The role of Norrie Disease Pseudoglioma (NDP) signaling in ... · Ahmed Ali Ahmed Ali Elsehemy...
Transcript of The role of Norrie Disease Pseudoglioma (NDP) signaling in ... · Ahmed Ali Ahmed Ali Elsehemy...
The role of Norrie Disease Pseudoglioma (NDP) signaling in glioblastoma
by
Ahmed Ali Ahmed Ali Elsehemy
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Ahmed Ali Ahmed Ali Elsehemy 2018
ii
The role of Norrie Disease Pseudoglioma (NDP) signaling in
glioblastoma
Ahmed Ali Ahmed Ali Elsehemy
Doctor of Philosophy
Department of Laboratory Medicine and Pathobiology
University of Toronto
2018
Abstract
Norrin is a WNT ligand that binds Frizzled-4 (FZD4) and Low-density lipoprotein receptor-
related protein (LRP5/6) receptor complex to activate canonical WNT/ β-Catenin signaling.
Norrin/FZD4 signaling is involved in the regulation of vasculature in several tissues including
retina, inner ear and for blood-brain barrier function. The role of Norrin in cancer is not very
well characterized. Here, we show that NDP is expressed in a wide range of cancer types, with a
particular enrichment in glioblastoma (GBM) and lower grade glioma (LGG). Kaplan-Meier
survival analysis of publicly available datasets revealed a significant correlation between NDP
expression and survival in GBM, LGG and neuroblastoma. To investigate the function of NDP in
GBM, we performed a set of NDP and FZD4 gain and loss of function experiments in patient-
derived GBM stem cell (GNS) lines. Recently ASCL1 expression was shown to stratify GNS
lines into two cohorts with different tumorigenic, proliferation and differentiation dynamics.
Surprisingly, we found that NDP manipulation resulted in opposite effects in ASCL1hi versus
ASCL1lo lines. NDP inhibited proliferation and sphere formation in ASCL1lo lines through
WNT- dependent mechanisms, while it stimulated proliferation and sphere formation in ASCL1hi
lines through WNT-independent mechanisms. Immunocytochemistry staining for proliferation
markers indicated that NDP affects cycle kinetics and cell cycle exit in both cohorts.
iii
Interestingly, RNA-Seq analysis of NDP knockdown ASCL1hi and ASCL1lo lines revealed a
remarkable effect of NDP knockdown on cell cycle controlling genes. In addition, the library
revealed a significant number of uniquely expressed genes in each cell line, consistent with the
divergence of NDP molecular functions between the two lines. Collectively, our results indicate
that NDP is involved in the regulation of GBM progression, and that NDP function in GBM
stratifies with ASCL1 expression.
iv
Acknowledgments
I would like to thank my supervisor Dr. Valerie Wallace for her limitless support and guidance
during my PhD studies. I am also thankful for my thesis advisory committee members; Dr.
Michael Taylor and Dr. Stephane Angers for their invaluable advices and guidance. My gratitude
extends to all my current and past colleagues in Wallace lab, especially Dr. Arturo Ortin-
Martinez for his precious help in preparing my final figures in the best presentable way. I am
very grateful to Dr. Peter Dirks and his group, especially Dr. Hayden Selvadurai, for their
significant help, collaboration and contribution to this project. Also, I am very thankful to Dr.
Kenneth Aldape and his group, especially Dr. Yasin Mamtjan, for their help and contribution
with the bioinformatics and computational analysis. I am very grateful for my family and friends
in Egypt and Canada for their continuous support and love.
Finally, I would like to thank sushi and Futurama, who always made me smile and laugh even
during stressful times.
v
Table of Contents
Acknowledgments.......................................................................................................................... iv
Table of Contents .............................................................................................................................v
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................ ix
List of Appendices ......................................................................................................................... xi
Chapter 1. Introduction ....................................................................................................................1
1.1 Glioma and Glioblastoma (GBM) .......................................................................................1
1.1.1 Classification of GBM ................................................................................................5
1.1.2 Transcriptional classification ......................................................................................6
1.1.3 Important aberrations and/or targets in GBM ...........................................................10
1.1.4 Treatment regimen ....................................................................................................15
1.2 GBM stem cells and their therapeutic potential .................................................................18
1.2.1 Glioma stem cell markers and culture systems .........................................................19
1.2.2 Glioma stem cell biology ..........................................................................................20
1.2.3 WNT signaling in glioma stem cells .........................................................................21
1.2.4 BMP signaling in glioma stem cells .........................................................................25
1.2.5 ASCL1 ......................................................................................................................28
1.3 Norrie Disease Pseudoglioma (NDP) in the endothelium and cancer cells .......................31
1.4 Rationale and objective ......................................................................................................34
1.5 Hypothesis..........................................................................................................................35
1.6 Specific aims ......................................................................................................................35
Chapter 2. Materials and Methods .................................................................................................36
2.1 Computational and in silico analysis ..................................................................................36
2.2 Primary tumor cell lines and culture ...................................................................................36
2.3 Recombinant DNA, plasmids and cloning ..........................................................................37
vi
2.4 Preparation of lentiviral particles and infection ..................................................................39
2.5 In vitro cell proliferation assay ...........................................................................................40
2.6 In vitro extreme limiting dilution assay (ELDA) ................................................................40
2.7 Cell and tissue immunostaining and microscopy ................................................................41
2.8 Cell competition assay ........................................................................................................43
2.9 Cell lysis and Western Blotting ..........................................................................................43
2.10 Small molecules and recombinant proteins.......................................................................44
2.11 Antibodies .........................................................................................................................45
2.12 Dual-Luciferase reporter assay system .............................................................................46
2.13 Flow cytometry analysis ...................................................................................................46
2.14 RNA extraction and qRT-PCR..........................................................................................46
2.15 PCR primers ......................................................................................................................47
2.16 RNA-Seq library ...............................................................................................................48
2.17 Animals .............................................................................................................................49
2.18 Orthotopic xenografting ....................................................................................................49
2.19 Quantification and statistical analysis ...............................................................................50
Chapter 3. Results ..........................................................................................................................51
3.1 NDP expression is enriched in GBM and correlates with survival in several
neurological cancers...........................................................................................................51
3.2 NDP/FZD4 pathway components are expressed in GNS and hNSC cells .........................58
3.3 NDP regulates proliferation and sphere formation of hNSC and GNS cells in vitro .........61
3.4 The biological effects of NDP in GBM stratify with ASCL1 expression levels ................70
3.5 Different molecular pathways mediate the biological function of NDP in ASCL1hi
versus ASCL1lo GBM ........................................................................................................81
3.6 The WNT-independent effects of NDP in ASCL1hi GBM are cell autonomous ................87
3.7 NDP knockdown decreases Ki67+ and SOX2+ populations in ASCL1hi, and increases
the Ki67+ population in ASCL1lo GNS lines ....................................................................90
vii
3.8 NDP affects cell cycle kinetics in both ASCL1hi and ASCL1lo GNS cells ........................95
3.9 NDP knockdown results in significantly variant differential expression profiles of
ASCL1hi versus ASCL1lo GNS lines ...............................................................................100
3.10 NDP affects tumor progression in xenografted GNS cells .............................................103
Chapter 4. Discussion ..................................................................................................................110
4.1 Novel perspectives of Norrin function: Role in Cancer ....................................................110
4.2 Norrin contributes to the progression of GBM and hNSC in vitro ...................................111
4.3 Divergence of Norrin functions in GBM based on ASCL1 subtype in vitro and in vivo .113
4.4 Potential therapeutic applications of Norrrin ....................................................................117
4.5 Summary and significance ................................................................................................119
References ....................................................................................................................................122
Appendices ...................................................................................................................................165
viii
List of Tables
Table 1. Transcriptional classification of GBM. ............................................................................ 9
Table 2. Sequences of shRNA constructs: .................................................................................... 38
Table 3. Sources and concentrations of used reagents: ................................................................. 44
Table 4. Sources, uses and dilutions of used antibodies: .............................................................. 45
Table 5. Sequences of qRT-PCR primers used in this study: ....................................................... 47
Table 6. In vitro effects of manipulating NDP or FZD4 expression on different cell types ........ 80
ix
List of Figures
Figure 1. Schematic illustration of glioma classification and its several subtypes. ........................ 4
Figure 2. Canonical WNT signaling in mammalian cells. ............................................................ 24
Figure 3. BMP signaling in mammalian cells. .............................................................................. 27
Figure 4. The alternative oscillatory regulation mechanism controlling the expression of
proneural factors such as ASCL1. ................................................................................................ 30
Figure 5. Norrin signaling in human cells. ................................................................................... 33
Figure 6. NDP expression is enriched in GBM and LGG tumor samples from TCGA ............... 53
Figure 7. NDP expression is enriched in GBM cell lines from CCLE. ........................................ 55
Figure 8. NDP expression levels correlate with survival in neurological cancers........................ 57
Figure 9. NDP/FZD4 pathway components are expressed in GNS and hNSC lines, and NDP
expression level is correlated with classical GBM gene set ......................................................... 60
Figure 10. NDP and FZD4 stimulate the proliferation of hNSC-1 in vitro. ................................. 63
Figure 11. NDP and FZD4 stimulate the proliferation of hNSC-3 in vitro. ................................. 65
Figure 12. NDP and FZD4 inhibit the proliferation of G411 cells in vitro. ................................. 67
Figure 13. NDP and FZD4 inhibit the proliferation of G564 cells in vitro. ................................. 69
Figure 14. NDP stimulates the proliferation of G523 cells independent of FZD4 in vitro. ......... 72
Figure 15. NDP stimulates the proliferation of G472 cells independent of FZD4 in vitro. ......... 74
Figure 16. GFP+ G523 shNDP cells diminish after 2 weeks in sphere cultures .......................... 76
Figure 17. Ectopic expression of shorthairpin insensitive NDP construct rescues the effects of
NDP knockdown. .......................................................................................................................... 78
x
Figure 18. The effects of NDP are FZD4 and WNT –dependent in ASCL1lo, and -independent in
ASCL1hi GNS lines. ...................................................................................................................... 84
Figure 19. BMP antagonizes the effects of NDP manipulation in ASCL1hi GNS lines. .............. 86
Figure 20. NDP mediates ASCL1hi GNS proliferation through a cell autonomous mechanism. . 89
Figure 21. Knocking down NDP or FZD4 increases Ki67+ cell population in G564 cells. ........ 92
Figure 22. Knocking down NDP or FZD4 decreases Ki67+ and SOX2+ cell population in G472
cells. .............................................................................................................................................. 94
Figure 23. Knocking down NDP increases Ki67+ but decreases Edu+/Ki67+ cell populations in
G411 cells. .................................................................................................................................... 97
Figure 24. Knocking down NDP decreases both Ki67+ and Edu+/Ki67+ cell populations in
G523 cells. .................................................................................................................................... 99
Figure 25. RNA-Seq analysis for G411 (ASCL1lo) and G523 (ASCL1hi) lines ......................... 102
Figure 26. Knocking down NDP affects tumor progression of xenografted GNS lines............. 105
Figure 27. IHC of formed G411 tumors in vivo indicate growth advantage of NDP knockdown
cells ............................................................................................................................................. 107
Figure 28. IHC of formed G523 tumors in vivo indicate growth disadvantage of NDP
knockdown cells.......................................................................................................................... 109
Figure 29. Proposed model of NDP biological functions in GBM ............................................. 121
xi
List of Appendices
Abbreviations ……………………………………………………………………………...…176
1
Chapter 1. Introduction
Glioblastoma (GBM) is the most common type of adult brain cancer (Ohgaki and Kleiheus,
2013; Weller et al., 2015). Due to several features such as genomic instability, high
heterogeneity, aggressiveness and rapid therapy resistance, GBM is currently considered
“incurable”, with very poor treatment outcomes (Stupp et al., 2009; Thakkar et al., 2014; Stupp
et al., 2005). Several classification systems have been advised trying to categorize GBM patients
into more clinically relevant groups for better treatment options, however; the extreme inter- and
intra-tumor heterogeneity lowers the efficiency and accuracy of these classification initiatives
(Cloughesy, Cavenee and Mischel, 2014). The current standard treatment regimen for GBM
consists of maximal-safe surgical resection followed by an adjuvant combination program of
Chemo and Radio therapy. The current first line chemotherapeutic agent for GBM remains
temozolomide (TMZ) (Stupp et al., 2005). TMZ is only effective in a small subset of patients,
and GBM cells frequently develop resistance to it very rapidly. (Cloughesy, Cavenee and
Mischel, 2014; Stupp et al., 2009). Thus, there is a critical need for better understanding of the
molecular mechanisms underlying GBM in order to develop more efficient and targeted
therapeutic options. Here, we characterize a novel role of Norrin, the protein product of NDP
gene, in regulating the progression of GBM. Norrin is an atypical ligand of WNT signaling,
which was also reported to directly interact with BMP signaling (Xu et al., 2004; Junge et al.,
2009; Ye et al., 2009; Ke et al., 2013; Xu et al., 2012; Deng et al., 2013). Both WNT and BMP
signaling pathways were documented to play a central role in regulating the progression of
several cancers including GBM (de Sousa, Melo and Vermeulin, 2016; Rheinbay et al., 2013;
Wu et al., 2017; Piccirillo et al., 2006; Lee et al., 2008; Liu et al., 2010). Therefore, we sought to
study the role of Norrin in GBM. Due to the remarkable heterogeneity of GBM, we will start this
thesis with a brief introduction about the clinical and biological characterization of this disease,
followed by an introduction about NDP, WNT and BMP signaling.
1.1 Glioma and Glioblastoma (GBM)
Glial tumors can be broadly grouped into two categories based on their infiltrative features:
circumscribed localized gliomas, and diffuse gliomas (Sahm et al., 2012). As the name implies,
2
diffuse gliomas are characterized by their infiltrative aggressive behavior that renders them
highly resistant to surgical resection procedures with near 100% probability of recurrence
following treatment (Aldape et al., 2015). According to the World Health Organization (WHO)
classification system, diffuse gliomas are classified into Low grade (II) and High (III, IV) grade.
Grade IV glioma is also called Glioblastoma (GBM) (Jovcevska, Kocevar and Komel, 2013;
Louis et al., 2007) (Figure 1). GBM is the most common and invasive type of malignant brain
tumor, accounting for approximately 60% of brain and 16% of all brain and central nervous
system tumors in adults (Thakkar et al., 2014; Rock et al., 2012). In addition to rapid
invasiveness, GBM is distinguished from low grade glioma by the remarkable necrosis and
microvascular proliferation (Louis et al., 2007). While GBM occurs predominantly in the higher
brain, it can also occur in other parts of the central nervous system, such as spinal cord and
cerebellum (Blissitt 2014). Previously, it was believed that GBM originates exclusively from
glial cells, however; recent research has questioned this hypothesis (Phillips et al., 2006).
Currently, there is evidence that GBM might also originate from neural stem cells that were
supposed to differentiate into glia or even neuron cell types (Davis 2016).
Historically, the diagnosis of GBM and determination of the subtype was mainly
histopathological based on characteristics such as hypercellularity, nuclear atypia, and mitotic
activity. However, the remarkable advances in understanding the biology of this disease led to
the incorporation of molecular subtyping for markers including IDH status (wildtype versus
mutant), EGFR and MDM-2 expression, loss of heterozygosity (LOH) of chromosome 10q,
which carries PTEN and p16 deletion (Sidaway 2017; Ohgaki and Kleiheus, 2007; Agnihotri et
al., 2013; Cloughesy, Cavenee and Mischel, 2014). Due to the very complex and heterogeneous
nature of GBM, there have been several attempts to more accurately stratify this disease into
more molecularly defined subtypes (Aldape et al., 2015; Cloughesy, Cavenee and Mischel,
2014). In the next sections we will highlight some of these proposed classification systems.
3
4
Figure 1. Schematic illustration of glioma classification and its several subtypes.
Glioma can be categorized into diffuse or circumscribed. Diffuse glioma grade I, II together comprise the “Low
grade glioma” subtype. Grade III is called anaplastic astrocytoma, and grade IV is called glioblastoma (GBM).
5
1.1.1 Classification of GBM
As mentioned in the previous section, the remarkable complexity and heterogeneity of GBM led
to the introduction of several classification systems in an effort to categorize the disease into
clinically meaningful subtypes (Weller et al., 2015). One of the most traditional classification
systems is to divide GBM into two groups; primary and secondary GBM (Figure 1). Primary
GBM refers to de novo tumors that arise without previous known pre-malignant precursors, in
contrast to secondary GBM tumors that arise from the advancement of primary or recurrent low-
grade gliomas (Ohgaki and Kleiheus, 2013). On the molecular level, primary GBM are distinct
from secondary GBM in terms of specific markers and/or cancer drivers. Primary GBM is
remarkable for abnormalities in EGFR, PTEN genes and TERT promoter mutations. On the other
hand, secondary GBM is marked by mutant TP53, IDH 1/2 and ATRX mutations (Ohgaki and
Kleiheus, 2013; Wilson, Karajannis and Harter, 2014).
GBM subtype also correlates with age, with the majority of primary GBMs arising in elderly
patients, and secondary GBMs arising in younger patients (Aldape et al., 2015). Generally,
secondary GBM is rare, accounting for only 5-10% of all GBM cases (Ohgaki and Keliheus,
2013). In addition, a recent study suggested the existence of a third GBM subtype that is distinct
from primary and secondary GBM by mutations in H3F3A and occurs primarily in pediatric
gliomas (Schwartzentruber et al., 2012; Sturm et al., 2012). Noteworthy, IDH mutations are
much more common in secondary GBM (about 70-80% of these tumors harbor IDH mutations,
compared with primary GBM (only about 5-10% are IDH mutant) (Parson et al., 2008; Yan et
al., 2009; Nobusawa et al., 2009). The predominant clinical significance of IDH mutations will
be discussed in the upcoming sections.
In addition to this traditional classification system for GBM, there are more precise systems that
have been proposed based on clinical relevance and/or histological features of the disease. The
most well-established and clinically relevant GBM classification systems based on
transcriptional classifications will be highlighted in the next section.
6
1.1.2 Transcriptional classification
The emergence of high throughput screening methods, next generation sequencing techniques, in
combination with large scale tumor data, such as The Cancer Genome Atlas (ACGT) and
International Cancer Genome Consortium (ICGC), has allowed for a more precise and clinically
relevant classification of GBM based on transcriptional profiling rather than clinical history
and/or histology. Based on unsupervised hierarchical clustering of GBM transcriptional, genomic
and epigenomic data, two studies (Phillips et al., 2006; Verhaak et al., 2010) categorized GBM
tumors into four major subtypes with unique genomic hallmarks, epigenomic aberrations, and
transcriptional profiles: classical, proneural, mesenchymal, and neural (Maher et al., 2006; Tso et
al., 2006; Freije et al., 2004) (Table 1).
The classical subtype is mainly characterized by EGFR amplification, PTEN loss, and CDKN2A
loss. The mesenchymal subtype is characterized by mutations or loss of TP53, NF1, and
CDKN2A genes. The proneural subtype is more complex, marked by enrichment of PDGFRA,
CDK6, CDK4, and MET alterations and often IDH1 mutations (Phillips et al., 2006; Verhaak et
al., 2010; Brennan et al., 2013; Wang et al., 2015) (Table 1). The proneural subtype itself can be
further subdivided into CpG (G–CIMP)-positive and -negative subgroups, depending on DNA
methylation patterns produced by IDH1/2 mutations. G-CIMP signature refers to a unique
hympermethylation landscape that is tightly linked to IDH mutation and MGMT promoter
methylation, and subsequently better prognosis and treatment outcomes (Bady et al., 2012;
Noushmehr et al., 2010; Turcan et al., 2012). The clinical and prognostic values of IDH
mutations and MGMT promoter methylation will be discussed in the next sections.
The neural subtype lacks any unique genetic signature. In fact, a recent study using a
comprehensive longitudinal analysis suggested that this subtype is not a real GBM cancer but
results from non-tumor cells contamination to the original samples in the initial classification
reports (Wang et al., 2017; Sidaway 2017). Further studies have suggested up to six subtypes
based on more in-depth transcriptional analysis and classification (Schwartzentruber et al., 2012;
Sturm et al., 2012). Moreover, individual primary GBM tumors have been shown to present
multiple subtypes concurrently (Patel et al., 2014; Meyer et al., 2015).
7
In summary, the introduction of next generation sequencing and large-scale screening techniques
allowed for a shift from the traditional classification of GBM into primary and secondary tumors
to a more precise and clinically relevant transcriptional classification. The transcriptional
classification, which categorizes GBM into four to six subtypes is more specific, clinically
relevant, and allowed for better understanding of GBM biology.
8
GBM Subtype Transcriptional
Signature
Common Genomic
aberrations
Proneural Olig2/DLL3/SOX2 TP53, PI3K,
PDGFRA
Mesenchymal YKL40/CD44
NF-κB
NF1
Classical EGFR/AKT2
Chr.7 gain
Chr 10 loss
PDGFRA
Neural MBP/MAL None*
9
Table 1. Transcriptional classification of GBM.
The transcriptional signature of each subtype, as well as common genomic aberrations (based on Phillips et al.,
2006; Verhaak et al., 2010 classifications). *Notably, neuronal subtype does not have any common aberrations, and
its validity as a real GBM subtype is currently under question (Wang et al., 2017; Sidaway 2017).
10
1.1.3 Important aberrations and/or targets in GBM
GBM is one of the most complex cancers, with a very large number of genetic variations and
genomic landscapes that result in a high degree of inter- and intra-tumor heterogeneity (Sidaway
2017; Ohgaki and Kleiheus, 2007; Agnihotri et al., 2013; Cloughesy, Cavenee and Mischel,
2014, Patel et al., 2014). Despite this complexity, some of the identified aberrations present high
significance in the classification and/or potential therapeutic strategies in GBM; such aberrations
will be discussed in this section.
1.1.3.1 IDH mutations
One of the most important discoveries that helped understanding the biology of glioma was the
finding that mutations in IDH 1 and 2 genes are quite frequent in low grade gliomas, and quite
rare in advanced GBM (Yan et al., 2009; Nobusawa et al., 2009). Because of the high
significance of IDH mutations, gliomas can be classified based on IDH status into two groups;
IDH wildtype versus IDH mutant tumors (Kloosterhof et al., 2011). In this section, we will
discuss the critical impact of these mutations on tumor progression dynamics and prognosis.
In humans there are three IDH isozymes; IDH 1, 2 and 3 (Kloosterhof et al., 2011). Only IDH 1
and 2 isozymes have been linked to glioma progression and biology (Yan et al., 2009; Nobusawa
et al., 2009). The three IDH isozymes function in the regulation of citric acid (Krebs) cycle on
different levels. IDH 1 and 2 function in the cytosol and mitochondria to reduce nicotinamide
adenine dinucleotide phosphate (NADPH) from NADP+ by catalyzing the oxidative
decarboxylation of isocitrate to α-KG outside of the Krebs cycle, while IDH 3 converts isocitrate
to α-ketoglutarate (α-KG) and NAD+ to NADH (Dang et al., 2009; Figueroa et al., 2010; Ward
et al., 2010; Reutman and Yan 2010). Therefore, the reduced levels of functional wildtype IDH
in combination with reactive oxygen species (ROS) render the cells quite sensitive to oxidative
stress and subsequent damage (Lee et al., 2002; Reitman and Yan 2010). IDH mutations in
glioma seem to be restricted to amino acid residue R132, which is located at the center of the
enzyme active site, and in about 85% of the cases it is a missense heterozygous mutation of
arginine to histidine (R132H) that is utilized for rapid diagnostic purposes by
11
immunohistochemistry or direct (pyro)-sequencing (Watanabe et al., 2009; Capper et al., 2009;
Felsberg et al., 2010; Yan et al., 2009).
IDH mutations are associated with histone methylation, as well as hypermethylation of multiple
CpG islands resulting in a characteristic epigenetic phenotype called the glioma CpG island
methylator phenotype (G-CIMP) (Noushmehr et al., 2010; Turcan et al., 2012; Lu et al., 2012). It
is believed that IDH mutation presents an initial step in the advancement of glioma (Watanabe et
al., 2009; Aldape et al., 2015), however, it is not sufficient on its own (Sasaki et al., 2012). A
second hit must follow IDH mutation to form a glioma, which include TP53, ATRX, TERT
promoter, CIC, and FUBP1 depending on the glioma subtype (Bettegowda et al., 2011; Sahm et
al., 2012; Weber et al., 1996; Ohgaki et al., 2004). IDH mutations in primary GBM are rare
(account for less than 5%) and quite common in secondary GBM and low-grade gliomas
(Nobusawa et al., 2009). In other words, IDH mutations in GBM are strictly linked to either
secondary or proneural tumors (Noushmehr et al., 2010).
From a clinical perspective, several independent studies have reported a significant prognostic
value of IDH mutations in glioma patients, where patients harboring these mutations had
significantly longer overall survival than patients with wildtype IDH (Sanson et al., 2009; Combs
et al., 2011; Weller et al., 2009). This prognostic value of IDH mutation is highly significant in
low grade gliomas (Hartmann et al., 2009). Interestingly, these studies reported that the
prognostic value of IDH mutation status is independent from other prognostic factors such as
age, and disease grade or subtype. Notably, proneural GBM subtype seems to be associated with
a better outcome, however; removing IDH mutant samples from the analysis shows that IDH
wildtype proneural GBM has no prognostic advantage over other GBM subtypes (Cloughesy,
Cavenee and Mischel, 2015; Noushmehr et al., 2010).
It is not clear if IDH mutation status also has a predictive value in response to treatment. A
recent in vitro study suggested that IDH mutation does not affect response to radiotherapy in low
grade glioma (Li et al. 2013). However; a few other studies suggest that IDH mutation might
result in better response to chemotherapy and radiotherapy when applied immediately after
surgery, leading to a better overall survival only in low grade glioma (Juratli et al. 2012;
Houillier et. al, 2010; Hartmann et al., 2011). In conclusion, it is not clear if IDH mutation status
12
has a predictive value in response to treatment in GBM. Nevertheless, the critical biological
contribution of these mutations on the nature of the tumor led to suggestions that IDH mutant
glioma is a completely different disease than IDH wildtype (Young et al., 2015; Aldape et al.,
2015). Subsequently, there have been trials to specifically target IDH mutant GBM utilizing its
unique characteristics, which showed promising preclinical results (Rohle et al., 2013;
Schumacher et al., 2014).
In summary, the discovery of IDH mutation and its consequences on glioma led to significant
enhancements in our understanding of glioma and GBM (where IDH mutation is restricted to
secondary and proneural GBM only) and the differences between the GBM subtypes due to the
substantial molecular effect of this mutation on the tumor biology and genomic/transcriptional
landscape. IDH mutation might represent an initiation event in the formation of glioma,
however; it is not sufficient on its own to drive malignancy and has to be followed by another
hit. Patients with IDH mutant glioma have significantly better prognosis and longer overall
survival compared to those with IDH wildtype glioma. In addition, IDH mutation status is an
important prognostic marker and might present a promising druggable target in GBM.
1.1.3.2 EGFR activation and EGFRvIII
EGFR amplification is one of the most common aberrations seen in GBM, which affects
approximately 40-50% of all GBM patients (Cancer Genome Atlas Res. Netw., 2008; Parson et
al., 2008; Hurtt et al., 1992). About half of these patients express a mutant version of EGFR
called (EGFRvIII). EGFRvIII contains a deletion of exons 2-7, which code for the ligand binding
domain, resulting in a constitutively active receptor tyrosine kinase that activates PI3K signaling,
promotes tumor growth and proliferation, and is correlated with worse clinical outcomes
(Karshunov et al., 2015; Huang et al., 2009; Shinojima et al., 2003; Heimberger et al., 2005).
Notably, there seem to be a functional discrepancy between wildtype EGFR and EGFRvIII, with
the latter being more active, proliferation-inducing and oncogenic (Wang et al., 2009). Similarly,
gain of function mutations in EGFR extracellular domains also lead to constitutive activation and
more proliferation (Lee t. al., 2006). The high frequency of EGFR mutation in GBM led to pre-
clinical research suggesting that targeting EGFR or the mutant version (EGFRvIII) could be an
13
efficient therapeutic strategy (Vivanco et al., 2012; Mukasa et al., 2010). However; clinical trials
using EGFR inhibitors failed to produce the expected success (Kesavabhotla et al., 2012; van den
Bent et al., 2009; Wen et al., 2014). That being said, a single-arm clinical trial suggested a
therapeutic strategy taking advantage of the immunogenicity of the novel, cancer-exclusive
peptide (EGFRvIII) as a target for anti-tumor vaccination. Initial results from this study show
promising outcomes, however; more analysis is required to conclude the efficiency of this novel
strategy (Sampson et al., 2010).
Currently, a lot of GBM research effort is dedicated to decipher the mechanisms through which
EGFR amplified- and EGFRvIII-GBM develop resistance to EGFR inhibitor therapy, with the
loss of PTEN appearing to be central in the acquisition of this resistance (Mellignhoff et al.,
2005; Fenton et al., 2012; Vivanco et al., 2010). Moreover, other tyrosine kinase receptors might
be able to compensate for EGFR inhibition causing tumor insensitivity to the treatment
(Stommel et al., 2007; Snuderl et al., 2011; Szerlip et al., 2012).
