loss of cell adhesion (Hattori et al,

2000; Janes et al, 2005). Termination of EphB/ephrin-B signalling occurs via

transendocytosis of the receptor-ligand complex (Zimmer et al, 2003). The cellular

adhesive and repulsive responses mediated by Eph-ephrin signalling are critical in

the regulation of developmental patterning processes that will be discussed in more

detail in section 1.9.

1.8.5Eph‐ephrindownstreamsignalling

A number of downstream signalling pathways have been linked to Eph-ephrin

signalling including the PI3K-Akt pathway, Rho and integrin signalling. These

pathways are involved in the regulation of cell shape, adhesion, movement and

proliferation.


19

1.8.5.1Rhofamily

Of particular importance in Eph regulation of cell shape and movement is the Rho

family. Eph receptor signalling activates RhoA, resulting in cytoskeletal contraction,

and down regulation of Rac1/Cdc42 (Noren & Pasquale, 2004). This results in a loss

of lamellipodia and filopodia with cytoskeletal collapse. A reverse pattern of Rho

activation positively regulates cell-cell adhesion (Holmberg et al, 2000); through a

mechanism that involves increasing integrin substrate binding affinity, cadherins and

other cell membrane receptors (Davy & Robbins, 2000).

1.8.5.2Ena/VASP

An independent pathway has been shown to mediate Eph regulation of cell shape and

movement. The Ena/VASP proteins are responsible for regulating cell motility

through organisation of the actin cytoskeleton. There are three, highly related, family

members in vertebrates (Evl, Mena and Vasp) all consisting of an N-terminal Ena-

VASP-homology-1 (EVH1) domain, a proline rich domain and a C-terminal EVH2

domain. These proteins localise at the leading edge of cell processes, focal adhesions

and sites of cell-cell contact (Lebrand et al, 2004). Eph-ephrin interaction occurs at

sites of cell-cell contact and a recent study by Evans et al showed that Ena/Vasp

proteins localise at sites of Eph activation (Evans et al, 2007). Ena/VASP proteins

mediate cytoskeletal collapse following Eph-ephrin signalling resulting in receptor

internalisation and proteolytic cleavage of the ephrin (Evans et al, 2007; Lebrand et

al, 2004).

1.8.5.3PI3Kpathway

Phosphatidyl inositol 3-kinases (PI3K) are a family of lipid kinases involved in cell

proliferation, growth and survival. They are divided into three classes (I, II and III)

based on sequence homology and substrate specificity (Domin & Waterfield, 1997).

Class I PI3Ks are able to convert phosphatidylinositol-4-5-bisphosphate (PIP2) to

phosphatidylinositol-3-4-5 trisphosphate (PIP3) at the cell membrane. PIP3 acts as a

docking site for proteins containing a pleckstrin homology domain such as the

serine/threonine kinases Akt (also known as protein kinase B, PKB) and


20

phosphoinositide-dependent kinase 1 (PDK1) (Alessi & Cohen, 1998; Rameh &

Cantley, 1999). Akt is phosphorylated at threonine 308 by PDK1 (Walker et al,

1998). Full activation of Akt requires phosphorylation at a second site, serine 473.

Activated Akt in turn phosphorylates multiple substrates including GTPases and

mammalian target of rapamycin (mTOR) (Manning & Cantley, 2007). The tyrosine

phosphatase, PTEN, negatively regulates the PI3K pathway by dephosphorylating

PIP3 resulting in its conversion back to PIP2 (Maehama & Dixon, 1998). Several

studies have linked Eph/ephrin expression and signalling to the PI3K/Akt pathway.

Activation of EphB4 in breast cancer (Kumar et al, 2006) and microvascular

endothelial cells (Steinle et al, 2002) resulted in an increase in Akt phosphorylation

while knockdown of EphB4 expression in a mesothelioma cell line reduced Akt

phosphorylation (Xia et al, 2005a). Alternatively, reverse signalling, by ephrin-B2, in

retinal endothelial cells has been shown to increase Akt phosphorylation (Steinle et

al, 2003). EphA2 regulation of endothelial cell migration was reported to be

mediated through PI3K activation of Rac1 (Brantley-Sieders et al, 2004) and

increased endothelial cell proliferation, from activation of EphB4, was blocked by a

PI3K inhibitor (Steinle et al, 2002). These results suggest Eph/ephrin signalling

targets the PI3K/Akt pathway affecting cell migration.

1.8.5.4Integrins

Eph-ephrin signalling has been shown to affect integrin mediated cell adhesion and

migration. Previous studies have reported activation of Eph receptors to cause

changes in cell morphology resulting in cell rounding and detachment (Lawrenson et

al, 2002; Miao et al, 2000). Activation of EphA2 in the prostate cancer cell line, PC-

3, was associated with an inactive conformational change in integrin β1 that led to a

decrease in cell adhesion to fibronectin and laminin (Miao et al, 2000). Similarly,

activation of EphB2 resulted in reduced cellular adhesion to extracellular matrix

components through R-Ras activity (Nakada et al, 2004; Nakada et al, 2005; Zou et

al, 1999). Reverse signalling by ephrin ligands has also been shown to affect integrin

mediated cell adhesion with activation of ephrin-A2 and ephrin-A5 causing increased

adhesion to laminin and fibronectin respectively (Davy & Robbins, 2000; Huai &


21

Drescher, 2001). Increasing evidence suggests Eph-ephrin signalling can both

enhance and suppress integrin mediated attachment to the extracellular matrix.

1.9BiologicalfunctionsofEphsandephrins

Regulatory effects of bi-directional signalling by Eph receptors and their ephrin

ligands has been shown to be important in many of the biological processes involved

in embryogenesis, including axon guidance, vascular development and tissue

boundary formation (Cheng et al, 2002; Pasquale, 2005; Poliakov et al, 2004). Many

of the studies involving the functional roles of these proteins have focused largely on

critical embryological processes.

1.9.1Earlyembryogenesis

EphA1 and EphA2 are expressed in embryonic stem cells (Lickliter et al, 1996) and

have potential roles in the earliest stages of differentiation. It has subsequently been

shown that EphA1 is expressed in the primitive streak of E6 embryos and has a

presumptive role in tail bud development (Duffy et al, 2006). Consistent with highly

conserved expression patterns during embryogenesis, Ephs and ephrins direct

patterning events underlying neural crest migration. Eph-ephrin signalling results in

neural tube closure through adhesive mechanisms. EphA7 and its ligand ephrin-A5

are co-expressed in the lateral edges of the neural plate (Holmberg et al, 2000).

Alternative splice variants of the EphA7 receptor turn signalling from repulsion to

adhesion resulting in fusion of the neural plate to form the neural tube (Holmberg et

al, 2000). Consistent with these observations, ephrin-A5 knockout mice display

neural tube closure defects (Greene & Copp, 2005).

1.9.2Circulatorysystemdevelopment

The Eph family also play a major role in vascular development by establishing the

arterial-venous boundary. EphB4 is expressed on venous cells while its ligand

ephrin-B2 is expressed on arterial cells (Wang et al, 1998). Recently, EphA3 has


22

been shown to play a critical role in the development of the heart. Approximately

75% of EphA3 knockout mice developed by Stephen et al died due to developmental

defects in the atrioventricular valves and atrial septum (Stephen et al, 2007).

1.9.3Centralnervoussystemdevelopment

EphA4 expression has been documented in neurons of the developing corticospinal

tract, where repulsive signals from ephrin-B3 prevent axons from re-crossing the

midline. In EphA4 knockout mice axons are able to re-cross the midline resulting in

an abnormal, kangaroo-like hopping gait (Coonan et al, 2001; Dottori et al, 1998;

Kullander et al, 2001a).

When compared with embryogenesis Eph and ephrin proteins are expressed at much

lower levels in “adult” tissues (post-embryogenesis). However, low level expression

may continue to play a role in tissue architecture, as has been demonstrated in the

kidney (Ogawa et al, 2006) and in the adult gut (Batlle et al, 2002). Eph and ephrin

re-expression has been shown to occur in normal adult cells after spinal cord injury

(Miranda et al, 1999) and during neo-vascularisation (van Moorselaar & Voest,

2002). Re-expression at levels comparable to those seen in development has been

observed following tissue injury and in numerous cancers (Pasquale, 2008).

1.10Ephsandephrinsincancer

The Eph receptor tyrosine kinase family has been implicated in many human

malignancies including various carcinomas, melanoma and brain tumours (Alam et

al, 2009; Herath et al, 2006; Kinch & Carles-Kinch, 2003; Pasquale, 2008; Wykosky

et al, 2005). Their role in cancer is not yet understood as some tumours present with

elevated levels of expression while others show a decrease in expression. In this

context it is notable that interactions between Eph and ephrin families can mediate

both pro-adhesive and anti-adhesive signals in tumour cells and also play a critical

role in tumour angiogenesis suggesting that in individual cases, Eph-ephrin

signalling may have very different, even diametrically opposite effects in cancer. The

differing levels of expression of Ephs and ephrins may also be explained by

differences in tumour grade, stage or differentiation. In ovarian carcinoma high


23

ephrin-A1 and ephrin-B expression correlated with decreased patient survival and

tumour differentiation respectively (Castellvi et al, 2006; Herath et al, 2006), while

low levels of EphB4 in breast cancer correlated with tumour grade (Berclaz et al,

2002). Expression has also been shown to predict metastasis. In non-small cell lung

cancer low levels of EphA2 expression were associated with prolonged disease free

survival while high levels were associated with brain metastasis (Kinch et al, 2003).

Previous studies have suggested a role for Eph receptors and their ephrin ligands in

tumour formation and progression. For example, high levels of EphA2 have been

shown to be associated with malignant transformation in breast epithelial cells, while

ligand binding to EphA2 is able to reverse this phenotype (Zelinski et al, 2001). Eph-

ephrin signalling also results in a number of effects on cell adhesion and movement

(Clifford et al, 2008; Miao et al, 2009; Miao et al, 2005). For example, activation of

EphB in colorectal carcinoma cells and activation of EphA3 in rhabdomyosarcoma

cells inhibited cell migration and integrin-mediated adhesion (Clifford et al, 2008;

Meyer et al, 2005) while activation of EphB4 in melanoma cells resulted in an

increase in cell migration (Yang et al, 2006). Along with other RTKs, the Eph family

has been suggested as a potential target for anti-tumour therapy. The potential of

Ephs and ephrins as targets for cancer therapy has previously been demonstrated.

Inhibition of signalling using soluble EphA2 or EphA3 Fc-fusion proteins has been

shown to block neo-angiogenesis and tumour progression (Brantley et al, 2002).

1.11Ephsandephrinsinprostatecancer

Although many studies have demonstrated involvement of the Eph family in the

development and progression of cancer, the number of studies focusing on the role of

Eph and ephrins in prostate cancer is limited. A study by Fox et al determined

expression of the entire Eph family using semi-quantitative RT-PCR in a series of six

prostate cancer cell lines (Fox et al, 2006). Included in the series of cell lines was

NPTX, derived from normal prostate epithelia and CTPX, derived from prostate

carcinoma. Both cell lines originated from the same patient, therefore, differences in

gene expression between these cell lines could be a useful indicator of

tumourigenicity. Their results showed an increase in expression of the receptors

EphA2, A5, A6 and A10 and a decrease in expression of EphA1 and EphB2 between


24

the normal and tumour cell lines. Major limitations of the Fox study include the use

of a semi-quantitative method, small numbers of cell lines and the absence of tumour

tissues. However, it does provide information suggesting that Eph genes may have a

role in prostate cancer.

Over expression of the EphA2 receptor has also been reported by other studies.

Walker-Daniels et al used Western blot analysis and immunohistochemical staining

to determine EphA2 expression in cell lines and tissue respectively (Walker-Daniels

et al, 1999). Although this study has used a combination of cell lines and tissue

samples the numbers for both were small with six benign prostate and 15 prostate

carcinomas samples screened. The study is also limited by the use of Western blot

analysis only being used for cell line expression and staining for human tissue. An

immunohistochemical study of EphA2 using a large cohort of radical prostatectomy

samples (n=93), reported significant up regulation of EphA2 in high grade PIN and

adenocarcinoma samples compared to paired benign epithelium (Zeng et al, 2003).

This suggests that EphA2 may be associated with prostate cancer progression.

Whilst a number of studies report over expression of the EphA2 receptor in prostate

cancer its role in this disease is far from clear. Only recently have studies begun to

examine its functional role and downstream signalling targets with a focus on ligand

dependent versus independent signalling. Ligand dependent activation of EphA2 has

been reported to inhibit the Ras/MAPK (Miao et al, 2001) and Akt-mTOR (Yang et

al, 2011) pathways in prostate cancer. In this context it is noteworthy that both

pathways affect cell proliferation. As a result PC-3 cells showed reduced growth in

MTT and soft agar colony formation assays when stimulated with ephrin-A1 (Yang

et al, 2011).

FAK has also been identified as a downstream target of EphA2 signalling however

results are contradictory with one study reporting an increase (Parri et al, 2007) and

the other a decrease (Miao et al, 2000) in FAK phosphorylation in PC-3 cells

stimulated with ephrin-A1.

EphA2 has also been implicated in prostate cancer cell motility. PC-3M cells

transfected with EphA2 short hairpin RNA (shRNA) showed a reduction in cell

migration while cells over expressing EphA2 showed an increase in cell migration


25

(Miao et al, 2009). In a study using EphA2 kinase deficient mutants it was reported

that both kinase dependent and kinase independent pathways are involved in PC-3

cell migration (Taddei et al, 2009).

Since EphA2 over expression is also evident in other malignancies such as

melanoma, colon, lung, oesophageal and breast cancer (Pratt & Kinch, 2003;

Wykosky & Debinski, 2008) potential therapies targeting the EphA2 receptor are

currently being investigated. Recently an EphA2/CD3-bispecific single-chain

antibody was developed that stimulates T cells to selectively target and lyse EphA2

expressing cells (Hammond et al, 2007). Antibodies targeting other Eph receptor

tyrosine kinases in tumours are also being developed.

Another Eph receptor that showed varied expression between the NPTX and CTPX

cell lines was EphA3 (Fox et al, 2006). EphA3 expression was shown to be down

regulated by methylation in the prostate cancer cell line, CPTX. Cells treated with a

de-methylating agent showed re-expression of EphA3 compared to mock-treated

cells (Fox et al, 2006). Similarly EphA7 was re-expressed in DU145 cells treated

with a de-methylating agent (Guan et al, 2009). Furthermore methylation of EphA7

was identified in 20 of 48 prostate carcinomas and positively correlated with Gleason

score (Guan et al, 2009). DU145 cells transfected with EphA7 showed reduced

anchorage independent growth in soft agar. These studies suggest that epigenetic

silencing of Eph receptors may contribute to prostate cancer progression in some

cases.

There is increasing evidence that members of the Eph receptor tyrosine kinase family

display tumour suppressor activity. Huusko et al identified a nonsense mutation in

the DU145 prostate cancer cell line that resulted in truncation of the EphB2 receptor

at the kinase domain. Further mutations including missense, nonsense and frameshift

mutations were also found in human prostate tumours. To determine the effect of the

EphB2 receptor mutations in prostate cancer the DU145 cell line was transfected

with wild type EphB2 which resulted in inhibition of cell growth (Huusko et al,

2004). Furthermore, decreased EphB2 expression resulting in accelerated

tumourigenesis in the colon and rectum of APCmin/+ mice suggest that EphB2 may

indeed play a role as a tumour suppressor (Batlle et al, 2005).


26

EphB4 expression was found in a majority of prostate tumours screened while most

of the normal prostate tissue showed little to no expression (Xia et al, 2005b). To

determine the functional role of EphB4 in prostate cancer Xia et al performed EphB4

knockdown studies using siRNA technology. Knockdown of EphB4 resulted in a

decrease in cell growth, migration and invasion of PC-3 prostate cancer cells (Xia et

al, 2005b).

These studies suggest a potential role for the Eph/ephrin family in prostate cancer

cell growth and movement.


27

1.12Knowledgegaps

Eph and ephrin involvement in some cancers (melanoma, breast cancer) has been

studied extensively but this is not true of prostate cancer where published data is

scanty and fragmented. Based on these studies and our laboratory’s own preliminary

observations, the current study assesses expression levels of EphA2, EphA3, ephrin-

A1 and ephrin-A5 in a series of prostate cancer cell lines and a cohort of clinical

isolates of prostate adenocarcinoma. This is the first screen of mRNA expression

levels of these genes in a cohort of cell lines and tissue samples using quantitative

real time polymerase chain reaction (Q-PCR). Q-PCR data was correlated with

Western blot analysis to determine protein expression and immunohistochemical

analysis was used to determine site of expression in tumour tissue. Other studies

have only assessed gene expression levels in cell lines and/or tumour samples using

limited methods.

The current study also examines the functional role of Eph and ephrins in prostate

cancer. While a number of studies are beginning to focus on the functional role of

Eph receptors in prostate cancer, in particular EphA2, their role is far from clear.

Furthermore, few studies have investigated the functional role of ephrin ligands in

prostate cancer. This is a key knowledge gap in beginning to understand some of the

cellular mechanisms underlying the regulation of cell movement in prostate cancer.

Hence, this study will provide a detailed assessment of specific members of the Eph

family and their role in cell migration in prostate cancer.

1.13Significance

Preliminary data provide evidence for Ephs and ephrins in critical aspects of cell

adhesion, and a potentially crucial role in tumour progression and metastasis. The

preferential expression of these proteins in prostate cancer suggests that these

molecules may be useful anti-cancer therapeutic targets, particularly for late stage

prostate cancer. There are already several therapeutic candidates in advanced pre-

clinical or early clinical assessment.


28

1.14Hypothesis

The objective of this study is to explore the involvement of the Eph-ephrin system in

regulating critical mechanisms of the metastatic process in prostate cancer. Based on

published data and preliminary findings for EphA2 and EphA3 in prostate cancer I

propose that:

1. High expression of Eph proteins, in particular EphA2 and EphA3, promotes

tumour growth through regulation of both cell adhesion and cell movement.

2. Eph/ephrin expression alters during tumour progression, particularly during

evolution to the metastatic stage.

1.15Aims

To investigate these hypotheses I have the following aims.

1. – To determine the expression and function of EphA2, EphA3 and their

high affinity ligands ephrin-A1 and ephrin-A5 in human prostate cancer.

2. – To determine the effect of EphA2 and EphA3 signalling pathways on cell

adhesion and movement in prostate cancer.

3. – To determine the effect of ephrin-A5 on cell adhesion and formation in

prostate cancer.

Chapter 2: Materials and methods

29

Chapter2:Materialsandmethods

All general materials and methods have been listed below. Additional methods

specific for a chapter are described in the relevant chapter.

2.1Cellculture

Cell lines consisted of RWPE1, a transformed cell line derived from normal prostate,

RWPE2, derived by Ki-Ras transformation of RWPE1, two androgen responsive

prostate cancer cell lines (LNCaP, 22Rv1) and four androgen independent prostate

cancer cell lines (DU145, PC-3, PC-3M, PC-3MM2). RWPE1 and RWPE2 cells

were cultured in Keratinocyte serum free medium (Gibco/Invitrogen Pty Ltd, Mount

Waverley, Australia) supplemented with 50 μg/ml bovine pituitary extract, 5 ng/ml

epithelial growth factor (Gibco) and 10% FBS (Gibco). 22RV1, LNCaP, DU145,

PC-3, PC-3M and PC-3MM2 cells were cultured in RPMI (Roswell Park Memorial

Institute) 1640 supplemented with 10% FBS (Gibco), 100 U/ml of penicillin-

streptomycin and 2 mM L-glutamine.

PC-3 and 22Rv1 were generously provided by Mitchell Stark (QIMR, Herston, Qld)

while RWPE1, RWPE2, LNCaP and DU145 were provided by Dr Michelle Burger

(QIMR). The PC-3 metastatic derivatives, PC-3M and PC-3MM2, were provided by

Professor Curtis Pettaway (MD Anderson Cancer Center, Houston, TX, USA).

2.2Antibodies

The following antibodies were used: mouse anti-EphA2 clone 1F7; mouse anti-

EphA2 clone 5D7; mouse-anti-EphA3 clone IIIA4, polyclonal rabbit anti-EphA3 and

polyclonal sheep anti-EphA3 (in-house), mouse anti-Eck/EphA2, clone D7; mouse

anti-phospho-Akt1/PKBα (ser 473), clone 11E6; mouse anti-Akt/PKB, clone SKB1;

mouse anti-FAK, clone 4.47; mouse anti-Rho (A –B –C) clone 55 (Upstate, Lake

Placid, NY, USA), goat anti-ephrin-A5 (R&D Systems, Minneapolis, MN, USA),

mouse anti-Fyn-59; mouse anti-c-Src and rabbit anti-ephrin-A5 H-66 (Santa Cruz

Biotechnology, Inc, Santa Cruz, CA, USA), rabbit anti-ephrin-A1 (Research

Diagnostics Inc, Flanders NJ), rabbit anti-pAb to EphA2 +A3 +A4 (phospho Y588)


30

(Abcam, Cambridge, MA, USA), mouse anti-Cdc42 (Chemicon International,

Temecula, CA, USA), rabbit anti-FAK pY397; rabbit anti-FAK pY407; rabbit anti-

FAK pY576; rabbit anti-FAK pY577; rabbit anti-Src pY529 and rabbit anti-Integrin β1

receptor pTpT 785/789 (BioSource™ International Inc, CA, USA), rabbit anti-Src

pY418 (Invitrogen, CA, USA) and mouse anti-Beta actin (Sigma-Aldrich Pty Ltd,

Castle Hill, NSW, Australia).

The following primary conjugated antibodies were used: mouse anti-EphA2 clone

1F7 - FITC, mouse anti-EphA3 clone IIIA4 - Alexa Fluor® 488 (in house) and

Rhodamine Phalloidin (Chemicon International).

The following fluorescent secondary antibodies were used: sheep anti-mouse Ig,

FITC conjugated F(ab)2 (Chemicon International), goat anti-mouse IgG Alexa

Fluor® 546, goat anti-rabbit IgG Alexa Fluor® 488, donkey anti-goat IgG Alexa

Fluor® 488 (Invitrogen, Molecular Probes®, Oregon, USA).

2.3RNAisolationandcDNAsynthesis

Total RNA was extracted when cells were 80-90% confluent using the Qiagen

RNeasy® mini kit (Qiagen Pty Ltd, Australia) according to manufacturer’s

instructions. Prior to cDNA synthesis, all RNA samples were subjected to DNase

treatment using RQ1 RNase-free DNase-I (Promega WI, USA) for 40 minutes at

37οC. First strand cDNA was synthesised by reverse transcription using Superscript

III Reverse Transcriptase (Invitrogen). Briefly, DNase-I digested RNA was

incubated with 1.5 μl of 10 mM dNTP, 1.5 μl of 250 ng/µl random hexamers and 7

μl of diethylpyrocarbonate treated ddH2O (DEPC ddH2O) for 5 minutes at 65οC. The

mixture was chilled on ice before the addition of 6 μl of 5 × RT buffer, 1.5 μl of 0.1

M dTT, 1 μl of 40 U/µL RNasin (Promega) and 1.5 μl of Superscript III. This was

then incubated at 25οC for 10 minutes, 50οC for 60 minutes and heat inactivated at

70οC for 15 minutes. cDNA was diluted to a final concentration of 10 ng/μl. All

reactions were performed in duplicate and pooled for quantitative real time PCR (Q-

PCR). Prior to Q-PCR, reverse transcription PCR was performed to confirm the

absence of genomic DNA using a house keeping gene.


31

2.4QuantitativerealtimePCR

Q-PCR was performed using QuantitectTM SYBR® Green PCR Master Mix (Qiagen)

according to manufacturer’s instructions on a Corbett Research Rotor-Gene 3000

(Corbett Research Pty Ltd, NSW, Australia). Briefly, 5 μl of diluted cDNA was

added to 10 μl of SYBR® Green PCR Master Mix and forward and reverse primers

were added to a final concentration of 0.1 µM. Primer sequences are listed in Table

2.1. Standard curves were generated for each Eph/ephrin gene using four-fold

dilutions of RWPE1 or 22Rv1 cDNA. Housekeeping genes Beta actin,

glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane

synthase (HMBS) and hypoxanthine guanine phosphoribosyltransferase (HPRT)

were all tested and showed similar results. Beta actin was chosen in this instance as

this showed minimal variability in prostate tissue. PCR cycling conditions included

activation for 10 minutes at 95οC followed by 45 cycles at 66οC for 20 seconds, 55οC

for 30 seconds and 72οC for 40 seconds. Fluorescence data were recorded at the end

of each 72οC step. All reactions were performed in duplicate. The relative expression

levels for all genes were calculated per copy number of Beta actin.

2.5Agarosegelelectrophoresis

DNA or RNA was electrophoresed on a 1% agarose gel containing 0.5 mg/ml

ethidium bromide. Visualisation was performed under an ultraviolet light.

2.6Flowcytometry

Cell suspensions were washed with PBS 5% FBS. Cells were incubated in primary

antibody for 20 minutes at room temperature, washed with PBS and incubated with a

fluorescently labelled secondary antibody for 15 minutes at 4°C. Cells were washed

with PBS and analysed on a BD FACSCanto™ flow cytometer (BD Biosciences,

MA, USA) using FACS Diva version 6.1.2. Alternatively cells were sorted on a

DakoCytomation MoFlo cell sorter (DAKO Australia Pty Ltd).


32

Table 2.1: Oligonucleotides used for quantitative real time RT-PCR

Primer Forward primer (5’ to 3’) Reverse primer (5’ to 3’)

Eph receptor

EphA1 GTGGACACTGTCATAGGAGAAGG GGTCTTAATGGCCACAGTCTTG

EphA2 GGGACCTGATGCAGAACATC AGTTGGTGCGGAGCCAGT

EphA3 GATGTTGGTGCTTGTGTTGC GTGTCTGGAAACATAGCCAGATT

EphA4 CTTCCCTGGTGGAAGTTCG GGTACCAGCCATTCACCATC

EphA5 ACTTGATCTTGGTGACCGTGT ACCAGAGCAATGCAAGCAC

EphA6 GAAAGGTGGCCACATGGA TTCTAGGCGAATGATGTTTGG

EphA7 TGGGAAGAAATTAGTGGTTTGG GTTAGTCCGCAGCCAGTTGT

EphA8 CCACATGAACTACTCCTTCTGGA CTGGTTCGTGGTGATGTTGA

EphB1 GCACATCTCTGGTGATTGCTC ACGCTGTTCTCAGGCTCATAG

EphB2 GAAGGAGCTCAGTGAGTACAACG GCACCTGGAAGACATAGATGG

EphB3 GGCCATAGCCTATCGGAAGT TCCCAGTAGGGTCGCTCTC

EphB4 GCCATTGAACAGGACTACCG TTCCGGATCATCTTGTCCA

EphB6 GAGCAGGAGGTACTAAATGCAA CCAGCTGGTCAAAATGAGG

ephrin ligand

ephrin-A1 CCGGAGAAGCTGTCTGAGAA GGTTTGGAGATGTAGTAGTAGCTGTG

ephrin-A2 TGGAGGTGAGCATCAATGAC CCGTTGACCATGTACAGCAC

ephrin-A3 GGATGAAGGTGTTCGTCTGC TTCTCTCCCTCAAAGTCTTCCA

ephrin-A4 CTCCAGGTGTCTGTCTGCTG AGTAATAGCAAGAGACAGAG

ephrin-A5 TTGCACGTGGAGATGTTGAC GGTTGCTGCTGTTCCAGTAGA

ephrin-B1 TGAAGGTTGGGCAAGATCC GGTTCACAGTCTCATGCTTGC

ephrin-B2 CCACAGATAGGAGACAAATTGGA TGCATCTGTCTGCTTGGTCT


33

ephrin-B3 CTTCACCATCAAGTTCCAGGA ATGCCTCTGGTTAGGCACAC

Rho family

RhoA GTGCCCATCATCATCCTGGTT CTCCATCTTTGGTCTTTGCTG

RhoF CCCTGAACCTCTACGACACG GGGAACCACTTGATGAGGAC

RhoG TCCTGCATCCTCTTGTGACC AAGGGGTGCCAGAATTAGTCC

Rac1 CGTGCAAAGTGGTATCC TGGGAGTCAGCTTCTTCTCC

Cdc42 TGCCAAGAACAAACAGAAGC GCTCTTCTTCGGTTCTGGAG

Integrin subunits

α1 CTGTGCTGTACCCAACTGGA AGTCCAGAATTGTGCCTCGT

α2 CAGACAAGGCTGGTGACATC TGAACGTCTTTCAACCAGCA

α4 GTTGCGCATGTTCTACTGGA TAAAGAAGCCAGCCTTCCAC

α6 GGGAGTACCTTGGTGGATCA TATCAGATGGCTGAGCATGG

αV TCACCAACTCCACATTGGTT TGAAGCTGCTCCCTTTCTTG

β1 GGTCCAACCTGATCCTGTGT ACAATTCCAGCAACCACACC

β4 TGTGACCCAGGAGTTTGTGA TGCAAGGATGGAGTAGCTGA

β5 AAGATGACCAGGAGGCTGTG CAAGCAGCTTCCAGATAGCC

Src family

Src CCTACCCTGGGATGGTGAAC CCTGCAGGTACTCGAAGGTG

Fyn GGTCACCAAAGGAAGAGTGC TACTCAAAAGTGGGGCGTTC

Lyn TGTGGTCCTTTGGAATCCTC ATCTGGGCAGTTCTCCACAC

Miscellaneous

PSA ACCAGAGGAGTTCTTGACCCCAAAA CCCCAGAATCACCCGAGCAG

Beta actin CACACTGTGCCCATCTACGA GTGGTGGTGAAGCTGTAGCC


34

2.7Westernblotting

Cell cultures at 70-80% confluence were washed in PBS and lysed in 1 ml of lysis

buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM NaVO4, 10 mM

NaF and protease inhibitors (Roche Diagnostics, Castle Hill, Australia)). Total

protein concentration was determined using a Bradford protein assay (Bio-Rad

Laboratories Pty Ltd, NSW, Australia). Each sample (100 μg) was electrophoresed

on a 7.5% or 10% sodium dodecyl sulphate (SDS) polyacrylamide gel. Protein was

then transferred onto nitrocellulose membranes (GE Healthcare Ltd,

Buckinghamshire, UK) and Western blot analyses performed using antibodies

previously listed in section 2.2. Membranes were incubated in primary antibody for

one hour at room temperature or overnight at 4°C. Membranes were washed in 1 ×

TBS (Tris buffered saline) with 0.02% Tween then incubated in secondary antibody

for 30 minutes at room temperature. Blots were visualised with either ECL™

substrate (GE Healthcare) or Lumi-LightPLUS substrate (Roche Diagnostics).

