molecular mechanisms of adipogenesis in obesity and the metabolic syndrome
The role of secreted factors in white and brown adipogenesis
Transcript of The role of secreted factors in white and brown adipogenesis
Ulm University Medical Center
Department of Pediatrics and Adolescent Medicine
Director: Prof. Dr. Klaus-Michael Debatin
Experimental Endocrinology and Metabolism Research Head: Prof. Dr. Pamela Fischer-Posovszky
The role of secreted factors in white and brown adipogenesis
Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor rerum naturalium (Dr. rer. nat.) of the International Graduate School in Molecular Medicine Ulm
Daniel Halbgebauer
Waiblingen
2021
ii
Current Dean of the Graduate School: Prof. Dr. Knöll Thesis Advisory Committee First Supervisor: Prof. Dr. Fischer-Posovszky Second Supervisor: Prof. Dr. Jan Tuckermann Third Supervisor: PD Dr. Marcel Scheideler External Reviewer: Prof. Dr. Engeli Day Doctorate Awarded: 17.05.2021
iii
Parts of the results gained in my thesis have previously been published in the following
publication:
Browning capabilities of human primary adipose-derived stromal cells compared to SGBS cells.
Halbgebauer D, Dahlhaus M, Wabitsch M, Fischer-Posovszky P, Tews D.
Sci Rep. 2020;10(1):1-8.
doi:10.1038/s41598-020-64369-7
PMID: 32541826
This publication is an open access article distributed under the terms of the Creative
Commons CC BY license, which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
iv
Contents
1. Introduction ............................................................................................. 1
1.1 Obesity ..................................................................................................... 1
1.2 Adipose tissue .......................................................................................... 1
1.3 Brown adipose tissue thermogenesis ............................................................ 3
1.4 Relevance for brown adipose tissue in humans ......................................... 5
1.5 Browning of the white adipose tissue ........................................................ 6
1.6 Activation of brown adipose tissue and white adipocyte browning as a new
therapeutic approach for obesity .............................................................. 8
1.7 Transforming growth factor beta ............................................................ 10
1.8 Latent transforming growth factor beta binding proteins ......................... 13
1.9 Aim of the study ..................................................................................... 16
2. Material and Methods ........................................................................... 19
2.1 Materials ................................................................................................ 19
2.2 Methods................................................................................................. 37
3. Results ................................................................................................... 52
3.1 The role of LTBPs in adipogenesis and their impact on UCP1 expression in
vitro ....................................................................................................... 52
3.2 The role of TGFβ in SGBS adipogenesis .................................................... 65
3.3 TGFβ2 is reduced in LTBP2- and LTBP3-deficient cells .............................. 73
3.4 TGFβ2 deficiency leads to alterations in UCP1 and metabolic function ..... 73
3.5 TGFβ2 correlates significantly with LTBP3 and UCP1 expression in human
subcutaneous adipose tissue .................................................................. 76
4. Discussion .............................................................................................. 77
4.1 LTBP3 deficiency leads to a decrease of UCP1 expression in SGBS cells .... 77
v
4.2 Inhibition of the TGFβ pathway leads to a decrease of UCP1 in SGBS
adipocytes .............................................................................................. 81
4.3 Repression of brown marker gene UCP1 by LTBP3-deficiency could be
mediated by alterations in TGFβ2 bioavailability ........................................ 85
4.4 Indications for LTBP3-TGFβ2 mediated browning in human WAT ............. 86
4.5 Conclusion, limitations and outlook ........................................................ 88
5. Summary ............................................................................................... 90
6. References ............................................................................................. 92
7. Register of illustrations and figure permissions .................................... 115
Appendix I .......................................................................................................... 118
Appendix II ......................................................................................................... 123
Acknowledgements ............................................................................................ 126
Statutory declaration .......................................................................................... 126
Curriculum vitae ................................................................................................. 128
vi
List of Abbreviations
AC adenylyl cyclase
adip. adipocytes
ADIPOQ Adiponectin
Ant/Rot Antimycin A/Rotenone
ATP adenosine-triphosphate
BAT brown adipose tissue
Batokine brown adipose tissue adipokine
BMI Body mass index
BMP bone morphogenic protein
BSA bovine serum albumin
cAMP cyclic adenosine-monophosphate
Cas9 CRSIPR associated protein 9
CRISPR clustered regularly interspaced short palindromic repeats
CS citrate synthase
DMSO dimethyl sulfoxide
dn deep neck
DNA deoxyribonucleic acid
dNTP deoxyribonucleotide triphosphate
DPBS Dulbecco’s phosphate buffered saline
DTT dithiothreitol
ECL enhanced chemiluminescence
ECM extracellular matrix
EDTA ethylenediaminetetraacetic acid
ELISA enzyme-linked immunosorbent assay
EV empty vector
eWAT epididymal white adipose tissue
FCCP carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone
FCS fetal calf serum
FDA federal drug enforcement
vii
FGF21 fibroblast growth factor 21
GAPDH glycerinaldehyd-3-phosphat-dehydrogenase
GLUT4 glucose transporter type 4
hASC human adipose stromal cell
HCL hydrochloric acid
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HPRT hypoxanthine-guanine phosphoribosyltransferase
HRP horse radish peroxidase
HSL hormone sensitive lipase
iBAT interscapular brown adipose tissue
IBMX 3-isobutyl-1-methylxanthine
ingWAT inguinal white adipose tissue
ITR inverted repeat
kb kilo base pair
KD knockdown
kDa kilo Dalton
KO knockout
LAP latency associated protein
LLC large latent complex
LTBP latent transforming growth factor beta binding protein
mRNA messenger ribonucleic acid
MuLE Multiple lentiviral expression system
MuSE Multiple sleeping beauty expression system
Myf5 myogenic factor 5
NTC non-targeting control
Oligo Oligomycin
PCR polymerase chain reaction
PGC1α PPARγ coactivator 1-alpha
pgWAT perigonadal white adipose tissue
PKA protein kinase A
viii
PPARγ peroxisome proliferator-activated receptor gamma
pre. preadipocytes
Puro Puromycin
qPCR quantitative polymerase chain reaction
rpm revolutions per minute
RT-PCR reverse-transcription polymerase chain reaction
SB sleeping beauty
sc subcutaneous
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
SGBS Simpson-Golabi-Behmel syndrome
sgRNA single guide RNA
siRNA small interfering ribonucleic acid
SLC small latent complex
SMAD “small” mothers against decapentaplegic (Drosophila)
TBS tris buffered saline
TGFβ transforming growth factor beta
TGFβR transforming growth factor beta receptor
TZD thiazolidinediones
UCP1 uncoupling protein 1
vs versus
WAT white adipose tissue
WHO world health organization
WT wild type
1
1. Introduction
1.1 Obesity
Obesity is defined by the world health organization (WHO) as a disease with “abnormal or
excessive fat accumulation that may impair health” [1]. Overweight or obesity can be
measured with the body mass index (BMI), which is calculated by the weight for height in
kg/m². Obese people have a BMI greater or equal 30 kg/m2, whereas overweight people
have a BMI equal or above 25 kg/m2 [1].
Obesity and its associated metabolic disorders are rapidly increasing worldwide [1]. In the
last 40 years the prevalence for obesity has nearly been tripled. In 2016, 650 million adult
people were obese and an additional 1.25 billion people were overweight. Obesity brings
along metabolic disorders like type 2 diabetes mellitus or cardiovascular diseases, which
are the number one cause for death worldwide [2]. Furthermore, childhood obesity is
associated with a higher chance of premature death, obesity and disability in adulthood. In
2018, 40 million of children under the age of 5 years were already overweight or obese [1].
From a physical perspective, obesity is based on an imbalance of energy intake and
expenditure, whereby high amounts of visceral adipose tissue are associated with
metabolic disorders such as cardiovascular diseases and diabetes type 2 [3,4]. The current
methods for the prevention of obesity and its treatment fails in the long term [3].
Approaches aiming at reducing energy intake or increasing energy expenditure through
exercise often fail due to low discipline and methods like bariatric surgery are not available
for the majority of people due to insufficient healthcare or are just not affordable [3]. All
these facts reveal obesity as a challenging pandemic disease which takes great influence
on our society and healthcare system.
1.2 Adipose tissue
The adipose tissue is a connective tissue which inter alia consists of pre- and adipocytes,
although macrophages, endothelial cells, fibroblasts and leukocytes can also be found [5].
There are two distinct types of adipose tissues in mammals [5]. The white adipose tissue
(WAT) and the brown adipose tissue (BAT). White adipocytes are mainly distributed in the
2
subcutaneous (sc) and visceral adipose tissue and can be recognized by an unilocular lipid
droplet (Figure 1) [5]. Brown adipocytes are histologically distinguishable from white
adipocytes by their large number of lipid vacuoles and a high density of mitochondria.
Furthermore, brown adipocytes express the specific BAT marker uncoupling protein 1
(UCP1) [5].
BAT can be found in the deep neck, supraclavicular, axillary, suprarenal, paravertebral, and
peri-aortic region of humans [6–9]. Of note, there is a third type of adipose tissue, the beige
adipose tissue which arises from WAT browning through cold exposure or β3 adrenergic
stimulation [10,11]. However, without these stimuli, browning is also reversable, which is
often referred as whitening [10]. Comparable to classical brown fat cells, beige adipocytes
are also rich in mitochondria and express UCP1, but they have a distinct gene expression
profile [10].
Figure 1: Morphology of different types of adipocytes. Left: White adipocyte with a unilocular lipid droplet. Due to certain stimuli like cold exposure or β3 adrenergic stimulation white adipocytes can undergo browning into beige adipocytes (middle), which have higher amounts of mitochondria and multilocular lipid droplets. However, browning is also reversable and often referred as whitening. Right: The morphology of brown adipocytes is characterized by small multilocular lipid droplets and high amounts of mitochondria.
One important role of the WAT is the energy storage and supply of the body with free fatty
acids and glycerol in case of need [12]. White adipocytes store surplus energy of the body
in form of triglycerides and play therefore a crucial role in energy homeostasis and energy
storage [4]. Of note, WAT is also an important endocrine organ which secretes adipokines
acting on other organs like liver and muscle [4,5]. Adiponectin and leptin are just two
important adipokines to mention [5]. Both are known to modulate metabolic pathways in
peripheral tissues. BAT accounts only for about 4% of the total body fat mass in adults,
whereby WAT is making up the other 96% [4]. In contrast to WAT, the primary function of
BAT is not to store energy in form of triglycerides, but to produce heat by oxidizing fatty
3
acids and glucose from intracellular energy storages and the circulation [12,13]. This
enables survival during nightly cold periods in winter as well as during cold stress after
childbirth and possibly offers advantages with a reduced supply of macronutrients [13].
Furthermore, BAT plays an important role in thermoregulation of human newborns [14].
In mice, BAT is the key organ regulating body temperature and energy homeostasis [13].
These properties are attributed to the expression and activation of UCP1, the key factor of
thermogenic capacity [13,15]. Importantly, recent findings suggest that BAT is relevant for
adult humans as well [8]. For a long time, BAT was thought to be only present in small
mammals and human infants, until 2007, when four independent studies revealed
evidence for BAT in human adults [6–9]. Compared to WAT there is just a small amount of
BAT in humans, but it has the potential to have a high impact on thermoregulation and
increasing energy expenditure [16–18].
1.3 Brown adipose tissue thermogenesis
Non-shivering thermogenesis occurs in BAT depots and strongly depends on the activation
of BAT [13,19]. It has been shown that non-shivering thermogenesis is dependent on UCP1,
which is an intermembrane protein residing in the inner mitochondrial membrane of brown
and beige adipocytes [13,20]. UCP1-deficient mice are not able to keep up their body
temperature during cold exposure, revealing the high impact of UCP1 on thermoregulation
[21]. A cold environment stimulates the activation of thermoreceptors on human skin,
which send afferent signals to the hypothalamus which leads to a release of norepinephrine
in sympathetic nerve fibers within the BAT [20,22]. Subsequently, norepinephrine binds to
β3-adrenoreceptors on the adipocytes surface (Figure 2), activating adenylyl cyclase (AC).
This activation triggers the production of cyclic adenosine monophosphate (cAMP), leading
to the activation of protein kinase A (PKA) which further phosphorylates the hormone
sensitive lipase (HSL) and perilipin A, followed by the hydrolysis of triglycerides into glycerol
and free fatty acids which are transported into mitochondria. These free fatty acids change
the conformation of UCP1, leading to its activation. UCP1 then uncouples the proton
motive force by transporting protons through the inner mitochondrial membrane into the
mitochondrial matrix. The energy of the cellular oxidation is then released as heat. The
activity of UCP1 is generally inhibited by purine nucleotides [22].
4
Under UCP1-inactivated conditions, the respiratory chain in the mitochondrial membrane
generates a proton gradient to produce adenosine-triphosphate (ATP). The ATP synthase
uses this proton motive force to recycle adenosine diphosphate (ADP) to ATP. If UCP1 is
activated by free fatty acids, the proton motive force is uncoupled from ATP generation. In
consequence, the cell compensates for the energy loss by increasing its respiratory chain
activity. As a result, the oxygen consumption is increased and more energy supply from the
citric acid cycle and β-oxidation is needed. Upon chronic activation, PKA leads to induction
and stabilization of UCP1 mRNA expression in brown and beige adipose tissue via
phosphorylation of cAMP-response-element-binding-protein (CREB) and p38 [23,24].
Figure 2: Molecular mechanism of BAT activation: Norepinephrine (NE) or other β3-agonists bind to the β3 adrenoreceptor on the adipocytes surface [22]. This activates the Gsα subunit of the G-protein Gs (Gs) which leads to cAMP synthesis by the adenylate cyclase (AC). Subsequent the protein kinase A (PKA) is activated, accompanied by the phosphorylation of hormone sensitive lipase (HSL), followed by the cleavage of triglycerides into free fatty acids and glycerin. These free fatty acids are transported into the mitochondria and activate the uncoupling protein 1 (UCP1). UCP1 sits in the inner mitochondrial membrane uncoupling the proton motive force by transporting protons through the membrane. The energy of the cellular oxidation is then released as heat. At the same time the cell tries to maintain adenosine triphosphate (ATP) production, thereby increasing oxygen consumption and demanding more energy from the citric acid cycle and β-oxidation. Figure 2 is taken from P.G. Crichton, Y. Lee, E.R.S. Kunji, The molecular features of uncoupling protein 1 support a conventional mitochondrial carrier-like mechanism, Biochimie. 134 (2017) 35–50. https://doi.org/10.1016/j.biochi.2016.12.016 with permission of Elsevier.
5
1.4 Relevance for brown adipose tissue in humans
It has been shown in several rodent studies that activation of BAT has significant positive
effects on metabolic health [10,25,26]. Rodents with chronically activated BAT were
resistant to high fat diet, had lower blood glucose levels and higher insulin sensitivity
[10,27]. Activation of BAT in rodents was achieved by exposing the animals either to chronic
cold or treatment with β3 adrenoreceptor agonists.
In humans, BAT was first described in the interscapular region of fetuses and newborns
[27,28]. Until recently, it had been assumed that human adults are mostly devoid of
functional BAT. However, the functionality was firstly described between 2007-2009 in four
independent studies, where it was shown that biopsies taken from the deep neck and
supraclavicular adipose tissue of human subjects are UCP1-positive [6–9]. Interestingly, the
BAT mass correlated negatively with the BMI as well as percent-body fat mass in humans,
suggesting that BAT is a regulator of body weight [6]. Further studies revealed that these
BAT depots could be activated by cold as it was shown before in rodents [8,9,29]. Subjects
exposed to acute cold showed a higher body temperature in the supraclavicular region and
increased glucose and fatty acid uptake [6,9,30,31]. In addition, subjects with higher BAT
mass had a significant overall higher glucose uptake rate, higher insulin sensitivity, and
higher basal metabolic rate [17,29,32]. Active BAT is associated with a higher overall energy
expenditure in humans and can therefore influence the energy homeostasis [8,9].
Interestingly, cold or β3-adrenergic stimulation led also to a significant increase in BAT mass
and UCP1 expression in humans and rodents [10,26].
However, it has also been shown that people lose BAT mass during ageing and that obese
people have little to no BAT [30,31,33,34]. On the other hand, obese people without active
BAT could restore its activity after weight loss due to bariatric surgery [33]. Moreover, cold
acclimation in obese subjects led to an reappearance of BAT [35]. This indicates that BAT
can still be recruited in adults, suggesting a relevant function.
6
1.5 Browning of the white adipose tissue
Browning is defined by a significant increase in UCP1 expression in adipocytes within the
WAT depots and was first described in 1984 in rodents [11,26]. Through chronic cold
exposure or β-adrenergic stimulation, adipocytes within the WAT of rodents phenocopy
brown adipocytes and are therefore referred to as beige adipocytes [12,13,26]. Many
factors have been discovered so far, known to stimulate white adipocyte browning in
rodents or in vitro. Activation of transcription factors like peroxisome proliferator activator
gamma coactivator 1 alpha (PGC1α) and PR domain containing protein 16 (PRDM16) are
known to trigger browning in white adipocytes. Furthermore, stimulation with extracellular
factors like bone morphogenic proteins (BMP), thyroid hormones, transforming growth
factor beta (TGFβ), and fibroblast growth factor 21 (FGF21) as well as natriuretic peptides
have been shown amongst others to regulate browning [36–41].
It is still controversially discussed if beige adipocytes occur in WAT due to
transdifferentiation of white adipocytes or de novo differentiation [42–44]. Currently there
are two different models discussed which are based on Cre-labeling studies in mice [42].
Myogenic factor 5 (Myf5) positive cells are known to be the precursor cells of the myogenic
lineages. In the transdifferentiation model, myocytes, brown adipocytes and white
adipocytes share the same origin, a multipotent Myf5 and Pax3-positive precursor cell,
whereas PRDM16 controls the switch from myogenic to adipogenic differentiation [42,45].
Browning occurs then through transdifferentiation of mature white adipocytes. But it is still
assumable that different lineages express Myf5 and Pax3 independently of each other [42].
The other model suggests that white and beige adipocytes have a common origin. Cells
labeled for Prx1, a transcription factor selective for precursor cells of the scWAT and not
for BAT or visceral WAT, revealed that beige adipocytes could emerge from the same
precursors of sc WAT by de novo differentiation [42]. In rodents one can distinguish
between the classical WAT, BAT, and beige adipose tissue [42]. Several marker genes have
been identified, which were differently expressed between these types of adipose tissue
[42]. In addition, the interscapular brown (iBAT) and the inguinal WAT (iWAT) are highly
temperature sensitive and under housing and cold conditions one will observe white
adipocyte browning in iWAT and distinct differences in morphology between the iBAT,
iWAT, and perigonadal WAT (pgWAT) (Figure 3). In humans, the composition of adipose
tissue found in the neck shows high inter-individual heterogeneity, which makes it much
7
more complicated to distinguish between the adipose tissue types [46,47]. UCP1-positive
cells referred as brown adipocytes can be found most likely in the deep neck and
supraclavicular region, but one will also find UCP1-negative cells within this tissue area. The
deeper the adipose tissue region in the neck of humans, the more classical BAT was found
[48]. In some studies, human brown adipocytes expressed markers, which fit to beige
markers of rodents [49–51]. On contrary to that, other studies found similar expression
patterns of human BAT to classical BAT of rodents [47,52,53].
These controversial results often lead to misunderstanding in the nomenclature in the
context of browning, beige adipose tissue, BAT, and WAT [54]. As previously mentioned,
browning is originally defined by an increase of UCP1 expression in the adipose tissue
depots [26]. Therefore, the term browning includes both, the de novo differentiation and
the transdifferentiation model. In the following, the term browning is used, when speaking
of a shift from a white towards a beige or brown phenotype within the murine or human
WAT. In this thesis, only the de novo differentiation model was considered for the in vitro
experiments. As mentioned above, it is still not clear whether UCP1-expressing adipocytes
from human WAT are beige or brown cells. Since this thesis focused on human adipose
stromal cells (hASCs) from the sc WAT, terms such as “an adipogenesis towards a brown
adipocyte phenotype” are used when a significant alteration in UCP1 expression was
observed in these cells.
Even if one cannot clearly distinguish between a beige and white adipose tissue depot in
humans as it is seen in rodents under cold conditions, there is evidence for browning of
white adipocytes in human sc adipose tissue [49,55,56]. The treatment with thyroid
hormones in a subject suffering from papillary thyroid carcinoma led to the appearance of
BAT marker genes in the sc tissue [57]. Furthermore, in patients suffering from
pheochromocytoma, UCP1-positive cells were found in the omental adipose tissue [44]. It
is assumed that high catecholamine levels secreted by the tumors induce browning in the
WAT [44]. This was also seen in patients with severe adrenergic stress [58]. Increased
mitochondrial density and the expression of UCP1 was observed in the sc WAT of patients
suffering from burn injuries [58]. In another study sc adipose tissue biopsies of individual
subjects were taken during summer and winter [55]. Interestingly, lean subjects had a
significantly higher UCP1 expression during winter compared to summer, which suggests a
potential for the induction of browning in human WAT [55].
8
Figure 3: Distribution of adipose tissue and its temperature sensitivity in mice. Under standard housing condition one can clearly distinguish between the different adipose tissue types in mice, shown by hematoxylin and eosin staining. It becomes even clearer after cold acclimation at 6°C. Multilocular lipid droplets are observed in the interscapular brown adipose tissue (iBAT), some in the inguinal white adipose tissue (ingWAT) and none in the perigonadal WAT (pgWAT). Figure 3 is taken from J. Sanchez-Gurmaches, C.M. Hung, D.A. Guertin, Emerging Complexities in Adipocyte Origins and Identity, Trends Cell Biol. 26 (2016) 313–326. https://doi.org/10.1016/j.tcb.2016.01.004 in agreement with Elsevier.
1.6 Activation of brown adipose tissue and white adipocyte browning as a new
therapeutic approach for obesity
As current obesity treatment methods often fail in the long term, new approaches for
weight loss should be found [59]. Since BAT activation in humans and browning of WAT in
rodents showed positive effects on metabolic health and body weight, the topic came into
focus as a new treatment approach for obesity [16,25,60,61]. Increasing the amount of
energy expenditure in obese patients by activating BAT or browning would thus lead to a
negative energy balance, weight loss, and improvements of obesity-related metabolic
disorders like diabetes or arteriosclerosis.
Several studies investigated the impact of BAT on overall metabolic health in humans over
time [18,55,62–65]. Human subjects were either exposed to chronic mild cold or
investigated during summers and winters. Cold exposition did not only lead to a higher BAT
activation but also to an increase in total BAT mass, a higher loss of fat mass, and a higher
glucose uptake rate compared to control groups [18,62–64]. However, a major problem is
9
that obese patients have almost none to no brown adipose tissue. It was shown that the
positive effects of BAT activation on the metabolism by cold stimulation were blunted in
obese individuals [30]. Several pharmacological, physiological, and nutritional compounds
can activate BAT or induce browning in rodents or UCP1 in vitro in cultured human
adipocytes but they were not tested or failed to activate BAT in humans so far
[26,27,61,66]. Different β3 agonists failed because of their cardiovascular side effects by
binding also to β1 and β2 receptors in humans [39,67–70]. Moreover, ephedrine failed to
activate BAT in another study with human subjects [39]. Nevertheless, it was shown
recently that human BAT activation can be induced by a selective β3 receptor stimulation
with the FDA-approved drug Mirabegron [71–73]. Subjects which were treated with
200 mg Mirabegron showed a significant increase in BAT activity and an increase of
200 Kcal of resting energy expenditure per day [71]. Furthermore, chronical Mirabegron
treatment increased human BAT as well as insulin sensitivity, and led to an increase of
brown marker genes in the sc adipose tissue of individuals [72,73]. However, besides these
positive effects, subjects had also a higher blood pressure and a higher heart rate.
Pharmacological induction of browning in human WAT in order to increase energy
expenditure represents another approach to target obesity.
One approach is the treatment with thyroid hormones since they have already been shown
to induce browning in a human patient [57]. Furthermore, triiodothyronine induced UCP1
expression in the ingWAT of rodents and activation of the thyroid receptor led to browning
and increased energy expenditure in mice [74,75]. However, thyroid hormones have similar
side effects as β3-receptor agonists, namely a higher risk for heart failure and hyperthermia
[76]. Another group of pharmacological compounds with high browning capacity are the
thiazolidinediones (TZD), which are strong peroxisome proliferator activator gamma
(PPARγ) agonists. PPARγ is the key regulator of adipogenesis [77]. Stimulation with TZDs
induced UCP1 in vitro and in vivo [78,79]. Approved TZDs have been already used for
treatment of type 2 diabetes but some of them have been banned by the FDA due to severe
side effects like heart failure, weight gain and bone loss [80,81]. A promising browning
therapeutic is FGF21. Mice treated with FGF21 showed a significant increase in UCP1
expression in the ingWAT [82]. Moreover, FGF21 null mice showed a significant lower
thermoregulation and an impaired response to cold. FGF21 is currently under investigation
in clinical trials and FGF21 analogs (LY2405319 and PF-05231023) have already been shown
10
to decrease body weight and improve lipid profile in human obese subjects or subjects with
type 2 diabetes after 25-28 days of treatment [83,84]. However, there are no studies on
long term treatment in humans yet. Furthermore, mice treated with FGF21 or
overexpressed FGF21 showed severe bone loss [82]. A significant reduction in markers for
bone formation was also obtained in humans treated with PF-05231023, which doubts
FGF21 as a suitable drug for overweight or its related metabolic disorders [84].
To date, no pharmaceuticals have been described in clinical studies that specifically induce
browning in human WAT without severe side effects. New factors should be found for
future pharmacological targeting to trigger WAT browning or an increase of BAT mass in
obese humans and humans with related metabolic disorders.
New approaches try to target the origins of the white or brown/beige adipocytes. Among
other theories it is assumed that white and beige and even brown adipocytes have the
same precursors, as all these cell types have a mesenchymal stem cell background and
different factors can control the direction of differentiation [42]. Therefore, several groups
isolated stromal cells from the deep neck adipose tissue and/or sc adipose tissue of humans
and differentiated these cells in vitro [47,48,52,85,86]. Interestingly, differentiated cells
derived from the deep neck (dn) or supraclavicular region showed a beige or brown
phenotype, whereas cells from the sc tissue a white phenotype. Furthermore, to find
potential targets, the expression patterns of the isolated hASCs were analyzed and
compared [47,85,86]. This new approach revealed several targets which may be involved
or important for the stimulation of an adipogenesis towards a brown adipocyte phenotype.
Especially adipokines are of interest since it was already shown that secreted factors
expressed in ASCs and adipocytes of the BAT (“batokines”) stimulate the thermogenic
activity in an autocrine or paracrine manner [87]. For example, the TGFβ isoforms are
secreted factors and have already been shown to either stimulate or inhibit UCP1
expression in vivo and in vitro [36,88].
1.7 Transforming growth factor beta
All TGFβ isoforms, i.e. TGFβ1, 2 and 3 are expressed in mammals and can be found in all
tissues and cell types [89,90]. The active isoforms are homodimeric peptides activating the
SMAD2/3 pathway [91]. The active TGFβ1 and TGFβ3 dimer bind to phosphorylated TGFβ
11
receptor2 (TGFβR2) on the cell surface, which then leads to recruitment and
transphosphorylation of the TGFβR1 (Figure 4) [91]. The activated TGFβR1 subsequently
phosphorylates SMAD2/3 intracellularly. This leads to binding of the Co-SMAD (SMAD4) to
phosphorylated SMAD2/SMAD3 which localize as a complex into the nucleus, regulating
gene expression. However, the TGFβ2 isoform has low affinity for TGFβR2, therefore using
a coreceptor for SMAD activation [91]. The peptide binds at first to the TGFβR3, which then
activates TGFβR2 and subsequently TGFβR1, which leads as well to SMAD2/3 pathway
activation.
Figure 4: TGFβ-SMAD signaling pathway The dimeric transforming growth factor β (TGFβ) peptide binds to the autophosphorylated TGFβ receptor2 (TGFβRII). This leads to the recruitment of TGFβ receptor 1 (TβRI), forming a heterodimeric complex. TβRI is then transphosphorylated by TβRII, activating it. Thereupon, the TβRI kinase phosphorylates SMAD2 and SMAD3 which activates intracellular signaling. Phosphorylated SMAD2/3 binds then to SMAD4, enabling the internalization into the nucleus, where they interact with other transcription factors, repressing or activating certain gene expression. Figure 4 is taken from E.H. Budi, D. Duan, R. Derynck, Transforming Growth Factor-β Receptors and Smads: Regulatory Complexity and Functional Versatility, Trends Cell Biol. 27 (2017) 658–672. https://doi.org/10.1016/j.tcb.2017.04.005 in agreement with AAA
The TGFβ isoforms control several vital processes, such as embryonic development,
immune regulation, and inflammation [89]. Furthermore, these cytokines exert their
regulatory role in a bifunctional manner, either inhibiting or stimulating cell proliferation
and differentiation, dependent on the cell type [89]. Knockout mouse models revealed vital
functions of all three isoforms in vivo. TGFβ1-deficient mice died within 3 weeks after birth
due to severe inflammation [92,93]. On the other hand, TGFβ2 null mice had
underdeveloped organs and died perinatally [94]. Moreover, TGFβ3-deficient mice died
directly after birth due to lung dysfunction [95]. These results indicate a crucial role for
TGFβ2 and TGFβ3 in early development and an important role for TGFβ1 in early immune
response.
12
1.7.1 Transforming growth factor beta in the context of adipose tissue
High circulating TGFβ levels are associated with obesity in mice and humans [96,97]. In
human, there is a positive correlation between TGFβ1 and BMI [97]. In addition, overweight
and obese individuals had significantly higher TGFβ1 plasma levels compared to lean [97].
In leptin deficient ob/ob mice, TGFβ is expressed 2.3 fold higher in the epididymal WAT
(eWAT) compared to WT mice [98]. Furthermore, the levels of phosphorylated SMAD3
(pSMAD3) was even 8-fold higher in ob/ob eWAT compared to WT [98].
Early on it was described that TGFβ1 plays a role in proliferation and subsequent adipogenic
differentiation. It inhibits differentiation in murine 3T3-L1 cells, murine brown
preadipocytes and in hASCs [36,96,98,99]. Of note, several studies suggested different
mechanisms of the TGFβ/SMAD pathway influencing the adipogenesis. In NIH3T3
adipocytes activated SMAD3 was bound to CCAAT/enhancer-binding protein beta (C/EBPβ)
and C/EBPδ, thereby inhibiting their activity as a transcription factor for PPARγ expression
and adipogenesis [100]. A study by Yadav et al. revealed new insights on the mechanism of
TGFβ in adipogenesis [97]. They showed that phosphorylated SMAD3 binds to the PGC1α
promoter in the nucleus, inhibiting its expression [97]. This suggests also a role for TGFβ in
browning since PGC1α is known to be a regulator of PPARγ and an inducer of brown marker
genes including UCP1 [101]. Indeed, browning and an increased mitochondrial biogenesis
was obtained in the WAT of SMAD3-deficient mice and in mice treated with an anti TGFβ
1,2,3 antibody [97,98]. Moreover, heterozygous TGFβR1-deficient mice had significant
browning of the eWAT compared to WT mice [102]. Interestingly, SMAD3 null mice also
had improved insulin sensitivity on high fat diet (HFD) and smaller adipocyte size compared
to WT. In addition, mice lacking SMAD3 were protected from insulin resistance and obesity
on HFD [103]. These mice had improved glucose tolerance and insulin sensitivity. The
blockage of the TGFβ pathway with a TGFβ 1,2,3 antibody in ob/ob and diet-induced
obesity mice (DIO) resulted in the protection from obesity and type 2 diabetes [97].
A special property in connection with adipose tissue was shown for TGFβ2 [88]. Mice
infused with recombinant TGFβ2 by an osmotic pump were resistant to high fat diet and
showed a higher glucose tolerance and insulin sensitivity [88]. Furthermore, TGFβ2
increased the UCP1 expression in murine brown adipose tissue and in in vitro differentiated
human brown adipocytes [88]. This was not true for TGFβ1 and TGFβ3. A specific pathway
for TGFβ2 on adipocytes was not discussed and is still unknown.
13
TGFβ bioavailability and signaling has an impact on adipogenic differentiation and
browning of WAT. However, the bioavailability is strongly dependent on the presence of
the latent TGFβ binding protein (LTBP) [104]. TGFβ1-3 are expressed as inactive pro-
peptides, which are secreted in a complex with LTBP, which is known as the large latent
complex (LLC). The importance of LTBP for TGFβ bioavailability was shown in a study with
mice, where a cysteine of the TGFβ1 propeptide, which is crucial for LTBP binding, was
substituted by a serine [105]. These mice showed comparable phenotypes to TGFβ1
knockout mice, inter alia a shorter lifespan. The strong dependency of TGFβ activity on
LTBP suggests that LTBPs have an impact on the generation of a white or brown adipocyte
phenotype.