1.1.3.3 hTERT promoter mutation
In humans, hTERT is the catalytic subunit of the telomerase enzyme that is responsible for
maintaining the ribonucleoprotein compartment of the telomeres to protect chromosomes from
continuous shortening (Autexier and Lue, 2006; Janknecht, 2004; Lewis and Tollefsbol, 2016).
In a vast majority of cancer types, hTERT promoter mutations lead to abnormal activity of the
enzyme, resulting in deregulation of telomere maintenance. Therefore, higher hTERT expression
levels are associated with worse clinical outcomes (Ducrest et al., 2002; Gertler et al., 2004;
Sanders et al., 2004). hTERT promoter mutations are one of the most common aberrations in
GBM, affecting 70-80% of all primary GBM patients (Killela et al., 2013; Koelsche et al., 2013;
Simon et al., 2015). Several studies have suggested that hTERT mutation might hold a
prognostic value for GBM patients, however; the correlation seems to be complicated and
dependent on other factors, such as IDH mutation status (Labussiere et al., 2014; Simon et al.,
2014; Srivastava et al., 2010; Killela et al., 2013).
14
1.1.3.4 PDGFRA activation
Another very common aberration in GBM is the PDGFRA mutation. PDGFRA mutation is
reported in about 15% of GBM patients and seems to be strictly linked to the proneural subtype
(Phillips et al., 2006; Verhaak et al., 2010). There are several reported forms of PDGFRA
mutations in GBM (Fleming et al., 1992; Hermanson et al., 1992; Lokker et al., 2002; Clarke and
Dirks, 2003; Ozawa et al., 2010; Cancer Genome Atlas Res. Netw., 2008), all of which
eventually lead to hyper-activation of PDGFR signaling and therefore aggressive proliferation
and tumor growth (Assanah et al., 2006; Assanah et al., 2009).
For example, almost half of PDGFRA amplification cases in GBM result from a deletion of 243
bases from exons 8 and 9, which leads to synthesis of a truncated, constitutively active
extracellular domain (Clarke and Dirks, 2003; Ozawa et al., 2010). Similarly, about one third
GBM tumors hyper-activate PDGFRA by overexpression of its ligands (PDGF A-D) (Lokker et
al., 2002; Smith et al., 2000). In addition, GBM tumors were reported to express forms of fusion
proteins consisting of the extracellular domains of receptors such as VEGFR, and the
intracellular domain of PDGFRA, leading to a similar constitutive activation (Aldape et al.,
2015).
1.1.3.5 PI3K/AKT Signaling
PI3K/AKT pathway in GBM can be activated as a result of aberrations in multiple common hits
including, EGFR or alternative receptor tyrosine kinases, PIK3CA itself, PTEN loss; and
abnormal AKT phosphorylation (Riemennschneider et al., 2006; Choe et al., 2003; Jiang et al.,
2006). This in turn makes PI3K/AKT one of the most commonly disrupted pathways in GBM,
with about 90% of patients harboring abnormal activity (Cancer Genome Atlas Res. Netw.,
2008). Due to this central role of PI3K/AKT pathway in GBM, there have been several trials to
target it for therapy, however; its interaction with other targets/pathways, namely EGFR
signaling in specific, led to a limited primary success (Cloughesy, Cavenee and Mischel, 2014).
15
1.1.3.6 NF1 and mTOR
NF1 gene is genetically lost, inactivated, or degraded at the protein level in 15% of glioma
tumors (Parsons et al., 2008; McGilly cuddy et al., 2009; Cancer Genome Atlas Res. Netw.,
2008). NF1 mutations are mainly linked with GBM mesenchymal subtype (Verhaak et al., 2010).
NF1 is a tumor suppressor in GBM, which negatively regulates multiple oncogenic and/or
growth promoting pathways including Ras signaling, STAT3, and Mammalian target of
rapamycin (mTOR) (Sandsmark et al., 2007; Banerjee et al., 2010).
mTOR signaling is highly activated in GBM (Network, T. C.., 2013), and its abnormal activity
promotes cell proliferation, protein translation, tumor growth and progression (Lablante and
Sabatini, 2012; Sonenberg and Pause 2006). In addition, mTOR plays a central role in linking
growth factors to the proliferative phenotype through controlling cell metabolism, amino acid
availability and energy production (ATP) (Yecies and Manning 2011; Gwinn et al., 2008).
Recently, mTOR has also been shown to be significantly involved in regulating autophagy,
shedding more light on the role of this pathway in response to stress and proliferation cues (Egan
et al., 2011). mTOR signaling was also reported to be mediating the effect of EGFRvIII and
PTEN loss (Tanaka et al., 2011; Wang et al., 2006). Based on the central role of mTOR in
mediating cancer cell proliferation and tumor growth, there have been clinical trials to target this
pathway in GBM, however; these trials failed to produce favorable results (Cloughesy et al.,
2008)
1.1.4 Treatment regimen
Generally, GBM has a very poor prognosis, with progression-free survival of only 7-8 months,
median overall survival of 14-15 months and a 5-year overall survival of about 10%, even under
aggressive combination therapy programs. Therefore, GBM is considered one of the most
aggressive and lethal cancers (Stupp et al., 2009; Thakkar et al., 2014; Stupp et al., 2005). The
current standard therapeutic regimen for GBM involves major surgical resection, adjuvant
radiation therapy in combination with temozolomide (TMZ) treatment (Stupp et al., 2009).
Despite this aggressive treatment program, the success rate is very low and the disease is
generally considered “surgically incurable” due to its infiltrative and diffused proliferation, as
16
well as the ability to rapidly invade surrounding brain tissues. (Aldape et al., 2015; Cloughesy,
Cavenee and Mischel, 2014; Stupp et al., 2009). One of the main factors leading to this
inefficacy of GBM treatment is the very high incidence of development of resistance against
both radio- and cytotoxic chemotherapy (Masui, Cloughesy and Mischel, 2012; Dunn et al.,
2012). In addition, the poor efficiency of current chemotherapeutic agents to pass the blood-brain
barrier presents an important challenge in the treatment of GBM (Aldape et al., 2015; Sarkaria et
al., 2018). Due to the very poor chemotherapy outcomes in GBM, it is critical to identify the
patient groups that are most likely to benefit from the treatment regimen. In the next section, we
will discuss one of the most important and reliable TMZ predictive factors in GBM⎯MGMT
promoter methylation.
1.1.4.1 MGMT promoter methylation
As mentioned in the previous section, temozolomide (TMZ) is the current standard
chemotherapeutic agent in the treatment of GBM (Stupp et al., 2009). One of the most clinically
important predictive factors for TMZ responsiveness is MGMT promoter methylation (Hegi et
al., 2005; Wick et al., 2012), which is hypermethylated in about 40% of GBM patients. Promoter
hypermethylation of MGMT, which encodes an essential DNA repair enzyme that specifically
repairs DNA damage induced by alkylating chemotherapy agents, such as TMZ, leads to gene
silencing (Hegi et al., 2005; Wick et al., 2012). Subsequently, MGMT promoter
hypermethylation is significantly associated with higher sensitivity to alkylating agents, as well
as better progression-free and overall survival in patients who were treated with alkylating agent,
leading to the proposal of MGMT silencing as a sensitizing strategy for GBM patients treated
with TMZ (Esteller et al., 2000; Hegi et al., 2004; Hegi et al., 2005; Herrlinger et al., 2006;
Weller et al., 2009). This significant predictive value of MGMT promoter methylation led many
GBM treatment centers to adopt a program of TMZ plus radiotherapy followed by TMZ alone
versus radiotherapy alone based on MGMT promoter methylation status (Wick et al., 2013;
Weller et al., 2015; Malmstrom 2012). It is also important to notice that the predictive value of
MGMT promoter methylation is specifically confirmed in elderly GBM patients (Hegi et al.,
17
2005; Malmstrom 2012; Olson, Brastiano and Palma, 2011; Wick et al.2012), however; its
reliability in younger patients is not very clear (Aldape et al., 2015).
In conclusion, the traditional treatment regimen in GBM has a very poor efficacy. This is likely
due to the very complex nature of the disease, as well as its very high level of genetic instability
and phenotypic plasticity that allows for rapid formation of treatment resistance (Johnson et al.,
2014). Therefore, research efforts are currently focused on precision medicine, which will be
discussed in the next section.
1.1.4.2 Novel therapeutic strategies and Precision medicine
As demonstrated in the previous sections, GBM is one of the most complex cancer types with a
very high level of inter- and intra-tumoral heterogeneity as well as genomic instability (Frattini et
al., 2013; Vivanco et al., 2012; Sottoriva et al., 2013). Thus, GBM is currently considered
incurable with a very poor average survival, highlighting the critical need of novel targeted
therapies, including precision or personalized medicine.
Targeted therapy against specific central biological tumorigenic processes of particular interest
in GBM is an example of novel strategies in combination with the traditional TMZ treatment
regimen (Prados et al., 2015). For example, the autophagy inhibitor Chloroquine was shown to
sensitize GBM cells to TMZ treatment in xenograft models (Golden et al., 2014), and enhance
clinical outcomes of adjuvant TMZ and radiotherapy (Briceno et al., 2007). However; clinical
trials of Chloroquine related compounds failed due to toxicity and inefficiency in blocking
autophagy (Rosenfeld et al., 2014).
Immunotherapy presents another active area of GBM treatment research (Hickey et al., 2010).
Several immunologic strategies are currently in clinical trials in GBM. For example, T-Cell
therapy was shown to be a potential beneficial treatment for recurrent GBM (Schuessler et al.,
2014). In addition, the unique, cancer-specific peptide sequence of EGFRvIII was utilized to
produce a specific anti-GBM vaccine that gave promising results in initial trails (Sampson et al.,
2010). More research is required to assess the efficacy of an adjuvant therapy composed of
immunotherapy approaches in combination with TMZ or radiotherapy in GBM (Patel et al.,
18
2014). Finally, precision medicine remains an important goal in the field of GBM treatment.
Despite having a lot of potential, precision medicine is still faced with several challenges and is
still currently under development (Prados et al., 2015).
1.2 GBM stem cells and their therapeutic potential
Cancer stem cells (CSCs) refer to a cell population that are thought to be responsible for tumor
initiation, and exclusively harbor the self-renewal and regeneration attributes of cancer (Dick
2008; Battle and Clevers, 2017; Plaks, Kong and Werb, 2015). This hypothesis of CSCs has
resulted in considerable research efforts to target CSCs for therapy (Podberezin, Wen and Chang,
2013). There are, however, many challenges hindering therapeutic CSC targeting, including the
inherent plasticity of cancer cells. It was reported that cancer cells have the plasticity to shift
from the differentiated to the stem cell phenotype in response to several microenvironmental
stresses, such as chemo- and radio- therapy (Cabrera, Hollingsworth and Hurt, 2015). Thus, it is
important to identify the conditions that control this plasticity in order to propose efficient
therapeutic strategies against CSCs (Doherty et al., 2016). In addition, CSCs isolation and
culture methods almost always depend on the expression of cell surface markers, the ability to
initiate tumors in experimental animals, and/or supplementing cancer cells with mitogens and
developmental factors (Gilbert and Ross, 2009). Subsequently, these experimental approaches
might be marginalizing some CSC populations and selecting for populations with better surface
marker representation, transplantation ability, or cell culture adaptability (Nassar and Blanpain,
2016). Therefore, more research is required to better characterize CSC populations and target
them in different cancer types.
CSCs have been identified in many cancer types (Battle and Clevers, 2017; Plaks, Kong and
Werb, 2015). Similar to developing brain tissues that exhibit cellular hierarchy with a clearly
defined stem cell population (Reya et al., 2001), tumors that arise from the brain, such as lower
grade glioma and GBM, exhibit hierarchal organization with a defined stem cell population that
is thought to be responsible for tumor initiation and harbors the regeneration and self-renewal
ability of the tumor (Ignatova et al., 2002; Galli et al., 2004; Singh et. al, 2004; Tirosh et al.,
2016). In addition to their exclusive self-renewal ability, GBM stem cells have been shown to be
19
the main population responsible for resistance to chemotherapy (Chen et al., 2012) and
radiotherapy (Bao et al., 2006), highlighting their significance for treatment and clinical
outcomes. In the next section, we will briefly introduce the markers and techniques used to
isolate and culture GBM stem cells as a key process in the research for targeted therapy against
them.
1.2.1 Glioma stem cell markers and culture systems
Glioma and GBM stem cells have been shown to express many of the normal neural stem cell
markers including SOX2, NANOG, OLIG2, MYC and Nestin (Hemmati et al., 2003; Ben-Porath
et al., 2008; Suva et al., 2014; Ligon et al., 2007; Kim et al., 2010; Tunici et al., 2004).
Additionally, multiple glioma stem cell surface markers have been identified to reliably select
and isolate these populations with experimental approaches such as flow cytometry. These cell
surface markers include CD133 (Hemmati et al., 2003; Liu et al., 2006), CD15 (Son et al., 2009),
CD44 (Liu et al., 2006), Integrin α6 (Lathia et al., 2010), and L1CAM (Bao et al., 2008). Despite
being the most commonly used glioma stem cell marker, the validity and efficiency of using
CD133 to isolate these cells is now under question after demonstration of the existence of
CD133-negative neural stem cell populations (Sun et al., 2009; Beier et al., 2007; Beier et al.,
2011). Therefore, the isolation of glioma and GBM stem cell populations is a complex procedure
and often lacks uniformity (Lathia et al., 2015).
Due to this complexity and variability of techniques used to isolate glioma stem cells,
researchers introduced alternative surrogates to be used for studying these populations.
Neurosphere culture, which takes advantage of the clonogenicity of CSCs in serum free cultures,
is one of the most commonly used surrogate techniques to enrich for glioma stem cell
populations (Goodell et al., 1996; Kondo et al., 2004). Notably, this culture system requires the
addition of mitogens, such as EGF and FGF, to the medium to inhibit differentiation and to retain
the self-renewal characteristics. This approach might in turn result in a bias towards CSC
populations that express the corresponding mitogen receptors (Pastrana, Silva-Vargas and
Doetsch, 2011). In fact, the neurosphere culture, also known as the “sphere formation assay”, is a
direct readout of sphere forming ability, rather than self-renewal and stemness characteristics
20
(Pastrana, Silva-Vargas and Doetsch, 2011). The gold standard for functional validation of
glioma stem cells remains the in vivo limited dilution assay to confirm the ability of a cell
population to initiate tumors that recapitulate the complexity of the original patient-derived
tumor (Bradshaw et al., 2016; Singh et al., 2004). Despite showing a clear advantage over
traditional serum-containing culture methods (Lee et al., 2006), neurosphere-cultured GBM stem
cells fail to recapitulate the original tumor heterogeneity (Lathia et al., 2011; Venere et al.,
2011).
Due to the limitations of the neurosphere culture, another surrogate monolayer technique was
introduced by Pollard and colleagues to propagate glioma stem cells (Pollard et al., 2009). In this
technique, which has been widely adopted for culturing glioma stem cells, cells are cultured as
monolayers on laminin-coated surfaces, and subjected to fewer than 20 passages. Since this
technique was shown to overcome the problems of the traditional neurosphere assay (i.e. cells
grown in the monolayer system perfectly recapitulate original tumor heterogeneity, genotype and
phenotype, and maintain the self-renewal ability) (Pollard et al., 2009; Woolard and Fine, 2009),
we have used it as the standard culture system to maintain our GBM cells for in vitro and in vivo
experiments.
1.2.2 Glioma stem cell biology
As mentioned in the previous section, CSCs are thought to be the tumor population responsible
for self-renewal, regeneration, therapy resistance and tumor recurrence. Thus, CSCs have gained
a great attention in the field of glioma and GBM research (Li et al., 2009; Veneree et al., 2011).
Great effort was put in research to understand the biological mechanisms underlying the
regulation of glioma stem cells; however, the incredible complexity and phenotypic plasticity of
these populations led to a remarkable difficulty in direct translation of this knowledge into more
targeted therapies (Altaner et al., 2008; Safa et al., 2016; Lan et al., 2017).
The biology of glioma stem cells can be regulated on several levels including genetic and
epigenetic, micro-environmental signals, as well as metabolic and niche factors (Lathia et al.,
2015). Some of the transcription factors that were identified as primary regulators of CSC
21
biology in glioma include MYC (Wang et al., 2008), TP53 and PTEN (Zheng et al., 2008),
STAT3 (Sherry et al., 2009), SOX2 (Gangemi et al., 2009), and NANOG (Zbinden et al., 2010).
There is a wide range of pathways and factors that are critical in regulating glioma stem cells
including NOTCH (Chu et al., 2013; Fan et al., 2006), BMP (Yan et al., 2014), WNT (Rheinbay
et al., 2013; Zheng et al., 2010), PDGFR (Kim et al., 2012), EGFR (Jun, Bronson and Charest,
2014), NF-κB (Bhat et al., 2013) and ASCL1 (Rheinbay et al., 2013; Park et al., 2017) pathways.
In the next sections, the roles of WNT, BMP and ASCL1 will be discussed in further detail since
these pathways are of a main concern for this study.
1.2.3 WNT signaling in glioma stem cells
WNT signaling is considered one of the central pathways controlling stem cell maintenance and
proliferation and involved in a very wide range of biological processes and diseases, including
most cancers (Clevers and Nusse, 2012; Zhan, Rindtroff and Boutros, 2017). Early observations
indicated that WNT activation leads to tumorigenesis in several organs (Nusse and Varmus,
1982; Tsukamoto et al., 1988) and subsequently, a great deal of effort was put in studying this
pathway in the initiation and maintenance of the vast majority of human cancers. The net result
of this work is the identification of clinical applications for WNT pathway modulation and
clinical trials of WNT modulators (Krishnamurthy and Kurzrock, 2018).
WNT signaling is mediated through canonical and noncanonical pathways (Nusse and Clevers,
2017). In this study we will be focusing on the canonical WNT signaling (Figure 2). Briefly,
canonical WNT signaling is turned off in the absence of WNT ligand. Under this inactivated
state, a multi-protein complex composed of CKI, AXIN, GSK, DVL and APC targets -Catenin
for phosphorylation, which targets it for proteasome degradation (Figure 2A). The binding of
WNT ligand to one of the Frizzled (FZD) family receptors leads to recruitment and of the multi-
protein complex, preventing it from phosphorylating β-Catenin. Unphosphorylated β-Catenin is
stable and localizes to the nucleus where it facilitates the bind of transcription factors, including
the T-cell factor/lymphoid enhancer factor (TCF/LEF), to DNA resulting in the expression of
WNT target genes (Clevers 2012; McDonald, Tamai and He, 200; Cadigan and Waterman, 2012;
Niehrs 2012) (Figure 2B).
22
The role of WNT in cancer has been extensively studied, revealing a central role of this pathway
in controlling many cancer cell biological processes and regulating the progression of many
cancer types (Polakis 2012; Zhan, Rindtroff and Boutros, 2017). Also, WNT signaling was
shown to be central in regulating the biology of stem cell populations in many organs, including
the hematopoietic system, intestine, skin, brain and embryonic stem cells (Nusse 2008; Nusse et
al., 2008; Clevers, Loh and Nusse, 2014). Consequently, WNT was one of the first pathways to
be studied in CSCs after their discovery. In this cell population, WNT was shown to exhibit a
critical role in regulating stemness, self-renewal, differentiation, proliferation, migration and
invasion (de Sousa, Melo and Vermeulin, 2016; Rheinbay et al., 2013; Wu et al., 2017).
Together, these observations led to the proposal of targeting WNT as a general strategy to
eliminate CSC populations (Polakis 2012; Zhan, Rindtroff and Boutros, 2017).
WNT is generally activated in GBM through genomic aberrations, including a deletion in FAT1,
a negative effector of WNT signaling, as seen in 20% of GBM patients (Morris et L., 2013; Lee
et al., 2016). WNT activation in GBM can also be achieved through epigenetic silencing of WNT
negative regulators including soluble Frizzled-related proteins (sFRPs); a group of antagonists
that bind WNT ligands to inhibit WNT signaling (Roth et al., 2000). Epigenetic silencing of
sFRPs is reported in almost 40% of GBM tumors (Roth et al., 2000). Several studies have
reported an important role of WNT in controlling the stem cell populations in glioma and GBM.
For instance, a network of WNT target genes was found to be essential in maintaining GBM
stem cells (Rheinbay et al., 2013). Similarly, PLAGL2 was found to be highly amplified in
glioma and functions to regulate glioma stem cells by suppressing WNT signaling (Zheng et al.,
2010). Recently, Zhang and colleagues showed that FOXM1 promotes GBM stem cells by
directly facilitating the translocation of β-Catenin to the nucleus, leading to expression of WNT
target genes that promote stemness and induce chemoresistance (Zhang et al., 2011). Moreover,
several components of WNT signaling pathway, such as FZD4 and DVL2, have been reported to
be overexpressed in GBM (Holland 2001; Jin et al., 2011).
Additionally, WNT has been reported to be critically involved in regulating GBM invasion and
epithelial-mesenchymal transition (EMT); the process by which cancer cells switch from
epithelial to mesenchymal phenotype in order to migrate and metastasize to a new location.
WNT activation in GBM was reported to result in overexpression of EMT master regulators,
23
such as SNAIL, TWIST, SLUG, and N-cadherin (Han et al., 2011; Mikheva et al., 2010; Yang et
al., 2010; Kemler et al., 2004). Similarly, several WNT components such as WNT5A and WNT2
have been reported to be directly involved in GBM cell migration (Kamino et al., 2011; Pu et al.,
2009). Consistent with the previously described role of CSCs in therapeutic resistance in other
cancers, several studies showed that WNT significantly affects GBM resistance to therapy by
regulating its cancer stem cell population. For example, Zhang and colleagues showed that
inhibiting the WNT activator, FOXM1, sensitizes GBM cells to TMZ (Zhang et al., 2012).
Moreover, a recent study reported that radioresistent GBM tumors in vivo are highly enriched in
WNT components (Kim et al., 2012). Activation of WNT receptors, such as FZD2, was also
reported to be involved in developing resistance to TMZ (Auger et al., 2006).
Therefore, the very well-established role of WNT in regulating normal stem cells as well as its
clear involvement in GBM biology and CSCs make it an interesting target for potential novel
therapies to overcome the current traditional treatment challenges.
24
Figure 2. Canonical WNT signaling in mammalian cells.
A) In the rest inactive state, the multi-protein complex of (GSK3, CKI, APC, Axin and DVL) remains free
in the cytoplasm, allowing it to target β-Catenin for phosphorylation. Upon phosphorylation, β-Catenin gets
primed for ubiquitin mediated degradation by the proteasome leading to degradation and failure to activate
target genes.
B) In the active state, WNT ligand binds specific FZD receptors leading to the recruitment of the multi-
protein complex, preventing it from phosphorylating β-Catenin. Active unphosphorylated β-Catenin then
translocates to the nucleus where it binds co-transcription factors such as TCF/LEF, which in turn bind
DNA and express WNT target genes.
Inactive Active A
B
25
1.2.4 BMP signaling in glioma stem cells
Bone Morphogenetic Protein (BMP) signaling represents another major pathway that controls
stem cell and disease in many organ systems (Bragdon et al., 2011; Wang et. al, 2014) (Figure
3). As a member of the Transforming Growth Factor-beta (TGF-β) superfamily (Urist 1997),
BMP signaling initiates when a homodimer or heterodimer BMP ligand (such as BMP 2/4) binds
BMPRI and BMPRII receptors on the cell surface to form a holocomplex leading to the
activation of downstream signaling cascade. This activated holocomplex recruits and
phosphorylates the key signaling mediators in the pathway, receptor-regulated-Smad (R-Smad;
SMAD1/5/8). Activated phosphorylated SMAD1/5/8 recruits the co-SMAD, SMAD4, to the
complex, which then translocates to the nucleus and regulates transcription of downstream target
genes (Figure 3). Another layer of regulation is provided by the presence of inhibitory SMADs
(I-SMADs) such as the SMAD5/7 complex, which inhibits the pathway by priming the
SMAD1/5/8 complex for ubiquitin-mediated protein degradation (Rahman et al., 2015; Wang et
al., 2014; Zhang and Li, 2005; Bragdon et al., 2011) (Figure 3).
In GBM, BMP4 expression is downregulated relative to surrounding normal brain tissues (Wu
and Yao, 2013). Interestingly, a recent report suggested that BMP4 expression level is inversely
correlated with GBM grade, where lower grade gliomas express significantly higher levels of
BMP4 (Bao et al., 2013). Similarly, downregulation of BMPRIB (a subunit of BMP receptor
complex) was reported in higher grade glioma patients (Liu et al., 2009). Activation of BMP
signaling was reported to promote CSC differentiation and inhibition of tumor growth in GBM
(Piccirillo et al., 2006; Lee et al., 2008; Liu et al., 2010). In addition, glioma stem cells were
reported to inhibit endogenous BMP signaling by secretion of the BMP antagonist Gremlin 1 to
protect themselves from BMP-induced differentiation (Yan et al., 2014; Guan et al., 2017).
Notably, these reports show that BMP signaling might induce astrocyte –and not neuronal-
differentiation. This is particularly important for therapeutic applications because astrocytes can
undergo cell cycle re-entry and regeneration of the stem cell population, whereas neuronal
differentiation, which is associated with terminal cell cycle exit, prevents tumor reformation
(Magnusson et al., 2014; Alcantara et al., 2009; Friedmann et al., 2012).
26
On the other hand, expression of BMP4 was shown to reverse the multi-drug resistant (MDR)
phenotype in GBM and result in a significant sensitization to TMZ treatment (Liu et al., 2013).
Similarly, BMP4 was shown to sensitize GBM cells to bevacizumab, a monoclonal antibody
against VEGF-A, leading to reduced tumor size and invasion (Rahman et al., 2013).
Subsequently, several trials have been introduced to use BMP in GBM therapy. For instance,
oncolytic virus overexpressing BMP4 was shown to induce GBM stem cell differentiation and
lead to significantly prolonged survival in mice (Duggal et al., 2013). Similar results were
obtained by systemic delivery of human fat-derived mesenchymal stem cells engineered to
overexpress BMP4 (Li et al., 2014; Mangraviti et. al, 2016). Collectively, BMP signaling seems
to play an important role in GBM stem cell function, and further studies are required to fully
characterize its role, biological functions, and therapeutic potential.
27
Figure 3. BMP signaling in mammalian cells.
BMP ligand proteins can form a wide variety of homo- or heterodimer molecules, which bind BMPRI and BMPRII,
forming a holocomplex structure. This complex recruit and phosphorylates SMAD1/5, which in turn recruits
SMAD4, forming the key complex in this pathway. BMP can be regulated at multiple levels, including competitive
inhibition by BMP ligand antagonists such as Noggin and Chordin, as well as the presence of inhibitory SMADs
such as SMAD6/7, which functions by degrading the active SMAD1/5/4 complex.
28
1.2.5 ASCL1
Achaete-Scute Family BHLH Transcription Factor 1 (ASCL1; also called Mash1) is an
evolutionary conserved basic helix-loop-helix (bHLH) transcription factor that plays a critical
role in neural differentiation of neural progenitor and stem cells (Bertrand et al., 2002; Kim et al.,
2011; Wilkinson, Dennis and Schuurmans 2013). ASCL1 expression is tightly controlled in
neural stem cells (NSC) through the activity of NOTCH signaling, which maintains NSCs by
inducing the expression of HES1 protein that in turn inhibits ASCL1 expression, and subsequent
neural differentiation (Hirata et al., 2002; Masamizu et al., 2006; Kobayashi et al., 2006). HES1
is controlled by a feedback inhibition, whereby the HES1 protein represses its own transcription,
resulting in a continuous autonomous oscillation of its expression, which in turn leads to
oscillating expression of its proneural gene targets, such as ASCL1 (Shimojo et al., 2006;
Imayoshi et al., 2013) (Figure 4). This oscillatory regulation mechanism of proneural gene
expression is critical to generate precise responses to environmental differentiation cues, as well
as stresses and signals surrounding progenitor cells, in addition to maintaining the organism
homeostasis and lineage commitment (Mengel et al., 2010; Pina et al., 2012; Sequerra et. al,
2013). Figure 4 illustrates a graphical representation of this alternative oscillatory regulation
mechanism.
ASCL1 is a unique proneural gene in that it not only promotes neuronal differentiation, which is
the canonical function of members of this gene family, but also promotes proliferation in certain
cellular contexts (Wilkinson, Dennis and Schuurmans 2013). In cycling neural stem cells
(NSCs), ASCL1 functions by directly regulating a large number of genes that control cell cycle
progression at different phases of the cycle during neural development, including E2F, EP400
and CDCA7 (Castro et al., 2011; Li et al., 2014). On the other hand, in differentiating neural
progenitors it interacts with the NOTCH pathway and functions as a pioneer factor that binds to
chromatin, recruits additional transcription factors and promotes the transcription of
differentiation genes (Raposo et a., 2015). ASCL1 is believed to control multiple stages of
neurogenesis, including neuronal differentiation, migration, axon guidance and synapse
formation (Vaconcelos and Castro, 2014; Castro et al., 2011). Generally, ASCL1 functions in
differentiation through pushing progenitor cells to exit cell cycle and adopt a full neuronal
specification and differentiation (Berninger et al., 2007; Chanda et al., 2014; Pang et al., 2011).