For ephrin-A5, the Odyssey® infrared imaging system was used according to

manufacturer’s instructions (LI-COR Biosciences, NE, USA).

Densitometry was performed using Quantity One 4.6.3 Basic (Bio-Rad).

2.8Immunocytochemistry

Cells were cultured on 12 mm round glass cover slips in a 24-well plate overnight,

then fixed in 4% paraformaldehyde for 10 minutes at room temperature and washed

with PBS. Cells were incubated with primary antibody for 20 minutes at room

temperature, washed with PBS and incubated with a fluorescently labelled secondary

antibody for 15 minutes at 4°C in the dark. Cover slips were washed in PBS and

mounted using Prolong® Gold antifade reagent with DAPI (Invitrogen, Molecular

Probes). Cells were imaged using a Delta Vision deconvolution microscope (Applied

Precision, Inc, Washington) or a Leica TCS SP2 Confocal scanning microscope

(Leica Microsystems Pty Ltd, Australia).


35

For EphA3 staining, cells were incubated in primary and secondary antibodies on ice

and were fixed in 4% paraformaldehyde after incubation with the secondary

antibody.

For F-actin staining, cells were fixed in 4% paraformaldehyde, permeabilised in

0.1% triton X-100 and incubated for 40 minutes at room temperature in rhodamine

phalloidin (Chemicon International) solution containing 1 mg/ml BSA.

2.9Adhesionassay

96-well plates were directly coated with 10 µg/ml of fibronectin (Biomedical

Technologies Inc, Stoughton MN), collagen type I, laminin or poly-l-lysine (Sigma-

Aldrich, Missouri, USA) in PBS overnight at 4°C. Wells were washed with PBS and

blocked with 0.1% BSA for one hour at room temperature. Cells were de-adhered

with 5 mM EDTA, seeded at 3 × 104 cells/well and allowed to adhere for 30 minutes.

After incubation wells were washed gently with PBS to remove any non-adhered

cells and adhered cells were fixed in 4% paraformaldehyde. Cells were stained with

0.1% crystal violet and solubilised in 10% acetic acid. Cell adhesion was quantitated

by measuring the absorbance at 590 nm on a VERSAmax™ microplate reader

(Molecular Devices, Sunnyvale, CA, USA). All reactions were performed in

triplicate wells in three independent experiments.

For adhesion to Eph/ephrin-Fc coated surfaces, adhesion assays were performed as

described above except plates were coated with 0.3, 1, 3 or 9 µg/ml of Eph/ephrin-Fc

and cells were allowed to adhere for three hours.

2.10Woundassay

24-well plates were coated with 10 μg/ml of fibronectin (Biomedical Technologies

Inc) for 60 minutes, washed with PBS and blocked with 0.1% BSA for 30 minutes at

room temperature. Wells were washed with PBS and cells seeded at 1 × 105

cells/well and allowed to adhere overnight. Cells were treated with 2 µg/ml


36

mitomycin C (Sigma-Aldrich) for three hours before wounding with a sterile pipette

tip. Wells were washed in medium to remove scraped cells. Images of the wound

were taken at 0 and 24 hour time points on a Leica MZ6 microscope (Leica

Microsystems Pty Ltd). Wound area measurements were made using Leica

Application Suite Version 2.4.0 R1 (Leica Microsystems Pty Ltd). All reactions were

performed in triplicate wells in three independent experiments.

2.11Invasionassay

Cells were serum starved overnight, de-adhered using 5 mM EDTA, washed and

resuspended at 4 × 105 cells/ml in serum free medium containing 0.1% BSA. 24-

transwell inserts with 8 μM pore size (Costar, NY, USA) were coated with 10 µg BD

Matrigel™ basement membrane matrix (BD Biosciences – Discovery labware,

Bedford, MA) at room temperature overnight. 100 µl of serum free medium was

added to the upper chamber and incubated at 37°C for four hours. 250 µl of cell

suspension was added to the upper chamber and 700 µl of medium containing 10%

FBS added to the lower chamber as the chemoattractant. Plates were incubated at

37οC for 24 hours. Cells were removed from the upper surface of the insert using a

cotton tip. Remaining cells on the lower surface of the insert were fixed in ice-cold

methanol for 15 minutes then stained in 0.1% crystal violet for 15 minutes. Inserts

were washed in running tap water and images of five random fields for each insert

were taken on a Leica DMIRB Inverted microscope (Leica Microsystems). All

reactions were performed in triplicate wells from three independent assays. For

activation studies 1 μg/ml ephrin-Fc or activating antibodies were placed in the lower

chamber. For drug studies cells were incubated for 30 minutes in 200 nM Dasatinib

(American Custom Chemicals Corporation, CA, USA), 10 µM PP2 or 10 µM PP3

(Calbiochem®, CA, USA) prior to addition to the upper chamber.


37

2.12MTSassay

Cells were resuspended at 3 × 104 cells/ml and 100 µl of cell suspension added per

well of a 96-well plate and incubated at 37°C for 72 hours. 20 µl of Cell Titer

96Aqueous One Solution Cell Proliferation Assay reagent (Promega, WI, USA) was

added to each well and incubated for two hours at 37οC. Absorbance was measured

at 490 nm on a VERSAmax™ microplate reader (Molecular Devices). Control wells

with medium only were included for each experiment and absorbance subtracted. All

reactions were performed in triplicate wells from three independent assays.

2.13Effectofdrugsoncellproliferation

Cells were resuspended at 3.75 × 104 cells/ml and 80 µl of cell suspension added per

well of a 96-well plate and incubated overnight at 37°C. 20 µl of Dasatinib

(American Custom Chemical Corporation) PP2, PP3 or DMSO was added to each

well to give a final concentration of 200 nM (Dasatinib) or 10 µM (PP2, PP3,

DMSO). Cells were incubated at 37°C for 72 hours. 20 µl of Cell Titer 96Aqueous

One Solution Cell Proliferation Assay reagent (Promega) was added to each well and

incubated for two hours at 37οC. Absorbance was measured at 490 nm on a

VERSAmax™ microplate reader (Molecular Devices). Control wells with medium

only or medium + drug were included for each experiment and the absorbance

subtracted. All reactions were performed in triplicate wells from three independent

assays.

2.14Transfections

Cells were transfected using Fugene 6 transfection reagent (Roche) or Lipofectamine

2000 (Invitrogen) according to manufacturer’s instructions. Briefly, cells were split

16-24 hours prior to the transfection and seeded at 50% confluency. The transfection

reaction was performed with a transfection reagent volume to DNA mass ratio of 3:1

and incubated for 20 minutes at room temperature. Cells were washed with PBS and

incubated in the transfection reagent/DNA mix for one minute prior to the addition of


38

RPMI 10% FBS. Antibiotic, 500 µg/ml Geneticin® (Gibco) or 1 µg/ml Puromycin

(Sigma-Aldrich), was added 48 hours after the transfection to enable selection.

2.15Statisticalanalysis

Unless otherwise specified a two-tailed Student’s t-test was performed using

GraphPad Prism 5 Version 5.02. A p-value of <0.05 was considered statistically

significant.

Chapter 3: Eph and ephrin expression in prostate cancer

39

Chapter 3: Eph and ephrin expression

inprostatecancer

3.1Introduction

The Eph receptors are the largest family of receptor tyrosine kinases. They bind to

cell membrane bound ephrin ligands and produce signals that influence cell

behaviour. Ephs and ephrins are predominantly expressed during embryonic

development and their interaction is responsible for many diverse processes

including the establishment of tissue boundaries, topographic mapping, axon

guidance and angiogenesis (Cheng et al, 2002; Pasquale, 2005). Limited expression

is also found in adult life where they have been shown to play a role in maintaining

tissue homeostasis. Furthermore, aberrant expression is increasingly being reported

in cancer (Pasquale, 2008).

Eph and ephrin expression has been reported in many human malignancies including

breast, lung, renal, ovarian, colon and prostate cancer (Brantley-Sieders et al, 2008;

Hafner et al, 2004; Herath et al, 2006; Kinch & Carles-Kinch, 2003; Walker-Daniels

et al, 1999). Interestingly, several members of this family including EphA1, EphA3

and EphB4 were first isolated from human cancers (Bennett et al, 1994; Boyd et al,

1992; Hirai et al, 1987). There is increasing evidence to support the Eph receptor

tyrosine kinase family’s involvement in cancer however their role is still not clear as

studies report both up- and down-regulation of individual members. These

differences may reflect tumour type, stage, differentiation and progression. For

example, increased expression of EphA1 has been reported in ovarian cancer (Herath

et al, 2006) while decreased expression was observed in non-melanoma skin cancers

(Hafner et al, 2006). In a study using paired normal and colorectal cancer tissue,

EphA1 expression was increased in stage II samples and down regulated in stage III

samples (Herath et al, 2009). EphA1 expression, like many other Eph receptors and

ephrin ligands, has also been correlated with disease progression and survival (Wang

et al, 2010).


40

Previous studies have provided evidence for a potential role for Eph receptor tyrosine

kinases in prostate cancer (as outlined in section 1.11). However, due to the unique

bi-directional signalling that results from the complex and promiscuous interaction of

Ephs and ephrins it is important to determine the full complement of expression of

these proteins. A previous study has reported expression of the Eph receptors and

ephrin ligands in a series of six prostate cancer cell lines using semi quantitative RT-

PCR (Fox et al, 2006). However, expression was only determined in cell lines and

was not correlated with protein levels. Therefore, in order to better understand their

role in prostate cancer this chapter will evaluate Eph and ephrin expression in a

series of prostate cancer cell lines, representing both the early and late stages of

advanced disease, using quantitative real time RT-PCR. Results show high

expression of the EphA2 and EphA3 receptors and their high affinity ligands, ephrin-

A1 and ephrin-A5. Protein levels were correlated with mRNA levels for these genes

and their expression was examined in a cohort of clinical isolates using both Q-PCR

and immunohistochemistry. Expression of known Eph and ephrin signalling targets

was also determined to establish possible pathways involved in prostate tumour

growth and progression.


41

3.2Materialsandmethods

All general materials and methods have been described in Chapter 2. Additional

methods for this chapter are described below.

3.2.1Patientcharacteristics

A total of 20 RNA samples were obtained from seven patients with benign prostatic

hypertrophy (BPH) and 13 patients with prostate adenocarcinoma. Samples were

obtained by radical prostatectomy, open prostatectomy or transurethral resection of

the prostate (TURP). The median age of patients was 79 years (range, 72-88) for

BPH and 65 years (range, 53-88) for prostate adenocarcinoma.

Samples were generously provided by Dr Michelle Burger and Linda Teng from

Professor Martin Lavin’s laboratory (QIMR).

3.2.2TissuesamplesforQ‐PCRscreen

cDNA was made from the 20 RNA samples above using the method outlined in

Chapter 2. A TissueScan™ Real-Time Prostate Cancer Disease panel (Array I) was

purchased from OriGene (OriGene Technologies, Inc, Rockville, MD).

3.2.3Tissuesamplesforimmunohistochemistry

A pilot array was obtained from the Australian Prostate Cancer Collaboration

BioResource (APCC Bio-Resource).

Slides from 10 patients with BPH and 10 patients with prostate adenocarcinoma were

generously provided by Linda Teng from Professor Martin Lavin’s laboratory

(QIMR).


42

3.2.4QuantitativerealtimePCR

Q-PCR was performed as outlined in Chapter 2 for the 20 patient samples listed

above. For the TissueScan™ Real-Time Prostate Cancer Disease panel, 15 μl of

SYBR® Green PCR Master Mix (Applied Biosystems, UK) and forward and reverse

primers at a final concentration of 1 µM was added to each well. Primer sequences

are listed in Table 2.1. Plates were run on an ABI 7900HT Fast Real-Time PCR

system (Applied Biosystems, CA, USA) using the PCR cycling conditions listed in

Chapter 2.

3.2.5Immunohistochemistry

Expression and cellular localisation of EphA2, EphA3, ephrin-A1 and ephrin-A5

were assessed immunohistochemically on formalin fixed paraffin embedded sections.

Sections were de-waxed with xylene and rehydrated through alcohol. Endogenous

peroxidase was blocked with 0.3% hydrogen peroxide for 10 minutes and subjected

to heat induced epitope retrieval using a citrate buffer. Samples were blocked in 10%

donkey serum followed by incubation in primary antibody for two hours at room

temperature or overnight at 4°C. Samples were incubated in secondary antibody

solutions for 30 minutes at room temperature followed by detection using the

EnVision DAB+ detection system. Alternatively samples were stained with the

RealBlue peroxidase substrate kit (Abnova) according to manufacturer’s instructions.

Slides were scanned using the Aperio™ system.

The following secondary antibodies were used: ImmPRESS™ anti-mouse Ig,

ImmPRESS™ anti-rabbit Ig and ImmPRESS™ anti-goat Ig (Vector Laboratories,

CA, USA).

Immunohistochemistry and tissue section histology were assessed by Dr Andrew

Clouston and Dr Blake O’Brien.


43

3.3Results

3.3.1Ephandephrinexpressioninprostatecancercelllines

3.3.1.1EphandephrinmRNAexpressioninhumanprostatecancercelllines

Gene expression profiles for the Eph receptor tyrosine kinase family were established

using quantitative real time RT-PCR in a series of six prostate cancer cell lines

including both androgen responsive (22Rv1, LNCaP) and androgen independent

(DU145, PC-3, PC-3M and PC-3MM2) cells. RWPE1 derived from normal prostate

was used as a control and compared to its tumourigenic derivative RWPE2. Initially,

the expression of 13 Eph and 8 ephrin genes (EphA1-8, EphB1-4, EphB6, ephrin A1-

A5 and ephrin B1-B3) was screened in two independent experiments which showed

similar profiles. Data from experiment two is shown in Figure 3.1. The expression

levels for EphA4, A5, A6, A7, A8, B1, B3, B6 and ephrin-A2 and -B3 were

relatively low in all cell lines and these genes were not considered further.

Eph receptor expression was variable across the range of prostate cancer cell lines

with EphA2 and EphA3 showing highest levels of expression (Figure 3.1A).

Interestingly, an inverse correlation was identified between EphA2 and EphA3. High

EphA3 expression was detected in the LNCaP and 22Rv1 cell lines, while EphA2

expression was more apparent in the DU145, PC-3, PC-3M and PC-3MM2 cell lines.

The only other Eph receptor that showed relatively high expression in the cell lines

was EphB4. EphB4 was variably expressed in all cell lines and was overall lower

than the highest levels seen with EphA2 and EphA3 (Figure 3.1B).

The most highly expressed ephrins in these cell lines were ephrin-A1, the high

affinity ligand for EphA2 and ephrin-A5, the high affinity ligand for EphA3 (Figure

3.1C). Ephrin-A1 appeared to be elevated in the high EphA3 expressing cell lines

and low in the high EphA2 expressing cell lines. Elevated ephrin-A5 expression was

observed in LNCaP cells. Ephrin-B1, the high affinity ligand for EphB2, also showed

relatively high expression, particularly in RWPE1, PC-3, PC-3M and PC-3MM2

cells (Figure 3.1D). The ligand for EphB4, ephrin-B2, was expressed at relatively

low but detectable levels in all cell lines.


44

ephrin-B

ephrin-B1 ephrin-B2 ephrin-B30

10

20

30

40

50RWPE1RWPE2

22Rv1LNCaP

DU145PC-3PC-3MPC-3MM2

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

ephrin-A

ephrin-A1 ephrin-A2 ephrin-A3 ephrin-A4 ephrin-A50

10

20

30

40

50RWPE1RWPE2

22Rv1LNCaP


Tra

nscr

ipt

# pe

r 10

00 -

acti

n

EphB

EphB1 EphB2 EphB3 EphB4 EphB60

10

20

30

40

50RWPE1RWPE2

22Rv1LNCaP


Tra

nscr

ipt

# pe

r 10

00 -

acti

nEphA

EphA1 EphA2 EphA3 EphA4 EphA5 EphA6 EphA7 EphA80

10

20

30

40

50RWPE1RWPE2

22Rv1LNCaP


Tra

nscr

ipt

# pe

r 10

00 -

acti

nA

D

B

C

Figure 3.1: Eph and ephrin mRNA expression in prostate cancer cell lines

Q-PCR data showing mRNA expression of (A & B) Eph receptors and (C& D) ephrin ligands in two androgen responsive cell lines (22Rv1 and LNCaP) and four androgen independent cell lines (DU145, PC-3, PC-3M and PC-3 MM2). RWPE1 was used as a control and compared to its tumourigenic derivative RWPE2. Values represent transcript number relative to 1000 copies of Beta actin from one independent screen.


45

This study will focus on the EphA2 and EphA3 receptors and their corresponding

high affinity ligands, ephrin-A1 and ephrin-A5, to explore the reciprocal nature of

and the level of expression of these receptors in prostate cancer.

3.3.1.2Ephandephrinproteinexpressioninhumanprostatecancercelllines

To further investigate high Eph and ephrin expression, mRNA data was correlated

with protein expression levels. Western blot analysis was used to determine protein

expression of EphA2, EphA3, ephrin-A1 and ephrin-A5 in the six prostate cancer

cell lines as well as RWPE1 and RWPE2 (Figure 3.2). In keeping with the mRNA

data, high levels of EphA2 (~120kDa) were observed in RWPE1, RWPE2, DU145

PC-3, PC-3M and PC-3MM2 cells. Minimal EphA2 was detected in LNCaP and

22Rv1 cells. Significant EphA3 protein expression was observed only in the two

highest EphA3 mRNA expressing cell lines, LNCaP and 22Rv1, with small levels

observed in PC-3M and PC-3MM2. Ephrin-A5 protein expression was observed

only in the LNCaP cell line. Western blot analysis showed close correlation between

mRNA and protein levels for all cell lines for EphA2, EphA3 and ephrin-A5 with the

exception of no ephrin-A5 protein being detected in the RWPE2 cell line. A reliable

Western blot could not be produced for ephrin-A1, due to limitations of available

antibodies.


46

ephrin-A5

RWPE1 RWPE2 22Rv1 LNCaP DU145 PC-3 PC-3M PC-3MM20

2

4

6

8

10

ephr

in-A

5 / -

acti

nra

tio

EphA3

RWPE1 RWPE2 22Rv1 LNCaP DU145 PC-3 PC-3M PC-3MM20.0

0.5

1.0

1.5

2.0

Eph

A3

/ -

acti

nra

tio

EphA2


0.5

1.0

1.5

2.0

2.5

Eph

A2

/ -

acti

nra

tio

EphA2

β-actin

EphA3

β-actin

ephrin-A5

β-actin

A

B

Figure 3.2: Eph and ephrin protein expression in prostate cancer (PCa) cell lines

(A) Western blot analysis of EphA2, EphA3 and ephrin-A5 in the prostate cancer cell lines. Total cell lysates were made from RWPE1, derived from normal prostate, its tumourigenic derivative, RWPE2 and the PCa cell lines 22Rv1, LNCaP, DU145, PC-3, PC-3M and PC-3 MM2. Beta actin was included as a loading control. EphA2 and EphA3 westerns were visualised with ECL™ while ephrin-A5 was visualised using the Odyssey® Infrared imaging system. (B) Densitometry performed for the Western blots from (A).


47

3.3.1.3Immunocytochemistry

Immunocytochemistry was performed on two representative cell lines, LNCaP and

PC-3, to assess the site of cellular localisation of the elevated levels of EphA2,

EphA3, ephrin-A1 and ephrin-A5 as demonstrated by Q-PCR and Western blotting.

EphA2 appeared to be localised to the membrane with uniform staining in PC-3 cells

(Figure 3.3A) while EphA3 expression in LNCaP cells was localised to the

membrane in a clustered appearance (Figure 3.3B). EphA3 expression also appears

to be strongest at the leading edge of cellular processes in LNCaP cells. No

background staining was observed in isotype controls for both EphA2 and EphA3.

Ephrin-A5 has previously been reported to be found in lipid rich microdomains in the

plasma membrane of ephrin-A5 transfected NIH-3T3 cells (Davy et al, 1999). In

keeping with this, ephrin-A5 was not diffusely distributed in LNCaP cells but rather

was localised in clusters (Figure 3.3D). A similar staining pattern was also observed

for ephrin-A1 in LNCaP cells however some background cytoplasmic staining was

present in both test and control cells (Figure 3.3C).


48

ephrin-A1 Brightfield

Brightfield2°Ab control

LNCaPC

EphA2 Brightfield

BrightfieldIsotype control

PC-3AEphA3 Brightfield

BrightfieldIsotype control

LNCaPB

ephrin-A5 Brightfield

Brightfield2°Ab control

LNCaPD

30 µm

30 µm

30 µm

30 µm

30 µm

30 µm 30 µm

30 µm

Figure 3.3: Cellular localisation of EphA2, EphA3, ephrin-A1 and ephrin-A5

(A) EphA2 expression in PC-3 cells detected with mouse anti-EphA2 monoclonal antibody 1F7 (in house) followed by a FITC labelled secondary antibody.

(B) EphA3 expression in LNCaP cells detected with mouse anti-EphA3 monoclonal antibody IIIA4 (in house) followed by a FITC labelled secondary antibody.

(C) Ephrin-A1 expression in LNCaP cells detected with rabbit anti-ephrin-A1 antibody (RDI) followed by a secondary Alexa Fluor® 488 antibody.

(D) Ephrin-A5 expression in LNCaP cells detected with goat anti-ephrin-A5 antibody (R&D Systems) followed by a secondary Alexa Fluor® 488 antibody.


49

3.3.2Ephandephrinexpressioninhumantissuesamples

3.3.2.1EphandephrinmRNAexpressioninhumanclinicalsamples

To determine whether Eph and ephrin expression patterns identified in prostate

cancer cell lines extended to prostate cancer tissue, Q-PCR was used to screen 7

benign prostatic hypertrophy and 13 prostate adenocarcinoma specimens as well as a

prostate cancer tissue Q-PCR array consisting of seven normal, 11 BPH and 30

prostate cancer tissue samples. Based on Q-PCR data from prostate cancer cell lines

EphA2, EphA3 and their high affinity ligands ephrin-A1 and ephrin-A5 were

selected to screen the tissue samples. The overall levels of expression, for all of the

genes screened, in the Q-PCR array was lower than the clinical samples obtained.

EphA2 expression was variable across all samples (Figure 3.4A and 3.4B). In

contrast to the strong expression observed in cell lines, expression in tissue was

modest. Individual samples from each group showed elevated levels of expression. In

the Q-PCR array, EphA2 expression in PCa appears to be lower overall than that

observed for the normal and BPH samples; however this was not statistically

significant.

EphA3 on the other hand, showed highest expression in the BPH samples from both

sets of tissue screened. The individual BPH clinical samples appeared to be split into

two groups; one with high expression and the other with low (Figure 3.4C). This

however, was not evident in the Q-PCR array (Figure 3.4D). Increased EphA3

expression was evident in some PCa and BPH samples, compared to normal tissue in

the Q-PCR array.

Ephrin-A1 was the most highly expressed gene in the tissue samples. In individual

clinical samples expression was significantly higher in PCa tissue compared to

benign specimens (p=0.0002, t-test) (Figure 3.4E). However, in the Q-PCR array

only a limited number of samples show elevated levels of expression (Figure 3.4F).

Similar to EphA2, ephrin-A5 expression was variable across all samples (Figure

3.4G and 3.4H). In the Q-PCR array, the overall levels of ephrin-A5 were lower in

the PCa samples compared to the normal and BPH samples however this was not

significant.


50

EphA3

BPH PCa0

10

20

30

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

EphA2

BPH PCa0

5

10

15

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

C

G

E

D

B

F

H

Individual clinical samples Q-PCR arrayA

ephrin-A1

BPH PCa0

10

20

30

40

50

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

ephrin-A5

BPH PCa0

5

10

15

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

EphA2

Normal BPH PCa0.0

0.1

0.2

0.3

0.4

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

EphA3

Normal BPH PCa0.0

0.1

0.2

0.3

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

ephrin-A1

Normal BPH PCa0

10

20

30

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

ephrin-A5

Normal BPH PCa0.0

0.1

0.2

0.3

Tra

nscr

ipt

# pe

r 10

00 -

acti

n

*

Figure 3.4: Eph and ephrin mRNA expression in PCa tissue

Q-PCR data showing Eph and ephrin mRNA expression in normal, benign (BPH) and tumour (PCa) prostate specimens from individual clinical samples (A, C, E & G) and from a Q-PCR array (B, D, F & H). Values represent transcript number relative to 1000 copies of Beta actin. * Indicates statistically significant difference (p<0.05, t-test) between the tumour and control specimens.


51

3.3.2.2Ephandephrinproteinexpressioninhumanclinicalsamples

A limitation in comparing the cell line data with the clinical samples is that the cell

lines are purely prostatic epithelial cells whereas the clinical samples are derived

from a mixture of cell types in which the tumour/epithelial cells may be a minority

population. Therefore, immunohistochemical quantitation of expression in tumour

cells is needed. However, due to the lack of antibodies suitable for

immunohistochemistry on paraffin sections further development and optimisation of

Eph/ephrin antibodies is still required. Therefore, quantitation at this point could not

be performed. However, some qualitative data was obtained relating to the site of

Eph/ephrin staining in BPH and PCa samples.

To identify Eph and ephrin expression patterns in clinical samples

immunohistochemistry was performed using DAB as a substrate on a tissue

microarray consisting of one kidney, one stroma, one urothelial carcinoma, eight

BPH and nine PCa specimens from the Australian Prostate Cancer Bio-Resource.

EphA2 protein expression appeared to be stronger in PCa samples (Figure 3.5C and

3.5D) compared to BPH samples (Figure 3.5A and 3.5B) in the tissue microarray.

Q-PCR in the individual BPH clinical isolates revealed an intriguing pattern of

EphA3 expression where samples presented with either high or low levels of EphA3

(Figure 3.4C). Immunohistochemical analysis of the tissue microarray reveals that

EphA3 appears to be expressed primarily in the stroma of BPH samples. In this small

cohort both negative (Figure 3.6A) and positive (Figure 3.B) staining of the stroma in

individual samples was identified suggesting that the high and low expression

observed by Q-PCR may be a result of EphA3 expression in the stroma. No positive

staining of epithelial cells for EphA3 was observed in PCa samples (Figure 3.6D).

Ephrin-A1 mRNA expression was significantly higher in PCa compared to BPH in

the individual clinical isolates (Figure 3.4E). However, positive ephrin-A1 protein

expression in PCa samples was not observed in the tissue microarray. Similar to

EphA2, ephrin-A5 expression appeared to be stronger in PCa samples (Figure 3.7D)

compared to BPH samples (Figure 3.7C).


52

A

C

40×

10×

BPH – EphA2

10×

40×

BPH – EphA2

40×

10×

PCa – EphA2

10×

40×

PCa – EphA2

B

D

Figure 3.5: EphA2 protein expression in BPH and PCa samples

Representative images of (A & B) benign prostatic hypertrophy (BPH) and (C & D) prostate cancer (PCa) specimens from a tissue microarray; provided by the Australian Prostate Cancer Bio-Resource. Tissue was stained with mouse anti-EphA2, clone D7 and DAB was used as substrate. EphA2 expression, indicated by a brown colour, appears more prominent in the glandular structures of the PCa samples compared to the BPH samples.


53

C

40×

10×

BPH – EphA3

10×

40×

PCa – EphA3D

A BPH – EphA3

20× 20×

BPH – EphA3B

Figure 3.6: EphA3 protein expression in BPH and PCa samples

Representative images of (A, B & C) benign prostatic hypertrophy (BPH) and (D) prostate cancer (PCa) specimens from a tissue microarray; provided by the Australian Prostate Cancer Bio-Resource. Tissue was stained with rabbit anti-EphA3 (in house) and DAB was used as substrate. Individual samples show either (A) negative or (B) positive staining for EphA3 in the stroma. Positive staining is indicated by a brown colour.


54

40×

10×

A

C

BPH – ephrin-A1

10×

40×

PCa – ephrin-A1

40×

10×

BPH – ephrin-A5

10×

40×

PCa – ephrin-A5

B

D

Figure 3.7: ephrin-A1 and ephrin-A5 protein expression in BPH and PCa samples

Representative images of benign prostatic hypertrophy (BPH) and prostate cancer (PCa) specimens from a tissue microarray; provided by the Australian Prostate Cancer Bio-Resource. Tissue was stained with (A & B) rabbit anti-ephrin-A1 (RDI), or (C & D) rabbit anti-ephrin-A5 (Santa Cruz) and DAB was used as substrate. Ephrin-A1 and ephrin-A5 expression, indicated by a brown colour, appears to be more prominent in the glandular structures of the PCa samples compared to the BPH samples.


55

Further optimisation of Eph/ephrin staining was performed on a selection of BPH

and PCa clinical samples using RealBlue peroxidase, a more sensitive substrate than

DAB (according to the manufacturer). Positive staining is indicated by a light blue to

purple colour. Eph and ephrin staining in tumour samples was compared with benign

glands from the same section in the individual clinical samples. IHC and tissue

section histology were assessed by an independent pathologist.