1.8 Latent transforming growth factor beta binding proteins
LTBPs are crucial for TGFβ bioavailability and play an important role in extracellular matrix
(ECM) modulation and stabilization [104,106,107]. In humans and rodents there are four
members of the LTBP family: LTBP1, LTBP2, LTBP3, and LTBP4. All of them are known to
interact with fibrillin in microfibrils [104]. LTBPs are expressed in a variety of cell types but
mostly in cells with a mesenchymal origin, like the adipogenic, osteogenic, or myogenic
lineages [108]. Structurally, all LTBPs contain calcium binding epidermal growth factor
domains and 8-Cys type domains, some of which are TGFβ-binding domains [104,106]. It
was demonstrated that LTBPs can bind intracellularly to TGFβ, by forming disulfide bridges
with the inactive propeptide of TGFβ, also called latency-associated peptide (LAP) (Figure 5)
[107,109]. When bound to LTBP, the mature TGFβ is cleaved off from its pro-form by furin
in the Golgi vesicle, but still bound by disulfide bridges to it (small latent complex, SLC). The
LTBP-SLC complex, called LLC is then secreted into the ECM where it incorporates by
binding to fibrillin and/or fibronectin [104]. LTBP keeps the mature TGFβ in a latent state
until proteases, integrins, or pH change leads to a release of the mature active TGFβ from
the LLC. Although structurally similar, the LTBP isoforms have also different biochemical
and functional properties [104,110]. Binding studies revealed that the affinity of LTBPs to
TGFβ is different between the isoforms. Only LTBP1 and LTBP3 are able to bind TGFβ1,
TGFβ2 and TGFβ3. LTBP4 can only bind the TGFβ1 isoform and LTBP2 is not able to bind
14
any of them [110] (Table 1). Until now there is no data published on any connection or
correlation of LTBPs with obesity.
Figure 5: Secretion of the large latent complex (LLC). The transforming growth factor beta (TGFβ) propeptide binds intracellular to the latent TGFβ binding protein (LTBP). This leads to structural changes and the mature TGFβ dimer is cleaved from its propeptide by furin in the Golgi-vesicle. However, the mature TGFβ is still bound by disulfide bridges to its propeptide, called small latent complex (SLC). The whole LTBP-SLC, also known as large latent complex (LLC), is then secreted into the extracellular matrix (ECM). The Mature TGFβ is then released by proteases, integrins, or pH change and can bind to its receptor. Figure 5 is taken from V. Todorovic, D.B. Rifkin, LTBPs, more than just an escort service, J. Cell. Biochem. 113 (2012) 410–418. https://doi.org/10.1002/jcb.23385 in agreement with John Wiley and Sons.
1.8.1 LTBP1
Among all LTBP isoforms, LTBP1 is the best studied member of this family. It binds to all
three TGFβ isoforms and incorporates into the matrix by binding with its N-terminal end to
fibrillin [104]. In contrast to the other LTBP members, LTBP1 is also able to bind to
fibronectin with its C-terminal end, which suggests an important role of fibrillin-fibronectin
linkage [111,112]. So far, integrin-mediated TGFβ activation was only shown for LTBP1
[113]. In the ECM, integrin can bind to the SLC and exerts force on LTBP1, which then
releases the mature TGFβ from the LLC [104,114]. However, for integrin-mediated TGFβ
release, the incorporation of LTBP1 into the matrix and binding to fibronectin is necessary,
15
since tension between the integrin and LTBP1 is needed [114]. Furthermore, in vitro studies
with antibodies or siRNA against LTBP1 revealed that LTBP1 is important for the
differentiation of endothelial cells [115]. The knockout of the long LTBP1 isoform in mice
resulted in lethality after birth due to persistent truncus arteriosus, which can be attributed
to a low TGFβ bioavailability [116,117]. On the other hand, the knockout of the short LTBP1
form had no effect on the phenotype in mice.
1.8.2 LTBP2
LTBP2 is the only LTBP member which cannot bind to any TGFβ isoform [104,110].
However, LTBP2-deficient mice revealed important functions for LTBP2 in microfibril
formation in the ciliary zones [118]. In addition, humans with LTBP2 null-mutations suffer
from primary congenital glaucoma [119,120]. It is suggested that LTBP2 plays a crucial role
for ECM modulation. LTBP2 binds not only to fibrillin in the matrix, but also to fibulin-5
which supports elastin fiber assembly [121,122]. Furthermore, it was shown that LTBP2 can
inhibit the maturation of BMP11 and secretion of myostatin intracellularly, thereby
influencing the bioavailability of these TGFβ superfamily proteins [123,124].
1.8.3 LTBP3
In contrast to the other LTBP isoforms, LTBP3 is only secreted if bound to the LAP of the
TGFβ isoforms, suggesting that LTBP3 does not have any TGFβ-independent functions
[125]. Mice lacking LTBP3 had premature ossification of the skull base or increased bone
density indicating a TGFβ deficiency which was verified by a lower SMAD3 phosphorylation
in the tissue [126,127]. Moreover, it was also shown that LTBP3 inhibits secretion of pro-
myostatin and maturation of pro-BMP11 by binding to the proprotein convertase 5/6A in
the endoplasmic reticulum [123].
1.8.4 LTBP4
LTBP4 has only low binding affinity for TGFβ1 [104,110]. However, LTBP4-deficient mice
developed cardiomyopathies and rectal-anal tumors which are associated with low levels
of TGFβ1 [128]. In addition, LTBP4 is assigned a role independent of TGFβ1. Studies
16
revealed that LTBP4 plays a crucial role in elastogenesis [129]. LTBP4 enhances fibulin 5
deposition onto microfibrils, thereby potentially building a bridge between fibrillin and
fibulin [104]. This integrates elastin into microfibrils which forms elastic fibers. The
knockout of LTBP4 showed an impaired elastogenesis due to insufficient binding of fibulin
to microfibrils [129,130].
Table 1: In vivo knockout phenotype and transforming growth factor β (TGFβ) binding properties of the latent TGFβ binding protein (LTBP) isoforms.
LTBP1 LTBP2 LTBP3 LTBP4
Knockout phenotype in vivo
▪ Lethality
▪ Persistent truncus arteriosus
▪ Lens luxation
▪ Increased bone density ▪ Premature ossification
of the skull base
▪ Cardiomyopathies
▪ Rectal-anal tumors
TGFβ binding
▪ TGFβ1
▪ TGFβ2
▪ TGFβ3
▪ None ▪ TGFβ1
▪ TGFβ2
▪ TGFβ3
▪ TGFβ1
1.9 Aim of the study
Obesity is a severe problem of the western civilization, since it leads to several
cardiovascular diseases, which are the number one cause of death worldwide [1,2]. Until
now obesity treatment methods are very limited and often fail in the long term [3].
There is evidence for the presence of functional BAT in human adults [6–9]. Browning and
the activation of BAT have been shown to significant increase overall metabolic health
among others by higher glucose uptake and fatty acid uptake [17,29,32]. Recent clinical
studies suggest that prolonged cold exposure leads to recruitment of BAT accompanied by
body weight reduction and improvement of obesity-associated metabolic diseases like type
2 diabetes [18,64,65,71]. Therefore, activation of BAT and stimulation of WAT browning
has become a new approach as an anti-obesity treatment [16,25,60,61].
Until now the exact mechanism how ASCs differentiate either into brown/beige or white
adipocytes is not completely understood. Thus, identification of factors driving these
distinct types of adipogenesis is mandatory and could lead to the development of
therapeutic targets.
In a previous study by our group (Tews et. al) hASCs of paired adipose tissue samples from
the sc and the dn region were isolated from patients undergoing neck surgery for
17
malignancies or nodular goiter [47]. These cells were ex vivo differentiated using identical
differentiation protocols and the expression of white and brown marker genes was
analyzed. Of note, adipocytes differentiated from cells derived from the dn region
expressed higher levels of brown marker genes as compared to adipocytes differentiated
from sc cells [47]. This was supported by other studies, which could also demonstrate that
stromal cells isolated from different adipose tissue regions reveal differences in function
and gene expression after in vitro differentiation [48,52,85]. To identify novel targets that
are potentially involved in the generation of a brown adipocyte phenotype, the gene
expression of the isolated hASCs was analyzed via microarray [47].
It was shown that adipokines can act in an autocrine or paracrine manner to stimulate or
inhibit the expression of brown marker gene UCP1 in vitro and in vivo [87]. Based on these
findings and the introduced results by Tews et al. we hypothesize that factors differently
secreted in the respective adipose tissues may play a role in stimulating or inhibiting an
adipogenesis towards a brown adipocyte phenotype [47]. Therefore, the focus in this work
was on secreted factors as potential targets to stimulate the adipogenesis towards a brown
phenotype. The microarray analysis by Tews et al. revealed 422 genes which were
significantly different expressed between dn and sc samples [47]. These were then ranked
for fold-change expression and screened for secreted factors (see figure 6 for study design).
Figure 6: Study design to identify new factors involved in the adipogenesis towards a brown adipocyte phenotype. Human adipose stromal cells (hASCs) were isolated from the deep neck (dn) and subcutaneous (sc) region of human subjects (1) [47]. These cells were then in vitro differentiated (2) and used for microarray analysis (3). 422 genes were significantly different expressed with a p-value below 0.05. This dataset was then screened for secreted factors which were ranked for the fold change expression between dn and sc. LTBP1, a secreted factor was 2-fold higher expressed in the hASCs derived from the dn compared to sc. Screening the literature revealed also other LTBPs differently expressed between brown and white hASCs [85]. Therefore, we decided to investigate the role of the LTBP family in the adipogenesis and their impact on the UCP1 expression in vitro.
18
Among the genes with a significant differential expression between dn and sc hASCs, LTBP1
was found to be enriched in dn hASCs. Of note, members of this family have also been
found to be higher expressed in brown compared to white hASCs in another study [85]. As
mentioned previously, the LTBP isoforms are secreted factors and known to regulate TGFβ
bioavailability. Several studies have been published on TGFβ and its role in adipogenesis
and WAT browning (see 1.7.1). However, to date, the role of LTBP family members in
adipogenesis and in the context of adipose tissue browning has not been addressed.
Therefore, the aim of this thesis was to investigate the role of the LTBP family members
in adipogenesis and their impact on UCP1 expression and metabolic function in vitro.
19
2. Material and Methods
2.1 Material
2.1.1 Chemicals, kits and reagents
Name Company Order number
Acetyl-CoA Sigma-Aldrich #A2056
Agarose Sigma -Aldrich #A9539
Ampicillin AppiChem #A0839
Antimycin A Sigma-Aldrich #A8674
BactoAgar BD #214010
BactoTryptone BD #211705
BactoYeast Extract BD #212750
BamHI NE Biolabs #R0136S
BfuAI NE Biolabs #R0701S
Biotin Sigma-Aldrich #B-4639
Bolt 4-12% Bis-Tris Plus gels ThermoFisher
Scientific
#NW04125BOX
#NW04122BOX
#NW04120BOX
Bolt LDS sample buffer, 4x ThermoFisher
Scientific
#B0007
Bolt MES SDS running buffer, 20X ThermoFisher
Scientific
#B0002
20
Bolt sample reducing agent, 10X ThermoFisher
Scientific
#B0009
Bradford protein assay concentrate, 5x Bio-Rad #5000006
BSA Sigma-Aldrich #A7906
BSA protein assay standard ThermoFisher
Scientific
#23209
cOmplete protease inhibitor cocktail
tablets
Roche #04693116001
Cortisol Sigma-Aldrich #H-0888
Dexamethasone Sigma-Aldrich #D-1756
D-Glucose Invitrogen #Q100-37
Dibutyryl-cAMP Sigma-Aldrich #D0627
Direct-zol RNA Miniprep Kit Zymo Research #R2052
DMEM ThermoFisher
Scientific
#41966029
DMEM base Sigma-Aldrich #D5030
DMEM/F12 ThermoFisher
Scientific
#31330-038
DMSO Honeywell #41641
dNTP mix, 20 mM Amersham #27-2094-01
DPBS ThermoFisher
Scientific
#14190094
DTNB Sigma-Aldrich #D8130
21
DTT solution, 100 mM ThermoFisher
Scientific
#Y00147
DuoSET ELISA Ancillary Reagent kit 1 R&D #DY007
DuoSET ELISA Ancillary Reagent kit 2 R&D #DY008
ECORI-HF NE-Biolabs #R3101S
EDTA Carl Roth #8043
Ethanol Honeywell #32205
FCCP Sigma-Aldrich #C2920
FCS ThermoFisher
Scientific
#10270106
Formaldehyde solution, 37-38 % (w/v) AppliChem #131328
Free glycerol reagent Sigma-Aldrich #F6428
Gateway LR Clonase II plus enzyme mix ThermoFisher
Scientific
#12538200
GeneArt Genomic Cleavage Detection Kit ThermoFisher
Scientific
#A24372
GlutaMAX, 100x ThermoFisher
Scientific
#35050061
Glycerol Carl Roth #7530
Glycerol standard solution, ~2.8 mM Sigma-Aldrich #G7793
HCl solution, 1 M Honeywell #35328
HEPES, 1 M BioChrome #L1613
Hexan Sigma-Aldrich #296090
Human TGF-beta 1 DuoSET ELISA R&D #DY240
22
Human TGF-beta 2 DuoSet ELISA R&D #DY302
Human TGF-beta 3 DuoSet ELISA R&D #DY243
IBMX Sigma-Aldrich #I-5879
Insulin Sigma-Aldrich #I-1507
Isopropanol VWR #20842
Janus Green B Carl Roth #7697
Kanamycin ThermoFisher
Scientific
#11815024
KCl Merck #104935
L-glutamine solution, 200 mM, 100X ThermoFisher
Scientific
#25030024
Lipofectamine2000 ThermoFisher
Scientific
#11668019
MEM non-essential amino acids solution,
100x
ThermoFisher
Scientific
#11140035
MgCl2 Merck #105833
MgSO4 ∙ 7 H2O Sigma-Aldrich #230391
Monarch DNA Gel Extraction Kit NE Biolabs #T1020S
Monarch PCR & DNA Cleanup Kit NE Biolabs #T1030S
Na2HPO4 AppliChem #A3567
NaCl Merck #106406
NAH2PO4 ∙ H2O Merck Millipore #106349
NaN3 Sigma-Aldrich #S2002
23
Neon Transfection system 100 µl kit ThermoFisher
Scientific
#MPK10025
Nile Red, 1 mg/ml Sigma-Aldrich #N3013
Novex NuPAGE 3-8% Tris-Acetate-Protein-
Gels
ThermoFisher
Scientific
#EA03752BOX
Novex NuPAGE LDS sample buffer (4x) ThermoFisher
Scientific
#NP0007
Novex NuPAGE Tris-Acetate-Running
buffer
ThermoFisher
Scientific
#LA0041
Novex Tris-Glycin native running buffer ThermoFisher
Scientific
#LC2672
Novex Tris-Glycin native sample buffer ThermoFisher
Scientific
#LC2673
Oligomycin Sigma-Aldrich #04876
Opti-MEM I ThermoFisher
Scientific
#31985047
Oxalacetate Sigma-Aldrich #171263
Panthotenat Sigma-Aldrich #P-5155
Penicillin/streptomycin solution, 100x ThermoFisher
Scientific
#15140122
peqGOLD DNA ladder mix VWR #25-2040
peqGOLD Plasmid MiniPrep kit I VWR #12-6943-02
phosSTOP phosphatase inhibitor cocktail
tablets
Roche #04906845001
24
PureLink HiPure plasmid MidiPrep kit ThermoFisher
Scientific
#K210005
Puromycin Sigma-Aldrich #P8833
Quick ligation kit NE Biolabs #M2200S
Random Primers ThermoFisher
Scientific
#48190011
Recombinant TGFβ1 Abcam #50036
Rosiglitazone Cayman #71740
Rotenone Sigma-Aldrich #R8875
SB 431542 R&D #1614
Seahorse XF base medium Agilent #103334-100
Seahorse XF Calibrant solution Agilent #100840-000
Seahorse XF glucose solution 1M Agilent #103577-100
SeeBlue Plus2 pre-stained protein standard ThermoFisher
Scientific
#LC5925
Skim milk powder Sigma-Aldrich #70166
Sodium pyruvate solution, 100 mM ThermoFisher
Scientific
#11360039
Sso Advanced Universal Probes Supermix Biorad #1725281
SuperScript II Reverse Transcriptase Invitrogen #18064014
T4 PNK NE Biolabs #M0201S
TE Buffer ThermoFisher
Scientific
#12090015
25
Trans-Blot Turbo RTA 0.2µM PVDF Transfer
kit
Biorad #1704272
#1704273
Transferrin Sigma-Aldrich #T-2252
Triglyceride reagent Sigma-Aldrich #T2449
Triiodothyronine Sigma-Aldrich #T-6397
Tris base Sigma-Aldrich #T1503
Tris HCl Sigma-Aldrich #10812846001
Triton
Trypsin/EDTA solution, 0.05 %/0.02% Merck #L2143
Tween 20 AppliChem #A1389
Westar Nova 2.0 Western blot substrate
solutions
Cyanagen #XLS071
XbaI NE Biolabs #R0145S
2.1.2 Equipment
Name Company Order number
cell culture dishes, 10 cm Sarstedt #83.3902
cell culture dishes, 6 cm Corning #353002
cell culture flasks, 175 cm² Sarstedt #83.3912.002
cell culture flasks, 175 cm² Corning #353112
cell culture plates, 12 well Corning #353043
cell scrapers Sarstedt #83.1830
cell strainer, 70 µm Falcon #352350
26
cryotubes Sarstedt #72.379.992
Finnpipette F2 Multichannel Thermo Scientific #4662020 #4662040
Finnpipette F2 single Thermo Scientific #4642090 #4642010 #4642020 #4642060 #4642080
glass pipettes VWR #612-1701
glass slides VWR #631-1551
Mr. Frosty freezing container Thermo Scientific #10110051
Multipipette Eppendorf #EP4982000012
multipipette tips, 0.5 ml, non-sterile Eppendorf #0030089421
multipipette tips, 10 ml, non-sterile Eppendorf #0030089820
multipipette tips, 5 ml Eppendorf #0030089669
multipipette tips, 5 ml, non-sterile Eppendorf #0030089456
PCR plates, 96-well, white shell/clear well BioRad #HSP9601
pipette tips, 1250 µl Sarstedt #70.1186
pipette tips, 20 µl Sarstedt #70.1116
pipette tips, 200 µl Sarstedt #70.760.002
plastic tubes with plug cap 13 ml Sarstedt #62.515.006
plastic tubes with screwed cap, 15 ml Sarstedt #62.554.502
plastic tubes with screwed cap, 50 ml Sarstedt #62.547.254
plate sealing films Bio-Rad #MSB1001
reaction tubes, 0.5 ml Sarstedt #72.704.400
27
reaction tubes, 1.5 ml Sarstedt #72.706.400
reaction tubes, 2 ml Sarstedt #72.695.400
seahorse XFe96 cell culture multiplate Agilent #101085-004
serological pipettes, 1 ml Corning #357521
serological pipettes, 10 ml Corning #4488
serological pipettes, 25 ml Corning #4489
serological pipettes, 5 ml Corning #4487
sterile filter 0.2 µM GE Healthcare #10462200
sterile filter units, 0.2 µM, 250 ml ThermoFisher
Scientific
#568-0020
sterile filter units, 0.2 µM, 500 ml ThermoFisher
Scientific
#569-0020
syringes, 20 ml BD #300629
syringes, 50 ml BD #300863
2.1.3 Devices
Name Company
Bolt Mini Gel Tank electrophoresis chamber ThermoFisher Scientific
BZ-9000 microscope Keyence
Chemidoc MP Biorad
Infinite 200Pro multimode plate reader Tecan
Min-Sub Cell GT Cell electrophoresis chamber Biorad
NanoDrop 2000 spectrophotometer ThermoFisher Scientific
28
Neon Transfection system ThermoFisher Scientific
peqStar 2X Universal Gradient thermocycler VWR
Seahorse XFe96 analyzer Agilent
Trans Blot Turbo Biorad
2.1.4 Buffers and solutions
Protein lysis buffer, pH 7.5 + 1% Triton X-100
+ 10 mM Tris
+ 10% glycerol
+ 150 mM NaCl
+ 2 mM EDTA
in dH2O
and ad
+ 1 mM DTT
+ 1X protease inhibitor
TBS 10X, pH 7.6 + 200 mM Tris base
+ 1.5 M NaCl
in dH2O
TBST + 1X TBS
+ 0.1% Tween 20
in dH2O
Antibody buffer + 2.0% (w/v) BSA
+ 0.02% (v/v) NaN3
in TBST
Western blot blocking buffer + 5.0 % (w/v) milk powder in TBST
29
2.1.5 Bacteria and mammalian cells
Name Company/Origin Order number
One Shot TOP10 Chemically Competent E. coli Thermo Fisher #C404010
One shot Stbl3 Chemically Competent E. coli Thermo Fisher #C737303
Human SGBS cells [131] -
2.1.6 Cell culture medium
SGBS basal medium (0F) + 100 U/ml Penicillin/streptomycin + 17 μM Pantothenate + 33 μM Biotin in DMEM:F12 (1:1)
SGBS growth medium + 10 % (v/v) FCS In 0F Medium SGBS Differentiation medium I (Quick medium) + 0.01 mg/ml Transferrin (day 0 - day 4) + 0.2 nM Triiodthyronine (T3)
+ 100 nM Cortisol + 2 μM Rosiglitazone + 20 nM Insulin + 25 nM Dexamethasone + 250 μM IBMX in 0F Medium
SGBS Differentiation medium II (3FC) + 0.01 mg/ml Transferrin (day 4-day 14) + 20 nM Insulin
+ 100 nM Cortisol + 0.2 nM Triiodthyronin (T3) in 0F medium
Seahorse XF assay medium + 1X glutamaxx + 1 mM sodium pyruvate + 10 mM glucose solution + 1%(w/v) BSA in Seahorse XF Base medium
30
2.1.7 Bacterial cell culture medium
LB agar, pH 7.00 + 10 g/l BactoTryptone + 5 g/l BactoYeast Extract + 15 g/l Bacto Agar + 10 g/l NaCl in dH2O Add either: 100 µg/ml Ampicillin or 100 µg/ml Kanamycin
LB medium 5X, pH 7.00 + 50 g/l BactoTryptone + 25 g/l BactoYeast Extract + 50 g/l NaCl in dH2O Add either: 100 µg/ml Ampicillin or 100 µg/ml Kanamycin
SOB medium + 10 mM MgCl2 + 10 mM MgSO4
+ 10 mM NaCl + 2.5 mM KCl + 5 g/l BactoYeast Extract
+ 20 g/l BactoTryptone in dH2O
SOC medium + 20 mM glucose in SOB medium
2.1.8 qPCR and sequencing Primer
Table 2: Primer used for qPCR or sequencing
Gene Primer Sequence 5’→3’
Adiponectin forward reverse
GGCCGTGATGGCAGAGAT CCTTCAGCCCCGGGTACT
COX8 forward reverse
TTTGTGGTGTACTCCGTGCCATCATGTC GTAAGCCCAACGGCCAATTCCATGATCC
CPT1B forward reverse
CATGGTGGGCAAGTAACTATGTGAGTGACTG GCACGTCTGTATTCTTGATGAGCACAAGG
31
DIO2 forward reverse
CGATGCCTACAAACAGGTGAAATTGGGTGAG AGCCTCATCAATGTAGACCAGCAGGAAGTCAG
GLUT4 forward reverse
TTCCAACAGATAGGCTCCGAAG AAGCACCGCAGAGAACACAG
HPRT forward reverse
GAGATGGGAGGCCATCACATTGTAGCCCTC CTCCACCAATTACTTTTATGTCCCCTGTTGACTGGTC
LTBP1 forward reverse
CGAGCATCTGTAAAGTGACCT AAGATGGCAAATTACCACTCGG
LTBP2 forward reverse
AGCACCAACCACTGTATCAAAC CTCATCGGGAATGACCTCCTC
LTBP3 forward reverse
TCCCCAGGGCTACAAGAGG AGACACAGCGATAGGAGCCA
LTBP4 forward reverse
CTGCCCATTCTGCGGAACAT GCCGAGTAGTGGTAACCAGG
NDUF8B forward reverse
CCGCCAAGAAGTATAATATGCGT TATCCACACGGTTCCTGTTGT
PGC1α forward reverse
CTCAAATATCTGACCACAAACGATGACCCTC GTTGTTGGTTTGGCTTGTAAGTGTTGTGAC
PPARG forward reverse
GATCCAGTGGTTGCAGATTACAA GAGGGAGTTGGAAGGCTCTTC
PRDM16 forward reverse
TCTACATTCCTGAAGACATTCCGATCCCA CCGTCAGTATTTGCTCCCATCCGAAGTC
SMAD4 forward reverse
TACACCAACAAGTAATGATGCC AATCCTTTCCGACCAGCC
TGFβ1 forward reverse
CTAATGGTGGAAACCCACAACG TATCGCCAGGAATTGTTGCTG
TGFβ2 forward reverse
CCCCGGAGGTGATTTCCATC GGGCGGCATGTCTATTTTGTAAA
TGFβ3 forward reverse
GGAAAACACCGAGTCGGAATA GCGGAAAACCTTGGAGGTAAT
TGFβR1 forward reverse
ACGGCGTTACAGTGTTTCTG GCACATACAAACGGCCTATCTC
TGFβR2 forward reverse
GTAGCTCTGATGAGTGCAATGAC CAGATATGGCAACTCCCAGTG
TGFβR3 forward reverse
TGGGGTCTCCAGACTGTTTTT CTGCTCCATACTCTTTTCGGG
UCP1 forward reverse
GGAAAGAAACAGCACCTAGTTTAGGAAGCA CGTCAAGCCTTCGGTTGTTGCTATTATTCTG
32
UQCRC2 forward reverse
TTCAGCAATTTAGGAACCACCC GGTCACACTTAATTTGCCACCAA
M13+ (sequencing
primer)
forward ACGTTGTAAAACGACGGCCAGT
2.1.9 siRNAs
Table 3: Small interfering RNAs (siRNA) used for in vitro gene knockdown
siRNA pool Sequence 5’→3’
Non-targeting control 1. UAAGGCUAUGAAGAGAUAC 2. AUGUAUUGGCCUGUAUUAG 3. AUGAACGUGAAUUGCUCAA 4. UGGUUUACAUGUCGACUAA
SMAD4 1. GUGUGCAGUUGGAAUGUAA 2. GUACAGAGUUACUACUUAG 3. GAGUAUUGGUGUUCCAUUG 4. GUAAUGCUCCAUCAAGUAU
2.1.10 Western blot antibodies
Table 4: Antibodies used for Western blot
Antigen clone host supplier Order number
Anti Goat Rabbit Santa Cruz sc-2768
Anti Mouse
520 nm
Goat Biorad #12005866
Anti Mouse
HRP
Goat Biorad #1706516
Anti Rabbit
520 nm
Goat Biorad #12005870
Anti Rabbit
HRP
Goat Biorad #1721019
33
GAPDH
Recombinant
rhodamine labeled
Biorad #12004168
LTBP1 Monoclonal Mouse R&D MAB388
LTBP2 Polyclonal Goat R&D AF3850
OXPHOS Monoclonal Mouse abcam ab110411
PPARG Monoclonal Rabbit Cell signaling #2443
TGFβ1 Monoclonal Rabbit abcam ab179695
TGFβ2 Monoclonal Mouse abcam ab36495
TGFβ3 Polyclonal Rabbit abcam ab227711
Tubulin
Recombinant
rhodamine labeled
Biorad #12004166
UCP1 Monoclonal Mouse R&D MAB6158
2.1.11 Single guide RNAs used for CRISPR/Cas9 mediated gene knockout
Table 5: sgRNA used for CRISPR/Cas9 mediated gene knockout
Target sgRNA Sequence 5’→3’
Empty vector (EV) Top Bottom
ACCGGTCACCGATCGAGAGCTAG AAACCTAGCTCTCGATCGGTGAC
LTBP1 Top Bottom
ACCGGTGGAACTGTGGGTACCTCC AAACGGAGGTACCCACAGTTCCAC
LTBP2 Top Bottom
ACCGCAGGTGGCAGAACTTCCCGG AAACCCGGGAAGTTCTGCCACCTG
LTBP3 Top Bottom
ACCGCGGCGTTCGAGCTCTCAATG AAACCATTGAGAGCTCGAACGCCG
LTBP4 Top Bottom
ACCGCTGCGATCCTGGGTACCACG AAACCGTGGTACCCAGGATCGCAG
TGFβ1 Top Bottom
ACCGTTGATGTCACCGGAGTTGTG AAACCACAACTCCGGTGACATCAA
TGFβ2 Top Bottom
ACCGCGACGAAGAGTACTACGCCA AAACTGGCGTAGTACTCTTCGTCG
34
TGFβ3 Top Bottom
ACCGATAAATTCGACATGATCCAG AAACCTGGATCATGTCGAATTTAT
2.1.12 Plasmids
Table 6: Plasmids used for cloning
Name Supplier Order
number
Comment Properties
pMuLE ENTR U6
stuffer sgRNA
scaffold L1-R5
Adgene #1000000060 Kindly provided
by Ian Frew
For sgRNA
insertion
pMuLE ENTR U6
stuffer sgRNA
scaffold L4-L5
Adgene #1000000060 Kindly provided
by Ian Frew
For sgRNA
insertion
pMuLE ENTR U6
stuffer sgRNA
scaffold L1-R5
Adgene #1000000060 Kindly provided
by Ian Frew
For sgRNA
insertion
pMuLE ENTR CMV-
hCas9 L3-L2
Adgene #1000000060 Kindly provided
by Ian Frew
Cas9 enzyme
pMuLE ENTR CMV-
hCas9 L5-L2
Adgene #1000000060 Kindly provided
by Ian Frew
Cas 9 enzyme
pSBtet-GP Adgene #60495 Kindly provided
by Eric Kowarz
Sleeping Beauty
recognition sites,
eGFP, Puromycin
resistance
pLenti6.3/V5- DEST Thermo-
Fisher
Scientific
#V53306 Destination
vector for LR
Gateway cloning
35
2.1.13 Cleavage assay primer
Table 7: Primer used for Gene Art Genomic Cleavage Assay
Gene Cleavage primer Sequence 5’→3’ LTBP1 forward
reverse GTGAGGGACAGCAGTGCTC CTCTTCCCCTGAGACAAAAAGTCCA
LTBP2 forward reverse
CAGGAAGGCAGGGGC GGCCCAGCTGTGCCG
LTBP3 forward reverse
AGCAAGCACGCCATCTACG AAGGAAAGGCAGATCCCGACT
LTBP4 forward reverse
GGGGGTTTAATCCAGAGGCC ATCTTGCCTCCCTGCTTC
2.1.14 Software
Name Version Company
BZII Viewer and Analyzer 2.1 Keyence
CFX Manager 3.1 Biorad
Image Lab 6.0.1 Biorad
Inkscape vector graphic
editor
0.92 Inkscape
Office 365 Microsoft
Prism 7.0 GraphPad
pMuSE SB eGFP-
P2A-PuroR-DEST
- - Cloned by Jan-
Bernd Funcke in
our department
Combination of
pLenti6.3/V5-
DEST and pSBtet-
GP [132,133]
pCMV(CAT)T7-
SB100
Adgene #34879 Kindly provided
by Zsuzsanna
Izsvak
Sleeping Beauty
transposase
36
SnapGene 4 GSL Biotech
Wave 2.6 Agilent
37
2.2 Methods
2.2.1 Cell culture
Simpson-Golabi-Behmel Syndrome (SGBS) cells are hASCs isolated from the scWAT of a 3-
month old infant who suffered from SGBS [131]. In the following, the term SGBS
preadipocytes will be used for this cell strain. These SGBS preadipocytes can be easily
subjected to adipogenesis and reach a differentiation rate up to 95% [131]. In addition,
they can be kept until the 30th generation without affecting differentiation [131].
SGBS preadipocytes were grown in T175 cell culture flasks with growth medium and split
at latest before full confluence was reached. To prepare SGBS preadipocytes for seeding,
cells were washed once with Dulbecco’s phosphate buffered saline (DPBS), subjected to
2 ml trypsin and incubated for 5 minutes at 37°C, 5% (v/v) CO2. Subsequently,
preadipocytes were resuspended in growth medium and centrifuged for 10 min at
1100 rpm. Thereupon, supernatant was discarded, and cells were resuspended once more
in 10 ml growth medium. Afterwards cell number was determined by counting the
preadipocytes with a light microscope and a Neubauer cell counting chamber.
For differentiation, SGBS cells were seeded into cell culture vessels and grown (37°C,
5%(v/v) CO2) for 72 h in growth medium until full confluence was obtained (d0). Cells were
then washed once with DPBS and growth medium was substituted with Quick medium.
After another four days the medium was substituted with 3FC medium without a washing
step. Cells were then kept for further ten days in the incubator until mature lipid laden
adipocytes were obtained (d14). If not stated differently, cells were cultured based on this
method in all experiments. Seeding densities are depicted in table 8.
For prolonged storage of SGBS preadipocytes, up to 500.000 cells were resuspended in 1 ml
growth medium containing 10 % DMSO and added to kryo tubes. These tubes were frozen
in freezing containers (Mr. Frosty, Thermo scientific) at -80°C and on the next day
transferred to liquid nitrogen for long term storage.
38
Table 8: Seeding densities for SGBS cell differentiation approach
2.2.2 Differentiation rate and microscopic pictures
Differentiation rate of mature adipocytes was determined on day 14 by counting the
number of preadipocytes and adipocytes in three independent segments using a light
microscope equipped with a net micrometer. If the cell contained at least 3 lipid droplets,
it was considered to be an adipocyte. On the same day, pictures of mature adipocytes were
taken at 10-fold magnification using a BZ-900 microscope (Keyence).