29
Recently, a published study uncovered a novel critical role of ASCL1 in GBM stem cell
differentiation (Park et al., 2017). In this study, Park and colleagues discovered that ASCL1
expression categorizes GBM tumors into two subgroups; ASCL1 high (ASCL1hi) and ASCL1
low (ASCL1lo) tumors. Through a set of in vitro and in vivo experiments on GBM stem cells, the
authors provide evidence that ASCL1 is required for neuronal differentiation in GBM, and that
NOTCH inhibition therapy is effective only in the ASCL1hi subgroup, which was described as
“differentiation-competent GBM”. In addition, the study shows that ASCL1 binds to closed
chromatin in promoter and enhancer regions of the neuronal target genes to activate the terminal
neuronal differentiation program. Subsequently, the authors showed evidence that ASCL1
expression significantly sensitizes GBM stem cells to terminal differentiation and inhibits tumor
progression and prolonged survival in xenografted mice. These results provide an example of the
value of understanding the biology of GBM stem cells and exploiting GBM molecular
mechanisms in combination therapeutic approaches. Collectively, these results suggest that the
well-established role of ASCL1 as proneural factor controlling neural stem cell differentiation,
extends to GBM stem cells as well.
30
Ex
pre
ssio
n l
evel
Figure 4. The alternative oscillatory regulation mechanism controlling the expression of
proneural factors such as ASCL1.
The NOTCH target HES1 exhibits a feedback loop regulation, which leads to inhibiting its own expression and
resulting in oscillations in the expression level over the periods of 2-3 hours as illustrated here. HES1 promotes
neural stem cells by inhibiting the expression proneural differentiation factors including ASCL1. Subsequently,
ASCL1 exhibits similar but alternative oscillatory expression levels to HES1.
HES1
ASCL1 2-3 hours period
31
1.3 Norrie Disease Pseudoglioma (NDP) in the endothelium and cancer cells
Norrin, encoded by the X-linked Norrie Disease Pseudogioma (NDP) gene, is a secreted cysteine
knot protein that forms homo-dimers and binds the Frizzled 4 (FZD4) receptor, which in the
presence of co-receptors LRP5 and TSPAN12, activates the downstream canonical WNT
signaling pathway in endothelial cells (Xu et al., 2004; Junge et al., 2009; Ye et al., 2009; Ke et
al., 2013; Lai et al., 2017; Ye, Wang and Nathans, 2010) (Figure 5). The Norrin/FZD4/WNT
signaling axis modulates retina angiogenesis, and disruption of this signaling pathway in humans
leads to defects in retina vasculature, sensory-neural deficits and cognitive disorders (Xu et al.,
2004; Ye et al., 2009; Ye, Wang and Nathans, 2010). While FZD4 and LRP5 are required for the
signaling, TSPAN12, while not essential, confers NDP-dependent signal amplification (Junge et
al., 2009; Lai et al., 2017). Interestingly, a recent study reported a surprising mechanism of
Norrin/FZD4 signaling in which Norrin binds FZD4 receptor, then the ligand/receptor complex
undergoes endocytosis and endo-lysosomal trafficking to control retinal angiogenesis and barrier
function (Zhang et al., 2017), indicating the existence of other unconventional mechanism that
mediate NDP/FZD4 signaling. Figure 5 illustrates the initial stages of Norrin/FZD4 signaling.
In addition to FZD4, several studies present evidence in support of FZD4 and endothelial cell-
independent NDP signaling (McNeill et al., 2013; Deng et al., 2013; Xu et al., 2012). For
example, Norrin was shown to bind LGR4 as an alternative mechanism to activate canonical
WNT signaling (Deng et al., 2013). Moreover, Norrin can competitively inhibit BMP signaling
by binding BMP4, preventing it from binding to BMP2 and activating the BMPRI/BMPRII
receptor complex (Xu et al., 2012; Deng et al., 2013) (Figure 5).
The Norrin/FZD4 signaling axis was also shown to function beyond the retina vasculature to
play a role in establishment of blood-brain barrier (BBB) in the cerebellum, as well as regulating
the endothelium in the inner ear (Xu et al., 2004; Chen et al., 2015; Zhou and Nathans, 2014;
Zhang et al., 2017; Cho, Smallwood and Nathans, 2017; Wang et al., 2012). Additional roles of
Norrin/FZD4 signaling in protecting retinal ganglion cells and preventing degradation of optic
nerve were also uncovered (Dailey et al., 2017; Leopold et al., 2017). Interestingly, Norrin was
32
recently shown to regulate stem cell- derived cardiac progenitors, suggesting a potential role of
Norrin in stem cell biology (Yoon et al., 2018).
Previously, our group showed that NDP is a downstream target of Sonic Hedgehog (Shh) and
functions to promote neural progenitor proliferation in the developing retina, a function that is
independent of FZD4 and angiogenesis, and seems to be cell autonomous (McNeill et al., 2012;
McNeill et al., 2013). Subsequently, our group also uncovered a novel role of Norrin signaling in
inhibiting the initiation of the Sonic hedgehog subtype of Medulloblastoma (Shh-MB) (Bassett et
al., 2016). In this study, our group showed that NDP is upregulated in human Shh-MB and in
tumors from the MB- prone Ptch+/- mouse, a widely used model for Shh-MB. This study
provided evidence that germline NDP inactivation or endothelial restricted FZD4 knockout
accelerates tumorigenesis in Ptch+/- mice, identifying a protective role for stromal Norrin/FZD4
signaling in tumor initiation in this model. Together, the biological significance of Norrin is
emerging as an atypical WNT ligand that can also inhibit BMP signaling to control several
biological processes. In addition, preliminary studies suggest NDP might be involved in
regulating the progression of some cancer types.
33
Figure 5. Norrin signaling in human cells.
Norrin is an atypical WNT ligand that specifically binds FZD4 leading to the activation of cascade canonical WNT
signaling in many cells. NDP/FZD4 signaling requires the presence of LRP5 co-receptor. TSPAN12 promotes the
strength and specificity of the signal but is not essential for the process. In addition, recent studies have shown that
NDP can bind BMP4, inhibiting the formation of BMP2/4 and suppressing BMP signaling.
34
1.4 Rationale and objective
Despite the interesting recent discoveries about Norrin as an atypical WNT ligand, there has
been very little research aimed at investigating the role of Norrin in cancer. In fact, there are
currently only two studies that investigated Norrin function in cancer: a) Our study in Shh-MB as
highlighted in the previous section (Bassett et al., 2016), and b) An in vitro study in colon cancer
cell lines (Planutis et al., 2007; Planutis, Planutiene and Holcombe 2014). This is likely because
there was a historical association of Norrin with eye disease and endothelial cell functions until
the recent uncovering of the molecular mechanisms mediating its functions.
GBM is extremely aggressive cancer, with very high degrees of heterogeneity and complexity
(Frattini et al., 2013; Vivanco et al., 2012; Sottoriva et al., 2013). Moreover, the current
treatment regimen has a very poor long-term efficiency (Stupp et al., 2009; Thakkar et al., 2014;
Stupp et al., 2005). Therefore, better understanding of the biological and molecular pathways
regulating this disease is in critical demand. Also, there is a significant need for novel therapeutic
targets to overcome the problems of the traditional treatment, such as the very rapid development
of resistance, and the inability of large compounds to pass the blood-brain barrier (Prados et al.,
2015; Hickey et al., 2010). NDP is shown to be expressed in the brain and other parts of the
central nervous system (Bassett et al., 2016; Ye, Wang and Nathans, 2010), and is shown to
activate canonical WNT signaling leading to regulation of cellular processes (Ye et al., 2009; Ke
et al., 2013; Lai et al., 2017).
Since the role of WNT signaling in cancer is very well-established (Clevers and Nusse, 2012;
Zhan, Rindtroff and Boutros, 2017), it is reasonable to propose a role for Norrin, the atypical
WNT ligand, in cancers where it is expressed. Supported by our previous results in MB (Bassett
et al., 2016), the essential role of WNT in regulating GBM stem cells (Rheinbay et al., 2013;
Zheng et al., 2010), as well as preliminary data showing expression of NDP in GBM (discussed
in details in the results section), we sought to investigate the role of Norrin in GBM stem cells.
In this study, we performed a set of in vitro and in vivo experiments, supported by analysis of
primary patient data, to uncover the potential role of Norrin in GBM stem cells. Despite the very
high degree of heterogeneity and complexity, GBM provides an ideal disease model, due to the
availability of large-scale genomic and transcriptomic data resorts, primary tissues, in addition to
35
well-established experimental models and techniques to propagate the cells in vitro. Beside the
extensive amount of research performed in GBM, the properties and experimental models of the
CSC population in this tumor have been very well characterized.
1.5 Hypothesis
Several studies reported a central role of both WNT and BMP signaling in maintaining the
proliferation and progression of CSC populations in several cancer types including GBM (de
Sousa, Melo and Vermeulin, 2016; Rheinbay et al., 2013; Wu et al., 2017; Piccirillo et al., 2006;
Lee et al., 2008; Liu et al., 2010). Norrin, an atypical WNT ligand that is reported to interact with
BMP signaling as well, was shown to be regulating the progression of medulloblastoma in vivo
and colon cancer in vitro (Bassett et al., 2016; Planutis et al., 2007; Planutis, Planutiene and
Holcombe 2014). Since our preliminary bioinformatics analysis shows that Norrin expression is
enriched in the GBM samples (Figure 1), we hypothesize that Norrin plays a role in regulating
the progression of GBM stem cells. To test this hypothesize we planned the next three specific
aims:
1.6 Specific aims
A) To examine the expression patterns of NDP and its receptor FZD4 in different types of
cancers including GBM and investigate if NDP/FZD4 expression correlates with clinical
outcome.
B) To investigate the effect of NDP and/or FZD4 on the growth and progression of GBM in
vitro and in vivo.
C) To identify the cell biological and molecular mechanisms that mediate NDP/FZD
function in GBM.
36
Chapter 2. Materials and Methods
2.1 Computational and in silico analysis
The Cancer Genome Atlas Data (TCGA) data we used in our analysis is publicly available from
the Genomic Data Commons (GDC) data portal (https://gdc.nci.nih.gov/). The gene expression
datasets were measured using the Illumina Hiseq _RNASeqV2 and log2 transformed by the
UCSC Cancer Browser team. NDP gene expression (Boxplot) across cancers was queried using
cBioPortal – a public online database.
Correlation between gene expression and survival was produced by Kaplan-Meier method using
Partek Genomics Suite software (Partek, St. Louis USA) and a log-rank test was performed to
calculate p values (0.05 was considered as the threshold for significance).
For the Gene-set enrichment analysis (GSEA), we compared NDP low vs. high expression (in
IDH wild type GBM) after data was normalized and differential expression was used to perform
pathway analysis. Statistical significance was determined based on the following criteria: FDR <
0.05, Fold change >1.7 or < -1.7.
Computational and in silico analysis was done in collaboration with Dr. Yasin Mamatjan; Aldape
Lab, Princess Margaret Cancer Research Center, Toronto, Canada.
2.2 Primary tumor cell lines and culture
All GBM stem cell (GNS) and human fetal neural stem cell (hNSC) lines used in this study were
obtained under MTA from the laboratory of our collaborator, Dr. Peter Dirks, at Sickkids
Hospital, Toronto, Canada. These cell lines were derived from primary tumors, as previously
described (Pollard et al., 2009), in accordance with the Research Ethics Board at The Hospital
for Sick Children (Toronto, Canada).
37
Primary-derived cell lines were cultured in neural expansion conditions to promote and maintain
the stem cell phenotype (Pollard et al., 2009). Briefly, tissue culture plates and dishes (BD
Falcon) were coated with Poly L-Ornithin (PLO) (Sigma Aldrich) for 20 minutes, followed by
Laminin (Sigma Aldrich) diluted by a factor of 1:200 in PBS for at least 24 hours before being
used for cell culture. Cells were cultured in Neurocult media (StemCell Technologies),
supplemented with BSA solution (Life Technologies) and 5 ml of 200mM L-Glutamine (Wisent)
per 500 ml bottle of media. This base was then supplied with in-house equivalent to N2 hormone
mix, 10 ng/ml recombinant human Epidermal Growth Factor (EGF) (Sigma Aldrich), 10 ng/ml
recombinant human Basic Fibroblast Growth Factor (bFGF) (StemCell Technologies), 2 μg/ml
Heparin (Sigma Aldrich) and 1X B27 Supplement (Life technologies). Cells were passaged for a
maximum of 20 passages, because it was shown that after 20 passages they start to significantly
lose the stem cell phenotype (Pollard et al., 2009). To dissociate and split cells, we used brief
Accutase (Sigma Aldrich) treatment (5 mins, 37 °C).
In this study we used four GNS (G523, G411, G472, G564) and two hNSC lines (hNSC-1,
hNSC-3). G523, G472 belong to the ASCL1hi subgroup, while G411 and G564 are from the
ASCL1lo subgroup.
Additionally, these cell lines were periodically tested for the expression of a panel of stem cell
and differentiation markers, such as SOX2, O4, TU-J, MAP2, GFAP and Nestin, using
immunocytochemistry to ensure the maintenance of the stem cell phenotype.
For lentiviral production, dual-luciferase reporter system assay, and proof of concept
experiments we used a Human Embryonic Kidney cell line (HEK-293T) obtained from (ATCC).
2.3 Recombinant DNA, plasmids and cloning
To knockdown NDP and FZD4 we used short hairpin RNA (shRNA) oligonucleotides (Table 2).
All shRNAs were cloned into pGFP-C-shLenti plasmid by its provider (Origene). qRT-PCR was
used to confirm knockdown of specific genes, and Western blotting was used to confirm
overexpression.
38
Table 2. Sequences of shRNA constructs:
shRNA Sequence Designed by
ShNDP-A GCACCACTATGTGGATTCTAT The RNAi
Consortium (TRC)
shNDP-C GTCACCCATTGTACAAGTGTA The RNAi
Consortium (TRC)
shFZD4-2 CTCAAGTGTGGCTATGATGCTGGCTTATA Origene
shFZD4-4 CATCACTTCAGGCATGTGGATTTGGTCTG Origene
To rescue the effects of short hairpin knockdown of NDP, a degenerate codon NDP transgene
NDP (Mod-NDP) was cloned into a pLV-mCherry plasmid (Addgene) by GeneArt services
(Thermo Fisher Invitrogen). Briefly, we designed a version of NDP coding sequence consisting
of degenerate codon sequences (codons that are not normally used in human cells), which will be
translated to the same amino acid sequence of normal endogenous NDP gene. This modified
version of NDP (Mod-NDP) was cloned into a lentiviral vector that expresses mCherry as a
fluorescence marker. Next, we co-transduced G523 cells with Mod-NDP and either
shScrambled, shNDP-A, or shNDP-C (with GFP marker). This empty mCherry plasmid
backbone was also used to express mCherry as a reporter in the wildtype cells in the cell
competition assay.
The transduction and expression of normal wildtype Norrin from Mod-NDP was confirmed by
western blotting, and its activity was confirmed by the Dual luciferase reporter system assay.
Cells were examined for the presence of both fluorescence markers (GFP for shRNA, and
mCherry for Mod-NDP).
39
Sequence edits of Mod-NDP:
Degenerate codon version (Mod-NDP):
a tgagaaaaca tgtactagct gcatcctttt ctatgctctc cctgctggtg ataatgggag atacagacag
taaaacggac agctcattca taatggactc ggaccctcga cgctgcatga gacatcatta cgtagacagc
atttcacatc cgctatataa atgctcatca aagatggtgc tcctggccag gtgcgagggg cactgcagcc
aggcgtcacg ctccgagcct ttggtgtcgt tcagcactgt cctcaagcaa cccttccgtt cctcctgtca
ctgctgccgg ccccagactt ccaagctgaa ggcactgcgg ctgcgatgct cagggggcat gcgactcact
gccacctacc ggtacatcct ctcctgtcac tgcgaggaat gcaattcctg
Wildtype human NDP sequence:
a tgagaaaaca tgtactagct gcatcctttt ctatgctctc cctgctggtg ataatgggag atacagacag
taaaacggac agctcattca taatggactc ggaccctcga cgctgcatga ggcaccacta tgtggattct
atcagtcacc cattgtacaa gtgtagctca aagatggtgc tcctggccag gtgcgagggg cactgcagcc
aggcgtcacg ctccgagcct ttggtgtcgt tcagcactgt cctcaagcaa cccttccgtt cctcctgtca
ctgctgccgg ccccagactt ccaagctgaa ggcactgcgg ctgcgatgct cagggggcat gcgactcact
gccacctacc ggtacatcct ctcctgtcac tgcgaggaat gcaattcctg
For ectopic NDP and FZD4 overexpression experiments, we used TrueORF cDNA clones from
Origene. pLenti-C-mGFP was used for NDP while pLenti-C-MYC-DDK was used for FZD4.
2.4 Preparation of lentiviral particles and infection
We used a 3rd generation lentiviral transduction system to stably knockdown or overexpress
genes of interest. To produce virus particles, HEK293T cells were cultured in 15 cm dishes (BD
Falcon) and allowed to adhere for 24 hours. The following day, cells were co-transfected with
the lentiviral expression vector in combination with plasmids expressing virus coat and assembly
proteins (REV, RRE, and VSVG) using Lipofectamin 3000 reagent (Lifetechnologies).
40
Conditional media containing virus particles were collected 24 and 48 hours after transfection.
Virus conditioned medium was passed through 0.45 μm low protein binding membranes
(Sarstedt) to capture any contaminating HEK293T cells or debri. Virus was concentrated by
ultracentrifugation of filtered conditioned medium at 22000 g for 2 hours. Virus pellets were
then reconstituted in PBS. To assess virus titer, we infected a series of HEK293T culture vessels
with 1 μL of a dilution series of the reconstituted virus pellet (1X, 1/10X, 1/102X, 1/103X etc.).
48 hours after the infection cells were analyzed using fluorescence microscopy and infectious
particles titer was assess by manual counting of cells expressing the fluorescent protein reporter.
For lentiviral plasmids that do not express fluorescence proteins, we used qRT-PCR using Lenti-
X qRT-PCR kit (Clontech, Takara). Virus solution was then aliquoted into the desired
volume/concentration and stored at -80 °C.
2.5 In vitro cell proliferation assay
For cell proliferation experiments, cells were counted and seeded in coated 24 well plates at a
density of 20,000 cells/well for slower grower lines, and 10,000 cells/well for faster growing
lines. Cells were quantified at two time points (3 and 6 days), or after one time point for more
complex experiments (6 days) during the logarithmic growth phase. To quantify absolute cell
numbers, cells were incubated with Accutase for 5 minutes at 37 °C and observed for full
dissociation using a light microscope. Then, live cells were counted using Hemocytometer slide
after addition of Trypan Blue exclusion dye (Sigma Aldrich). Cell numbers were normalized to
the seeding density of the first day in culture to assess percentage of cell proliferation. At least 3-
4 technical replicate wells were seeded for each sample, and results were statistically analyzed
using standard methods to confirm significance.
2.6 In vitro extreme limiting dilution assay (ELDA)
To assess sphere formation ability, we used the in vitro extreme limiting dilution assay (ELDA),
as previously described (Hu and Smyth 2009). Briefly, cells were carefully dissociated using
Accutase and thorough pipetting to ensure the formation of single cell suspension. After
41
counting, cells were seeded starting from the second lane of an uncoated, suspension culture 96-
well plate (Sarstedt) at a density of 4000 cells/well, with a minimum of 3 or 4 well replicates per
sample. Peripheral rows and columns of the plate were filled with PBS and not included in the
experiment because they harbor different humidity and proliferation kinetics. Cells in the first
column (4000 cells/well) were then serially diluted from one column to the next till cell density
reached 4 cells/well in the last column. Plates were incubated for one and two weeks at 37 °C,
and sphere forming wells were scored at these time points, as per the protocol instructions (Hu
and Smyth, 2009). Scoring results are then analyzed using ELDA software
(http://bioinf.wehi.edu.au/software/elda/) from Walter+Eliza Hall Institute for Medical Research
(WEHI) according to the developer instructions.
Secondary sphere assays were performed as a proof of concept to confirm our results. After
scoring primary sphere plates, spheres of the same samples were collected and dissociated by
incubation with Accutase for 10 minutes at 37 °C and rigorous pipetting. Single cell suspensions
from primary spheres were seeded into new 96 well plates. Secondary sphere plates were then
incubated for two more weeks then scored and analyzed as described above.
2.7 Cell and tissue immunostaining and microscopy
Cells were seeded at least 24 hours prior to the staining procedure on 8-well chamber slides (BD
Falcon) coated with PLO and Laminin, as described above. Once the cells reach appropriate
confluency and/or intended time point, the culture media was removed and cells were washed
briefly with PBS. For fixation, cells were incubated with electron microscopy grade 4%
Paraformaldehyde (PFA) (Bio-Rad) for 10 minutes at room temperature. Subsequently, the cells
were permeabilized in 0.1% Triton-X in PBS (PBST) for 5 minutes at room temperature
followed by incubation with 5% BSA in PBST (blocking solution) at room temperature to block
nonspecific protein binding. Cells were incubated overnight at 4 °C with primary antibodies
diluted in blocking solution. After washing 3 times with PBS (5 minutes each), cells were
incubated for 1 hour at room temperature with secondary antibodies and DAPI (nuclear stain)
diluted in blocking solution, followed by 3 washes with PBS (5 minutes each), mounted in
mounting medium (DAKO) and stored at 4 °C. Cells were imaged at 20X magnification on a
42
Zeiss M2 epifluoresence microscope with apotome unless otherwise is stated in particular
experiments. Zeiss software was then used to analyze, and edit the images, which were then
quantified manually.
To determine the percentage of cycling cells, we quantified EdU+ (5-ethynyl-2'-deoxyuridine)
population using the Click-iT kit (LifeTechnologies), according to manufacturer’s instructions.
Cells were pulsed with 10 μM EdU for 3 hours prior to harvesting. After the incubation, cells
were fixed, permeabilized and EdU+ cells were fluorescence-labeled and detected according to
the protocol of the kit. In some experiments, cells were also stained for the detection of other
markers/antigens such as Ki67 using a different fluorophore.
For immunostaining in tissue sections, animals were perfused transcardially. Briefly, animals
were injected with 10 ml PBS in the heart to clear the circulatory system, followed by 10 ml 4%
PFA injection. Then, the brain was dissected and in 4% PFA overnight at 4°C. Tissues were then
washed in PBS, and cryoprotected in 30% sucrose/PBS overnight at 4°C. After cryoprotection,
tissues were equilibrated in a 50:50 mixture of Optimal cutting temperature compound (OCT
compound):30% sucrose and embedded into plastic molds and snap-frozen in liquid nitrogen.
Brain sections taken at 16 µm in the coronal plane using a Leica CM1850 cyrostat were air dried
(1-2 hr) on Superfrost Plus positively charged slides (Fisher Scientific) and stored with desiccant
at −20°C. Slides were washed in PBS and permeabilized in 0.1% Triton X-100 in PBS. Slides
were blocked with 10% donkey serum (Sigma Aldrich) in PBS for 30 min at room temperature.
Primary antibodies were diluted in 10% donkey serum and incubated with the slides overnight at
4°C. Next day, sections were incubated with secondary antibodies (Molecular Probes) of the
desired fluorescence at 1:1000 for 1 hour at room temperature, and nuclei were stained with
Hoechst and a coverslip was attached with fluorescence mounting medium (Dako S3023).
Fluorescent images of the tumors were captured using an LSM 780 confocal microscope (Zeiss)
at 20X magnification.
43
2.8 Cell competition assay
To address the question of whether NDP functions in a cell autonomous manner, we used a cell
competition assay. Cells were divided into two groups; one was infected with a lentivirus
expressing mCherry only, while the other was infected with a lentivirus expressing GFP in
addition to shRNA oligonucleotide. After both groups expressed the fluorescence dyes,
mCherry+ and GFP+ cells were mixed in 1:1 ratio and part of the resulting cell mixture was
directly analyzed by flow cytometry to determine the seeding density and ratio. Next, mixed cells
were cultured on pre-coated 24 well plates (BD Falcon) and left to grow for 6 days at 37 °C.
After 6 days, cells were dissociated using Accutase and analyzed by flow cytometry to detect the
ratio of mCherry+: GFP+ cells. Additionally, cell mixtures were cultured on pre-coated 8-well
chamber slides (BD Flacon) and analyzed under the fluorescence microscope for visual analysis
and production of representative images. The assay was repeated in two independent biological
replicates.
2.9 Cell lysis and Western Blotting
For preparation of cell lysates, cells were incubated with RIPA buffer (Cell Signaling
Technology) supplemented with protease inhibitor complex (Roche) and phosphatase inhibitor
complex (Cell Signaling Technology) for 5 minutes, followed by sonication and then centrifuged
(13000 RPM, 15 minutes) to remove nucleic acids and cell debris. Bradford assay was used
according to manufacturer instructions to assess protein concentration. Protein concentrations
were measured using a benchtop spectrophotometer (Eppendorf). After addition of Laemmli
loading buffer (Sigma Aldrich), lysates are incubated at 95 °C to ensure complete protein
denaturation. Western blotting was performed according to standard protocols (wet transfer,
PVDF membranes), and images were developed using Odyssey fluorescence scanner system.
BLUeye prestained protein ladder (GeneDireX) was used as a marker to identify the molecular
weights of target proteins. Housekeeping controls such as GAPDH was used as a loading control.
44
2.10 Small molecules and recombinant proteins
Table 3. Sources and concentrations of used reagents:
Reagent Source Working
concentration
Description
Anti-FZD4
blocking antibody
Lexicon
pharmaceuticals
10 nM Monoclonal
blocking antibody
Anti-KLH
blocking antibody
Lexicon
pharmaceuticals
10 nM Isotype matched
control for Anti-
FZD4
IWP-2 Sigma-Aldrich 2 nM Porcupine
inhibitor
XAV939 Sigma-Aldrich 5 nM Tankyrase
inhibitor
rhNorrin R&D systems 100 ng/ml Recombinant
human Norrin
rhWNT3a R&D systems 100 ng/ml Recombinant
human WNT3a
rhBMP4 R&D systems 30 ng/ml Recombinant
human BMP4
DMH1 Sigma-Aldrich 100 nM BMP signaling
inhibitor
45
2.11 Antibodies
Table 4. Sources, uses and dilutions of used antibodies:
Antibody Source Catalog
number
Technique Dilution
Anti-GAPDH EMD Millipore CB1001 Western
blotting
1:5000
Anti-NDP R&D AF3014 Western
blotting
1:500
Anti-MYC Abcam ab32 Western
Blotting, IHC
1:1000
Anti-Ki67 BD Biosciences 550609 ICC 1:100
Anti-Sox2 Abcam ab97959 ICC 1:1000
Anti-SMAD1 Cell Signaling Technology 9743S WB 1:1000
Anti-GFAP Dako Z0334 ICC 1:1000
Anti-MAP2 Abcam ab5392 ICC 1:2000
Anti-O4 Abcam ab53041 ICC 1:1000
Anti-
phospho-
SMAD1/5
Cell Signaling Technology 9516S WB 1:1000
Anti-Nestin Abcam ab22035 ICC 1:500
Anti-TUB33 EMD-Millipore MAB1637 ICC 1:200
Anti-HuAg EMD Millipore MAB1281 IHC 1:1000
46
2.12 Dual-Luciferase reporter assay system
To assess WNT activity, we used the Dual-Luciferase reporter assay system (Promega) to detect
the signal produced by Top-flash (with a β-Catenin activated promoter) reporter plasmid.
Briefly, HEK293T cells were transiently transfected with a plasmid mixture containing NDP,
FZD4, LRP5, TSPAN12, TOP-FLASH, and Renilla as a transfection control. We used
recombinant human Norrin (R&D Systems), recombinant human WNT3a (R&D systems),
WNT3a overexpression, NDP overexpression, or small molecule GSK3 inhibitors (CHIR or Bio)
as positive controls to activate canonical WNT signaling in different experiments. Cells were
incubated for 24 or 48 hours and cell lysates were prepared by passive lysis according to the
manufacturer’s instruction. Subsequently, luminescence signals were measured and normalized
to the renilla internal control using a bench top luminometer. Each sample was measured in at
least 3-4 biological replicates and results were analyzed using standard statistical methods to
confirm significance.
2.13 Flow cytometry analysis
Flow cytometry analysis was used to quantify the percentage of mCherry+: GFP+ for the
competition assay. Cells were lifted using Accutase, washed with PBS then fixed using 4% PFA.