Overall, no consistent positive staining of Ephs/ephrins in epithelial cells was

achieved and problems with background staining were encountered. However,

individual samples stained for EphA2 (Figure 3.8A and 3.8B), EphA3 (Figure 3.8C

and 3.8D), ephrin-A1 (Figure 3.9A and 3.9B) and ephrin-A5 (Figure 3.9C and 3.9D)

suggest that positive protein expression is present in this cohort of clinical samples.

Positive nuclear staining was observed for both EphA2 (Figure 3.8B) and ephrin-A5

(Figure 3.9D).


56

Benign – EphA2

40×

10×

Tumour – EphA2

10×

40×

A B

40×

10×

C Benign – EphA3

10×

40×

Tumour – EphA3D

Figure 3.8: EphA2 and EphA3 IHC for PCa samples

Representative images of EphA2 and EphA3 protein expression in benign and tumour glands taken from the same tissue sample. Tissue was stained with (A & B) mouse anti-EphA2, clone D7 or (C & D) sheep anti-EphA3 (in house) and RealBlue peroxidase was used as a substrate. Positive staining is indicated by a light blue to purple colour.


57

40×

10×

Tumour – ephrin-A1

40×

10×

Benign – ephrin-A1A

40×

10×

Benign – ephrin-A5

40×

10×

Tumour – ephrin-A5C

B

D

Figure 3.9: ephrin-A1 and ephrin-A5 IHC for PCa tissue samples

Representative images of ephrin-A1 and ephrin-A5 protein expression in benign and tumour glands taken from the same tissue sample. Tissue was stained with (A & B) rabbit anti-ephrin-A1 (RDI) or (C & D) rabbit anti-ephrin-A5 (Santa Cruz) and RealBlue peroxidase was used as a substrate. Positive staining is indicated by a light blue to purple colour.


58

3.3.3Downstreamsignalling

In order to identify potential targets of Eph-ephrin signalling in prostate cancer, Q-

PCR and Western blot analysis were performed to evaluate expression of known

Eph-ephrin signalling targets from other model systems. These included members of

the Rho, Integrin and Src families.

3.3.3.1Rhofamily

As mentioned in Chapter 1, the Rho family have already been shown to be

downstream targets of Eph-ephrin signalling. High mRNA levels of RhoA, Rac1 and

Cdc42 were observed across all cell lines (Figure 3.10). 22Rv1 showed the highest

levels of expression of RhoA and Cdc42 followed by the other EphA3 expressing

cell line LNCaP by Q-PCR. However, protein levels for RhoA and Cdc42 did not

fully correlate with mRNA levels as 22Rv1 cells showed lower RhoA expression by

Western blot while RWPE1 and RWPE2 showed the highest levels of Cdc42 protein

expression (Figure 3.11). Unlike mRNA, protein levels for Rac1 were similar across

all cell lines. RhoF and RhoG were expressed at relatively low levels in all cell lines

with RhoF expression more apparent in the androgen independent cell lines and

RhoG expressed at similar levels across all samples.

RhoA RhoF RhoG Rac1 Cdc420

50

100

150

200RWPE1RWPE2

22Rv1LNCaP


Tra

nscr

ipt

# pe

r 10

00 -

acti

n

Figure 3.10: Rho family mRNA expression in prostate cancer cell lines

mRNA expression of individual Rho family members including RhoA, RhoF, RhoG, Rac1 and Cdc42 in the cell lines RWPE1, derived from normal prostate, its tumourigenic derivative, RWPE2 and the PCa cell lines 22Rv1, LNCaP, DU145, PC-3, PC-3M and PC-3MM2 as determined by Q-PCR. Values represent transcript number relative to 1000 copies of Beta actin from one independent screen.


59

Cdc42


0.1

0.2

0.3

0.4

Cdc

42 / -

acti

nra

tio

Rac1


0.5

1.0

1.5

Rac

1 / -

acti

nra

tio

RhoA

RWPE1 RWPE2 22Rv1 LNCaP DU145 PC-3 PC-3M PC-3MM20

1

2

3

4

Rho

A / -

acti

nra

tio

B

A

Rac1

β-actin

Cdc42

β-actin

RhoA

β-actin

Figure 3.11: Rho family protein expression in prostate cancer cell lines

(A) Western blot analysis of RhoA, Rac1 and Cdc42 in RWPE1, derived from normal prostate, its tumourigenic derivative, RWPE2 and the prostate cancer cell lines 22Rv1, LNCaP, DU145, PC-3, PC-3M and PC-3 MM2. Beta actin was included as a loading control.

(B) Densitometry performed for the Western blots from (A).


60

3.3.3.2Integrinsubunits

To explore the relationship between the Eph receptors and integrins in cellular

adhesion Q-PCR was used to screen the following integrin subunits; α1, α2, α4, α6,

αV, β1, β4 and β5 (Figure 3.12A) to identify potential targets for adhesion assays.

Integrin β1 was the most highly expressed integrin subunit with levels up to eight-

fold higher than those seen with the other subunits. Highest expression was observed

in RWPE2, DU145 and PC-3 (all high EphA2 expressing cells) while expression was

lower in the metastatic variants of PC-3. Western blot analysis was used to confirm

mRNA expression of integrin β1 (Figure 3.12B and 3.12C). All cells except RWPE2,

where a slightly lower than expected protein level was seen, showed correlation

between mRNA and protein levels. Integrin β4 was not expressed in the EphA3

expressing cell lines 22Rv1 and LNCaP and integrin β5 was expressed at similar

levels across all cell lines. Integrin αV was the most highly expressed α subunit with

RWPE2 and 22Rv1 showing highest levels of expression. Similar to integrin β1,

integrin α1 was highest in RWPE2 followed by PC-3 cells with the PC-3 metastatic

variants showing reduced levels. Integrin α4 was not expressed in any of the cell

lines. Integrin α2 and α6 were more highly expressed in the high EphA2 cell lines.

The two metastatic variants of PC-3 (PC-3M and PC-3MM2) show decreased

integrin expression compared to PC-3 cells.

Based on the mRNA expression screen of individual integrin subunits in the prostate

cancer cell lines it is possible that the following heterodimers could be formed:

11, 21 (laminin and collagen receptors), 61 (laminin receptor), V1

(fibronectin receptor) and V5 (vitronectin receptor) (Berman et al, 2003).

Adhesion to extracellular matrix components will be explored in Chapter 4.


61

1 2 4 6 V 1 4 50

10

20

30306090

120150180 RWPE1

RWPE2

22Rv1LNCaP


Tran

scri

pt #

per

100

0-

acti

n

A

Integrin β1

β-actin

B


0.5

1.0

1.5

2.0

Inte

grin 1

/ -

acti

nra

tio

C

Figure 3.12: Integrin mRNA and protein expression in prostate cancer cell lines

(A) mRNA expression of integrin alpha and beta subunits in RWPE1, derived from normal prostate, its tumourigenic derivative, RWPE2 and the prostate cancer cell lines 22Rv1, LNCaP, DU145, PC-3, PC-3M and PC-3 MM2 as determined by Q-PCR. Values represent transcript number relative to 1000 copies of Beta actin from one independent screen. Integrin β1 showed the highest expression and was further analysed by Western blotting. (B) Total cell lysates (100 μg) were electrophoresed on a 7.5% SDS-PAGE gel, transferred to a nitrocellulose membrane and blotted with integrin β1 antibody. Beta actin was included as a loading control. (C) Densitometry performed for the Western blot from (B).


62

3.3.3.3Srcfamilykinases

The Src family is a group of non-receptor protein tyrosine kinases that have already

been shown to be downstream targets of both Eph receptor and ephrin ligand

signalling, in particular Src and Fyn (Davy et al, 1999; Parri et al, 2007). To explore

the relationship between the Eph receptor tyrosine kinases and Src family kinases, in

prostate cancer, Q-PCR and Western blotting were used to assess expression of these

genes in the cohort of prostate cancer cell lines. mRNA expression of Src, Fyn and

Lyn was variable across all cell lines with overall levels relatively low (Figure

3.13A). Src protein expression appeared to be considerably even across all cell lines

while Fyn protein expression was low for 22Rv1, LNCaP, DU145 and PC-3 cells

(Figure 3.13B and 3.13C).


63

Src Fyn Lyn0

2

4

6

8

10RWPE1RWPE2

22Rv1LNCaP


Tra

nscr

ipt

# pe

r 10

00 -

acti

n

A

B

Src

β-actin

Fyn

β-actin

Fyn


0.05

0.10

0.15

0.20

Fyn

/ -

acti

nra

tio

Src


0.5

1.0

1.5

2.0

Src

/ -

acti

nra

tio

C

Figure 3.13: Src family kinase mRNA and protein expression

(A) mRNA expression of individual Src family members including Src, Fyn and Lyn in RWPE1, derived from normal prostate, its tumourigenic derivative, RWPE2 and the prostate cancer cell lines 22Rv1, LNCaP, DU145, PC-3, PC-3M and PC-3 MM2 as determined by Q-PCR. Values represent transcript number relative to 1000 copies of Beta actin from one independent screen. (B) Western blot analysis on whole cell lysates to determine Src and Fyn protein expression. Beta actin was included as a loading control. (C) Densitometry performed for the Western blots from (B).


64

3.4Discussion

Whilst not providing a comprehensive analysis in PCa, in part due to lack of suitable

reagents and in part due to limitations of access to clinical material, the current study

has established gene expression profiles for the Eph receptor tyrosine kinase family

in a series of prostate cancer cell lines using Q-PCR. High levels of expression of

EphA2, EphA3, EphB4, ephrin-A1, ephrin-A5 and ephrin-B1 were observed. The

most striking observation was the significant over expression of either the EphA2 or

the EphA3 receptor in individual tumour cell lines. An inverse correlation was

observed although the number of cell lines in this study was small. EphA3 was

predominantly expressed in the androgen responsive cell lines, 22Rv1 and LNCaP,

while EphA2 was predominantly expressed in the androgen independent cell lines,

DU145, PC-3, PC-3M and PC-3MM2. Regulation of EphA2 and EphA3 expression

by androgen will be explored in Chapter 4. Their high affinity ligands, ephrin-A1 and

ephrin-A5 were also elevated although to a lesser degree than the receptors.

Expression of the ephrin-A ligands appeared to be more apparent in the androgen

responsive cell lines.

To further explore these findings, Western blotting was used to assess protein

expression levels in these cell lines. EphA2 and EphA3 protein expression correlated

with mRNA expression for all cell lines. Immunocytochemistry revealed membrane

localisation for both receptors however, EphA2 showed even expression while

EphA3 appeared to be present in clusters with strongest expression observed at the

end of cellular extensions. The staining pattern of ephrin-A1 and ephrin-A5 suggests

that they are situated on the cell membrane in clusters. These results are similar to

those reported for ephrin-A5 artificially over expressed in NIH-3T3 cells (Davy et al,

1999).

Following the cell line study, EphA2, EphA3, ephrin-A1 and ephrin-A5 were chosen

to screen seven BPH and 13 PCa tissue samples as well as a Q-PCR tissue array

using Q-PCR. As with the cell lines variable levels of expression for all four genes

were observed in the tissue samples. EphA2 and ephrin-A5 expression was increased

in individual tumour samples compared to controls however no significant

differences were identified between the normal, BPH and PCa groups.


65

Ephrin-A1 expression in tumour samples was increased compared to the BPH

controls. This was significant in the individual clinical samples. Previous studies

have demonstrated a correlation between increased levels of ephrin-A1 and poor

prognosis (Herath et al, 2006; Straume & Akslen, 2002). Further investigations are

required to determine if this correlation is present in a larger cohort of prostate

adenocarcinomas.

Increased EphA3 expression was observed in a small subset of cell line and tissue

samples. Interestingly, in the cell lines and individual BPH clinical samples EphA3

expression appeared to be either high or low. The human EphA3 receptor was

initially discovered as an over-expressed gene in leukaemia (Boyd et al, 1992) and

its expression is frequently elevated in melanoma, lung and renal carcinomas (Chiari

et al, 2000). However, in some leukaemias and lymphomas EphA3 has been shown

to be subject to epigenetic silencing through methylation of the EphA3 core promoter

(Dottori et al, 1999). EphA3 expression was also shown to be regulated by

methylation in the prostate cancer cell line, CPTX (Fox et al, 2006). Based on

previous data, it is possible that EphA3 may be suppressed in some prostate cancers

through epigenetic silencing of gene expression.

A significant limitation of this study was the inability to confirm/quantify Eph/ephrin

protein expression in prostate cancer tissue samples. Q-PCR results show evidence

that EphA2, EphA3, ephrin-A1 and ephrin-A5 are expressed at the mRNA level in

individual clinical samples, however; this could not be confirmed at the protein level

using immunohistochemistry. Previous work from our laboratory, in other tissue

types e.g. colon cancer, and collaborations with other laboratories also trying to

achieve staining in tissue samples, particularly for EphA3, suggest that this is most

likely a result of difficulties with optimisation and inadequate sensitivity of the

currently available antibodies for Eph and ephrins on fixed tissue samples. For

example, ephrin-A1 showed the highest levels of expression in the Q-PCR screen

however positive staining in tissue using DAB as a substrate was not achieved. The

use of a reportedly more sensitive substrate, RealBlue peroxidase, resulted in some

positive staining for ephrin-A1 in tissue samples however, background staining was a

problem. These results suggest that further optimisation and/or development of new


66

Eph/ephrin antibodies for use in immunohistochemistry is required. A possible

alternative approach is Western blot analysis of laser capture microdissected samples

to restrict analysis to the cell type of interest e.g. epithelial prostate cancer cells.

However, this would be even more technically challenging if a comprehensive

analysis of PCa was envisaged.

The lack of tissue available for both mRNA and protein expression studies meant

that trends observed in the Q-PCR screen could not be fully explored at the protein

level. Samples showing high levels of Eph/ephrin expression in the Q-PCR screen

could not be used to identify Eph/ephrin expression at the protein level and direct

correlation between mRNA and protein could not be performed. Although

immunohistochemical analysis was performed on a different cohort of samples it

allowed the identification of cellular staining patterns such as those observed for

EphA3. The high and low expression of EphA3 in BPH tissue may be explained by

the positive and negative staining of EphA3 in the stroma. The knowledge obtained

in this study for staining Eph and ephrins on fixed tissue will aid future studies in

performing immunohistochemical quantitation on prostate cancer tissues.

The preliminary expression profile obtained from clinical samples has been sufficient

to identify increased expression of Eph and ephrins in individual tumours. However,

expression patterns could not be related to clinical staging, Gleason score, survival or

other clinical data due to incomplete documentation of clinical data and the small

number of samples in this cohort. The apparent exclusive expression of EphA2 or

EphA3 in cell lines and possible relation to stage are not able to be assessed from a

clinical context in the limited clinical samples so far assessed. These studies are

critical in determining the possible scope of targeted therapies.

In addition to Eph and ephrin expression this study also set out to examine the

expression of potential downstream targets of Eph-ephrin signalling including

integrin, Rho and Src family members. Q-PCR and Western blotting showed

increased levels of RhoA, Rac1, Cdc42, Src, Fyn and Integrin β1. These genes will

now be used in signalling studies to determine their role in prostate cancer cell

proliferation, adhesion and migration in response to Eph-ephrin signalling.


67

The overall aim of this chapter was to provide a descriptive identification of Eph

receptors and ephrin ligands expressed in prostate cancer and also to determine

expression of some of their known downstream targets. Based on the results

obtained, this aim has not yet been achieved and is a work in progress. The

remaining chapters of this thesis will focus on exploring the functional role of Eph

and ephrin proteins using cell lines. EphA2 and EphA3 in prostate cancer will be

discussed in Chapter 4. Although there appears to be high ephrin-A1 expression in

the cell lines and tissue samples, preliminary results demonstrated a role for ephrin-

A5 but not ephrin-A1 in cell adhesion. Therefore Chapter 5 will focus on the

potential role of ephrin-A5 in the regulation of cell adhesion in prostate cancer.

Future studies to further investigate ephrin-A1 expression and function in prostate

cancer are needed. Furthermore, EphB4 and ephrin-B1 also showed increased

expression in individual cell lines. However as my focus was EphA and ephrin-A

function in prostate cancer they were not further explored. It would be beneficial to

correlate the mRNA levels identified with protein and also to evaluate their

expression in tissue samples. Exploring the potential roles of these genes may reveal

new insights into the formation and progression of prostate cancer leading to new

therapeutic targets.

Chapter 4 – EphA2 and EphA3

68

Chapter4–EphA2andEphA3

4.1IntroductionThe Eph receptor tyrosine kinase family, together with their membrane bound ephrin

ligands, form a complex bi-directional signalling system. As mentioned previously

interactions between Eph receptors and ephrin ligands are promiscuous and therefore

provide a basis for partial functional redundancy. This can make data difficult to

interpret when altering expression of one receptor in order to identify functional

changes. The reciprocal expression pattern of EphA2 and EphA3 identified in

prostate cancer cell lines (Chapter 3) provides a unique opportunity to identify

similarities and differences between these two receptors in prostate cancer formation

and progression.

Over expression of EphA2 and/or EphA3 has been reported in a number of

malignancies including breast, colon, prostate, ovarian and lung cancer (Chiari et al,

2000; Fox et al, 2006; Hafner et al, 2004; Herath et al, 2006; Kinch & Carles-Kinch,

2003). The role of EphA2 in human malignancies has been extensively studied with

evidence suggesting both a complex and seemingly contradictory role. EphA3 has

not received as much attention as EphA2 however data also suggest a potential role

in tumour promotion.

As reviewed in Chapter 1, the Eph receptor tyrosine kinase family plays an important

role in altering cell adhesion and motility in developmental processes. The re-

emergence of Eph and ephrin expression in human cancers has led to the notion that

the underlying mechanisms involved in developmental patterning may also be

responsible for processes involved in metastasis. Of particular interest, as a result of

the expression data reported in Chapter 3, EphA2 and EphA3 have both previously

been implicated in changes to cell adhesion and motility. Activation of EphA2 in

prostate cancer cells and EphA3 in melanoma cells resulted in cell rounding and de-

adhesion (Lawrenson et al, 2002; Miao et al, 2000). Reduced EphA3 expression in

rhabdomyosarcoma cells increased cell motility (Clifford et al, 2008) while reduced

EphA2 expression in glioma cells decreased cell motility (Miao et al, 2009). EphA2


69

over expression has also been associated with malignant transformation in the breast

cancer cell line MCF-10A (Zelinski et al, 2001).

There is increasing evidence of Eph receptors having both tumour promoting and

tumour suppressing activity (Chen et al, 2008; Dopeso et al, 2009; Kumar et al,

2007; Miao et al, 2009). In this regard, it is important to note that Eph receptors can

function in both a ligand -dependent and -independent manner (Chen et al, 2008;

Miao et al, 2009). This has led to a focus on exploring both the expression and

activation status of the receptor. This was highlighted in a recent study that reported

differing roles of EphA2 in glioblastoma. EphA2 over expression resulted in

increased cell migration independent of ligand stimulation while activation of EphA2

with ligand decreased cell migration (Miao et al, 2009).

This chapter will explore the specific roles of EphA2 and EphA3 in prostate cancer

cell proliferation, adhesion, migration and invasion. Results show cells expressing

EphA2 have a greater capacity for migration and invasion compared to cells

expressing EphA3. To further analyse their roles in prostate cancer, EphA2 and

EphA3 were either over expressed or down regulated in LNCaP and PC-3 cells.

Forced expression of EphA2 in the LNCaP cell line resulted in a more invasive

phenotype while forced expression of EphA3 in the PC-3 cell line resulted in a less

invasive phenotype. Activation of EphA2 resulted in changes to the activation status

of Rho family members, including RhoA and Rac1, associated with reorganisation of

the actin cytoskeleton. A decrease in invasion of PC-3 cells as a result of EphA2

activation was also observed.

The identification of mediators of prostate cancer metastasis may provide new

therapeutic targets. These results suggest differing roles for EphA2 and EphA3 in

prostate cancer progression and suggest that they may be potential tumour

biomarkers.


70




4.2.1Androgenstimulationstudies

Cells were grown in phenol red free RPMI supplemented with 10% charcoal stripped

FBS for 48 hours prior to addition of 5-dihydrotestosterone (DHT) (Sigma-Aldrich,

Australia) at 1 nM and 10 nM concentrations. Ethanol was used as a vehicle control.

Cells were harvested after 24 hours of treatment and total RNA extracted using a

QIAGEN RNeasy kit (Qiagen Pty Ltd) followed by cDNA synthesis using

Superscript III Reverse Transcriptase; refer to Chapter 2 for complete method. Q-

PCR was used to determine Eph expression. PSA was measured in parallel by Q-

PCR to verify DHT activity.

4.2.2EphA2andEphA3constructs

EphA2 prc/cmv1 was generously provided by Dr Bingcheng Wang (Case Western

Reserve University, Cleveland, OH, USA). The entire EphA2 coding sequence

(NCBI Reference sequence, NM_004431.3) was verified by sequencing.

EphA3 pIRES2 DsRed-Express was made (in house) by Dr Brett Stringer. Briefly,

the entire EphA3 coding sequence (NCBI Reference sequence, NM_005233.5) was

cloned into the pIRES2 DsRed-Express vector (BD Biosciences).

4.2.3ShorthairpinRNA(shRNA)

EphA3 shRNA pSuperior.neo+gfp was made (in house) by Dr Michael Ting and Dr

Bryan Day. The target EphA3 shRNA coding sequence was: 5’-GAT CCC CGA

TCA TCA GTA GCA TTA AAT TCA AGA GAT TTA ATG CTA CTG ATG

ATC TTT TTA–3’. Briefly, paired oligonucleotides containing a 19 nucleotide

sequence from EphA3 (in bold) were annealed and then ligated into linearised

pSuperior.neo+gfp (Oligoengine, USA) according to manufacturer’s instructions.


71

4.2.4Transwellmigrationassay

Cultures were serum starved overnight and cells de-adhered using 5 mM EDTA,

washed and resuspended at 4 × 105 cells/ml in serum free medium containing 0.1%

BSA. 250 µl of cell suspension was added to the upper chamber of a 24-transwell

insert with 8 μm pore size (Costar, NY) and 500 µl of medium containing 10% FBS

added to the lower chamber as the chemoattractant. As a control for chemokinesis

10% FBS was added to both the upper and lower chamber. Plates were incubated

overnight at 37οC. Cells were removed from the upper surface of the insert using a

cotton tip. Remaining cells on the lower surface of the insert were fixed in ice-cold

methanol for 15 minutes then stained in 0.1% crystal violet for 15 minutes. Inserts

were washed in running tap water and transferred to new wells. Images of five

random fields were taken on a Leica IM1000 microscope at x150 magnification.

4.2.5EphA2/EphA3activationstudies

Cells were serum starved overnight when they were approximately 70% confluent.

The layer of cells was wounded with a multi-channel pipette and incubated for 4-8

hours. Cells were treated with 1 µg/ml of pre-clustered ephrin-A5-Fc for the

indicated time points. Pre-clustering involved incubation of ephrin-A5-Fc (fusion

protein between the extracellular domain of ephrin-A5 and the Fc fragment of human

IgG1) with anti-human IgG, at a 2:1 molar ratio for one hour at 4°C, to form

oligomeric complexes required for Eph activation. Ephrin-A1-Fc was not used in

these studies as it was shown to be highly unstable at room temperature (unpublished

data from the Boyd Laboratory).

Cell lysis and Western blotting were performed as outlined in Chapter 2.

Immunoprecipitations of GTP-bound RhoA, using Rhotekin-RBD agarose (Upstate)

and GTP-bound Rac1, using Human PAK-1 PBD GST fusion beads (Chemicon

International) were performed according to manufacturer’s instructions.


72

4.3Results

As shown in Chapter 3, high levels of EphA2 or EphA3, but not both together, were

observed in prostate cancer cell lines. This chapter aims to define similarities and

differences in EphA2 and EphA3 function. This was explored in two parts, a

functional analysis and an exploration of the signalling pathways downstream of

each receptor.

The cell lines chosen for this section include two EphA2 expressing cell lines, PC-3

and DU145, and two EphA3 expressing cell lines, LNCaP and 22Rv1. EphA2 and

EphA3 were also over expressed or down regulated in the LNCaP and PC-3 cell

lines. These cells were tested for changes in morphology, proliferation, migration

and invasion in order to determine direct effects of changes in EphA2 or EphA3

expression.

4.3.1RegulationofEphA2andEphA3expressionbyandrogen

Based on the observation that the androgen responsive cell lines express EphA3

while the androgen independent cell lines express EphA2, I set out to explore a

possible link between the androgen receptor and Eph receptor expression. The

androgen receptor is a member of the nuclear hormone receptor superfamily. Upon

androgen binding the receptor complex dimerises, translocates into the nucleus and

binds to specific DNA sequences called androgen response elements (ARE) that

regulate genes involved in cell proliferation and apoptosis (Agoulnik & Weigel,

2006).

Bioinformatic analysis of the human EphA2 and EphA3 receptor gene loci, including

100 kb of flanking genomic DNA sequence, was performed to seek locations of

possible ARE using published ARE consensus sequences: 5’-

AGAACANNNTGTTCT-3’ and 5’-GGTACANNNTGTTCT-3’ (Roche et al, 1992).

A potential ARE was found in intron 1 of the EphA3 receptor with the sequence: 5’-

AGAACACACTTTTTCT-3’. No ARE was identified in the EphA2 receptor

sequence however, a potential ARE was found within the 100 kb flanking region

downstream of the receptor.


73

To determine if androgens are able to affect Eph expression, cells were treated with

5-dihydrotestosterone (DHT) at 1 nM and 10 nM concentrations. Cells were

harvested after 24 hours of treatment and total RNA was extracted and cDNA

synthesised for analysis by Q-PCR. PSA expression, which is up-regulated by DHT,

was used as a control. The initial screen consisted of EphA3 expressing cell lines,

LNCaP and 22Rv1 (both androgen responsive) and EphA2 expressing cell lines PC-3

and DU145 (both androgen independent). Data from this screen are shown in Figure

4.1.

PSA levels increased by greater than two-fold in 22Rv1 cells (Figure 4.1A) and 20-

fold in LNCaP cells (Figure 4.1B) in response to DHT. However, EphA3 expression

remained unaffected for both concentrations of DHT (Figure 4.1C & 4.1D). As

expected, as both PC-3 and DU145 cells are non-responsive to androgens, no effects

were seen on EphA2 in these lines (Figure 4.1E & 4.1F). A second screen including

LNCaP and PC-3 cells was performed with similar results.


74

22Rv1

Control 1 nM 10 nM0

1

2

3Fo

ld c

hang

e fr

om c

ontr

olP

SA m

RN

A

LNCaP

Control 1 nM 10 nM0

10

20

30

40

Fold

cha

nge

from

con

trol

PSA

mR

NA

PC-3

Control 1 nM 10 nM0.0

0.5

1.0

1.5

2.0

Fold

cha

nge

from

con

trol

Eph

A2

mR

NA

DU145


0.5

1.0

1.5

2.0

Fold

cha

nge

from

con

trol

Eph

A2

mR

NA

LNCaP


0.5

1.0

1.5

2.0

Fold

cha

nge

from

con

trol

Eph

A3

mR

NA

22Rv1


0.5

1.0

1.5

2.0

Fold

cha

nge

from

con

trol

Eph

A3

mR

NA

C D

A B

E F

Figure 4.1: DHT does not regulate EphA2 or EphA3 mRNA expression

(A & B) Histograms representing the fold change in PSA mRNA expression in DHT treated cells relative to vehicle control treated cells.

(C & D) Histograms representing the fold change in EphA3 mRNA expression in DHT treated cells relative to vehicle control treated cells.

(E & F) Histograms representing the fold change in EphA2 mRNA expression in DHT treated cells relative to vehicle control treated cells.

Values are representative of one independent Q-PCR screen.


75

4.3.2EphA2/EphA3overexpressionorknockdown

4.3.2.1EstablishmentofstableEphA2expressingLNCaPcells

LNCaP cells express low or no endogenous EphA2. To test functional effects of

EphA2, LNCaP cells were generated in which EphA2 was over expressed. LNCaP

cells were transfected with EphA2 prc/cmv1 or empty vector as a control.

Transfected cells were screened for EphA2 expression using FACs. Individual stable

clonal populations were isolated and EphA2 expression confirmed by Western

blotting (Figure 4.2A). Initially two EphA2 prc/cmv1 (clone 1 and 2) and empty

vector clones were selected for functional analysis, however due to clonal variation

in the functional assays a further two EphA2 prc/cmv1 clones (clone 3 and 4) were

isolated, as well as a stable EphA2 expressing polyclonal population.

Immunocytochemistry was performed to assess the site of cellular localisation of the

elevated levels of EphA2 (Figure 4.2B). LNCaP EphA2 transfected cells showed

high intensity staining, EphA2 appeared to be localised to the membrane with

uniform expression.

EphA2 prc/cmv1prc/cmv1

EphA2

β-actinLNCaP EphA2 prc/cmv1 – clone 2

EphA2Brightfield

B

30 µm

Figure 4.2: EphA2 expression in transfected LNCaP cells

(A) EphA2 expression was detected in the EphA2 transfected LNCaP cells by Western blotting with mouse anti-EphA2 clone D7 antibody. PC-3 cells, which endogenously express EphA2, were used as a positive control for EphA2 expression.

(B) EphA2 expression in transfected LNCaP cells detected with mouse anti-EphA2 monoclonal antibody (in house) followed by a FITC-conjugated anti-mouse secondary antibody.