2.2.3 Determination of triglyceride content
Triglyceride accumulation in SGBS adipocytes was determined enzymatically on d14 by
measuring the intracellular glycerol content. Therefore, triglycerides were isolated by
washing the wells 2-times with 500 µl Hexan:Isopropanol (60:40 ratio). The solved
triglycerides were then transferred into a microcentrifuge tube. This tube was incubated
with an open lid overnight until solvent was completely evaporated. Samples were then
stored at -20°C or resuspended in 100 µl isopropanol. Per sample and well 0.33 µl were
Cell culture
vessel
Cell density/well
followed by 72 h
incubation
Medium
volume (ml)
Usage
12-well plate 20,000 1
RNA isolation, generation of cell
supernatant, determination of
differentiation rate,
determination of triglyceride
content
6 cm dish 150,000 5 Protein isolation
96-well
Seahorse XF96
cell culture
microplates
2,500 0.1 Measurement of cellular oxygen
consumption and extracellular
acidification rate
39
then transferred into a 96-well plate. Ten µl of a glycerol standard (1250 µg/ml, 625 µg/ml
312 µg/ml, 156.3 µg/ml, 78 µg/ml, 39 µg/ml diluted in isopropanol) was transferred into
the 96 well plate as well. Subsequently, 160 µl/well triglyceride reagent to cleave
triglycerides into glycerol and 40 µl/well glycerol reagent for detection of free glycerol were
added to each well. After 15 minutes of incubation at room temperature (RT), the
absorption was measured at 550 nm and triglyceride content was calculated using a linear
standard curve.
2.2.4 RNA isolation and qRT-PCR
Total RNA of SGBS cells was harvested with TRIzol reagent and then either stored at -80°C
or isolated subsequently with the ZYMO Direct-zol RNA Miniprep kit, according to the
manufacturer’s protocol. RNA concentration was determined with a NanoDrop 2000
spectrophotometer (Thermo fisher) measuring the wavelength at 260 nm and using the
following equation:
c=(A*ε)/b
c= concentration (ng/µl); A= absorbance (AU); ε=40 ng*cm/µl; b= pathlength (cm)
For cDNA synthesis 500-1000 ng of RNA was mixed with 1 µl Random Primer (3 µg/ml) and
subjected to denaturation (85°C for 3 min). Afterwards samples were immediately stored
on ice and each complemented with 10 µl of RT-PCR Master-mix, containing 1 µl
Superscript II RT (200 units), 1 µl dNTP (10 µM), 1 µl H2O, 2 µl DTT (0.1 M) and 5 µl first
strand buffer(5X). Samples were then subjected to a peqStar 2X Universal Gradient
thermocycler using the following conditions:
25°C for 15 min
42°C for 50 min
70°C for 15 min
4°C until termination
Afterwards samples were diluted with RNAse free water to a final concentration of 5 ng/µl
cDNA.
40
For quantitative real time PCR (qRT-PCR) 1 µL Primer (5 µM), 5 µl Sso Advanced Universal
SYBR Green Supermix and 3 µl H2O per well was pipetted in advance into a hard shell 96-
well PCR plate (Biorad). Thereupon 1 µl cDNA (5 ng/µl) was added per well. Finally, the PCR
assay was performed in a CFX96 Real-time PCR detection System (Biorad) with the
following conditions:
30 s at 95 °C
40 Cycles of
5s at 95°C
30s at 60°C
Verification of the correct amplicon size was determined by analyzing the melting
temperature of the PCR products. If not stated differently Hypoxanthine-Guanin-
Phosphoribosyltransferase (HPRT) was used as a house keeping gene and the expression
was calculated either using the 2-ΔCt or the 2-ΔΔCT method for normalization.
2.2.5 Protein isolation, separation and immunoblotting
For protein isolation, cells in 6 cm dishes were washed once with ice cold DPBS and
subjected subsequently to 100 µl of protein lysis buffer, followed by harvesting with a cell
scraper and transferring into a microcentrifuge tube. Samples were then incubated for
30 min on ice and centrifuged for 30 min at 14,000 g. Subsequently, supernatant was
transferred into a new microcentrifuge tube and stored at -20°C for further experiments.
To determine the protein concentration of the cell lysates a Bradford assay was applied
according to the manufacture’s protocol (Biorad). Protein samples were pre-diluted 1:10
and measured in duplicates. For concentration determination a bovine serum albumin
(BSA) standard was used and previously diluted in dH2O to 500 µg/ml, 300 µg/ml, 200
µg/ml, 100 µg/ml, 50 µg/ml and 0 µg/ml. Absorbance was measured at 550 nm using a
multimoded plate reader (Tecan).
Isolated protein samples (12-15 µg) were separated by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) using a Bolt Mini Gel Tank electrophoresis
chamber. Samples were mixed with 4x sample buffer and adjusted with H2O to a final
volume of 25-40 µl. For denaturation conditions, 10x reducing reagent was included in the
41
mix. Samples were then heated at 70°C for 10 min and transferred onto the gel. SeeBlue
Plus2 pre-stained protein standard served as a reference. Different SDS-PAGE running
conditions are depicted in table 9.
Table 9: SDS-PAGE running conditions for different protein properties (SDS: sodium dodecyl sulfate; MES: 2-(N-Morpholino)ethansulfonic acid; LDS: lithium dodecyl sulfate)
Protein properties Type of Gel Sample Buffer Running Buffer Conditions
Denatured/Native
Mixed molecular
weight
Bolt 4-12% Bis-
Tris Plus gels
(10-17 wells)
Bolt LDS
sample buffer
Bolt MES SDS
running buffer
200 V
25- 35 min
Native
High molecular
weight
NuPAGE 3-8%
Tris-Acetate-
Protein gels
(12-well)
Novex Tris-
Glycine Native
Sample Buffer
Novex Tris-
Glycine Native
Running Buffer
150 V
60 min
Denatured
High molecular
weight
NuPAGE 3-8%
Tris-Acetate-
Protein gels
(12-well)
NuPAGE LDS
Sample Buffer
NuPAGE Tris-
Acetate SDS
Running Buffer
150 V
90 min
For Western blot, filter paper and nitrocellulose membrane were previously incubated for
10 min in transfer buffer (Biorad). Proteins were then transferred on membrane using the
Trans-Blot Turbo transfer system (Biorad) according to the manufactures protocol (2.5 A,
19 V, 7 min) Hereinafter, the membrane was blocked for 1h in 1x tris-buffered saline with
Tween 20 (TBST) with 5% (w/v) fat free milk powder and subsequently washed 3 times for
10 min in 1xTBST. Afterwards membrane was incubated with the primary antibody
overnight at 4°C. Thereupon the membrane was washed again 3 times for 10 min in 1x TBST
and then incubated for another hour with the secondary antibody (in 5% milk TBST)
followed by another three washing steps á 10 min in TBST. Depending on the sensitivity of
the primary antibody, secondary antibodies with either fluorescent or horse radish
42
peroxidase (HRP) labeling were used and detected by fluorescence or enhanced
chemiluminescence (ECL), respectively. Membranes were analyzed using a ChemiDoc MP
Imager (Biorad).
2.2.6 Citrate synthase assay
To measure the citrate synthase activity as a surrogate for mitochondrial content, a kinetic
assay was performed. Citrate synthase catalyzes citrate from oxaloacetate and acetyl CoA
thereby reducing CoA. This reduced form transforms 5,5’ dithiobis 2 nitrobenzoic acid
(DTNB) into 2-nitro-5benzoic acid (TNB). The activity of citrate synthase can then be
assessed by the absorbance of TNB at 412 nm.
The following reaction media was prepared per 96-well and sample:
4 µl of 5 mM DTNB
6 µl of 10 mM acetyl CoA
19 µl of 1M Tris HCl pH 8.1
151 µl of H2O
This solution was added to 5 µg of protein sample in 10 µl H2O. Each sample was then
transferred to a 96-well plate. The 96-well plate containing the samples and reaction media
was then subjected to a multimoded plate reader (Tecan) with the following measurement:
-Baseline: 7 cycles measurement with an absorbance at 412 nm
-Injection: Injection of 10 µl/well oxaloacetate solution (10 mM)
-Reaction: 7 cycles measurement with an absorbance at 412 nm
Citrate synthase activity was calculated with the following equation
Units (µmol/min/mg) = ΔA412/min ∗ V(ml)
ε ∗ L(cm) ∗ mg protein
ΔA412 /min= The absorption at 413 nm/min at baseline activity subtracted from the
absorption at 413 nm/min at the endogenous activity.
V(ml) = sample volume (0.2 ml)
43
ε (mM-1cm-1) = extinction coefficient (13.6 for TNB)
L(cm) = pathlength (0.625 cm for 96-well plate)
2.2.7 Determination of the cellular oxygen consumption rate
To measure the cellular oxygen consumption rate (OCR) of SGBS adipocytes, an
extracellular Flux Analyzer (Seahorse XF96, Agilent) was used. Therefore, mature
adipocytes in 96-well Seahorse XF96 cell culture microplates were washed twice with 0F
medium on the day before measurement (for seeding and differentiation see 2.2.1) and
200 µL/well of Seahorse XF Calibrant solution was added to a Flux plate and subsequently
incubated at 37°C, no CO2. On the day of measurement, cells in the 96-well plate were
washed once with 100 µl/well Seahorse assay medium and finally 155 µl assay medium was
added. The plate was then incubated for 1h at 37°C, no CO2. The Seahorse Flux plate was
prepared for injection with 0.5 mM/well dibutyryl cyclic adenosine monophosphate
(cAMP), 2 µM/well Oligomycin, 4 µM/well carbonylcyanide-p-trifluoro-
methoxyphenylhydrazone (FCCP) and 1.5 µM/well Antimycin A and Rotenone (Ant/Rot)
according to the manufacture’s protocol. Cellular oxygen consumption rate was then
measured in the 96-well plate with following parameters: 3-5 cycles basal; 10-12 cycles
after cAMP injection, 5 cycles after Oligomycin injection, 3 cycles after FCCP injection, 3
cycles after Ant/Rot injection.
2.2.8 Normalization for lipid content and cell density
To normalize for lipid content, cells were stained with Nile Red, a lipophilic dye which
incorporates into neutral lipids and can be detected by its fluorescence. After the
measurement of the OCR, cells in the 96 well plate were fixed in 4% PFA/PBS (100 µl/well)
for a minimum of 20 min and then washed with DPBS. Subsequently 100 µl of 10%
DMSO/0.1% Nile Red in DPBS was added per well and incubated for 20 min, protected from
light. Afterwards Nile Red staining was analyzed using a Tecan plate reader at 550 nm
excitation and 640 nm emission. Afterwards the plate was washed again once with DPBS
and subsequently 25 µl of a 0.3% Janus green solution was added per well, followed by 30
min incubation time. Thereupon, the plates were washed with water and then tapped on
a paper towel until the plate was dry. 100 µl of a 0.5 M HCl solution was added per well
44
and incubated for further 10 min. Subsequently, the Janus green staining was measured
using a Tecan plate reader at 630 nm absorption. The data was used to normalize the
measured OCR data to lipid content (NileRed) or cell content (JanusGreen) of the individual
well and as a determination for differentiation rate or cell amount.
2.2.9 siRNA Transfection
For siRNA transfection SGBS preadipocytes were seeded as described before (2.2.1) and
transfected with the siRNA after 24 h of cell growth and incubated for 48 h until d0 was
reached (see 2.2.1). For transfection of a single 12 well, 1 µl siRNA (20 µM) was added to
49 µl of OptiMEM and mixed with 2.5 µl lipofectamine 2000, previously added to 47.5 µl
OptiMEM. This stock solution was incubated for 20 min and subsequent pipetted drop by
drop on SGBS preadipocytes to a final siRNA concentration of 20 nM.
2.2.10 Multiple Gateway cloning for CRISPR/Cas gene knockout in vitro and transposase
mediated stable transfection
CRISPR/Cas9 system has become the gold standard for stable genetic modification in cells.
The Cas9 protein, discovered in the bacterial immune system is a RNA guided DNA
endonuclease allowing specific gene manipulation [134,135]. A convenient way to clone
CRISPR/Cas9 knockout constructs is the multiple lentiviral expression system (MuLE) [136].
This has been frequently used as a flexible tool to recombine up to four different ENTRY
vectors containing e.g fluorescent proteins, resistance genes, the Cas9 gene or the
designed single guide RNAs (sgRNA) into a destination vector (Figure 7). The recombination
is achieved by LR Gateway cloning. In this thesis the system was used to recombine up to
four entry vectors with different sgRNAs and the Cas9 into a destination vector [136,137].
Designing the intended sgRNA is achieved by public online tools e.g. the broad institute. By
typing in the target gene, the program suggests several options for sgRNA sequences
ranked for lowest off target effects and highest specificity in gene targeting calculated by
algorithms [138,139].
The final constructs for CRISPR/Cas9 mediated knockout are named multiple sleeping
beauty expression vector (MuSE). These vectors contain an enhanced green fluorescent
protein (eGFP) under the control of a RPL13A promoter which is used for visual transfection
45
control. Under the control of the same promotor a puromycin resistance (PuroR) gene for
selection of transfected cells is encoded. Furthermore, a cytomegalovirus (CMV) promoter
controls the Cas9 and a U6 promoter the intended sgRNA. The complete cassette is flanked
by inverted repeats (ITR), which are Sleeping Beauty (SB) transposase recognition sites.
The usage of SB transposase system offers a way for stable gene integration into
mammalian cells [140]. Originally the sleeping beauty transposase was discovered as an
inactive gene in fish [141]. Genetic modification of this sequence created a new synthetic
transposon system. Through further modification of the gene a high activity was achieved,
enabling the generation of stable transgenic cell lines [140]. The SB transposase works
according to the cut and paste principle. It recognizes the ITRs which flank the transposon
(genes of interest). This transposon ends are then brought together by the SB transposase
and subsequent excised. Afterwards, the transposon is integrated by the SB transposase
into the host genome at TA dinucleotide sites. Compared to a common lentiviral
transfection, the SB transposase reveals a faster and safer way for a stable host gene
integration with high molecular weight plasmids [140].
Figure 7: LR Gateway cloning
with multiple fragments.
Multisite gateway cloning is a
powerful tool for rapid and easy
recombination of up to 4
different entry vectors. By using
the multiple lentiviral expressing
system (MuLe) two (A) and up to
four fragments (B) can be
recombined and cloned into a
destination vector within 16 h.
Specific attL and attR sites
mediate the recombination step.
CMR=Chloramphenicol-
resistance
ccdB=ccdB toxin gene.
46
For cloning of CRISPR/Cas9 constructs, partially modified plasmids of the multiple lentiviral
expression (MuLE) system kit (Adgene) were used [132,136]. The respective plasmids used
for cloning are listed in 2.1.12 table 6 and the related sequences and vector maps of
products are attached in the appendix (Figure S1 and S2)
1) Digestion of pMuLE ENTR plasmids
For preparation the pMuLE ENTR U6 stuffer sgRNA scaffold plasmids (see 2.1.12) were
digested for 2 h at 50°C using the restriction enzyme BfuAI with NEBuffer 3.1 according to
the manufacture’s protocol. Digested plasmids were then subjected to an agarose gel
electrophoresis (1% (w/v) agarose, 120 V, 30 min) to separate the insert from the
backbone. The plasmids backbone was then cut from the gel and extracted using the
Monarch DNA Extraction kit (NEB) according to its protocol. The product contained the
purified linearized plasmid, ready for insertion of the intended sgRNA.
2) sgRNA design
For Crispr/Cas 9 knockout constructs the respective sgRNA for the target gene was
designed using the broads institutes analysis tool [142], which assures maximal on-target
and minimal off-target effects using approved scoring models for sgRNA prediction [138].
The top and the complementary bottom sgRNA flanked by restriction sites for further
ligation, was then synthesized at Biomers GmbH (see 2.1.11 for sequences).
3) Phosphorylation and annealing
The first step of cloning was the annealing and phosphorylation of top and bottom sgRNA
with the following formula:
1 µl sgRNA top (100 µM)
1 µl sgRNA bottom (100 µM)
1 µl T4 DNA Ligase reaction buffer (10X)
6.5 µl H2O
0.5 µl T4 PNK (10 U/µl)
47
All reagents were mixed in a microcentrifuge tube and incubated in a peqStar 2X Universal
Gradient thermocycler at:
37°C 30 min
95°C 5 min
95°C to 8°C with 5°C/min cooling
4) Ligation of sgRNA duplexes into the opened entry vector
sgRNA duplexes were then diluted 1/200 in H2O to a total concentration of 50 nM and
ligated into the corresponding entry vector. For each ligation, the following approach was
pipetted into a microcentrifuge tube, followed by 10 min incubation at room temperature:
Digested pMuLE ENTR U6 stuffer sgRNA scaffold 50 ng
sgRNA duplex (50 nM) 1 µl
Quick ligase reaction buffer (2X) 5 µl
Quick ligase 1 µl
H2O fill up to a total of 11 µl
5) Transformation of ligated plasmids into TOP10 E. coli
For the amplification of the plasmid, the ligated plasmids were transformed into TOP10
E. coli bacteria. For this purpose, the bacteria were thawed 5-10 min on ice and then 7 µl
of the plasmid solution was added to the bacteria and incubated for 30 min on ice. The
bacteria were then heat shocked for 1.30 min at 42°C in a water bath. Subsequently, the
tubes with bacteria were incubated on ice for 2 min and 250 µl SOC medium was added to
each sample and shaken for 1h at 37°C, 220 rpm. Thereupon, each batch was plated on
agar plates with kanamycin (50 µg/ml) and incubated for 12-18h at 37°C.
6) Control digest and sequencing
Bacterial cultures were inoculated into liquid LB medium containing 100 µg/ml kanamycin
and were shaken overnight at 37°C. As a backup, 500 µl of each batch was mixed with 250 µl
glycerol and frozen at -80°C. The plasmids were isolated according to the instructions of
48
the peqGOLD miniprep kit. DNA concentrations were measured with a NanoDrop 2000
spectrophotometer (Thermo fisher) and afterwards a control digest was prepared.
Therefore 250 ng plasmid was mixed with 2.5 µl Cut smart buffer (10x) and 0.5 µl EcoRI-HF
enzyme and digested for 1-2 h at 37°C. Samples were subsequently mixed with loading dye
(6X) and applied to a 1% agarose gel (120 V, 400 mA, 100 W, 30 min) and analyzed with the
ChemiDoc MP imager.
To exclude mutations and to verify correct insertion, the entry vectors containing the
respective sgRNA were sent to Sanger sequencing (Eurofins genomics) using a M13+
forward primer.
7) Gateway LR reaction
The entry vector with the sgRNA was then recombined with the entry vector containing the
Cas9 and cloned into the destination vector using LR gateway cloning [137]. For
recombination of single sgRNA constructs see table 10. Table 11 depicts the recombination
for a TGFβ1-3 KO plasmid containing three sgRNAs.
The destination vector contains a puromycin resistance, GFP and the recognition sites for
the sleeping beauty transposon. For the LR reaction 1 µl entry sgRNA vector (10 fmol) was
added with 1 µl entry Cas9 vector (10 fmol) and 1 µl destination vector (20 fmol) to a PCR
tube and filled up to 5 µl with TE buffer. 2 µl LR Clonase II Plus Enzyme Mix (5x) was then
added to each sample and incubated for 24 h at 25°C. After that, the reaction was stopped
by adding 1 µl Proteinase K (10X), incubating for 10 min at 37°C.
8) Transformation in Stbl3 E. coli, plasmid isolation and control digestion
7 µl of the LR reaction tube was used for transformation of Stbl3 E. coli bacteria as described
above (5). Agar plates and liquid LB medium for inoculation contained 100 µg/ml Ampicillin
instead of Kanamycin. Plasmids were isolated as described before (6) and 500 ng of DNA
was digested for control, using 2.5 µl NEBuffer 3.1 and 0.5 µl BamHI at 37°C for 2 h. Samples
were mixed with loading dye (6X) and applied to a 1% Agarose gel (120 V, 400 mA, 100 W,
30 min) and analyzed with the ChemiDoc MP imager.
49
9) Midiprep DNA isolation
Bacteria containing the correct plasmids were inoculated from kryopreserved glycerol
stocks in an Erlenmeyer flask containing 100 ml liquid LB medium with 100 µg/ml
Ampicillin. Flasks were shaken at 37°C overnight with 220 rpm. Plasmids were then isolated
with the PureLink HiPure Plasmid Midiprep Kit adhering to the manufacture’s protocol.
DNA pellet was eluted with 100 µl TE buffer.
Table 10: Plasmids used for LR Gateway cloning for single CRIPSR/Cas9 knockout constructs
sgRNA ENTRY vector Recombined with…
(LR Gateway cloning)
Product
LTBP1
LTBP2
LTBP3
LTBP4
TGFβ2
TGFβ1
pMuLE ENTR U6 stuffer
sgRNA scaffold L1-R5
-pMuLE ENTR CMV-
hCas9 L5-L2
-pMuSE SB eGFP-P2A-
PuroR-DEST R1-R2
pMuSE SB CRISPR/Cas9
sgRNA
(LTBP1/LTBP2/LTBP3/
LTBP4/TGFβ2/ TGFβ1)
Table 11: Plasmids used for LR Gateway cloning for triple CRIPSR/Cas9 knockout construct
sgRNA ENTRY vector Recombined with…
(LR Gateway cloning)
Product
TGFβ1 pMuLE ENTR U6 stuffer
sgRNA scaffold L1-R5
-pMuSE SB eGFP-P2A-
PuroR-DEST R1-R2
-pMuLE ENTR CMV-
hCas9 L3-L2
-pMuSE SB
CRISPR/Cas9 TGFβ1-3
TGFβ2 pMuLE ENTR U6 stuffer
sgRNA scaffold L4-L5
TGFβ3 pMuLE ENTR U6 stuffer
sgRNA scaffold R3-R4
50
2.2.11 Electroporation
For transfection of SGBS cells with CRISPR/Cas9 knockout constructs a Neon
electroporation transfection system (Invitrogen) was used. 10.5 µg of Plasmid DNA per
knockout construct was mixed with 500 ng pCMV(CAT)T7-SB100 and adjusted to a final
volume of 110 µl with R buffer (Neon kit). Neon transfection system was prepared
according to the manufacture’s protocol. SGBS preadipocytes were trypsinized as
described before (see 2.2.1) and 1.1x106 cells were used for one transfection approach,
added into a 1.5 ml microcentrifuge tube and centrifuged for 5 min at 300g. Hereinafter,
the supernatant was discarded and cells resuspended in 110 µl plasmid-buffer solution.
Subsequently, 100 µl of this cell-plasmid-buffer suspension was taken up with a Neon
pipette (Neon kit) and the electroporation was performed according to the manufacture’s
protocol. Cells were electroporated at 1400 V with a pulse of 3x 10 ms. A mock control
containing no plasmid DNA was also subjected to electroporation and later used as a
selection control. After electroporation, cells were placed in a 10 cm dish with 10 ml
antibiotic free growth medium and incubated at 37°C, 5% CO2 (v/v). On the next day
medium was changed to normal growth medium, additionally containing 5 µg/ml
puromycin to start the selection process. When the mock control cells were completely
dead (after 7-10 days), medium was changed to normal growth medium without
puromycin. Cells which underwent selection were then transferred into T175 flasks,
cultivated and prepared for seeding or freezing (see 2.2.1).
2.2.12 Genomic cleavage assay
To control for DNA deletion in target gene regions of CRISPR/Cas9 mediated LTBP knockout
SGBS cells, a genomic cleavage assay was performed using the GeneArtGenomic cleavage
detection kit (Thermo). To address this, the genomic DNA regions which were assumed to
be mutated were amplified, denatured and re-annealed. A specific enzyme detects
mismatches in the re-annealed DNA strands and breaks it. A positive control was done to
verify successful amplification and cleavage. A cleavage exhibits a reduction of parental
DNA and cleaved bands compared to the control (NC), indicating a mutation in this DNA
region. The designed cleavage assay primers are listed in table 7.
51
2.2.13 Generation of SGBS supernatant
To generate FCS free supernatant of SGBS preadipocytes the LTBP knockout cells and
control cells were seeded in 12 well plates as described previously (2.2.1). After 72 h in
growth medium, the medium was aspirated, and cells immediately washed once with
DPBS. Afterwards cells were subjected to 0F medium (1 ml /well) and incubated for further
4 days at 37°C 5% CO2 (v/v) before the supernatant was transferred into microcentrifuge
tubes and stored at –20°C.
2.2.14 TGFβ ELISA
Enzyme linked immunosorbent assays (ELISAs) were used to determine TGFβ1, TGFβ2, and
TGFβ3 content of SGBS supernatants. To measure also bound TGFβ the supernatant
samples were previously heated for 5 min at 80°C to activate TGFβ. ELISAs were then
performed adhering to the manufacture’s protocol.
2.2.15 Statistics
GraphPad Prism 7 software was used for statistical analysis. Students t-test was applied to
compare two groups with a two-tailed calculation and assumption of Gaussian distribution.
When groups were normalized to control an unpaired t-test was used, otherwise a paired
t-test was applied. For more than two time points a two-way ANOVA was applied with
multiple comparison and tukey correction. For correlation analysis linear regression was
applied. A p-value of <0.05 was considered as statistically significant.
52
3. Results
Based on the previously introduced study by Tews et al., we hypothesized that hASCs
respective of the adipose tissue region, secrete different factors which act in an auto- or
paracrine manner, stimulating or inhibiting a differentiation towards a brown adipocyte
phenotype [47]. We identified LTBP1 as a factor higher expressed in hASCs derived from
the dn vs sc, suggesting a role in the adipogenesis towards a brown adipocyte phenotype.
The LTBP protein family has 4 members [104]. Screening the literature revealed that LTBP3
and LTBP1 were also higher expressed in isolated brown hASCs vs white hASCs in another
study [85]. Furthermore, LTBP2 and LTBP3 were differently expressed as well, when
comparing murine ASCs from BAT vs WAT [86]. Therefore, the expression of all four LTBP
members (LTBP1, LTBP2, LTBP3, LTBP4) were characterized during adipogenesis of in vitro
differentiated hASCs from mamma tissue and in SGBS preadipocytes. The SGBS cell strain
is commonly used as an in vitro model for human white preadipocytes [131,143]. These
cells can be easily subjected to adipogenesis and represent an excellent model to study any
effect on the UCP1 expression and metabolic function [79,144,145]. In a next step, we
aimed to establish CRISPR/Cas9 mediated LTBP knockout SGBS preadipocytes to study the
impact of LTBPs on adipogenic differentiation, mitochondrial content, UCP1 expression and
metabolic function.
3.1 The role of LTBPs in adipogenesis and their impact on UCP1 expression in vitro
3.1.1 LTBP1, LTBP3 and LTBP4 are enriched in hASCs from the deep neck adipose tissue
In order to validate the array findings by Tews et al., the cDNA samples of the isolated
hASCs derived from the dn and sc region of human adipose tissue were used to determine
the mRNA expression of LTBPs [47]. Indeed, LTBP1 was 2.5-fold higher expressed in dn vs
sc (Figure 8). LTBP2 was equally expressed between dn- and sc-derived samples. However,
LTBP3 (1.8-fold) and LTBP4 (10-fold) were also significantly higher expressed in hASCs
derived from the dn region compared to sc.
53
Figure 8: Expression of LTBP family members in isolated human adipose stromal cells (hASCs) from subcutaneous (sc) and deep neck (dn) adipose tissue. mRNA expression of all 4 members of the LTBP family was determined by qPCR in isolated hASCs derived from the dn and sc adipose tissue. HPRT served as a reference gene. Mean values +SEM of n=6 from paired patient samples are shown. *p<0.05, paired student’s t-test
3.1.2 LTBP expression is decreased during adipogenic differentiation
To characterize the expression of LTBP isoforms in human WAT samples and in isolated and
in vitro differentiated hASCs of WAT, tissue samples and hASCs were derived and isolated
from mammary adipose tissue of patients who underwent plastic surgery. All LTBPs, except
LTBP4 showed comparable regulation during adipogenesis in hASCs (Figure 9), i.e. high
expression levels in hASCs and decreased levels in mature adipocytes (hASC adip).
Figure 9: Expression of LTBP isoforms in human adipose tissue and in isolated and in in vitro differentiated human adipose stromal cells (hASCs). Samples of human adipose tissue are derived from mamma adipose tissue of n=28 patients which underwent plastic surgery. Mean age±SD = 45±15 years, Mean BMI±SD = 28.2±4.9 kg/m². These samples belong to our in-house biobank. hASCs have been isolated in a previous study from mamma adipose tissue [79]. LTBP mRNA expression in human mamma adipose tissue and in isolated hASCs and in vitro differentiated adipocytes (adip.). Mean values +SEM n=28 (tissue) and n=9 (hASCs), ***p<0.001, ****p<0.0001, two-way ANOVA, multiple comparison.
Interestingly, tissue expression varied between LTBP isoforms compared to hASCs. LTBP1
expression was equally in tissue compared to isolated stromal cells. In contrast, LTBP2
expression was lower compared to hASCs and LTBP3 was significantly higher in adipose
tissue compared to isolated stromal cells. Furthermore, LTBP4 was 100-fold higher
expressed in tissue samples. Of note, the expression levels of isolated mamma ASCs were
54
in line with the levels seen in isolated hASCs derived from supraclavicular sc adipose tissue
(Figure 8).
Primary cells are not suitable for prolonged experiments due to senescence after a few
passages in vitro. Therefore, the human SGBS preadipocyte cell strain was used to
investigate the function of LTBP family members in adipocytes. SGBS cells were subjected
to adipogenic differentiation (Figure 10). Before (d0) and at early stages of differentiation
(d2), the cells have a fibroblast like morphology (Figure 10A). Commencing from d4, the
incorporation of intracellular lipid droplets can be observed, which is steadily increasing
during the time course (d7, d10, d14). After d14, more than 70% of the total cell population
represents mature, lipid laden adipocytes. The expression of adipogenic marker genes was
significantly upregulated, e.g. PPARγ, adiponectin and glucose transporter 4 (GLUT4)
(Figure 10B). Furthermore, UCP1 was abundantly expressed in SGBS cells with increasing
amount during adipogenesis. All LTBP family members were expressed in SGBS cells, with
LTBP4 showing the lowest abundance (Figure 10C). All LTBPs showed similar expression
patterns during adipogenesis, with a rapid increase during early adipogenesis (d0-d2)
followed by a decrease until mature adipocytes were observed (d14). Of note, the LTBP
expression pattern and levels during adipogenesis are similar to that of in vitro
differentiated hASCs (Figure 9), which underlines the SGBS cells as a suitable cell model for
in vitro studies.
55
Figure 10: Expression of differentiation marker and LTBP members in SGBS cells during adipogenesis. SGBS preadipocytes (d0) were subjected to adipogenic differentiation for 14 days. (A) Microscopic picture of SGBS cells on different timepoints during adipogenesis. (B) mRNA expression of the differentiation marker PPARγ, adiponectin, GLUT4 and UCP1 during adipogenic differentiation were measured by qRT-PCR. (C) Expression of LTBP1-4 mRNA on different days during adipogenesis. HPRT served as a reference gene. Mean +SEM n=3; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; two-way ANOVA vs. d0.
56
3.1.3 CRISPR/Cas9 mediated knockout of LTBPs in SGBS cells
To elucidate the role of LTBPs in adipocytes, SGBS preadipocytes deficient for LTBP1, LTBP2,
LTBP3 and LTBP4 were generated using the CRISPR/Cas9 system. SGBS cells were
transfected in the preadipocyte state with the final vectors containing the Cas9 and the
sgRNA targeting either LTBP1, LTPB2, LTBP3, or LTBP4, and were then subjected to
puromycin selection for 7 days.
SGBS cells can be kept in culture until the 30th generation without affecting the
differentiation rate [131]. However, these cells are not immortalized and have a prolonged
doubling time of 38.4 h [131]. Thus, the generation of single cell clones was considered to
be not possible and bulk cultures were studied instead. Successful knockout of the target
gene was proven by cleavage assay, mRNA expression and Western blot. Each LTBP
knockout strain showed a reduction in DNA product of the target gene region compared to
the NC and a cleaved band smaller in size (Figure 11A). Furthermore, a significant decrease
in mRNA expression of LTBPs compared to empty vector control (EV) was observed in each
knockout bulk culture of SGBS preadipocytes (Figure 11B) and in mature adipocytes after
14 days of adipogenesis (Figure 11C). A stable downregulation of at least 80% was
measured in pre- and adipocytes. Deficiency of LTBP1 and LTBP2 was also confirmed by
Western blot, where protein in knockout cells was almost diminished compared to EV
control (Figure 11D and E). LTBP3 and LTBP4 antibodies were tested for Western blot but
both LTBPs could not be detected properly.