Wild type and single fluorescent marker cells were used as controls for each experiment. The
flow cytometry run, analysis and quantification were performed at The SickKids-UHN Flow and
Mass Cytometry Facility with the assistance of Ms. Emily Reddy.
2.14 RNA extraction and qRT-PCR
We used quantitative real time PCR (qRT-PCR) to quantify gene expression. RNA was extracted
using RNeasy mini-prep (Qiagen), according to manufacturer’s instructions. The concentration
and purity of RNA were assessed using a bench top Nanodrop. First strand complementary
cDNA was reverse transcribed using QuantiTect (Qiagen) kit, according to manufacturer’s
47
instructions. All samples included a no-reverse transcriptase (NRT) negative control to ensure
total elimination of genomic DNA. The resulting cDNA was stored in -20 °C. For the qRT-PCR
experiments, we used the iQ SYBR Green Supermix (Bio-Rad), as per manufacturer’s
instructions. Results were statistically analyzed according to the standard protocols to generate
double-delta CT values and comparative fold changes in gene expression relative to the controls.
All qRT-PCR products were confirmed by gel electrophoresis, sequencing, as well as the
existence of only one melting curve peak/gene product.
2.15 PCR primers
qRT-PCR primers were generated using NCBI primer blast tool with the standard parameters,
and specifically designed to span an exon-exon junction in order to avoid amplification of
genomic gDNA. Primers were synthesized by ACGT company, Toronto, Canada.
Table 5. Sequences of qRT-PCR primers used in this study:
NDP-Forward TGCGTTCCCCTAAGCTGTG
NDP-Reverse ACCAGCAGGGAGAGCATAGA
FZD4-Forwards CTGACTGTAGGCCGGGAAAG
FZD4-Reverse TGACCCCATTTGAGTCCTGC
TSPAN12-Forward CTGCAGAAACGAGGGTAGAGG
TSPAN12-Reverse ACGCCACAAGCCAGTTCTAC
LRP5-Forward GTCGTCGGTGACAGAGTTACA
48
LRP5-Reverse AGCAAGCATCACGTCCTCTG
B-Actin-Forward GAGCACAGAGCCTCGCC
B-Actin-Reverse TCATCATCCATGGTGAGCTGG
GAPDH-Forward ATGTTGCAACCGGGAAGGAA
GAPDH-Reverse AGGAAAAGCATCACCCGGAG
hPRT2-Forward CCTGGCGTCGTGATTAGTGA
hPRT2-Reverse CGAGCAAGACGTTCAGTCCT
2.16 RNA-Seq library
Cells were infected with ShScrambled, shNDP-A, or shNDP-C and after 48h GFP reporter
expression was confirmed and RNA was extracted using RNeasy mini kit (Qiagen). A proportion
of each sample was used to synthesize cDNA and confirm NDP knockdown efficiency using
qRT-PCR as explained above. Subsequently, samples were submitted to Genome Quebec center,
where RNA quality was confirmed using Bioanalyzer (Agilent), then RNA-Seq libraries were
run. The screen consisted of two cell lines; G523 and G411. Each cell line had 9 samples; 3
biological replicates of shScrambled controls, 3 biological replicates of shNDP-A, and 3
biological replicates of shNDP-C transduced cells. Sample extracts were enriched for stranded
poly(A)-mRNA and sequenced on Illumina HiSeq 4000 PE100. After library run, paired-ends
sequencing reads were clipped for adapter sequence, trimmed for minimum quality (Q30) in 3'
and filtered for minimum length of 32 bp using Trimmomatic [PMID: 24695404]. Surviving read
49
pairs were aligned to the Ensembl 87 release GRCh38 Homo sapiens assembly using the STAR
[PMID: 23104886] two-passes method.
A gene-level count-based gene quantification against Ensembl annotations was performed using
HT-seq count [PMID: 25260700] in the intersection-nonempty mode. Exploratory analysis was
conducted using various functions and packages from R and the Bioconductor project [PMID:
25633503]. Differential expression was conducted using both edgeR [PMID: 19910308] and
DEseq [PMID: 20979621]. Terms from the Gene Ontology were tested for enrichment with the
GOseq [PMID: 20132535] R package. Transcript-level assembly, quantification and differential
expression analysis was performed using Cufflinks [PMID: 20436464] and Cuffdiff [PMID:
23222703].
We would like to thank Jose Hector Galvez at the Canadian Centre for Computational Genomics
(C3G) for his help with the RNA-seq analysis. The C3G is a Node of the Canadian Genomic
Innovation Network and is supported by the Canadian Government through Genome Canada.
2.17 Animals
For in vivo transplantation experiments we used 5 to 8-week-old NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ
(NSG) female mice. All mice were purchased from Animal Research Center (ARC), UHN,
Toronto, Canada. Experimental groups consisted of at least 5 mice/ group. Randomization was
not performed. Mice were housed in our facility located at the Krembil Discovery tower and all
experimental protocols were approved by the ethics and biosafety board of the Animal Research
Center (ARC), UHN, Toronto, Canada.
2.18 Orthotopic xenografting
Lentiviral infected GNS cells were dissociated using Accutase, then reconstituted to a
concentration of 50000 cells/μl in PBS. Mice were anaesthetized with Ketamine/Medetomidine
and immobilized using a stereotaxic head frame. After shaving the head, an incision was made at
50
the midline, then a bore-hole was drilled in the skull 1 mm lateral and 2 mm posterior to Bregma.
Using a Hamilton syringe with a 27G round bottom needle, cells were uniformly injected with an
automated nano-injector over the period of 3 minutes. After injection, the needle was left in
place for 5 minutes to avoid cell reflux, then removed slowly and uniformly. Finally, the skull
was covered with bone wax, the incision was closed with sutures (size 5.0) followed by reversal
of the anesthetic. Tramadol (Sigma Aldrich) was used for analgesia according to the ethics board
protocols and recommendations for major surgeries. After surgery, animals were observed on a
daily basis until they developed symptomatic tumors. Upon tumor formation, mice were
sacrificed, perfused with PBS and 4% PFA, and brains were collected and fixed according to
protocols for immunohistochemical analysis, as described above. Mice that developed
complications due to surgery were removed from the study.
2.19 Quantification and statistical analysis
All experiments in this study were repeated at least three independent times (3 biological
replicates), each of them included at least three technical replicates to confirm significance of
observations. All groups in each independent experiment were matched in regard to number of
biological and technical replicates. In addition, cells were matched in regard to passage number
and culture conditions, as well as chemicals and reagents stocks.
Quantification of immunohistochemical markers staining was performed manually with the
assistance of Zeiss software by visually detecting and marking positive cells, then manually
counting them. Quantification of qRT-PCR experiments was performed using the standard
double-delta CT (ΔΔCT) method, comparing the expression levels of experimental samples to
internal controls of housekeeping genes then experimental control of untreated or unmodified
cells. Unpaired two tailed Student’s t-test was used to assess significance unless otherwise is
stated in specific experiments. Standard deviation and standard error of the mean values were
calculated for each experimental group, and standard error of the mean values were used in the
graphical representation of error bars in the figures. Significance of in vivo transplantation and
survival experiments was assessed using Log-rank test.
51
Chapter 3. Results
3.1 NDP expression is enriched in GBM and correlates with survival in several neurological cancers
We queried the cancer genome atlas (TCGA) database and found that NDP expression is highly
enriched in primary human gliomas, LGG and GBM (Figure 6A). Interestingly, NDP expression
was also abundant in a wide variety of cancer types, some of which revealed variable expression
levels, like breast cancer (Figure 6A). Similarly, analysis of the cancer cell line encyclopedia
(CCLE) (Barretina et al., 2012) revealed a significant enrichment of NDP expression in brain
tumor lines (Figure 7A). The Norrin receptor, FZD4, is also expressed in different cancer types;
however, the expression levels in GBM are comparable with other cancers (Figure 6B, 7B) and
not highly enriched as in the case of NDP.
Next, we examined whether NDP expression levels correlate with survival in neurological
cancers. We found that NDP expression positively correlates with survival outcomes in GBM,
neuroblastoma and brain astrocytoma (LGG) (Figure 8). In contrast, there was no correlation
between FZD4 expression and survival in GBM (Figure 8). Collectively, these results indicate
the NDP is expressed in a wide range of cancer types, with significant enrichment in GBM.
52
53
Figure 6. NDP expression is enriched in GBM and LGG tumor samples from TCGA
A) NDP expression levels among different cancer types from TCGA data portal analyzed by firebrowse server
provided by the Broad Institute, USA (Deng et al., 2017). NDP expression was detected in several types of
cancer including breast, prostate, leukemia, low grade glioma, and GBM cancers. Red boxes represent
tumor samples, blue boxes represent normal counterparts, and white boxes represent missing normal
counterparts.
B) FZD4 expression levels among different cancer types from TCGA data portal analyzed by firebrowse
server provided by the Broad Institute, USA (Deng et al., 2017).
54
A
B
55
Figure 7. NDP expression is enriched in GBM cell lines from CCLE.
A) Analysis of NDP expression levels in CCLE from the Broad Institute, (Barretina et al., 2012), which
contains data from more than 1000 cell lines representing a wide variety of cancer types.
B) Analysis of FZD4 expression levels in CCLE from the Broad Institute, (Barretina et al., 2012), which
contains data from more than 1000 cell lines representing a wide variety of cancer types.
56
57
Figure 8. NDP expression levels correlate with survival in neurological cancers
A) NDP expression levels positively correlated with patients’ survival outcomes in GBM, neuroblastoma, and
LGG.
B) FZD4 expression levels do not correlate with survival outcomes in GBM patients.
C) NDP expression levels exhibit divergent correlation patterns with survival outcomes in GBM based on
ASCL1 expression levels. In ASCL1lo GBM patients, there is a striking positive correlation of NDP
expression levels with survival outcomes.
58
3.2 NDP/FZD4 pathway components are expressed in GNS and hNSC cells
Using previously described Glioblastoma neural stem cell (GNS) culture protocols (Pollard et al.,
2009), we expanded primary GNS and non-cancerous fetal human neural stem cell (hNSC) lines
to assess the expression of Norrin/FZD4 signaling axis components (NDP, FZD4, LRP5 and
TSPAN12). Quantitative real time qRT-PCR revealed the expression of all signaling components
in almost all tested lines (Figure 9A), however; the expression levels varied significantly from
one line to another. In addition, we performed Gene Set Enrichment Analysis (GSEA) on GBM
tumors and found that NDP expression levels significantly correlate with classical GBM (Figure
9B) and aging brain (Figure 9C) gene sets. Together, the survival and GSEA results suggest that
NDP might be functionally important in GBM.
59
60
Figure 9. NDP/FZD4 pathway components are expressed in GNS and hNSC lines, and NDP
expression level is correlated with classical GBM gene set
A) Expression of NDP/FZD4 pathway components (NDP, FZD4, LRP5, TSPAN12) in a panel of 9 primary-
derived GNS was determined by qRT-PCR analysis. Expression levels were normalized to a control
housekeeping gene (hPRT2) and individual cell line expression levels were represented as fold change
relative to the summed average expression level of all lines.
B) Similarly, expression of NDP/FZD4 pathway components (NDP, FZD4, LRP5, TSPAN12) was assessed in
3 hNSC lines by qRT-PCR as described above. Generally, hNSC lines expressed significantly higher levels
of NDP than GNS lines (gave quite higher CT values).
C) GSEA analysis revealed a correlation between NDP and classical GBM and aging brain gene sets. NDP
high group is associated with several significantly enriched pathways, where NDP high group were
enriched for molecular pathways like VERHAAK_GLIOBLASTOMA_CLASSICAL pathway.
61
3.3 NDP regulates proliferation and sphere formation of hNSC and GNS cells in vitro
To investigate the role of NDP and FZD4 on growth and clonogenicity of nontransformed hNSC
and tumorigenic GNS lines we generated lentiviral constructs to express gene-specific
shorthairpins (2/gene) or full length cDNAs. We confirmed knockdown efficiency by
quantitative real time PCR (qRT-PCR), and ectopic expression by western blotting (Figure 9,
10). NDP and FZD4 knockdown in two hNSC lines significantly inhibited growth, whereas
ectopic expression of these genes had the opposite effect, indicating that activation of the
NDP/FZD4 signaling pathway is growth promoting in nontransformed NSCs (Figure 10, 11).
Next, we tested the effect of NDP or FZD4 gain and loss of function on GNS growth and sphere
formation. NDP or FZD4 knockdown in ASCL1lo GNS line G411 increased growth (Figure 12)
and sphere formation (Figure 12), and ectopic expression was inhibitory in these assays (Figure
12), which is in direct contrast to our findings in hNSC. We tested a second ASCL1lo GNS line
(G564) and obtained similar results (Figure 13), suggesting that NDP/FZD4 signaling is growth
inhibitory in ASCL1lo GNS cells. Consistent with this possibility, when we stratified GBM on
the basis of ASCL1 expression we found that most of the survival advantage of NDP expression
stratified with tumors that had low levels of ASCL1 expression, while tumors with high ASCL1
levels did not show any correlation between NDP expression level and survival outcomes (Fig
7). Taken together, we find that NDP/FZD4 signaling is growth promoting in non-transformed
hNSC, but is growth inhibitory in ASCL1lo GNS, which is consistent with the survival advantage
associated with NDP expression in ASCL1lo GBM.
62
63
Figure 10. NDP and FZD4 stimulate the proliferation of hNSC-1 in vitro.
A) hNSC-1 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-
C (targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously, to knockdown the
indicated genes. Next, cells were seeded in 24 well plates (20000 cells/well, 4 replicates/sample), and left
to grow for 3 and 6 days. At each of these time points, cells were lifted, quantified by Trypan blue and
compared to the seeding density to quantify the fold change in cell number. Graphs represent the averages
of 3 independent biological replicates (e.g. 3 independent viral infection experiments). p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
B) To confirm our observations, hNSC-1 cells were infected with an empty lentiviral construct (control),
hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic MYC-tagged FZD4). Next, cells were used
in a growth assay as described above. Graphs represent the averages of 3 independent biological replicates.
p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) qRT-PCR was used to confirm knockdown efficiency. Results were normalized to a housekeeping gene
control and represented as fold changes compared to the shScrambled control. PCR products were validated
by sequencing.
D) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
64
65
Figure 11. NDP and FZD4 stimulate the proliferation of hNSC-3 in vitro.
A) hNSC-3 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-
C (targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously, to knockdown the
indicated genes. Next, cells were seeded in 24 well plates (20000 cells/well, 4 replicates/sample), and left
to grow for 3 and 6 days. At each of these time points, cells were lifted, quantified by Trypan blue and
compared to the seeding density to quantify the fold change in cell number. Graphs represent the averages
of 3 independent biological replicates (e.g. 3 independent viral infection experiments). p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
B) To confirm our observations, hNSC-3 cells were infected with an empty lentiviral construct (control),
hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic MYC-tagged FZD4). Next, cells were used
in a growth assay as described above. Graphs represent the averages of 3 independent biological replicates.
p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) qRT-PCR was used to confirm knockdown efficiency. Results were normalized to a housekeeping gene
control and represented as fold changes compared to the shScrambled control. PCR products were validated
by sequencing.
D) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
66
67
Figure 12. NDP and FZD4 inhibit the proliferation of G411 cells in vitro.
A) G411 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-C
(targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously. Next, cells were
seeded in a 24 well plates (20000 cells/well, 4 replicates/sample), and left to grow for 3 and 6 days. At each
of these time points, cells were lifted, quantified by Trypan blue and compared to the seeding density to
identify the fold change in cell number. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
B) Cells were seeded in 96 well plates in a serial dilution series starting with 2000 cells/well, as described in
Chapter 2. After 2 weeks in culture, wells were scored for the presence of spheres and sphere frequency
was quantified as described in the methods. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) Growth assay with NDP or FZD4 overexpression G411 cells. Cells were infected with an empty lentiviral
construct (control), hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic FZD4 fused to MYC
reporter) and used in the growth assay as described above. Graphs represent the averages of 3 independent
biological replicates. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
D) Sphere formation with cells with ectopic NDP or FZD4 expression. Graphs represent the averages of 3
independent biological replicates. Graphs represent the averages of 3 independent biological replicates. p <
0.05 was considered significant. Error bars represent standard error of the mean values of the corresponding
sample replicates.
E) qRT-PCR was used to confirm knockdown efficiency of the shorthairpin constructs. Results were
normalized to a housekeeping gene control and represented as fold changes compared to the shScrambled
control. PCR products were validated by sequencing.
F) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
68
69
Figure 13. NDP and FZD4 inhibit the proliferation of G564 cells in vitro.
A) G564 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-C
(targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously. Next, cells were
seeded in a 24 well plates (20000 cells/well, 4 replicates/sample), and left to grow for 3 and 6 days. At each
of these time points, cells were lifted, quantified by Trypan blue and compared to the seeding density to
identify the fold change in cell number. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
B) Cells were seeded in 96 well plates in a serial dilution series starting with 2000 cells/well, as described in
Chapter 2. After 2 weeks in culture, wells were scored for the presence of spheres and sphere frequency
was quantified as described in the methods. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) Growth assay with NDP or FZD4 overexpression G564 cells. Cells were infected with an empty lentiviral
construct (control), hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic FZD4 fused to MYC
reporter) and used in the growth assay as described above. Graphs represent the averages of 3 independent
biological replicates. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
D) Sphere formation with cells with ectopic NDP or FZD4 expression. Graphs represent the averages of 3
independent biological replicates. Graphs represent the averages of 3 independent biological replicates. p <
0.05 was considered significant. Error bars represent standard error of the mean values of the corresponding
sample replicates.
E) qRT-PCR was used to confirm knockdown efficiency of the shorthairpin constructs. Results were
normalized to a housekeeping gene control and represented as fold changes compared to the shScrambled
control. PCR products were validated by sequencing.
F) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
70
3.4 The biological effects of NDP in GBM stratify with ASCL1 expression levels
These findings led us to examine the function of NDP/FZD4 in GNS lines with high levels of
ASCL1 expression (ASCL1hi). To address this question, we performed a similar gain and loss of
function analysis in two independent ASCL1hi lines (G523, G472). NDP knockdown resulted in
striking inhibition of proliferation and sphere formation in vitro (Figure 14, 15). Notably, cells
with NDP knockdown, marked by the presence of the GFP reporter from the lentivirus, were
significantly diminished after two weeks in the sphere cultures compared to controls, suggesting
that they have a growth disadvantage (Figure 16). Interestingly, manipulating FZD4 in either
ASCL1hi cell line failed to produce a significant phenotype, suggesting the existence of an
alternative mechanism mediating the effect of NDP expression on growth in these lines (Figure
14, 15). Although one of the two shFZD4 constructs (shFZD4-2) seemed to have a slight effect
on the proliferation and sphere formation in G523 cells, this effect was not reproducible with the
other shFZD4 construct (shFZD4-4). Additionally, overexpressing FZD4 in this line failed to
produce a phenotype, indicating that the slight phenotype observed in case of shFZD4-2 likely to
be an off-target effect. Moreover, both shFZD4 constructs failed to produce a phenotype on
proliferation or sphere formation in G472 cells.
To confirm the specificity of the short hairpin RNA constructs, we tried an alternate CRISPR-
based approach for NDP knockdown, however we were unable to grow out clones. Therefore,
we designed a degenerate codon modified NDP lentivirus (MOD-NDP) and confirmed that this
version could rescue the growth inhibitory effect of shorthairpin NDP knockdown (Figure 17).
Table 6 includes a summary of our in vitro cell growth and sphere formation results in all cell
lines. These findings indicate a significant role of NDP in regulating proliferation and sphere
formation attributes of GNS cells. In addition, the function of NDP in ASCL1hi GNS cells might
be FZD4-independent. Finally, these results indicate a surprising difference in the biological
effects of NDP on GBM in vitro that stratify with ASCL1 expression status.
71
72
Figure 14. NDP stimulates the proliferation of G523 cells independent of FZD4 in vitro.
A) G523 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-C
(targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously. Next, cells were
seeded in a 24 well plates (20000 cells/well, 4 replicates/sample), and left to grow for 3 and 6 days. At each
of these time points, cells were lifted, quantified by Trypan blue and compared to the seeding density to
identify the fold change in cell number. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
B) Cells were seeded in 96 well plates in a serial dilution series starting with 2000 cells/well, as described in
Chapter 2. After 2 weeks in culture, wells were scored for the presence of spheres and sphere frequency
was quantified as described in the methods. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) Growth assay with NDP or FZD4 overexpression G523 cells. Cells were infected with an empty lentiviral
construct (control), hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic FZD4 fused to MYC
reporter) and used in the growth assay as described above. Graphs represent the averages of 3 independent
biological replicates. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
D) Sphere formation with cells with ectopic NDP or FZD4 expression. Graphs represent the averages of 3
independent biological replicates. Graphs represent the averages of 3 independent biological replicates. p <
0.05 was considered significant. Error bars represent standard error of the mean values of the corresponding
sample replicates.
E) qRT-PCR was used to confirm knockdown efficiency of the shorthairpin constructs. Results were
normalized to a housekeeping gene control and represented as fold changes compared to the shScrambled
control. PCR products were validated by sequencing.
F) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
73
74
Figure 15. NDP stimulates the proliferation of G472 cells independent of FZD4 in vitro.
A) G472 cells were infected with lentiviral construct expressing shScrambled (control), shNDP-A, shNDP-C
(targeting NDP), shFZD4-2 or shFZD4-4 (targeting FZD4), as described previously. Next, cells were
seeded in a 24 well plates (20000 cells/well, 4 replicates/sample), and left to grow for 3 and 6 days. At each
of these time points, cells were lifted, quantified by Trypan blue and compared to the seeding density to
identify the fold change in cell number. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
B) Cells were seeded in 96 well plates in a serial dilution series starting with 2000 cells/well, as described in
Chapter 2. After 2 weeks in culture, wells were scored for the presence of spheres and sphere frequency
was quantified as described in the methods. Graphs represent the averages of 3 independent biological
replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean values of the
corresponding sample replicates.
C) Growth assay with NDP or FZD4 overexpression G472 cells. Cells were infected with an empty lentiviral
construct (control), hNDP (expressing ectopic NDP) or hFZD4 (expressing ectopic FZD4 fused to MYC
reporter) and used in the growth assay as described above. Graphs represent the averages of 3 independent
biological replicates. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
D) Sphere formation with cells with ectopic NDP or FZD4 expression. Graphs represent the averages of 3
independent biological replicates. Graphs represent the averages of 3 independent biological replicates. p <
0.05 was considered significant. Error bars represent standard error of the mean values of the corresponding
sample replicates.
E) qRT-PCR was used to confirm knockdown efficiency of the shorthairpin constructs. Results were
normalized to a housekeeping gene control and represented as fold changes compared to the shScrambled
control. PCR products were validated by sequencing.
F) Western blotting was used to confirm overexpression. Due to the lack of efficient FZD4 antibodies,
MYC tag was used to detect ectopic FZD4 expression.
75
76
Figure 16. GFP+ G523 shNDP cells diminish after 2 weeks in sphere cultures
G523 shScrambled, shNDP or shFZD4 cells were seeded in sphere culture as previously described. After 2 weeks in
culture, cells were examined under fluorescence microscope to assess the maintenance of GFP expression as a
marker of the cells with shRNA constructs in each sample. Shown are representative images taken by a fluorescence
microscope at 20X magnification. Scale bar, 100 μM.
77
78
Figure 17. Ectopic expression of shorthairpin insensitive NDP construct rescues the effects
of NDP knockdown.
A) G523 shScrambled or shNDP cells were prepared as previously described then transduced with a
lentivirus expressing empty mCherry, or mCherry+Mod-NDP (expressing a degenerate codon version
of NDP that is insensitive to shNDP A or C). After 3 days in culture, infection efficiency was roughly
assessed by the expression of GFP (reporter in the knockdown construct) and mCherry, then used in
subsequent functional assay. Cell proliferation was assessed using Trypan blue proliferation assay.
Cells were seeded in a 24 well plates (20000 cells/well, 4 replicates/sample), and left to grow for 3 and
6 days. At each of these time points, cells were quantified and compared to the seeding density to
identify the fold change in cell number. qRT-PCR was used to confirm knockdown efficiency as
previously described. Mod-NDP was able to completely rescue the effect of endogenous NDP
knockdown. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding
sample replicates.
B) Western blotting was used to confirm Mod-NDP overexpression in cells infected with the indicated
lentiviruses. GAPDH expression was used as a loading control.
79
80
Table 6. In vitro effects of manipulating NDP or FZD4 expression on different cell types
Summary of observed effects on growth (examined by Trypan blue proliferation assa), or sphere formation
(examined by ELDA assa) after NDP or FZD4 expression manipulation. Sphere formation of hNSC lines after
manipulating NDP or FZD4 was not tested.
81
3.5 Different molecular pathways mediate the biological function of NDP in ASCL1hi versus ASCL1lo GBM
NDP was shown to function predominantly through binding the FZD/LRP5 receptor complex in
the presence of TSPAN12 as a signal amplifier to activate canonical WNT pathway (Xu et al.,
2004; Junge et al., 2009; Ke et al., 2013). However, several subsequent studies suggested the
existence of alternative pathways and/or receptors mediating different biological functions of
NDP (Seuitz et al., 2017; McNeill et al., 2013; Deng et al., 2013, Xu et al., 2012). In the previous
section, we show that manipulating FZD4 in ASCL1lo GNS lines phenocopies manipulation of
NDP, while in ASCL1hi lines, manipulation of FZD4 fails to produce a phenotype. Thus, we
hypothesized that NDP function in ASCL1hi lines is FZD4 and canonical WNT pathway
independent.
To test this hypothesis, we overexpressed NDP in G411 (ASCL1lo) and G523 (ASCL1hi) cells,
then treated them with several WNT inhibitors that act at different levels of the pathway
(monoclonal anti-FZD4 blocking antibody that inhibits FZD4 receptor; and Tankyrase inhibitor
(XAV 939) that stimulates β-Catenin degradation by stabilizing its destruction complex), to test
whether inhibiting WNT signaling is sufficient to block the effect of NDP overexpression.
Expectedly, anti-FZD4 antibody as well as WNT inhibitor treatments were sufficient to inhibit
the growth phenotype of ectopic NDP expression in G411 (ASCL1lo) cells, indicating WNT-
functional dependence of NDP in these cells and confirming the effect of WNT inhibition in this
cohort of GBM (Figure 18). On the other hand, blocking FZD4 or inhibiting WNT signaling
failed to affect the proliferation of G523 cells with or without NDP overexpression, indicating
WNT-functional independence of NDP in these cells (Figure 19). The biological activity of all
reagents was confirmed through a luciferase reporter TOP-Flash assay, as previously described
(Liu et al., 2003) (Figure 18).
NDP was previously reported to antagonize BMP signaling in Xenopus by binding BMP4
protein and preventing it from activating the BMP/SMAD4 signaling cascade (Xu et al., 2012).
Interestingly, BMP activation in GBM stem cells was reported to promote differentiation and
inhibit proliferation (Piccirillo et al., 2006; Lee et al., 2008), which is similar to the phenotype of
NDP knockdown in ASCL1hi GNS lines. Therefore, we hypothesized that NDP might promote
82
proliferation and sphere formation in ASCL1hi GNS cells by antagonizing BMP/SMAD4
signaling. To test this hypothesis, we treated NDP overexpressing G523 or G472 cells with
recombinant human BMP4 (rhBMP4). rhBMP4 treatment was able to overcome the effect of
NDP overexpression on the proliferation of G523 cells (Figure 19). Another prediction of this
model is that blocking BMP signaling should rescue the growth defect cause by NDP
knockdown. Therefore, we monitored growth of shNDP G523 cells treated with the specific
BMP inhibitor (DMH1). DMH1 treatment produced a striking stimulation of proliferation in
control cells, indicating that there is an endogenous level of BMP signaling that is growth
inhibitory. However, inhibiting BMP signaling failed to rescue proliferation in NDP knockdown
cells (Figure 19). One possibility is that NDP knockdown results in high levels of BMP signaling
activity that cannot be antagonized by the DMH1. In other words, it is possible the NDP
knockdown rescued the effect of BMP inhibition and not the opposite. Collectively, these results
indicate that NDP functions in WNT-dependent and WNT-independent modes depending on
ASCL1 status in GNS.
83
84
Figure 18. The effects of NDP are FZD4 and WNT –dependent in ASCL1lo, and -
independent in ASCL1hi GNS lines.
A) G411 (ASCL1lo) NDP overexpression cells were prepared as previously described then treated with either
DMSO as a vehicle control, XAV939 (5 μM), anti-FZD4 blocking antibody (10 nM), or its isomatched
control anti-KLH antibody (10 nM). Treatments were re-applied every 3 days. Cell density was then
assessed using Trypan blue proliferation assay after 6 days as previously described and represented as fold
change in cell number relative to seeding density. Graphs represent the averages of 3 independent
biological replicates. p-Value <= 0.05 was considered significant. Error bars represent standard error of the
mean values of the corresponding sample replicates. Graphs represent the averages of 3 independent
biological replicates. p < 0.05 was considered significant. Error bars represent standard error of the mean
values of the corresponding sample replicates.