76

4.3.2.2EstablishmentofstableEphA3expressingPC‐3cells

Similarly, non-EphA3 expressing PC-3 cells were engineered to over express

EphA3. PC-3 cells were transfected with EphA3 pIRES2 DsRed-Express or empty

vector as a control. Transfected cells were screened for high EphA3 expression using

FACs. Individual stable clonal populations were isolated and EphA3 expression

confirmed by Western blotting (Figure 4.3A) and Immunocytochemistry (Figure

4.3B). Due to the clonal variation encountered with the EphA2 transfected cell lines

two PC-3 EphA3 pIRES2 clones were isolated and tested alongside a separate

polyclonal population. However, during the course of testing the cells for functional

changes, the EphA3 pIRES2 clone 2 showed dramatic changes in cellular

morphology and proliferation, greatly different from both clone 1 and the polyclonal

population suggesting insertional effects in clone 2. Therefore this clone was

excluded from further study.

AEphA3 pIRES2pIRES2

B

PC-3 EphA3 pIRES2 - polyclonal

EphA3Brightfield

5 µm

Figure 4.3: EphA3 expression in transfected PC-3 cells

(A) EphA3 expression was detected in the EphA3 transfected PC-3 cells by Western blotting with a rabbit anti-EphA3 antibody (in house).

(B) EphA3 expression in EphA3 transfected PC-3 cells detected with mouse anti-EphA3 monoclonal antibody conjugated to Alexa Fluor 488 (in house) at 4°C. Cells were fixed with 4% PFA and images taken with a Delta Vision deconvolution microscope.


77

4.3.2.3EstablishmentofstableEphA3knockdowninLNCaPcells

LNCaP cells were transfected with luciferase shRNA, as a control, or EphA3 shRNA

in a pSuperior.neo+gfp vector. Cells were screened for high GFP expression using

FACs. Individual stable clonal populations were isolated and EphA3 expression

confirmed by Western blotting (Figure 4.4). The three clones selected for further

analysis showed greater than 70% knockdown by Western blotting.

Luciferase shRNA

EphA3 shRNA

EphA3

β-actin

A

B

LNCaP clone 1 clone 2 clone 1 clone 2 clone 30

20

40

60

80

100

120

Eph

A3

/ -

acti

n ra

tio

EphA3 shRNA

Luciferase shRNA

Figure 4.4: EphA3 knockdown in LNCaP cells

(A) Decreased EphA3 expression in LNCaP cells transfected with EphA3 shRNA compared to parental and LNCaP luciferase shRNA control cells as detected by Western blotting with rabbit anti-EphA3 antibody (in house).

(B) Densitometry performed for the Western blot from (A).


78

4.3.2.4StableEphA2knockdowncouldnotbeestablishedinPC‐3cells

PC-3 cells were successfully transfected with four EphA2 shRNA sequences in a

pRS vector which also conferred expression of GFP. Cells were sorted three times by

FACs for stable GFP expressing cells. No EphA2 knockdown was observed for any

of the four sequences. The transfection was repeated with similar results. The four

EphA2 shRNA sequences were tested in two LNCaP EphA2 transfected clones. Two

sequences showed approximately 50% knockdown. This level of knockdown was not

observed in the PC-3 cell line.

A further two EphA2 shRNA sequences in a pSuperior.neo+gfp vector were tested.

Similarly no knockdown was observed. In an alternative approach, PC-3 cells were

transfected with a tetracycline repressor construct followed by the EphA2 shRNA

pSuperior.neo+gfp vector to establish a tetracycline inducible system for knockdown

of EphA2. A small level of transient knockdown was observed after 48 hours.

However this was considered insufficient to provide reliable results in the functional

assays. Therefore alternative methods for successful knockdown of EphA2 are

required. This aspect of the study was not further pursued, due to time constraints.

4.3.2.5 Co‐localisationofEphA2andEphA3

In Chapter 3, the expression of EphA2 and EphA3, whilst located to the membrane,

showed different staining patterns in different cell lines. EphA3 appeared in clusters

while EphA2 had a more uniform expression. To determine the site of cellular

localisation of EphA2 and EphA3 in transfected cell lines dual immunofluorescent

staining was performed on LNCaP cells transfected with EphA2 (Figure 4.5A) and

PC-3 cells transfected with EphA3 (Figure 4.5B). EphA2 and EphA3 show co-

localisation in some areas along the cell membrane, however there does not appear to

be a consistent co-localisation pattern between the two receptors.


79

EphA2 EphA3

DAPIBrightfield Overlay

PC-3 EphA3 pIRES2 – polyclonal

LNCaP EphA2 prc/cmv1 – clone 2

EphA2 EphA3

DAPIBrightfield Overlay

A

B

25 µm

15 µm

Figure 4.5: EphA2 and EphA3 co-localisation

(A) EphA2/EphA3 co-localisation in EphA2 transfected LNCaP cells detected by immunocytochemistry with mouse anti-EphA3 monoclonal antibody (in house) followed by Alexa 546-conjugated anti-mouse secondary antibody. Cells were then stained with mouse anti-EphA2 monoclonal antibody conjugated to FITC (in house). Images were taken with a Leica TCS SP2 confocal scanning microscope.

(B) EphA2/EphA3 co-localisation in EphA3 transfected PC-3 cells detected by immunocytochemistry with mouse anti-EphA2 monoclonal antibody (in house) followed by Alexa 546-conjugated anti-mouse secondary antibody. Cells were then stained with mouse anti-EphA3 monoclonal antibody conjugated to Alexa Fluor 488 (in house). Images were taken with a Delta Vision deconvolution microscope.


80

4.3.3EffectofEphA2andEphA3modulationoncellmorphology

The two endogenously expressing EphA3 cell lines (22Rv1 and LNCaP) have a

triangular elongated, fibroblastic shape with extended processes while the two

natural EphA2 expressing cell lines (DU145 and PC-3) have a more rounded

morphology (Figure 4.6A). DU145 and PC-3 cells show signs of active migration in

monolayer culture with lamellipodia and filopodia formation (Figure 4.6B).

LNCaP cells transfected with EphA2 had a more rounded morphology than the

parental cells (Figure 4.7). Some cells still maintained the triangular shape present in

the parental cells but the majority of cells were rounded with smaller processes.

Empty vector control cells show similar morphology to the parental cells.

No changes in cell morphology were observed in the LNCaP EphA3 shRNA or PC-3

EphA3 pIRES2 cells compared to vector control and parental cells (Figure 4.8A and

4.8B).

22Rv1 PC-3DU145LNCaP

A

PC-3

B

DU145

Figure 4.6: Cell morphology of parental cell lines

Cells were grown in a 24-well plate and fixed with 4% paraformaldehyde. (A) The EphA3 expressing cell lines, 22Rv1 and LNCaP, have a triangular elongated shape while the two EphA2 expressing cell lines, DU145 and PC-3, have a more rounded morphology. (B) Filopodia and lamellipodia formation in PC-3 and DU145 cells. Images were taken with a Delta Vision deconvolution microscope.


81

LNCaP EphA2 prc/cmv1

clone 1 clone 2

LNCaP prc/cmv1

clone 1 clone 2

LNCaP

clone 3 clone 4

LNCaP EphA2 prc/cmv1

Figure 4.7: Cell morphology of LNCaP EphA2 transfected cells

Cells were grown in a 24-well plate, fixed with 4% paraformaldehyde and images taken with a Delta Vision deconvolution microscope. LNCaP cells transfected with EphA2 show a more rounded morphology than the parental and vector control cells.


82

LNCaP EphA3 shRNA

clone 1 clone 2 clone 3

polyclonal clone 1

PC-3 EphA3 pIRES2

A

B

LNCaP Luciferase shRNA

clone 1 clone 2LNCaP

PC-3 pIRES2

polyclonal clone 1PC-3

Figure 4.8: Cell morphology of EphA3 and EphA3 shRNA transfected cell lines

(A) LNCaP cells transfected with EphA3 shRNA and (B) PC-3 cells transfected with EphA3 were grown in a 24-well plate, fixed with 4% paraformaldehyde and images taken with a Delta Vision deconvolution microscope. No changes in cell morphology were observed between parental and transfected cells.


83

4.3.4 EphA2 and EphA3 expression do not affect cell

proliferation

To determine relative cell proliferation rates between EphA2 and EphA3 expressing

cells an MTS assay was performed. Cells were grown in a 96-well plate for 72 hours.

There did not appear to be a correlation between Eph expression and proliferation in

this cohort of cells. LNCaP and PC-3 cells proliferate at similar levels while 22Rv1

proliferate more slowly and DU145 proliferate more rapidly (Figure 4.9A).

No significant differences were observed in cell proliferation for LNCaP EphA2

transfected cells (Figure 4.9B). Similarly, neither LNCaP EphA3 knockdown (Figure

4.9C) nor PC-3 EphA3 transfected (Figure 4.9D) cells show alteration in

proliferation. These results suggest that neither EphA2 nor EphA3 affect prostate

cancer cell proliferation in the cell lines studied.

4.3.5 EphA2 expressing cells show enhanced migration and

invasioncomparedtoEphA3expressingcells

To investigate the role of EphA2 and EphA3 in cell movement and invasion, in vitro

wound assays and Matrigel™ invasion assays were performed. In the in vitro wound

assay, to prevent cell proliferation contributing to wound closure, cells were treated

with mitomycin C, a mitosis blocker, prior to wounding. The two EphA2 expressing

cell lines, PC-3 and DU145, were able to migrate into the wound with full wound

closure observed for both cell lines by 24 hours. However, the two EphA3 expressing

cell lines, 22Rv1 and LNCaP, showed lower levels of migration with approximately

25% and 50% wound closure observed after 24 hours, respectively (Figure 4.10A

and 4.10B).

In the Matrigel™ invasion assay, PC-3 and DU145 cells showed higher levels of

invasion (> five-fold) compared to 22Rv1 and LNCaP cells in response to 10% FBS

as a chemoattractant. After 24 hours the entire underside of the chamber insert was

covered by DU145 cells and greater than 50% by PC-3 cells (Figure 4.10C and

4.10D).


84

PC-3

polyc

lona

l

clone

1

polyc

lona

l

clone

1

0.0

0.5

1.0

1.5

2.0O

D a

t 490

nm

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

clone

4

0.0

0.5

1.0

1.5

2.0

OD

at 4

90 n

m

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

OD

at 4

90 n

m

22Rv1 LNCaP DU145 PC-30.0

0.5

1.0

1.5

2.0O

D a

t 490

nm

prc/cmv1 EphA2prc/cmv1

C

A

D

B

LuciferaseshRNA

EphA3shRNA pIRES2 EphA3

pIRES2

Figure 4.9: Prostate cancer cell proliferation

Histograms representing cell proliferation of (A) parental, (B) EphA2 transfected LNCaP, (C) LNCaP EphA3 knockdown and (D) EphA3 transfected PC-3 cells using an MTS assay. 3 × 103 cells were added per well in a 96-well plate and allowed to grow for 72 hours. Values represent OD readings at 490 nm (mean + s.d. from triplicate wells from three independent experiments).


85

C

22Rv1 LNCaP DU145 PC-30

200

400

600

800

1000

# C

ells

per

fie

ld

22Rv1 LNCaP DU145 PC-30

20

40

60

80

100

120

% W

ound

clo

sure

0 hr

24 hr

A

B

D

Figure 4.10: Prostate cancer cell migration and invasion

(A) Wound assay images, at 20× magnification, of the EphA3 expressing cell lines, 22Rv1 and LNCaP, and the EphA2 expressing cell lines, DU145 and PC-3, at 0 and 24 hours. (B) Histogram representing cell migration. Values represent percentage area of wound closure over 24 hours (mean + s.d. from triplicate wells from three independent experiments).

(C) Invasion assay images, at 150× magnification, of the underside of the transwell membrane of 22Rv1, LNCaP, DU145 and PC-3 cells after 24 hours stained with 0.1% crystal violet. (D) Histogram representing cell invasion. Values represent the number of cells per field that invaded through the Matrigel™ membrane (mean + s.d. from triplicate wells from three independent experiments).


86

For, the EphA3 expressing cells, LNCaP and 22Rv1, both assays showed lower

levels of migration/invasion compared to the high EphA2 expressing cells, PC-3 and

DU145, raising the possibility that EphA2 expression enhances cell invasiveness.

To investigate this possibility EphA2 transfected LNCaP cells were tested using a

Matrigel™ invasion assay. The transfected LNCaP cells showed an increase in

invasion, ranging from 2 to 18 fold, while empty vector controls were no different

from the parental cell line (Figure 4.11A and 4.11B). The level of invasion was

variable among the four EphA2 transfected clones. Initially only two clones (1 and 2)

were tested however due to the difference in the level of invasion a further two

clones (3 and 4) were tested. Similarly a large difference in the level of invasion

between the two clones was observed. A polyclonal population then was tested

which showed a five-fold increase in invasion. Thus, although there was clonal

variation in the level of invasion, all of the EphA2 transfected LNCaP cells showed

some increase in invasion compared to the parental cell line and vector control cells.

This was statistically significant for LNCaP EphA2 prc/cmv1 clones 2, 3 and 4

(p<0.05, t-test).

In vitro wound assays were performed to determine if EphA2 over expression leads

to an increase in cell migration. Interestingly, LNCaP EphA2 expressing cells

showed rounding and clumping when grown on a fibronectin coated surface for 24

hours (data not shown). Due to the cell rounding, wound assays could not be used to

determine migration. This effect was not seen for DU145 and PC-3 cells suggesting

that it is not EphA2 specific. Alternatively, cells were tested using a transwell

migration assay. Due to changes in the manufacturing of commercial transwell

inserts only preliminary experiments have been performed. All LNCaP cells

expressing EphA2 showed an increase in migration compared to parental and vector

control cells (Figure 4.11C). These data suggest that EphA2 may play a role in

prostate cancer cell migration.


87

LNCaP

clone

1

clone

2

clone

1

clone

2PC-3

clone

3

clone

4

LNCaP

poly

cl0

100

200

300

400

# C

ells

per

fie

ld

*

*

*

EphA2prc/cmv1

prc/cmv1 EphA2prc/cmv1

EphA2prc/cmv1

B

A

LNCaP

prc/cmv1 EphA2 prc/cmv1

clone 1 clone 2 clone 1 clone 2 clone 3 clone 4 poly cl

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

clone

4

0

20

40

60

80

100

# C

ells

per

fie

ld

C

EphA2 prc/cmv1prc/cmv1

Figure 4.11: EphA2 transfected LNCaP cell migration and invasion

(A) Invasion assay images, at 150× magnification, of the underside of the transwell membrane of LNCaP, empty vector and EphA2 prc/cmv1 cells stained with 0.1% crystal violet.

(B) Histogram representing cell invasion. Values represent the number of cells per field that invaded through the MatrigelTM membrane (mean + s.d. from triplicate wells from three independent experiments). *Indicates statistically significant difference (p<0.05, t-test) between the parental and EphA2 transfected LNCaP cells.

(C) Histogram representing cell migration. Values represent the number of cells per field that migrated through the membrane towards 10% FBS in the lower chamber – the number of cells per field that migrated through the membrane with 10% FBS in the upper and lower chamber (mean + s.d. from triplicate wells).


88

To determine if EphA3 expression is also able to affect cell migration and invasion

LNCaP EphA3 shRNA cells were tested with a wound and Matrigel™ invasion

assay. LNCaP EphA3 shRNA cells show no change in migration or invasion when

compared to the parental or luciferase shRNA control cells (Figure 4.12A and

4.12B). As parental LNCaP cells show low levels of invasion, an alternative

approach using PC-3 cells transfected with EphA3 was tested to determine if EphA3

has a negative effect on migration and invasion.

In the in vitro wound assay, the polyclonal population of PC-3 cells expressing

EphA3 showed a statistically significant decrease (approximately 25%) in wound

closure compared to the parental cells (p=0.0179, t-test). A small decrease

(approximately 10%) was also observed for clone 1 however, this was not

significant. The vector control cells showed similar levels of wound closure to the

parental cell line (Figure 4.12C).

In the Matrigel™ invasion assay the EphA3 transfected PC-3 cells showed

approximately a 35% (polyclonal) and 60% (clone 1) reduction in invasion compared

to the parental cell line (Figure 4.12D). This was statistically significant for both

populations (polyclonal p=0.0259 and clone 1 p=0.0029, t-test). However, there was

some variability in the vector control cells compared to the parental cell line with

clone 2 showing a large increase in invasion perhaps due to insertional effects in this

clone. These results suggest that EphA3 may have a negative effect on cell migration

and invasion.


89

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

20

40

60

80

100

120

% W

ound

Clo

sure

PC-3

polyc

lonal

clone

1

polyc

lonal

clone

1

0

20

40

60

80

100

120

% W

ound

Clo

sure

PC-3

polyc

lonal

clone

1

polyc

lonal

clone

1

0

100

200

300

400

# C

ells

per

fie

ld

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

100

200

300

400

# C

ells

per

fie

ld

LuciferaseshRNA

EphA3shRNA

A B

LuciferaseshRNA

EphA3shRNA

C

pIRES2 EphA3pIRES2

pIRES2 EphA3pIRES2

D

*

**

Figure 4.12: Effect of EphA3 expression on cell migration and invasion

(A) Histogram representing cell migration in LNCaP cells with reduced EphA3. Values represent percentage area of wound closure over 24 hours (mean + s.d. from triplicate wells from three independent experiments).

(B) Histogram representing cell invasion in LNCaP cells with reduced EphA3. Values represent the number of cells per field that invaded through the MatrigelTM membrane (mean + s.d. from triplicate wells from three independent experiments).

(C) Histogram representing cell migration in EphA3 transfected PC-3 cells. Values represent percentage area of wound closure over 24 hours (mean + s.d. from triplicate wells from three independent experiments).

(D) Histogram representing cell invasion in EphA3 transfected PC-3 cells. Values represent the number of cells per field that invaded through the MatrigelTM membrane (mean + s.d. from triplicate wells from three independent experiments).

*Indicates statistically significant difference (p<0.05, t-test) between the parental and transfected cells.


90

4.3.6Integrinmediatedcelladhesion

Eph-ephrin signalling has previously been shown to regulate integrin mediated

adhesion to extracellular matrix components in other model systems (Nakada et al,

2004; Zou et al, 1999). To determine whether EphA2 or EphA3 expression may play

a role in integrin mediated cell adhesion in prostate cancer, adhesion assays were

performed on fibronectin, collagen and laminin coated surfaces. PBS coated plates

were used as a control to determine baseline adhesion while poly-l-lysine was used

as a positive control.

The two EphA3 expressing cell lines, 22Rv1 and LNCaP, show a greater than two-

fold increase in adhesion to the control, PBS, than the EphA2 expressing cell lines,

DU145 and PC-3. All cell lines show strong adhesion to the positive control, poly-l-

lysine, as well as an increase in adhesion to fibronectin (Figure 4.13). The increase in

adhesion to fibronectin compared to the PBS control was statistically significant for

LNCaP (p=0.0027, t-test) and DU145 (p=0.0068) cells which showed approximately

a two-fold and four-fold increase, respectively.

Interestingly, given the greater expression of laminin and collagen receptors on these

cells, DU145 and PC-3 cells show a large increase in adhesion to laminin (~three-

fold, DU145 and ~five-fold, PC-3) and collagen (~four-fold, DU145 and ~ten-fold,

PC-3) coated surfaces while 22Rv1 and LNCaP cells show no change in adhesion

compared to the PBS control (Figure 4.13). The increase in adhesion to laminin and

collagen was statistically significant for both PC-3 and DU145 cells (p<0.05, t-test).


91

PC-3

PBS

Fibro

necti

n

Lamin

in

Collag

en

Poly-

l-lys

ine

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

DU145

PBS

Fibro

necti

n

Lamin

in

Collag

en

Poly-

l-lys

ine

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

LNCaP

PBS

Fibro

necti

n

Lamin

in

Collag

en

Poly-

l-lys

ine

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

22Rv1

PBS

Fibro

necti

n

Lamin

in

Collag

en

Poly-

l-lys

ine

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

A B

C D

*

**

**

*

Figure 4.13: Cell adhesion in prostate cancer cell lines

96-well plates were coated with PBS, fibronectin, laminin, collagen or poly-l-lysine at 10 μg/ml. Cells were added and allowed to adhere for 30 minutes. Adhered cells were fixed and stained with crystal violet and OD measured at 590 nm. Values represent cell adhesion of the EphA3 expressing cell lines, (A) 22Rv1 and (B) LNCaP, and the EphA2 expressing cell lines, (C) DU145 and (D) PC-3, (mean + s.d. from triplicate wells from three independent assays).

*Indicates statistically significant difference (p<0.05, t-test) in adhesion between the extracellular matrix components and PBS control.


92

4.3.7EphA2/EphA3downstreamsignalling

To identify similarities and differences between EphA2 and EphA3 downstream

signalling targets PC-3 and LNCaP cells were stimulated with their common ligand,

pre-clustered ephrin-A5-Fc, followed by Western blotting with phospho-specific

antibodies for FAK, Src family kinases, PI3 kinase and integrin β1.

To determine when peak activation (i.e. tyrosine phosphorylation) occurs, LNCaP

and PC-3 cells were stimulated with pre-clustered ephrin-A5-Fc to activate EphA3

and EphA2 over a range of time points. PC-3 cells show activation of EphA2

occurring after 5 minutes with strong activation present at 10, 15 and 20 minute time

points (Figure 4.14A). LNCaP cells show activation of EphA3 at 1 and 5 minute time

points; however this declines to the level of unstimulated cells at 10 minutes (Figure

4.14B).

5’ 10’1’0’

+ + - +--- ephrin-A5-Fc

PTyr EphA

EphA3

β-actin

+ + - + - +--- ephrin-A5-Fc

PTyr EphA

EphA2

β-actin

10’ 20’15’5’0’A

B

Figure 4.14: EphA2 and EphA3 activation

Cells were treated with 1 µg/ml of pre-clustered ephrin-A5-Fc for the indicated time points for (A) EphA2 activation in PC-3 cells and (B) EphA3 activation in LNCaP cells. Total cell lysates (100 µg) were electrophoresed on a 7.5% SDS-PAGE gel, transferred to a nitrocellulose membrane and blotted with a rabbit anti-pAb to EphA2 +A3 +A4 antibody to detect tyrosine phosphorylation. Total EphA2 and EphA3 protein levels were detected using (A) mouse anti-EphA2, clone D7 and (B) rabbit anti-EphA3 (in house). Beta actin was included as a loading control.


93

Recent studies have demonstrated down-regulation of the PI3K-Akt pathway in

response to EphA2 activation (Miao et al, 2009; Yang et al, 2011). To confirm these

results and to explore the effect of EphA3 signalling on the PI3K-Akt pathway PC-3

and LNCaP cells were stimulated with pre-clustered ephrin-A5-Fc for EphA2 and

EphA3 activation respectively and the phosphorylation status of Akt was examined.

For both cell lines Akt shows strong constitutive/intrinsic activation at the zero time

point. However, upon ligand stimulation Akt becomes rapidly dephosphorylated (e.g.

after 5 minutes) in PC-3 cells (Figure 4.15A) but not LNCaP cells (Figure 4.15B).

Akt phosphorylation remained consistent in the Fc control treated cells. This

suggests that ephrin-A5 stimulation of EphA2, but not EphA3, may negatively

regulate the PI3K/Akt pathway in prostate cancer cells.

PTyr Akt

Akt

β-actin

ephrin-A5-Fc+ + - + - +---

10’ 20’15’5’0’

PC-3 LNCaP

PTyr Akt

Akt

β-actin

ephrin-A5-Fc+ + - + - +---5’ 15’10’1’0’

A B

Figure 4.15: Akt is dephosphorylated after EphA2 but not EphA3 activation

(A) PC-3 and (B) LNCaP cells were treated with pre-clustered ephrin-A5-Fc for the indicated time points for EphA2 and EphA3 activation respectively. Cells were then lysed and Western blotting of whole cell lysates was used to determine phosphorylation levels of Akt.

FAK and Src are non receptor tyrosine kinases involved in cell adhesion and

migration. FAK has already been identified as a downstream target of EphA2

signalling in PC-3 cells however results are contradictory with one study reporting an

increase (Parri et al, 2007) and the other a decrease (Miao et al, 2000) in FAK

phosphorylation. To further explore the effect of EphA2 and identify the effect of

EphA3 signalling on FAK and Src, PC-3 and LNCaP cells were stimulated with pre-

clustered ephrin-A5-Fc for the time points indicated and the phosphorylation status

of FAK and Src examined.


94

At the zero time point PC-3 cells show endogenous phosphorylation of Src at

tyrosine 418. Upon activation of EphA2 Src becomes rapidly dephosphorylated (e.g.

after 5 minutes) at this site with levels returning to baseline levels after 15 minutes

(Figure 4.16A). This result suggests that EphA2 activation leads to a transient

inactivation of Src. Alternatively, EphA3 activation in LNCaP cells does not appear

to affect Src phosphorylation at this site (Figure 4.16B).

FAK has multiple tyrosine phosphorylation sites. Tyrosine 397 is the auto

phosphorylation site while 407, 576 and 577 can be phosphorylated by Src. EphA2

activation in PC-3 cells leads to decreased phosphorylation at tyrosines 397, 407 and

577. Interestingly, a doublet at tyrosine 576 was observed upon ligand stimulation

(Figure 4.16C). EphA3 activation in LNCaP cells does not appear to affect

phosphorylation at any of these sites (Figure 4.16D).

To determine if EphA2 and EphA3 are able to affect integrin signalling, cells were

stimulated, as above, and the activation status of the most highly expressed integrin

subunit, β1, from Chapter 3 (Figure 3.12) was examined. EphA2 and EphA3

activation had no effect on integrin β1 phosphorylation status (Figure 4.16E &

4.16F).

EphA2 expression appears to be associated with increased cell migration/invasion.

However, the signalling data show that activation of EphA2 results in down

regulation of signalling pathways thought to be involved in cell migration/invasion.

As mentioned in the introduction there is increasing evidence that EphA2 can act as a

tumour suppressor or promoter depending on ligand dependent versus independent

signalling. The following experiments, 4.3.8 cell morphology, 4.3.9 Rho kinase

signalling and 4.3.10 invasion assays, were performed to determine if activation of

EphA2 has a negative effect on cell migration/invasion.


95

ephrin-A5-Fc+ + - + - +---

5’ 15’10’1’0’

PTyr Integrin β1

Integrin β1

PTyr FAK407

FAK

β-actin

PTyr FAK397

FAK

β-actin

ephrin-A5-Fc+ + - + - +---

10’ 20’15’5’0’

PTyr FAK577

FAK

β-actin

PTyr FAK576

FAK

β-actin

PC-3 LNCaP

PTyr Src418

Src

β-actin

ephrin-A5-Fc+ + - + - +---

5’ 15’10’1’0’

PTyr Src418

Src

β-actin

ephrin-A5-Fc+ + - + - +---

10’ 20’15’5’0’

PTyr FAK397

FAK

β-actin

PTyr FAK407

FAK

β-actin

PTyr FAK576

FAK

β-actin

PTyr FAK577

FAK

β-actin

ephrin-A5-Fc+ + - + - +---

5’ 15’10’1’0’

A B

C D

PTyr Integrin β1

Integrin β1

ephrin-A5-Fc+ + - + - +---

10’ 20’15’5’0’

E F

Figure 4.16: Src, FAK and integrin signalling

(A, C & E) PC-3 and (B, D & F) LNCaP cells were treated with pre-clustered ephrin-A5-Fc for the indicated time points for EphA2 and EphA3 activation respectively. Cells were then lysed and Western blotting performed with antibodies indicated on the right hand side of the figure. Beta actin was included as a loading control.


96

4.3.8EphA2activationresultsinroundedmorphology

Previous studies have shown activation of EphA2 in PC-3 cells results in cell

rounding (Miao et al, 2000; Yang et al, 2011). To confirm these data PC-3 cells were

treated with pre-clustered ephrin-A5-Fc or an Fc control for 20 minutes. The pattern

of EphA2 staining in EphA2 activated cells has not yet been reported. To investigate

this, cells were fixed with 4% PFA and stained for EphA2. Alternatively cells were

fixed, permeabilised and stained with Rhodamine phalloidin to visualise F-actin.

Similar to previous studies PC-3 cells show rounding upon activation of EphA2

(Figure 4.17A). Intriguingly, EphA2 disappears from the cell surface following

activation and accumulates around the nucleus (Figure 4.17B). Control cells, treated

with pre-clustered HuIgG, show a similar staining pattern of EphA2 as the untreated

cells, with no cell rounding obvious.

Untreated

α-Rhodamine Phalloidin

ephrin-A5-FcFc control

A

Fc control

Isotype control

Untreated

B

Untreated ephrin-A5-Fc

α-EphA2

20 µm20 µm 20 µm 20 µm

30 µm 30 µm 30 µm

Figure 4.17: EphA2 activation results in PC-3 cell rounding

PC-3 cells were treated with pre-clustered ephrin-A5-Fc for 20 minutes then fixed in 4% PFA. (A) Cells were permeabilised and stained with Rhodamine phalloidin to visualise F-actin. (B) Cells were stained with mouse anti-EphA2 monoclonal antibody (in house) followed by Alexa Fluor® 546-conjugated anti-mouse secondary antibody. EphA2 accumulates around the nucleus after stimulation with ephrin-A5.


97

4.3.9EphA2activationresultsinactivationofRhokinase

The Rho family plays a key role in reorganisation of the actin cytoskeleton (Nobes et

al, 1995). It has been shown to be important in Eph regulation of cell shape and

movement (Noren & Pasquale, 2004). To determine if Rho family signalling occurs

downstream of EphA2 in prostate cancer, PC-3 cells were treated with pre-clustered

ephrin-A5-Fc for EphA2 activation. Activation of EphA2 in the prostate cancer cell

line, PC-3, results in activation of RhoA (Figure 4.18A) and down regulation of Rac1

(Figure 4.18B). These results are in keeping with the observation that EphA2

activation in PC-3 cells led to cytoskeletal changes and retraction of cellular

processes (Figure 4.17).