57
Figure 11: Transfection with CRISPR/Cas9 knockout constructs leads to stable downregulation of LTBPs in SGBS cells After stable transfection of SGBS preadipocytes with LTBP CRIPSR/Cas9 constructs, the cells were controlled for specific LTBP knockout. (A) Agarose gel of DNA products after GeneArt genomic cleavage assay to detect DNA mutations. PS = positive control; NC = negative control, Cleav. = Cleaved DNA. (B) LTBP mRNA expression of the respective knockout and empty vector control (EV) SGBS preadipocyte strain and (C) in adipocytes. Mean +SEM, n=4-5, ****p<0.0001, student’s t-test. (D) Western blot analysis of EV and LTBP1 knockout cells with α-Tubulin as loading control. (E) Western blot in EV and LTBP2 knockout cells with α-Tubulin as loading control.
58
3.1.4 LTBP deficiency does not alter the adipogenesis and mitochondrial content in
SGBS cells.
LTBPs are crucial for TGFβ secretion into the extracellular matrix [109]. TGFβ is known to
play a role in the regulation of adipogenic differentiation [36,96,98,99]. Furthermore, LTBPs
themselves can modulate the extracellular matrix composition which is known to have
influence on the adipogenesis as well [104,146].
Deficiency of LTBPs in SGBS cells had no effect on the morphology of mature adipocytes,
shown in Figure 12A by microscopic pictures. Moreover, there were no significant changes
in the differentiation rate between knockout strains and EV control (Figure 12B). In line
with this, the triglyceride content (Figure 12C) as well as the fluorescence after staining
with Nile Red, a lipophilic dye incorporating into neutral lipids (Figure 12D), was
comparable to the EV control as well. This was also confirmed by measuring the mRNA
expression of key adipogenic marker genes PPARγ, adiponectin and GLUT4 (Figure 12E),
which were comparable in the different cell strains. The only exception was adiponectin,
which was slightly, but statistically significant increased among LTBP1 knockout compared
to EV control. Browning of WAT is commonly accompanied by an increase in mitochondrial
mass in vivo [13]. mRNA expression of genes involved in mitochondrial metabolism were
not significantly altered between LTBP knockout adipocytes and empty vector (EV) control
(Figure 12F).
To further investigate mitochondrial content, protein expression of genes involved in the
respiratory chain were assessed by Western blot. Again, there were no significant
differences seen in LTBP-deficient SGBS cells, assured by densitometric analysis (Figure
12G, one representative is shown). Determination of citrate synthase (CS) activity serves as
a marker of intact mitochondria and mitochondrial content. CS activity was significantly
reduced by 15% in LTBP2-deficient adipocytes compared to the EV, whereas the other
LTBPs showed no significant alterations (Figure 12H).
59
Figure 12: Reduced LTBP expression has no effect on adipogenic differentiation and mitochondrial content. LTBP-deficient cells were subjected to differentiation until lipid laden adipocytes were observed. Different adipogenic and mitochondrial markers were measured to draw conclusions on the differentiation rate and mitochondrial content. (d14). (A) Microscopic pictures of LTBP knockout adipocytes and empty vector (EV) control with 10-times magnification. (B) Differentiation rate was counted on d14. Fold change compared to EV is shown. (C) Triglyceride content of mature adipocytes, n=3 (D) Nile Red staining of mature adipocytes, fold change of intensity compared to EV, n=4-5. (E) mRNA expression of key adipogenic marker was assessed by qRT-PCR. Fold change compared to EV control is shown. (F) Mitochondrial marker genes on d14 assessed by qRT-PCR. HPRT served as a reference gene and fold change to EV control is shown n=4 (LTBP2, LTBP3, LTBP4) n=5(LTBP1) (G) OXPHOS genes of the respiratory chain were assessed by Western blot. One representative is shown. (H) Citrate synthase activity was measured spectrophotometric by substrate conversion. Fold change to control is shown. Mean +SEM of, *p<0.05, students t-test vs. EV control.
60
3.1.5 Deficiency of LTBP2 and LTBP3 leads to a decrease in browning marker UCP1
The overall aim of this study was to identify potential targets which are involved in the
generation of UCP1-expressing cells. To address this, the mRNA expression of marker genes
known to be higher expressed in brown or beige adipocytes compared to white adipocytes
were determined.
Figure 13: LTBP2 and LTBP3 deficiency leads to a decreased UCP1 expression After 14 day of adipogenesis different adipocyte marker genes were analyzed. (A) mRNA expression of markers known to be upregulated in brow adipocytes versus white adipocytes. HPRT serves as a reference gene and fold change to EV control is shown n=4 (LTBP2, LTBP3, LTBP4) n=5(LTBP1). (B) Representative Western blot is shown and densitometric analysis was performed in n=3-5 independent experiments, GAPDH serves as a loading control. Fold change to EV is shown n=3 (LTBP3) n=4 (LTBP2, LTBP4) n=5(LTBP1). Mean +SEM, *p<0.05, ***p<0.001, ****p<0.001 students t-test vs. EV control.
The UCP1 expression was checked on mRNA and protein level, since browning is defined
by a significant upregulation of UCP1 [26]. A significant reduction of UCP1 was observed in
LTBP2-deficient cells (35%) and a 37% reduction in LTBP3-deficient SGBS adipocytes
compared to EV (Figure 13A). Brown marker genes type II iodothyronine deiodinase (DIO2)
and the transcription coregulator PR domain containing 16 (PRDM16) were not altered
compared to control cells (EV) (Figure 13A). However, PGC1α expression was 1.3-fold
61
upregulated in LTBP3-deficient SGBS adipocytes compared to EV cells. In line with the
mRNA expression, LTBP3 deficiency led also to downregulation of UCP1 protein expression
assessed by Western blot and densitometric analysis (Figure 13B). Of note, UCP1 protein
was reduced by 45% compared to EV control. PPARγ protein expression was equal
indicating no changes in differentiation. On the contrary to LTBP3 deficiency, the UCP1
protein expression was not altered in LTBP2-deficient cells compared to the EV cells.
3.1.6 LTBP deficiency leads to metabolic alterations in SGBS adipocytes
To address if the changes in UCP1 expression influence the metabolic function in LTBP-
deficient cells, the oxygen consumption rate (OCR) was measured with an extracellular flux
analyzer (seahorse). A schematic graph of a seahorse plot and how different values are
calculated is depicted in figure 14.
To mimic beta-adrenergic stimulation cells were treated with cAMP during the
measurement. cAMP induces lipolysis in the cells and the resulting free fatty acids activate
UCP1 which then should result in a higher oligomycin-insensitive OCR. Through this, one
can draw conclusions on the activity of UCP1. Indeed, there was a decrease in OCR after
stimulation with cAMP in LTBP2- and LTBP3-deficient cells compared to the control (Figure
15B and C). Basal respiration after cAMP injection was 22% lower in LTBP2- and 18% lower
in LTBP3-deficient cells. In addition, the response of the cellular respiration to cAMP
stimulation was reduced by 43% in LTBP2- and 44% reduced in LTBP3-deficient adipocytes.
This is in line with the UCP1 mRNA expression of LTBP2- and LTBP3-deficient adipocytes.
Interestingly, LTBP1 deficiency resulted in a significant increase in OCR after cAMP
stimulation (Figure 15A). Basal respiration before (1.2-fold) and after cAMP injection (1.2-
fold) was significantly increased. However, there were no significant changes in UCP1
mRNA and protein expression or on the mitochondrial content in LTBP1-deficient cells.
Diminishing LTBP4 had no effect on the OCR in SGBS adipocytes (Figure 15D).
To address changes in ATP production and proton leak of LTBP-deficient cells compared to
EV, cells were treated with oligomycin (Oligo) which inhibits the ATP synthase. The
corresponding OCR values of LTBP3-deficient cells after oligomycin treatment were
significantly lower, indicating a significantly lower ATP production (11%) (Figure 15C). In
contrast, ATP production was 1.4-fold higher in LTBP1-deficient cells compared to EV cells
62
(Figure 15A). Moreover, FCCP treatment led to complete uncoupling of the proton motive
force and resulted in maximum respiration (Max. resp.). Only LTBP1-deficient cells showed
alterations upon FCCP treatment. The OCR was 1.1-fold higher compared to control
adipocytes, suggesting an increased mitochondrial content in these cells (Figure 15A),
which could not be confirmed by the gene expression data (Figure 13).
Summarizing these data, the deficiency of LTBP2 and LTBP3 exhibits a significant decrease
of UCP1 expression. Furthermore, metabolic function was changed inter alia by a lower
response to cAMP, supporting the gene expression data.
Figure 14: Schematic view of a seahorse plot. An example of the oxygen consumption rate (OCR) over time is shown in red. Through induction of lipolysis with dibutyryl-cyclic adenosine monophosphate (cAMP), inhibition of ATP synthase with oligomycin, full uncoupling of the proton motive force by carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP), and inhibition of the respiratory chain by antimycin A and rotenone, the non-mitochondrial oxygen consumption, basal respiration (resp.), cAMP response, ATP production, proton leak, and maximum respiration (Max. resp.) can be calculated. Colored boxes represent these values and demonstrate how these are calculated.
63
Figure 15: LTBP deficiency alters the metabolic function of SGBS adipocytes CRISPR/Cas9 mediated LTBP-deficient SGBS cells were subjected to adipogenesis. On day 14 of differentiation the oxygen consumption rate (OCR) was measured with an extracellular flux analyzer and normalized with Nile Red to the amount of lipid content. (A) LTBP1 KO, (B) LTBP2 KO (C), LTBP3 KO, (D) LTBP4. To calculate basal and maximum respiration, as well as ATP production, proton leak and cAMP response, cells were treated with dibutyryl-cyclic adenosine monophosphate (cAMP), oligomycin (Oligo), carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycin/rotenone (Ant/Rot). Mean +SEM of n=4 (LTBP2, LTBP3, LTBP4) and n=5 (LTBP1) is shown. **p<0.01, ***p<0.001, students t-test vs. EV control.
64
3.1.7 LTBP3 correlates positive with UCP1 expression in human subcutaneous adipose
tissue
The in vitro data suggests a role for LTBP2 and LTBP3 in the regulation of brown marker
gene UCP1. To elucidate any connection of LTBPs to adipocyte browning in human WAT,
the UCP1 and LTBP expression was examined in human sc mamma adipose tissue of n=28
patients (age=45±15 years, BMI=28.2±4.9 kg/m²), which underwent plastic surgery. There
was no correlation of LTBP1, LTBP2 and LTBP4 mRNA expression with UCP1 (Figure 16).
However, a significant positive correlation for LTBP3 and UCP1 mRNA expression was
observed in human WAT (p=0.0382), using a linear regression.
Figure 16: LTBP3 correlates significant positive with UCP1 mRNA expression in human subcutaneous
adipose tissue. mRNA expression of LTBPs and UCP1 was determined in human sc adipose tissue samples
derived from mamma tissue of n=28 patients which underwent plastic surgery. LTBP mRNA expression was plotted against UCP1 mRNA expression and a linear regression was applied. Adipose tissue samples belong to our in-house biobank. Mean age±SD = 45±15 years, Mean BMI±SD = 28.2±4.9 kg/m². P<0.05 is considered as statistically significant.
65
3.2 The role of TGFβ in SGBS adipogenesis
The absence of LTBP2 and LTBP3 in SGBS adipocytes resulted in alterations in UCP1
expression and metabolic function, but the mechanism remained to be investigated. To
examine whether the observed effects of LTBP deficiency are dependent on TGFβ signaling,
it was investigated if the TGFβ ligands TGFβ1, TGFβ2 and TGFβ3 are co-expressed with
LTBPs and whether the TGFβ receptors are present in SGBS pre- and adipocytes.
3.2.1 TGFβ2 and TGFβR3 are co-expressed with LTBPs during adipogenesis of SGBS cells
The TGFβ isoforms are differentially regulated upon adipogenesis in SGBS cells
(Figure 16A). TGFβ1 is the most abundant ligand and downregulated during adipogenesis.
Interestingly, comparison of the expression data to that of the LTBPs during adipogenesis,
revealed an overlapping expression pattern only for TGFβ2 with a peak on day 4 of
adipogenesis (Figure 17A and 10C). In contrast, TGFβ3 expression was low in preadipocytes
with a steady increase until day 14. Tracing the receptor expression during the time course
of adipogenic differentiation revealed different regulation patterns in between the
receptor isoforms (Figure 17B). TGFβR1 expression was stable during the whole
adipogenesis, whereas the expression of TGFβR2 reached a peak on day two of
differentiation and decreased during adipogenesis until d14. Of note, TGFβR3, which is
exclusively involved in TGFβ2 signaling, was highly expressed on the first days of
adipogenesis, with similar expression to TGFβ2 and the LTBPs (Figure 17 and 10C).
Additionally, the expression of TGFβ ligands and their receptors was examined in hASCs
derived from the dn and sc adipose tissue (Figure 18). Of note, expression of ligands as well
as of receptors was not significantly altered comparing dn vs sc samples as it was seen
before with LTBP1, LTBP3, and LTBP4 (Figure 18 and Figure 8). In SGBS cells as well as in
primary cells, TGFβ1 is the highest expressed ligand (Figure 18). In contrast, TGFβ2 and
TGFβ3 were less expressed. TGFβ receptors were abundantly expressed in isolated hASCs.
In line with the data from SGBS cells, all three receptors and ligands are expressed in hASCs
to a similar extent as compared to SGBS preadipocytes (Figure 17 and 18).
66
Figure 17: TGFβ ligands and TGFβ receptors are expressed during adipogenesis of SGBS cells. SGBS preadipocytes (d0) were subjected to adipogenesis for 14 days until lipid laden adipocytes were observed (d14). (A) mRNA expression of TGFβ ligands and (B) TGFβ receptors (TGFβR) during adipogenic differentiation measured by qRT-PCR. Mean +SEM n=3; *p<0.05; **p<0.01;****p<0.0001; ANOVA vs. d0
Figure 18: TGFβ ligand and receptor expression of isolated hASCs from dn and sc adipose tissue Expression of TGFβ ligands and receptors was investigated in the samples which were previously isolated and used in the study by Tews et al.[47] (A) mRNA expression of TGFβ ligands and (B) TGFβ receptors (TGFβR) in isolated hASCs derived from dn and sc adipose tissue. Mean values +SEM of n=7 paired patient samples are shown.
It was reported that LTBP3 is able to bind all three TGFβ ligands and it was shown in several
studies that these ligands and their mediated pathway influences browning [88,96,102].
Since LTBP3 deficiency led to a decrease in UCP1 expression and all three ligands are
expressed in SGBS preadipocytes, we were interested whether the inhibition of the TGFβ
pathway results in a similar UCP1 expression compared to the LTBP3-deficient adipocytes.
Therefore, in a first step a knockout of TGFβ1, TGFβ2, and TGFβ3 at the same time was
generated in SGBS preadipocytes.
67
3.2.2 TGFβ1-3 deficiency leads to a decrease of UCP1 in SGBS adipocytes
After transfection of SGBS preadipocytes with the triple knockout construct, stable bulk
cultures were generated by puromycin selection. TGFβ mRNA was reduced by more than
75% in pre- and more than 60% in adipocytes (Figure 19A and B). Protein expression of
TGFβ1-3 was almost diminished in SGBS bulk cultures (Figure 19C). Inhibition of TGFβ
ligands by blocking antibodies or the knockout of a TGFβ pathway in vivo resulted in
browning of WAT [96,97,102]. Therefore, the expression of brown marker genes and the
metabolic function in EV control and TGFβ1-3-deficient SGBS adipocytes was examined in
this approach.
Figure 19: Transfection with CRISPR/Cas9 triple knockout construct leads to stable downregulation of TGFβ ligands in SGBS cells during adipogenesis. After stable transfection of SGBS preadipocytes with CRIPSR/Cas9 TGFβ1-3 knockout construct, the cells were controlled for TGFβ ligand specific knockout. (A) mRNA expression of TGFβ ligands in triple knockout and EV SGBS preadipocytes (B) and in adipocytes. Mean +SEM, fold change with n=4, ***p<0.001, ****p<0.0001, student’s t-test. (C) Representative Western blot of n=3 independent experiments with GAPDH as loading control. Mean +SEM, fold change, **p<0.01, ****p<0.0001, student’s t-test vs EV.
Microscopic pictures revealed no morphological changes of TGFβ1-3-deficient adipocytes
compared to EV (Figure 20A). Furthermore, counted differentiation rate (Figure 20B) and
lipid staining with Nile Red (Figure 20C) exhibited no differences as well. In line, the mRNA
expression of differentiation marker also showed no alterations between EV and TGFβ1-3-
deficient adipocytes (Figure 20D). In addition, mRNA expression of markers associated with
mitochondrial metabolism were not altered between EV control and TGFβ-deficient
adipocytes (Figure 20E). In line, there was no alteration of OXPHOS proteins upon TGFβ
deficiency as shown by Western blot analysis (Figure 20F). The activity of CS was
comparable between EV cells and TGFβ1-3 KO adipocytes (Figure 20G).
68
Figure 20: No alterations on adipogenic differentiation and mitochondrial content after CRISPR/Cas9 mediated TGFβ1-3 knockout: TGFβ1-3 deficiency was achieved by CRISPR/Cas9 in SGBS preadipocytes, which were subjected to adipogenic differentiation for 14 days. (A) Microscopic pictures of EV and TGFβ1-3-deficient SGBS adipocytes, 10-fold magnification. (B) Counted differentiation rate of mature adipocytes. (C) Lipids of mature adipocytes were stained with Nile Red and fluorescent intensity was measured at 550 nm excitation; fold change is shown. (D) mRNA expression of differentiation marker PPARG, Glut4 and Adiponectin. (E) Mitochondrial marker genes on d14 assessed by qRT-PCR. HPRT served as a reference gene. (F) Oxphos genes of the respiratory chain were assessed by Western blot. One representative is shown of 4 independent experiments. GAPDH served as loading control. (G) Citrate synthase activity was enzymatically determined. Mean +SEM, n=4.
Of note, investigation of UCP1 mRNA and protein levels revealed a decrease in expression
of 50% in SGBS adipocytes with TGFβ1-3 deficiency (Figure 21A and C). PGC1α is known to
be a marker for brown adipogenesis and proposed to be influenced by TGFβ signaling
[41,97] but its mRNA expression was not significantly altered between transfected SGBS
strains (Figure 21B). Furthermore, the oxygen consumption rate was determined with
injection of cAMP to induce lipolysis in EV and TGFβ1-3-deficient adipocytes (Figure 21D).
In contrast to my expectation, no significant alterations were observed, even after cAMP
69
injection. Calculation of cAMP response, proton leak or ATP production revealed
comparable results between EV and TGFβ1-3-deficient cells. Why differences in UCP1
expression did not lead to alterations in metabolic function is not clear at this point and
remains to be resolved.
Figure 21: Decreased UCP1 expression in TGFβ1-3 deficient SGBS adipocytes. After 14 day of adipogenesis PGC1α and UCP1 expression were determined in EV control and TGFβ1-3 KO SGBS cells and the oxygen consumption rate (OCR) was measured with an extracellular flux analyzer and normalized with Nile Red to the amount of lipid content. (A) mRNA expression of uncoupling protein 1 (UCP1) and (B) PGC1α. HPRT serves as a reference gene. (C) Representative Western blot is shown and densitometric analysis was performed in n=4 independent experiments, GAPDH serves as a loading control. (D) OCR plot over time. To calculate basal and maximum respiration, as well as ATP production, proton leak and cAMP response, cells were treated with dibutyryl-cAMP (cAMP), oligomycin (Oligo), carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycin/rotenone (Ant/Rot). Mean +SEM of n=4, *p<0.05, **p<0.01, student’s t-test
70
3.2.3 Inhibition of TGFβ receptor 1 kinase leads to a decrease in UCP1 expression
Active TGFβ ligands act on the cells through receptor activation. Binding to phosphorylated
TGFβR2 on the cell surface enables the recruitment and transphosphorylation of TGFβR1
[91]. Thereupon activated TGFβR1 phosphorylates SMAD2/3 intracellularly, leading to
changes in gene expression. In this approach, TGFβ signaling is blocked during SGBS
adipogenesis with the compound SB 431542 (SB). SB inhibits TGFβR1 kinase activity
thereby preventing SMAD2/3 phosphorylation. At first, the optimal inhibitor concentration
was titrated by adding 0.5 ng/ml recombinant TGFβ1 (rTGFβ1) to SB treated SGBS
preadipocytes followed by measurement of SMAD2/3 phosphorylation (Figure 22A). A
concentration of 10 µM SB inhibited SMAD3 phosphorylation to a basal level and was
chosen for SGBS treatment on day 0 and day 4 of adipogenesis. Microscopic pictures of
mature adipocytes on day 14 revealed differences in the morphological appearance upon
SB treatment. Cells treated with TGFβR1 inhibitor were smaller in size and appeared more
rounded compared to vehicle control (Figure 22B), but this did not influence the counted
differentiation rate which was equal (Figure 22C). However, analyzing expression of
differentiation marker genes in SGBS adipocytes revealed significant changes in mRNA
expression after TGFβR1 inhibition (Figure 22D and E). PPARγ was 1.55-fold upregulated
and adiponectin was 2.2-fold higher. Interestingly, the mRNA expression of browning
marker UCP1 was decreased by 77% in SB treated adipocytes (Figure 22F) which could be
observed on the protein level as well. UCP1 was 78% lower in adipocytes treated with the
inhibitor (Figure 22G). In line with the mRNA data, PPARγ protein level was also higher
compared to vehicle control. These findings are in line with the results seen in TGFβ-
deficient SGBS cells, showing that the inhibition of the TGFβ-pathway in SGBS cells leads to
a repression of UCP1 expression.
71
Figure 22: Inhibition of TGFβ receptor1 kinase leads to significant alterations in differentiation marker and UCP1 expression. (A) Phosphorylation of SMAD2/3 in SGBS preadipocytes after treatment with different concentrations of SB followed by stimulation with or without recombinant TGFβ1 (rTGFβ1). α-Tubulin and unphosphorylated SMAD3 served as loading control. (B) SGBS wild type preadipocytes were subjected to differentiation and treated either with DMSO as a vehicle control or with 10 µM of the inhibitor SB 431542 (SB) on day 0 and day 4 of adipogenesis. Microscopic picture of SGBS adipocytes are shown with 4-fold magnification. (C) Counted differentiation rate. (D) mRNA expression of differentiation marker adiponectin, (E) PPARγ, and (F) browning marker UCP1 in mature adipocytes. HPRT served as a reference gene. (G) Representative blot of UCP1 and PPARγ protein expression. Densitometric analysis for UCP1 was done in three independent experiments. α-Tubulin served a loading control. Mean+SEM of n=3, **p<0.01, ****p<0.0001, student’s t-test
3.2.4 SMAD4 downregulation decreases UCP1 expression in SGBS adipocytes
To provide prove that TGFβ-signaling regulates UCP1 expression, the pathway at the level
of intracellular signaling was inhibited and a siRNA-mediated knockdown of SMAD4 was
performed. SGBS preadipocytes were transfected with a siRNA targeting SMAD4 (siSMAD4)
or a non-targeting control (NTC). A knockdown of SMAD4 by 62% was achieved after 48h
(Figure 23A) and cells were subjected to adipogenic differentiation.
72
Figure 23: Decrease of UCP1 expression and oxygen consumption rate upon SMAD4 knockdown. SGBS preadipocytes were transfected with siRNA targeting SMAD4 (siSMAD4) and a non-targeting siRNA control (NTC). After 48h cells were subjected to adipogenesis for 14 days and mature adipocytes were analyzed for UCP1 expression and the oxygen consumption was measured with an extracellular flux analyzer. (A) SMAD4 mRNA expression in siRNA transfected SGBS preadipocytes after 48h of transfection. HPRT served as a reference gene. (B) Microscopic pictures of mature adipocytes with 10-fold magnification. (C) Counted differentiation rate of siRNA transfected adipocytes. (D) mRNA of adipogenic differentiation marker PPARγ, GLUT4, adiponectin, and (E) browning marker UCP1. HPRT served as a reference gene. Mean+SEM for n=4 (F) Representative Western blot and densitometric analysis of UCP1 of n=3 independent experiments. GAPDH served as a loading control and PPARγ as differentiation marker. Mean+SEM for n=3. (G) Oxygen consumption rate (OCR) over time, which was normalized with Nile Red to the amount of lipid content. To calculate basal and maximum respiration, as well as ATP production, proton leak and cAMP response, cells were treated with dibutyryl-cAMP (cAMP), oligomycin (oligo), carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycin/rotenone (AA/Rot). Dotted lines indicate treatment intervals. Mean +SEM of n=3. *p<0.05, **p<0.01, student’s t-test
There was no difference in cellular morphology (Figure 23B) and the rate of adipogenic
differentiation (Figure 23C), as well as mRNA expression of differentiation marker PPARγ,
GLUT4 and Adiponectin (Figure 23D) was comparable between SMAD4 knockdown and
controls. Interestingly, UCP1 mRNA expression and protein expression were significantly
reduced upon SMAD4 knockdown. A reduction of 93% UCP1 mRNA expression was
73
observed and 72% less protein after densitometric analysis of Western blot
(Figure 23E and F). Moreover, knockdown of SMAD4 resulted in a decrease of cellular
oxygen consumption measured with an extracellular flux analyzer (Figure 23G). ATP
production (25%) and response to cAMP injection (46%) was significantly decreased in
SMAD4 downregulated SGBS adipocytes.
3.3 TGFβ2 is reduced in LTBP2- and LTBP3-deficient cells
To implement whether LTBP deficiency leads to a lower TGFβ secretion, the supernatant of
the LTBP-deficient preadipocytes was analyzed for TGFβ content with ELISAs (Figure 24).
No significant alterations of TGFβ1 content in SGBS supernatant could be detected and
TGFβ3 was below the reliable detection limit. However, TGFβ2 was significantly decreased
(28%) in supernatant of LTBP3-deficient SGBS preadipocytes (Figure 24 B). Unexpectedly
this was also true for LTBP2-deficient cells (29%). As already mentioned previously, it was
reported that LTBP2 is not able to bind any TGFβ [104].
Figure 24: LTBP2 and LTBP3 deficiency alters the TGFβ2 content in SGBS preadipocyte supernatant TGFβ content in supernatant of LTBP deficient SGBS preadipocytes and empty vector control (EV) was measured with an enzyme-linked immunosorbent assay. (A) TGFβ1 content(pg/ml) and (B) TGFβ2 content (pg/ml). TGFβ3 was below the reliable detection limit. Mean+SEM for n=3, *p<0.05 vs EV, student’s t-test
3.4 TGFβ2 deficiency leads to alterations in UCP1 and metabolic function
Both, LTBP2- and LTBP3-deficient cells showed a similar reduction of TGFβ2 content in the
supernatant. Furthermore, both had a decreased UCP1 expression and a significant
reduced response to cAMP. It has been reported earlier that in contrast to TGFβ1 and
TGFβ3, administration of recombinant TGFβ2 increased UCP1 expression in murine brown
adipose tissue in vivo and in immortalized brown adipocytes in vitro [88].
74
Figure 25: TGFβ2 deficiency leads to a higher differentiation rate TGFβ2 deficiency was achieved by CRISPR/Cas9 in SGBS preadipocytes, which were subjected to adipogenic differentiation for 14 days. (A) mRNA expression of TGFβ2 in knockout and empty vector (EV) SGBS preadipocytes (B) and in adipocytes. (C) Representative Western blot of n=4 independent experiments with GAPDH as loading control. (D) Microscopic pictures of EV and TGFβ2-deficient SGBS adipocytes, 10-fold magnification. (E) Counted differentiation rate and (F) triglyceride content of mature adipocytes. (G) mRNA expression of differentiation marker PPARG, Glut4 and Adiponectin. Mean +SEM with n=4, **p<0.01, student’s t-test.
To study the role of TGFβ2 in this context in more detail, CRISPR/Cas9 mediated TGFβ2-
deficient SGBS cells were generated. After stable transfection and puromycin selection,
TGFβ2 mRNA expression was significantly decreased in SGBS pre- (67%) and adipocytes
(70%) compared to EV control (Figure25A and B). In addition, TGFβ2 protein was
significantly reduced in SGBS preadipocytes (Figure 25C). After 14 days of differentiation
microscopic pictures and counted differentiation rate of mature adipocytes revealed
(Figure 25D) a significant higher differentiation for TGFβ2-deficient adipocytes (Figure 24E).
However, no significant differences were observed measuring triglyceride content and
mRNA expression of differentiation marker (Figure 25F and G).
75
Figure 26: TGFβ2 deficiency leads to a reduction of UCP1 and a decreased response to cAMP. After 14 days of adipogenesis UCP1 expression was determined in EV control and TGFβ2-deficient SGBS cells and the oxygen consumption rate (OCR) was measured with an extracellular flux analyzer and normalized with Janus Green. (A) mRNA expression of UCP1 was determined by q-RT-PCR. HPRT serves as a reference gene (B) Representative Western blot is shown and densitometric analysis was performed in n=4 independent experiments, GAPDH serves as a loading control. (C) OCR over time of n=3 individual experiments. To calculate basal and maximum respiration, as well as ATP production, proton leak and cAMP response, cells were treated with dibutyryl-cAMP (cAMP), oligomycin (Oligo), carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycin/rotenone (Ant/Rot). Mean +SEM of n=4, *p<0.05, student’s t-test.
Despite a higher differentiation rate of TGFβ2-deficient cells, the UCP1 expression was
decreased compared to EV control. mRNA expression was altered but did not reach
statistical significance (p=0.053) (Figure 26A). However, protein expression was
significantly reduced by 35% in TGFβ2-deficient SGBS adipocytes (Figure 26B). In line with
that, the response to cAMP and the basal respiration after cAMP induction was significantly
reduced (Figure 26D). Moreover, the maximum respiration obtained after FCCP
administration was reduced as well in TGFβ2-deficient cells compared to EV control. TGFβ1
deficiency did not alter UCP1 expression or metabolic function in SGBS cells (Appendix
Figure S4).
76
3.5 TGFβ2 correlates significantly positive with LTBP3 and UCP1 expression in human
subcutaneous adipose tissue
To elucidate if the impact of LTBP3 on the regulation of UCP1 mediated by TGFβ2
bioavailability and signaling may also play a role in human WAT, the correlation of LTBP3
expression with the TGFβ ligands and receptors in human sc WAT was examined. LTBP3
correlated positively with TGFβ2 (R²=0.2291, p=0.01) but not with TGFβ1 or TGFβ3 mRNA
expression (Figure 27A). In addition, none of the other LTBPs which bind TGFβ correlated
with any ligand (Appendix, Table S2). Moreover, there was a statistically significant positive
correlation of LTBP3 with all three receptor isoforms with R²=0.4641 for TGFβR1
(p<0.0001), R²=0.326 for TGFβR2 (p=0.0015) and R²=0.5053 for TGFβR3 (p<0.0001) (Figure
27B). Of note, TGFβ2 mRNA expression correlated significantly positive with UCP1 with
R2 = 0.8735 (p<0.0001) (Figure 27C).
Figure 27: TGFβ2 mRNA expression correlates positive with UCP1 in human subcutaneous adipose tissue samples. mRNA expression of LTBP3, UCP1, TGFβ ligands and receptors was determined in human sc adipose tissue samples derived from mamma tissue of n=28 patients which underwent plastic surgery. (A) Correlation of LTBP3 mRNA expression to TGFβ ligand and (B) to TGFβ receptor (TGFβR) expression. (C) Correlation of TGFβ mRNA expression and UCP1 mRNA expression. Adipose tissue samples belong to our in-house biobank. Mean age±SD = 45±15 years, Mean BMI±SD = 28.2±4.9 kg/m². p<0.05 is considered as statistically significant.
77
4. Discussion
Browning of white adipose tissue in vivo and activating brown adipose tissue in humans is
associated with weight loss and an overall better metabolic health [17,29,32]. The switch
from a white to a brown adipocyte phenotype by inhibiting or stimulating targets involved
in this process, is a new approach for the treatment of obesity and its related metabolic
disorders [16,25,60,61]. How and why ASCs within the adipose tissue differentiate either
into brown/beige or white adipocytes has not yet been resolved completely. Therefore, it
is important to identify new factors which are involved in this process. Furthermore, these
factors could potentially represent future targets for the treatment of obesity.
Our group has shown that in vitro differentiated adipocytes derived from isolated ASCs
from human dn highly express brown marker genes compared to the adipocytes derived
from ASCs isolated from the sc adipose tissue [47]. Furthermore, Tews et al. have
demonstrated that the gene expression of these ASCs is differently regulated dependent
on the adipose tissue’s origin [47]. Through ranking of these differentially regulated genes
and literature comparison, the LTBP family was identified as potential factors involved in
the regulation of brown marker gene UCP1 [85]. Since there is nothing known to date about
the role of LTBPs in the context of adipose tissue browning, the aim of this thesis was to
study the role of LTBP members in adipogenesis and investigate their impact on the UCP1
expression and on the metabolic function in vitro.
4.1 LTBP2 and LTBP3 deficiency leads to a decrease of UCP1 expression in SGBS cells
Nothing has been described so far about the role of LTBPs in adipose tissue. It was reported
that LTBPs are highly expressed in mesenchymal stem cells from adipose tissue but their
role in the adipogenesis towards a white or brown adipocyte phenotype has not been
addressed so far [108]. LTBP1 was 2-fold higher in dn hASCs compared to sc in the
microarray analysis by Tews et al. [47]. This was verified in this study, with a statistically
significant difference of LTBP1 in dn hASCs compared to sc. In addition, investigation of the
LTBP3 and LTBP4 expression exhibited a significant higher level in dn hASCs.