B) Similar to G411 cells, G523 (ASCL1hi) NDP overexpression cells were treated with the same WNT
inhibitors, and cell proliferation was assessed in the same way. Graphs represent the averages of 3
independent biological replicates. p < 0.05 was considered significant. Error bars represent standard error
of the mean values of the corresponding sample replicates.
C) HEK293T cells were transiently transfected with TOP-flash dual luciferase reporter system assay
components (hFZD4, hLRP5, hTSPAN12, Top-Flash, and Renilla plasmids) as previously described. Then,
cells were treated with recombinant human WNT3a (100ng) in combination with either DMSO or XAV939
(5 μM). Graphs represent the averages of 3 independent biological replicates. p < 0.05 was considered
significant. Error bars represent standard error of the mean values of the corresponding sample replicates.
D) Similarly, HEK293T cells were transiently transfected with TOP-flash dual luciferase reporter system assay
components then treated with recombinant human Norrin (100ng) +anti-KLH or anti-FZD4 to test their
biological activities. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
85
86
Figure 19. BMP antagonizes the effects of NDP manipulation in ASCL1hi GNS lines.
A) G523 (ASCL1hi) NDP knockdown cells were seeded in 24 well plates (20000 cells/ well) and treated with
either DMSO as a vehicle control, or the BMP inhibitor (DMH1) (100 nM, treatment was re-applied every
3 days). In the second graph, G523 NDP overexpression cells were treated with either PBS as a vehicle
control, or rhBMP4 (15 ng/ml, treatment was re-applied every 3 days). Cell density was then assessed using
Trypan blue proliferation assay as previously described and represented as fold change in cell number
relative to seeding density. Knocking down NDP silenced the effect of DMH1 and rendered cells
insensitive to the treatment while rhBMP4 treatment completely compensated the effect of NDP
overexpression. Graphs represent the averages of 3 independent biological replicates. p < 0.05 was
considered significant. Error bars represent standard error of the mean values of the corresponding sample
replicates.
B) Similar to G523 cells, G472 (ASCL1hi) NDP overexpression cells treated with rhBMP4 to observe effects
on proliferation. rhBMP4 treatment completely compensated the effect of NDP overexpression. Graphs
represent the averages of 3 independent biological replicates. p-Value <= 0.05 was considered significant.
Error bars represent standard error of the mean values of the corresponding sample replicates.
C) To confirm the bioactivity of rhBMP4 and DMH1, HEK293T cells were treated with rhBMP4 (15 or 30
ng) alone or in combination with DMH1 (100 nM) for 2 hours. Following the treatment, cell lysates were
collected and phosphor-SMAD1/5 was detected using Western blotting as a readout for BMP signaling
activation. Total SMAD1 was used as a loading control.
87
3.6 The WNT-independent effects of NDP in ASCL1hi GBM are cell autonomous
NDP functions as a short-range paracrine signal to activate FZD4 and the canonical WNT
pathway (Xu et al., 2004), however, it is not known whether the FZD4-independent effects of
NDP in ASCL1hi cells are paracrine or autocrine. To address this issue, we performed a
competition assay, where we mixed equivalent numbers of ASCL1hi cells infected with Lenti-
shNDP-GFP with cells infected with Lenti-mCherry and measured the ratio of mCherry+: GFP+
cells over time. If NDP functions as a paracrine signal, then NDP expressed from the mCherry+
cells should rescue the growth of the NDP-deficient GFP+ cells, which would result in a change
to the ratio of mCherry+ : GFP+ cells during the culture period. The equal seeding of the cultures
was confirmed by flow cytometric analysis of the cultures at day 1 (Figure 20) and then re-
assessed after 6 days. Interestingly, the ratio of mCherry+: GFP + cells remained almost equal in
cultures expressing the scrambled shorthairpin control, whereas the ratio shifted dramatically
towards the mCherry+ cohort in the NDP knockdown samples. Given that the two populations
were intermixed this result strongly suggests that NDP is functioning as an autocrine signal in
ASCL1hi cells (Figure 20). This interpretation is particularly important considering the possible
implications of the results of our study in therapeutic initiatives.
88
89
Figure 20. NDP mediates ASCL1hi GNS proliferation through a cell autonomous
mechanism.
A) G523 (ASCL1hi) (GFP+) shScrambled, shNDP-A, shNDP-C, were mixed with wildtype G523 cells
expressing mCherry cells in 1:1: ratio, and seede in 6-well plates (50000 cells/well). A portion of each
cell mixture was analyzed by FACS to confirm equal seeding (Day 1 histograms). At day 6, cells were
collected and analyzed again by FACS to determine the ratio of mCherry+: GFP+ cells. The
experiment was repeated two independent times to confirm reproducibility (2 biological replicates).
Histogram figures represent one replicate. The GFP+ cell population underwent a striking decrease in
shNDP-A or shNDP-C expressing co-cultures cells, while is remained stable in shScrambled co-
cultures.
B) Portions of cell mixtures from different samples were taken at day1 (seeding day) and day 6, and fixed
on imaging slides to examine the GFP+ and mCherry+ cells. Images were taken by a fluorescence
microscope at 20X magnification.
90
3.7 NDP knockdown decreases Ki67+ and SOX2+ populations in ASCL1hi, and increases the Ki67+ population in ASCL1lo GNS lines
Since manipulating NDP expression affects growth and sphere formation in vitro, we examined
proliferation and stem cell markers in our lines after NDP knockdown using
immunohistochemistry. Expectedly, the fraction of cycling cells, marked by Ki67 (marker of cell
proliferation), was significantly and oppositely changed in ASCL1hi versus ASCL1lo GNS lines
after knocking down NDP. In G472 (ASCL1hi), NDP knockdown reduced the proportion of
Ki67+ cells, while in G564 (ASCL1lo) NDP knockdown increased the proportion Ki67+ cells
(Figure 21, 22). Interestingly, SOX2+ population was significantly reduced in G472, but not
G564, after NDP knockdown (Figure 21, 22), which is further confirmation of the difference in
NDP function between ASCL1hi versus ASCL1lo GNS. A change in the proportion of cycling
cells (Ki67+ cell population) is indicative of a change in the balance of cell cycle exit versus cell
cycle re-entry in the population. Therefore, the increase in the cycling pool in ASCL1lo cells with
NDP knockdown is consistent with the increase in sphere formation. Conversely, the reduction
in the cycling pool in ASCL1hi cells is consistent with the reduction in sphere formation. Taken
together these observations suggests that NDP signaling affects GNS self-renewal.
91
92
Figure 21. Knocking down NDP or FZD4 increases Ki67+ cell population in G564 cells.
A) NDP and FZD4 were knocked down in G564 (ASCL1lo) cells as previously described. 3 days post-
infection, cells were cultured on 8-well chamber slides (100000 cells/well) for immunocytochemistry. After
fixation and permeabilization, cells were incubated with antibodies to detect Ki67+ (red) and SOX2+
(green) cell populations. Hoechst was used as a nuclear marker. Images were taken by a fluorescence
microscope at 20X magnification. The figure shows representative images of different samples. Scale bar,
50 µM.
B) Images were analyzed using ZEN software and Ki67+ or SOX2+ cells were quantified manually. Changes
in these cell populations were represented as fold changes relative to shScrambled controls. Graphs
represent the averages of 3 independent biological replicates. p < 0.05 was considered significant. Error
bars represent standard error of the mean values of the corresponding sample replicates.
93
94
Figure 22. Knocking down NDP or FZD4 decreases Ki67+ and SOX2+ cell population in
G472 cells.
A) NDP and FZD4 were knocked down in G472 (ASCL1hi) cells as previously described. 3 days post-
infection, cells were cultured on 8-well chamber slides (100000 cells/well) for immunocytochemistry. After
fixation and permeabilization, cells were incubated with antibodies to detect Ki67+ (red) and SOX2+
(green) cell populations. Hoechst was used as a nuclear marker. Images were taken by a fluorescence
microscope at 20X magnification. The figure shows representative images of different samples. Scale bar,
50 µM.
B) Images were analyzed using ZEN software and Ki67+ or SOX2+ cells were quantified manually. Changes
in these cell populations were represented as fold changes relative to shScrambled controls. Graphs
represent the averages of 3 independent biological replicates. p < 0.05 was considered significant. Error
bars represent standard error of the mean values of the corresponding sample replicates.
95
3.8 NDP affects cell cycle kinetics in both ASCL1hi and ASCL1lo GNS cells
To further analyze the cell biological effects of NDP on proliferation we exposed ASCL1hi
(G523) and ASCL1lo (G411) cells to a short (3 hour) pulse of EdU, to mark cells in S-phase, then
stained them for Ki67 and EdU incorporation and quantified the percentage of EdU+ cells
relative to the total cell population and to the Ki67+ cells. Interestingly, the proportion of
EdU+/Ki67+ cells was reduced by NDP knockdown in G523 and G411 cells (Figure 23, 24).
Because the fraction of EdU+ cells amongst the cycling pool is an estimation of the length of S-
phase, this result means that the other phases of the cycle are lengthened indicating slower cell
cycle progression. Interestingly, the percentage of EdU+ cells regardless Ki67 status was
significantly lower in NDP knockdown G523 cells but unchanged in G411 knockdown cells
compared to controls (Figure 23, 24). These results suggest that NDP knockdown in ASCl1hi
cells inhibits cell cycle re-entry and slows the cell cycle. Whereas, knocking down NDP in
ASCL1lo cells increases cell cycle re-entry but slows the cell cycle. This interpretation raises the
possibility that NDP signaling in ASCL1lo affects two competing mechanisms: one slowing cell
cycle kinetics and the other promoting cell cycle re-entry, with the latter having the dominant
effect.
96
97
Figure 23. Knocking down NDP increases Ki67+ but decreases Edu+/Ki67+ cell
populations in G411 cells.
A) NDP and FZD4 were knocked down in G411 (ASCL1lo) cells as previously described. 3 days post
infection, cells were cultured on 8-well chamber slides (100000 cells/well) to be used for
immunocytochemistry. After fixation and permealization, cells were co-stained with Ki67+ (red) and
EdU+ (green) cell populations. Hoecht was used as a nuclear marker. Images were taken by a
fluorescence microscope at 20X magnification.
B) Ki67+, EdU+ and EdU+/Ki67+ cell populations were manually quantified after analyzing images with
ZEN software. Changes in this cell population were represented as fold changes relative to
shScrambled controls. Graphs show the average of 3 independent biological replicates. Graphs
represent the averages of 3 independent biological replicates. p < 0.05 was considered significant.
Error bars represent standard error of the mean values of the corresponding sample replicates.
98
99
Figure 24. Knocking down NDP decreases both Ki67+ and Edu+/Ki67+ cell populations in
G523 cells.
A) NDP and FZD4 were knocked down in G523 (ASCL1hi) cells as previously described. 3 days post
infection, cells were cultured on 8-well chamber slides (100000 cells/well) to be used for
immunocytochemistry. After fixation and permealization, cells were co-stained with Ki67+ (red) and
EdU+ (green) cell populations. Hoecht was used as a nuclear marker. Images were taken by a
fluorescence microscope at 20X magnification.
B) Ki67+, EdU+ and EdU+/Ki67+ cell populations were manually quantified after analyzing images with
ZEN software. Changes in this cell population were represented as fold changes relative to
shScrambled controls. Graphs show the average of 3 independent biological replicates. Graphs
represent the averages of 3 independent biological replicates. p < 0.05 was considered significant.
Error bars represent standard error of the mean values of the corresponding sample replicates.
100
3.9 NDP knockdown results in significantly variant differential expression profiles of ASCL1hi versus ASCL1lo GNS lines
To obtain a global view of the changes in expression profile of GNS cells after NDP knockdown,
we performed RNA-Seq analysis on one ASCL1lo line (G411) and one ASCL1hi line (G523),
after knocking down NDP with two different shRNA constructs. NDP knockdown resulted in
differential expression of significantly more genes in ASCL1lo (about 2400 hits after filtration)
than ASCL1hi cells (About 1600 hits after filtration). The overlapping hits that were identified to
differentially expressed after NDP knockdown in both lines were a little more than 800 (about
50% of ASCL1hi, and 35% of ASCL1lo hits) (Figure 25A). Thus, there is a significant amount of
unique hits that were identified in each line, especially in ASCL1lo (About 65% of ASCL1 lo and
50% of ASCl1hi identified hits were unique). The vast majority of the top common hits between
the two lines were related to cell cycle kinetics (Figure 25B). This list of the common identified
hits incuded master regulators of cell cycle such as, Cyclin A2, Cyclin G2, Cyclin E1, Cyclin B1,
and Cyclin B2. This supports our previous results showing that NDP knockdown affects cell
cycle kinetics in both ASCL1hi and ASCL1lo lines (Figure 21-24). The list of unique identified
hits in ASCL1lo cells was related to remarkably different biological processes. Most of the
ASCL1lo unique identified targets were related to processes such as migration, invasion,
metastasis, EMT and Extracellular matrix modulation (Figure 25C). On the other hand, the
unique identified hits in ASCL1hi were mainly related to cell cycle, proliferation, differentiation
and DNA repair (Figure 25D). While ASCL1lo unique hits list still contained cell cycle and
growth regulating genes, they were significantly underrepresented compared to the common hits,
and the ASCL1hi unique hits lists. The activation of these tumor promoting processes might
indicate the existence of competing mechanisms mediating the function of NDP in ASCL1lo and
explain the phenotype we observe after modulating NDP expression in these cells. Moreover, the
exclusive abundance of differentiation genes in ASCL1hi list supports our previous observation
that SOX2+ population is only changed after NDP knockdown in ASCL1hi but not ASCL1lo cells
(Figure 21, 22). Collectively, these results indicate that NDP knockdown affects cell cycle
kinetics and re-entry in both ASCl1hi and ASCL1lo GNS lines. In addition, these results indicate
that NDP knockdown results in a significant amount of divergent differential gene expression in
ASCL1hi versus ASCL1lo lines.
101
102
Figure 25. RNA-Seq analysis for G411 (ASCL1lo) and G523 (ASCL1hi) lines
A) Venn diagram representing the number of identified differentially expressed genes in each line, and the
proportion of overlapping identified hits (the percentage of overlapping hits is 49% in G523 and 34% in
G411). To prepare the library, G411 and G523 cells were transduced with lentiviral constructs shNDP-A
and shNDP-C to knockdown NDP as mentioned previously. 48 hours after infection, cells were lifted and
a portion of each sample was used to confirm knockdown effieicny by qRT-PCR as previously described.
Subsequently, the quality and integrity of RNA samples was assessed using Nanodrop and Bioanalyzer.
RNA Samples were then sent to the sequencing lab were the RNA-Seq library was run (Genome Quebec,
QC, Canada). The analysis included 3 biological replicates of each construct (Scrambled, shNDP-A,
shNDP-C) for each cell line. The quality assurance, statistics and bioinformatics analysis of the samples
was performed by Jose Hector Galvez at the Canadian Centre for Computational Genomics (C3G), QC,
Canada.
B) Heatmap representing selected genes that are differentially expressed in both lines after NDP knockdown.
For simplification of presentation, the heatmap include comparison between Scrambled and shNDP-C
replicates only, but all genes included in the heatmap were confirmed to be differentially expressed in the
other NDP knockdown construct as well (shNDP-A). All of the represented genes are related to regulation
of cell cycle and proliferation.
C) Heatmap representing selected genes that are differentially expressed in G411 but not G523 cells after
NDP knockdown. For simplification of presentation, the heatmap include comparison between Scrambled
and shNDP-C replicates only, but all genes included in the heatmap were confirmed to be differentially
expressed in the other NDP knockdown construct as well (shNDP-A). Gene represented are related to cell
cycle, proliferation, differentiation, DNA repair, and apoptosis.
D) Heatmap representing selected genes that are differentially expressed in G523 but not G411 cells after
NDP knockdown. For simplification of presentation, the heatmap include comparison between Scrambled
and shNDP-C replicates only, but all genes included in the heatmap were confirmed to be differentially
expressed in the other NDP knockdown construct as well (shNDP-A). Genes represented are related to cell
cycle, proliferation, migration, invasion and extracellular matrix.
103
3.10 NDP affects tumor progression in xenografted GNS cells
To validate the function of NDP in vivo, we orthotopically xenografted Nod-SCID Gamma
(NSG) mice with G411 (ASCL1lo) or G523 (ASCL1hi) after knocking down or overexpressing
NDP. Consistent with our in vitro studies, overexpression of NDP or FZD4 in ASCL1lo GNS
significantly prolonged survival in xenografted mice (Figure 26). The tumors that did form had a
reduction in GFP+ cells relative to tumors that formed from cells infected with the control
lentivirus (despite being grafted with cells that were over 90% GFP+), suggesting that there was
a selection bias against NDP or FZD4 overexpressing cells during tumor progression (Figure 27).
NDP knockdown in ASCL1lo cells had a subtle but not significant effect on survival, likely
because of the rapid kinetics of tumor formation (3-4 weeks) of this line would make it difficult
to observe faster tumor formation (Figure 26).
On the other hand, knocking down NDP significantly prolonged survival in mice grafted with
ASCL1hi cells (G523) (Figure 26) and overexpressing NDP in this line significantly shortened
survival (Figure 26). Similar to G411 overexpression cells, tumors that formed in mice
xenografted with G523 cells after NDP knockdown had a great loss of GFP+ cells despite
coming from lines that had over 90% GFP+ cells (Figure 28). This observation suggests that
NDP knockdown in G523 cells results in a strong selective disadvantage during tumor
progression. Nevertheless, Human Nuclear antigen staining confirmed the presence of human
tumor cells in the brains of tumor bearing mice (Figure 27, 28). In conclusion, results in this
section confirm that NDP enhances the progression of ASCL1hi, while inhibiting the progression
of ASCL1lo GBM cells.
104
105
Figure 26. Knocking down NDP affects tumor progression of xenografted GNS lines
A) G411 (ASCL1lo) cells were transduced to knockdown or overexpress NDP or FZD4, as previously
described, to produce stable cell lines with respective modifications. After confirming the knockdown
or overexpression, cells were orthotopically transplanted in NSG mice (1 mm lateral and 2 mm
posterior to the bregma). After developing terminal symptoms, mice were sacrificed, survival days
recorded, and brains were collected for IHC analysis. Knocking down NDP or FZD4 in G411 failed to
affect xenografted mouse survival, likely due to the very fast tumor progression dynamics of this cell
line. However, overexpressing NDP or FZD4 prolonged survival.
B) G523 (ASCL1hi) cells were transduced with two different shNDP, or NDP overexpression constructs
as previously described. After confirming the knockdown or overexpression, cells were orthotopically
xenografted in mice and survival experiment was carried on as described above. NDP knockdown
resulted in a significant prolongation of G523 xenografted mice survival. Overexpressing NDP
resulted in faster tumor progression and shorter mice survival. Graphs represent survival days of mice
transplanted with different samples. n=8/ knockdown group and 6/overexpression group. Results were
analyzed using Graph Pad software. Log-rank p-Value<=0.05 was considered significant.
106
107
Figure 27. IHC of formed G411 tumors in vivo indicate growth advantage of NDP
knockdown cells
A) Representative images of tumors formed in brains of mice transplanted with G411 (ASCL1lo) cells after
knocking down NDP or FZD4. Brains were collected, perfused, sectioned and immunostained with
antibody specific for human nuclear antigen (HuAg), and nuclei were labelled with DAPI. Endogenous
GFP expressed by the knockdown constructs was examined as well. GFP+ cells are still abundant in
shNDP and shFZD4 tumors at the endpoint of the survival experiment. Scale bar, 50 µM.
B) Representative images of tumors formed in brains of mice transplanted with G411 cells after
overexpressing NDP or FZD4. GFP+ and MYC+ cells are significantly diminished in hNDP and hFZD4
overexpression tumors compared to the empty vector control tumors. Brains were collected, perfused,
sectioned and immunostained with antibodies specific for human nuclear antigen (HuAg), MYC (to
detect hFZD4), and nuclei were labelled with DAPI. Endogenous GFP expressed by the overexpression
constructs was examined as well. In case of hFZD4, the overexpression construct expressed a MYC tag
marker, which we detected by an anti-MYC antibody and represented as GFP in the image. Scale bar, 50
µM.
108
109
Figure 28. IHC of formed G523 tumors in vivo indicate growth disadvantage of NDP
knockdown cells
A) Representative images of tumors formed in brains of mice transplanted with G523 (ASCL1hi) cells
after knocking down NDP. Brains were collected, perfused, sectioned and preserved as previously
described. For IHC, brain sections were stained with human nuclear antigen (HuAg), and Dapi.
Endogenous GFP expressed by the knockdown constructs was examined as well. GFP+ cells
diminished in shNDP-A and shNDP-C tumors at the endpoint of the survival experiment compared to
shScrambled control. Scale bar, 50 µM.
B) Representative images of tumors formed in brains of mice transplanted with G523 cells after
overexpressing NDP. Brains were collected, perfused, sectioned and preserved as previously
described. For IHC, brain sections were stained with human nuclear antigen (HuAg), and Dapi.
Endogenous GFP expressed by overexpression constructs was examined as well. GFP+ cells are still
abundant in hNDP tumors at the endpoint of the experiment. Scale bar, 50 µM.
110
Chapter 4. Discussion
4.1 Novel perspectives of Norrin function: Role in Cancer
Early studies on Norrin were focused primarily on its function in endothelial cell development
and vascularization. However, the identification of its molecular function and uncovering its role
as an atypical WNT ligand led to the suggestion that it may have additional functions in other
cell types, tissues and/or contexts. Our group identified Norrin as a target of the Sonic hedgehog
signaling pathway in retinal progenitor cells (McNeill et al., 2012) and showed that it has a novel
cell autonomous function in promoting proliferation of these neural progenitors through a FZD4-
independent mechanism (McNeill et al., 2013). Additional non-vascular functions for Norrin
include a neuroprotective role in CNS injury (Dailey et al., 2017; Leopold et al., 2017).
More recently, Norrin has also been implicated in cancer. Planutis and colleagues showed in an
in vitro study using an established colon cancer cell line that Norrin regulates the angiogenesis of
colon cancer (Planutis, Planutiene and Holcombe, 2014). However, additional in vivo and human
tumor data on the role of Norrin in colon cancer require further study. Our group showed that
Norrin inhibits tumor initiation and progression of Shh-medulloblastoma in two genetic mouse
models, an effect that is mediated through the vasculature and stromal remodeling (Bassett et al.,
2016). This was the first in vivo study to demonstrate a tumorigenic function for Norrin signaling
in the vasculature. The direct effect of Norrin neural progenitor proliferation (McNeill et al.,
2013), also raised the possibility that Norrin has additional non-vascular functions in
tumorigenesis.
As a preliminary computational analysis, we used publicly available genomic and transcriptomic
tumor data to determine if there was any association between Norrin and tumorigenesis. This
analysis revealed some very interesting aspects of NDP expression in cancer. First, we observed
variable expression of NDP among the vast majority of cancer types in TCGA. Additionally, the
expression of NDP in low grade glioma (LGG) and GBM was strikingly higher than the average
expression level among all cancer types. Because there was no available data from normal tissue
counterparts to LGG or GBM, it is unclear if NDP is specifically overexpressed in these cancer
111
types, or a feature of the cell of origin for these tumors. Norrin was reported to have a
widespread expression in astrocytes in the forebrain and midbrain, and Bergman glia in the
cerebellum of mice during development (Ye, Smallwood and Nathans, 2011). However; the
inefficiency of probes used to detect Norrin in earlier microarray screens makes it difficult to
compare NDP expression in GBM and LGG to normal cell counterparts. Our analysis also
revealed a striking degree of variability in NDP expression as well NDP mutations in non-CNS
cancer types such as breast, bladder and ovarian cancers. It will be important to investigate how
variable NDP expression levels are related to disease stage, progression or clinical outcomes for
these tumor types. Interestingly, in a recent transcriptome-based map associating signaling
pathways with clinical outcome in ovarian cancer there was a striking correlation between NDP
and FZD4 expression and favorable outcomes (Reinartz et al., 2016). Based on this association
in ovarian cancer, it would be interesting to perform similar NDP/FZD4 pathway analyses in the
other cancers where NDP shows a high degree of expression variability, such as breast cancer,
and determine if it is associated with a certain molecular subtype, survival outcomes, or a
specific clinical course. In addition, it is important to determine the factors and molecular
pathway that lead to the activation or inhibition of NDP expression in these cancers.
To have an insight about the relevance of NDP expression in CNS cancers, we investigated the
association between NDP expression levels and survival rates in neurological cancers.
Interestingly, NDP expression was significantly correlated with survival in the three neurological
cancer types we tested: GBM, Astrocytoma (LGG) and Neuroblastoma. FZD4 on the other hand
did not seem to exhibit a similar correlation pattern. Collectively, our preliminary computational
analysis, as well as our previous study in MB, were consistent with the possibility that Norrin
expression is functionally relevant in brain tumors.
4.2 Norrin contributes to the progression of GBM and hNSC in vitro
In collaboration with Dr. Peter Dirks (SickKids, Toronto), we used primary-derived GBM stem
cells (GNS) and primary human fetal neural stem cells (hNSC) for in vitro and in vivo analysis
of NDP/FZD4 function. While this culture system is reported to better recapitulate the genetic
112
and transcriptional heterogeneity and stem cell phenotype of the original tumor relative to the
traditional sphere culture system (Pollard et al., 2009), there are a few limitations of this model.
First, the culture system depends on the ability of GBM cells to adhere and expand in monolayer
culture, leading to a selection for stem cells with better inherent adherence characteristics.
Second, the culture media depends on the use of mitogens, such as FGF and EGF, which could
result in a selective bias for GBM cells that are responsive to these factors under monolayer
conditions. Despite these limitations, this monolayer culture system remains one of the most
acceptable models in the field when the results obtained in vitro are confirmed in mouse
xenograft models. Therefore, we verified our observations in xenograft mouse models to confirm
its relevance to original tumors.
First, we examined the expression of NDP/FZD4 pathway components (NDP, FZD4, LRP5,
TSPAN12) in a panel of 9 GNS and 3 hNSC lines. Interestingly, we detected significant
expression of all pathway components in almost all lines, which is consistent with our in silico
analysis, which revealed a strikingly high level of NDP expression in GBM with limited
variability. These observations suggest that there could be a conservation of this pathway in
GBM. Then, to model NDP/FZD4 function in a non-transformed counterpart to GNS, we tested
the effects of NDP or FZD4 gain and loss of function in primary human fetal NSC (hNSC).
hNSCs have been reported to be closely related to the stem cell populations of neurological
cancers, based on the high degree of genetic and phenotypic similarity of both cell types. There,
hNSCs present an important experimental model to study the initiation and development of
several neurological cancers including GBM and Neuroblastoma (Zhang et al., 2017; Gage and
Temple, 2013; Ebben et al., 2010). In fact, the use of hNSC model was shown to be very
valuable for cancer gene therapy research by providing an ideal surrogate for cancer drug
screening (Ahmed et al., 2010). Interestingly, NDP or FZD4 loss of function resulted in a
striking inhibition of proliferation in two hNSC lines that express high or low levels of NDP.
This effect was confirmed to be specific by a complementary gain of function experiment. Our
observations in hNSCs raise the possibility that NDP/FZD4 might be relevant in normal NSC
maintenance. It would be very interesting to expand on these observations and examine their
clinical relevance, for example, in vivo experiments would be required to examine whether
Norrin is involved in brain regeneration after injury and/or neural cell death. Subsequently,
113
activation of NDP/FZD4 pathway might provide a potential therapeutic strategy against brain
damage and degenerative diseases. This is particularly promising since WNT signaling has a
well-established role in brain and spinal cord development and regeneration, as well as
modulating stromal changes and immune response after injury (Oliva et al., 2018; Marchetti and
Pluchino, 2013; Herman et al., 2018; Clevers, Noh and Nusse, 2014).
4.3 Divergence of Norrin functions in GBM based on ASCL1 subtype in vitro and in vivo
To investigate the biological role of NDP/FZD4 in GBM, we performed NDP and FZD4 gain
and loss of function experiments in four GNS lines: 2 of the ASCL1hi subtype and 2 of the
ASCL1lo subtype. Surprisingly, our results indicated that NDP might play a completely opposite
role in subtype. Based on our in vitro observations, NDP inhibits proliferation and sphere
formation in ASCL1lo GNS and promotes these processes in ASCL1hi lines. These results were
confirmed in vivo in orthotopic xenografts. This very interesting divergence of NDP functions in
GBM highlights the importance of the transcriptional and genomic background of the tumor and
how it might determine the outcome of modulating signaling pathways such as NDP/FZD4. In
addition, these results also shed more light on the potential significance of stratifying GBM
tumors based on ASCL1 expression levels.