GTP-Rho

Total Rho

β-actin

ephrin-A5-Fc

IP: GST-Rhotekin-RBD

+ +---10’5’0’A

GTP-Rac1

Total Rac1

β-actin

ephrin-A5-Fc

IP: GST-PBD

+ +---10’5’0’B

Figure 4.18: Rho family signalling in response to EphA2 activation

PC-3 cells were serum starved overnight then treated with pre-clustered ephrin-A5-Fc for activation of EphA2. Cells were lysed and the following immunoprecipitations performed:

(A) GST-Rhotekin-RBD beads were used to pull down GTP-bound Rho followed by Western blotting with an anti-Rho antibody.

(B) GST-PBD beads were used to pull down GTP-bound Rac1 followed by Western blotting with an anti-Rac1 antibody.

Western blotting was performed on whole cell lysates to determine (A) total Rho and (B) Rac1 levels. Beta actin was included as a loading control.


98

4.3.10EphA2activationresultsindecreasedinvasion

High level activation of Eph signalling has been associated with retraction of

filopodia and lamellipodia and condensation of the actin cytoskeleton (Miao et al,

2000), resulting in decreased invasiveness (Wykosky et al, 2005). In this respect it is

of interest that the PC-3 prostate line shows low endogenous levels of EphA2

phosphorylation (Figure 4.14A). To explore whether invasiveness could be countered

by EphA2 activation PC-3 cells were tested in a Matrigel™ invasion assay in which

ephrin-A5-Fc was placed in the lower chamber to activate EphA2. This resulted in a

40% reduction in cell invasion (p=0.0149, t-test) (Figure 4.19).

Fc control ephrin-A5-FcFc control ephrin-A5-Fc

0

100

200

300

400

# C

ells

per

fie

ld

A B

*

Figure 4.19: EphA2 activation reduces PC-3 cell invasiveness

(A) Histogram representing cell invasion. Values represent the number of cells per field that invaded through the Matrigel™ membrane (mean + s.d. from triplicate wells from three independent experiments). *Indicates statistically significant difference (p<0.05, t-test) between the Fc control and ephrin-A5-Fc wells.

(B) Invasion of PC-3 cells in response to 10% FBS as a chemoattractant +/- 1 µg/ml ephrin-A5-Fc. After 24 hours cells that invaded through the Matrigel™ membrane were stained with crystal violet and images taken at 150× magnification.

To be sure that these effects are entirely specific to EphA2 the experiment was

repeated using a novel method of specifically activating EphA2, without affecting

other Eph receptors, by using two in house Mabs (IF7 and 5D7) which bind non-

competitively to different epitopes of the extracellular domain of EphA2 (Figure

4.20A). This resulted in a statistically significant reduction (p=0.0139, t-test), of

approximately 30%, in cell invasion compared to the isotype control (Figure 4.20B).


99

PTyr EphA

EphA2

β-actin

A

B

Ab control 1F7 + 5D70

20

40

60

80

100

120

% In

vasi

on to

PC

-3 c

ells

*

Figure 4.20: EphA2 activation, by EphA2 antibodies, results in reduced PC-3 cell

invasiveness

(A) PC-3 cells were serum starved overnight then treated with 5 µg/ml of Ab control, 1F7, 5D7 or 1F7/5D7 for 20 minutes. Cells were also treated with 1 µg/ml of ephrin-A5-Fc as a positive control for EphA2 activation. Cells were lysed and total cell lysates (100 μg) were electrophoresed on a 7.5% SDS-PAGE gel, transferred to a nitrocellulose membrane and blotted with rabbit anti-pAb to EphA2 +A3 +A4 antibody followed by mouse anti-EphA2, clone D7. Beta actin was included as a loading control.

(B) Histogram representing cell invasion of PC-3 cells in response to 10% FBS as a chemoattractant +/- 5 µg/ml of EphA2 Mabs (1F7 + 5D7). Values represent the number of cells per field that invaded through the Matrigel™ membrane as a percentage of untreated PC-3 cells (mean + s.d. from triplicate wells from four independent experiments). *Indicates statistically significant difference (p<0.05, t-test) between the Ab control and the combination of EphA2 Mabs (1F7 + 5D7) wells.


100

4.3.11 Investigation of Dasatinib as a potential therapy for

prostatecancer

Dasatinib is used as a treatment for chronic myelogenous leukaemia (CML) based on

its inhibition of Bcr-Abl kinase function (Brave et al, 2008; Talpaz et al, 2006).

However, Dasatinib is a multi target kinase inhibitor that has been shown to potently

inhibit both Src family kinases (SFK) and Eph kinases including EphA2 and EphA3

(Karaman et al, 2008).

To determine if Dasatinib is able to inhibit EphA2 in prostate cancer cell lines, PC-3

cells were pre-treated for one hour with Dasatinib at increasing concentrations

followed by pre-clustered ephrin-A5-Fc for EphA2 activation. Cells were lysed for

Western blot analysis. Dasatinib dramatically reduces EphA2 phosphorylation in PC-

3 cells with levels of phosphorylated EphA2 reaching basal levels at a concentration

of 100 nM (Figure 4.21).

PTyr EphA

EphA2

β-actin

+ + + + + ++-- ephrin-A5-Fc

Dasatinib

Figure 4.21: Dasatinib reduces EphA2 phosphorylation in PC-3 cells

Cultures were serum starved overnight at 70-80% confluence. Cells were treated for 1 hour with dasatinib or vehicle control (DMSO) prior to EphA2 activation with pre-clustered ephrin-A5-Fc. Cells were lysed and Western blotting performed on whole cell lysates to determine levels of phosphorylated EphA2.


101

4.3.11.1DasatinibandPP2decreasePC‐3cellproliferation

Dasatinib is a potent inhibitor of Src family kinases which are downstream effectors

of Eph function but have many effects independent of this role. The use of Dasatinib

to identify functional changes as a result of Eph inhibition is complicated by its

potent inhibition of Src family kinases. To help identify the Src specific component

of Dasatinib cells were treated with PP2, a selective SFK inhibitor or its control PP3.

Cells were placed in a 96-well plate and allowed to adhere overnight. Cells were

treated with increasing concentrations of Dasatinib or PP2 and allowed to grow for

72 hours. Cells treated with Dasatinib (Figure 4.22A) or PP2 (Figure 4.22B) showed

a large reduction (>45% at the lowest concentration) in proliferation compared to

untreated and control cells (Figure 4.22C).

4.3.11.2DasatinibandPP2decreasePC‐3cellmigrationandinvasion

As activation of EphA2 and therefore down regulation of Src appears to reduce PC-3

cell invasiveness I sought to determine if inhibition of Src kinases, would yield

similar results. Cells were treated with 200 nM Dasatinib or 10 µM PP2 and in vitro

wound and Matrigel™ invasion assays performed. Both Dasatinib and PP2 treated

cells showed a dramatic reduction in cell migration and invasion. This reduction was

greater in cells treated with Dasatinib. For the in vitro wound assay PP2 treated cells

showed approximately 80% reduction in wound closure compared to control cells

while Dasatinib treated cells showed almost a 90% reduction (Figure 4.23A). The

difference in wound closure between PP2 and Dasatinib treated cells was not

statistically significant. For the Matrigel™ invasion assay PP2 treated cells showed

approximately 98% reduction compared to control cells while Dasatinib treated cells

showed over 99% reduction (Figure 4.23B).


102

PP3

M0 M5

M10

M

20

M50

0.0

0.5

1.0

1.5

OD

at 4

90 n

mPP2

M0 M5

M10

M

20

M50

0.0

0.5

1.0

1.5

OD

at 4

90 n

mDasatinib

DMSO

0 nM

50 nM

100 n

M

200 n

M

500 n

M

0.0

0.5

1.0

1.5O

D a

t 490

nm

A

B C

* * * *

* * * *

Figure 4.22: Effect of Dasatinib and Src kinase inhibitor, PP2, on PC-3 cell proliferation

Histograms representing cell proliferation, using an MTS assay, in PC-3 cells in response to increasing concentrations of (A) Dasatinib (B) Src kinase inhibitor, PP2, and its control (C) PP3. 3 × 103 cells were added per well in a 96-well plate and allowed to adhere overnight. Dasatinib, PP2, PP3 or DMSO was added to each well and cells were allowed to grow for 72 hours. Values represent OD readings at 490 nm (mean + s.d. from triplicate wells from three independent experiments).

*Indicates statistically significant difference (p<0.05, t-test) between the control and inhibitor treated wells.


103

DMSO

PP3PP2

Dasati

nib

0

20

40

60

80

100

120

% W

ound

clo

sure

**

DMSO

PP3PP2

Dasati

nib

0

100

200

300

# C

ells

per

fie

ld

* *

A

B

Figure 4.23: Effect of Dasatinib and PP2 on migration and invasion in PC-3 cells

PC-3 cells were treated with vehicle control (DMSO), PP3 (10 µM), PP2 (10 µM) or Dasatinib (200 nM) and in vitro wound assay and Matrigel™ invasion assays performed.

(A) Histogram representing cell migration using an in vitro wound assay. Values represent area of wound closure (as a percentage) over 24 hours (mean + s.d. from triplicate wells in triplicate experiments).

(B) Histogram representing cell invasion. Values represent the number of cells per field that invaded through the MatrigelTM membrane (mean + s.d. from triplicate wells in triplicate experiments).

*Indicates statistically significant difference (p<0.05, t-test) between the control and inhibitor treated wells.


104

4.4Discussion

The overall aim of this chapter was to identify similarities and differences between

EphA2 and EphA3 function and mechanism of action in prostate cancer cell lines.

Both functional and signalling studies indicate differing roles for these two receptors

in prostate cancer cell migration and invasion. Initially it was observed that EphA3

expression was higher in the androgen responsive cell lines, LNCaP and 22Rv1, and

EphA2 expression higher in the androgen independent cell lines, DU145 and PC-3.

However, expression of EphA3 was not regulated by the androgen 5-

dihydrotestosterone. Previous studies have reported ephrin-A1 and ephrin-A5 to be

androgen regulated genes (Nantermet et al, 2004; Velasco et al, 2004). As ephrin

expression was more prominent in the androgen responsive cell lines it would be of

interest to examine ephrin expression in response to androgen stimulation.

To explore EphA2 and EphA3 function in prostate cancer these genes were over

expressed and down regulated in individual cell lines. A problem encountered in this

study, that was evident in the EphA2 transfected LNCaP cells, was clonal variation.

To help address this problem polyclonal populations were introduced. An important

result missing from this study was the functional consequence of knockdown of

EphA2 in prostate cancer cells. PC-3 cells were successfully transfected with the

EphA2 shRNA constructs, confirmed by GFP expression; however stable

knockdown was not achieved. A small transient knockdown was observed however

this was insufficient to alter EphA2 function appreciably. EphA2 transfected LNCaP

cells showed up to a 50% reduction in EphA2 when transfected with the same

constructs. It is unclear at this time why the same level of knockdown could not be

achieved in the PC-3 cells. In any case 50% knockdown is an inadequate level for

further analysis. The same sequences were also tested in the DU145 cell line;

however successful transfection of EphA2 shRNA was not achieved. Two recent

studies have now reported successful knockdown of EphA2 using siRNA in PC-3

cells (Yang et al, 2011) and EphA2 shRNA via lentiviral infection in PC-3M cells

(Miao et al, 2009). In future studies, these constructs will be used to knockdown

EphA2 in order to complete the functional experiments to further understand the role

of EphA2 in aspects of prostate cancer adhesion and migration.


105

In this study, prostate cancer cells expressing EphA2 (DU145 and PC-3) showed a

greater ability for migration and invasion compared to cells expressing EphA3

(22Rv1 and LNCaP). Forced expression of EphA2 in the LNCaP cell line resulted in

an increase in cell invasion. Consistent with these results, EphA2 over expression has

been linked to increased cell invasion in other model systems including lung,

pancreatic and breast cancer (Brantley-Sieders et al, 2008; Duxbury et al, 2004;

Faoro et al, 2010). Alternatively, forced expression of EphA3 in the PC-3 cell line

revealed a possible negative effect of EphA3 expression on migration and invasion.

Additional clones (or polyclonal populations) of PC-3 cells expressing EphA3 need

to be tested to confirm these results. While knockdown of EphA3 in the LNCaP cell

line appeared to have no effect on cell migration/invasion a previous study reported

knockdown of EphA3 in RD cells, using siRNA, resulted in an increase in cell

migration compared to cells transfected with control siRNA (Clifford et al, 2008).

Taken together with this data, my results suggest a potential role for EphA3 in the

regulation of cell migration/invasion.

One possible first step in exploring this apparent difference between EphA2 and

EphA3 function is to replace the cytoplasmic region of EphA2 with the cytoplasmic

region of EphA3, and the reverse, and test the effect of these chimaeric molecules to

narrow down whether the extracellular domain or the cytoplasmic domain is the

critical factor in initiating different modes of signalling. This will be a necessary step

before designing a more intensive dissection of the key domain to determine the

precise regions involved in differing signalling.

Furthermore, the EphA2/EphA3 dual transfected cell lines created in this study will

be useful tools in identifying differences in signalling targets and outcomes between

the two receptors. EphA2 can be specifically activated using the combination of two

in house EphA2 Mabs reported in this study while EphA3 can be specifically

activated by the EphA3 Mab, IIIA4 (Vearing et al, 2005). Changes in the

phosphorylation status of potential downstream targets, including PI3K, Akt, Rho

GTPases, FAK and Src can be examined as well as changes in cellular function e.g.

cell migration and invasion. These studies will provide information in understanding

the apparent opposing roles of EphA2 and EphA3 in prostate cancer.


106

Similar to other Eph receptors, EphA2 has been reported to have both tumour

promoting and tumour suppressing activity (Miao et al, 2009). Many studies are now

exploring the molecular mechanisms responsible for these opposing roles. One

possible explanation is ligand dependent versus independent signalling (Chen et al,

2008). In the current study EphA2 over expression in LNCaP cells resulted in a more

invasive phenotype while EphA2 activation via ligand stimulation in PC-3 cells

resulted in a less invasive phenotype. These results further support the notion for

differing outcomes for ligand dependent and independent signalling.

Activation of EphA2 has been shown to inhibit pathways involved in cell

proliferation and migration including the Ras-MAP kinase pathway (Miao et al,

2001). There is now increasing evidence implicating Akt involvement in EphA2

regulation of cell migration. A study by Miao et al showed that phosphorylation of

EphA2 at serine 897 by Akt was required for ligand independent promotion of cell

migration and invasion (Miao et al, 2009). Upon ligand stimulation this site becomes

dephosphorylated together with Akt resulting in reduced cell migration and invasion.

Ligand dependent activation of EphA2 in the current study also resulted in decreased

Akt activity. According to a recent study, this decrease in Akt activity may be due to

cross talk of EphA2 with a serine/threonine phosphatase (Yang et al, 2011) (Figure

4.24).

Activation of EphA3 in LNCaP cells did not appear to affect the phosphorylation

status of Akt, Src and FAK in this study. Therefore, at this point in time the effect of

EphA3 activation on cell migration/invasion was not explored further. However,

Hek293T cells over expressing EphA3 showed a significant decrease in migration

when stimulated with ephrin-A5 (Clifford et al, 2008). It would be thus very

interesting to further explore the effect of EphA3 activation on cell

migration/invasion in the prostate cancer cell lines.


107

ephexin

P

Cell rounding

Reduced migration /invasion

Akt

GTP

RhoA

Rac1

SrcFAKP

P

? phosphatase

Increased migration /invasion

P

GTP P

AktP

?

SrcFAKP

?

EphA2

ephrin-A

EphA2

PP2 Dasatinib

SrcFAKP

Reduced migration /invasion

P

P

A B

Figure 4.24: Possible mechanisms involved in EphA2 signalling

Schematic representation of possible mechanisms involved in EphA2 (A) ligand independent and (B) ligand dependent signalling based on results observed in this study and previous studies (Miao et al, 2009; Yang et al, 2011).

To explore how EphA2 over expression is able to promote cell migration/invasion

experiments using EphA2 with mutations in the kinase or juxtamembrane domain or

deletion of the cytoplasmic region entirely are needed. Expression of the EphA2

mutants in the LNCaP cell line will aid in identifying the region of EphA2 required

for the increased migration/invasion observed in this study. Furthermore,

migration/invasion assays with the LNCaP EphA2 transfected clones from this study

treated with a specific Akt inhibitor will determine if Akt signalling is involved.

Another possible pathway to explore is the Src/FAK complex. Src and FAK activity

were both observed in unstimulated PC-3 cells. It would be beneficial to measure the

level of Src and FAK expression and activation in the LNCaP EphA2 transfected

cells versus empty vector controls. Unstimulated PC-3 cells also showed a dramatic

reduction in cell migration/invasion when treated with a specific Src inhibitor, PP2;

further suggesting that Src activity may be involved. Treatment of the LNCaP EphA2

transfected cells with PP2 prior to migration/invasion assays would also be


108

beneficial. These studies should aid in understanding the mechanisms behind EphA2

ligand independent signalling.

Ligand activation of EphA2 in PC-3 cells resulted in decreased Src and FAK

activity. FAK phosphorylation in response to EphA2 activation in PC-3 cells has

previously been performed by others, however results were contradictory with one

study showing a decrease in total phosphorylation (Miao et al, 2000) while the other

showed an increase (Parri et al, 2007). Results from this study show a decrease in

phosphorylation of FAK at tyrosines 397, 407 and 577 suggesting activation of

EphA2 results in decreased FAK activity. However not all of the tyrosine sites of

FAK were investigated. A second band of increasing intensity was observed at

tyrosine 576 but the relevance of this band is unclear at this time. Care should be

taken when interpreting the data presented in the Parri et al study as Fc controls for

each time point and an unstimulated basal control are not included. Data from the

Miao et al study show that FAK phosphorylation drops initially with ligand

stimulation and then gradually increases with levels reaching approximately 80% of

basal within 40 minutes. These results suggest that EphA2 activation may lead to a

transient decrease in total FAK activity however further investigation is required.

Dasatinib is a multi target tyrosine kinase inhibitor of which EphA2 is a known

target (Karaman et al, 2008). EphA2 phosphorylation was greatly reduced in ligand

stimulated PC-3 cells treated with Dasatinib. This was also observed in the DU145

cell line (data not shown). Cells treated with Dasatinib showed almost complete

inhibition of migration and invasion. As PC-3 cells show low endogenous levels of

EphA2 activation the reduction in invasion observed with the use of Dasatinib is

most likely due to its potent inhibition of Src family kinases which are downstream

effectors of Eph function but have many effects independent of this role. Similarly,

EphA2 activation resulted in decreased Src activity and reduced invasion. A novel

finding in the current study was the activation of EphA2 using a combination of two

in house EphA2 Mabs. In view of the results previously discussed activation of

EphA2 may prove to be a beneficial therapy. Preliminary results show a possible

negative effect on prostate cancer cell invasion, however studies to further optimise

and characterise these antibodies are needed.


109

In conclusion, EphA2 and EphA3 appear to function differently in prostate cancer

cell lines. In the Eph field this is significant as the prevailing view is that there is

redundancy of function amongst EphA receptors. Understanding the role of

individual Eph receptors, and ephrin ligands, in cancer may aid in the development

of new anticancer therapies.

Chapter 5 – ephrin-A5

110

Chapter5–ephrin‐A5

5.1Introduction

In the past the majority of studies reporting on the Eph receptor tyrosine kinase

family in cancer have focused primarily on Eph receptor expression and forward

signalling (Dodelet & Pasquale, 2000; McCarron et al, 2010). However, due to the

complex nature of the Eph-ephrin bi-directional signalling system it is important to

look at both the Eph and ephrin expression profiles in individual cancers. As more

studies begin to focus on ephrin expression and reverse signalling there is increasing

evidence that the ephrin ligands may affect critical aspects of tumour progression and

metastasis (Campbell et al, 2006; Campbell & Robbins, 2008; McCarron et al,

2010).

As with Eph receptor expression, both increased and decreased ephrin expression has

been demonstrated in a variety of human malignancies including glioma, colon and

ovarian cancer (Herath et al, 2006; Li et al, 2009; Liu et al, 2002). However, most

studies report increased ephrin expression compared to normal controls reviewed in

(McCarron et al, 2010). There are also a number of studies reporting a correlation

between increased ephrin expression and poor survival (Alam et al, 2009; Herath et

al, 2006; Wu et al, 2004), suggesting that ephrins may be useful prognostic

indicators for survival. Overall, relatively little attention has been paid to the role of

ephrin ligands in major cancers such as prostate cancer as outlined in Chapter 1 –

Literature Review. This chapter will focus on the function of ephrin-A5 in prostate

cancer, a focus following from my finding of adhesion of the ephrin-A5 expressing

cell line, LNCaP, to an EphA3-Fc coated surface. Ephrin-A5 is the high affinity

ligand for EphA3. However, as shown in Chapter 3, LNCaP cells also express

ephrin-A1 which is the high affinity ligand for EphA2. However, LNCaP cells did

not show an increase in adhesion to an EphA2-Fc coated surface. Keeping this in

mind I chose to investigate in detail the interaction of ephrin-A5 with EphA3.

Many studies have identified Eph-ephrin signalling to be important in regulating cell-

cell adhesion. Ephrin-A5, along with its Eph receptor, has been shown to play an

important role in regulation of cell movement through adhesive and repulsive


111

guidance cues. For example, EphA7 and its ligand ephrin-A5 are co-expressed in the

lateral edges of the neural plate (Holmberg et al, 2000). Alternative splice variants of

the EphA7 receptor turn signalling from repulsion to adhesion resulting in fusion of

the neural plate to form the neural tube.

The stripe assay is a well established method for studying guidance molecules

involved in axon growth. In stripe assay experiments performed by Walter et al

chicken retinal ganglion cell axons showed preferential growth on membranes

derived from the anterior tectum when presented with alternating stripes of anterior

and posterior tectal membranes (Walter et al, 1987). Further studies by Drescher et al

identified a 25 kDa GPI-linked protein (ephrin-A5, originally named RAGS) that

was responsible for repelling the retinal ganglion cell axons (Drescher et al, 1995).

Ephrin-A5 is expressed in an increasing gradient from the anterior to the posterior

region of the tectum (Drescher et al, 1995). This gradient, together with the opposing

Eph gradient on the retinal axons acts as a molecular guide in the formation of the

retinotectal map. Consistent with these observations ephrin-A5 knockout mice also

display a defect in the topographic mapping of retinal axons (Frisen et al, 1998).

In the present study stripe assays were used to further explore the attraction of

LNCaP cells to EphA3-Fc. The data show that this attraction appears to be a result of

ephrin-A5 expression on the cell. LNCaP cells also express EphA3 however, they do

not show similar adhesion to an ephrin-A5-Fc coated surface, suggesting that cell

surface ephrin-A5 expression and activation of reverse signalling is required. To

further analyse the role of ephrin-A5 in prostate cancer, experiments using shRNA-

mediated knockdown of ephrin-A5 were performed. Down-regulation of ephrin-A5

in LNCaP cells prevented preferential migration onto the EphA3-Fc stripes.

Interestingly, ephrin-A5 knockdown also led to a reduction in cell proliferation.

Furthermore, in vivo tumour growth was markedly inhibited in ephrin-A5

knockdown cells compared to vector control cells. These results suggest a potential

role for ephrin-A5 in early prostate cancer.


112




5.2.1Stripeassay

A special silicon matrix with 90 µm channels (purchased from Dr Martin

Bastmeyer’s laboratory) was used to adsorb stripes of pre-clustered Eph- or ephrin-

Fc fusion protein (stripe solution 1 – 10 µg/ml) onto glass cover slips for 30 minutes

at 37°C. Pre-clustered human IgG or other Eph- or ephrin-Fc constructs were used as

controls. Cover slips were washed with PBS and the protein free stripes blocked with

pre-clustered human IgG (stripe solution 2 – 1 µg/ml) for 30 minutes at 37°C. Cells

were seeded approximately 1 × 105 cells/well and allowed to adhere overnight. After

incubation cells were washed gently with PBS and fixed with 4% PFA for 10

minutes at room temperature. In order to differentiate between the stripes, stripe

solution 1 was pre-clustered using a mouse anti-human IgG while stripe solution 2

was pre-clustered using a rabbit anti-human IgG. Stripes were visualised using an

anti-mouse secondary fluorescent antibody. Experiments were performed in which

the rabbit anti-human IgG was used in stripe solution 1 and mouse anti-human IgG in

stripe solution 2. No difference was observed between pre-clustering with the mouse

or rabbit anti-human IgG. Cells were considered to adhere to a particular stripe if

greater than 50% of its spread area lies on that stripe. The proportion of cells

adhering to stripes was determined by counting cells in five random fields with a

total of greater than 100 cells counted per cover slip.

5.2.2ShorthairpinRNA(shRNA)

Four HuSH 29mer shRNA constructs against ephrin-A5 in a pRS plasmid were

purchased from OriGene Technologies, Inc (Rockville, MD) as well as a pRS

plasmid control.


113

5.2.3StainingusingFcconstructs

Cells were de-adhered with 5 mM EDTA and washed with PBS 5% FBS. Cells were

incubated in 5 µg/ml of EphA3-Fc for 30 minutes at room temperature, washed with

PBS and labelled with anti-human IgG-FITC (Chemicon International). EphA3-Fc

will bind to ephrin-A5 and can therefore be used as an alternative to an anti-ephrin-

A5 antibody.

5.2.4Westernblotanalysisofdetergentinsolubleprotein

Cell cultures at 70-80% confluence were washed in PBS and lysed in 1ml of lysis

buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM NaVO4, 10 mM

NaF and protease inhibitors (Roche Diagnostics, Castle Hill, Australia)). Lysates

were spun at 400 g at 4°C to remove cellular debris. Lysates were then spun at 16

000 g at 4°C for 10 minutes. After collection of lysate into a separate tube the

remaining insoluble pellet was resuspended in 2 × reducing sample buffer, boiled and

Western blotting performed as outlined in Chapter 2.

5.2.5PIcellcycleanalysis

Cells were serum starved for 24 hours for cell cycle synchronisation. Cells were then

grown for 24 hours in RPMI 10% FBS washed with PBS and resuspended in 300 µl

PBS. While gently vortexing 700 µl of ice-cold 70% ethanol was added and cells

incubated on ice for a minimum of 2 hours. Cells were washed with PBS and

incubated for 40 minutes in 1ml of staining solution (PI 50 µg/ml, RNase A 10

µg/ml, 0.05% Triton X-100) at 37°C and then analysed by flow cytometry on a BD

FACs Canto™ (BD Biosciences). Cell cycle analysis was performed using Modfit

LT™ analysis software version 3.2.1.


114

5.2.6Softagarcolonyformationassay

Anchorage independent growth was assessed using a soft agar colony formation

assay. 0.5ml of 0.5% agar was added to the bottom of a 24-well plate and once solid

1.25 × 103 cells in 0.35% agar was layered over the top. RPMI 10% FBS was gently

layered over the agar every 3 - 4 days. After 14 days of incubation at 37°C, 5% CO2

wells were imaged using a Leica MZ6 microscope (Leica Microsystems). Images

were analysed using AnalySIS LS Research version 2.6.

5.2.7Invivoexperiments

Groups of five NOD/SCID mice were injected subcutaneously into the right flank

with either 2 × 106 LNCaP, LNCaP vector control or LNCaP ephrin-A5 shRNA

cells. Animals were monitored daily and tumour size measured twice weekly. Once

the tumours reached 1 cm in diameter the mice were euthanised and tumours

harvested for histological analysis and preparation of RNA for Q-PCR.

5.2.8RNAisolationofmousexenografts

Mice were euthanised and the tumour dissected then cut into smaller pieces. Tumour

samples were snap frozen on dry ice and stored at -70°C. Tissue was placed in 1 ml

TRIzol® reagent (Invitrogen) and homogenised with a tissue homogeniser. 200 µl of

chloroform was added and the suspension shaken, incubated at room temperature for

5 minutes and then spun at 4°C for 20 minutes at 16 000 g. The top clear layer was

collected and 500 µl of isopropanol added, mixed by inverting and incubated at -

20°C for 20 minutes. After an additional spin at 4°C for 15 minutes at 16 000 g the

supernatant was removed and the remaining pellet washed in 75% ethanol. The pellet

was dried and resuspended in 10 µl of RNase free H2O with RNasin (Promega).

RNA was quantitated by spectrophotometry and agarose gel electrophoresis.


115

5.2.9Statisticalanalysis

A Log-rank (Mantel-Cox) test performed in GraphPad® prism version 5.02 was used

to assess survival endpoint data.


116

5.3Results

To investigate the effects of Eph-ephrin interaction on cell adhesion in prostate

cancer, cells were exposed to surfaces coated with Eph-Fc or ephrin-Fc. Protein used

for coating of plates consisted of the extracellular domain of either the Eph receptor

or ephrin ligand fused to the Fc fragment of human IgG1. All proteins were produced

in house and their binding specificities confirmed by BIAcore analysis as previously

described (Himanen et al, 2004; Lackmann et al, 1998).

Preliminary experiments with LNCaP cells showed a three-fold increase in cell

adhesion to an EphA3-Fc coated surface compared to the PBS control (0 µg/ml)

surface. The control plates coated with human IgG showed no obvious effect on cell

adhesion (Figure 5.1).

0 0.3 1 3 90

1

2

3

4

EphA3HuIgG

g/ml

Fold

cha

nge

in c

ell a

dhes

ion

from

con

trol

- 0g

/ml

*

*

**

Figure 5.1: LNCaP cell adhesion to EphA3-Fc

96-well plates were coated with EphA3-Fc or HuIgG at 0, 0.3, 1, 3 and 9 μg/ml. Cells were added and allowed to adhere for 3 hours. Adhered cells were fixed with 4% PFA, stained with 0.1% crystal violet and OD measured at 590 nm. Values represent cell adhesion expressed as a fold change from the PBS control (0 μg/ml) (mean + s.d from three independent experiments). *Indicates statistically significant difference (p<0.05, t-test) between cells adhered to the EphA3-Fc coated surface and the PBS control coated surface.