The human SGBS cell strain served as a model to study the impact of LTBPs on UCP1
regulation and on the metabolic function in vitro. Therefore, it was a prerequisite, that all
78
four LTBP member are expressed during adipogenesis. Importantly, expression levels of
LTBPs in human SGBS pre- and adipocytes were comparable to isolated and in vitro
differentiated hASCs. Based on this, the SGBS cells were considered as a suitable model for
the in vitro studies. The high expression of LTBPs in adipose tissue samples and the
regulation during adipogenesis in in vitro differentiated human primary cells and SGBS cells
suggests that LTBPs may play an import role in the regulation of adipogenesis, especially in
the first days of differentiation. Furthermore, the higher expression of LTBP1, LTBP3, and
LTBP4 in hASCs of the dn compared to sc may indicate a role for these isoforms in the
adipogenesis towards a brown adipocyte phenotype.
In this study LTBP-deficient SGBS preadipocytes were introduced to examine possible
effects on adipogenic differentiation, brown marker genes or metabolic function. Indeed,
changes in UCP1 expression and metabolic function were observed in LTBP2- and LTBP3-
deficient SGBS adipocytes, whereas the adipogenic differentiation was not affected.
Deficiency of LTBP1 in SGBS cells showed no consistent results on expression of UCP1 and
on a functional level. If LTBP1 was involved in generating a brown adipocyte phenotype,
one might have expected a decrease in UCP1 after LTBP1 deficiency in SGBS cells, based on
its higher expression in dn hASCs compared to sc. However, no significant changes were
observed in UCP1 expression in LTBP1-deficient SGBS adipocytes. Furthermore, functional
analysis revealed even a higher OCR after cAMP induction and a higher maximum
respiration. Small changes in a higher differentiation rate in LTBP1-deficient cells may be
the reason, indicated by a significant higher adiponectin expression. However, this was not
supported by the differentiation rate, or triglyceride content. Interestingly, the knockout
of LTBP1 in vivo is lethal, due to reduced TGFβ bioavailability and the phenotype was
overlapping with the TGFβ1 knockout mouse [104]. LTBP1 is known to bind all three TGFβ
isoforms, but measurement of secreted TGFβ in SGBS preadipocytes revealed no significant
differences between control and LTBP1-deficient cells. This either indicates that LTBP1 is
not important for TGFβ secretion in SGBS preadipocytes or LTBP3 and LTBP4 are
compensating for the loss of LTBP1. It seems that LTBP1 may have other roles in hASCs than
promoting a brown adipocyte phenotype. LTBP1 was shown to be a regulator of TGFβ in
late development, in the mineralization and maturation phase of osteogenic differentiation
in vitro, whereas LTBP3 played a role in early commitment [104]. This may indicate that
LTBP1 also does not play an important role in early adipogenesis.
79
In summary, LTBP1 deficiency did not alter UCP1 expression and the results did not support
a role for LTBP1 in stimulating an adipogenesis towards a brown adipocyte phenotype.
LTBP4 can only bind TGFβ1 but with low affinity [104,110]. LTBP4 deficiency did not
influence the TGFβ1 secretion in vitro, indicating a nonessential role in this context. LTBP4
seems to play a subordinary role in SGBS cells, as it was little expressed in preadipocytes as
well as in adipocytes and the deficiency had no effect on differentiation rate or UCP1
expression. Interestingly, LTBP4 expression was 100-fold higher in human WAT samples
compared to isolated preadipocytes, which indicates that LTBP4 is highly expressed by
other cell types like macrophages, fibroblasts or endothelial cells in the adipose tissue.
LTBP2 was equally expressed in hASCs of dn and sc adipose tissue. However, deficiency of
LTBP2 in SGBS cells led to an inhibition of UCP1 expression and function. In contrast, protein
expression showed no differences. LTBP2 is the only LTBP isoform which does not bind any
TGFβ ligand and was described to be highly expressed in elastic tissues [104,110].
Unexpectedly, LTBP2 deficiency revealed a reduction of secreted TGFβ2. As well as other
LTBPs, LTBP2 is secreted and associates with the extracellular matrix. It interacts with
fibrillin-1 in the ECM and shares the same binding site of fibrillin-1 as LTBP1 [121,122]. Both
are competing with comparable affinity for fibrillin-1 binding. Thus, it is suggested that
LTBP2 can indirectly regulate the activation of TGFβ by preventing LTBP1 matrix
incorporation [104]. If these properties led to the lower TGFβ2 levels in LTBP2-deficient
SGBS preadipocytes remains unclear.
This study for the first time demonstrates that the LTBP2-deficiency has a significant impact
on the UCP1 expression and metabolic function in SGBS cells. A possible mechanism is via
TGFβ2 bioavailability, which is discussed later (see 4.3). Another mechanism could be the
inhibition of BMP11 and myostatin [123,124]. LTBP2 was shown to inhibit proprotein
convertase 5/6A (PC5/6) by binding to it. PC5/6 cleaves pro-BMP11 into the mature BMP11.
Furthermore, LTBP2 can also bind to pro-myostatin, thereby inhibiting its secretion. Both,
myostatin and BMP11 have been shown to inhibit UCP1 expression in vitro and in vivo
[36,147].
Our hypothesis is that secreted factors act in an auto- or paracrine manner on hASCs,
stimulating or repressing an adipogenesis towards a brown adipocyte phenotype. The
significantly higher expression of LTBP3 in the dn hASCs compared to sc supports this thesis
80
and suggests a role for LTBP3 in generating a brown adipocyte phenotype. Furthermore, in
another work to study the characterizations of hASCs of different adipose tissue origins,
LTBP3 was significantly higher expressed in hASCs from supraclavicular compared to sc
adipose tissue [85]. Interestingly, Dabovic et al. published a study where they determined
which organs might be affected by LTBP3 in early murine embryonic development [148]. In
situ hybridization revealed that LTBP3 was only detected in four organs of 16.5 days old
murine embryos, inter alia in the BAT. This again supports the notion that LTBP3 plays a
role in an adipogenesis towards a brown adipocyte phenotype.
The published LTBP3 knockout mouse had premature ossification of the skull base or
increased bone density indicating a TGFβ deficiency, but data on the effects on adipose
tissue had not been reported [126,127]. In this thesis, it was demonstrated that LTBP3 has
a significant impact on the expression of key brown marker gene UCP1. In contrast to all
other LTBP isoforms, LTBP3 deficiency in SGBS cells showed a decrease in UCP1 mRNA as
well as in protein expression by over 35%. Furthermore, the metabolic function was altered
after cAMP injection, supporting the expression data. It was published that LTBP3 is an
important regulator of TGFβ bioavailability and can bind all three TGFβ isoforms [104]. Until
now there is no extracellular TGFβ-independent function known for LTBP3, as it was shown
for LTBP1, LTBP2 and LTBP4 [104]. In addition, LTBP3 was reported to be only secreted
when bound to a TGFβ isoform [149]. Indeed, significantly lower TGFβ2 levels were
observed in the supernatant of LTBP3-deficient preadipocytes, which may lead to a
repressed UCP1 expression in adipocytes. In addition, it was shown that LTBP3 can also
bind to pro-myostatin and inhibit the proprotein convertase 5/6A (PC5/6) in the
endoplasmic reticulum [123,124]. If a LTBP3 deficiency in SGBS cells could lead to a higher
BMP11 and myostatin secretion and if this has an impact on the UCP1 expression remains
to be investigated.
In summary these results revealed that LTBP deficiency has no effect on the adipogenic
differentiation in SGBS cells. In addition, UCP1 expression was not altered in LTBP1 and
LTBP4-deficient SGBS cells. Moreover, TGFβ levels in SGBS preadipocyte supernatant of
LTBP1- and LTBP4-deficient SGBS preadipocytes was not reduced, indicating a dispensable
role for TGFβ bioavailability in SGBS cells. However, deficiency of LTBP2 and LTBP3 in SGBS
cells led to a significant decrease of UCP1 and a regulation of metabolic function.
81
Supernatant of both, LTBP2- and LTBP3-deficient SGBS preadipocytes revealed a significant
reduction of TGFβ2 levels.
These data indicate that LTBP2 and LTBP3 are involved in promoting a brown adipocyte
phenotype.
4.2 Inhibition of the TGFβ pathway leads to a decrease of UCP1 in SGBS adipocytes
LTBPs belong to the extracellular matrix proteins and are therefore secreted by cells. Except
for LTBP2, they are known to bind TGFβ ligands, which are then secreted by the cell as a
LTBP-TGFβ complex. Therefore, LTBPs are crucial for the regulation of TGFβ bioavailability.
Animal models of TGFβ1, TGFβ2 or TGFβ3 deficiency were reported to be lethal, which
hampered a detailed characterization of their function in vivo [89]. While information on
the role of LTBPs in adipocyte biology is scarce, the TGFβ pathway has been shown to play
a fundamental role in adipogenesis and adipocyte metabolism. Clinical studies revealed
that high TGFβ1 serum levels are associated with obesity and a higher BMI [96,97].
Furthermore, it has been shown in several studies that the TGFβ pathway has an influence
on white adipocyte browning in vivo and in vitro [97,98,102]. SMAD3 KO in mice resulted
in WAT browning and SMAD3 KD in murine 3T3-L1 adipocytes increased UCP1 expression.
On the other hand, TGFβ2 has been shown to induce UCP1 expression in murine BAT in
vivo and in brown adipocytes in vitro [88].
To study the effect of TGFβ on the expression of brown adipocyte marker in SGBS cells, the
TGFβ pathway was inhibited in three independent approaches. First, TGFβ1-3-deficient
preadipocytes were generated. Second, the pathway was inhibited by blocking SMAD2/3
phosphorylation with a TGFβR1 kinase inhibitor. Third, SMAD4 was silenced in SGBS
preadipocytes. Of note, TGFβ1-3-deficient SGBS adipocytes revealed a significantly lower
UCP1 expression compared to the EV control. In line, the inhibition of TGFβR1 kinase in
SGBS cells resulted in a significant reduction of UCP1 mRNA and protein as well. Moreover,
to inhibit the TGFβ SMAD2/3 axis downstream, a siRNA-mediated SMAD4 knockdown was
performed in SGBS preadipocytes. This led to a significant decrease in UCP1 expression of
over 90% on mRNA and over 70% on protein level and also inhibited UCP1 on a functional
level. These results demonstrate that inhibition of the TGFβ signaling pathway represses
UCP1 expression and function in SGBS cells.
82
Interestingly, in vitro studies showed that treatment with recombinant TGFβ resulted in an
inhibition of differentiation and treatment with TGFβR1 kinase inhibitor SB431542 in an
increase in differentiation [36,102]. Unexpectedly, no effects on the differentiation rate
were observed in all three approaches. However, the treatment with TGFβR kinase
inhibitor resulted only in an increase in differentiation marker on mRNA and protein level,
not on adipocyte number. On the other hand, treatment of SGBS cells with recombinant
TGFβ1 resulted in an inhibition of differentiation (Appendix Figure S3). It has been reported
that phosphorylation of SMAD2 and SMAD3 by TGFβR activation leads to a repression of
adipogenic transcription factors. Yadav et al. showed that phosphorylated SMAD3 interacts
with C/EBPβ and C/EBPδ thereby inhibiting the induction of transcription factor PPARγ [97].
Activation of pSMAD2 resulted in a decreased expression of C/EBPα and PPARγ, whereby
the mechanism is unclear. It is conceivable that there was no effect on the differentiation
rate, as SGBS cells are already maximally differentiated under basal conditions [143]. This
is inter alia due to the strong PPARγ agonist rosiglitazone which is contained in the
differentiation medium.
In this study a significant reduction of UCP1 expression was demonstrated upon TGFβ1-3
deficiency. Unexpectedly, the metabolic function was not altered after cAMP injection. The
reason for this remains unclear. The UCP1 protein expression was reduced in all 4 individual
experiments on mRNA and protein level. Moreover, the data of TGFβR inhibition and
SMAD4 KD supported the observed decrease in UCP1 expression.
A repression of UCP1 due to TGFβ inhibition contrasts with the published in vivo and in vitro
results. Yadav et al. inhibited all three TGFβ isoforms in vivo and investigated the effects on
the adipose tissue and overall metabolism [97]. For this purpose, murine models for obesity
(Lepob/ob) and type 2 diabetes (DIO) were treated intraperitonally with an antibody (AB)
capturing TGFβ1-3, and therefore preventing receptor activation. Interestingly, TGFβ1-3 AB
treated mice had lower fat mass, lower level of triglycerides and improved glucose and
insulin tolerance compared to control-AB treated mice. Moreover, these mice showed
increased mitochondrial DNA content and increased levels of BAT markers including UCP1
in WAT. There was nothing reported on any side effects. Furthermore, in vitro studies using
TGFβR1 kinase inhibitor SB431542 during adipogenic differentiation exhibited an increased
UCP1 expression in murine stroma vascular cells from WAT and in human induced
83
pluripotent stem cells [102,150]. It was also shown that the usage of SB431542 leads to a
higher number of differentiated cells, which would explain a higher UCP1 expression [150].
However, significantly lower UCP1 levels were observed upon SB431542 treatment in SGBS
cells compared to the vehicle control and at the same time a significant higher expression
of differentiation markers. This indicates that the inhibition of UCP1 seems not to be an
effect of differentiation on the SGBS cells, rather a specific effect. Interestingly, Takeda et
al. described a similar effect on UCP1 expression [151]. They stimulated dermal fibroblasts
with an “optimized chemical cocktail” containing inter alia SB431542 to differentiate these
cells into chemical induced brown adipocytes (ciBAs). These mature ciBAS expressed basal
levels of UCP1. However, when SB was omitted in the differentiation cocktail, the UCP1
expression was significantly higher (⁓5-fold). They speculated that this is due to a higher
number of “adipocyte like” cells. A potential mechanism which leads to these observations
was not discussed. In this work, there were no differences observed in adipocyte number
of SB and control treated SGBS cells.
The TGFβR activation leads to phosphorylation of SMAD2/3, which then bind to SMAD4 for
the internalization into the nucleus [91]. In vivo, the SMAD4 knockout was reported to be
lethal in early embryonal stage, which makes it difficult to study the exact role of SMAD4
in adipocyte browning [152]. However, SMAD3 knockout in vivo is not lethal and its impact
on the metabolism and on the expression of brown marker genes has been studied as well
by Yadav et al. [97]. Mice with a homozygous knockout for SMAD3 had a reduced fat mass
and higher glucose uptake in WAT. Furthermore, the WAT of SMAD3-deficient mice
showed a morphology similar to that of BAT, with smaller and unilocular adipocytes. These
observations were supported by a higher UCP1 mRNA expression and protein level in WAT
compared to WT mice. In addition, 3T3-L1 cells expressing a short hairpin RNA against
SMAD3 showed elevated levels of brown marker genes in vitro compared to the control
[97].
Summarizing the results to study the impact of the TGFβ-SMAD pathway on brown marker
genes and on the metabolic function in SGBS cells revealed a significant decrease in UCP1
expression in all three approaches. Interestingly, these are the opposite results compared
to the published literature of in vitro and in vivo experiments. One can speculate if this is
due to the differences between human and mouse or in vivo and in vitro. It has been
demonstrated that TGFβ is also highly expressed and secreted by other cell types residing
84
in the adipose tissue, such as macrophages and leukocytes, thus influencing the
adipogenesis as well [89]. This exogenous TGFβ is absent in our in vitro model.
Furthermore, a SMAD4 knockdown could not only affect TGFβ action, but also diminish the
effect of BMP4 and BMP7 on promoting a brown adipocyte phenotype. The intracellular
signaling of BMPs, which belong to the TGF superfamily, is mediated via phosphorylation
of SMAD1, SMAD5 and SMAD8 which also require SMAD4 for the internalization into the
nucleus [91]. In vivo and in vitro experiments have demonstrated that BMP4 and BMP7 can
induce adipogenesis towards a brown adipocyte phenotype [36]. On the other hand, this
was not supported by the publication of Modica et al. [153]. They performed a SMAD4
knockdown in vitro in immortalized murine brown adipocytes which resulted in an increase
in UCP1.
Yadav et al. have also shown that TGFβ signaling can repress the expression of PGC1α via
promotor regulation, speculating that this inhibits both, differentiation and browning [97].
No differences in the PGC1α expression of TGFβ-deficient cells versus EV control were
observed in this work, proving at least that there was no repression of transcription factor
PGC1α. The reasons why the inhibition of the TGFβ-SMAD axis led to an inhibition of UCP1
in SGBS cells remains unclear at this point. If this is an SGBS cell specific effect needs to be
investigated by repeating the same approaches in other hASCs derived from the sc WAT.
However, in this work, it was clearly demonstrated in three independent approaches that
inhibition of the TGFβ pathway represses UCP1 expression in human SGBS cells in vitro.
This data demonstrates new insights in the context of TGFβ and the regulation of key
browning marker UCP1.
Comparing the observations of TGFβ pathway inhibition in SGBS cells with the LTBP-
deficient adipocytes reveals overlapping results in UCP1 expression on mRNA and protein
level with LTBP3-deficient cells. Furthermore, the supernatant of LTBP3-deficient
preadipocytes exhibited a significant reduced level of TGFβ2. These results support a role
for LTBP3 in generating a brown adipocyte phenotype and suggests that the effects on
UCP1 and metabolic function seen in LTBP3-deficient SGBS cells are mediated via the TGFβ-
pathway.
85
4.3 Repression of brown marker gene UCP1 by LTBP3-deficiency could be mediated by
alterations in TGFβ2 bioavailability
TGFβ2 levels were significantly reduced in LTBP3-deficient preadipocytes. Thus, this work
focused on this ligand as a potential factor mediating an adipogenesis towards a brown
adipocyte phenotype.
Of note, comparing the TGFβ ligand and receptor expression during SGBS adipogenesis to
the expression pattern of LTBPs, revealed a co-regulation only for TGFβ2 and TGFβR3 with
the LTBPs. This suggests a special role for TGFβ2 in the adipogenesis of SGBS cells. Indeed,
TGFβ2 deficiency in SGBS cells revealed a significant reduction of UCP1 on protein level by
35%. In addition, induction of lipolysis by cAMP exhibited a significant lower OCR in TGFβ2-
deficient adipocytes compared to control cells. This observation supports a reduction of
UCP1 in TGFβ2-deficient adipocytes. Of note, TGFβ1 knockout did not alter UCP1
expression or metabolic function in SGBS cells. Recently, Takahashi et al. published a study
on TGFβ2 and its impact on the metabolism in vitro and in vivo [88]. They found that the
secretion of TGFβ2 in adipocytes from the sc WAT is induced by exercise and that TGFβ2
can regulate the metabolism in mice. In vitro treatment with recombinant TGFβ2 resulted
in a higher fatty acid uptake and glucose uptake inter alia in 3T3-L1 adipocytes and in
human immortalized brown adipocytes (WT-1) [88]. Furthermore, UCP1 expression was
significantly increased in WT-1 adipocytes. This was not observed for TGFβ1 and TGFβ3.
Moreover, mice treated with a β-3 receptor agonist showed a significant reduction of
TGFβ1 and TGFβ3 expression in sc WAT, whereby TGFβ2 was not altered. Mice challenged
with HFD and infused with recombinant TGFβ2 by an osmotic pump showed an overall
improved metabolism including a better glucose tolerance and insulin sensitivity compared
to control mice on HFD [88]. It was shown that mainly muscle tissue was responsible for
these improvements. However, TGFβ2 treatment also significantly increased UCP1
expression in BAT. In addition, they have shown that TGFβ2 inhibits macrophage infiltration
into the scWAT and hypothesized that TGFβ2 acts as in immune suppressor [88]. They
suggest that this reduction of inflammation in scWAT led to an improved overall
metabolism in TGFβ2 treated mice. Unfortunately, they did not discuss the observed in
vitro results or a potential mechanism of TGFβ2 on the UCP1 expression [88]. In addition,
they did observe different results for each TGFβ ligand, but did not comment on the special
role of TGFβ2, since the same pathways are assumed for all three ligands. However, there
86
are some different properties for TGFβ2 compared to TGFβ1 and TGFβ3. In contrast to the
other TGFβ isoforms, TGFβ2 has a low affinity for TGFβR2, thus it binds first to the co-
receptor TGFβR3 which then activates TGFβR2 [91]. Moreover, it is not completely
understood how TGFβ2 is activated in the ECM. It was demonstrated that LTBP1 and LTBP3
can bind this isoform and that cells secrete this complex into the ECM [104]. TGFβ1 and
TGFβ3 can be released from the LLC by integrin binding but the pro-TGFβ2 is missing this
binding sequence making an integrin-mediated activation in the ECM unlikely [104].
Therefore, other factors or circumstances like pH change or proteases must lead to TGFβ2
release in the ECM. Interestingly, Petrus et al. exhibited another difference to the other
isoforms. TGFβ1 and TGFβ3 expression was significantly higher in human sc WAT of an
obese cohort compared to control [154]. However, TGFβ2 expression was not altered due
to obesity or after weight loss of this cohort. These data may explain differences in function
of TGFβ2 compared to TGFβ1 and TGFβ3, but the mechanism remains unknown. Another
possibility for the lower UCP1 expression of TGFβ2-deficient SGBS cells is the influence of
the p38 MAPK pathway. It was shown that p38 MAPK can be phosphorylated by TGFβR
activation [91]. In different studies, it has been shown that the activation of p38 e.g. by
natriuretic peptides, stimulates UCP1 expression [24,40]. Whether this has an impact in our
cell system remains to be investigated. A specific pathway for TGFβ2 distinct of TGFβ1 or
TGFβ3 is not known yet.
My observations and the published effects of TGFβ2 on the adipocyte metabolism indicate
that LTBP3 regulates UCP1 expression in an auto- or paracrine manner via control of TGFβ2
bioavailability [88]. However, the mechanism by which UCP1 is regulated is unknown and
remains to be determined.
4.4 Indications for LTBP3-TGFβ2 mediated browning in human WAT
The overall idea of this study was to identify potential new target structure for the
treatment of obesity and its associated cardiovascular diseases. Therefore, it was
important to show if the observed LTBP3-TGFβ2 axis may also play a role in browning of
human sc WAT. Correlation of mRNA expression analysis in WAT of patients who
underwent plastic surgery revealed interesting results. First, the LTBP3 expression
correlated positive with TGFβ2 expression. Of note, LTBP3 did not correlate with any other
87
TGFβ ligand in those patient samples. This indicates an important relation of LTBP3 with
TGFβ2 in human adipose tissue, since it was shown that LTBP3 secretion is dependent on
the expression of TGFβ [149]. Even more important, the LTBP3 expression correlated
significantly and positively with the UCP1 expression in these WAT samples. No publication
was found on a negative correlation of LTBP3 to obesity, insulin resistance or any disease
which could be associated with low UCP1 levels. McInerney-Leo et al. reported on patients
with heterozygous mutations in the LTBP3 gene [155]. These subjects suffered from
acromicric dysplasia or geleophysica dysplasia, including a shorter statue or brachydactyly.
It was reported that these patients had normal proportions to their height. Nothing was
described in detail on BMI, body fat mass or insulin resistance. It seems that LTBP3 plays
an important role in the early development of humans since some of these patients also
died in early childhood. In line to the previously described LTBP3 knockout mouse, LTBP3
takes a crucial role in the early bone formation [126,127]. However, the role of LTBP3 in
WAT may be different and has not been elucidated to date. As previously described, the
TGFβ2 knockout mouse is lethal due to insufficient development of vital organs in the
embryonal stage [94]. Humans with heterozygous TGFβ2 mutations suffered inter alia from
Loeys-Dietz syndrome, which is often characterized by a higher TGFβ signaling, higher
SMAD2/3 phosphorylation and aortic aneurysm [156]. These observations are often seen
within mutations of the TGFβ isoforms and are also known from the Marfan syndrome. The
complete mechanism is not understood, but it is assumed that the other TGFβ isoforms are
overcompensating the loss of functional TGFβ2 protein. As previously described, TGFβ2
treatment in vivo led to an increase in UCP1 in BAT and to an improved overall metabolism
[88]. The authors of this study did not observe any side effects after 13 days of treatment.
In the same study they also performed an adipocyte specific TGFβ2 knockout in mice. There
were no changes in the glucose tolerance test compared to control mice. Unfortunately,
they did not show the UCP1 expression in the WAT of these mice or report anything on the
context of white adipocyte browning. However, in this thesis, a significant correlation of
TGFβ2 expression to UCP1 was found in human WAT samples with R²=0.8735. This supports
the in vitro observations and the hypothesis that LTBP3 alters UCP1 expression via TGFβ2
and suggests a role for LTBP3 in WAT browning in vivo.
88
4.5 Conclusion, limitations and outlook
This study has demonstrated that the LTBP3-TGFβ2 pathway is involved in the adipogenesis
towards a brown adipocyte phenotype in vitro and may also be an important axis in human
WAT browning. However, these findings also reveal some limitations and open questions
which should be addressed in future experiments. Not much is known to date about LTBP3
in the context of adipose tissue and the release of TGFβ2 by LTBPs, but insight in its
pathway could reveal new targets to stimulate the adipogenesis towards a brown
adipocyte phenotype. The same pathways are assumed for all three TGFβs, but the ligands
have already been shown to have different functions [87]. Especially in the context of
adipose tissue browning, it would be interesting to reveal any new pathways. RNAseq or
proteomics analysis in the LTBP3- and TGFβ2-deficient SGBS cells may detect any
differences in pathway activation. Another approach would be the in vitro treatment with
each TGFβ ligand followed by RNAseq or proteomics.
Despite the new findings in this study it should be considered that all approaches were
done in vitro in a 2-dimensional cell culture model only using SGBS cells. The adipose tissue
is a highly complex organ with several different cell types [5]. Especially immune cells with
the secretion of cytokines are known to have an impact on the development and expression
profile of pre- and adipocytes [157].
In this thesis, the focus was on LTBPs, the TGFβ-pathway, and the cytokine TGFβ2. LTBPs
are known to be matrix proteins, keeping TGFβs there in a latent state [104]. The SGBS cells
express and secrete extracellular matrix proteins in vitro [158], but whether this is enough
for adequate LTBP binding and e.g integrin-activated TGFβ secretion remains to be
investigated. Furthermore, LTBPs and TGFβ isoforms are also known to be expressed by
other cells residing in the adipose tissue [89,108]. My measurements revealed also higher
expression for LTBP3 and LTBP4 in adipose tissue samples compared to isolated hASCs. This
should be considered thinking of a potential role for LTBP3 in stimulating UCP1 expression
in vivo. The LTBP3 or TGFβ2, which is secreted by other cell types than ASCs may have an
impact as well. Therefore, an interesting approach would be an adipocyte specific knockout
for LTBP3 in mice. This could be achieved with a Cre-loxP system and under the control of
an adiponectin promoter. Challenging these mice with HFD, housing under cold conditions
or treatment with a β3-receptor agonist could give insights on the role of LTBP3 in WAT
and its impact on WAT browning and on the overall metabolism. The same approach would
89
be interesting for TGFβ2. As previously mentioned, an adipocyte specific knockout for
TGFβ2 has already been generated, but the authors focused more on the role of TGFβ2 in
exercise and on the overall metabolism of these mice [88]. Approaches with cold or β3-
adrenergic stimulation of mice with adipocytes specific TGFβ2 knockout were not done yet.
The overall goal of my study was to identify a new factor which is involved in the
adipogenesis towards a brown adipocyte phenotype and may be a target for the treatment
of obesity and its associated cardiovascular diseases. Although, LTBP3 and TGFβ2 was
identified to regulate UCP1 expression, it remains to be elucidated if these are targets for
a treatment of obesity or cardiovascular diseases. High levels of LTBP3 have been
associated with metastatic tumors [104]. Furthermore, it was reported that TGFβ2 has an
impact on several cellular processes such as differentiation, proliferation and immune
suppression, suggesting that TGFβ2 treatment in humans could have severe side effects
[89]. Stimulating a higher LTBP3 expression or TGFβ2 secretion locally in the adipose tissue
could overcome this. Several approaches to implement a local treatment of the adipose
tissue have been published so far. It was shown that a special patch, locally applied on the
sc adipose tissue, stimulated browning in vivo by injecting rosiglitazone with microneedles
[159]. Another interesting approach is the transplantation of preadipocytes which are
preprogrammed to undergo adipogenesis into UCP1-expressing cells. Very recently Wang
et al. activated the UCP1 gene expression with CRISPR/Cas in human preadipocytes derived
from the sc WAT and transplanted them into the sc WAT of obese mice [160]. These mice
showed an improved glucose tolerance, insulin sensitivity, and higher energy expenditure
compared to control mice. However, it is not clear when this transplantation method will
become clinically relevant. Injection with nanoparticles containing “batokines” or its mRNA
into the sc adipose tissue of obese patients to induce browning could be a realistic scenario.
Nanoparticles specifically targeting the adipose tissue have already been developed and
pharma companies have mRNA-based drugs in phase 1 and phase 2 of clinical trials [161–
164].
In conclusion my findings indicate LTBP3 as a new factor regulating UCP1 expression via
TGFβ2 bioavailability.
90
5. Summary
Obesity is a global epidemic and the main risk factor for cardiovascular diseases which is
the number one cause of death worldwide. Current treatment methods for obesity are very
limited and often fail in the long term.
In the last decade it has been demonstrated that not only human newborns but also adults
have functional brown adipose tissue mass. Furthermore, there is evidence for
uncoupling protein 1 (UCP1)-expressing adipocytes within the white adipose tissue (WAT)
of humans. White adipocyte browning is defined by a significant increase in UCP1
expression in the adipose tissue depot and has been shown to significantly increase overall
metabolic health inter alia by higher glucose uptake and fatty acid uptake, thus providing
a strategy for obesity treatment. An approach for implementation, is to stimulate human
adipose stromal cells (hASCs) within the WAT to undergo adipogenesis into UCP1-
expressing adipocytes. However, the mechanism how these cells differentiate either into
adipocytes with a white or with a brown phenotype is not fully understood. Our group has
shown that hASCs isolated from deep neck (dn) adipose tissue differentiated in vitro into
adipocytes with a brown phenotype and hASCs derived from the subcutaneous (sc) adipose
tissue differentiated into adipocytes with a white phenotype. Microarray analysis revealed
different expression patterns of these hASCs dependent on their adipose tissue origin.
Therefore, we hypothesized, that hASCs secrete factors which stimulate or inhibit the
adipogenesis into a brown adipocyte phenotype in an auto- or paracrine manner.
After target ranking of these differentially regulated genes and literature screening the
latent transforming growth factor beta binding proteins (LTBP1-4) were identified as
potential factors involved in generating a brown adipocyte phenotype. Except for LTBP2,
they are known to play a crucial role in the bioavailability of transforming growth factors
(TGFβ). These TGFβ cytokines in turn are known to be involved in regulating UCP1
expression in vitro and WAT browning in vivo. The SMAD2/SMAD3 mediated TGFβ pathway
has already been shown to inhibit white adipocyte browning and TGFβ2 was reported to
increase UCP1 expression in murine BAT. The aim of this study was to investigate the
impact of the LTBP isoforms on brown marker genes and the metabolic function in vitro.
91
LTBP1, LTBP3 and LTBP4 were significantly higher expressed in the dn hASCs and all four
LTBPs were expressed during the adipogenesis of a human sc preadipocyte cell strain (SGBS
cells). LTBP1 and LTBP4 were not involved in the generation of a brown phenotype in SGBS
cells. However, LTBP2 deficiency showed a reduced UCP1 mRNA expression and altered
metabolic function. Moreover, deficiency of LTBP3 in SGBS adipocytes led to a repression
of UCP1 expression on mRNA and protein level. Furthermore, the metabolic function of
these cells was altered as well.
Inhibition of the TGFβ-pathway in human SGBS cells led in three different approaches to an
adipogenesis towards a white phenotype. TGFβ deficiency, TGFβ receptor1 kinase
inhibition and knockdown of SMAD4 led to a significant decrease in UCP1 expression,
whereby the differentiation rate was not affected in these cells. These results are in
accordance with the observed UCP1 expression in LTBP2- and LTBP3-deficient cells.
Measuring the TGFβ content in the supernatant of LTBP2- and LTBP3-deficient
preadipocytes revealed a significant lower level for TGFβ2 compared to the control. The
TGFβ2 knockout in turn resulted in a decreased UCP1 expression and metabolic function as
well. Moreover, the LTBP3 and TGFβ2 axis seems to play also a relevant role in human WAT
browning. LTBP3 expression correlated positively with the TGFβ2 expression in human sc
WAT samples. Furthermore, both LTBP3 and TGFβ2 correlated significantly positive with
the UCP1 expression in the same patient samples. As a result, one can hypothesize that
LTBP3 regulates the adipogenesis towards a brown phenotype via TGFβ2 bioavailability.
The findings of this thesis revealed LTBP3 as a new factor involved in generating a brown
adipocyte phenotype. Furthermore, the inhibition of TGFβ pathway demonstrated new
insights of TGFβ and the regulation of UCP1 expression. The specific pathway how LTBP3
and TGFβ2 mediate a shift towards a brown adipocyte phenotype should be addressed in
the future, thereby identifying a new mechanism to induce UCP1 expression in human
WAT. As a consequence, LTBP3 or TGFβ2 may become new promising targets for the
treatment of obesity.