Another observation from these experiments was the different effects of FZD4 function among
the two groups. FZD4 gain and loss of functions in ASCL1lo lines exactly phenocopies NDP gain
and loss of function, while in ASCL1hi GNS lines FZD4 does not affect proliferation or sphere
formation in vitro. These observations suggested that there is a fundamental difference in the
effect of canonical WNT signaling in these GNS subtypes. Consistent with this possibility, we
found that treatment with a WNT inhibitor or anti-FZD4 antibodies blocked the effects of ectopic
NDP expression in ASCL1lo, but not in ASCL1hi lines. Moreover, these treatments promoted
proliferation in control ASCL1lo cells. Our qRT-PCR results confirmed the expression of FZD4,
LRP5 and TSPAN12 in ASCL1hi lines including the ones we used in our experiments (G523 and
G472). In this instance, Norrin might still bind FZD4 and activate the canonical WNT pathway
in ASCL1hi cells, but that it regulates different biological processes. In that case, it would be
114
crucial to investigate what determines the different outcomes of NDP/FZD4 signaling in
ASCL1hi versus ASCL1lo lines, and identify biological processes controlled by NDP/FZD4 axis
in ASCL1hi GNS.
On the other hand, there is a possibility that the functional discrepancy of Norrin in the two GNS
subsets results from the inability of Norrin to bind FZD4 and activate downstream WNT
signaling cascade in ASCL1hi GNS cells. If that is the case, it would be interesting to investigate
how Norrin binds specific receptors and what determines this selection process. There might be
other alternative receptors with more affinity to Norrin that compete with FZD4 in this system.
Additionally, the selective binding of Norrin to specific receptors might be regulated on a
different level through receptor antagonists and competitive inhibitors. Nevertheless, these
observations indicate that Norrin effects on proliferation and sphere formation in ASCL1hi cells
are WNT-independent.
Besides its well documented function as an atypical WNT ligand, Norrin was also reported to
antagonize BMP signaling in human and frog cells (Xu et al., 2012; Deng et al., 2013). This
alternative signaling pathway for Norrin is particularly relevant to our study because BMP
signaling is a potent driver of cell cycle exit and differentiation in GBM (Piccirillo et al., 2006;
Lee et al., 2008). Additionally, Gremlin-1 (a BMP antagonist protein), was recently reported to
promote GBM carcinogenesis by protecting GBM stem cells from BMP-induced differentiation
(Yan et al., 2014; Guan et al., 2017). Interestingly, the effect of Gremlin-1 on GBM is very
similar to the effects we observe with ectopic NDP expression in ASCL1hi GBM. Moreover,
ASCL1hi cells seem to be affected by endogenous BMP because their growth is increased in the
presence of a BMP inhibitor. Therefore, we hypothesized that NDP might promote the
proliferation and sphere formation of ASCL1hi cells through antagonizing BMP signaling. One
prediction of this model is that BMP inhibition should rescue growth in the context of NDP
knockdown, which was not the case in this context. Alternatively, NDP knockdown rendered
cells completely resistant to the BMP inhibitor, suggesting that these pathways do interact, but in
a way that is more complex than our simple model. For example, it is possible that NDP
knockdown results in and increase in BMP4 levels that overwhelm the capacity of DMH1
inhibitor. While we were unable to corroborate this observation with a second inhibitor because
of toxicity, we showed that excess BMP4 is antagonistic to the growth promoting effect of NDP
115
overexpression, which is consistent with this interpretation. To confirm the involvement of BMP
signaling in mediating effects of NDP in this context we would need to perform a thorough gain
and loss of function analysis for BMP4 and its receptor, in combination with NDP gain and loss
of function. In conclusion, our chemical inhibitor experiments confirmed that the effects of NDP
are mediated through WNT in ASCL1lo and that there is an interaction between BMP and NDP
in ASCL1hi cells.
Despite differences in growth and signaling of NDP in both types of GBM, there was a
surprising overlap in their cell biological effects. In both instances, NDP affected the proportion
of cycling cells (Ki67+) in the cultures, suggesting that it functions to control the rate of cell
cycle exit and differentiation, which is also consistent with the effects of NDP on sphere
formation. Even more interesting, NDP knockdown in both cell types affected cell cycle kinetics
based on the reduction of the proportion of cells in S-phase amongst the cycling cell pool
(EdU+/Ki67+). This phenotype in ASCL1lo cells is particularly notable because the overall
effect of NDP knockdown is growth promoting and suggests the existence of other growth
promoting effects of NDP knockdown, which are dominant to the cell cycle inhibitory effects.
More experiments would be required in this context to fully characterize the cell biological
effects of NDP signaling. For example, changes in stemness, differentiation and cell growth
often lead to subsequent changes in cell death and apoptosis. Therefore, we are currently
investigating whether NDP knockdown results in a change in apoptosis in both cohorts. In
addition to TUNEL assay that uses DNA damage as an indication for cell death, we plan to query
a panel of apoptotic proteins such as cleaved-Caspase 3 and cleaved-PARP in NDP knockdown
cells. Notably, NDP was reported to protect retina ganglion cells during oxidative stress
(Leopold et al., 2017; Dailey et al., 2017), so it would be interesting to examine if NDP
knockdown in GNS results in forms of cellular stresses such as oxidative stress and reactive
oxygen species (ROS).
In parallel with these observations, our RNA-Seq screening revealed a significantly different
profile of differential gene expression after knocking down NDP in ASCL1hi versus ASCL1lo
cells. Interestingly, the number of the significant identified hits that were differentially expressed
in ASCL1lo cells after NDP knockdown (about 2400 hits) was quite larger than hits identified in
ASCL1hi cells (about 1600 hits). We categorized these hits into 3 groups; common hits
116
(differentially expressed after NDP knockdown in both lines), ASCL1hi unique, and ASCL1lo
unique hits. The vast majority of the common hits were directly related to cell cycle regulation
and DNA replication, consistent with the phenotypic effects of NDP knockdown on cell cycle
kinetics in both GNS subtypes. This supports with our observations that NDP knockdown affects
EdU+/Ki67+ population (indicating changes in cell cycle kinetics) in both ASCL1hi and ASCL1lo
lines. Notably, many of the unique hits in ASCL1hi GNS line were related to cell cycle kinetics
and DNA replication, as well as differentiation and apoptosis. This is also supported by our ICC
experiments revealed that SOX2+ cell population is affected after NDP knockdown only in
ASCL1hi but not ASCL1lo cells. Conversely, the unique hits in ASCL1lo cells were related to
quite different cellular processes, including invasion, migration, metastasis and extracellular
matrix modulation there were also some death genes. The activation of these processes in
ASCL1lo cells after NDP knockdown could explain the enhanced growth phenotype, even in the
context of slower cell cycle.
While most of our experiments focus on the downstream effects of NDP signaling in GNS and
how it varies between ASCL1hi and ASCL1lo cohorts, it would be very interesting to investigate
the upstream regulation and identify the factors controlling this functional discrepancy. First, it is
important to investigate whether ASCL1 expression level is sufficient to direct the NDP mode of
action. To address this question, we designed an in vitro to investigate whether ASCL1 loss of
function leads to reversal of NDP effects in these cells. If ASCL1 is found to be interacting with
NDP, it would be important to identify the mechanism mediating this interaction and how this
interaction controls GNS tumorigenesis and stemness. Notably, ASCL1 levels were shown to be
significantly associated with the proneural subtype in GBM (Park et al., 2017), therefore it will
be interesting to examine if NDP functions segregate with GBM transcriptional subtypes. We
confirmed the reproducibility of our results in two lines of each cohort, however; expanding this
analysis to include more primary lines and tumor samples would be important to further validate
our hypothesis and assess its reproducibility degree and significance. In conclusion, our results
reveal a striking divergence in the functions of NDP between ASCL1hi and ASCL1lo GNS lines
and indicate the existence of at least two alternative mechanisms that mediate different aspects of
NDP effects.
117
ASCL1 expression levels were shown to be important predictive factors for NOTCH inhibition as
a differentiation therapy, and ASCL1hi lines were termed “differentiation-competent cells” (Park
et al., 2017). Similarly, it is would be interesting to examine whether NDP manipulation can
sensitize GNS cells to differentiation therapy and provide a synergistic value when applied in
combination with NOTCH inhibition. In summary, our results indicate a segregation of NDP
biological effects with ASCL1 expression levels, however; more experiments will be required to
test if ASCL1 and NDP mechanistically interact, and the degree to which this interaction
controls GNS progression.
4.4 Potential therapeutic applications of Norrrin
Despite the enormous research efforts applied to GBM over the last decades, it remains one of
the most lethal and aggressive cancer types with very poor clinical outcomes (Jovcevska,
Kocevar and Komel, 2013; Louis et al., 2007). The current first line chemotherapeutic agent for
GBM remains temozolomide, which is only effective in a small subset of patients who
eventually develop resistance and relapse (Stupp et al., 2009). Therefore, research efforts have
been directed towards developing targeted therapies to treat patients harboring specific
genotypes and/or expressing specific markers (Quartararo et al., 2015; Prados et al., 2015; Chen
et al., 2016). For example, in an interesting application of this concept, Lee and colleagues
studied both genomic and expression profiles of 127 multisector or longitudinal specimens
coming from 52 GBM patients to identify the degree of heterogeneity and apply precision
medicine (Lee et al., 2017). Despite the well documented intra-tumor heterogeneity of GBM, the
authors found that cells from the same tumor mass share a specific degree of genomic and
expression signatures that can be exploited to specifically identify targeted therapy. While the
use of large scale screens to identify potential therapeutic targets has led to a significant
advancement in the field, the learned application of biological knowledge and molecular
signaling information remains highly important for therapeutic initiatives. For example, the
knowledge about the role of ASCL1 in controlling terminal neuronal differentiation of NSCs led
to the hypothesis that ASCL1hi GNS cells are more prone to NOTCH inhibition and
differentiation therapy (Park et al., 2017).
118
In this study, we show an interesting example of this concept. Here, we show that NDP, which is
highly expressed in GBM, can function to either promote or inhibit GBM progression, depending
on the signature of the tumor. These observations suggest that silencing NDP can have potential
therapeutic benefits in ASCL1hi cells. However, the same approach in ASCL1lo GBM, could
promote faster tumor progression. This concept becomes more critical when we consider other
components of WNT signaling pathway. In fact, both WNT activation and inhibition were
suggested as potential therapeutic strategies in GBM (Rampazzo et al., 2013; McCord et al.,
2017; De Robertis et al., 2013). While different models, culture systems, and experimental
conditions might explain the discrepancy in these studies, it is clear that we need better
understanding of GBM biology and and tumor stratification to prescribe the accurate therapy. In
this study, we used the expression of ASCL1 to stratify GBM stem cells. We provide indications
that NDP-mediated activation of canonical WNT signaling might be growth inhibiting in
ASCL1lo GBM stem cells. Similarly, other markers and/or important molecules can be used to
further stratify GBM tumors and propose targeted therapies based on specific tumor profiles.
Our observations in ASCL1hi GNS cells suggest that NDP is a novel target for cancer stem cell
therapy. In this study we provide evidence that NDP promotes the proliferation and sphere
formation of GBM stem cells. It is critical to identify the mechanism underlying these effects of
NDP and whether it is mediated through BMP signaling, because BMP activation leads to
astrocyte and not neuronal differentiation. Astrocyte differentiation is not terminal, as
differentiated astrocytes can re-enter cell cycle and regain the cancer stem cell phenotype in
response stress of radio or chemotherapy. Conversely neuronal differentiation was shown to be
terminal and leading to permanent cell cycle exit (Magnusson et al., 2014; Alcantara et al., 2009;
Friedmann et al., 2012). Therefore, the potential therapeutic benefits of NDP in ASCL1hi cells
should be considered with caution.
As a direct clinically relevant application of these observations, it would be valuable to examine
the effects of inhibiting NDP (by either orthotopic adenovirus delivery of short-haipin RNA or
blocking NDP) on the progression of established ASCL1hi GNS tumors in vivo. Here we show
that silencing NDP in ASCL1hi, and overexpressng it in ASCL1lo GBM stem cells prior to
orthotopic xenografting results in a significant increase in survival. Subsequently, more
experiments would be required to test the effects of NDP manipulation in established in vivo
119
tumors to assess the therapeutic potential of targeting NDP. In ASCL1lo cells, our results argue
that activating NDP/FZD mediated canonical WNT signaling might inhibit tumor progression,
therefore, small molecule agonists and/or WNT ligands can be tested in mice with established
ASCL1lo GBM tumors.
Another important aspect of the function of Norrin comes from its clear involvement in the
stroma and cellular microenvironment, as reported by several studies (Bassett et al., 2016;
Reinartz et al., 2016; Planutis K, Planutiene M and Holcombe, 2014; Planutis et al., 2014).
Remodeling and modification of GBM microenvironment was proposed as a potential
therapeutic strategy in several studies (Volak et al., 2018; Achyut et al., 2017; Hovinga et al.,
2010; Sadahiro et al., 2018). In this study we focused on the cell autonomous functions of NDP
in GBM stem cells, however; it would be interesting to examine the role of NDP in mediating
GBM microenvironment and stroma.
4.5 Summary and significance
To the best of our knowledge, this is the first study to report a cell autonomous role of NDP in
cancer cells. Our results provide evidence for a novel role of Norrin in regulating the progression
of GBM stem cells in vitro and in vivo. Interestingly, we show that NDP inhibits the progression
of ASCL1lo GBM, while promoting the progression of ASCL1hi GBM. In addition, we show that
the effects of NDP in both groups are mediated by different mechanisms. An illustration
summary of our proposed model of NDP functions in GBM stem cells is demonstrated in Figure
29.
This study proposes NDP as a novel targetable protein to treat GBM. Particularly in ASCL1lo
cells where Norrin can present an effective approach to activate canonical WNT signaling and is
likely involved in other important stroma-related functions such as endothelial cell remodeling
and inhibiting angiogenesis.
In addition, our initial computational analysis reveals the abundance of Norrin expression in
many cancer types, suggesting it might play role in regulating other cancers as well.
120
121
Figure 29. Proposed model of NDP biological functions in GBM
A) In ASCL1hi cells, NDP affects cell cycle regulation, but also affects differentiation, apoptosis and DNA
repair in a WNT-independent mechanism resulting in pro-tumorigenic effects on progression.
B) In ASCL1lo cells, NDP affects cell cycle regulation, but also affects migration, invasion and EMT in a
WNT-dependent mechanism resulting in changes in cell cycle re-entry leading to anti-tumorigenic effects
on progression.
122
References
Achyut, B. R., K. Angara, M. Jain, T. F. Borin, M. H. Rashid, A. S. M. Iskander, R. Ara, R.
Kolhe, S. Howard, N. Venugopal, P. C. Rodriguez, J. W. Bradford, and A. S. Arbab. "Canonical
Nfkappab Signaling in Myeloid Cells Is Required for the Glioblastoma Growth." Sci Rep 7, no.
1 (2017): 13754.
Agnihotri, S., K. E. Burrell, A. Wolf, S. Jalali, C. Hawkins, J. T. Rutka, and G. Zadeh.
"Glioblastoma, a Brief Review of History, Molecular Genetics, Animal Models and Novel
Therapeutic Strategies." Arch Immunol Ther Exp (Warsz) 61, no. 1 (2013): 25-41.
Ahmed, A. U., N. G. Alexiades, and M. S. Lesniak. "The Use of Neural Stem Cells in Cancer
Gene Therapy: Predicting the Path to the Clinic." Curr Opin Mol Ther 12, no. 5 (2010): 546-52.
Alcantara Llaguno, S., J. Chen, C. H. Kwon, E. L. Jackson, Y. Li, D. K. Burns, A. Alvarez-
Buylla, and L. F. Parada. "Malignant Astrocytomas Originate from Neural Stem/Progenitor Cells
in a Somatic Tumor Suppressor Mouse Model." Cancer Cell 15, no. 1 (2009): 45-56.
Aldape, K., G. Zadeh, S. Mansouri, G. Reifenberger, and A. von Deimling. "Glioblastoma:
Pathology, Molecular Mechanisms and Markers." Acta Neuropathol 129, no. 6 (2015): 829-48.
Altaner, C. "Glioblastoma and Stem Cells." Neoplasma 55, no. 5 (2008): 369-74.
Assanah, M., R. Lochhead, A. Ogden, J. Bruce, J. Goldman, and P. Canoll. "Glial Progenitors in
Adult White Matter Are Driven to Form Malignant Gliomas by Platelet-Derived Growth Factor-
Expressing Retroviruses." J Neurosci 26, no. 25 (2006): 6781-90.
Assanah, M. C., J. N. Bruce, S. O. Suzuki, A. Chen, J. E. Goldman, and P. Canoll. "Pdgf
Stimulates the Massive Expansion of Glial Progenitors in the Neonatal Forebrain." Glia 57, no.
16 (2009): 1835-47.
Auger, N., J. Thillet, K. Wanherdrick, A. Idbaih, M. E. Legrier, B. Dutrillaux, M. Sanson, and
M. F. Poupon. "Genetic Alterations Associated with Acquired Temozolomide Resistance in Snb-
19, a Human Glioma Cell Line." Mol Cancer Ther 5, no. 9 (2006): 2182-92.
123
Autexier, C., and N. F. Lue. "The Structure and Function of Telomerase Reverse Transcriptase."
Annu Rev Biochem 75, (2006): 493-517.
Bady, P., D. Sciuscio, A. C. Diserens, J. Bloch, M. J. van den Bent, C. Marosi, P. Y. Dietrich, M.
Weller, L. Mariani, F. L. Heppner, D. R. McDonald, D. Lacombe, R. Stupp, M. Delorenzi, and
M. E. Hegi. "Mgmt Methylation Analysis of Glioblastoma on the Infinium Methylation
Beadchip Identifies Two Distinct Cpg Regions Associated with Gene Silencing and Outcome,
Yielding a Prediction Model for Comparisons across Datasets, Tumor Grades, and Cimp-Status."
Acta Neuropathol 124, no. 4 (2012): 547-60.
Banerjee, S., J. N. Byrd, S. M. Gianino, S. E. Harpstrite, F. J. Rodriguez, R. G. Tuskan, K. M.
Reilly, D. R. Piwnica-Worms, and D. H. Gutmann. "The Neurofibromatosis Type 1 Tumor
Suppressor Controls Cell Growth by Regulating Signal Transducer and Activator of
Transcription-3 Activity in Vitro and in Vivo." Cancer Res 70, no. 4 (2010): 1356-66.
Bao, S., Q. Wu, Z. Li, S. Sathornsumetee, H. Wang, R. E. McLendon, A. B. Hjelmeland, and J.
N. Rich. "Targeting Cancer Stem Cells through L1cam Suppresses Glioma Growth." Cancer Res
68, no. 15 (2008): 6043-8.
Bao, S., Q. Wu, R. E. McLendon, Y. Hao, Q. Shi, A. B. Hjelmeland, M. W. Dewhirst, D. D.
Bigner, and J. N. Rich. "Glioma Stem Cells Promote Radioresistance by Preferential Activation
of the DNA Damage Response." Nature 444, no. 7120 (2006): 756-60.
Bao, Z., C. Zhang, W. Yan, Y. Liu, M. Li, W. Zhang, and T. Jiang. "Bmp4, a Strong Better
Prognosis Predictor, Has a Subtype Preference and Cell Development Association in Gliomas." J
Transl Med 11, (2013): 100.
Barretina, J., G. Caponigro, N. Stransky, K. Venkatesan, A. A. Margolin, S. Kim, C. J. Wilson, J.
Lehar, G. V. Kryukov, D. Sonkin, A. Reddy, M. Liu, L. Murray, M. F. Berger, J. E. Monahan, P.
Morais, J. Meltzer, A. Korejwa, J. Jane-Valbuena, F. A. Mapa, J. Thibault, E. Bric-Furlong, P.
Raman, A. Shipway, I. H. Engels, J. Cheng, G. K. Yu, J. Yu, P. Aspesi, Jr., M. de Silva, K.
Jagtap, M. D. Jones, L. Wang, C. Hatton, E. Palescandolo, S. Gupta, S. Mahan, C. Sougnez, R.
C. Onofrio, T. Liefeld, L. MacConaill, W. Winckler, M. Reich, N. Li, J. P. Mesirov, S. B.
Gabriel, G. Getz, K. Ardlie, V. Chan, V. E. Myer, B. L. Weber, J. Porter, M. Warmuth, P. Finan,
124
J. L. Harris, M. Meyerson, T. R. Golub, M. P. Morrissey, W. R. Sellers, R. Schlegel, and L. A.
Garraway. "The Cancer Cell Line Encyclopedia Enables Predictive Modelling of Anticancer
Drug Sensitivity." Nature 483, no. 7391 (2012): 603-7.
Bassett, E. A., N. Tokarew, E. A. Allemano, C. Mazerolle, K. Morin, A. J. Mears, B. McNeill, R.
Ringuette, C. Campbell, S. Smiley, N. T. Pokrajac, A. M. Dubuc, V. Ramaswamy, P. A.
Northcott, M. Remke, P. P. Monnier, D. Potter, K. Paes, L. L. Kirkpatrick, K. J. Coker, D. S.
Rice, C. Perez-Iratxeta, M. D. Taylor, and V. A. Wallace. "Norrin/Frizzled4 Signalling in the
Preneoplastic Niche Blocks Medulloblastoma Initiation." Elife 5, (2016).
Batlle, E., and H. Clevers. "Cancer Stem Cells Revisited." Nat Med 23, no. 10 (2017): 1124-
1134.
Beier, D., P. Hau, M. Proescholdt, A. Lohmeier, J. Wischhusen, P. J. Oefner, L. Aigner, A.
Brawanski, U. Bogdahn, and C. P. Beier. "Cd133(+) and Cd133(-) Glioblastoma-Derived Cancer
Stem Cells Show Differential Growth Characteristics and Molecular Profiles." Cancer Res 67,
no. 9 (2007): 4010-5.
Beier, F., C. P. Beier, I. Aschenbrenner, G. C. Hildebrandt, T. H. Brummendorf, and D. Beier.
"Identification of Cd133(-)/Telomerase(Low) Progenitor Cells in Glioblastoma-Derived Cancer
Stem Cell Lines." Cell Mol Neurobiol 31, no. 3 (2011): 337-43.
Ben-Porath, I., M. W. Thomson, V. J. Carey, R. Ge, G. W. Bell, A. Regev, and R. A. Weinberg.
"An Embryonic Stem Cell-Like Gene Expression Signature in Poorly Differentiated Aggressive
Human Tumors." Nat Genet 40, no. 5 (2008): 499-507.
Berninger, B., F. Guillemot, and M. Gotz. "Directing Neurotransmitter Identity of Neurones
Derived from Expanded Adult Neural Stem Cells." Eur J Neurosci 25, no. 9 (2007): 2581-90.
Bertrand, N., D. S. Castro, and F. Guillemot. "Proneural Genes and the Specification of Neural
Cell Types." Nat Rev Neurosci 3, no. 7 (2002): 517-30.
Bettegowda, C., N. Agrawal, Y. Jiao, M. Sausen, L. D. Wood, R. H. Hruban, F. J. Rodriguez, D.
P. Cahill, R. McLendon, G. Riggins, V. E. Velculescu, S. M. Oba-Shinjo, S. K. Marie, B.
125
Vogelstein, D. Bigner, H. Yan, N. Papadopoulos, and K. W. Kinzler. "Mutations in Cic and
Fubp1 Contribute to Human Oligodendroglioma." Science 333, no. 6048 (2011): 1453-5.
Bhat, K. P. L., V. Balasubramaniyan, B. Vaillant, R. Ezhilarasan, K. Hummelink, F.
Hollingsworth, K. Wani, L. Heathcock, J. D. James, L. D. Goodman, S. Conroy, L. Long, N.
Lelic, S. Wang, J. Gumin, D. Raj, Y. Kodama, A. Raghunathan, A. Olar, K. Joshi, C. E. Pelloski,
A. Heimberger, S. H. Kim, D. P. Cahill, G. Rao, W. F. A. Den Dunnen, Hwgm Boddeke, H. S.
Phillips, I. Nakano, F. F. Lang, H. Colman, E. P. Sulman, and K. Aldape. "Mesenchymal
Differentiation Mediated by Nf-Kappab Promotes Radiation Resistance in Glioblastoma."
Cancer Cell 24, no. 3 (2013): 331-46.
Blissitt, P. A. "Clinical Practice Guideline Series Update: Care of the Pediatric Patient with a
Brain Tumor." J Neurosci Nurs 46, no. 6 (2014): 368.
Borromeo, M. D., D. M. Meredith, D. S. Castro, J. C. Chang, K. C. Tung, F. Guillemot, and J. E.
Johnson. "A Transcription Factor Network Specifying Inhibitory Versus Excitatory Neurons in
the Dorsal Spinal Cord." Development 141, no. 14 (2014): 2803-12.
Bradshaw, A., A. Wickremsekera, S. T. Tan, L. Peng, P. F. Davis, and T. Itinteang. "Cancer
Stem Cell Hierarchy in Glioblastoma Multiforme." Front Surg 3, (2016): 21.
Bragdon, B., O. Moseychuk, S. Saldanha, D. King, J. Julian, and A. Nohe. "Bone Morphogenetic
Proteins: A Critical Review." Cell Signal 23, no. 4 (2011): 609-20.
Brennan, C. W., R. G. Verhaak, A. McKenna, B. Campos, H. Noushmehr, S. R. Salama, S.
Zheng, D. Chakravarty, J. Z. Sanborn, S. H. Berman, R. Beroukhim, B. Bernard, C. J. Wu, G.
Genovese, I. Shmulevich, J. Barnholtz-Sloan, L. Zou, R. Vegesna, S. A. Shukla, G. Ciriello, W.
K. Yung, W. Zhang, C. Sougnez, T. Mikkelsen, K. Aldape, D. D. Bigner, E. G. Van Meir, M.
Prados, A. Sloan, K. L. Black, J. Eschbacher, G. Finocchiaro, W. Friedman, D. W. Andrews, A.
Guha, M. Iacocca, B. P. O'Neill, G. Foltz, J. Myers, D. J. Weisenberger, R. Penny, R.
Kucherlapati, C. M. Perou, D. N. Hayes, R. Gibbs, M. Marra, G. B. Mills, E. Lander, P.
Spellman, R. Wilson, C. Sander, J. Weinstein, M. Meyerson, S. Gabriel, P. W. Laird, D.
Haussler, G. Getz, and L. Chin. "The Somatic Genomic Landscape of Glioblastoma." Cell 155,
no. 2 (2013): 462-77.
126
Briceno, E., A. Calderon, and J. Sotelo. "Institutional Experience with Chloroquine as an
Adjuvant to the Therapy for Glioblastoma Multiforme." Surg Neurol 67, no. 4 (2007): 388-91.
Cabrera, M. C., R. E. Hollingsworth, and E. M. Hurt. "Cancer Stem Cell Plasticity and Tumor
Hierarchy." World J Stem Cells 7, no. 1 (2015): 27-36.
Cadigan, K. M., and M. L. Waterman. "Tcf/Lefs and Wnt Signaling in the Nucleus." Cold Spring
Harb Perspect Biol 4, no. 11 (2012).
Cancer Genome Atlas Res. Netw. "Comprehensive Genomic Characterization Defines Human
Glioblastoma Genes and Core Pathways." Nature 455, no. 7216 (2008): 1061-8.
Capper, D., H. Zentgraf, J. Balss, C. Hartmann, and A. von Deimling. "Monoclonal Antibody
Specific for Idh1 R132h Mutation." Acta Neuropathol 118, no. 5 (2009): 599-601.
Castro, D. S., B. Martynoga, C. Parras, V. Ramesh, E. Pacary, C. Johnston, D. Drechsel, M.
Lebel-Potter, L. G. Garcia, C. Hunt, D. Dolle, A. Bithell, L. Ettwiller, N. Buckley, and F.
Guillemot. "A Novel Function of the Proneural Factor Ascl1 in Progenitor Proliferation
Identified by Genome-Wide Characterization of Its Targets." Genes Dev 25, no. 9 (2011): 930-
45.
Chanda, S., C. E. Ang, J. Davila, C. Pak, M. Mall, Q. Y. Lee, H. Ahlenius, S. W. Jung, T. C.
Sudhof, and M. Wernig. "Generation of Induced Neuronal Cells by the Single Reprogramming
Factor Ascl1." Stem Cell Reports 3, no. 2 (2014): 282-96.
Chang, T. H., F. L. Hsieh, M. Zebisch, K. Harlos, J. Elegheert, and E. Y. Jones. "Structure and
Functional Properties of Norrin Mimic Wnt for Signalling with Frizzled4, Lrp5/6, and
Proteoglycan." Elife 4, (2015).
Chen, J., Y. Li, T. S. Yu, R. M. McKay, D. K. Burns, S. G. Kernie, and L. F. Parada. "A
Restricted Cell Population Propagates Glioblastoma Growth after Chemotherapy." Nature 488,
no. 7412 (2012): 522-6.