117

5.3.1Ephrin‐A5promotesstrongadhesiontoEphA3

To further extend the finding that LNCaP cells show strong adhesion to EphA3,

stripe assays were performed. Stripes of EphA3-Fc protein were coated onto glass

cover slips using a special silicon matrix. Approximately 94% of LNCaP cells

migrated (migration confirmed by time lapse microscopy) onto the EphA3-Fc stripes

(Figure 5.2A and 5.2B). The control stripes, made with human IgG showed no

obvious effect on cell adhesion.

22Rv1 cells have a similar Eph/ephrin expression profile to LNCaP cells except for

ephrin-A5 expression (Figure 3.1), which is high in LNCaP cells and low in 22Rv1

cells. 22Rv1 cells do not show attraction to the EphA3-Fc stripes (Figure 5.2C and

5.2D) suggesting that the strong attraction to EphA3 is a result of ephrin-A5

expression.

LNCaP cells express both EphA3 and ephrin-A5, therefore, in an alternative

approach cells were exposed to glass cover slips coated with ephrin-A5-Fc stripes.

However, LNCaP cells do not show the attraction to the ephrin-A5-Fc stripes (Figure

5.2E and 2F) that was seen with EphA3. They also do not show repulsion from the

ephrin-A5-Fc stripes with cells showing even distribution across the striped surface.

This suggests that ephrin-A5 expression and signalling may be involved in prostate

cancer adhesion.


118

EphA3 Fc control0

20

40

60

80

100

22Rv1 cells on stripes22Rv1 cells between stripes

% o

f C

ells

C D

22Rv1EphA3 stripes

22Rv1Fc control stripes

ephrin-A5 Fc control0

20

40

60

80

100

LNCaP cells on stripesLNCaP cells between stripes

% o

f C

ells

E F

LNCaPephrin-A5 stripes

LNCaPFc control stripes

EphA3 Fc control0

20

40

60

80

100


% o

f C

ells

LNCaPEphA3 stripes

A B

LNCaPFc control stripes

*

100 µm 100 µm

100 µm 100 µm

100 µm 100 µm

Figure 5.2: Stripe assays

LNCaP cells, which express both EphA3 and ephrin-A5, show attraction to EphA3-Fc stripes (A & B) but not ephrin-A5-Fc stripes (E & F). 22Rv1 cells have a similar Eph/ephrin expression profile to LNCaP cells but do not express ephrin-A5. They do not show attraction to the EphA3-Fc stripes (C & D).

(A, C and E) Histograms representing percentage of cells on or between protein stripes. Values represent mean + s.d. from three independent experiments. Cells were counted from five random fields for each experiment. *Indicates statistically significant difference (p<0.05, t-test) between cells on test and control stripes.


119

5.3.2Srckinases

Src family kinases have been shown to be downstream targets of ephrin-A signalling.

To determine if they play a role in the strong adhesion observed to EphA3, cells were

pre-treated with a Src inhibitor, PP2, or its control, PP3 and stripe assays performed.

Cells were also pre-treated with DMSO as a vehicle control as PP3 has been shown

to target EGFR. LNCaP cells pre-treated with PP2 showed almost a 20% reduction in

adhesion to EphA3-Fc compared to DMSO treated cells (p=0.0081, t-test) (Figure

5.3A and 5.3B).

*

LNCaP + DMSO + PP3 + PP20

20

40

60

80

100


% o

f C

ells

B

A

LNCaP + 10 µM PP3

100 µm

LNCaP + 10 µM PP2

100 µm

Figure 5.3: Src inhibitor, PP2, reduces LNCaP attraction to EphA3-Fc stripes

(A) Histogram representing percentage of cells on or between EphA3-Fc stripes. Cells were treated with 10 µM DMSO, PP3 or PP2. Cells were counted from five random fields for each experiment. *Indicates statistically significant difference (p<0.05, t-test) between the control and inhibitor treated cells. Values represent mean + s.d. from three independent experiments.

(B) LNCaP cells treated with the Src inhibitor PP2 (10 µM) show reduced attraction to EphA3-Fc stripes compared to the control PP3 (10 µM) cells.


120

5.3.3Theeffectofsignallingbyephrin‐A5onSrckinases

Whilst reverse signalling by ephrin-A ligands remains incompletely understood, as

described in Chapter 1, Src family kinase signalling has been shown to be a target of

ephrin-A activation by Eph receptor engagement (Davy et al, 1999). To determine

whether these families are downstream targets of ephrin-A5 reverse signalling in

prostate cancer LNCaP cells were stimulated with pre-clustered EphA3-Fc over a

range of time points followed by Western blot analysis. Ephrin-A ligands lack a

cytoplasmic domain. Therefore I was unable to use phosphorylation levels to confirm

optimal time points for activation of ephrin-A5 by Western blot analysis as was

performed for EphA2 and EphA3 activation studies. Initially time points ranging

from five minutes to one hour were considered and activation/down regulation of

potential targets determined. As ephrin-A5 has been reported to signal within lipid

rich micro-domains (Davy et al, 1999) both detergent soluble and insoluble fractions

were analysed.

Activation of Src, identified by phosphorylation at tyrosine 418, was observed after

60 minutes of pre-clustered EphA3-Fc treatment (Figure 5.4) in the detergent

insoluble fraction. These results together with the decreased attraction to EphA3-Fc

stripes observed with the use of the Src inhibitor, PP2, suggest a potential role for

ephrin-A5 signalling via Src in prostate cancer cell adhesion/migration to EphA3-Fc.

EphA3-Fc

PTyr Src418

Src

β-actin

+ + - + - +---

0’ 5’ 10’ 30’ 60’

Figure 5.4: Activation of Src downstream of ephrin-A5

LNCaP cells were serum starved for 24 hours before stimulating with pre-clustered EphA3-Fc for the indicated time points. Detergent insoluble pellets were analysed by Western blotting using an anti-phosphotyrosine Src418 antibody. Total Src and β-actin were used as loading controls.


121

5.3.4Productionofephrin‐A5knockdowninLNCaPcells

To further explore the finding that ephrin-A5 expression may result in strong

adhesion to EphA3, LNCaP ephrin-A5 knockdown cells were produced. As a

control, cells were also transfected with empty vector. Stable transfection of LNCaP

cells with ephrin-A5 shRNA yielded 70% or greater knockdown of ephrin-A5. Three

stable clonal populations were produced using three different ephrin-A5 shRNA

sequences. Knockdown was confirmed by Q-PCR (Figure 5.5A) and FACs analysis

(Figure 5.5B and 5.5C). Cells were probed with EphA3-Fc for FACs analysis due to

the lack of a reliable ephrin-A5 antibody for FACs and Western blotting.

5.3.5Reducedephrin‐A5resultsinreducedadhesiontoEphA3

Stripe assays were performed to determine if reduced ephrin-A5 expression results in

reduced adhesion/migration to EphA3. Ephrin-A5 knockdown resulted in cells no

longer showing adhesion/migration to the EphA3-Fc stripes (Figure 5.6A and 5.6B).

This was statistically significant for all three ephrin-A5 knockdown clones (p<0.05,

t-test). The vector control cells showed similar adhesion to the parental cells.

Parental, vector control and ephrin-A5 knockdown cells all show no effect on cell

adhesion with the human IgG control (Figure 5.6C and 5.6D).


122

ephrin-A5 shRNA - clone 1 ephrin-A5 shRNA - clone 2 ephrin-A5 shRNA - clone 3

Cou

nts

EphA3-Fc FITC

LNCaP Vector control - clone 1 Vector control - clone 2

17% 30% 26%

ephrin-A5 shRNA

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

50

100

150

Tran

scri

pt #

per

100

0-

acti

n

Vector control

100% 67% 124%

ephrin-A5 shRNA

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

50

100

150

Rel

ativ

e ex

pres

sion

(%

)

Vector control

A

C

B

Figure 5.5: ephrin-A5 knockdown in LNCaP cells

(A) Histogram representing ephrin-A5 mRNA expression in parental, vector control and ephrin-A5 shRNA cells. Q-PCR was used to determine mRNA expression. Values represent ephrin-A5 transcript number relative to 1000 copies of β-actin performed in duplicate.

(B) Histogram representing ephrin-A5 protein expression in parental, vector control and ephrin-A5 shRNA cells. Values represent mean cell fluorescence as a percentage of ephrin-A5 expression in LNCaP parental cells from (C).

(C) All cells were stained with EphA3-Fc followed by a secondary anti-human FITC antibody and analysed by flow cytometry for ephrin-A5 expression. Values represent mean cell fluorescence as a percentage of LNCaP parental cells.


123


20

40

60

80

100

Cells on EphA3 stripesCells between EphA3 stripes

% o

f C

ells

A

Vectorcontrol

ephrin-A5shRNA

Vector controlEphA3 stripes

ephrin-A5 shRNAEphA3 stripes

* * *

B


20

40

60

80

100

Cells on HuIgG stripesCells between HuIgG stripes

% o

f C

ells

Vectorcontrol

ephrin-A5shRNA

C

Vector controlHuIgG stripes

ephrin-A5 shRNAHuIgG stripes

D

100 µm 100 µm

100 µm 100 µm

Figure 5.6: ephrin-A5 knockdown cells lose strong attraction to EphA3-Fc

(A) Histogram representing percentage of cells on or between EphA3-Fc stripes. LNCaP ephrin-A5 shRNA cells show reduced attraction to EphA3. Values represent mean + s.d. from three independent experiments. Cells were counted from five random fields for each experiment.

(B) Representative images of LNCaP vector control cells showing attraction to EphA3-Fc stripes while LNCaP ephrin-A5 shRNA cells show no attraction.

(C) Histogram representing percentage of cells on or between HuIgG stripes. All cells show no attraction to HuIgG. Values represent mean + s.d. from three independent experiments. Cells were counted from five random fields for each experiment.

(D) Representative images of LNCaP vector control and ephrin-A5 shRNA cells showing no attraction to control HuIgG stripes.


124

5.3.6 Ephrin‐A5 expression does not affect cell morphology,

migrationorinvasioninLNCaPcells

Previous studies have reported a role for ephrin-A5 expression and signalling in

regulating cell morphology (Cooper et al, 2008; Davy & Robbins, 2000). To

determine if any changes to cell morphology occur as a result of reduced ephrin-A5

expression LNCaP, vector control and ephrin-A5 knockdown cells were grown on

glass cover slips, fixed and images taken. The vector control and ephrin-A5

knockdown cells had a similar triangular elongated, fibroblastic shape to the parental

cell line (Figure 5.7A). Ephrin-A5 expression does not appear to affect cell

morphology in the LNCaP prostate cancer cell line.

To determine if ephrin-A5 expression plays a role in cell migration and invasion, in

vitro wound assays and Matrigel™ invasion assays were performed respectively.

LNCaP ephrin-A5 shRNA cells show no change in cell migration (Figure 5.7B) or

invasion (Figure 5.7C) when compared to the parental or vector control cells.

5.3.7Ephrin‐A5knockdowndoesnot affect integrinmediated

celladhesioninLNCaPcells

To determine if ephrin-A5 signalling plays a role in integrin function, cell adhesion

assays on fibronectin, laminin, collagen and poly-l-lysine surfaces were performed

with LNCaP ephrin-A5 knockdown cells and compared to parental and vector

controls. Cells were exposed to a PBS control surface to determine a baseline level of

adhesion for each clone. Cells were allowed to adhere to the coated surface for 30

minutes at 37°C.

LNCaP ephrin-A5 shRNA cells show no change in the level of adhesion to the PBS

control surface compared to the parental and vector controls (Figure 5.8A).

Similarly, there was no change in the level of adhesion observed on plates coated

with fibronectin (Figure 5.8C), laminin (Figure 5.8D) and collagen (Figure 5.8E).

These data suggest that ephrin-A5 does not affect integrin-mediated cell adhesion in

LNCaP cells.


125

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

20

40

60

80

100

% W

ound

Clo

sure

Vectorcontrol

ephrin-A5shRNA

B

LNCaP

clone

1

clone

2

clone

1

clone

2

0

20

40

60

80

100#

Cel

ls p

er f

ield

C

Vector control

A

ephrin-A5 shRNA

clone 2 clone 3clone 1


Vectorcontrol

ephrin-A5shRNA

Figure 5.7: ephrin-A5 expression does not affect LNCaP cell morphology,

migration or invasion

(A) Cells were grown on a glass cover slip, fixed in 4% paraformaldehyde and images taken. LNCaP ephrin-A5 shRNA cells show no change in cell morphology compared to parental and vector control cells.

(B) Histogram representing cell migration. Values represent area of wound closure (as a percentage) over 24 hours (mean + s.d. from triplicate wells in triplicate experiments).

(C) Histogram representing cell invasion. Values represent the number of cells per field that invaded through the Matrigel™ membrane over 24 hours (mean + s.d. from triplicate wells from three independent experiments).


126

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

2.5

OD

at 5

90 n

m

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.5

1.0

1.5

2.0

2.5O

D a

t 590

nm

PBS

Vectorcontrol

ephrin-A5shRNA

APoly-l-lysine

B

FibronectinC

LamininD

CollagenE

Vectorcontrol

ephrin-A5shRNA

Vectorcontrol

ephrin-A5shRNA

Vectorcontrol

ephrin-A5shRNA

Vectorcontrol

ephrin-A5shRNA

Figure 5.8: ephrin-A5 expression does not affect LNCaP cell adhesion to

extracellular matrix proteins

Histograms representing cell adhesion to (A) PBS, (B) poly-l-lysine, (C) fibronectin, (D) laminin and (E) collagen. 3 × 104 cells were added to each well and allowed to adhere for 30 minutes at 37°C. Adhered cells were stained with 0.1% crystal violet and solubilised in 10% acetic acid. Values represent OD readings at 590 nm (mean + s.d. from triplicate wells from three independent experiments).


127

5.3.8 Ephrin‐A5 knockdown reduces prostate cancer cell

proliferation

Ephrin expression has previously been reported to affect cell proliferation (Iida et al,

2005; Liu et al, 2007; Liu et al, 2004). MTS assays were performed to determine if

ephrin-A5 signalling modulates cell proliferation in prostate cancer cells. LNCaP,

vector control and ephrin-A5 shRNA cells were plated into triplicate wells of a 96-

well plate and allowed to grow for 72 hours. LNCaP ephrin-A5 knockdown cells

show a significant reduction in proliferation compared to the parental and vector

control cell lines (p<0.05, t-test) (Figure 5.9A). The reduction observed was

approximately 40% in two of the clones while the third clone showed only a 20%

reduction. To determine if this reduction is a result of altered cell cycle transit,

propidium iodide staining was performed. No change was observed in the cell cycle

for two of the ephrin-A5 shRNA clones, however, one clone (clone 2) showed a 16%

increase in cells in G1 phase and a reduction in cells in both S (7%) and G2 (9%)

phase (Figure 5.9B and 5.9C).

Soft agar colony forming assays were performed to determine if reduced ephrin-A5

expression results in reduced anchorage-independent growth. Cells were grown

suspended in 0.35% agar for 14 days. While there was no obvious change in the

number of colonies formed between the parental, vector control and ephrin-A5

shRNA cells (data not shown) a reduction in the average colony size was observed.

The two ephrin-A5 shRNA clones that showed a 40% reduction in proliferation in

the MTS assay (clone 1 and 2) showed a significant reduction (30% and 50%

respectively, p<0.05, t-test) in colony volume while clone 3 which showed a 20%

reduction in proliferation in the MTS assay showed a 25% reduction in colony

volume (Figure 5.10).


128

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0.0

0.2

0.4

0.6

0.8O

D a

t 490

nm

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

20

40

60

80

100 G1S

G2

% o

f C

ells

LNCaP

ephrin-A5 shRNA - clone 1

Vector control - clone 1


Vector control - clone 2


Vectorcontrol

ephrin-A5shRNA

Vectorcontrol

ephrin-A5shRNA

A B

C

Cou

nts

PE-A

* **

Figure 5.9: Cell proliferation and cell cycle analysis

(A) Histogram representing cell proliferation. Cells were grown for 72 hours and proliferation was measured using an MTS assay. LNCaP ephrin-A5 knockdown cells show reduced proliferation compared to parental and vector control cells. Values represent OD readings at 490 nm (mean + s.d. from triplicate wells from four independent experiments). *Indicates a statistically significant difference (p<0.05, t-test) between the parental and ephrin-A5 knockdown cells.

(B) Histogram representing cell cycle analysis. Values represent percentage of cells in each phase (mean + s.d. from three independent experiments).

(C) Cells were stained with propidium iodide and analysed by flow cytometry to measure cells in G1, S and G2 phase. Images represent one of three independent experiments.


129

clone 2 clone 3clone 1

ephrin-A5 shRNA

Vector control


B

LNCaP

clone

1

clone

2

clone

1

clone

2

clone

3

0

20

40

60

80

100

120

140

Ave

rage

col

ony

volu

me

(% o

f L

NC

aP)

ephrin-A5 shRNA

Vector control

**

A

Figure 5.10: ephrin-A5 expression affects colony size

(A) Histogram representing average colony volume of LNCaP, vector control and ephrin-A5 shRNA cells in a soft agar colony forming assay. Values represent colony volume as a percentage compared to the parental cell line LNCaP valued at 100% (mean + s.d. from triplicate wells in triplicate experiments). *Indicates a statistically significant difference (p<0.05, t-test) between the parental and ephrin-A5 knockdown cells.

(B) Photos of colonies in 0.35% agar in a 24-well plate that were allowed to grow for 14 days. Images were taken with a Leica MZ6 microscope.


130

5.3.9Effectofephrin‐A5knockdownontumourgrowthinvivo

Given the reduced proliferation seen in ephrin-A5 transfected LNCaP cells it was

important to determine if this translates into an effect on tumour formation/growth.

To determine the effect of ephrin-A5 knockdown on cell proliferation in vivo, groups

of five NOD/SCID mice were injected subcutaneously with either LNCaP, LNCaP

vector control (clone 1 or clone 2) or LNCaP ephrin-A5 knockdown cells (clone 1 or

clone 2). Tumour growth was significantly inhibited in ephrin-A5 knockdown

compared to vector control cells (Figure 5.11A) (p=0.0372, Log-rank/Mantel-Cox

test). However, tumour growth is also inhibited in the vector controls compared to

parental cells, although to a lesser degree.

To confirm stability of the knockdown cells in vivo, tumours were analysed for

ephrin-A5 expression using Q-PCR. At the end of the experiment two mice in the

ephrin-A5 knockdown group (one from each clone) had formed a small tumour.

These tumours were used to confirm that knockdown of ephrin-A5 was still present

after 120 days in vivo (Figure 5.11B). Interestingly, tumours from the LNCaP and

one vector control, clone 1, had higher levels of ephrin-A5 than the original cell line.


131

0 30 60 90 1200

20

40

60

80

100

LNCaP (n=5)

Vector control (n=9)

ephrin-A5 KD (n=8)

Day

Per

cent

sur

viva

l **

Cel

l lin

eT

umou

r

Cel

l lin

eT

umou

r

Cel

l lin

eT

umou

r

Cel

l lin

eT

umou

r

Cel

l lin

eT

umou

r

0

20

40

60

80

Tran

scri

pt #

per

100

0-

acti

n

ephrin-A5KD

Vectorcontrol

LNCaP

A

B

Figure 5.11: Reduced ephrin-A5 expression leads to reduced tumour growth in

vivo

(A) Survival curve of NOD/SCID mice injected subcutaneously with 2 × 106 LNCaP, vector control or ephrin-A5 shRNA cells. ** Survival = mice were euthanised when tumours measured 1 cm in diameter.

(B) Histogram representing ephrin-A5 mRNA expression in cell line and corresponding tumour sample from parental, vector control and ephrin-A5 shRNA cells. Q-PCR was used to determine mRNA expression. Values represent transcript number relative to 1000 copies of β-actin from three pooled cDNA reactions performed in duplicate.


132

5.4Discussion

The overall aim of this chapter was to determine the effect of ephrin-A5 on cell

adhesion and formation in prostate cancer. LNCaP cells, which express high levels of

ephrin-A5, showed a significant increase in cell migration onto EphA3-Fc stripes. As

confirmed by time-lapse microscopy the cells adhere to the cover slip and then

migrate onto the EphA3-Fc stripes all lining up in similar direction along the stripe.

Ephrin-A5 is the high affinity ligand for EphA3. However, when the same cells,

which also express EphA3, were exposed to ephrin-A5-Fc stripes no attraction was

seen. These results suggest that ephrin-A5 expression on the cell surface, and

therefore reverse signalling, is required for this attraction. 22Rv1 cells have a similar

Eph/ephrin expression profile to LNCaP cells except they do not express ephrin-A5.

The 22Rv1 cells did not show attraction to the EphA3-Fc stripes. In future studies it

would be of interest to transfect ephrin-A5 into 22Rv1 cells to determine if this

would confer the ability to show strong attraction to EphA3.

LNCaP cells pre-treated with the Src inhibitor, PP2, showed a significant reduction

in migration to the EphA3-Fc stripes. A small decrease was also observed with cells

pre-treated with the PP3 control which has been shown to target EGFR. PP2 has been

shown to inhibit Fyn, Lck, Hck and Src. Davy et al reported Fyn, but not Src, was

present in lipid raft domains and that NIH-3T3 cells expressing ephrin-A5 required

Fyn to regulate cell adhesion (Davy et al, 1999). However, this study identified Src,

but was unable to identify Fyn, as a potential target of ephrin-A5 reverse signalling.

It is therefore possible that the reduction in adhesion to EphA3-Fc observed in

LNCaP cells pre-treated with PP2 could be due to ephrin-A5 downstream signalling

through Src. A major limitation involved with identifying potential downstream

targets of ephrin-A5 reverse signalling is isolating protein complexes from lipid rich

domains without disrupting protein-protein interactions. In this study a detergent

insoluble pellet was isolated by high speed microcentrifugation to initially screen for

potential targets. Previous studies have performed ultracentrifugation on sucrose

gradients to isolate proteins within lipid rafts (Campbell et al, 2008; Jiang et al,

2008). This would be a valuable experiment in identifying, and confirming,

individual targets of ephrin-A5 signalling.


133

However, further studies to identify the full extent of downstream targets of ephrin-

A5 signalling are needed. For example, other adhesion mechanisms, such as the

cadherin/catenin complex, are fundamental to the normal structure of many epithelial

tissues and inactivation of this complex in cancer facilitates early invasion into

surrounding tissue (Berx & Van Roy, 2001). A comprehensive proteomic profiling to

include LNCaP and LNCaP ephrin-A5 knockdown cells, with and without activation

by cross-linked EphA3-Fc protein, could yield novel data on ephrin-A5 function.

It was originally thought that loss of ephrin-A5 expression in LNCaP cells, resulting

in reduced adhesiveness to EphA3, may confer greater metastatic potential as loss of

adhesion allows individual tumour cells to move away from the primary tumour.

However, LNCaP cells with reduced ephrin-A5 expression showed no obvious

change to cell migration or invasion using an in vitro wound assay or Matrigel™

invasion assay. In contrast, in a study by Campbell et al, NIH-3T3 cells transfected

with ephrin-A5 showed an increase in invasion compared to empty vector control

cells (Campbell et al, 2006). In keeping with the results observed in this study we

would then expect to see a decrease in invasion. As parental LNCaP cells show

modest migration and invasion, identifying reductions in this cell line may not be

ideal. Therefore, an alternative approach would be to transfect 22Rv1 cells with

ephrin-A5 to determine if an increase in ephrin-A5 results in an increase in invasion

in prostate cancer cell lines.

One of the major findings of this study is the role of ephrin-A5 in regulating prostate

cancer proliferation. Here two ephrin-A5 shRNA sequences resulted in

approximately 40% reduction in proliferation while a third sequence showed

approximately 20% reduction. In contrast, Davy et al found that NIH-3T3 cells

showed a decrease in proliferation with increased levels of ephrin-A5 (Davy et al,

1999). Although three different shRNA sequences were used here to knockdown

ephrin-A5 expression, to exclude the possibility of the reduction in proliferation

being an off-target effect rescue experiments need to be performed. This would be

performed by transfecting an ephrin-A5 construct which is not subject to knockdown

by the shRNA to confirm that proliferation levels are rescued. For the ephrin-A5

shRNA sequences used in this study this would require nucleotide substitutions being


134

made in the shRNA target sites that do not alter the primary amino acid sequence of

the ephrin-A5 rescue construct.

In vivo experiments were performed to determine if the reduction of proliferation

observed in the ephrin-A5 shRNA cell lines translates into an effect on tumour

formation. The ephrin-A5 shRNA cells showed a marked decrease in tumour

formation compared to both the parental and vector controls. These results require

further validation with increased numbers of animals in each group. As mentioned

above it is now important to perform rescue experiments to confirm that

tumourigenicity is restored upon re-expression of ephrin-A5. Immunohistochemical

analysis including Ki67 for cell proliferation and cleaved caspase 3 for apoptosis

should be performed. These studies were not performed for this particular cohort due

to limited material from the ephrin-A5 shRNA tumours however they will be

performed in the future with further cohorts.

In order to make the ephrin-A5 knockdown cells an effective constitutive expression

system routinely delivering 70-80% knockdown was established. This made these

experiments feasible although it required multiple clones and requires further rescue

experiments. Initially an inducible system was trialled; however this approach did

not yield an adequate level of knockdown with available Tet-inducible systems. As

newer inducible vector systems are being made which aim to address the issue of

leaky expression, future experiments using this approach in vivo would be valuable.

This study has demonstrated a potential role of ephrin-A5 in critical aspects of cell

adhesion and a potentially crucial role in tumour formation. This data provides

evidence that ephrin-A5 may be a useful anti-cancer therapeutic target.

Chapter 6: Conclusions and future directions

135

Chapter6:Conclusionsandfuturedirections

The objective of this study was to explore the involvement of the Eph-ephrin system

in regulating critical mechanisms which can contribute to the metastatic process in

prostate cancer. This thesis presents expression levels of individual Ephs and ephrins

in prostate cancer cell lines and tissue samples and identifies specific roles for

EphA2, EphA3 and ephrin-A5 in the regulation of cell adhesion, growth and

movement.

6.1EphA2andEphA3function

This study shows a reciprocal relationship between EphA2 and EphA3 expression in

individual prostate cancer cell lines. EphA3 expression was higher in the androgen

responsive cell lines however expression did not appear to be regulated by androgen.

EphA2 expression was more prominent in the androgen independent cell lines. While

differences in EphA2 and EphA3 expression were observed in individual tumour

samples, the average levels do not differ greatly from the controls. The preliminary

expression data obtained from clinical samples is at this stage insufficient to relate

this apparent exclusive expression of EphA2 and EphA3 to clinical stage, Gleason

score or androgen responsiveness. Thus further studies of patient samples are critical

in determining the possible scope of targeted therapies. Therefore, analysis of these

genes in a large cohort of clinical samples is needed to identify clinical correlations.

Further analysis to determine the roles of EphA2 and EphA3 in prostate cancer cell

biology, revealed that EphA2 and EphA3 appear to function differently in this

cancer. Cells expressing EphA2 showed a greater ability for migration and invasion

while cells expressing EphA3 showed relatively poor migration and invasion. Forced

expression of EphA2 in LNCaP cells resulted in a more invasive phenotype while

forced expression of EphA3 in PC-3 cells resulted in a less invasive phenotype.

These expression studies should also be performed in the 22Rv1 and DU145 cell

lines to confirm these results. Furthermore, EphA2 knockdown studies, which were

attempted but not successful, are required in order to fully assess its contribution to

the invasive phenotype. It is not clear why such structurally similar receptors with


136

similar ligand binding properties show these differences in function. These studies

will provide further knowledge of the role of EphA2 and EphA3 in prostate cancer

movement and will help in determining whether they may make useful biological

markers for the assessment of prostate cancer or targets for new therapies.

6.2Liganddependentversusindependentsignalling

Increasing evidence suggest that members of the Eph receptor tyrosine kinase family

play a role in both tumour promotion and tumour suppression. One possible

explanation for this is the difference in outcome of ligand dependent and ligand

independent signalling (Chen et al, 2008; Miao et al, 2009). Results from this study

support this notion. Over expression of EphA2 in LNCaP cells resulted in a more

invasive phenotype while ligand-induced activation of EphA2 in PC-3 cells resulted

in a less invasive phenotype. In this respect it is interesting to consider the negative

correlation between EphA2 and its primary ligand, ephrin-A1, in prostate cancer cell

lines. There is the possibility that ephrin expression might induce activation of

EphA2 by interaction with an adjacent cell (i.e. in trans) or within the same cells (i.e.

in cis). Therefore, it is possible that PC-3 cells are able to maintain their invasive

nature due to their low ephrin-A1 expression. To further explore this, PC-3 and

DU145 cells could be transfected with ephrin-A1 to determine the effect on cell

migration and invasion.

The novel activation of EphA2 by a combination of two EphA2 Mabs found in this

study may have potential as a therapeutic strategy. PC-3 cells treated with the

combination antibodies resulted in a strong increase in EphA2 activation and a

decrease in invasion. These results are only preliminary and much work is needed to

fully optimise these antibodies to see if a greater reduction in cell invasion can be

achieved. Ultimately, testing in xenografts would be useful in defining anti-tumour

activity.

Cell signalling analyses performed in this and other studies (Miao et al, 2000; Parri

et al, 2007; Taddei et al, 2009; Yang et al, 2011) suggest that Akt, Src and FAK

activity are involved in EphA2 ligand dependent cell movement in prostate cancer,


137

however results are still inconclusive as to the exact mechanisms involved. Further

analysis of these pathways is needed. The mechanisms involved in ligand

independent signalling are also not fully understood. The LNCaP EphA2 transfected

cell line, paired with its vector control, provides a useful tool to identify components

involved. Expression studies as well as co-immunoprecipitation analysis could be

used to assess recruitment of proteins known to be involved in cell movement

including Src, FAK and Akt as well as Rho family members and integrins. These

studies will help to identify how EphA2 ligand dependent signalling differs from

EphA2 ligand independent signalling and provide new insights into how this receptor

could be targeted therapeutically in prostate cancer.