92
6. References
[1] WHO, Obesity and overweight, World Heal. Organ. (2017).
https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight
(accessed June 3, 2020).
[2] WHO, Cardiovascular diseases (CVDs), World Heal. Organ. (2017).
https://www.who.int/news-room/fact-sheets/detail/cardiovascular-diseases-(cvds)
(accessed June 3, 2020).
[3] M. Blüher, Obesity: global epidemiology and pathogenesis, Nat. Rev. Endocrinol. 15
(2019) 288–298. https://doi.org/10.1038/s41574-019-0176-8.
[4] E.K. Oikonomou, C. Antoniades, The role of adipose tissue in cardiovascular health
and disease, Nat. Rev. Cardiol. 16 (2019) 83–99. https://doi.org/10.1038/s41569-
018-0097-6.
[5] L. Luo, M. Liu, Adipose tissue in control of metabolism, J. Endocrinol. 231 (2016) R77–
R99. https://doi.org/10.1530/JOE-16-0211.
[6] A.M. Cypess, S. Lehman, G. Williams, I. Tal, D. Rodman, A.B. Goldfine, F.C. Kuo, E.L.
Palmer, Y.-H. Tseng, A. Doria, G.M. Kolodny, C.R. Kahn, Identification and importance
of brown adipose tissue in adult humans., N. Engl. J. Med. 360 (2009) 1509–1517.
https://doi.org/10.1097/OGX.0b013e3181ac8aa2.
[7] J. Nedergaard, T. Bengtsson, B. Cannon, Unexpected evidence for active brown
adipose tissue in adult humans., Am. J. Physiol. Endocrinol. Metab. 293 (2007) E444–
E452. https://doi.org/10.1152/ajpendo.00691.2006.
[8] K.A. Virtanen, M.E. Lidell, J. Orava, M. Heglind, R. Westergren, T. Niemi, M.
Taittonen, J. Laine, N.J. Savisto, S. Enerback, P. Nuutila, Functional brown adipose
tissue in healthy adults, N Engl J Med. 360 (2009) 1518–1525.
https://doi.org/360/15/1518 [pii] 10.1056/NEJMoa0808949.
93
[9] W.D. Van Marken Lichtenbelt, J.W. Vanhommerig, N.M. Smulders, J.M.A.F.L.
Drossaerts, G.J. Kemerink, N.D. Bouvy, P. Schrauwen, G.J.J. Teule, Cold-activated
brown adipose tissue in healthy men, N. Engl. J. Med. 360 (2009) 1500–1508.
https://doi.org/10.1056/NEJMoa0808718.
[10] A. Bartelt, J. Heeren, Adipose tissue browning and metabolic health, Nat. Rev.
Endocrinol. 10 (2014) 24–36. https://doi.org/10.1038/nrendo.2013.204.
[11] P. Young, J.R.S. Arch, M. Ashwell, Brown adipose tissue in the parametrial fat pad of
the mouse, 1984. https://doi.org/10.1016/0014-5793(84)80822-4.
[12] E.D. Rosen, B.M. Spiegelman, What we talk about when we talk about fat, Cell. 156
(2014) 20–44. https://doi.org/10.1016/j.cell.2013.12.012.
[13] B. Cannon, J. Nedergaard, Brown Adipose Tissue: Function and Physiological
Significance, Physiol. Rev. 84 (2004) 277–359.
https://doi.org/10.1152/physrev.00015.2003.
[14] V. Gilsanz, H.H. Hu, S. Kajimura, Relevance of brown adipose tissue in infancy and
adolescence, Pediatr. Res. 73 (2013) 3–9. https://doi.org/10.1038/pr.2012.141.
[15] M. Klingenberg, Uncoupling protein - A useful energy dissipator, J. Bioenerg.
Biomembr. 31 (1999) 419–430. https://doi.org/10.1023/A:1005440221914.
[16] A.L. Poher, J. Altirriba, C. Veyrat-Durebex, F. Rohner-Jeanrenaud, Brown adipose
tissue activity as a target for the treatment of obesity/insulin resistance, Front.
Physiol. 6 (2015) 4. https://doi.org/10.3389/fphys.2015.00004.
[17] M. Chondronikola, E. Volpi, E. Børsheim, C. Porter, P. Annamalai, S. Enerbäck, M.E.
Lidell, M.K. Saraf, S.M. Labbe, N.M. Hurren, C. Yfanti, T. Chao, C.R. Andersen, F.
Cesani, H. Hawkins, L.S. Sidossis, Brown adipose tissue improves whole-body glucose
homeostasis and insulin sensitivity in humans, Diabetes. 63 (2014) 4089–4099.
https://doi.org/10.2337/db14-0746.
94
[18] M.J.W. Hanssen, J. Hoeks, B. Brans, A.A.J.J. Van Der Lans, G. Schaart, J.J. Van Den
Driessche, J.A. Jörgensen, M. V. Boekschoten, M.K.C. Hesselink, B. Havekes, S.
Kersten, F.M. Mottaghy, W.D. Van Marken Lichtenbelt, P. Schrauwen, Short-term
cold acclimation improves insulin sensitivity in patients with type 2 diabetes mellitus,
Nat. Med. 21 (2015) 863–865. https://doi.org/10.1038/nm.3891.
[19] B. Cannon, J. Nedergaard, Nonshivering thermogenesis and its adequate
measurement in metabolic studies, J. Exp. Biol. 214 (2011) 242–253.
https://doi.org/10.1242/jeb.050989.
[20] E.T. Chouchani, L. Kazak, B.M. Spiegelman, New Advances in Adaptive
Thermogenesis: UCP1 and Beyond, Cell Metab. 29 (2019) 27–37.
https://doi.org/10.1016/j.cmet.2018.11.002.
[21] S. Enerbäck, A. Jacobsson, E.M. Simpson, C. Guerra, H. Yamashita, M.E. Harper, L.P.
Kozak, Mice lacking mitochondrial uncoupling protein are cold-sensitive but not
obese, 1997. https://doi.org/10.1038/387090a0.
[22] P.G. Crichton, Y. Lee, E.R.S. Kunji, The molecular features of uncoupling protein 1
support a conventional mitochondrial carrier-like mechanism, Biochimie. 134 (2017)
35–50. https://doi.org/10.1016/j.biochi.2016.12.016.
[23] B. Wicksteed, L.M. Dickson, PKA differentially regulates adipose depots to control
energy expenditure, Endocrinology. 158 (2017) 464–466.
https://doi.org/10.1210/en.2017-00038.
[24] W. Cao, K.W. Daniel, J. Robidoux, P. Puigserver, A. V. Medvedev, X. Bai, L.M. Floering,
B.M. Spiegelman, S. Collins, p38 Mitogen-Activated Protein Kinase Is the Central
Regulator of Cyclic AMP-Dependent Transcription of the Brown Fat Uncoupling
Protein 1 Gene, Mol. Cell. Biol. 24 (2004) 3057–3067.
https://doi.org/10.1128/mcb.24.7.3057-3067.2004.
[25] A. Vargas-Castillo, R. Fuentes-Romero, L.A. Rodriguez-Lopez, N. Torres, A.R. Tovar,
Understanding the Biology of Thermogenic Fat: Is Browning A New Approach to the
Treatment of Obesity?, Arch. Med. Res. 48 (2017) 401–413.
https://doi.org/10.1016/j.arcmed.2017.10.002.
95
[26] C.T. Herz, F.W. Kiefer, Adipose tissue browning in mice and humans, J. Endocrinol.
241 (2019) R97–R109. https://doi.org/10.1530/joe-18-0598.
[27] M. Harms, P. Seale, Brown and beige fat: development, function and therapeutic
potential, Nat. Med. 19 (2013) 1252–1263. https://doi.org/10.1038/nm.3361.
[28] W. Aherne, D. Hull, Brown adipose tissue and heat production in the newborn
infant., J. Pathol. Bacteriol. 91 (1966) 223–234.
https://doi.org/10.1002/path.1700910126.
[29] K.A. Iwen, J. Backhaus, M. Cassens, M. Waltl, O.C. Hedesan, M. Merkel, J. Heeren, C.
Sina, L. Rademacher, A. Windjäger, A.R. Haug, F.W. Kiefer, H. Lehnert, S.M. Schmid,
Cold-Induced Brown Adipose Tissue Activity Alters Plasma Fatty Acids and Improves
Glucose Metabolism in Men, J. Clin. Endocrinol. Metab. 102 (2017) 4226–4234.
https://doi.org/10.1210/jc.2017-01250.
[30] J. Orava, P. Nuutila, T. Noponen, R. Parkkola, T. Viljanen, S. Enerbäck, A. Rissanen,
K.H. Pietiläinen, K.A. Virtanen, Blunted metabolic responses to cold and insulin
stimulation in brown adipose tissue of obese humans, Obesity. 21 (2013) 2279–
2287. https://doi.org/10.1002/oby.20456.
[31] C. Pfannenberg, M.K. Werner, S. Ripkens, I. Stef, A. Deckert, M. Schmadl, M. Reimold,
H.U. Häring, C.D. Claussen, N. Stefan, Impact of age on the relationships of brown
adipose tissue with sex and adiposity in humans, Diabetes. 59 (2010) 1789–1793.
https://doi.org/10.2337/db10-0004.
[32] V. Ouellet, S.M. Labbé, D.P. Blondin, S. Phoenix, B. Guérin, F. Haman, E.E. Turcotte,
D. Richard, A.C. Carpentier, Brown adipose tissue oxidative metabolism contributes
to energy expenditure during acute cold exposure in humans, J. Clin. Invest. 122
(2012) 545–552. https://doi.org/10.1172/JCI60433.
[33] G.H.E.J. Vijgen, N.D. Bouvy, G.J.J. Teule, B. Brans, J. Hoeks, P. Schrauwen, W.D. Van
Marken Lichtenbelt, Increase in brown adipose tissue activity after weight loss in
morbidly obese subjects, J. Clin. Endocrinol. Metab. 97 (2012).
https://doi.org/10.1210/jc.2012-1289.
96
[34] T. Yoneshiro, S. Aita, M. Matsushita, Y. Okamatsu-Ogura, T. Kameya, Y. Kawai, M.
Miyagawa, M. Tsujisaki, M. Saito, Age-related decrease in cold-activated brown
adipose tissue and accumulation of body fat in healthy humans, Obesity. 19 (2011)
1755–1760. https://doi.org/10.1038/oby.2011.125.
[35] M.J.W. Hanssen, A.A.J.J. Van Der Lans, B. Brans, J. Hoeks, K.M.C. Jardon, G. Schaart,
F.M. Mottaghy, P. Schrauwen, W.D. Van Marken Lichtenbelt, Short-term cold
acclimation recruits brown adipose tissue in obese humans, Diabetes. 65 (2016)
1179–1189. https://doi.org/10.2337/db15-1372.
[36] M.J. Lee, Transforming growth factor beta superfamily regulation of adipose tissue
biology in obesity, Biochim. Biophys. Acta - Mol. Basis Dis. 1864 (2018) 1160–1171.
https://doi.org/10.1016/j.bbadis.2018.01.025.
[37] Y.H. Tseng, E. Kokkotou, T.J. Schulz, T.L. Huang, J.N. Winnay, C.M. Taniguchi, T.T.
Tran, R. Suzuki, D.O. Espinoza, Y. Yamamoto, M.J. Ahrens, A.T. Dudley, A.W. Norris,
R.N. Kulkarni, C.R. Kahn, New role of bone morphogenetic protein 7 in brown
adipogenesis and energy expenditure, Nature. 454 (2008) 1000–1004.
https://doi.org/10.1038/nature07221.
[38] F.F. Fisher, S. Kleiner, N. Douris, E.C. Fox, R.J. Mepani, F. Verdeguer, J. Wu, A.
Kharitonenkov, J.S. Flier, E. Maratos-Flier, B.M. Spiegelman, FGF21 regulates PGC-1α
and browning of white adipose tissues in adaptive thermogenesis, Genes Dev. 26
(2012) 271–281. https://doi.org/10.1101/gad.177857.111.
[39] A.M. Cypess, Y.C. Chen, C. Sze, K. Wang, J. English, O. Chan, A.R. Holman, I. Tal, M.R.
Palmer, G.M. Kolodny, C.R. Kahn, Cold but not sympathomimetics activates human
brown adipose tissue in vivo, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 10001–10005.
https://doi.org/10.1073/pnas.1207911109.
[40] M. Bordicchia, D. Liu, E.Z. Amri, G. Ailhaud, P. Dessì-Fulgheri, C. Zhang, N. Takahashi,
R. Sarzani, S. Collins, Cardiac natriuretic peptides act via p38 MAPK to induce the
brown fat thermogenic program in mouse and human adipocytes, J. Clin. Invest. 122
(2012) 1022–1036. https://doi.org/10.1172/JCI59701.
97
[41] W. Wang, P. Seale, Control of brown and beige fat development, Nat. Rev. Mol. Cell
Biol. 17 (2016) 691–702. https://doi.org/10.1038/nrm.2016.96.
[42] J. Sanchez-Gurmaches, C.M. Hung, D.A. Guertin, Emerging Complexities in Adipocyte
Origins and Identity, Trends Cell Biol. 26 (2016) 313–326.
https://doi.org/10.1016/j.tcb.2016.01.004.
[43] G. Barbatelli, I. Murano, L. Madsen, Q. Hao, M. Jimenez, K. Kristiansen, J.P.
Giacobino, R. De Matteis, S. Cinti, The emergence of cold-induced brown adipocytes
in mouse white fat depots is determined predominantly by white to brown adipocyte
transdifferentiation, Am. J. Physiol. - Endocrinol. Metab. 298 (2010) E1244-53.
https://doi.org/10.1152/ajpendo.00600.2009.
[44] A. Frontini, A. Vitali, J. Perugini, I. Murano, C. Romiti, D. Ricquier, M. Guerrieri, S.
Cinti, White-to-brown transdifferentiation of omental adipocytes in patients
affected by pheochromocytoma, Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1831
(2013) 950–959. https://doi.org/10.1016/j.bbalip.2013.02.005.
[45] P. Seale, B. Bjork, W. Yang, S. Kajimura, S. Chin, S. Kuang, A. Scimè, S. Devarakonda,
H.M. Conroe, H. Erdjument-Bromage, P. Tempst, M.A. Rudnicki, D.R. Beier, B.M.
Spiegelman, PRDM16 controls a brown fat/skeletal muscle switch, Nature. 454
(2008) 961–967. https://doi.org/10.1038/nature07182.
[46] M. Esteve Ràfols, Adipose tissue: Cell heterogeneity and functional diversity,
Endocrinol. y Nutr. (English Ed. 61 (2014) 100–112.
https://doi.org/10.1016/j.endoen.2014.02.001.
[47] D. Tews, V. Schwar, M. Scheithauer, T. Weber, T. Fromme, M. Klingenspor, T.F. Barth,
P. Möller, K. Holzmann, K.M. Debatin, P. Fischer-Posovszky, M. Wabitsch,
Comparative gene array analysis of progenitor cells from human paired deep neck
and subcutaneous adipose tissue., Mol. Cell. Endocrinol. 395 (2014) 41–50.
https://doi.org/10.1016/j.mce.2014.07.011.
98
[48] A.M. Cypess, A.P. White, C. Vernochet, T.J. Schulz, R. Xue, C.A. Sass, T.L. Huang, C.
Roberts-Toler, L.S. Weiner, C. Sze, A.T. Chacko, L.N. Deschamps, L.M. Herder, N.
Truchan, A.L. Glasgow, A.R. Holman, A. Gavrila, P.O. Hasselgren, M.A. Mori, M.
Molla, Y.H. Tseng, Anatomical localization, gene expression profiling and functional
characterization of adult human neck brown fat, Nat. Med. 19 (2013) 635–639.
https://doi.org/10.1038/nm.3112.
[49] M.E. Lidell, M.J. Betz, O. Dahlqvist Leinhard, M. Heglind, L. Elander, M. Slawik, T.
Mussack, D. Nilsson, T. Romu, P. Nuutila, K.A. Virtanen, F. Beuschlein, A. Persson, M.
Borga, S. Enerbäck, Evidence for two types of brown adipose tissue in humans, Nat.
Med. 19 (2013) 631–634. https://doi.org/10.1038/nm.3017.
[50] J. Wu, P. Boström, L.M. Sparks, L. Ye, J.H. Choi, A.H. Giang, M. Khandekar, K.A.
Virtanen, P. Nuutila, G. Schaart, K. Huang, H. Tu, W.D. Van Marken Lichtenbelt, J.
Hoeks, S. Enerbäck, P. Schrauwen, B.M. Spiegelman, Beige adipocytes are a distinct
type of thermogenic fat cell in mouse and human, Cell. 150 (2012) 366–376.
https://doi.org/10.1016/j.cell.2012.05.016.
[51] L.Z. Sharp, K. Shinoda, H. Ohno, D.W. Scheel, E. Tomoda, L. Ruiz, H. Hu, L. Wang, Z.
Pavlova, V. Gilsanz, S. Kajimura, Human BAT Possesses Molecular Signatures That
Resemble Beige/Brite Cells, PLoS One. 7 (2012) e49452.
https://doi.org/10.1371/journal.pone.0049452.
[52] N.Z. Jespersen, T.J. Larsen, L. Peijs, S. Daugaard, P. Homøe, A. Loft, J. De Jong, N.
Mathur, B. Cannon, J. Nedergaard, B.K. Pedersen, K. Møller, C. Scheele, A classical
brown adipose tissue mrna signature partly overlaps with brite in the supraclavicular
region of adult humans, Cell Metab. 17 (2013) 798–805.
https://doi.org/10.1016/j.cmet.2013.04.011.
[53] J.M.A. de Jong, W. Sun, N.D. Pires, A. Frontini, M. Balaz, N.Z. Jespersen, A. Feizi, K.
Petrovic, A.W. Fischer, M.H. Bokhari, T. Niemi, P. Nuutila, S. Cinti, S. Nielsen, C.
Scheele, K. Virtanen, B. Cannon, J. Nedergaard, C. Wolfrum, N. Petrovic, Human
brown adipose tissue is phenocopied by classical brown adipose tissue in
physiologically humanized mice, Nat. Metab. 1 (2019) 830–843.
https://doi.org/10.1038/s42255-019-0101-4.
99
[54] M. Rosenwald, C. Wolfrum, The origin and definition of brite versus white and
classical brown adipocytes, Adipocyte. 3 (2014) 4–9.
https://doi.org/10.4161/adip.26232.
[55] P.A. Kern, B.S. Finlin, B. Zhu, N. Rasouli, R.E. McGehee, P.M. Westgate, E.E. Dupont-
Versteegden, The effects of temperature and seasons on subcutaneous white
adipose tissue in humans: Evidence for thermogenic gene induction, J. Clin.
Endocrinol. Metab. 99 (2014) E2772–E2779. https://doi.org/10.1210/jc.2014-2440.
[56] N. Martínez-Sánchez, J.M. Moreno-Navarrete, C. Contreras, E. Rial-Pensado, J.
Fernø, R. Nogueiras, C. Diéguez, J.M. Fernández-Real, M. López, Thyroid hormones
induce browning of white fat, J. Endocrinol. 232 (2017) 351–362.
https://doi.org/10.1530/JOE-16-0425.
[57] M.C. Skarulis, F.S. Celi, E. Mueller, M. Zemskova, R. Malek, L. Hugendubler, C.
Cochran, J. Solomon, C. Chen, P. Gorden, Thyroid hormone induced brown adipose
tissue and amelioration of diabetes in a patient with extreme insulin resistance, J.
Clin. Endocrinol. Metab. 95 (2010) 256–262. https://doi.org/10.1210/jc.2009-0543.
[58] L.S. Sidossis, C. Porter, M.K. Saraf, E. Børsheim, R.S. Radhakrishnan, T. Chao, A. Ali,
M. Chondronikola, R. Mlcak, C.C. Finnerty, H.K. Hawkins, T. Toliver-Kinsky, D.N.
Herndon, Browning of Subcutaneous White Adipose Tissue in Humans after Severe
Adrenergic Stress, Cell Metab. 22 (2015) 219–227.
https://doi.org/10.1016/j.cmet.2015.06.022.
[59] A. Ruban, K. Stoenchev, H. Ashrafian, J. Teare, Current treatments for obesity, Clin.
Med. J. R. Coll. Physicians London. 19 (2019) 205–212.
https://doi.org/10.7861/clinmedicine.19-3-205.
[60] R.K.C. Loh, B.A. Kingwell, A.L. Carey, Human brown adipose tissue as a target for
obesity management; beyond cold-induced thermogenesis, Obes. Rev. 18 (2017)
1227–1242. https://doi.org/10.1111/obr.12584.
[61] C.M. Kusminski, P.E. Bickel, P.E. Scherer, Targeting adipose tissue in the treatment
of obesity-associated diabetes, Nat. Rev. Drug Discov. 15 (2016) 639–660.
https://doi.org/10.1038/nrd.2016.75.
100
[62] A.A.J.J. Van Der Lans, J. Hoeks, B. Brans, G.H.E.J. Vijgen, M.G.W. Visser, M.J.
Vosselman, J. Hansen, J.A. Jörgensen, J. Wu, F.M. Mottaghy, P. Schrauwen, W.D. Van
Marken Lichtenbelt, Cold acclimation recruits human brown fat and increases
nonshivering thermogenesis, J. Clin. Invest. 123 (2013) 3395–3403.
https://doi.org/10.1172/JCI68993.
[63] D.P. Blondin, S.M. Labbé, H.C. Tingelstad, C. Noll, M. Kunach, S. Phoenix, B. Guérin,
É.E. Turcotte, A.C. Carpentier, D. Richard, F. Haman, Increased brown adipose tissue
oxidative capacity in cold-acclimated humans, J. Clin. Endocrinol. Metab. 99 (2014)
E438-46. https://doi.org/10.1210/jc.2013-3901.
[64] T. Yoneshiro, S. Aita, M. Matsushita, T. Kayahara, T. Kameya, Y. Kawai, T. Iwanaga,
M. Saito, Recruited brown adipose tissue as an antiobesity agent in humans, J. Clin.
Invest. 123 (2013) 3404–3408. https://doi.org/10.1172/JCI67803.
[65] K.Y. Chen, R.J. Brychta, J.D. Linderman, S. Smith, A. Courville, W. Dieckmann, P.
Herscovitch, C.M. Millo, A. Remaley, P. Lee, F.S. Celi, Brown fat activation mediates
cold-induced thermogenesis in adult humans in response to a mild decrease in
ambient temperature, J. Clin. Endocrinol. Metab. 98 (2013) E1218-23.
https://doi.org/10.1210/jc.2012-4213.
[66] S. Srivastava, R.L. Veech, Brown and brite: The fat soldiers in the anti-obesity fight,
Front. Physiol. 10 (2019). https://doi.org/10.3389/fphys.2019.00038.
[67] C. Weyer, P.A. Tataranni, S. Snitker, E. Danforth, E. Ravussin, Increase in insulin
action and fat oxidation after treatment with CL 316,243, a highly selective β3-
adrenoceptor agonist in humans, Diabetes. 47 (1998) 1555–1561.
https://doi.org/10.2337/diabetes.47.10.1555.
[68] L.M. Redman, L. De Jonge, X. Fang, B. Gamlin, D. Recker, F.L. Greenway, S.R. Smith,
E. Ravussin, Lack of an effect of a novel β3-adrenoceptor agonist, TAK-677, on energy
metabolism in obese individuals: A double-blind, placebo-controlled randomized
study, J. Clin. Endocrinol. Metab. 92 (2007) 527–531.
https://doi.org/10.1210/jc.2006-1740.
101
[69] J.R.S. Arch, The discovery of drugs for obesity, the metabolic effects of leptin and
variable receptor pharmacology: Perspectives from β3- adrenoceptor agonists,
Naunyn. Schmiedebergs. Arch. Pharmacol. 378 (2008) 225–240.
https://doi.org/10.1007/s00210-008-0271-1.
[70] T.M. Larsen, S. Toubro, M.A. Van Baak, K.M. Gottesdiener, P. Larson, W.H.M. Saris,
A. Astrup, Effect of a 28-d treatment with L-796568, a novel β 3-adrenergic receptor
agonist, on energy expenditure and body composition in obese men, Am. J. Clin.
Nutr. 76 (2002) 780–788. https://doi.org/10.1093/ajcn/76.4.780.
[71] A.M. Cypess, L.S. Weiner, C. Roberts-Toler, E.F. Elía, S.H. Kessler, P.A. Kahn, J. English,
K. Chatman, S.A. Trauger, A. Doria, G.M. Kolodny, Activation of Human Brown
Adipose Tissue by a β3-Adrenergic Receptor Agonist, Cell Metab. 21 (2015) 33–38.
https://doi.org/10.1016/J.CMET.2014.12.009.
[72] A.E. O’Mara, J.W. Johnson, J.D. Linderman, R.J. Brychta, S. McGehee, L.A. Fletcher,
Y.A. Fink, D. Kapuria, T.M. Cassimatis, N. Kelsey, C. Cero, Z.A. Sater, F. Piccinini, A.S.
Baskin, B.P. Leitner, H. Cai, C.M. Millo, W. Dieckmann, M. Walter, N.B. Javitt, Y.
Rotman, P.J. Walter, M. Ader, R.N. Bergman, P. Herscovitch, K.Y. Chen, A.M. Cypess,
Chronic mirabegron treatment increases human brown fat, HDL cholesterol, and
insulin sensitivity, J. Clin. Invest. 130 (2020) 2209–2219.
https://doi.org/10.1172/JCI131126.
[73] B.S. Finlin, H. Memetimin, A.L. Confides, I. Kasza, B. Zhu, H.J. Vekaria, B. Harfmann,
K.A. Jones, Z.R. Johnson, P.M. Westgate, C.M. Alexander, P.G. Sullivan, E.E. Dupont-
Versteegden, P.A. Kern, Human adipose beiging in response to cold and mirabegron,
JCI Insight. 3 (2018). https://doi.org/10.1172/jci.insight.121510.
[74] G. Medina-Gomez, R.M. Calvo, M.-J. Obregon, Thermogenic effect of
triiodothyroacetic acid at low doses in rat adipose tissue without adverse side effects
in the thyroid axis, Am. J. Physiol. Metab. 294 (2008) E688–E697.
https://doi.org/10.1152/ajpendo.00417.2007.
102
[75] J.Z. Lin, A.J. Martagón, S.L. Cimini, D.D. Gonzalez, D.W. Tinkey, A. Biter, J.D. Baxter,
P. Webb, J.Å. Gustafsson, S.M. Hartig, K.J. Phillips, Pharmacological Activation of
Thyroid Hormone Receptors Elicits a Functional Conversion of White to Brown Fat,
Cell Rep. 13 (2015) 1528–1537. https://doi.org/10.1016/j.celrep.2015.10.022.
[76] I. Klein, K. Ojamaa, Thyroid Hormone and the Cardiovascular System, N. Engl. J. Med.
344 (2001) 501–509. https://doi.org/10.1056/NEJM200102153440707.
[77] M. Aprile, M.R. Ambrosio, V. D’Esposito, F. Beguinot, P. Formisano, V. Costa, A.
Ciccodicola, PPARG in Human Adipogenesis: Differential Contribution of Canonical
Transcripts and Dominant Negative Isoforms, PPAR Res. 2014 (2014).
https://doi.org/10.1155/2014/537865.
[78] J.X. Rong, Y. Qiu, M.K. Hansen, L. Zhu, V. Zhang, M. Xie, Y. Okamoto, M.D. Mattie, H.
Higashiyama, S. Asano, J.C. Strum, T.E. Ryan, Adipose mitochondrial biogenesis is
suppressed in db/db and high-fat diet-fed mice and improved by rosiglitazone,
Diabetes. 56 (2007) 1751–1760. https://doi.org/10.2337/db06-1135.
[79] D. Halbgebauer, M. Dahlhaus, M. Wabitsch, P. Fischer-Posovszky, D. Tews, Browning
capabilities of human primary adipose-derived stromal cells compared to SGBS cells,
Sci. Rep. 10 (2020) 1–8. https://doi.org/10.1038/s41598-020-64369-7.
[80] R.E. Soccio, E.R. Chen, M.A. Lazar, Thiazolidinediones and the promise of insulin
sensitization in type 2 diabetes, Cell Metab. 20 (2014) 573–591.
https://doi.org/10.1016/j.cmet.2014.08.005.
[81] A. Abbas, J. Blandon, J. Rude, A. Elfar, D. Mukherjee, PPAR- γ Agonist in
Treatment of Diabetes: Cardiovascular Safety Considerations, Cardiovasc. Hematol.
Agents Med. Chem. 10 (2012) 124–134.
https://doi.org/10.2174/187152512800388948.
[82] D. Cuevas-Ramos, R. Mehta, C.A. Aguilar-Salinas, Fibroblast growth factor 21 and
browning of white adipose tissue, Front. Physiol. 10 (2019).
https://doi.org/10.3389/fphys.2019.00037.
103
[83] G. Gaich, J.Y. Chien, H. Fu, L.C. Glass, M.A. Deeg, W.L. Holland, A. Kharitonenkov, T.
Bumol, H.K. Schilske, D.E. Moller, The effects of LY2405319, an FGF21 Analog, in
obese human subjects with type 2 diabetes, Cell Metab. 18 (2013) 333–340.
https://doi.org/10.1016/j.cmet.2013.08.005.
[84] S. Talukdar, Y. Zhou, D. Li, M. Rossulek, J. Dong, V. Somayaji, Y. Weng, R. Clark, A.
Lanba, B.M. Owen, M.B. Brenner, J.K. Trimmer, K.E. Gropp, J.R. Chabot, D.M. Erion,
T.P. Rolph, B. Goodwin, R.A. Calle, A long-acting FGF21 molecule, PF-05231023,
decreases body weight and improves lipid profile in non-human primates and type
2 diabetic subjects, Cell Metab. 23 (2016) 427–440.
https://doi.org/10.1016/j.cmet.2016.02.001.
[85] K. Shinoda, I.H.N. Luijten, Y. Hasegawa, H. Hong, S.B. Sonne, M. Kim, R. Xue, M.
Chondronikola, A.M. Cypess, Y.H. Tseng, J. Nedergaard, L.S. Sidossis, S. Kajimura,
Genetic and functional characterization of clonally derived adult human brown
adipocytes, Nat. Med. 21 (2015) 389–394. https://doi.org/10.1038/nm.3819.
[86] A. Perdikari, G.G. Leparc, M. Balaz, N.D. Pires, M.E. Lidell, W. Sun, F. Fernandez-
Albert, S. Müller, N. Akchiche, H. Dong, L. Balazova, L. Opitz, E. Röder, H. Klein, P.
Stefanicka, L. Varga, P. Nuutila, K.A. Virtanen, T. Niemi, M. Taittonen, G. Rudofsky, J.
Ukropec, S. Enerbäck, E. Stupka, H. Neubauer, C. Wolfrum, BATLAS: Deconvoluting
Brown Adipose Tissue, Cell Rep. 25 (2018) 784-797.e4.
https://doi.org/10.1016/j.celrep.2018.09.044.
[87] F. Villarroya, R. Cereijo, J. Villarroya, M. Giralt, Brown adipose tissue as a secretory
organ, Nat. Rev. Endocrinol. 13 (2017) 26–35.
https://doi.org/10.1038/nrendo.2016.136.
[88] H. Takahashi, C.R.R. Alves, K.I. Stanford, R.J.W. Middelbeek, P. Nigro, R.E. Ryan, R.
Xue, M. Sakaguchi, M.D. Lynes, K. So, J.D. Mul, M.-Y. Lee, E. Balan, H. Pan, J.M.
Dreyfuss, M.F. Hirshman, M. Azhar, J.C. Hannukainen, P. Nuutila, K.K. Kalliokoski, S.
Nielsen, B.K. Pedersen, C.R. Kahn, Y.-H. Tseng, L.J. Goodyear, TGF-β2 is an exercise-
induced adipokine that regulates glucose and fatty acid metabolism, Nat. Metab.
2019 12. 1 (2019) 291. https://doi.org/10.1038/s42255-018-0030-7.
104
[89] M. Morikawa, R. Derynck, K. Miyazono, TGF- β and the TGF-β family: Context-
dependent roles in cell and tissue physiology, Cold Spring Harb. Perspect. Biol. 8
(2016) a021873. https://doi.org/10.1101/cshperspect.a021873.
[90] H. Chang, C.W. Brown, M.M. Matzuk, Genetic analysis of the mammalian
transforming growth factor-β superfamily, Endocr. Rev. 23 (2002) 787–823.
https://doi.org/10.1210/er.2002-0003.
[91] R. Derynck, E.H. Budi, Specificity, versatility, and control of TGF-b family signaling,
Sci. Signal. 12 (2019) eaav5183. https://doi.org/10.1126/scisignal.aav5183.
[92] M.M. Shull, I. Ormsby, A.B. Kier, S. Pawlowski, R.J. Diebold, M. Yin, R. Allen, C.
Sidman, G. Proetzel, D. Calvin, N. Annunziata, T. Doetschman, Targeted disruption of
the mouse transforming growth factor-β1 gene results in multifocal inflammatory
disease [14], Nature. 359 (1992) 693–699. https://doi.org/10.1038/359693a0.
[93] A.B. Kulkarni, C.G. Huh, D. Becker, A. Geiser, M. Lyght, K.C. Flanders, A.B. Roberts,
M.B. Sporn, J.M. Ward, S. Karlsson, Transforming growth factor β1 null mutation in
mice causes excessive inflammatory response and early death, Proc. Natl. Acad. Sci.