127
Chen, Y., Z. Gao, B. Wang, and R. Xu. "Towards Precision Medicine-Based Therapies for
Glioblastoma: Interrogating Human Disease Genomics and Mouse Phenotypes." BMC Genomics
17 Suppl 7, (2016): 516.
Chen, Y., Y. Zhang, J. Tang, F. Liu, Q. Hu, C. Luo, H. Feng, and J. H. Zhang. "Norrin Protected
Blood-Brain Barrier Via Frizzled-4/Beta-Catenin Pathway after Subarachnoid Hemorrhage in
Rats." Stroke 46, no. 2 (2015): 529-36.
Cho, C., P. M. Smallwood, and J. Nathans. "Reck and Gpr124 Are Essential Receptor Cofactors
for Wnt7a/Wnt7b-Specific Signaling in Mammalian Cns Angiogenesis and Blood-Brain Barrier
Regulation." Neuron 95, no. 5 (2017): 1221-1225.
Choe, G., S. Horvath, T. F. Cloughesy, K. Crosby, D. Seligson, A. Palotie, L. Inge, B. L. Smith,
C. L. Sawyers, and P. S. Mischel. "Analysis of the Phosphatidylinositol 3'-Kinase Signaling
Pathway in Glioblastoma Patients in Vivo." Cancer Res 63, no. 11 (2003): 2742-6.
Chu, Q., B. A. Orr, S. Semenkow, E. E. Bar, and C. G. Eberhart. "Prolonged Inhibition of
Glioblastoma Xenograft Initiation and Clonogenic Growth Following in Vivo Notch Blockade."
Clin Cancer Res 19, no. 12 (2013): 3224-33.
Clarke, I. D., and P. B. Dirks. "A Human Brain Tumor-Derived Pdgfr-Alpha Deletion Mutant Is
Transforming." Oncogene 22, no. 5 (2003): 722-33.
Clevers, H., K. M. Loh, and R. Nusse. "Stem Cell Signaling. An Integral Program for Tissue
Renewal and Regeneration: Wnt Signaling and Stem Cell Control." Science 346, no. 6205
(2014): 1248012.
Clevers, H., and R. Nusse. "Wnt/Beta-Catenin Signaling and Disease." Cell 149, no. 6 (2012):
1192-205.
Cloughesy, T. F., W. K. Cavenee, and P. S. Mischel. "Glioblastoma: From Molecular Pathology
to Targeted Treatment." Annu Rev Pathol 9, (2014): 1-25.
Cloughesy, T. F., K. Yoshimoto, P. Nghiemphu, K. Brown, J. Dang, S. Zhu, T. Hsueh, Y. Chen,
W. Wang, D. Youngkin, L. Liau, N. Martin, D. Becker, M. Bergsneider, A. Lai, R. Green, T.
128
Oglesby, M. Koleto, J. Trent, S. Horvath, P. S. Mischel, I. K. Mellinghoff, and C. L. Sawyers.
"Antitumor Activity of RapaMYCin in a Phase I Trial for Patients with Recurrent Pten-Deficient
Glioblastoma." PLoS Med 5, no. 1 (2008): e8.
Combs, S. E., S. Rieken, W. Wick, A. Abdollahi, A. von Deimling, J. Debus, and C. Hartmann.
"Prognostic Significance of Idh-1 and Mgmt in Patients with Glioblastoma: One Step Forward,
and One Step Back?" Radiat Oncol 6, (2011): 115.
Dailey, W. A., K. A. Drenser, S. C. Wong, M. Cheng, J. Vercellone, K. K. Roumayah, E. V.
Feeney, M. Deshpande, A. E. Guzman, M. Trese, and K. P. Mitton. "Norrin Treatment Improves
Ganglion Cell Survival in an Oxygen-Induced Retinopathy Model of Retinal Ischemia." Exp Eye
Res 164, (2017): 129-138.
Dang, L., D. W. White, S. Gross, B. D. Bennett, M. A. Bittinger, E. M. Driggers, V. R. Fantin,
H. G. Jang, S. Jin, M. C. Keenan, K. M. Marks, R. M. Prins, P. S. Ward, K. E. Yen, L. M. Liau,
J. D. Rabinowitz, L. C. Cantley, C. B. Thompson, M. G. Vander Heiden, and S. M. Su. "Cancer-
Associated Idh1 Mutations Produce 2-Hydroxyglutarate." Nature 462, no. 7274 (2009): 739-44.
Davis, M. E. "Glioblastoma: Overview of Disease and Treatment." Clin J Oncol Nurs 20, no. 5
Suppl (2016): S2-8.
De Robertis, A., S. Valensin, M. Rossi, P. Tunici, M. Verani, A. De Rosa, C. Giordano, M.
Varrone, A. Nencini, C. Pratelli, T. Benicchi, A. Bakker, J. Hill, K. Sangthongpitag, V.
Pendharkar, B. Liu, F. M. Ng, S. W. Then, S. Jing Tai, S. M. Cheong, X. He, A. Caricasole, and
M. Salerno. "Identification and Characterization of a Small-Molecule Inhibitor of Wnt Signaling
in Glioblastoma Cells." Mol Cancer Ther 12, no. 7 (2013): 1180-9.
de Sousa, E. Melo F., and L. Vermeulen. "Wnt Signaling in Cancer Stem Cell Biology." Cancers
(Basel) 8, no. 7 (2016).
Deng, C., P. Reddy, Y. Cheng, C. W. Luo, C. L. Hsiao, and A. J. Hsueh. "Multi-Functional
Norrin Is a Ligand for the Lgr4 Receptor." J Cell Sci 126, no. Pt 9 (2013): 2060-8.
129
Deng, M., J. Bragelmann, I. Kryukov, N. Saraiva-Agostinho, and S. Perner. "Firebrowser: An R
Client to the Broad Institute's Firehose Pipeline." Database (Oxford) 2017, (2017).
Dick, J. E. "Stem Cell Concepts Renew Cancer Research." Blood 112, no. 13 (2008): 4793-807.
Doherty, M. R., J. M. Smigiel, D. J. Junk, and M. W. Jackson. "Cancer Stem Cell Plasticity
Drives Therapeutic Resistance." Cancers (Basel) 8, no. 1 (2016).
Donnai, D., R. C. Mountford, and A. P. Read. "Norrie Disease Resulting from a Gene Deletion:
Clinical Features and DNA Studies." J Med Genet 25, no. 2 (1988): 73-8.
Ducrest, A. L., H. Szutorisz, J. Lingner, and M. Nabholz. "Regulation of the Human Telomerase
Reverse Transcriptase Gene." Oncogene 21, no. 4 (2002): 541-52.
Duggal, R., U. Geissinger, Q. Zhang, J. Aguilar, N. G. Chen, E. Binda, A. L. Vescovi, and A. A.
Szalay. "Vaccinia Virus Expressing Bone Morphogenetic Protein-4 in Novel Glioblastoma
Orthotopic Models Facilitates Enhanced Tumor Regression and Long-Term Survival." J Transl
Med 11, (2013): 155.
Dunn, G. P., M. L. Rinne, J. Wykosky, G. Genovese, S. N. Quayle, I. F. Dunn, P. K. Agarwalla,
M. G. Chheda, B. Campos, A. Wang, C. Brennan, K. L. Ligon, F. Furnari, W. K. Cavenee, R. A.
Depinho, L. Chin, and W. C. Hahn. "Emerging Insights into the Molecular and Cellular Basis of
Glioblastoma." Genes Dev 26, no. 8 (2012): 756-84.
Ebben, J. D., D. M. Treisman, M. Zorniak, R. G. Kutty, P. A. Clark, and J. S. Kuo. "The Cancer
Stem Cell Paradigm: A New Understanding of Tumor Development and Treatment." Expert
Opin Ther Targets 14, no. 6 (2010): 621-32.
Egan, D. F., D. B. Shackelford, M. M. Mihaylova, S. Gelino, R. A. Kohnz, W. Mair, D. S.
Vasquez, A. Joshi, D. M. Gwinn, R. Taylor, J. M. Asara, J. Fitzpatrick, A. Dillin, B. Viollet, M.
Kundu, M. Hansen, and R. J. Shaw. "Phosphorylation of Ulk1 (Hatg1) by Amp-Activated
Protein Kinase Connects Energy Sensing to Mitophagy." Science 331, no. 6016 (2011): 456-61.
130
Esteller, M., J. Garcia-Foncillas, E. Andion, S. N. Goodman, O. F. Hidalgo, V. Vanaclocha, S. B.
Baylin, and J. G. Herman. "Inactivation of the DNA-Repair Gene Mgmt and the Clinical
Response of Gliomas to Alkylating Agents." N Engl J Med 343, no. 19 (2000): 1350-4.
Fan, X., W. Matsui, L. Khaki, D. Stearns, J. Chun, Y. M. Li, and C. G. Eberhart. "Notch
Pathway Inhibition Depletes Stem-Like Cells and Blocks Engraftment in Embryonal Brain
Tumors." Cancer Res 66, no. 15 (2006): 7445-52.
Felsberg, J., M. Wolter, H. Seul, B. Friedensdorf, M. Goppert, M. C. Sabel, and G. Reifenberger.
"Rapid and Sensitive Assessment of the Idh1 and Idh2 Mutation Status in Cerebral Gliomas
Based on DNA Pyrosequencing." Acta Neuropathol 119, no. 4 (2010): 501-7.
Fenton, T. R., D. Nathanson, C. Ponte de Albuquerque, D. Kuga, A. Iwanami, J. Dang, H. Yang,
K. Tanaka, S. M. Oba-Shinjo, M. Uno, M. M. Inda, J. Wykosky, R. M. Bachoo, C. D. James, R.
A. DePinho, S. R. Vandenberg, H. Zhou, S. K. Marie, P. S. Mischel, W. K. Cavenee, and F. B.
Furnari. "Resistance to Egf Receptor Inhibitors in Glioblastoma Mediated by Phosphorylation of
the Pten Tumor Suppressor at Tyrosine 240." Proc Natl Acad Sci U S A 109, no. 35 (2012):
14164-9.
Figueroa, M. E., O. Abdel-Wahab, C. Lu, P. S. Ward, J. Patel, A. Shih, Y. Li, N. Bhagwat, A.
Vasanthakumar, H. F. Fernandez, M. S. Tallman, Z. Sun, K. Wolniak, J. K. Peeters, W. Liu, S.
E. Choe, V. R. Fantin, E. Paietta, B. Lowenberg, J. D. Licht, L. A. Godley, R. Delwel, P. J. Valk,
C. B. Thompson, R. L. Levine, and A. Melnick. "Leukemic Idh1 and Idh2 Mutations Result in a
Hypermethylation Phenotype, Disrupt Tet2 Function, and Impair Hematopoietic Differentiation."
Cancer Cell 18, no. 6 (2010): 553-67.
Flavahan, W. A., Q. Wu, M. Hitomi, N. Rahim, Y. Kim, A. E. Sloan, R. J. Weil, I. Nakano, J. N.
Sarkaria, B. W. Stringer, B. W. Day, M. Li, J. D. Lathia, J. N. Rich, and A. B. Hjelmeland.
"Brain Tumor Initiating Cells Adapt to Restricted Nutrition through Preferential Glucose
Uptake." Nat Neurosci 16, no. 10 (2013): 1373-82.
Fleming, T. P., A. Saxena, W. C. Clark, J. T. Robertson, E. H. Oldfield, S. A. Aaronson, and I.
U. Ali. "Amplification and/or Overexpression of Platelet-Derived Growth Factor Receptors and
131
Epidermal Growth Factor Receptor in Human Glial Tumors." Cancer Res 52, no. 16 (1992):
4550-3.
Frattini, V., V. Trifonov, J. M. Chan, A. Castano, M. Lia, F. Abate, S. T. Keir, A. X. Ji, P.
Zoppoli, F. Niola, C. Danussi, I. Dolgalev, P. Porrati, S. Pellegatta, A. Heguy, G. Gupta, D. J.
Pisapia, P. Canoll, J. N. Bruce, R. E. McLendon, H. Yan, K. Aldape, G. Finocchiaro, T.
Mikkelsen, G. G. Prive, D. D. Bigner, A. Lasorella, R. Rabadan, and A. Iavarone. "The
Integrated Landscape of Driver Genomic Alterations in Glioblastoma." Nat Genet 45, no. 10
(2013): 1141-9.
Freije, W. A., F. E. Castro-Vargas, Z. Fang, S. Horvath, T. Cloughesy, L. M. Liau, P. S. Mischel,
and S. F. Nelson. "Gene Expression Profiling of Gliomas Strongly Predicts Survival." Cancer
Res 64, no. 18 (2004): 6503-10.
Friedmann-Morvinski, D., E. A. Bushong, E. Ke, Y. Soda, T. Marumoto, O. Singer, M. H.
Ellisman, and I. M. Verma. "Dedifferentiation of Neurons and Astrocytes by Oncogenes Can
Induce Gliomas in Mice." Science 338, no. 6110 (2012): 1080-4.
Gage, F. H., and S. Temple. "Neural Stem Cells: Generating and Regenerating the Brain."
Neuron 80, no. 3 (2013): 588-601.
Galli, R., E. Binda, U. Orfanelli, B. Cipelletti, A. Gritti, S. De Vitis, R. Fiocco, C. Foroni, F.
Dimeco, and A. Vescovi. "Isolation and Characterization of Tumorigenic, Stem-Like Neural
Precursors from Human Glioblastoma." Cancer Res 64, no. 19 (2004): 7011-21.
Gangemi, R. M., F. Griffero, D. Marubbi, M. Perera, M. C. Capra, P. Malatesta, G. L. Ravetti, G.
L. Zona, A. Daga, and G. Corte. "Sox2 Silencing in Glioblastoma Tumor-Initiating Cells Causes
Stop of Proliferation and Loss of Tumorigenicity." Stem Cells 27, no. 1 (2009): 40-8.
Gertler, R., R. Rosenberg, D. Stricker, J. Friederichs, A. Hoos, M. Werner, K. Ulm, B.
Holzmann, H. Nekarda, and J. R. Siewert. "Telomere Length and Human Telomerase Reverse
Transcriptase Expression as Markers for Progression and Prognosis of Colorectal Carcinoma." J
Clin Oncol 22, no. 10 (2004): 1807-14.
132
Gilbert, C. A., and A. H. Ross. "Cancer Stem Cells: Cell Culture, Markers, and Targets for New
Therapies." J Cell Biochem 108, no. 5 (2009): 1031-8.
Golden, E. B., H. Y. Cho, A. Jahanian, F. M. Hofman, S. G. Louie, A. H. Schonthal, and T. C.
Chen. "Chloroquine Enhances Temozolomide Cytotoxicity in Malignant Gliomas by Blocking
Autophagy." Neurosurg Focus 37, no. 6 (2014): E12.
Goodell, M. A., K. Brose, G. Paradis, A. S. Conner, and R. C. Mulligan. "Isolation and
Functional Properties of Murine Hematopoietic Stem Cells That Are Replicating in Vivo." J Exp
Med 183, no. 4 (1996): 1797-806.
Guan, Y., W. Cheng, C. Zou, T. Wang, and Z. Cao. "Gremlin1 Promotes Carcinogenesis of
Glioma in Vitro." Clin Exp Pharmacol Physiol 44, no. 2 (2017): 244-256.
Gwinn, D. M., D. B. Shackelford, D. F. Egan, M. M. Mihaylova, A. Mery, D. S. Vasquez, B. E.
Turk, and R. J. Shaw. "Ampk Phosphorylation of Raptor Mediates a Metabolic Checkpoint."
Mol Cell 30, no. 2 (2008): 214-26.
Han, S. P., J. H. Kim, M. E. Han, H. E. Sim, K. S. Kim, S. Yoon, S. Y. Baek, B. S. Kim, and S.
O. Oh. "Snai1 Is Involved in the Proliferation and Migration of Glioblastoma Cells." Cell Mol
Neurobiol 31, no. 3 (2011): 489-96.
Hardwick, Laura JA, Fahad R. Ali, Roberta Azzarelli, and Anna Philpott. "Cell cycle regulation
of proliferation versus differentiation in the central nervous system." Cell and tissue research
359, no. 1 (2015): 187-200.
Hartmann, C., B. Hentschel, M. Tatagiba, J. Schramm, O. Schnell, C. Seidel, R. Stein, G.
Reifenberger, T. Pietsch, A. von Deimling, M. Loeffler, and M. Weller. "Molecular Markers in
Low-Grade Gliomas: Predictive or Prognostic?" Clin Cancer Res 17, no. 13 (2011): 4588-99.
Hartmann, C., J. Meyer, J. Balss, D. Capper, W. Mueller, A. Christians, J. Felsberg, M. Wolter,
C. Mawrin, W. Wick, M. Weller, C. Herold-Mende, A. Unterberg, J. W. Jeuken, P. Wesseling,
G. Reifenberger, and A. von Deimling. "Type and Frequency of Idh1 and Idh2 Mutations Are
133
Related to Astrocytic and Oligodendroglial Differentiation and Age: A Study of 1,010 Diffuse
Gliomas." Acta Neuropathol 118, no. 4 (2009): 469-74.
Hegi, M. E., A. C. Diserens, S. Godard, P. Y. Dietrich, L. Regli, S. Ostermann, P. Otten, G. Van
Melle, N. de Tribolet, and R. Stupp. "Clinical Trial Substantiates the Predictive Value of O-6-
Methylguanine-DNA Methyltransferase Promoter Methylation in Glioblastoma Patients Treated
with Temozolomide." Clin Cancer Res 10, no. 6 (2004): 1871-4.
Hegi, M. E., A. C. Diserens, T. Gorlia, M. F. Hamou, N. de Tribolet, M. Weller, J. M. Kros, J. A.
Hainfellner, W. Mason, L. Mariani, J. E. Bromberg, P. Hau, R. O. Mirimanoff, J. G. Cairncross,
R. C. Janzer, and R. Stupp. "Mgmt Gene Silencing and Benefit from Temozolomide in
Glioblastoma." N Engl J Med 352, no. 10 (2005): 997-1003.
Heimberger, A. B., R. Hlatky, D. Suki, D. Yang, J. Weinberg, M. Gilbert, R. Sawaya, and K.
Aldape. "Prognostic Effect of Epidermal Growth Factor Receptor and Egfrviii in Glioblastoma
Multiforme Patients." Clin Cancer Res 11, no. 4 (2005): 1462-6.
Hemmati, H. D., I. Nakano, J. A. Lazareff, M. Masterman-Smith, D. H. Geschwind, M. Bronner-
Fraser, and H. I. Kornblum. "Cancerous Stem Cells Can Arise from Pediatric Brain Tumors."
Proc Natl Acad Sci U S A 100, no. 25 (2003): 15178-83.
Herman, P. E., A. Papatheodorou, S. A. Bryant, C. K. M. Waterbury, J. R. Herdy, A. A. Arcese,
J. D. Buxbaum, J. J. Smith, J. R. Morgan, and O. Bloom. "Highly Conserved Molecular
Pathways, Including Wnt Signaling, Promote Functional Recovery from Spinal Cord Injury in
Lampreys." Sci Rep 8, no. 1 (2018): 742.
Herrlinger, U., J. Rieger, D. Koch, S. Loeser, B. Blaschke, R. D. Kortmann, J. P. Steinbach, T.
Hundsberger, W. Wick, R. Meyermann, T. C. Tan, C. Sommer, M. Bamberg, G. Reifenberger,
and M. Weller. "Phase Ii Trial of Lomustine Plus Temozolomide Chemotherapy in Addition to
Radiotherapy in Newly Diagnosed Glioblastoma: Ukt-03." J Clin Oncol 24, no. 27 (2006): 4412-
7.
134
Hickey, M. J., C. C. Malone, K. L. Erickson, M. R. Jadus, R. M. Prins, L. M. Liau, and C. A.
Kruse. "Cellular and Vaccine Therapeutic Approaches for Gliomas." J Transl Med 8, (2010):
100.
Hirata, H., S. Yoshiura, T. Ohtsuka, Y. Bessho, T. Harada, K. Yoshikawa, and R. Kageyama.
"Oscillatory Expression of the Bhlh Factor Hes1 Regulated by a Negative Feedback Loop."
Science 298, no. 5594 (2002): 840-3.
Holland, E. C. "Gliomagenesis: Genetic Alterations and Mouse Models." Nat Rev Genet 2, no. 2
(2001): 120-9.
Houillier, C., X. Wang, G. Kaloshi, K. Mokhtari, R. Guillevin, J. Laffaire, S. Paris, B. Boisselier,
A. Idbaih, F. Laigle-Donadey, K. Hoang-Xuan, M. Sanson, and J. Y. Delattre. "Idh1 or Idh2
Mutations Predict Longer Survival and Response to Temozolomide in Low-Grade Gliomas."
Neurology 75, no. 17 (2010): 1560-6.
Hovinga, K. E., F. Shimizu, R. Wang, G. Panagiotakos, M. Van Der Heijden, H. Moayedpardazi,
A. S. Correia, D. Soulet, T. Major, J. Menon, and V. Tabar. "Inhibition of Notch Signaling in
Glioblastoma Targets Cancer Stem Cells Via an Endothelial Cell Intermediate." Stem Cells 28,
no. 6 (2010): 1019-29.
Hu, Y., and G. K. Smyth. "Elda: Extreme Limiting Dilution Analysis for Comparing Depleted
and Enriched Populations in Stem Cell and Other Assays." J Immunol Methods 347, no. 1-2
(2009): 70-8.
Huang, H. C., and P. S. Klein. "The Frizzled Family: Receptors for Multiple Signal Transduction
Pathways." Genome Biol 5, no. 7 (2004): 234.
Hurtt, M. R., J. Moossy, M. Donovan-Peluso, and J. Locker. "Amplification of Epidermal
Growth Factor Receptor Gene in Gliomas: Histopathology and Prognosis." J Neuropathol Exp
Neurol 51, no. 1 (1992): 84-90.
135
Huszthy, P. C., I. Daphu, S. P. Niclou, D. Stieber, J. M. Nigro, P. O. Sakariassen, H. Miletic, F.
Thorsen, and R. Bjerkvig. "In Vivo Models of Primary Brain Tumors: Pitfalls and Perspectives."
Neuro Oncol 14, no. 8 (2012): 979-93.
Ignatova, T. N., V. G. Kukekov, E. D. Laywell, O. N. Suslov, F. D. Vrionis, and D. A. Steindler.
"Human Cortical Glial Tumors Contain Neural Stem-Like Cells Expressing Astroglial and
Neuronal Markers in Vitro." Glia 39, no. 3 (2002): 193-206.
Imayoshi, I., A. Isomura, Y. Harima, K. Kawaguchi, H. Kori, H. Miyachi, T. Fujiwara, F.
Ishidate, and R. Kageyama. "Oscillatory Control of Factors Determining Multipotency and Fate
in Mouse Neural Progenitors." Science 342, no. 6163 (2013): 1203-8.
Isashiki, Y., N. Ohba, T. Yanagita, N. Hokita, Y. Hotta, M. Hayakawa, K. Fujiki, and U. Tanabe.
"Mutations in the Norrie Disease Gene: A New Mutation in a Japanese Family." Br J
Ophthalmol 79, no. 7 (1995): 703-4.
Jacobs, V. L., P. A. Valdes, W. F. Hickey, and J. A. De Leo. "Current Review of in Vivo Gbm
Rodent Models: Emphasis on the Cns-1 Tumour Model." ASN Neuro 3, no. 3 (2011): e00063.
Janknecht, R. "On the Road to Immortality: Htert Upregulation in Cancer Cells." FEBS Lett 564,
no. 1-2 (2004): 9-13.
Jiang, R., C. Mircean, I. Shmulevich, D. Cogdell, Y. Jia, I. Tabus, K. Aldape, R. Sawaya, J. M.
Bruner, G. N. Fuller, and W. Zhang. "Pathway Alterations During Glioma Progression Revealed
by Reverse Phase Protein Lysate Arrays." Proteomics 6, no. 10 (2006): 2964-71.
Jin, X., H. Y. Jeon, K. M. Joo, J. K. Kim, J. Jin, S. H. Kim, B. G. Kang, S. Beck, S. J. Lee, A. K.
Park, W. Y. Park, Y. J. Choi, D. H. Nam, and H. Kim. "Frizzled 4 Regulates Stemness and
Invasiveness of Migrating Glioma Cells Established by Serial Intracranial Transplantation."
Cancer Res 71, no. 8 (2011): 3066-75.
Johnson, B. E., T. Mazor, C. Hong, M. Barnes, K. Aihara, C. Y. McLean, S. D. Fouse, S.
Yamamoto, H. Ueda, K. Tatsuno, S. Asthana, L. E. Jalbert, S. J. Nelson, A. W. Bollen, W. C.
Gustafson, E. Charron, W. A. Weiss, I. V. Smirnov, J. S. Song, A. B. Olshen, S. Cha, Y. Zhao,
136
R. A. Moore, A. J. Mungall, S. J. M. Jones, M. Hirst, M. A. Marra, N. Saito, H. Aburatani, A.
Mukasa, M. S. Berger, S. M. Chang, B. S. Taylor, and J. F. Costello. "Mutational Analysis
Reveals the Origin and Therapy-Driven Evolution of Recurrent Glioma." Science 343, no. 6167
(2014): 189-193.
Jovcevska, I., N. Kocevar, and R. Komel. "Glioma and Glioblastoma - How Much Do We (Not)
Know?" Mol Clin Oncol 1, no. 6 (2013): 935-941.
Jun, H. J., R. T. Bronson, and A. Charest. "Inhibition of Egfr Induces a C-Met-Driven Stem Cell
Population in Glioblastoma." Stem Cells 32, no. 2 (2014): 338-48.
Junge, H. J., S. Yang, J. B. Burton, K. Paes, X. Shu, D. M. French, M. Costa, D. S. Rice, and W.
Ye. "Tspan12 Regulates Retinal Vascular Development by Promoting Norrin- but Not Wnt-
Induced Fzd4/Beta-Catenin Signaling." Cell 139, no. 2 (2009): 299-311.
Juratli, T. A., M. Kirsch, K. Robel, S. Soucek, K. Geiger, R. von Kummer, G. Schackert, and D.
Krex. "Idh Mutations as an Early and Consistent Marker in Low-Grade Astrocytomas Who
Grade Ii and Their Consecutive Secondary High-Grade Gliomas." J Neurooncol 108, no. 3
(2012): 403-10.
Kamino, M., M. Kishida, T. Kibe, K. Ikoma, M. Iijima, H. Hirano, M. Tokudome, L. Chen, C.
Koriyama, K. Yamada, K. Arita, and S. Kishida. "Wnt-5a Signaling Is Correlated with
Infiltrative Activity in Human Glioma by Inducing Cellular Migration and Mmp-2." Cancer Sci
102, no. 3 (2011): 540-8.
Ke, J., K. G. Harikumar, C. Erice, C. Chen, X. Gu, L. Wang, N. Parker, Z. Cheng, W. Xu, B. O.
Williams, K. Melcher, L. J. Miller, and H. E. Xu. "Structure and Function of Norrin in Assembly
and Activation of a Frizzled 4-Lrp5/6 Complex." Genes Dev 27, no. 21 (2013): 2305-19.
Kemler, R., A. Hierholzer, B. Kanzler, S. Kuppig, K. Hansen, M. M. Taketo, W. N. de Vries, B.
B. Knowles, and D. Solter. "Stabilization of Beta-Catenin in the Mouse Zygote Leads to
Premature Epithelial-Mesenchymal Transition in the Epiblast." Development 131, no. 23 (2004):
5817-24.
137
Kesavabhotla, K., C. D. Schlaff, B. Shin, L. Mubita, R. Kaplan, A. J. Tsiouris, S. C. Pannullo, P.
Christos, E. Lavi, R. Scheff, and J. A. Boockvar. "Phase I/Ii Study of Oral Erlotinib for
Treatment of Relapsed/Refractory Glioblastoma Multiforme and Anaplastic Astrocytoma." J Exp
Ther Oncol 10, no. 1 (2012): 71-81.
Killela, P. J., Z. J. Reitman, Y. Jiao, C. Bettegowda, N. Agrawal, L. A. Diaz, Jr., A. H. Friedman,
H. Friedman, G. L. Gallia, B. C. Giovanella, A. P. Grollman, T. C. He, Y. He, R. H. Hruban, G.
I. Jallo, N. Mandahl, A. K. Meeker, F. Mertens, G. J. Netto, B. A. Rasheed, G. J. Riggins, T. A.
Rosenquist, M. Schiffman, M. Shih Ie, D. Theodorescu, M. S. Torbenson, V. E. Velculescu, T.
L. Wang, N. Wentzensen, L. D. Wood, M. Zhang, R. E. McLendon, D. D. Bigner, K. W.
Kinzler, B. Vogelstein, N. Papadopoulos, and H. Yan. "Tert Promoter Mutations Occur
Frequently in Gliomas and a Subset of Tumors Derived from Cells with Low Rates of Self-
Renewal." Proc Natl Acad Sci U S A 110, no. 15 (2013): 6021-6.
Kim, E. J., J. L. Ables, L. K. Dickel, A. J. Eisch, and J. E. Johnson. "Ascl1 (Mash1) Defines
Cells with Long-Term Neurogenic Potential in Subgranular and Subventricular Zones in Adult
Mouse Brain." PLoS One 6, no. 3 (2011): e18472.