6.3Ephrin‐A5inprostatecanceradhesionandproliferation

One of the most striking observations in this thesis was the role of the high affinity

ligand for EphA3, ephrin-A5, in regulating prostate cancer adhesion and movement.

LNCaP cells, which express high levels of ephrin-A5, showed strong

attraction/migration to EphA3-Fc in stripe assays. This attraction/migration was

inhibited following down regulation of ephrin-A5 using shRNA technology. Reverse

signalling by ephrin-A ligands is not fully understood, however Src family kinases

and integrin signalling have been shown to be targets of ephrin-A activation (Davy &

Robbins, 2000). The reduction in cell attraction/migration to the EphA3-Fc stripes as

a result of treatment with the Src kinase inhibitor, PP2, suggests that the Src family

are targets of ephrin-A5 signalling in prostate cancer. While Fyn has previously been

implicated in ephrin-A signalling (Davy et al, 1999) this study was unable to confirm

its involvement in this system. LNCaP cells show low levels of Fyn but have higher

levels of Lyn and to a lesser degree Src. In future studies Lyn would be a better

target to explore. Similar to the LNCaP cells transfected with EphA2 the LNCaP

ephrin-A5 shRNA cells with their controls provide a useful tool in identifying the

downstream targets of ephrin-A5.


138

A reduction in cell proliferation was observed with the down regulation of ephrin-A5

in vitro. Tumour growth was also markedly inhibited in a mouse xenograft model.

Rescue experiments involving transfection of cells with an ephrin-A5 construct

which is not subject to knockdown by the shRNA are needed to confirm that

tumourigenicity is rescued. These results will help define the scope of targeting

ephrin-A5 in prostate cancer.

6.4OtherEphfamilymembers

While this study focused on the potential roles of EphA2, EphA3 and ephrin-A5,

gene expression profiles in the prostate cancer cell lines also revealed increased

expression of EphB4 and ephrin-B1. A significant increase in ephrin-A1 expression

was also found in tumour compared to BPH clinical samples. Previous studies have

demonstrated a correlation between increased levels of ephrin-A1 and poor prognosis

(Herath et al, 2006; Straume & Akslen, 2002; Xu et al, 2005). In view of these

studies, further investigation is required to determine if this correlation is present in

prostate cancer. High levels of EphB4 have previously been reported for prostate

cancer (Lee et al, 2005; Xia et al, 2005b). EphB4 knockdown studies in PC-3 cells

show reduced cell viability, migration and invasion (Xia et al, 2005b). Similar to the

results observed in this study for EphA2, EphB4 activation by ligand stimulation has

been reported to inhibit cell migration/invasion in breast cancer (Noren et al, 2006).

Ephrin-B2 is the cognate ligand of the EphB4 receptor and it is interesting to note

that ephrin-B2 expression was low for all cell lines. Therefore, it is possible that PC-

3 cells may maintain their invasive nature not only due to their low ephrin-A1

expression but due to low overall levels of ephrin.

In conclusion, this study has provided new information about the potential role of

ephrin-A5 in cell adhesion and proliferation and has identified a potential difference

in function and signalling between the EphA2 and EphA3 receptors in prostate

cancer. Further experiments are necessary to answer new questions raised that will

hopefully provide new insights into unravelling this complex biological system.

References

139

References

(1999) Cancer risks in BRCA2 mutation carriers. The Breast Cancer Linkage Consortium. Journal of the National Cancer Institute 91: 1310-6 (2007) Cancer Facts and Figures 2007. American Cancer Society Aasheim HC, Patzke S, Hjorthaug HS, Finne EF (2005) Characterization of a novel Eph receptor tyrosine kinase, EphA10, expressed in testis. Biochimica et Biophysica Acta 1723: 1-7 Abate-Shen C, Shen MM (2000) Molecular genetics of prostate cancer. Genes & Development 14: 2410-34 Agoulnik IU, Weigel NL (2006) Androgen receptor action in hormone-dependent and recurrent prostate cancer. Journal of Cellular Biochemistry 99: 362-72 AIHW (2010) Cancer in Australia: an overview, 2010. Alam SM, Fujimoto J, Jahan I, Sato E, Tamaya T (2009) Coexpression of EphB4 and ephrinB2 in tumor advancement of uterine cervical cancers. Gynecologic Oncology 114: 84-8 Alessi DR, Cohen P (1998) Mechanism of activation and function of protein kinase B. Current Opinion in Genetics & Development 8: 55-62 Arima T, Enokida H, Kubo H, Kagara I, Matsuda R, Toki K, Nishimura H, Chiyomaru T, Tatarano S, Idesako T, Nishiyama K, Nakagawa M (2007) Nuclear translocation of ADAM-10 contributes to the pathogenesis and progression of human prostate cancer. Cancer Science 98: 1720-6 Armstrong DG, Jude EB (2002) The role of matrix metalloproteinases in wound healing. Journal of the American Podiatric Medical Association 92: 12-8 Arvanitis D, Davy A (2008) Eph/ephrin signaling: networks. Genes & Development 22: 416-29 Ayala AG, Ro JY (2007) Prostatic intraepithelial neoplasia: recent advances. Archives of Pathology & Laboratory Medicine 131: 1257-66 Batlle E, Bacani J, Begthel H, Jonkheer S, Gregorieff A, van de Born M, Malats N, Sancho E, Boon E, Pawson T, Gallinger S, Pals S, Clevers H (2005) EphB receptor activity suppresses colorectal cancer progression. Nature 435: 1126-30 Batlle E, Henderson JT, Beghtel H, van den Born MM, Sancho E, Huls G, Meeldijk J, Robertson J, van de Wetering M, Pawson T, Clevers H (2002) Beta-catenin and

References

140

TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB. Cell 111: 251-63 Bennett BD, Wang Z, Kuang WJ, Wang A, Groopman JE, Goeddel DV, Scadden DT (1994) Cloning and characterization of HTK, a novel transmembrane tyrosine kinase of the EPH subfamily. The Journal of Biological Chemistry 269: 14211-8 Bennett BD, Zeigler FC, Gu Q, Fendly B, Goddard AD, Gillett N, Matthews W (1995) Molecular cloning of a ligand for the EPH-related receptor protein-tyrosine kinase Htk. Proceedings of the National Academy of Sciences of the United States of America 92: 1866-70 Berclaz G, Flutsch B, Altermatt HJ, Rohrbach V, Djonov V, Ziemiecki A, Dreher E, Andres AC (2002) Loss of EphB4 receptor tyrosine kinase protein expression during carcinogenesis of the human breast. Oncology Reports 9: 985-9 Berman AE, Kozlova NI, Morozevich GE (2003) Integrins: structure and signaling. Biochemistry (Moscow) 68: 1284-99 Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, Donovan J, Barretina J, Boehm JS, Dobson J, Urashima M, Mc Henry KT, Pinchback RM, Ligon AH, Cho YJ, Haery L, Greulich H, Reich M, Winckler W, Lawrence MS, Weir BA, Tanaka KE, Chiang DY, Bass AJ, Loo A, Hoffman C, Prensner J, Liefeld T, Gao Q, Yecies D, Signoretti S, Maher E, Kaye FJ, Sasaki H, Tepper JE, Fletcher JA, Tabernero J, Baselga J, Tsao MS, Demichelis F, Rubin MA, Janne PA, Daly MJ, Nucera C, Levine RL, Ebert BL, Gabriel S, Rustgi AK, Antonescu CR, Ladanyi M, Letai A, Garraway LA, Loda M, Beer DG, True LD, Okamoto A, Pomeroy SL, Singer S, Golub TR, Lander ES, Getz G, Sellers WR, Meyerson M (2010) The landscape of somatic copy-number alteration across human cancers. Nature 463: 899-905 Berx G, Van Roy F (2001) The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Research 3: 289-93 Birgbauer E, Cowan CA, Sretavan DW, Henkemeyer M (2000) Kinase independent function of EphB receptors in retinal axon pathfinding to the optic disc from dorsal but not ventral retina. Development 127: 1231-41 Bostwick DG, Liu L, Brawer MK, Qian J (2004) High-grade prostatic intraepithelial neoplasia. Reviews in Urology 6: 171-9 Botchorishvili G, Matikainen MP, Lilja H (2009) Early prostate-specific antigen changes and the diagnosis and prognosis of prostate cancer. Current Opinion in Urology 19: 221-6 Boyd AW, Ward LD, Wicks IP, Simpson RJ, Salvaris E, Wilks A, Welch K, Loudovaris M, Rockman S, Busmanis I (1992) Isolation and characterization of a

References

141

novel receptor-type protein tyrosine kinase (hek) from a human pre-B cell line. The Journal of Biological Chemistry 267: 3262-7 Bracarda S, de Cobelli O, Greco C, Prayer-Galetti T, Valdagni R, Gatta G, de Braud F, Bartsch G (2005) Cancer of the prostate. Critical Reviews in Oncology Hematology 56: 379-96 Brantley-Sieders DM, Caughron J, Hicks D, Pozzi A, Ruiz JC, Chen J (2004) EphA2 receptor tyrosine kinase regulates endothelial cell migration and vascular assembly through phosphoinositide 3-kinase-mediated Rac1 GTPase activation. Journal of Cell Science 117: 2037-49 Brantley-Sieders DM, Chen J (2004) Eph receptor tyrosine kinases in angiogenesis: from development to disease. Angiogenesis 7: 17-28 Brantley-Sieders DM, Zhuang G, Hicks D, Fang WB, Hwang Y, Cates JM, Coffman K, Jackson D, Bruckheimer E, Muraoka-Cook RS, Chen J (2008) The receptor tyrosine kinase EphA2 promotes mammary adenocarcinoma tumorigenesis and metastatic progression in mice by amplifying ErbB2 signaling. The Journal of Clinical Investigation 118: 64-78 Brantley DM, Cheng N, Thompson EJ, Lin Q, Brekken RA, Thorpe PE, Muraoka RS, Cerretti DP, Pozzi A, Jackson D, Lin C, Chen J (2002) Soluble Eph A receptors inhibit tumor angiogenesis and progression in vivo. Oncogene 21: 7011-26 Brave M, Goodman V, Kaminskas E, Farrell A, Timmer W, Pope S, Harapanhalli R, Saber H, Morse D, Bullock J, Men A, Noory C, Ramchandani R, Kenna L, Booth B, Gobburu J, Jiang X, Sridhara R, Justice R, Pazdur R (2008) Sprycel for chronic myeloid leukemia and Philadelphia chromosome-positive acute lymphoblastic leukemia resistant to or intolerant of imatinib mesylate. Clinical Cancer Research 14: 352-9 Bruckner K, Pasquale EB, Klein R (1997) Tyrosine phosphorylation of transmembrane ligands for Eph receptors. Science 275: 1640-3 Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, Gasser TC, Mihatsch MJ (2000) Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients. Human Pathology 31: 578-83 Calalb MB, Polte TR, Hanks SK (1995) Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases. Molecular and Cellular Biology 15: 954-63 Calalb MB, Zhang X, Polte TR, Hanks SK (1996) Focal adhesion kinase tyrosine-861 is a major site of phosphorylation by Src. Biochemical and Biophysical Research Communications 228: 662-8

References

142

Campbell TN, Attwell S, Arcellana-Panlilio M, Robbins SM (2006) Ephrin A5 expression promotes invasion and transformation of murine fibroblasts. Biochemical and Biophysical Research Communications 350: 623-8 Campbell TN, Davy A, Liu Y, Arcellana-Panlilio M, Robbins SM (2008) Distinct membrane compartmentalization and signaling of ephrin-A5 and ephrin-B1. Biochemical and Biophysical Research Communications 375: 362-6 Campbell TN, Robbins SM (2008) The Eph receptor/ephrin system: an emerging player in the invasion game. Current Issues in Molecular Biology 10: 61-6 Carter N, Nakamoto T, Hirai H, Hunter T (2002) EphrinA1-induced cytoskeletal re-organization requires FAK and p130(cas). Nature Cell Biology 4: 565-73 Carvalho RF, Beutler M, Marler KJ, Knoll B, Becker-Barroso E, Heintzmann R, Ng T, Drescher U (2006) Silencing of EphA3 through a cis interaction with ephrinA5. Nature Neuroscience 9: 322-30 Castellvi J, Garcia A, de la Torre J, Hernandez J, Gil A, Xercavins J, Ramon y Cajal S (2006) Ephrin B expression in epithelial ovarian neoplasms correlates with tumor differentiation and angiogenesis. Human Pathology 37: 883-9 Catalona WJ, Smith DS, Ratliff TL, Dodds KM, Coplen DE, Yuan JJ, Petros JA, Andriole GL (1991) Measurement of prostate-specific antigen in serum as a screening test for prostate cancer. The New England Journal of Medicine 324: 1156-61 Cerretti DP, Nelson N (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics 47: 131-5 Chen J, Zhuang G, Frieden L, Debinski W (2008) Eph receptors and Ephrins in cancer: common themes and controversies. Cancer Research 68: 10031-3 Cheng N, Brantley DM, Chen J (2002) The ephrins and Eph receptors in angiogenesis. Cytokine & Growth Factor Reviews 13: 75-85 Chiari R, Hames G, Stroobant V, Texier C, Maillere B, Boon T, Coulie PG (2000) Identification of a tumor-specific shared antigen derived from an Eph receptor and presented to CD4 T cells on HLA class II molecules. Cancer Research 60: 4855-63 Clifford N, Smith LM, Powell J, Gattenlohner S, Marx A, O'Connor R (2008) The EphA3 receptor is expressed in a subset of rhabdomyosarcoma cell lines and suppresses cell adhesion and migration. Journal of Cellular Biochemistry 105: 1250-9

References

143

Collen A, Hanemaaijer R, Lupu F, Quax PH, van Lent N, Grimbergen J, Peters E, Koolwijk P, van Hinsbergh VW (2003) Membrane-type matrix metalloproteinase-mediated angiogenesis in a fibrin-collagen matrix. Blood 101: 1810-7 Contreras HR, Ledezma RA, Vergara J, Cifuentes F, Barra C, Cabello P, Gallegos I, Morales B, Huidobro C, Castellon EA (2010) The expression of syndecan-1 and -2 is associated with Gleason score and epithelial-mesenchymal transition markers, E-cadherin and beta-catenin, in prostate cancer. Urologic Oncology 28: 534-40 Coonan JR, Greferath U, Messenger J, Hartley L, Murphy M, Boyd AW, Dottori M, Galea MP, Bartlett PF (2001) Development and reorganization of corticospinal projections in EphA4 deficient mice. The Journal of Comparative Neurology 436: 248-62 Cooper MA, Son AI, Komlos D, Sun Y, Kleiman NJ, Zhou R (2008) Loss of ephrin-A5 function disrupts lens fiber cell packing and leads to cataract. Proceedings of the National Academy of Sciences of the United States of America 105: 16620-5 Cowan CA, Henkemeyer M (2001) The SH2/SH3 adaptor Grb4 transduces B-ephrin reverse signals. Nature 413: 174-9 Cress AE, Rabinovitz I, Zhu W, Nagle RB (1995) The alpha 6 beta 1 and alpha 6 beta 4 integrins in human prostate cancer progression. Cancer Metastasis Reviews 14: 219-28 Davidson D, Bostwick DG, Qian J, Wollan PC, Oesterling JE, Rudders RA, Siroky M, Stilmant M (1995) Prostatic intraepithelial neoplasia is a risk factor for adenocarcinoma: predictive accuracy in needle biopsies. The Journal of Urology 154: 1295-9 Davis S, Gale NW, Aldrich TH, Maisonpierre PC, Lhotak V, Pawson T, Goldfarb M, Yancopoulos GD (1994) Ligands for EPH-related receptor tyrosine kinases that require membrane attachment or clustering for activity. Science 266: 816-9 Davy A, Gale NW, Murray EW, Klinghoffer RA, Soriano P, Feuerstein C, Robbins SM (1999) Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine kinase to regulate cellular adhesion. Genes & Development 13: 3125-35 Davy A, Robbins SM (2000) Ephrin-A5 modulates cell adhesion and morphology in an integrin-dependent manner. The EMBO Journal 19: 5396-405 Denmeade SR, Lin XS, Isaacs JT (1996) Role of programmed (apoptotic) cell death during the progression and therapy for prostate cancer. Prostate 28: 251-65 Dodelet VC, Pasquale EB (2000) Eph receptors and ephrin ligands: embryogenesis to tumorigenesis. Oncogene 19: 5614-9

References

144

Domin J, Waterfield MD (1997) Using structure to define the function of phosphoinositide 3-kinase family members. FEBS Letters 410: 91-5 Dopeso H, Mateo-Lozano S, Mazzolini R, Rodrigues P, Lagares-Tena L, Ceron J, Romero J, Esteves M, Landolfi S, Hernandez-Losa J, Castano J, Wilson AJ, Ramon y Cajal S, Mariadason JM, Schwartz S, Jr., Arango D (2009) The receptor tyrosine kinase EPHB4 has tumor suppressor activities in intestinal tumorigenesis. Cancer Research 69: 7430-8 Dottori M, Down M, Huttmann A, Fitzpatrick DR, Boyd AW (1999) Cloning and characterization of EphA3 (Hek) gene promoter: DNA methylation regulates expression in hematopoietic tumor cells. Blood 94: 2477-86 Dottori M, Hartley L, Galea M, Paxinos G, Polizzotto M, Kilpatrick T, Bartlett PF, Murphy M, Kontgen F, Boyd AW (1998) EphA4 (Sek1) receptor tyrosine kinase is required for the development of the corticospinal tract. Proceedings of the National Academy of Sciences of the United States of America 95: 13248-53 Drescher U, Kremoser C, Handwerker C, Loschinger J, Noda M, Bonhoeffer F (1995) In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to ligands for Eph receptor tyrosine kinases. Cell 82: 359-70 Duffy SL, Steiner KA, Tam PP, Boyd AW (2006) Expression analysis of the Epha1 receptor tyrosine kinase and its high-affinity ligands Efna1 and Efna3 during early mouse development. Gene Expression Patterns 6: 719-23 Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE (2004) EphA2: a determinant of malignant cellular behavior and a potential therapeutic target in pancreatic adenocarcinoma. Oncogene 23: 1448-56 Edwards J (2010) Src kinase inhibitors: an emerging therapeutic treatment option for prostate cancer. Expert Opinion on Investigational Drugs 19: 605-14 Edwards J, Krishna NS, Witton CJ, Bartlett JM (2003) Gene amplifications associated with the development of hormone-resistant prostate cancer. Clinical Cancer Research 9: 5271-81 Edwards JL (2008) Diagnosis and management of benign prostatic hyperplasia. American Family Physician 77: 1403-10 Emberton M, Cornel EB, Bassi PF, Fourcade RO, Gomez JM, Castro R (2008) Benign prostatic hyperplasia as a progressive disease: a guide to the risk factors and options for medical management. International Journal of Clinical Practice 62: 1076-86 English HF, Santen RJ, Isaacs JT (1987) Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. Prostate 11: 229-42

References

145

Evans GS, Chandler JA (1987) Cell proliferation studies in the rat prostate: II. The effects of castration and androgen-induced regeneration upon basal and secretory cell proliferation. Prostate 11: 339-51 Evans IR, Renne T, Gertler FB, Nobes CD (2007) Ena/VASP proteins mediate repulsion from ephrin ligands. Journal of Cell Science 120: 289-98 Faoro L, Singleton PA, Cervantes GM, Lennon FE, Choong NW, Kanteti R, Ferguson BD, Husain AN, Tretiakova MS, Ramnath N, Vokes EE, Salgia R (2010) EphA2 mutation in lung squamous cell carcinoma promotes increased cell survival, cell invasion, focal adhesions, and mammalian target of rapamycin activation. The Journal of Biological Chemistry 285: 18575-85 Forbes SA, Bhamra G, Bamford S, Dawson E, Kok C, Clements J, Menzies A, Teague JW, Futreal PA, Stratton MR (2008) The Catalogue of Somatic Mutations in Cancer (COSMIC). Current Protocols in Human Genetics Chapter 10: Unit 10 11 Fox BP, Tabone CJ, Kandpal RP (2006) Potential clinical relevance of Eph receptors and ephrin ligands expressed in prostate carcinoma cell lines. Biochemical and Biophysical Research Communications 342: 1263-72 Frankenberry KA, Somasundar P, McFadden DW, Vona-Davis LC (2004) Leptin induces cell migration and the expression of growth factors in human prostate cancer cells. The American Journal of Surgery 188: 560-5 Franks LM (1953) Benign nodular hyperplasia of the prostate; a review. Annals of The Royal College of Surgeons of England 14: 92-106 Freywald A, Sharfe N, Roifman CM (2002) The kinase-null EphB6 receptor undergoes transphosphorylation in a complex with EphB1. The Journal of Biological Chemistry 277: 3823-8 Frisen J, Yates PA, McLaughlin T, Friedman GC, O'Leary DD, Barbacid M (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron 20: 235-43 Futreal PA, Coin L, Marshall M, Down T, Hubbard T, Wooster R, Rahman N, Stratton MR (2004) A census of human cancer genes. Nature Reviews Cancer 4: 177-83 Gao L, Smith RS, Chen LM, Chai KX, Chao L, Chao J (2010) Tissue kallikrein promotes prostate cancer cell migration and invasion via a protease-activated receptor-1-dependent signaling pathway. The Journal of Biological Chemistry 391: 803-12 Gao X, Honn KV (1995) Recessive oncogenes: current status. Pathology and Oncology Research 1: 7-22

References

146

Gauthier LR, Robbins SM (2003) Ephrin signaling: One raft to rule them all? One raft to sort them? One raft to spread their call and in signaling bind them? Life Sciences 74: 207-16 Gazdar AF (1992) The molecular biology of lung cancer. The Tohoku Journal of Experimental Medicine 168: 239-45 Gelmann EP (2002) Molecular biology of the androgen receptor. Journal of Clinical Oncology 20: 3001-15 Goel HL, Breen M, Zhang J, Das I, Aznavoorian-Cheshire S, Greenberg NM, Elgavish A, Languino LR (2005) beta1A integrin expression is required for type 1 insulin-like growth factor receptor mitogenic and transforming activities and localization to focal contacts. Cancer Research 65: 6692-700 Goel HL, Li J, Kogan S, Languino LR (2008) Integrins in prostate cancer progression. Endocrine-Related Cancer 15: 657-64 Goldenberg-Furmanov M, Stein I, Pikarsky E, Rubin H, Kasem S, Wygoda M, Weinstein I, Reuveni H, Ben-Sasson SA (2004) Lyn is a target gene for prostate cancer: sequence-based inhibition induces regression of human tumor xenografts. Cancer Research 64: 1058-66 Gottlieb B, Beitel LK, Wu JH, Trifiro M (2004) The androgen receptor gene mutations database (ARDB): 2004 update. Human Mutation 23: 527-33 Greene ND, Copp AJ (2005) Mouse models of neural tube defects: investigating preventive mechanisms. American Journal of Medical Genetics Part C, Seminars in Medical Genetics 135C: 31-41 Greenman C, Stephens P, Smith R, Dalgliesh GL, Hunter C, Bignell G, Davies H, Teague J, Butler A, Stevens C, Edkins S, O'Meara S, Vastrik I, Schmidt EE, Avis T, Barthorpe S, Bhamra G, Buck G, Choudhury B, Clements J, Cole J, Dicks E, Forbes S, Gray K, Halliday K, Harrison R, Hills K, Hinton J, Jenkinson A, Jones D, Menzies A, Mironenko T, Perry J, Raine K, Richardson D, Shepherd R, Small A, Tofts C, Varian J, Webb T, West S, Widaa S, Yates A, Cahill DP, Louis DN, Goldstraw P, Nicholson AG, Brasseur F, Looijenga L, Weber BL, Chiew YE, DeFazio A, Greaves MF, Green AR, Campbell P, Birney E, Easton DF, Chenevix-Trench G, Tan MH, Khoo SK, Teh BT, Yuen ST, Leung SY, Wooster R, Futreal PA, Stratton MR (2007) Patterns of somatic mutation in human cancer genomes. Nature 446: 153-8 Guan M, Xu C, Zhang F, Ye C (2009) Aberrant methylation of EphA7 in human prostate cancer and its relation to clinicopathologic features. International Journal of Cancer 124: 88-94 Gurniak CB, Berg LJ (1996) A new member of the Eph family of receptors that lacks protein tyrosine kinase activity. Oncogene 13: 777-86

References

147

Guy M, Kote-Jarai Z, Giles GG, Al Olama AA, Jugurnauth SK, Mulholland S, Leongamornlert DA, Edwards SM, Morrison J, Field HI, Southey MC, Severi G, Donovan JL, Hamdy FC, Dearnaley DP, Muir KR, Smith C, Bagnato M, Ardern-Jones AT, Hall AL, O'Brien LT, Gehr-Swain BN, Wilkinson RA, Cox A, Lewis S, Brown PM, Jhavar SG, Tymrakiewicz M, Lophatananon A, Bryant SL, Horwich A, Huddart RA, Khoo VS, Parker CC, Woodhouse CJ, Thompson A, Christmas T, Ogden C, Fisher C, Jameson C, Cooper CS, English DR, Hopper JL, Neal DE, Easton DF, Eeles RA (2009) Identification of new genetic risk factors for prostate cancer. Asian Journal of Andrology 11: 49-55 Haas GP, Sakr WA (1997) Epidemiology of prostate cancer. CA: A Cancer Journal for Clinicians 47: 273-87 Hafner C, Becker B, Landthaler M, Vogt T (2006) Expression profile of Eph receptors and ephrin ligands in human skin and downregulation of EphA1 in nonmelanoma skin cancer. Modern Pathology 19: 1369-77 Hafner C, Schmitz G, Meyer S, Bataille F, Hau P, Langmann T, Dietmaier W, Landthaler M, Vogt T (2004) Differential gene expression of Eph receptors and ephrins in benign human tissues and cancers. Clinical Chemistry 50: 490-9 Halloran MC, Wolman MA (2006) Repulsion or adhesion: receptors make the call. Current Opinion in Cell Biology 18: 533-40 Hammond SA, Lutterbuese R, Roff S, Lutterbuese P, Schlereth B, Bruckheimer E, Kinch MS, Coats S, Baeuerle PA, Kufer P, Kiener PA (2007) Selective targeting and potent control of tumor growth using an EphA2/CD3-Bispecific single-chain antibody construct. Cancer Research 67: 3927-35 Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100: 57-70 Harkaway RC, Issa MM (2006) Medical and minimally invasive therapies for the treatment of benign prostatic hyperplasia. Prostate Cancer Prostatic Diseases 9: 204-14 Hattori M, Osterfield M, Flanagan JG (2000) Regulated cleavage of a contact-mediated axon repellent. Science 289: 1360-5 Herath NI, Doecke J, Spanevello MD, Leggett BA, Boyd AW (2009) Epigenetic silencing of EphA1 expression in colorectal cancer is correlated with poor survival. British Journal of Cancer 100: 1095-102 Herath NI, Spanevello MD, Sabesan S, Newton T, Cummings M, Duffy S, Lincoln D, Boyle G, Parsons PG, Boyd AW (2006) Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival. BMC Cancer 6: 144

References

148

Himanen JP, Chumley MJ, Lackmann M, Li C, Barton WA, Jeffrey PD, Vearing C, Geleick D, Feldheim DA, Boyd AW, Henkemeyer M, Nikolov DB (2004) Repelling class discrimination: ephrin-A5 binds to and activates EphB2 receptor signaling. Nature Neuroscience 7: 501-9 Himanen JP, Rajashankar KR, Lackmann M, Cowan CA, Henkemeyer M, Nikolov DB (2001) Crystal structure of an Eph receptor-ephrin complex. Nature 414: 933-8 Himanen JP, Yermekbayeva L, Janes PW, Walker JR, Xu K, Atapattu L, Rajashankar KR, Mensinga A, Lackmann M, Nikolov DB, Dhe-Paganon S (2010) Architecture of Eph receptor clusters. Proceedings of the National Academy of Sciences of the United States of America 107: 10860-5 Hirai H, Maru Y, Hagiwara K, Nishida J, Takaku F (1987) A novel putative tyrosine kinase receptor encoded by the eph gene. Science 238: 1717-20 Hockenbery DM, Zutter M, Hickey W, Nahm M, Korsmeyer SJ (1991) BCL2 protein is topographically restricted in tissues characterized by apoptotic cell death. Proceedings of the National Academy of Sciences of the United States of America 88: 6961-5 Holland SJ, Gale NW, Mbamalu G, Yancopoulos GD, Henkemeyer M, Pawson T (1996) Bidirectional signalling through the EPH-family receptor Nuk and its transmembrane ligands. Nature 383: 722-5 Holmberg J, Clarke DL, Frisen J (2000) Regulation of repulsion versus adhesion by different splice forms of an Eph receptor. Nature 408: 203-6 Huai J, Drescher U (2001) An ephrin-A-dependent signaling pathway controls integrin function and is linked to the tyrosine phosphorylation of a 120-kDa protein. The Journal of Biological Chemistry 276: 6689-94 Hubbard SR (1999) Structural analysis of receptor tyrosine kinases. Progress in Biophysics and Molecular Biology 71: 343-58 Hudson DL (2004) Epithelial stem cells in human prostate growth and disease. Prostate Cancer Prostatic Disease 7: 188-94 Huusko P, Ponciano-Jackson D, Wolf M, Kiefer JA, Azorsa DO, Tuzmen S, Weaver D, Robbins C, Moses T, Allinen M, Hautaniemi S, Chen Y, Elkahloun A, Basik M, Bova GS, Bubendorf L, Lugli A, Sauter G, Schleutker J, Ozcelik H, Elowe S, Pawson T, Trent JM, Carpten JD, Kallioniemi OP, Mousses S (2004) Nonsense-mediated decay microarray analysis identifies mutations of EPHB2 in human prostate cancer. Nature Genetics 36: 979-83 Hynes RO (1987) Integrins: a family of cell surface receptors. Cell 48: 549-54