U. S. A. 90 (1993) 770–774. https://doi.org/10.1073/pnas.90.2.770.
[94] L.P. Sanford, I. Ormsby, A.C. Gittenberger-de Groot, H. Sariola, R. Friedman, G.P.
Boivin, E. Lou Cardell, T. Doetschman, TGFβ2 knockout mice have multiple
developmental defects that are non-overlapping with other TGFβ knockout
phenotypes, Development. 124 (1997) 2659–2670.
[95] V. Kaartinen, J.W. Voncken, C. Shuler, D. Warburton, D. Bu, N. Heisterkamp, J.
Groffen, Abnormal lung development and cleft palate in mice lacking TGF–β3
indicates defects of epithelial–mesenchymal interaction, Nat. Genet. 11 (1995) 415–
421. https://doi.org/10.1038/ng1295-415.
[96] C.K. Tan, H.C. Chong, E.H.P. Tan, N.S. Tan, Getting “Smad” about obesity and
diabetes, Nutr. Diabetes. 2 (2012) e29–e29. https://doi.org/10.1038/nutd.2012.1.
105
[97] H. Yadav, C. Quijano, A.K. Kamaraju, O. Gavrilova, R. Malek, W. Chen, P. Zerfas, D.
Zhigang, E.C. Wright, C. Stuelten, P. Sun, S. Lonning, M. Skarulis, A.E. Sumner, T.
Finkel, S.G. Rane, Protection from obesity and diabetes by blockade of TGF-β/Smad3
signaling, Cell Metab. 14 (2011) 67–79. https://doi.org/10.1016/j.cmet.2011.04.013.
[98] Y. Tsurutani, M. Fujimoto, M. Takemoto, H. Irisuna, M. Koshizaka, S. Onishi, T.
Ishikawa, M. Mezawa, P. He, S. Honjo, Y. Maezawa, Y. Saito, K. Yokote, The roles of
transforming growth factor-β and Smad3 signaling in adipocyte differentiation and
obesity, Biochem. Biophys. Res. Commun. 407 (2011) 68–73.
https://doi.org/10.1016/j.bbrc.2011.02.106.
[99] R.L. Sparks, B.J. Allen, E.E. Strauss, TGF‐β blocks early but not late differentiation‐
specific gene expression and morphologic differentiation of 3T3 T proadipocytes, J.
Cell. Physiol. 150 (1992) 568–577. https://doi.org/10.1002/jcp.1041500318.
[100] L. Choy, R. Derynck, Transforming growth factor-β inhibits adipocyte differentiation
by Smad3 interacting with CCAAT/enhancer-binding protein (C/EBP) and repressing
C/EBP transactivation function, J. Biol. Chem. 278 (2003) 9609–9619.
https://doi.org/10.1074/jbc.M212259200.
[101] H. Liang, W.F. Ward, PGC-1α: A key regulator of energy metabolism, Am. J. Physiol.
- Adv. Physiol. Educ. 30 (2006) 145–151.
https://doi.org/10.1152/advan.00052.2006.
[102] U.D. Wankhade, J.H. Lee, P.K. Dagur, H. Yadav, M. Shen, W. Chen, A.B. Kulkarni, J.P.
McCoy, T. Finkel, A.M. Cypess, S.G. Rane, TGF-β receptor 1 regulates progenitors that
promote browning of white fat, Mol. Metab. 16 (2018) 160–171.
https://doi.org/10.1016/j.molmet.2018.07.008.
[103] C.K. Tan, N. Leuenberger, M.J. Tan, Y.W. Yan, Y. Chen, R. Kambadur, W. Wahli, N.S.
Tan, Smad3 deficiency in mice protects against insulin resistance and obesity
induced by a high-fat diet, Diabetes. 60 (2011) 464–476.
https://doi.org/10.2337/db10-0801.
106
[104] I.B. Robertson, M. Horiguchi, L. Zilberberg, B. Dabovic, K. Hadjiolova, D.B. Rifkin,
Latent TGF-β-binding proteins, Elsevier, 2015.
https://doi.org/10.1016/j.matbio.2015.05.005.
[105] K. Yoshinaga, H. Obata, V. Jurukovski, R. Mazzieri, Y. Chen, L. Zilberberg, D. Huso, J.
Melamed, P. Prijatelj, V. Todorovic, B. Dabovic, D.B. Rifkin, Perturbation of
transforming growth factor (TGF)-β1 association with latent TGF-β binding protein
yields inflammation and tumors, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 18758–
18763. https://doi.org/10.1073/pnas.0805411105.
[106] D.B. Rifkin, W.J. Rifkin, L. Zilberberg, LTBPs in biology and medicine: LTBP diseases,
Matrix Biol. 71–72 (2018) 90–99. https://doi.org/10.1016/j.matbio.2017.11.014.
[107] V. Todorovic, D.B. Rifkin, LTBPs, more than just an escort service, J. Cell. Biochem.
113 (2012) 410–418. https://doi.org/10.1002/jcb.23385.
[108] M.R. Davis, R. Andersson, J. Severin, M. de Hoon, N. Bertin, J.K. Baillie, H. Kawaji, A.
Sandelin, A.R.R. Forrest, K.M. Summers, Transcriptional profiling of the human
fibrillin/LTBP gene family, key regulators of mesenchymal cell functions, Mol. Genet.
Metab. 112 (2014) 73–83. https://doi.org/10.1016/J.YMGME.2013.12.006.
[109] I.B. Robertson, D.B. Rifkin, Regulation of the bioavailability of TGF-β and TGF-β-
related proteins, Cold Spring Harb. Perspect. Biol. 8 (2016).
https://doi.org/10.1101/cshperspect.a021907.
[110] J. Saharinen, J. Keski-Oja, Specific sequence motif of 8-Cys repeats of TGF-β binding
proteins, LTBPs, creates a hydrophobic interaction surface for binding of small latent
TGF-β, Mol. Biol. Cell. 11 (2000) 2691–2704.
https://doi.org/10.1091/mbc.11.8.2691.
[111] C. Unsöld, M. Hyytiäinen, L. Bruckner-Tuderman, J. Keski-Oja, Latent TGF-β binding
protein LTBP-1 contains three potential extracellular matrix interacting domains, J.
Cell Sci. 114 (2001) 187–197.
107
[112] S.L. Dallas, P. Sivakumar, C.J.P. Jones, Q. Chen, D.M. Peters, D.F. Mosher, M.J.
Humphries, C.M. Kielty, Fibronectin regulates latent transforming growth factor-β
(TGFβ) by controlling matrix assembly of latent TGFβ-binding protein-1, J. Biol.
Chem. 280 (2005) 18871–18880. https://doi.org/10.1074/jbc.M410762200.
[113] J.P. Annes, Y. Chen, J.S. Munger, D.B. Rifkin, Integrin αvβ6-mediated activation of
latent TGF-β requires the latent TGF-β binding protein-1, J. Cell Biol. 165 (2004) 723–
734. https://doi.org/10.1083/jcb.200312172.
[114] L. Fontana, Y. Chen, P. Prijatelj, T. Sakai, R. Fässler, L.Y. Sakai, D.B. Rifkin, Fibronectin
is required for integrin o:vβ6‐mediated activation of latent TGF‐β complexes
containing LTBP‐1, FASEB J. 19 (2005) 1798–1808. https://doi.org/10.1096/fj.05-
4134com.
[115] A. Gualandris, J.P. Annes, M. Arese, I. Noguera, V. Jurukovski, D.B. Rifkin, The Latent
Transforming Growth Factor-beta -binding Protein-1 Promotes In Vitro
Differentiation of Embryonic Stem Cells into Endothelium, Mol. Biol. Cell. 11 (2000)
4295–4308. https://doi.org/10.1091/mbc.11.12.4295.
[116] V. Todorovic, D. Frendewey, D.E. Gutstein, Y. Chen, L. Freyer, E. Finnegan, F. Liu, A.
Murphy, D. Valenzuela, G. Yancopoulos, D.B. Rifkin, Long form of latent TGF-β
binding protein 1 (Ltbp1L) is essential for cardiac outflow tract septation and
remodeling, Development. 134 (2007) 3723–3732.
https://doi.org/10.1242/dev.008599.
[117] M. Horiguchi, V. Todorovic, K. Hadjiolova, R. Weiskirchen, D.B. Rifkin, Abrogation of
both short and long forms of latent transforming growth factor-β binding protein-1
causes defective cardiovascular development and is perinatally lethal, Matrix Biol.
43 (2015) 61–70. https://doi.org/10.1016/j.matbio.2015.03.006.
[118] T. Inoue, T. Ohbayashi, Y. Fujikawa, H. Yoshida, T.O. Akama, K. Noda, M. Horiguchi,
K. Kameyama, Y. Hata, K. Takahashi, K. Kusumoto, T. Nakamura, Latent TGF-β
binding protein-2 is essential for the development of ciliary zonule microfibrils, Hum.
Mol. Genet. 23 (2014) 5672–5682. https://doi.org/10.1093/hmg/ddu283.
108
[119] M. Narooie-Nejad, S.H. Paylakhi, S. Shojaee, Z. Fazlali, M. Rezaei Kanavi, N.
Nilforushan, S. Yazdani, F. Babrzadeh, F. Suri, M. Ronaghi, E. Elahi, C. Paisán-Ruiz,
Loss of function mutations in the gene encoding latent transforming growth factor
beta binding protein 2, LTBP2, cause primary congenital glaucoma, Hum. Mol. Genet.
18 (2009) 3969–3977. https://doi.org/10.1093/hmg/ddp338.
[120] M. Ali, M. McKibbin, A. Booth, D.A. Parry, P. Jain, S.A. Riazuddin, J.F. Hejtmancik, S.N.
Khan, S. Firasat, M. Shires, D.F. Gilmour, K. Towns, A.L. Murphy, D. Azmanov, I.
Tournev, S. Cherninkova, H. Jafri, Y. Raashid, C. Toomes, J. Craig, D.A. Mackey, L.
Kalaydjieva, S. Riazuddin, C.F. Inglehearn, Null Mutations in LTBP2 Cause Primary
Congenital Glaucoma, Am. J. Hum. Genet. 84 (2009) 664–671.
https://doi.org/10.1016/j.ajhg.2009.03.017.
[121] M. Hirai, M. Horiguchi, T. Ohbayashi, T. Kita, K.R. Chien, T. Nakamura, Latent TGF-β-
binding protein 2 binds to DANCE/fibulin-5 and regulates elastic fiber assembly,
EMBO J. 26 (2007) 3283–3295. https://doi.org/10.1038/sj.emboj.7601768.
[122] P. Vehviläinen, M. Hyytiäinen, J. Keski-Oja, Matrix association of latent TGF-beta
binding protein-2 (LTBP-2) is dependent on fibrillin-1, J. Cell. Physiol. 221 (2009) 586–
593. https://doi.org/10.1002/jcp.21888.
[123] X. Sun, R. Essalmani, D. Susan-Resiga, A. Prat, N.G. Seidah, Latent transforming
growth factor β-binding proteins-2 and -3 inhibit the proprotein convertase 5/6A, J.
Biol. Chem. 286 (2011) 29063–29073. https://doi.org/10.1074/jbc.M111.242479.
[124] S.B. Anderson, A.L. Goldberg, M. Whitman, Identification of a novel pool of
extracellular pro-myostatin in skeletal muscle, J. Biol. Chem. 283 (2008) 7027–7035.
https://doi.org/10.1074/jbc.M706678200.
[125] Y. Chen, B. Dabovic, J.P. Annes, D.B. Rifkin, Latent TGF-β binding protein-3 (LTBP-3)
requires binding to TGF-β for secretion, FEBS Lett. 517 (2002) 277–280.
https://doi.org/10.1016/S0014-5793(02)02648-0.
109
[126] S. Morkmued, J. Hemmerle, E. Mathieu, V. Laugel-Haushalter, B. Dabovic, D.B. Rifkin,
P. Dollé, K. Niederreither, A. Bloch-Zupan, Enamel and dental anomalies in latent-
transforming growth factor beta-binding protein 3 mutant mice, Eur. J. Oral Sci. 125
(2017) 8–17. https://doi.org/10.1111/eos.12328.
[127] B. Dabovic, Y. Chem, C. Colarossi, L. Zambuto, H. Obata, D.B. Rifkin, Bone defects in
latent TGF-β binding protein (Ltbp)-3 null mice; a role for Ltbp in TGF-β presentation,
J. Endocrinol. 175 (2002) 129–141. https://doi.org/10.1677/joe.0.1750129.
[128] A. Sterner-Kock, I.S. Thorey, K. Koli, F. Wempe, J. Otte, T. Bangsow, K. Kuhlmeier, T.
Kirchner, S. Jin, J. Keski-Oja, H. Von Melchner, Disruption of the gene encoding the
latent transforming growth factor-β binding protein 4 (LTBP-4) causes abnormal lung
development, cardiomyopathy, and colorectal cancer, Genes Dev. 16 (2002) 2264–
2273. https://doi.org/10.1101/gad.229102.
[129] K. Noda, B. Dabovic, K. Takagi, T. Inoue, M. Horiguchi, M. Hirai, Y. Fujikawa, T.O.
Akama, K. Kusumoto, L. Zilberberg, L.Y. Sakai, K. Koli, M. Naitoh, H. Von Melchner, S.
Suzuki, D.B. Rifkin, T. Nakamura, Latent TGF-β binding protein 4 promotes elastic
fiber assembly by interacting with fibulin-5, Proc. Natl. Acad. Sci. U. S. A. 110 (2013)
2852–2857. https://doi.org/10.1073/pnas.1215779110.
[130] B. Dabovic, I.B. Robertson, L. Zilberberg, M. Vassallo, E.C. Davis, D.B. Rifkin, Function
of latent TGFβ binding protein 4 and fibulin 5 in elastogenesis and lung development,
J. Cell. Physiol. 230 (2015) 226–236. https://doi.org/10.1002/jcp.24704.
[131] M. Wabitsch, R.E. Brenner, I. Melzner, M. Braun, P. Möller, E. Heinze, K.M. Debatin,
H. Hauner, Characterization of a human preadipocyte cell strain with high capacity
for adipose differentiation, Int. J. Obes. 25 (2001) 8–15.
https://doi.org/10.1038/sj.ijo.0801520.
[132] D. Tews, T. Pula, J.B.B. Funcke, M. Jastroch, M. Keuper, K.M.M. Debatin, M.
Wabitsch, P. Fischer-Posovszky, Elevated UCP1 levels are sufficient to improve
glucose uptake in human white adipocytes, Redox Biol. 26 (2019) 101286.
https://doi.org/10.1016/j.redox.2019.101286.
110
[133] T. Reisser, D. Halbgebauer, J. Scheurer, L. Wolf, F. Leithäuser, N. Beyersdorf, P.
Fischer-Posovszky, K.-M. Debatin, G. Strauss, In vitro-generated alloantigen-specific
Th9 cells mediate antileukemia cytotoxicity in the absence of graft-versus-host
disease, Leukemia. (2020) 4–9. https://doi.org/10.1038/s41375-020-0731-2.
[134] M. Jinek, K. Chylinski, I. Fonfara, M. Hauer, J.A. Doudna, E. Charpentier, A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,
Science (80-. ). 337 (2012) 816–821. https://doi.org/10.1126/science.1225829.
[135] P. Mali, L. Yang, K.M. Esvelt, J. Aach, M. Guell, J.E. DiCarlo, J.E. Norville, G.M. Church,
RNA-guided human genome engineering via Cas9, Science (80-. ). 339 (2013) 823–
826. https://doi.org/10.1126/science.1232033.
[136] J. Albers, C. Danzer, M. Rechsteiner, H. Lehmann, L.P. Brandt, T. Hejhal, A. Catalano,
P. Busenhart, A.F. Gonçalves, S. Brandt, P.K. Bode, B. Bode-Lesniewska, P.J. Wild, I.J.
Frew, A versatile modular vector system for rapid combinatorial mammalian
genetics, J. Clin. Invest. 125 (2015) 1603–1619. https://doi.org/10.1172/JCI79743.
[137] F. Katzen, Gateway® recombinational cloning: A biological operating system, Expert
Opin. Drug Discov. 2 (2007) 571–589. https://doi.org/10.1517/17460441.2.4.571.
[138] J.G. Doench, N. Fusi, M. Sullender, M. Hegde, E.W. Vaimberg, K.F. Donovan, I. Smith,
Z. Tothova, C. Wilen, R. Orchard, H.W. Virgin, J. Listgarten, D.E. Root, Optimized
sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.,
Nat. Biotechnol. 34 (2016) 184–91. https://doi.org/10.1038/nbt.3437.
[139] K.R. Sanson, R.E. Hanna, M. Hegde, K.F. Donovan, C. Strand, M.E. Sullender, E.W.
Vaimberg, A. Goodale, D.E. Root, F. Piccioni, J.G. Doench, Optimized libraries for
CRISPR-Cas9 genetic screens with multiple modalities, Nat. Commun. 9 (2018).
https://doi.org/10.1038/s41467-018-07901-8.
[140] E. Kowarz, D. Löscher, R. Marschalek, Optimized Sleeping Beauty transposons rapidly
generate stable transgenic cell lines, Biotechnol. J. 10 (2015) 647–653.
https://doi.org/10.1002/biot.201400821.
111
[141] L. Mátés, M.K.L. Chuah, E. Belay, B. Jerchow, N. Manoj, A. Acosta-Sanchez, D.P.
Grzela, A. Schmitt, K. Becker, J. Matrai, L. Ma, E. Samara-Kuko, C. Gysemans, D.
Pryputniewicz, C. Miskey, B. Fletcher, T. Vandendriessche, Z. Ivics, Z. Izsvák,
Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables
robust stable gene transfer in vertebrates, Nat. Genet. 41 (2009) 753–761.
https://doi.org/10.1038/ng.343.
[142] Broad Institute, sgRNA Designer: CRISPRko, (2018).
https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design (accessed
April 2, 2020).
[143] P. Fischer-Posovszky, F.S. Newell, M. Wabitsch, H.E. Tornqvist, Human SGBS cells - A
unique tool for studies of human fat cell biology, Obes. Facts. 1 (2008) 184–189.
https://doi.org/10.1159/000145784.
[144] D. Tews, T. Fromme, M. Keuper, S.M. Hofmann, K.M. Debatin, M. Klingenspor, M.
Wabitsch, P. Fischer-Posovszky, Teneurin-2 (TENM2) deficiency induces UCP1
expression in differentiating human fat cells, Mol. Cell. Endocrinol. 443 (2017) 106–
113. https://doi.org/10.1016/j.mce.2017.01.015.
[145] D. Tews, P. Fischer-Posovszky, T. Fromme, M. Klingenspor, J. Fischer, U. Rüther, R.
Marienfeld, T.F. Barth, P. Möller, K.M. Debatin, M. Wabitsch, FTO deficiency induces
UCP-1 expression and mitochondrial uncoupling in adipocytes, Endocrinology. 154
(2013) 3141–3151. https://doi.org/10.1210/en.2012-1873.
[146] E.C.M. Mariman, P. Wang, Adipocyte extracellular matrix composition, dynamics and
role in obesity, Cell. Mol. Life Sci. . 67 (2010) 1277. https://doi.org/10.1007/S00018-
010-0263-4.
[147] A. Koncarevic, S. Kajimura, M. Cornwall-Brady, A. Andreucci, A. Pullen, D. Sako, R.
Kumar, A. V. Grinberg, K. Liharska, J.A. Ucran, E. Howard, B.M. Spiegelman, J. Seehra,
J. Lachey, A novel therapeutic approach to treating obesity through modulation of
TGFβ signaling, Endocrinology. 153 (2012) 3133–3146.
https://doi.org/10.1210/en.2012-1016.
112
[148] B. Dabovic, Y. Chen, J. Choi, E.C. Davis, L.Y. Sakai, V. Todorovic, M. Vassallo, L.
Zilberberg, A. Singh, D.B. Rifkin, Control of Lung Development by Latent TGF-β
Binding Proteins, (n.d.). https://doi.org/10.1002/jcp.22479.
[149] C. Penttinen, J. Saharinen, K. Weikkolainen, M. Hyytiäinen, J. Keski-Oja, Secretion of
human latent TGF-beta-binding protein-3 (LTBP-3) is dependent on co-expression of
TGF-beta., J. Cell Sci. 115 (2002) 3457–68.
http://www.ncbi.nlm.nih.gov/pubmed/12154076 (accessed March 26, 2020).
[150] A.L. Hafner, J. Contet, C. Ravaud, X. Yao, P. Villageois, K. Suknuntha, K. Annab, P.
Peraldi, B. Binetruy, I.I. Slukvin, A. Ladoux, C. Dani, Brown-like adipose progenitors
derived from human induced pluripotent stem cells: Identification of critical
pathways governing their adipogenic capacity, Sci. Rep. 6 (2016).
https://doi.org/10.1038/srep32490.
[151] Y. Takeda, P. Dai, A developed serum-free medium and an optimized chemical
cocktail for direct conversion of human dermal fibroblasts into brown adipocytes,
Sci. Rep. 10 (2020) 1–13. https://doi.org/10.1038/s41598-020-60769-x.
[152] C. Sirard, J.L. De La Pompa, A. Elia, A. Itie, C. Mirtsos, A. Cheung, S. Hahn, A.
Wakeham, L. Schwartz, S.E. Kern, J. Rossant, T.W. Mak, The tumor suppressor gene
Smad4/Dpc4 is required for gastrulation and later for anterior development of the
mouse embryo, Genes Dev. 12 (1998) 107–119.
https://doi.org/10.1101/gad.12.1.107.
[153] S. Modica, L.G. Straub, M. Balaz, W. Sun, C. Wolfrum, L. Varga, B. Ukropcova, J.
Ukropec, L. Varga, P. Stefanicka, M. Profant, B. Ukropcova, H. Neubauer, E. Simon,
Bmp4 Promotes a Brown to White-like Adipocyte Shift, Cell Rep. 16 (2016) 2243–
2258. https://doi.org/10.1016/j.celrep.2016.07.048.
113
[154] P. Petrus, N. Mejhert, P. Corrales, S. Lecoutre, Q. Li, E. Maldonado, A. Kulyté, Y.
Lopez, M. Campbell, J.R. Acosta, J. Laurencikiene, I. Douagi, H. Gao, C. Martínez-
Álvarez, P. Hedén, K.L. Spalding, A. Vidal-Puig, G. Medina-Gomez, P. Arner, M. Rydén,
P. Petrus, A. Vidal-Puig, Y. Lopez, H. Gao, S. Lecoutre, J. Laurencikiene, E. Maldonado,
M. Rydén, N. Mejhert, A. Kulyté, P. Hedén, M. Campbell, Q. Li, G. Medina-Gomez, P.
Arner, K.L. Spalding, P. Corrales, J.R. Acosta, Transforming Growth Factor-β3
Regulates Adipocyte Number in Subcutaneous White Adipose Tissue, Cell Rep. 25
(2018) 551-560.e5. https://doi.org/10.1016/j.celrep.2018.09.069.
[155] A.M. McInerney-Leo, C. Le Goff, P.J. Leo, T.J. Kenna, P. Keith, J.E. Harris, R. Steer, C.
Bole-Feysot, P. Nitschke, C. Kielty, M.A. Brown, A. Zankl, E.L. Duncan, V. Cormier-
Daire, Mutations in LTBP3 cause acromicric dysplasia and geleophysic dysplasia, J.
Med. Genet. 53 (2016) 457–464. https://doi.org/10.1136/jmedgenet-2015-103647.
[156] M.E. Lindsay, D. Schepers, N.A. Bolar, J.J. Doyle, E. Gallo, J. Fert-Bober, M.J.E.
Kempers, E.K. Fishman, Y. Chen, L. Myers, D. Bjeda, G. Oswald, A.F. Elias, H.P. Levy,
B.M. Anderlid, M.H. Yang, E.M.H.F. Bongers, J. Timmermans, A.C. Braverman, N.
Canham, G.R. Mortier, H.G. Brunner, P.H. Byers, J. Van Eyk, L. Van Laer, H.C. Dietz,
B.L. Loeys, Loss-of-function mutations in TGFB2 cause a syndromic presentation of
thoracic aortic aneurysm, Nat. Genet. 44 (2012) 922–927.
https://doi.org/10.1038/ng.2349.
[157] C.C. Chan, M.S.M.A. Damen, P.C. Alarcon, J. Sanchez-Gurmaches, S. Divanovic,
Inflammation and Immunity: From an Adipocyte’s Perspective, J. Interf. Cytokine
Res. 39 (2019) 459–471. https://doi.org/10.1089/jir.2019.0014.
[158] A. Rosenow, T.N. Arrey, F.G. Bouwman, J.P. Noben, M. Wabitsch, E.C.M. Mariman,
M. Karas, J. Renes, Identification of novel human adipocyte secreted proteins by
using SGBS cells, J. Proteome Res. 9 (2010) 5389–5401.
https://doi.org/10.1021/pr100621g.
[159] Y. Zhang, Q. Liu, J. Yu, S. Yu, J. Wang, L. Qiang, Z. Gu, Locally Induced Adipose Tissue
Browning by Microneedle Patch for Obesity Treatment, ACS Nano. 11 (2017) 9223–
9230. https://doi.org/10.1021/acsnano.7b04348.
114
[160] C.-H. Wang, M. Lundh, A. Fu, R. Kriszt, T.L. Huang, M.D. Lynes, L.O. Leiria, F. Shamsi,
J. Darcy, B.P. Greenwood, N.R. Narain, V. Tolstikov, K.L. Smith, B. Emanuelli, Y.-T.
Chang, S. Hagen, N.N. Danial, M.A. Kiebish, Y.-H. Tseng, CRISPR-engineered human
brown-like adipocytes prevent diet-induced obesity and ameliorate metabolic
syndrome in mice., Sci. Transl. Med. 12 (2020).
https://doi.org/10.1126/scitranslmed.aaz8664.
[161] Pipeline | Biontech, (n.d.). https://biontech.de/de/science/pipeline (accessed
September 7, 2020).
[162] Pipeline – CureVac, (n.d.). https://www.curevac.com/en/pipeline/ (accessed
September 7, 2020).
[163] C. Jiang, M.A. Cano-Vega, F. Yue, L. Kuang, N. Narayanan, G. Uzunalli, M.P. Merkel,
S. Kuang, M. Deng, Dibenzazepine-Loaded Nanoparticles Induce Local Browning of
White Adipose Tissue to Counteract Obesity, Mol. Ther. 25 (2017) 1718–1729.
https://doi.org/10.1016/j.ymthe.2017.05.020.
[164] Y. Xue, X. Xu, X.Q. Zhang, O.C. Farokhzad, R. Langer, Preventing diet-induced obesity
in mice by adipose tissue transformation and angiogenesis using targeted
nanoparticles, Proc. Natl. Acad. Sci. U. S. A. 113 (2016) 5552–5557.
https://doi.org/10.1073/pnas.1603840113.
115
7. Register of illustrations and figure permissions
Table 1: In vivo knockout phenotype and TGFβ binding properties of the LTBP isoforms. ............................ 16
Table 2: Primer used for qPCR or sequencing .............................................................................................. 30
Table 3: Small interfering RNAs used for in vitro gene knockdown .............................................................. 32
Table 4: Antibodies used for Western blot ................................................................................................... 32
Table 5: sgRNA used for CRISPR/Cas9 mediated gene knockout .................................................................. 33
Table 6: Plasmids used for cloning ............................................................................................................... 34
Table 7: Primer used for Gen Art Genomic Cleavage Assay .......................................................................... 35
Table 8: Seeding densities for SGBS cell differentiation approach ................................................................ 38
Table 9: SDS-PAGE running conditions for different protein properties ....................................................... 41
Table 10: Plasmids used for LR Gateway cloning for single CRIPSR/Cas9 knockout constructs ..................... 49
Table 11: Plasmids used for LR Gateway cloning for triple CRIPSR/Cas9 knockout construct ........................ 49
Figure 1: Morphology of different types of adipocytes. ................................................................................. 2
Figure 2: Molecular mechanism of BAT activation. ........................................................................................ 4
Figure 3: Distribution of adipose tissue and its temperature sensitivity in mice ............................................. 8
Figure 4: TGFβ-SMAD signaling pathway...................................................................................................... 11
Figure 5: Secretion of the large latent complex (LLC). .................................................................................. 14
Figure 6: Study design to identify new factors involved in the adipogenesis towards a brown adipocyte
phenotype. .................................................................................................................................................. 17
Figure 7: LR Gateway cloning with multiple fragments ................................................................................ 45
Figure 8: Expression of LTBP family members in isolated hASCs from subcutaneous and deep neck adipose
tissue ........................................................................................................................................................... 53
Figure 9: Expression of LTBP isoforms in human adipose tissue and in isolated and in in vitro differentiated
human adipose derived stem cells ............................................................................................................... 53
Figure 10: Expression of differentiation marker and LTBP members in SGBS cells during adipogenesis........ 55
Figure 11: Transfection with CRISPR/Cas9 knockout constructs leads to stable downregulation of LTBPs in
SGBS cells .................................................................................................................................................... 57
Figure 12: Reduced LTBP expression has no effect on adipogenic differentiation and mitochondrial content..
.................................................................................................................................................................... 59
Figure 13: LTBP2 and LTBP3 deficiency leads to a decreased UCP1 expression ............................................ 60
Figure 14: Schematic view of a seahorse plot .............................................................................................. 62
Figure 15: LTBP deficiency alters the metabolic function of SGBS adipocytes .............................................. 63
Figure 16: LTBP3 correlates significant positive with UCP1 mRNA expression in human subcutaneous adipose
tissue ........................................................................................................................................................... 64
Figure 17: TGFβ ligands and TGFβ receptors are expressed during adipogenesis of SGBS cells. ................... 66
Figure 18: TGFβ ligand and receptor expression of isolated hASCs from dn and sc adipose tissue ............... 66
116
Figure 19: Transfection with CRISPR/Cas9 triple knockout construct leads to stable downregulation of TGFβ
ligands in SGBS cells during adipogenesis .................................................................................................... 67
Figure 20: No changes on adipogenic differentiation and mitochondrial content after CRISPR/Cas9 mediated
TGFβ1-3 knockout:. ..................................................................................................................................... 68
Figure 21: Decreased UCP1 expression in TGFβ1-3 deficient SGBS adipocytes. ............................................ 69
Figure 22: Inhibition of TGFβ receptor1 kinase leads to significant alterations in differentiation marker and
UCP1 expression. ......................................................................................................................................... 71
Figure 23: Decrease of UCP1 expression and oxygen consumption rate upon SMAD4 knockdown. ............. 72
Figure 24: LTBP2 and LTBP3 deficiency alters the TGFβ2 content in SGBS preadipocyte supernatant .......... 73
Figure 25: TGFβ2 deficiency leads to a higher differentiation rate ............................................................... 74
Figure 26: TGFβ2 deficiency leads to a reduction of UCP1 and a decreased response to cAMP. ................... 75
Figure 27: TGFβ2 mRNA expression correlates positive with UCP1 in human subcutaneous adipose tissue
samples. ...................................................................................................................................................... 76
117
Figure permission
Figure 2 was taken from P.G. Crichton, Y. Lee, E.R.S. Kunji, The molecular features of
uncoupling protein 1 support a conventional mitochondrial carrier-like mechanism,
Biochimie. 134 (2017) 35–50. https://doi.org/10.1016/j.biochi.2016.12.016.
I have read and understood the user license: https://creativecommons.org/licenses/by-nc-
nd/4.0/; accessed on 14.09.2020
Figure 3 was taken from J. Sanchez-Gurmaches, C.M. Hung, D.A. Guertin, Emerging
Complexities in Adipocyte Origins and Identity, Trends Cell Biol. 26 (2016) 313–326.
https://doi.org/10.1016/j.tcb.2016.01.004
in agreement with Elsevier.
Figure 4 was taken from E.H. Budi, D. Duan, R. Derynck, Transforming Growth Factor-β
Receptors and Smads: Regulatory Complexity and Functional Versatility, Trends Cell Biol.
27 (2017) 658–672. https://doi.org/10.1016/j.tcb.2017.04.005.
I have read an understood the terms and conditions of using AAA material in a thesis or
dissertation: https://www.sciencemag.org/help/reprints-and-permissions; accessed on
14.09.2020.
Figure 5 was taken from V. Todorovic, D.B. Rifkin, LTBPs, more than just an escort service,
J. Cell. Biochem. 113 (2012) 410–418. https://doi.org/10.1002/jcb.23385
in agreement with John Wiley and Sons.
118
Appendix I
pMuSE SB CRISPR/Cas9 sgRNA:
Figure S1: Vector map of the final CRISPR/Cas9 knockout construct for single gene knockout. The vector carries eGFP (bright green) and puromycin resistance (mint green) under the control of a RPL13A promoter. Both genes are separated by a P2A sequence which enables cleavage of the gene product into two separate protein. Cas9 (red) expression is controlled by a CMV promotor and the expression of the introduced sgRNA cassette (orange) is under the control of a U6 promoter. These genes are flanked by inverted repeats (ITRs, light blue), the SB transposase recognition sites.
Sequence pMuSE SB CRISPR/Cas9 sgRNA:
atgaccgagtacaagcccacGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCG
GGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG
TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTC
TCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGG
CTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGATTCGAAGGCCTGTCGTGAAGCTTGGGGATCAATTCTCTAGAGCTCGCTG
ATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTG
AGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCT
GGGCCTACTAGCTACTCGGGACCCCTTACCGAAACATCGCCGCATTCTGCAGAGGAGTCGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGAAATAAAAGCTGAAATGAATCATTCTCTCT
ACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCTAACTGACCTAAGACAGGGAATTTTTACTAGGATTAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTA
TGTAAACTTCCGACTTCAACTGTATAGGGATCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGG
GGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG
TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT
GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTC
CAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAAC
AGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAA
AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGT
GTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAG
119
TGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTC
GTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT
ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG
CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCA
CTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC
CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGATGCGGTG
TGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATATTTTGTTAAAATTGGATCCCTATACAGTTGAAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAA
ACTCGTTTTTCAACTACTCCACAAATTTCTTGTTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTCCAACAATTGTTTACAGACAGATTATTTCACTTATA
ATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAGTTCGACTCCTCTGCAGAATGCGGCGATGTTTCGGTAAGGGGTCCGCTATCTAGACACAAGTTTGTACAAAAAAGCAGGCTCTA
TCGATCACGAGACTAGCCTCGAGCGGCCGCCCCCTTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAA
GATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATAT
ATCTTGTGGAAAGGACGAAACACCGxxxxxxxxxxxxxxxxxxxxGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGAATTCG
ACAACTTTGTATACAAAAGTTGGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACA
TAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACG
GTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCA
GTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTT
TTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACT
GCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTTGGTACCGCCACCATGGACAAGAAGTACTCCATTGGGCTCGATATCGGCACAAACAGCGTCGGCTGGGCCGTCATTACG
GACGAGTACAAGGTGCCGAGCAAAAAATTCAAAGTTCTGGGCAATACCGATCGCCACAGCATAAAGAAGAACCTCATTGGCGCCCTCCTGTTCGACTCCGGGGAGACGGCCGAAGCCACGCGGCTCAAA
AGAACAGCACGGCGCAGATATACCCGCAGAAAGAATCGGATCTGCTACCTGCAGGAGATCTTTAGTAATGAGATGGCTAAGGTGGATGACTCTTTCTTCCATAGGCTGGAGGAGTCCTTTTTGGTGGAGG
AGGATAAAAAGCACGAGCGCCACCCAATCTTTGGCAATATCGTGGACGAGGTGGCGTACCATGAAAAGTACCCAACCATATATCATCTGAGGAAGAAGCTTGTAGACAGTACTGATAAGGCTGACTTGC
GGTTGATCTATCTCGCGCTGGCGCATATGATCAAATTTCGGGGACACTTCCTCATCGAGGGGGACCTGAACCCAGACAACAGCGATGTCGACAAACTCTTTATCCAACTGGTTCAGACTTACAATCAGCTTT
TCGAAGAGAACCCGATCAACGCATCCGGAGTTGACGCCAAAGCAATCCTGAGCGCTAGGCTGTCCAAATCCCGGCGGCTCGAAAACCTCATCGCACAGCTCCCTGGGGAGAAGAAGAACGGCCTGTTTG
GTAATCTTATCGCCCTGTCACTCGGGCTGACCCCCAACTTTAAATCTAACTTCGACCTGGCCGAAGATGCCAAGCTTCAACTGAGCAAAGACACCTACGATGATGATCTCGACAATCTGCTGGCCCAGATCG
GCGACCAGTACGCAGACCTTTTTTTGGCGGCAAAGAACCTGTCAGACGCCATTCTGCTGAGTGATATTCTGCGAGTGAACACGGAGATCACCAAAGCTCCGCTGAGCGCTAGTATGATCAAGCGCTATGA
TGAGCACCACCAAGACTTGACTTTGCTGAAGGCCCTTGTCAGACAGCAACTGCCTGAGAAGTACAAGGAAATTTTCTTCGATCAGTCTAAAAATGGCTACGCCGGATACATTGACGGCGGAGCAAGCCAG
GAGGAATTTTACAAATTTATTAAGCCCATCTTGGAAAAAATGGACGGCACCGAGGAGCTGCTGGTAAAGCTTAACAGAGAAGATCTGTTGCGCAAACAGCGCACTTTCGACAATGGAAGCATCCCCCACC
AGATTCACCTGGGCGAACTGCACGCTATCCTCAGGCGGCAAGAGGATTTCTACCCCTTTTTGAAAGATAACAGGGAAAAGATTGAGAAAATCCTCACATTTCGGATACCCTACTATGTAGGCCCCCTCGCC
CGGGGAAATTCCAGATTCGCGTGGATGACTCGCAAATCAGAAGAGACCATCACTCCCTGGAACTTCGAGGAAGTCGTGGATAAGGGGGCCTCTGCCCAGTCCTTCATCGAAAGGATGACTAACTTTGATA
AAAATCTGCCTAACGAAAAGGTGCTTCCTAAACACTCTCTGCTGTACGAGTACTTCACAGTTTATAACGAGCTCACCAAGGTCAAATACGTCACAGAAGGGATGAGAAAGCCAGCATTCCTGTCTGGAGAG
CAGAAGAAAGCTATCGTGGACCTCCTCTTCAAGACGAACCGGAAAGTTACCGTGAAACAGCTCAAAGAAGACTATTTCAAAAAGATTGAATGTTTCGACTCTGTTGAAATCAGCGGAGTGGAGGATCGCT
TCAACGCATCCCTGGGAACGTATCACGATCTCCTGAAAATCATTAAAGACAAGGACTTCCTGGACAATGAGGAGAACGAGGACATTCTTGAGGACATTGTCCTCACCCTTACGTTGTTTGAAGATAGGGA
GATGATTGAAGAACGCTTGAAAACTTACGCTCATCTCTTCGACGACAAAGTCATGAAACAGCTCAAGAGGCGCCGATATACAGGATGGGGGCGGCTGTCAAGAAAACTGATCAATGGGATCCGAGACAA
GCAGAGTGGAAAGACAATCCTGGATTTTCTTAAGTCCGATGGATTTGCCAACCGGAACTTCATGCAGTTGATCCATGATGACTCTCTCACCTTTAAGGAGGACATCCAGAAAGCACAAGTTTCTGGCCAGG
GGGACAGTCTTCACGAGCACATCGCTAATCTTGCAGGTAGCCCAGCTATCAAAAAGGGAATACTGCAGACCGTTAAGGTCGTGGATGAACTCGTCAAAGTAATGGGAAGGCATAAGCCCGAGAATATCG
TTATCGAGATGGCCCGAGAGAACCAAACTACCCAGAAGGGACAGAAGAACAGTAGGGAAAGGATGAAGAGGATTGAAGAGGGTATAAAAGAACTGGGGTCCCAAATCCTTAAGGAACACCCAGTTGA
AAACACCCAGCTTCAGAATGAGAAGCTCTACCTGTACTACCTGCAGAACGGCAGGGACATGTACGTGGATCAGGAACTGGACATCAATCGGCTCTCCGACTACGACGTGGATCATATCGTGCCCCAGTCT
TTTCTCAAAGATGATTCTATTGATAATAAAGTGTTGACAAGATCCGATAAAAATAGAGGGAAGAGTGATAACGTCCCCTCAGAAGAAGTTGTCAAGAAAATGAAAAATTATTGGCGGCAGCTGCTGAACG
CCAAACTGATCACACAACGGAAGTTCGATAATCTGACTAAGGCTGAACGAGGTGGCCTGTCTGAGTTGGATAAAGCCGGCTTCATCAAAAGGCAGCTTGTTGAGACACGCCAGATCACCAAGCACGTGG
CCCAAATTCTCGATTCACGCATGAACACCAAGTACGATGAAAATGACAAACTGATTCGAGAGGTGAAAGTTATTACTCTGAAGTCTAAGCTGGTCTCAGATTTCAGAAAGGACTTTCAGTTTTATAAGGTG
AGAGAGATCAACAATTACCACCATGCGCATGATGCCTACCTGAATGCAGTGGTAGGCACTGCACTTATCAAAAAATATCCCAAGCTTGAATCTGAATTTGTTTACGGAGACTATAAAGTGTACGATGTTAG
GAAAATGATCGCAAAGTCTGAGCAGGAAATAGGCAAGGCCACCGCTAAGTACTTCTTTTACAGCAATATTATGAATTTTTTCAAGACCGAGATTACACTGGCCAATGGAGAGATTCGGAAGCGACCACTT
ATCGAAACAAACGGAGAAACAGGAGAAATCGTGTGGGACAAGGGTAGGGATTTCGCGACAGTCCGGAAGGTCCTGTCCATGCCGCAGGTGAACATCGTTAAAAAGACCGAAGTACAGACCGGAGGCTT
CTCCAAGGAAAGTATCCTCCCGAAAAGGAACAGCGACAAGCTGATCGCACGCAAAAAAGATTGGGACCCCAAGAAATACGGCGGATTCGATTCTCCTACAGTCGCTTACAGTGTACTGGTTGTGGCCAAA
GTGGAGAAAGGGAAGTCTAAAAAACTCAAAAGCGTCAAGGAACTGCTGGGCATCACAATCATGGAGCGATCAAGCTTCGAAAAAAACCCCATCGACTTTCTCGAGGCGAAAGGATATAAAGAGGTCAA
AAAAGACCTCATCATTAAGCTTCCCAAGTACTCTCTCTTTGAGCTTGAAAACGGCCGGAAACGAATGCTCGCTAGTGCGGGCGAGCTGCAGAAAGGTAACGAGCTGGCACTGCCCTCTAAATACGTTAATT
TCTTGTATCTGGCCAGCCACTATGAAAAGCTCAAAGGGTCTCCCGAAGATAATGAGCAGAAGCAGCTGTTCGTGGAACAACACAAACACTACCTTGATGAGATCATCGAGCAAATAAGCGAATTCTCCAA
AAGAGTGATCCTCGCCGACGCTAACCTCGATAAGGTGCTTTCTGCTTACAATAAGCACAGGGATAAGCCCATCAGGGAGCAGGCAGAAAACATTATCCACTTGTTTACTCTGACCAACTTGGGCGCGCCTG
CAGCCTTCAAGTACTTCGACACCACCATAGACAGAAAGCGGTACACCTCTACAAAGGAGGTCCTGGACGCCACACTGATTCATCAGTCAATTACGGGGCTCTATGAAACAAGAATCGACCTCTCTCAGCTC
GGTGGAGACAGCAGGGCTGACCCCAAGAAGAAGAGGAAGGTGTGAGCGGCCGCGACTCTAGAGGTACCCAGCTTTCTTGTACAAAGTGGTGGCCTGTCAGGCCAAGCTTCCATCGATAGACATGATAA
GATACATTGATGAGTTTGGACAAACCACAACAAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATT
GCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTACCTAGGCGAGACCCTGTCTCACAAAATAAAGTAAGCCCGGACTGAGTGCGGA
AAGGCGGGCCTGGCGGGTCTGGTCTCCCCATGCGGGCCACCAGAGGCCCTGCAGCCTTCAGTCGCTTGAAGGGGTAATGGCGCTTCCACTCACAAACATGGCGGACAGAGCGTGTGAACGAGATGAAC
AGCCCCTCAAAAATATGGCCGCCGAGGCTGGACGGCCGTGCCCCAGCAGCACCGCCTCCGCGCCCCACGTGATCTCTCGCCGGGCACAGCGCTGACCGCGGAGGTCCAACCGGAAGAATGTCCGGATTG
GACATTCGGAAGAGGGCCCGCCTTCCCTGGGGAATCTCTGCGCACGCGCAGAACGCTTCGACCAATGAAAACACAGGAAGCCGTCCGCGCAACCGCGTTGCGTCACTTCTGCCGCCCCTGTTTCAAGGTA
TATAGCCGTAGACGGAACTTCGCCTTTCTCTCGGCCTTAGCGCCATTTTTTTGGGTGAGTGTTTTTTGGTTCCTGCGTTGGGATTCCGTGTACAATCCATAGACATCTGACCTCGGCACTTAGCATCATCACA
GCAAACTAACTGTAGCCTTTCTCTCTTTCCCTGTAGAAACCTCTGCACCTGAGGCCACCATGTTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAA
CGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTAC
GGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCG
CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATC
ATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTG
CCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
GGCAGTGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGTGACGTCgaggagaatcctggcccc
120
xxxxxxxxxxxxxxxxxxxx=
GGTCACCGATCGAGAGCTAG: Empty vector
GTGGAACTGTGGGTACCTCC: LTBP1 KO
CAGGTGGCAGAACTTCCCGG: LTBP2 KO
CGGCGTTCGAGCTCTCAATG: LTBP3 KO
CTGCGATCCTGGGTACCACG: LTBP4 KO
AGAAAACTATAAAGTCCACT: TGFβ2 KO
TTGATGTCACCGGAGTTGTG: TGFβ1 KO
pMuSE SB CRISPR/Cas9 TGFβ1-3KO:
Figure S2: Vector map of the final CRISPR/Cas9 knockout construct for triple gene knockout of TGFβ1-3. The vector carries eGFP (bright green) and puromycin resistance (mint green) under the control of a RPL13A promoter. Both genes are separated by P2A which leads to two separate proteins. A CMV promoter controls the Cas9 (red) and a U6 promoter each sgRNA (orange and purple). These genes are flanked by inverted repeats (ITRs, light blue), the Sleeping Beauty transposase recognition sites.
121
Sequence pMuSE SB CRISPR/Cas9 TGFβ1-3 KO:
atgaccgagtacaagcccacGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCG
GGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG
TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTC
TCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGG
CTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGATTCGAAGGCCTGTCGTGAAGCTTGGGGATCAATTCTCTAGAGCTCGCTG
ATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTG
AGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCT
GGGCCTACTAGCTACTCGGGACCCCTTACCGAAACATCGCCGCATTCTGCAGAGGAGTCGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGAAATAAAAGCTGAAATGAATCATTCTCTCT
ACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCTAACTGACCTAAGACAGGGAATTTTTACTAGGATTAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTA
TGTAAACTTCCGACTTCAACTGTATAGGGATCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGG
GGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG
TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT
GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTC
CAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAAC
AGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAA
AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGT
GTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAG
TGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTC
GTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT
ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG
CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCA
CTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC
CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGATGCGGTG
TGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATATTTTGTTAAAATTGGATCCCTATACAGTTGAAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAA
ACTCGTTTTTCAACTACTCCACAAATTTCTTGTTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTCCAACAATTGTTTACAGACAGATTATTTCACTTATA
ATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAGTTCGACTCCTCTGCAGAATGCGGCGATGTTTCGGTAAGGGGTCCGCTATCTAGACACAAGTTTGTACAAAAAAGCAGGCTCTA
TCGATCACGAGACTAGCCTCGAGCGGCCGCCCCCTTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAA
GATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATAT
ATCTTGTGGAAAGGACGAAACACCGTTGATGTCACCGGAGTTGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGA
ATTCGACAACTTTGTATACAAAAGTTGCTATCGATCACGAGACTAGCCTCGAGCGGCCGCCCCCTTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGAT
AATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACT
TGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCGACGAAGAGTACTACGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA
AAGTGGCACCGAGTCGGTGCTTTTTTTGAATTCGCACCCAACTTTTCTATACAAAGTTGCTATCGATCACGAGACTAGCCTCGAGCGGCCGCCCCCTTCACCGAGGGCCTATTTCCCATGATTCCTTCATATT
TGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTT
TTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGATAAATTCGACATGATCCAGGTTTTAGAGCTAGAAATAGCAAGTT
AAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGAATTCGACAACTTTGTATAATAAAGTTGGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACT
AGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATG
ACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAAT
GACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGT
GGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGG
CGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTTGGTACCGCCACCAT
GGACAAGAAGTACTCCATTGGGCTCGATATCGGCACAAACAGCGTCGGCTGGGCCGTCATTACGGACGAGTACAAGGTGCCGAGCAAAAAATTCAAAGTTCTGGGCAATACCGATCGCCACAGCATAAA
GAAGAACCTCATTGGCGCCCTCCTGTTCGACTCCGGGGAGACGGCCGAAGCCACGCGGCTCAAAAGAACAGCACGGCGCAGATATACCCGCAGAAAGAATCGGATCTGCTACCTGCAGGAGATCTTTAG
TAATGAGATGGCTAAGGTGGATGACTCTTTCTTCCATAGGCTGGAGGAGTCCTTTTTGGTGGAGGAGGATAAAAAGCACGAGCGCCACCCAATCTTTGGCAATATCGTGGACGAGGTGGCGTACCATGA
AAAGTACCCAACCATATATCATCTGAGGAAGAAGCTTGTAGACAGTACTGATAAGGCTGACTTGCGGTTGATCTATCTCGCGCTGGCGCATATGATCAAATTTCGGGGACACTTCCTCATCGAGGGGGAC
CTGAACCCAGACAACAGCGATGTCGACAAACTCTTTATCCAACTGGTTCAGACTTACAATCAGCTTTTCGAAGAGAACCCGATCAACGCATCCGGAGTTGACGCCAAAGCAATCCTGAGCGCTAGGCTGTC
CAAATCCCGGCGGCTCGAAAACCTCATCGCACAGCTCCCTGGGGAGAAGAAGAACGGCCTGTTTGGTAATCTTATCGCCCTGTCACTCGGGCTGACCCCCAACTTTAAATCTAACTTCGACCTGGCCGAAG
ATGCCAAGCTTCAACTGAGCAAAGACACCTACGATGATGATCTCGACAATCTGCTGGCCCAGATCGGCGACCAGTACGCAGACCTTTTTTTGGCGGCAAAGAACCTGTCAGACGCCATTCTGCTGAGTGAT
ATTCTGCGAGTGAACACGGAGATCACCAAAGCTCCGCTGAGCGCTAGTATGATCAAGCGCTATGATGAGCACCACCAAGACTTGACTTTGCTGAAGGCCCTTGTCAGACAGCAACTGCCTGAGAAGTACA
AGGAAATTTTCTTCGATCAGTCTAAAAATGGCTACGCCGGATACATTGACGGCGGAGCAAGCCAGGAGGAATTTTACAAATTTATTAAGCCCATCTTGGAAAAAATGGACGGCACCGAGGAGCTGCTGGT
AAAGCTTAACAGAGAAGATCTGTTGCGCAAACAGCGCACTTTCGACAATGGAAGCATCCCCCACCAGATTCACCTGGGCGAACTGCACGCTATCCTCAGGCGGCAAGAGGATTTCTACCCCTTTTTGAAAG
ATAACAGGGAAAAGATTGAGAAAATCCTCACATTTCGGATACCCTACTATGTAGGCCCCCTCGCCCGGGGAAATTCCAGATTCGCGTGGATGACTCGCAAATCAGAAGAGACCATCACTCCCTGGAACTTC
GAGGAAGTCGTGGATAAGGGGGCCTCTGCCCAGTCCTTCATCGAAAGGATGACTAACTTTGATAAAAATCTGCCTAACGAAAAGGTGCTTCCTAAACACTCTCTGCTGTACGAGTACTTCACAGTTTATAA
CGAGCTCACCAAGGTCAAATACGTCACAGAAGGGATGAGAAAGCCAGCATTCCTGTCTGGAGAGCAGAAGAAAGCTATCGTGGACCTCCTCTTCAAGACGAACCGGAAAGTTACCGTGAAACAGCTCAA
AGAAGACTATTTCAAAAAGATTGAATGTTTCGACTCTGTTGAAATCAGCGGAGTGGAGGATCGCTTCAACGCATCCCTGGGAACGTATCACGATCTCCTGAAAATCATTAAAGACAAGGACTTCCTGGACA
ATGAGGAGAACGAGGACATTCTTGAGGACATTGTCCTCACCCTTACGTTGTTTGAAGATAGGGAGATGATTGAAGAACGCTTGAAAACTTACGCTCATCTCTTCGACGACAAAGTCATGAAACAGCTCAA
GAGGCGCCGATATACAGGATGGGGGCGGCTGTCAAGAAAACTGATCAATGGGATCCGAGACAAGCAGAGTGGAAAGACAATCCTGGATTTTCTTAAGTCCGATGGATTTGCCAACCGGAACTTCATGCA
GTTGATCCATGATGACTCTCTCACCTTTAAGGAGGACATCCAGAAAGCACAAGTTTCTGGCCAGGGGGACAGTCTTCACGAGCACATCGCTAATCTTGCAGGTAGCCCAGCTATCAAAAAGGGAATACTG
CAGACCGTTAAGGTCGTGGATGAACTCGTCAAAGTAATGGGAAGGCATAAGCCCGAGAATATCGTTATCGAGATGGCCCGAGAGAACCAAACTACCCAGAAGGGACAGAAGAACAGTAGGGAAAGGAT
GAAGAGGATTGAAGAGGGTATAAAAGAACTGGGGTCCCAAATCCTTAAGGAACACCCAGTTGAAAACACCCAGCTTCAGAATGAGAAGCTCTACCTGTACTACCTGCAGAACGGCAGGGACATGTACGT
GGATCAGGAACTGGACATCAATCGGCTCTCCGACTACGACGTGGATCATATCGTGCCCCAGTCTTTTCTCAAAGATGATTCTATTGATAATAAAGTGTTGACAAGATCCGATAAAAATAGAGGGAAGAGT
122
GATAACGTCCCCTCAGAAGAAGTTGTCAAGAAAATGAAAAATTATTGGCGGCAGCTGCTGAACGCCAAACTGATCACACAACGGAAGTTCGATAATCTGACTAAGGCTGAACGAGGTGGCCTGTCTGAG
TTGGATAAAGCCGGCTTCATCAAAAGGCAGCTTGTTGAGACACGCCAGATCACCAAGCACGTGGCCCAAATTCTCGATTCACGCATGAACACCAAGTACGATGAAAATGACAAACTGATTCGAGAGGTGA
AAGTTATTACTCTGAAGTCTAAGCTGGTCTCAGATTTCAGAAAGGACTTTCAGTTTTATAAGGTGAGAGAGATCAACAATTACCACCATGCGCATGATGCCTACCTGAATGCAGTGGTAGGCACTGCACTT
ATCAAAAAATATCCCAAGCTTGAATCTGAATTTGTTTACGGAGACTATAAAGTGTACGATGTTAGGAAAATGATCGCAAAGTCTGAGCAGGAAATAGGCAAGGCCACCGCTAAGTACTTCTTTTACAGCAA
TATTATGAATTTTTTCAAGACCGAGATTACACTGGCCAATGGAGAGATTCGGAAGCGACCACTTATCGAAACAAACGGAGAAACAGGAGAAATCGTGTGGGACAAGGGTAGGGATTTCGCGACAGTCCG
GAAGGTCCTGTCCATGCCGCAGGTGAACATCGTTAAAAAGACCGAAGTACAGACCGGAGGCTTCTCCAAGGAAAGTATCCTCCCGAAAAGGAACAGCGACAAGCTGATCGCACGCAAAAAAGATTGGG
ACCCCAAGAAATACGGCGGATTCGATTCTCCTACAGTCGCTTACAGTGTACTGGTTGTGGCCAAAGTGGAGAAAGGGAAGTCTAAAAAACTCAAAAGCGTCAAGGAACTGCTGGGCATCACAATCATGG
AGCGATCAAGCTTCGAAAAAAACCCCATCGACTTTCTCGAGGCGAAAGGATATAAAGAGGTCAAAAAAGACCTCATCATTAAGCTTCCCAAGTACTCTCTCTTTGAGCTTGAAAACGGCCGGAAACGAAT
GCTCGCTAGTGCGGGCGAGCTGCAGAAAGGTAACGAGCTGGCACTGCCCTCTAAATACGTTAATTTCTTGTATCTGGCCAGCCACTATGAAAAGCTCAAAGGGTCTCCCGAAGATAATGAGCAGAAGCAG
CTGTTCGTGGAACAACACAAACACTACCTTGATGAGATCATCGAGCAAATAAGCGAATTCTCCAAAAGAGTGATCCTCGCCGACGCTAACCTCGATAAGGTGCTTTCTGCTTACAATAAGCACAGGGATAA
GCCCATCAGGGAGCAGGCAGAAAACATTATCCACTTGTTTACTCTGACCAACTTGGGCGCGCCTGCAGCCTTCAAGTACTTCGACACCACCATAGACAGAAAGCGGTACACCTCTACAAAGGAGGTCCTG
GACGCCACACTGATTCATCAGTCAATTACGGGGCTCTATGAAACAAGAATCGACCTCTCTCAGCTCGGTGGAGACAGCAGGGCTGACCCCAAGAAGAAGAGGAAGGTGTGAGCGGCCGCGACTCTAGAG
GTACCCAGCTTTCTTGTACAAAGTGGTGGCCTGTCAGGCCAAGCTTCCATCGATAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACAAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAA
TTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTA
CAAATGTGGTACCTAGGCGAGACCCTGTCTCACAAAATAAAGTAAGCCCGGACTGAGTGCGGAAAGGCGGGCCTGGCGGGTCTGGTCTCCCCATGCGGGCCACCAGAGGCCCTGCAGCCTTCAGTCGCT
TGAAGGGGTAATGGCGCTTCCACTCACAAACATGGCGGACAGAGCGTGTGAACGAGATGAACAGCCCCTCAAAAATATGGCCGCCGAGGCTGGACGGCCGTGCCCCAGCAGCACCGCCTCCGCGCCCCA
CGTGATCTCTCGCCGGGCACAGCGCTGACCGCGGAGGTCCAACCGGAAGAATGTCCGGATTGGACATTCGGAAGAGGGCCCGCCTTCCCTGGGGAATCTCTGCGCACGCGCAGAACGCTTCGACCAATG
AAAACACAGGAAGCCGTCCGCGCAACCGCGTTGCGTCACTTCTGCCGCCCCTGTTTCAAGGTATATAGCCGTAGACGGAACTTCGCCTTTCTCTCGGCCTTAGCGCCATTTTTTTGGGTGAGTGTTTTTTGG
TTCCTGCGTTGGGATTCCGTGTACAATCCATAGACATCTGACCTCGGCACTTAGCATCATCACAGCAAACTAACTGTAGCCTTTCTCTCTTTCCCTGTAGAAACCTCTGCACCTGAGGCCACCATGTTGAGCA
AGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAA
GTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGC
CCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG
GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGG
CAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCAC
ATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCAGTGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGTGACGTCgaggagaatcctggcccc
123
Appendix II
Figure S3: TGFβ1 treatment inhibits the adipogenic differentiation of SGBS cells. SGBS preadipocytes were treated with different concentrations of recombinant TGFβ1 (r TGFβ1) during adipogenesis. (A) Pictures were taken on day 14 and (B) protein expression of Adiponectin was assessed by Western Blot. Tubulin served as a reference, n=1.
124
Figure S4: TGFβ1 deficiency does not alter UCP1 expression or metabolic function. TGFβ1 deficiency was achieved by CRISPR/Cas9 in SGBS preadipocytes, which were subjected to adipogenic differentiation for 14 days. (A) Representative Western blot of EV and TGFβ1-deficient SGBS preadipocytes of n=3 independent experiments with GAPDH as loading control. (B) Microscopic pictures of EV and TGFβ1-deficient SGBS adipocytes, 10-fold magnification. (C) mRNA expression of differentiation marker PPARG, GLUT4, Adiponectin and (D) UCP1 was determined by q-RT-PCR. HPRT serves as a reference gene. Mean +SEM of n=4 (E) Representative Western blot is shown of EV and TGFβ1-deficient SGBS adipocytes and densitometric analysis was performed in n=3 independent experiments, GAPDH serves as a loading control. (F) OCR over time of n=4 individual experiments. To calculate basal and maximum respiration, as well as ATP production, proton leak and cAMP response, cells were treated with dibutyryl-cAMP (cAMP), oligomycin (Oligo), carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycin/rotenone (Ant/Rot). Mean +SEM of n=4
125
Table S1: p-values of correlated mRNA expression in human WAT. UCP1 and LTBP mRNA expression was correlated with the TGFβ ligands and receptors mRNA expression in human mamma subcutaneous adipose tissue of n=28 patients which underwent plastic surgery. Mean age±SD = 45±15 years, Mean BMI±SD = 28.2±4.9 kg/m². A linear regression was applied and p<0.05 is considered as statistically significant (marked in bolt).
LTBP1 LTBP2 LTBP3 LTBP4 UCP1
UCP1 p=0.7582 p=0.2710 p=0.0382 p=0.1573 -
TGFβ1 p=0.2355 p=0.0258 p=0.3372 p=0.8546 p =0.3361
TGFβ2 p=0.2585 p=0.1180 p=0.0100 p=0.1618 p<0.0001
TGFβ3 p=0.1968 p=0.1585 p=0.2336 p=0.4400 p=0.3786
TGFβR1 p=0.654 p=0.0197 p<0.0001 p=0.2762 p<0.0001
TGFβR2 p=0.0884 p=0.7880 p=0.0015 p=0.0871 p=0.3467
TGFβR3 p=0.3178 p=0.0266 p<0.0001 p=0.0149 p=0.3668
126
Acknowledgements
The acknowledgements were removed for data privacy protection reasons.
127
Statutory declaration
I hereby declare that I wrote the present dissertation with the topic:
“Role of secreted factors in white and brown adipogenesis”
independently and used no other aids that those cited. In each individual case, I have clearly
identified the source of the passages that are taken word for word or paraphrased from
other works.
I also hereby declare that I have carried out my scientific work according to the principles
of good scientific practice in accordance with the current “ Satzung der Universität Ulm zur
Sicherung guter wissenschaftlicher Praxis” [Rules of the University of Ulm for Assuring
Good Scientific Practice]
Ulm, 25.11.2020
Daniel Halbgebauer
128
Curriculum vitae
Personal information
Name: Daniel Halbgebauer
Year of Birth: 1990
Dissertation
06/2017-12/2020 PhD student at the University Medical Center Ulm
➢ Department of Pediatrics and Adolescent Medicine
➢ Experimental endocrinology and metabolism research
➢ Title: Role of secreted factors for white and brown adipocyte differentiation
Education
10/2014-04/2017 Master of science Biochemistry University of Ulm
➢ Thesis at the department of peptide pharmaceuticals ➢ Title: Development of a biomedical bilayer hydrogel for
catching and killing Pseudomonas aeruginosa
09/2015-05/2016 2 Semesters at the University of Massachusetts-Amherst-USA,
➢ Fellowship of the Baden Württemberg exchange program
10/2011-09/2014 Bachelor of science Biochemistry University of Ulm
➢ Bachelor thesis at the internal medicine II, section for sports and rehabilitation medicine
➢ Title: The effect of estradiol and testosterone on the irisin signaling pathway.
09/2010 - 05/2011 Civil service Paulinenpflege Winnenden
09/2001 - 07/2010 Abitur Lessing-Gymnasium Winnenden
129
Conferences
Annual meeting of the German Obesity Association 2018, Wiesbaden, Germany Poster presentation: Investigation of the browning capacity in human cell models during adipogenesis Daniel Halbgebauer, Martin Wabitsch, Meike Dahlhaus, Pamela Fischer-Posovszky, Daniel Tews Poster presentation: Investigation of the functional role of Matrix Gla Protein in adipocytes Daniel Halbgebauer, Jan-Bernd Funcke, Heike Neubauer, Bradford Hamilton, Martin Wabitsch, Pamela Fischer-Posovszky, Daniel Tews
Publications:
Halbgebauer D, Dahlhaus M, Wabitsch M, Fischer-Posovszky P, Tews D. Browning capabilities of human primary adipose-derived stromal cells compared to SGBS cells. Sci Rep. 2020;10(1):1-8. doi:10.1038/s41598-020-64369-7
Reisser T, Halbgebauer D, Scheurer J, Wolf L, Leithäuser F, Beyersdorf N, Fischer-Posovszky P, Debatin KM, Strauss G. In vitro-generated alloantigen-specific Th9 cells mediate antileukemia cytotoxicity in the absence of graft-versus-host disease. Leukemia. February 2020:1-6. doi:10.1038/s41375-020-0731-2
Dahlhaus M, Roos J, Engel D, Tews D, Halbgebauer D, Funcke JB, Kiener S, Schuler PJ, Döscher J, Hoffmann TK, Zinngrebe J, Rojewski M, Schrezenmeier H, Debatin KM, Wabitsch M, Fischer-Posovszky P. CD90 is dispensable for white and beige/brown adipocyte differentiation. Int J Mol Sci. 2020;21(21):1-19. doi:10.3390/ijms21217907
Roos J, Dahlhaus M, Funcke JB, Kustermann M, Strauss G, Halbgebauer D, Boldrin E, Holzmann K, Möller P, Trojanowski BM, Baumann B, Michael K, Martin D, Posovszky PF. miR-146a regulates insulin sensitivity via NPR3. Cell Mol Life Sci. 2020;(0123456789). doi:10.1007/s00018-020-03699-1
Bodenberger N, Kubiczek D, Halbgebauer D, Rimola V, Wiese S, Mayer D, Rodriguez Alfonso AA, Ständker L, Stenger S, Rosenau F. Lectin-Functionalized Composite Hydrogels for “capture-and-Killing” of Carbapenem-Resistant Pseudomonas aeruginosa. Biomacromolecules. 2018;19(7):2472-2482. doi:10.1021/acs.biomac.8b00089