References

149

Iida H, Honda M, Kawai HF, Yamashita T, Shirota Y, Wang BC, Miao H, Kaneko S (2005) Ephrin-A1 expression contributes to the malignant characteristics of {alpha}-fetoprotein producing hepatocellular carcinoma. Gut 54: 843-51 Isaacs JT, Coffey DS (1981) Adaptation versus selection as the mechanism responsible for the relapse of prostatic cancer to androgen ablation therapy as studied in the Dunning R-3327-H adenocarcinoma. Cancer Research 41: 5070-5 Janes PW, Saha N, Barton WA, Kolev MV, Wimmer-Kleikamp SH, Nievergall E, Blobel CP, Himanen JP, Lackmann M, Nikolov DB (2005) Adam meets Eph: an ADAM substrate recognition module acts as a molecular switch for ephrin cleavage in trans. Cell 123: 291-304 Jeronimo C, Henrique R, Hoque MO, Ribeiro FR, Oliveira J, Fonseca D, Teixeira MR, Lopes C, Sidransky D (2004) Quantitative RARbeta2 hypermethylation: a promising prostate cancer marker. Clinical Cancer Research 10: 4010-4 Jiang G, Freywald T, Webster J, Kozan D, Geyer R, DeCoteau J, Narendran A, Freywald A (2008) In human leukemia cells ephrin-B-induced invasive activity is supported by Lck and is associated with reassembling of lipid raft signaling complexes. Molecular Cancer Research 6: 291-305 Johnson FM, Bekele BN, Feng L, Wistuba I, Tang XM, Tran HT, Erasmus JJ, Hwang LL, Takebe N, Blumenschein GR, Lippman SM, Stewart DJ (2010) Phase II study of dasatinib in patients with advanced non-small-cell lung cancer. Journal of Clinical Oncology 28: 4609-15 Johnson TR, Khandrika L, Kumar B, Venezia S, Koul S, Chandhoke R, Maroni P, Donohue R, Meacham RB, Koul HK (2008) Focal adhesion kinase controls aggressive phenotype of androgen-independent prostate cancer. Molecular Cancer Research 6: 1639-48 Karaman MW, Herrgard S, Treiber DK, Gallant P, Atteridge CE, Campbell BT, Chan KW, Ciceri P, Davis MI, Edeen PT, Faraoni R, Floyd M, Hunt JP, Lockhart DJ, Milanov ZV, Morrison MJ, Pallares G, Patel HK, Pritchard S, Wodicka LM, Zarrinkar PP (2008) A quantitative analysis of kinase inhibitor selectivity. Nature Biotechnology 26: 127-32 Kinch MS, Carles-Kinch K (2003) Overexpression and functional alterations of the EphA2 tyrosine kinase in cancer. Clinical and Experimental Metastasis 20: 59-68 Kinch MS, Moore MB, Harpole DH, Jr. (2003) Predictive value of the EphA2 receptor tyrosine kinase in lung cancer recurrence and survival. Clinical Cancer Research 9: 613-8 Knox JD, Cress AE, Clark V, Manriquez L, Affinito KS, Dalkin BL, Nagle RB (1994) Differential expression of extracellular matrix molecules and the alpha 6-

References

150

integrins in the normal and neoplastic prostate. American Journal of Pathology 145: 167-74 Kohli M, Tindall DJ (2010) New developments in the medical management of prostate cancer. Mayo Clinic Proceedings 85: 77-86 Krajewska M, Krajewski S, Epstein JI, Shabaik A, Sauvageot J, Song K, Kitada S, Reed JC (1996) Immunohistochemical analysis of bcl-2, bax, bcl-X, and mcl-1 expression in prostate cancers. American Journal of Pathology 148: 1567-76 Kullander K, Croll SD, Zimmer M, Pan L, McClain J, Hughes V, Zabski S, DeChiara TM, Klein R, Yancopoulos GD, Gale NW (2001a) Ephrin-B3 is the midline barrier that prevents corticospinal tract axons from recrossing, allowing for unilateral motor control. Genes & Development 15: 877-88 Kullander K, Mather NK, Diella F, Dottori M, Boyd AW, Klein R (2001b) Kinase-dependent and kinase-independent functions of EphA4 receptors in major axon tract formation in vivo. Neuron 29: 73-84 Kumar SR, Masood R, Spannuth WA, Singh J, Scehnet J, Kleiber G, Jennings N, Deavers M, Krasnoperov V, Dubeau L, Weaver FA, Sood AK, Gill PS (2007) The receptor tyrosine kinase EphB4 is overexpressed in ovarian cancer, provides survival signals and predicts poor outcome. British Journal of Cancer 96: 1083-91 Kumar SR, Singh J, Xia G, Krasnoperov V, Hassanieh L, Ley EJ, Scehnet J, Kumar NG, Hawes D, Press MF, Weaver FA, Gill PS (2006) Receptor tyrosine kinase EphB4 is a survival factor in breast cancer. American Journal of Pathology 169: 279-93 Lackmann M, Oates AC, Dottori M, Smith FM, Do C, Power M, Kravets L, Boyd AW (1998) Distinct subdomains of the EphA3 receptor mediate ligand binding and receptor dimerization. The Journal of Biological Chemistry 273: 20228-37 Lara PN, Jr., Longmate J, Evans CP, Quinn DI, Twardowski P, Chatta G, Posadas E, Stadler W, Gandara DR (2009) A phase II trial of the Src-kinase inhibitor AZD0530 in patients with advanced castration-resistant prostate cancer: a California Cancer Consortium study. Anticancer Drugs 20: 179-84 Lawrenson ID, Wimmer-Kleikamp SH, Lock P, Schoenwaelder SM, Down M, Boyd AW, Alewood PF, Lackmann M (2002) Ephrin-A5 induces rounding, blebbing and de-adhesion of EphA3-expressing 293T and melanoma cells by CrkII and Rho-mediated signalling. Journal of Cell Science 115: 1059-72 Lawson DA, Zong Y, Memarzadeh S, Xin L, Huang J, Witte ON (2010) Basal epithelial stem cells are efficient targets for prostate cancer initiation. Proceedings of the National Academy of Sciences of the United States of America 107: 2610-5

References

151

Lebrand C, Dent EW, Strasser GA, Lanier LM, Krause M, Svitkina TM, Borisy GG, Gertler FB (2004) Critical role of Ena/VASP proteins for filopodia formation in neurons and in function downstream of netrin-1. Neuron 42: 37-49 Lee LF, Louie MC, Desai SJ, Yang J, Chen HW, Evans CP, Kung HJ (2004) Interleukin-8 confers androgen-independent growth and migration of LNCaP: differential effects of tyrosine kinases Src and FAK. Oncogene 23: 2197-205 Lee YC, Perren JR, Douglas EL, Raynor MP, Bartley MA, Bardy PG, Stephenson SA (2005) Investigation of the expression of the EphB4 receptor tyrosine kinase in prostate carcinoma. BMC Cancer 5: 119 Li JJ, Liu DP, Liu GT, Xie D (2009) EphrinA5 acts as a tumor suppressor in glioma by negative regulation of epidermal growth factor receptor. Oncogene 28: 1759-68 Lickliter JD, Smith FM, Olsson JE, Mackwell KL, Boyd AW (1996) Embryonic stem cells express multiple Eph-subfamily receptor tyrosine kinases. Proceedings of the National Academy of Sciences of the United States of America 93: 145-50 Lin D, Gish GD, Songyang Z, Pawson T (1999) The carboxyl terminus of B class ephrins constitutes a PDZ domain binding motif. The Journal of Biological Chemistry 274: 3726-33 Liu DP, Wang Y, Koeffler HP, Xie D (2007) Ephrin-A1 is a negative regulator in glioma through down-regulation of EphA2 and FAK. International Journal of Oncology 30: 865-71 Liu W, Ahmad SA, Jung YD, Reinmuth N, Fan F, Bucana CD, Ellis LM (2002) Coexpression of ephrin-Bs and their receptors in colon carcinoma. Cancer 94: 934-9 Liu W, Jung YD, Ahmad SA, McCarty MF, Stoeltzing O, Reinmuth N, Fan F, Ellis LM (2004) Effects of overexpression of ephrin-B2 on tumour growth in human colorectal cancer. British Journal of Cancer 90: 1620-6 Locke JA, Guns ES, Lubik AA, Adomat HH, Hendy SC, Wood CA, Ettinger SL, Gleave ME, Nelson CC (2008) Androgen levels increase by intratumoral de novo steroidogenesis during progression of castration-resistant prostate cancer. Cancer Research 68: 6407-15 Lu Q, Sun EE, Klein RS, Flanagan JG (2001a) Ephrin-B reverse signaling is mediated by a novel PDZ-RGS protein and selectively inhibits G protein-coupled chemoattraction. Cell 105: 69-79 Lu Z, Jiang G, Blume-Jensen P, Hunter T (2001b) Epidermal growth factor-induced tumor cell invasion and metastasis initiated by dephosphorylation and downregulation of focal adhesion kinase. Molecular and Cellular Biology 21: 4016-31

References

152

Maehama T, Dixon JE (1998) The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. The Journal of Biological Chemistry 273: 13375-8 Manning BD, Cantley LC (2007) AKT/PKB signaling: navigating downstream. Cell 129: 1261-74 Matsuoka H, Iwata N, Ito M, Shimoyama M, Nagata A, Chihara K, Takai S, Matsui T (1997) Expression of a kinase-defective Eph-like receptor in the normal human brain. Biochemical and Biophysical Research Communications 235: 487-92 McCarron JK, Stringer BW, Day BW, Boyd AW (2010) Ephrin expression and function in cancer. Future Oncology 6: 165-76 McCulloch DR, Akl P, Samaratunga H, Herington AC, Odorico DM (2004) Expression of the disintegrin metalloprotease, ADAM-10, in prostate cancer and its regulation by dihydrotestosterone, insulin-like growth factor I, and epidermal growth factor in the prostate cancer cell model LNCaP. Clinical Cancer Research 10: 314-23 McCulloch DR, Harvey M, Herington AC (2000) The expression of the ADAMs proteases in prostate cancer cell lines and their regulation by dihydrotestosterone. Molecular and Cellular Endocrinology 167: 11-21 McDonnell TJ, Troncoso P, Brisbay SM, Logothetis C, Chung LW, Hsieh JT, Tu SM, Campbell ML (1992) Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Research 52: 6940-4 McNeal JE (1981) The zonal anatomy of the prostate. Prostate 2: 35-49 McNeal JE, Redwine EA, Freiha FS, Stamey TA (1988) Zonal distribution of prostatic adenocarcinoma. Correlation with histologic pattern and direction of spread. The American Journal of Surgical Pathology 12: 897-906 Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC, Baylin SB, Sidransky D (1995) 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nature Medicine 1: 686-92 Meyer S, Hafner C, Guba M, Flegel S, Geissler EK, Becker B, Koehl GE, Orso E, Landthaler M, Vogt T (2005) Ephrin-B2 overexpression enhances integrin-mediated ECM-attachment and migration of B16 melanoma cells. International Journal of Oncology 27: 1197-206 Miao H, Burnett E, Kinch M, Simon E, Wang B (2000) Activation of EphA2 kinase suppresses integrin function and causes focal-adhesion-kinase dephosphorylation. Nature Cell Biology 2: 62-9

References

153

Miao H, Li DQ, Mukherjee A, Guo H, Petty A, Cutter J, Basilion JP, Sedor J, Wu J, Danielpour D, Sloan AE, Cohen ML, Wang B (2009) EphA2 mediates ligand-dependent inhibition and ligand-independent promotion of cell migration and invasion via a reciprocal regulatory loop with Akt. Cancer Cell 16: 9-20 Miao H, Strebhardt K, Pasquale EB, Shen TL, Guan JL, Wang B (2005) Inhibition of integrin-mediated cell adhesion but not directional cell migration requires catalytic activity of EphB3 receptor tyrosine kinase. Role of Rho family small GTPases. The Journal of Biological Chemistry 280: 923-32 Miao H, Wei BR, Peehl DM, Li Q, Alexandrou T, Schelling JR, Rhim JS, Sedor JR, Burnett E, Wang B (2001) Activation of EphA receptor tyrosine kinase inhibits the Ras/MAPK pathway. Nature Cell Biology 3: 527-30 Miller GJ, Torkko KC (2001) Natural history of prostate cancer--epidemiologic considerations. Epidemiologic Reviews 23: 14-8 Millichip MI, Dallas DJ, Wu E, Dale S, McKie N (1998) The metallo-disintegrin ADAM10 (MADM) from bovine kidney has type IV collagenase activity in vitro. Biochemical and Biophysical Research Communications 245: 594-8 Miranda JD, White LA, Marcillo AE, Willson CA, Jagid J, Whittemore SR (1999) Induction of Eph B3 after spinal cord injury. Experimental Neurology 156: 218-22 Morita N, Uemura H, Tsumatani K, Cho M, Hirao Y, Okajima E, Konishi N, Hiasa Y (1999) E-cadherin and alpha-, beta- and gamma-catenin expression in prostate cancers: correlation with tumour invasion. British Journal of Cancer 79: 1879-83 Morton RA, Jr., Ewing CM, Watkins JJ, Isaacs WB (1995) The E-cadherin cell-cell adhesion pathway in urologic malignancies. World Journal Urology 13: 364-8 Murant SJ, Handley J, Stower M, Reid N, Cussenot O, Maitland NJ (1997) Co-ordinated changes in expression of cell adhesion molecules in prostate cancer. European Journal of Cancer 33: 263-71 Musial J, Sporny S, Nowicki A (2007) Prognostic significance of E-cadherin and ezrin immunohistochemical expression in prostate cancer. Polish Journal of Pathology 58: 235-43 Nakada M, Niska JA, Miyamori H, McDonough WS, Wu J, Sato H, Berens ME (2004) The phosphorylation of EphB2 receptor regulates migration and invasion of human glioma cells. Cancer Research 64: 3179-85 Nakada M, Niska JA, Tran NL, McDonough WS, Berens ME (2005) EphB2/R-Ras signaling regulates glioma cell adhesion, growth, and invasion. American Journal of Pathology 167: 565-76

References

154

Nantermet PV, Xu J, Yu Y, Hodor P, Holder D, Adamski S, Gentile MA, Kimmel DB, Harada S, Gerhold D, Freedman LP, Ray WJ (2004) Identification of genetic pathways activated by the androgen receptor during the induction of proliferation in the ventral prostate gland. The Journal of Biological Chemistry 279: 1310-22 Nobes CD, Hall A (1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81: 53-62 Nobes CD, Hawkins P, Stephens L, Hall A (1995) Activation of the small GTP-binding proteins rho and rac by growth factor receptors. Journal of Cell Science 108 ( Pt 1): 225-33 Nogueira L, Corradi R, Eastham JA (2009) Prostatic specific antigen for prostate cancer detection. International Brazilian Journal of Urology 35: 521-9; discussion 530-2 Noren NK, Foos G, Hauser CA, Pasquale EB (2006) The EphB4 receptor suppresses breast cancer cell tumorigenicity through an Abl-Crk pathway. Nature Cell Biology 8: 815-25 Noren NK, Pasquale EB (2004) Eph receptor-ephrin bidirectional signals that target Ras and Rho proteins. Cellular Signalling 16: 655-66 Ogawa K, Wada H, Okada N, Harada I, Nakajima T, Pasquale EB, Tsuyama S (2006) EphB2 and ephrin-B1 expressed in the adult kidney regulate the cytoarchitecture of medullary tubule cells through Rho family GTPases. Journal of Cell Science 119: 559-70 Palmer A, Zimmer M, Erdmann KS, Eulenburg V, Porthin A, Heumann R, Deutsch U, Klein R (2002) EphrinB phosphorylation and reverse signaling: regulation by Src kinases and PTP-BL phosphatase. Molecular Cell 9: 725-37 Parri M, Buricchi F, Giannoni E, Grimaldi G, Mello T, Raugei G, Ramponi G, Chiarugi P (2007) EphrinA1 activates a Src/focal adhesion kinase-mediated motility response leading to rho-dependent actino/myosin contractility. The Journal of Biological Chemistry 282: 19619-28 Pasquale EB (2004) Eph-ephrin promiscuity is now crystal clear. Nature Neuroscience 7: 417-8 Pasquale EB (2005) Eph receptor signalling casts a wide net on cell behaviour. Nature Reviews Molecular Cell Biology 6: 462-75 Pasquale EB (2008) Eph-ephrin bidirectional signaling in physiology and disease. Cell 133: 38-52

References

155

Poliakov A, Cotrina M, Wilkinson DG (2004) Diverse roles of eph receptors and ephrins in the regulation of cell migration and tissue assembly. Developmental Cell 7: 465-80 Pratt RL, Kinch MS (2003) Ligand binding up-regulates EphA2 messenger RNA through the mitogen-activated protein/extracellular signal-regulated kinase pathway. Molecular Cancer Research 1: 1070-6 Raffo AJ, Perlman H, Chen MW, Day ML, Streitman JS, Buttyan R (1995) Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo. Cancer Research 55: 4438-45 Rameh LE, Cantley LC (1999) The role of phosphoinositide 3-kinase lipid products in cell function. The Journal of Biological Chemistry 274: 8347-50 Robinson DR, Wu YM, Lin SF (2000) The protein tyrosine kinase family of the human genome. Oncogene 19: 5548-57 Robinson EJ, Neal DE, Collins AT (1998) Basal cells are progenitors of luminal cells in primary cultures of differentiating human prostatic epithelium. Prostate 37: 149-60 Roche PJ, Hoare SA, Parker MG (1992) A consensus DNA-binding site for the androgen receptor. Molecular Endocrinology 6: 2229-35 Ross JS, Kaur P, Sheehan CE, Fisher HA, Kaufman RA, Jr., Kallakury BV (2003) Prognostic significance of matrix metalloproteinase 2 and tissue inhibitor of metalloproteinase 2 expression in prostate cancer. Modern Pathology 16: 198-205 Rovin JD, Frierson HF, Jr., Ledinh W, Parsons JT, Adams RB (2002) Expression of focal adhesion kinase in normal and pathologic human prostate tissues. Prostate 53: 124-32 Schaller MD, Borgman CA, Cobb BS, Vines RR, Reynolds AB, Parsons JT (1992) pp125FAK a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proceedings of the National Academy of Sciences of the United States of America 89: 5192-6 Simard J, Dumont M, Soucy P, Labrie F (2002) Perspective: prostate cancer susceptibility genes. Endocrinology 143: 2029-40 Slack-Davis JK, Hershey ED, Theodorescu D, Frierson HF, Parsons JT (2009) Differential requirement for focal adhesion kinase signaling in cancer progression in the transgenic adenocarcinoma of mouse prostate model. Molecular Cancer Therapeutics 8: 2470-7

References

156

Stearns M, Stearns ME (1996) Evidence for increased activated metalloproteinase 2 (MMP-2a) expression associated with human prostate cancer progression. Oncology Research 8: 69-75 Steinberg GD, Carter BS, Beaty TH, Childs B, Walsh PC (1990) Family history and the risk of prostate cancer. Prostate 17: 337-47 Steinle JJ, Meininger CJ, Chowdhury U, Wu G, Granger HJ (2003) Role of ephrin B2 in human retinal endothelial cell proliferation and migration. Cellular Signalling 15: 1011-7 Steinle JJ, Meininger CJ, Forough R, Wu G, Wu MH, Granger HJ (2002) Eph B4 receptor signaling mediates endothelial cell migration and proliferation via the phosphatidylinositol 3-kinase pathway. The Journal of Biological Chemistry 277: 43830-5 Stephen LJ, Fawkes AL, Verhoeve A, Lemke G, Brown A (2007) A critical role for the EphA3 receptor tyrosine kinase in heart development. Developmental Biology 302: 66-79 Straume O, Akslen LA (2002) Importance of vascular phenotype by basic fibroblast growth factor, and influence of the angiogenic factors basic fibroblast growth factor/fibroblast growth factor receptor-1 and ephrin-A1/EphA2 on melanoma progression. American Journal of Pathology 160: 1009-19 Strohmeyer DM, Berger AP, Moore DH, 2nd, Bartsch G, Klocker H, Carroll PR, Loening SA, Jensen RH (2004) Genetic aberrations in prostate carcinoma detected by comparative genomic hybridization and microsatellite analysis: association with progression and angiogenesis. Prostate 59: 43-58 Taddei ML, Parri M, Angelucci A, Onnis B, Bianchini F, Giannoni E, Raugei G, Calorini L, Rucci N, Teti A, Bologna M, Chiarugi P (2009) Kinase-dependent and -independent roles of EphA2 in the regulation of prostate cancer invasion and metastasis. The American Journal of Pathology 174: 1492-503 Talpaz M, Shah NP, Kantarjian H, Donato N, Nicoll J, Paquette R, Cortes J, O'Brien S, Nicaise C, Bleickardt E, Blackwood-Chirchir MA, Iyer V, Chen TT, Huang F, Decillis AP, Sawyers CL (2006) Dasatinib in imatinib-resistant Philadelphia chromosome-positive leukemias. The New England Journal of Medicine 354: 2531-41 Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, Oudard S, Theodore C, James ND, Turesson I, Rosenthal MA, Eisenberger MA (2004) Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England Journal of Medicine 351: 1502-12

References

157

Tatarov O, Mitchell TJ, Seywright M, Leung HY, Brunton VG, Edwards J (2009) SRC family kinase activity is up-regulated in hormone-refractory prostate cancer. Clinical Cancer Research 15: 3540-9 Tremblay L, Hauck W, Aprikian AG, Begin LR, Chapdelaine A, Chevalier S (1996) Focal adhesion kinase (pp125FAK) expression, activation and association with paxillin and p50CSK in human metastatic prostate carcinoma. International Journal of Cancer 68: 164-71 Tsuchiya N, Kondo Y, Takahashi A, Pawar H, Qian J, Sato K, Lieber MM, Jenkins RB (2002) Mapping and gene expression profile of the minimally overrepresented 8q24 region in prostate cancer. The American Journal of Pathology 160: 1799-806 Tuzi NL, Gullick WJ (1994) eph, the largest known family of putative growth factor receptors. British Journal of Cancer 69: 417-21 Umbas R, Schalken JA, Aalders TW, Carter BS, Karthaus HF, Schaafsma HE, Debruyne FM, Isaacs WB (1992) Expression of the cellular adhesion molecule E-cadherin is reduced or absent in high-grade prostate cancer. Cancer Research 52: 5104-9 Unni E, Sun S, Nan B, McPhaul MJ, Cheskis B, Mancini MA, Marcelli M (2004) Changes in androgen receptor nongenotropic signaling correlate with transition of LNCaP cells to androgen independence. Cancer Research 64: 7156-68 van Moorselaar RJ, Voest EE (2002) Angiogenesis in prostate cancer: its role in disease progression and possible therapeutic approaches. Molecular and Cellular Endocrinology 197: 239-50 van Oort IM, Tomita K, van Bokhoven A, Bussemakers MJ, Kiemeney LA, Karthaus HF, Witjes JA, Schalken JA (2007) The prognostic value of E-cadherin and the cadherin-associated molecules alpha-, beta-, gamma-catenin and p120ctn in prostate cancer specific survival: a long-term follow-up study. Prostate 67: 1432-8 Vearing C, Lee FT, Wimmer-Kleikamp S, Spirkoska V, To C, Stylianou C, Spanevello M, Brechbiel M, Boyd AW, Scott AM, Lackmann M (2005) Concurrent binding of anti-EphA3 antibody and ephrin-A5 amplifies EphA3 signaling and downstream responses: potential as EphA3-specific tumor-targeting reagents. Cancer Research 65: 6745-54 Velasco AM, Gillis KA, Li Y, Brown EL, Sadler TM, Achilleos M, Greenberger LM, Frost P, Bai W, Zhang Y (2004) Identification and validation of novel androgen-regulated genes in prostate cancer. Endocrinology 145: 3913-24 Veldscholte J, Voorhorst-Ogink MM, Bolt-de Vries J, van Rooij HC, Trapman J, Mulder E (1990) Unusual specificity of the androgen receptor in the human prostate tumor cell line LNCaP: high affinity for progestagenic and estrogenic steroids. Biochimica et Biophysica Acta 1052: 187-94

References

158

Verhagen AP, Aalders TW, Ramaekers FC, Debruyne FM, Schalken JA (1988) Differential expression of keratins in the basal and luminal compartments of rat prostatic epithelium during degeneration and regeneration. Prostate 13: 25-38 Walker-Daniels J, Coffman K, Azimi M, Rhim JS, Bostwick DG, Snyder P, Kerns BJ, Waters DJ, Kinch MS (1999) Overexpression of the EphA2 tyrosine kinase in prostate cancer. Prostate 41: 275-80 Walker KS, Deak M, Paterson A, Hudson K, Cohen P, Alessi DR (1998) Activation of protein kinase B beta and gamma isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in vitro: comparison with protein kinase B alpha. Biochemical Journal 331 ( Pt 1): 299-308 Walter J, Kern-Veits B, Huf J, Stolze B, Bonhoeffer F (1987) Recognition of position-specific properties of tectal cell membranes by retinal axons in vitro. Development 101: 685-96 Wang HU, Chen ZF, Anderson DJ (1998) Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93: 741-53 Wang J, Dong Y, Wang X, Ma H, Sheng Z, Li G, Lu G, Sugimura H, Zhou X (2010) Expression of EphA1 in gastric carcinomas is associated with metastasis and survival. Oncology Reports 24: 1577-84 Watt KW, Lee PJ, M'Timkulu T, Chan WP, Loor R (1986) Human prostate-specific antigen: structural and functional similarity with serine proteases. Proceedings of the National Academy of Sciences of the United States of America 83: 3166-70 Wells CM, Ahmed T, Masters JR, Jones GE (2005) Rho family GTPases are activated during HGF-stimulated prostate cancer-cell scattering. Cell Motility and the Cytoskeleton 62: 180-94 Wimmer-Kleikamp SH, Janes PW, Squire A, Bastiaens PI, Lackmann M (2004) Recruitment of Eph receptors into signaling clusters does not require ephrin contact. Journal of Cell Biology 164: 661-6 Wu D, Suo Z, Kristensen GB, Li S, Troen G, Holm R, Nesland JM (2004) Prognostic value of EphA2 and EphrinA-1 in squamous cell cervical carcinoma. Gynecologic Oncology 94: 312-9 Wu E, Croucher PI, McKie N (1997) Expression of members of the novel membrane linked metalloproteinase family ADAM in cells derived from a range of haematological malignancies. Biochemical and Biophysical Research Communications 235: 437-42

References

159

Wykosky J, Debinski W (2008) The EphA2 receptor and ephrinA1 ligand in solid tumors: function and therapeutic targeting. Molecular Cancer Research 6: 1795-806 Wykosky J, Gibo DM, Stanton C, Debinski W (2005) EphA2 as a novel molecular marker and target in glioblastoma multiforme. Molecular Cancer Research 3: 541-51 Xia G, Kumar SR, Masood R, Koss M, Templeman C, Quinn D, Zhu S, Reddy R, Krasnoperov V, Gill PS (2005a) Up-regulation of EphB4 in mesothelioma and its biological significance. Clinical Cancer Research 11: 4305-15 Xia G, Kumar SR, Masood R, Zhu S, Reddy R, Krasnoperov V, Quinn DI, Henshall SM, Sutherland RL, Pinski JK, Daneshmand S, Buscarini M, Stein JP, Zhong C, Broek D, Roy-Burman P, Gill PS (2005b) EphB4 expression and biological significance in prostate cancer. Cancer Research 65: 4623-32 Xu F, Zhong W, Li J, Shanshen Z, Cui J, Nesland JM, Suo Z (2005) Predictive value of EphA2 and EphrinA-1 expression in oesophageal squamous cell carcinoma. Anticancer Research 25: 2943-50 Yang NY, Fernandez C, Richter M, Xiao Z, Valencia F, Tice DA, Pasquale EB (2011) Crosstalk of the EphA2 receptor with a serine/threonine phosphatase suppresses the Akt-mTORC1 pathway in cancer cells. Cellular Signalling 23: 201-12 Yang NY, Pasquale EB, Owen LB, Ethell IM (2006) The EphB4 receptor-tyrosine kinase promotes the migration of melanoma cells through Rho-mediated actin cytoskeleton reorganization. The Journal of Biological Chemistry 281: 32574-86 Yeatman TJ (2004) A renaissance for SRC. Nature Reviews Cancer 4: 470-80 Yin Y, Yamashita Y, Noda H, Okafuji T, Go MJ, Tanaka H (2004) EphA receptor tyrosine kinases interact with co-expressed ephrin-A ligands in cis. Neuroscience Research 48: 285-96 Zelinski DP, Zantek ND, Stewart JC, Irizarry AR, Kinch MS (2001) EphA2 overexpression causes tumorigenesis of mammary epithelial cells. Cancer Research 61: 2301-6 Zeng G, Hu Z, Kinch MS, Pan CX, Flockhart DA, Kao C, Gardner TA, Zhang S, Li L, Baldridge LA, Koch MO, Ulbright TM, Eble JN, Cheng L (2003) High-level expression of EphA2 receptor tyrosine kinase in prostatic intraepithelial neoplasia. American Journal of Pathology 163: 2271-6 Zhong M, Boseman ML, Millena AC, Khan SA (2010) Oxytocin induces the migration of prostate cancer cells: involvement of the Gi-coupled signaling pathway. Molecular Cancer Research 8: 1164-72

References

160

Zimmer M, Palmer A, Kohler J, Klein R (2003) EphB-ephrinB bi-directional endocytosis terminates adhesion allowing contact mediated repulsion. Nature Cell Biology 5: 869-78 Zou JX, Wang B, Kalo MS, Zisch AH, Pasquale EB, Ruoslahti E (1999) An Eph receptor regulates integrin activity through R-Ras. Proceedings of the National Academy of Sciences of the United States of America 96: 13813-8

The role of the Eph and ephrin proteins in prostate...

Documents

Transcript of The role of the Eph and ephrin proteins in prostate...