Kim, J., A. J. Woo, J. Chu, J. W. Snow, Y. Fujiwara, C. G. Kim, A. B. Cantor, and S. H. Orkin.
"A MYC Network Accounts for Similarities between Embryonic Stem and Cancer Cell
Transcription Programs." Cell 143, no. 2 (2010): 313-24.
Kim, Y., E. Kim, Q. Wu, O. Guryanova, M. Hitomi, J. D. Lathia, D. Serwanski, A. E. Sloan, R.
J. Weil, J. Lee, A. Nishiyama, S. Bao, A. B. Hjelmeland, and J. N. Rich. "Platelet-Derived
Growth Factor Receptors Differentially Inform Intertumoral and Intratumoral Heterogeneity."
Genes Dev 26, no. 11 (2012): 1247-62.
Kim, Y., K. H. Kim, J. Lee, Y. A. Lee, M. Kim, S. J. Lee, K. Park, H. Yang, J. Jin, K. M. Joo,
and D. H. Nam. "Wnt Activation Is Implicated in Glioblastoma Radioresistance." Lab Invest 92,
no. 3 (2012): 466-73.
Kloosterhof, N. K., L. B. Bralten, H. J. Dubbink, P. J. French, and M. J. van den Bent. "Isocitrate
Dehydrogenase-1 Mutations: A Fundamentally New Understanding of Diffuse Glioma?" Lancet
Oncol 12, no. 1 (2011): 83-91.
138
Kobayashi, T., H. Mizuno, I. Imayoshi, C. Furusawa, K. Shirahige, and R. Kageyama. "The
Cyclic Gene Hes1 Contributes to Diverse Differentiation Responses of Embryonic Stem Cells."
Genes Dev 23, no. 16 (2009): 1870-5.
Koelsche, C., F. Sahm, D. Capper, D. Reuss, D. Sturm, D. T. Jones, M. Kool, P. A. Northcott, B.
Wiestler, K. Bohmer, J. Meyer, C. Mawrin, C. Hartmann, M. Mittelbronn, M. Platten, B.
Brokinkel, M. Seiz, C. Herold-Mende, A. Unterberg, J. Schittenhelm, M. Weller, S. Pfister, W.
Wick, A. Korshunov, and A. von Deimling. "Distribution of Tert Promoter Mutations in
Pediatric and Adult Tumors of the Nervous System." Acta Neuropathol 126, no. 6 (2013): 907-
15.
Kondo, T., T. Setoguchi, and T. Taga. "Persistence of a Small Subpopulation of Cancer Stem-
Like Cells in the C6 Glioma Cell Line." Proc Natl Acad Sci U S A 101, no. 3 (2004): 781-6.
Korshunov, A., M. Ryzhova, V. Hovestadt, S. Bender, D. Sturm, D. Capper, J. Meyer, D.
Schrimpf, M. Kool, P. A. Northcott, O. Zheludkova, T. Milde, O. Witt, A. E. Kulozik, G.
Reifenberger, N. Jabado, A. Perry, P. Lichter, A. von Deimling, S. M. Pfister, and D. T. Jones.
"Integrated Analysis of Pediatric Glioblastoma Reveals a Subset of Biologically Favorable
Tumors with Associated Molecular Prognostic Markers." Acta Neuropathol 129, no. 5 (2015):
669-78.
Krishnamurthy, N., and R. Kurzrock. "Targeting the Wnt/Beta-Catenin Pathway in Cancer:
Update on Effectors and Inhibitors." Cancer Treat Rev 62, (2018): 50-60.
Labussiere, M., B. Boisselier, K. Mokhtari, A. L. Di Stefano, A. Rahimian, M. Rossetto, P.
Ciccarino, O. Saulnier, R. Paterra, Y. Marie, G. Finocchiaro, and M. Sanson. "Combined
Analysis of Tert, Egfr, and Idh Status Defines Distinct Prognostic Glioblastoma Classes."
Neurology 83, no. 13 (2014): 1200-6.
Lai, M. B., C. Zhang, J. Shi, V. Johnson, L. Khandan, J. McVey, M. W. Klymkowsky, Z. Chen,
and H. J. Junge. "Tspan12 Is a Norrin Co-Receptor That Amplifies Frizzled4 Ligand Selectivity
and Signaling." Cell Rep 19, no. 13 (2017): 2809-2822.
139
Lan, X., D. J. Jorg, F. M. G. Cavalli, L. M. Richards, L. V. Nguyen, R. J. Vanner, P. Guilhamon,
L. Lee, M. M. Kushida, D. Pellacani, N. I. Park, F. J. Coutinho, H. Whetstone, H. J. Selvadurai,
C. Che, B. Luu, A. Carles, M. Moksa, N. Rastegar, R. Head, S. Dolma, P. Prinos, M. D.
Cusimano, S. Das, M. Bernstein, C. H. Arrowsmith, A. J. Mungall, R. A. Moore, Y. Ma, M.
Gallo, M. Lupien, T. J. Pugh, M. D. Taylor, M. Hirst, C. J. Eaves, B. D. Simons, and P. B. Dirks.
"Fate Mapping of Human Glioblastoma Reveals an Invariant Stem Cell Hierarchy." Nature 549,
no. 7671 (2017): 227-232.
Laplante, M., and D. M. Sabatini. "Mtor Signaling in Growth Control and Disease." Cell 149, no.
2 (2012): 274-93.
Lathia, J. D., J. Gallagher, J. M. Heddleston, J. Wang, C. E. Eyler, J. Macswords, Q. Wu, A.
Vasanji, R. E. McLendon, A. B. Hjelmeland, and J. N. Rich. "Integrin Alpha 6 Regulates
Glioblastoma Stem Cells." Cell Stem Cell 6, no. 5 (2010): 421-32.
Lathia, J. D., S. C. Mack, E. E. Mulkearns-Hubert, C. L. Valentim, and J. N. Rich. "Cancer Stem
Cells in Glioblastoma." Genes Dev 29, no. 12 (2015): 1203-17.
Lathia, J. D., M. Venere, M. S. Rao, and J. N. Rich. "Seeing Is Believing: Are Cancer Stem Cells
the Loch Ness Monster of Tumor Biology?" Stem Cell Rev 7, no. 2 (2011): 227-37.
Lee, J., S. Kotliarova, Y. Kotliarov, A. Li, Q. Su, N. M. Donin, S. Pastorino, B. W. Purow, N.
Christopher, W. Zhang, J. K. Park, and H. A. Fine. "Tumor Stem Cells Derived from
Glioblastomas Cultured in Bfgf and Egf More Closely Mirror the Phenotype and Genotype of
Primary Tumors Than Do Serum-Cultured Cell Lines." Cancer Cell 9, no. 5 (2006): 391-403.
Lee, J., M. J. Son, K. Woolard, N. M. Donin, A. Li, C. H. Cheng, S. Kotliarova, Y. Kotliarov, J.
Walling, S. Ahn, M. Kim, M. Totonchy, T. Cusack, C. Ene, H. Ma, Q. Su, J. C. Zenklusen, W.
Zhang, D. Maric, and H. A. Fine. "Epigenetic-Mediated Dysfunction of the Bone Morphogenetic
Protein Pathway Inhibits Differentiation of Glioblastoma-Initiating Cells." Cancer Cell 13, no. 1
(2008): 69-80.
Lee, J. C., I. Vivanco, R. Beroukhim, J. H. Huang, W. L. Feng, R. M. DeBiasi, K. Yoshimoto, J.
C. King, P. Nghiemphu, Y. Yuza, Q. Xu, H. Greulich, R. K. Thomas, J. G. Paez, T. C. Peck, D.
140
J. Linhart, K. A. Glatt, G. Getz, R. Onofrio, L. Ziaugra, R. L. Levine, S. Gabriel, T. Kawaguchi,
K. O'Neill, H. Khan, L. M. Liau, S. F. Nelson, P. N. Rao, P. Mischel, R. O. Pieper, T.
Cloughesy, D. J. Leahy, W. R. Sellers, C. L. Sawyers, M. Meyerson, and I. K. Mellinghoff.
"Epidermal Growth Factor Receptor Activation in Glioblastoma through Novel Missense
Mutations in the Extracellular Domain." PLoS Med 3, no. 12 (2006): e485.
Lee, J. K., J. Wang, J. K. Sa, E. Ladewig, H. O. Lee, I. H. Lee, H. J. Kang, D. S. Rosenbloom, P.
G. Camara, Z. Liu, P. van Nieuwenhuizen, S. W. Jung, S. W. Choi, J. Kim, A. Chen, K. T. Kim,
S. Shin, Y. J. Seo, J. M. Oh, Y. J. Shin, C. K. Park, D. S. Kong, H. J. Seol, A. Blumberg, J. I.
Lee, A. Iavarone, W. Y. Park, R. Rabadan, and D. H. Nam. "Spatiotemporal Genomic
Architecture Informs Precision Oncology in Glioblastoma." Nat Genet 49, no. 4 (2017): 594-
599.
Lee, S. M., H. J. Koh, D. C. Park, B. J. Song, T. L. Huh, and J. W. Park. "Cytosolic Nadp(+)-
Dependent Isocitrate Dehydrogenase Status Modulates Oxidative Damage to Cells." Free Radic
Biol Med 32, no. 11 (2002): 1185-96.
Lee, Y., J. K. Lee, S. H. Ahn, J. Lee, and D. H. Nam. "Wnt Signaling in Glioblastoma and
Therapeutic Opportunities." Lab Invest 96, no. 2 (2016): 137-50.
Leopold, S. A., L. F. Zeilbeck, G. Weber, R. Seitz, M. R. Bosl, H. Jagle, R. Fuchshofer, E. R.
Tamm, and A. Ohlmann. "Norrin Protects Optic Nerve Axons from Degeneration in a Mouse
Model of Glaucoma." Sci Rep 7, no. 1 (2017): 14274.
L'Episcopo, F., C. Tirolo, N. Testa, S. Caniglia, M. C. Morale, M. Deleidi, M. F. Serapide, S.
Pluchino, and B. Marchetti. "Plasticity of Subventricular Zone Neuroprogenitors in Mptp (1-
Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine) Mouse Model of Parkinson's Disease Involves
Cross Talk between Inflammatory and Wnt/Beta-Catenin Signaling Pathways: Functional
Consequences for Neuroprotection and Repair." J Neurosci 32, no. 6 (2012): 2062-85.
Lewis, K. A., and T. O. Tollefsbol. "Regulation of the Telomerase Reverse Transcriptase
Subunit through Epigenetic Mechanisms." Front Genet 7, (2016): 83.
141
Li, Q., O. Wijesekera, S. J. Salas, J. Y. Wang, M. Zhu, C. Aprhys, K. L. Chaichana, D. A.
Chesler, H. Zhang, C. L. Smith, H. Guerrero-Cazares, A. Levchenko, and A. Quinones-Hinojosa.
"Mesenchymal Stem Cells from Human Fat Engineered to Secrete Bmp4 Are Nononcogenic,
Suppress Brain Cancer, and Prolong Survival." Clin Cancer Res 20, no. 9 (2014): 2375-87.
Li, S., A. P. Chou, W. Chen, R. Chen, Y. Deng, H. S. Phillips, J. Selfridge, M. Zurayk, J. J. Lou,
R. G. Everson, K. C. Wu, K. F. Faull, T. Cloughesy, L. M. Liau, and A. Lai. "Overexpression of
Isocitrate Dehydrogenase Mutant Proteins Renders Glioma Cells More Sensitive to Radiation."
Neuro Oncol 15, no. 1 (2013): 57-68.
Li, Saiqun, Pierre Mattar, Rajiv Dixit, Samuel O. Lawn, Grey Wilkinson, Cassandra Kinch,
David Eisenstat, Deborah M. Kurrasch, Jennifer A. Chan, and Carol Schuurmans. "RAS/ERK
signaling controls proneural genetic programs in cortical development and gliomagenesis."
Journal of Neuroscience 34, no. 6 (2014): 2169-2190.
Li, Z., H. Wang, C. E. Eyler, A. B. Hjelmeland, and J. N. Rich. "Turning Cancer Stem Cells
inside Out: An Exploration of Glioma Stem Cell Signaling Pathways." J Biol Chem 284, no. 25
(2009): 16705-9.
Ligon, K. L., E. Huillard, S. Mehta, S. Kesari, H. Liu, J. A. Alberta, R. M. Bachoo, M. Kane, D.
N. Louis, R. A. Depinho, D. J. Anderson, C. D. Stiles, and D. H. Rowitch. "Olig2-Regulated
Lineage-Restricted Pathway Controls Replication Competence in Neural Stem Cells and
Malignant Glioma." Neuron 53, no. 4 (2007): 503-17.
Liu, B., Q. Chen, D. Tian, L. Wu, H. Dong, J. Wang, B. Ji, X. Zhu, Q. Cai, L. Wang, and S.
Zhang. "Bmp4 Reverses Multidrug Resistance through Modulation of Bcl-2 and Gdnf in
Glioblastoma." Brain Res 1507, (2013): 115-24.
Liu, B., D. Tian, W. Yi, L. Wu, Q. Cai, H. Dong, H. Shen, B. Ji, L. Wang, S. Zhang, D. Ruan,
and Q. Chen. "Effect of Bone Morphogenetic Protein 4 in the Human Brain Glioma Cell Line
U251." Cell Biochem Biophys 58, no. 2 (2010): 91-6.
142
Liu, B. Y., Y. C. Kim, V. Leatherberry, P. Cowin, and C. M. Alexander. "Mammary Gland
Development Requires Syndecan-1 to Create a Beta-Catenin/Tcf-Responsive Mammary
Epithelial Subpopulation." Oncogene 22, no. 58 (2003): 9243-53.
Liu, G., X. Yuan, Z. Zeng, P. Tunici, H. Ng, I. R. Abdulkadir, L. Lu, D. Irvin, K. L. Black, and J.
S. Yu. "Analysis of Gene Expression and Chemoresistance of Cd133+ Cancer Stem Cells in
Glioblastoma." Mol Cancer 5, (2006): 67.
Liu, S., Z. Tian, F. Yin, P. Zhang, Y. W, X. Ding, H. Wu, Y. Wu, X. Peng, J. Yuan, B. Qiang,
W. Fan, and M. Fan. "Expression and Functional Roles of Smad1 and Bmpr-Ib in Glioma
Development." Cancer Invest 27, no. 7 (2009): 734-40.
Lokker, N. A., C. M. Sullivan, S. J. Hollenbach, M. A. Israel, and N. A. Giese. "Platelet-Derived
Growth Factor (Pdgf) Autocrine Signaling Regulates Survival and Mitogenic Pathways in
Glioblastoma Cells: Evidence That the Novel Pdgf-C and Pdgf-D Ligands May Play a Role in
the Development of Brain Tumors." Cancer Res 62, no. 13 (2002): 3729-35.
Louis, D. N., H. Ohgaki, O. D. Wiestler, W. K. Cavenee, P. C. Burger, A. Jouvet, B. W.
Scheithauer, and P. Kleihues. "The 2007 Who Classification of Tumours of the Central Nervous
System." Acta Neuropathol 114, no. 2 (2007): 97-109.
Lu, C., P. S. Ward, G. S. Kapoor, D. Rohle, S. Turcan, O. Abdel-Wahab, C. R. Edwards, R.
Khanin, M. E. Figueroa, A. Melnick, K. E. Wellen, D. M. O'Rourke, S. L. Berger, T. A. Chan, R.
L. Levine, I. K. Mellinghoff, and C. B. Thompson. "Idh Mutation Impairs Histone
Demethylation and Results in a Block to Cell Differentiation." Nature 483, no. 7390 (2012): 474-
8.
MacDonald, B. T., K. Tamai, and X. He. "Wnt/Beta-Catenin Signaling: Components,
Mechanisms, and Diseases." Dev Cell 17, no. 1 (2009): 9-26.
Magnusson, J. P., C. Goritz, J. Tatarishvili, D. O. Dias, E. M. Smith, O. Lindvall, Z. Kokaia, and
J. Frisen. "A Latent Neurogenic Program in Astrocytes Regulated by Notch Signaling in the
Mouse." Science 346, no. 6206 (2014): 237-41.
143
Maher, E. A., C. Brennan, P. Y. Wen, L. Durso, K. L. Ligon, A. Richardson, D. Khatry, B. Feng,
R. Sinha, D. N. Louis, J. Quackenbush, P. M. Black, L. Chin, and R. A. DePinho. "Marked
Genomic Differences Characterize Primary and Secondary Glioblastoma Subtypes and Identify
Two Distinct Molecular and Clinical Secondary Glioblastoma Entities." Cancer Res 66, no. 23
(2006): 11502-13.
Malmstrom, A., B. H. Gronberg, C. Marosi, R. Stupp, D. Frappaz, H. Schultz, U. Abacioglu, B.
Tavelin, B. Lhermitte, M. E. Hegi, J. Rosell, and R. Henriksson. "Temozolomide Versus
Standard 6-Week Radiotherapy Versus Hypofractionated Radiotherapy in Patients Older Than
60 Years with Glioblastoma: The Nordic Randomised, Phase 3 Trial." Lancet Oncol 13, no. 9
(2012): 916-26.
Mangraviti, A., S. Y. Tzeng, D. Gullotti, K. L. Kozielski, J. E. Kim, M. Seng, S. Abbadi, P.
Schiapparelli, R. Sarabia-Estrada, A. Vescovi, H. Brem, A. Olivi, B. Tyler, J. J. Green, and A.
Quinones-Hinojosa. "Non-Virally Engineered Human Adipose Mesenchymal Stem Cells
Produce Bmp4, Target Brain Tumors, and Extend Survival." Biomaterials 100, (2016): 53-66.
Marchetti, B., and S. Pluchino. "Wnt Your Brain Be Inflamed? Yes, It Wnt!" Trends Mol Med
19, no. 3 (2013): 144-56.
Masamizu, Y., T. Ohtsuka, Y. Takashima, H. Nagahara, Y. Takenaka, K. Yoshikawa, H.
Okamura, and R. Kageyama. "Real-Time Imaging of the Somite Segmentation Clock:
Revelation of Unstable Oscillators in the Individual Presomitic Mesoderm Cells." Proc Natl
Acad Sci U S A 103, no. 5 (2006): 1313-8.
Masui, K., T. F. Cloughesy, and P. S. Mischel. "Review: Molecular Pathology in Adult High-
Grade Gliomas: From Molecular Diagnostics to Target Therapies." Neuropathol Appl Neurobiol
38, no. 3 (2012): 271-91.
McCord, M., Y. S. Mukouyama, M. R. Gilbert, and S. Jackson. "Targeting Wnt Signaling for
Multifaceted Glioblastoma Therapy." Front Cell Neurosci 11, (2017): 318.
McGillicuddy, L. T., J. A. Fromm, P. E. Hollstein, S. Kubek, R. Beroukhim, T. De Raedt, B. W.
Johnson, S. M. Williams, P. Nghiemphu, L. M. Liau, T. F. Cloughesy, P. S. Mischel, A. Parret,
144
J. Seiler, G. Moldenhauer, K. Scheffzek, A. O. Stemmer-Rachamimov, C. L. Sawyers, C.
Brennan, L. Messiaen, I. K. Mellinghoff, and K. Cichowski. "Proteasomal and Genetic
Inactivation of the Nf1 Tumor Suppressor in Gliomagenesis." Cancer Cell 16, no. 1 (2009): 44-
54.
McNeill, B., C. Mazerolle, E. A. Bassett, A. J. Mears, R. Ringuette, P. Lagali, D. J. Picketts, K.
Paes, D. Rice, and V. A. Wallace. "Hedgehog Regulates Norrie Disease Protein to Drive Neural
Progenitor Self-Renewal." Hum Mol Genet 22, no. 5 (2013): 1005-16.
McNeill, B., C. Perez-Iratxeta, C. Mazerolle, M. Furimsky, Y. Mishina, M. A. Andrade-Navarro,
and V. A. Wallace. "Comparative Genomics Identification of a Novel Set of Temporally
Regulated Hedgehog Target Genes in the Retina." Mol Cell Neurosci 49, no. 3 (2012): 333-40.
Meindl, A., B. Lorenz, H. Achatz, H. Hellebrand, P. Schmitz-Valckenberg, and T. Meitinger.
"Missense Mutations in the Ndp Gene in Patients with a Less Severe Course of Norrie Disease."
Hum Mol Genet 4, no. 3 (1995): 489-90.
Mellinghoff, I. K., M. Y. Wang, I. Vivanco, D. A. Haas-Kogan, S. Zhu, E. Q. Dia, K. V. Lu, K.
Yoshimoto, J. H. Huang, D. J. Chute, B. L. Riggs, S. Horvath, L. M. Liau, W. K. Cavenee, P. N.
Rao, R. Beroukhim, T. C. Peck, J. C. Lee, W. R. Sellers, D. Stokoe, M. Prados, T. F. Cloughesy,
C. L. Sawyers, and P. S. Mischel. "Molecular Determinants of the Response of Glioblastomas to
Egfr Kinase Inhibitors." N Engl J Med 353, no. 19 (2005): 2012-24.
Mengel, B., A. Hunziker, L. Pedersen, A. Trusina, M. H. Jensen, and S. Krishna. "Modeling
Oscillatory Control in Nf-Kappab, P53 and Wnt Signaling." Curr Opin Genet Dev 20, no. 6
(2010): 656-64.
Meyer, M., J. Reimand, X. Lan, R. Head, X. Zhu, M. Kushida, J. Bayani, J. C. Pressey, A. C.
Lionel, I. D. Clarke, M. Cusimano, J. A. Squire, S. W. Scherer, M. Bernstein, M. A. Woodin, G.
D. Bader, and P. B. Dirks. "Single Cell-Derived Clonal Analysis of Human Glioblastoma Links
Functional and Genomic Heterogeneity." Proc Natl Acad Sci U S A 112, no. 3 (2015): 851-6.
Mikels, A. J., and R. Nusse. "Wnts as Ligands: Processing, Secretion and Reception." Oncogene
25, no. 57 (2006): 7461-8.
145
Mikheeva, S. A., A. M. Mikheev, A. Petit, R. Beyer, R. G. Oxford, L. Khorasani, J. P. Maxwell,
C. A. Glackin, H. Wakimoto, I. Gonzalez-Herrero, I. Sanchez-Garcia, J. R. Silber, P. J. Horner,
and R. C. Rostomily. "Twist1 Promotes Invasion through Mesenchymal Change in Human
Glioblastoma." Mol Cancer 9, (2010): 194.
Morris, Luc GT, Andrew M. Kaufman, Yongxing Gong, Deepa Ramaswami, Logan A. Walsh,
Şevin Turcan, Stephanie Eng et al. "Recurrent somatic mutation of FAT1 in multiple human
cancers leads to aberrant Wnt activation." Nature genetics 45, no. 3 (2013): 253.
Mukasa, A., J. Wykosky, K. L. Ligon, L. Chin, W. K. Cavenee, and F. Furnari. "Mutant Egfr Is
Required for Maintenance of Glioma Growth in Vivo, and Its Ablation Leads to Escape from
Receptor Dependence." Proc Natl Acad Sci U S A 107, no. 6 (2010): 2616-21.
Nassar, D., and C. Blanpain. "Cancer Stem Cells: Basic Concepts and Therapeutic Implications."
Annu Rev Pathol 11, (2016): 47-76.
Network, T. C. "Corrigendum: Comprehensive Genomic Characterization Defines Human
Glioblastoma Genes and Core Pathways." Nature 494, no. 7438 (2013): 506.
Niehrs, C. "The Complex World of Wnt Receptor Signalling." Nat Rev Mol Cell Biol 13, no. 12
(2012): 767-79.
Nobusawa, S., T. Watanabe, P. Kleihues, and H. Ohgaki. "Idh1 Mutations as Molecular
Signature and Predictive Factor of Secondary Glioblastomas." Clin Cancer Res 15, no. 19
(2009): 6002-7.
Noushmehr, H., D. J. Weisenberger, K. Diefes, H. S. Phillips, K. Pujara, B. P. Berman, F. Pan,
C. E. Pelloski, E. P. Sulman, K. P. Bhat, R. G. Verhaak, K. A. Hoadley, D. N. Hayes, C. M.
Perou, H. K. Schmidt, L. Ding, R. K. Wilson, D. Van Den Berg, H. Shen, H. Bengtsson, P.
Neuvial, L. M. Cope, J. Buckley, J. G. Herman, S. B. Baylin, P. W. Laird, and K. Aldape.
"Identification of a Cpg Island Methylator Phenotype That Defines a Distinct Subgroup of
Glioma." Cancer Cell 17, no. 5 (2010): 510-22.
Nusse, R. "Wnt Signaling and Stem Cell Control." Cell Res 18, no. 5 (2008): 523-7.
146
Nusse, R., and H. Clevers. "Wnt/Beta-Catenin Signaling, Disease, and Emerging Therapeutic
Modalities." Cell 169, no. 6 (2017): 985-999.
Nusse, R., C. Fuerer, W. Ching, K. Harnish, C. Logan, A. Zeng, D. ten Berge, and Y. Kalani.
"Wnt Signaling and Stem Cell Control." Cold Spring Harb Symp Quant Biol 73, (2008): 59-66.
Nusse, R., and H. E. Varmus. "Many Tumors Induced by the Mouse Mammary Tumor Virus
Contain a Provirus Integrated in the Same Region of the Host Genome." Cell 31, no. 1 (1982):
99-109.
Ohgaki, H., P. Dessen, B. Jourde, S. Horstmann, T. Nishikawa, P. L. Di Patre, C. Burkhard, D.
Schuler, N. M. Probst-Hensch, P. C. Maiorka, N. Baeza, P. Pisani, Y. Yonekawa, M. G.
Yasargil, U. M. Lutolf, and P. Kleihues. "Genetic Pathways to Glioblastoma: A Population-
Based Study." Cancer Res 64, no. 19 (2004): 6892-9.
Ohgaki, H., and P. Kleihues. "Genetic Pathways to Primary and Secondary Glioblastoma." Am J
Pathol 170, no. 5 (2007): 1445-53.
Ohgaki, H., and P. Kleihues . "The Definition of Primary and Secondary Glioblastoma." Clin
Cancer Res 19, no. 4 (2013): 764-72.
Ohlmann, A., and E. R. Tamm. "Norrin: Molecular and Functional Properties of an Angiogenic
and Neuroprotective Growth Factor." Prog Retin Eye Res 31, no. 3 (2012): 243-57.
Oliva, C. A., C. Montecinos-Oliva, and N. C. Inestrosa. "Wnt Signaling in the Central Nervous
System: New Insights in Health and Disease." Prog Mol Biol Transl Sci 153, (2018): 81-130.
Olson, R. A., P. K. Brastianos, and D. A. Palma. "Prognostic and Predictive Value of Epigenetic
Silencing of Mgmt in Patients with High Grade Gliomas: A Systematic Review and Meta-
Analysis." J Neurooncol 105, no. 2 (2011): 325-35.
Ozawa, T., C. W. Brennan, L. Wang, M. Squatrito, T. Sasayama, M. Nakada, J. T. Huse, A.
Pedraza, S. Utsuki, Y. Yasui, A. Tandon, E. I. Fomchenko, H. Oka, R. L. Levine, K. Fujii, M.
Ladanyi, and E. C. Holland. "Pdgfra Gene Rearrangements Are Frequent Genetic Events in
Pdgfra-Amplified Glioblastomas." Genes Dev 24, no. 19 (2010): 2205-18.
147
Pang, Z. P., N. Yang, T. Vierbuchen, A. Ostermeier, D. R. Fuentes, T. Q. Yang, A. Citri, V.
Sebastiano, S. Marro, T. C. Sudhof, and M. Wernig. "Induction of Human Neuronal Cells by
Defined Transcription Factors." Nature 476, no. 7359 (2011): 220-3.
Park, N. I., P. Guilhamon, K. Desai, R. F. McAdam, E. Langille, M. O'Connor, X. Lan, H.
Whetstone, F. J. Coutinho, R. J. Vanner, E. Ling, P. Prinos, L. Lee, H. Selvadurai, G. Atwal, M.
Kushida, I. D. Clarke, V. Voisin, M. D. Cusimano, M. Bernstein, S. Das, G. Bader, C. H.
Arrowsmith, S. Angers, X. Huang, M. Lupien, and P. B. Dirks. "Ascl1 Reorganizes Chromatin
to Direct Neuronal Fate and Suppress Tumorigenicity of Glioblastoma Stem Cells." Cell Stem
Cell 21, no. 3 (2017): 411.
Parsons, D. W., S. Jones, X. Zhang, J. C. Lin, R. J. Leary, P. Angenendt, P. Mankoo, H. Carter,
I. M. Siu, G. L. Gallia, A. Olivi, R. McLendon, B. A. Rasheed, S. Keir, T. Nikolskaya, Y.
Nikolsky, D. A. Busam, H. Tekleab, L. A. Diaz, Jr., J. Hartigan, D. R. Smith, R. L. Strausberg,
S. K. Marie, S. M. Shinjo, H. Yan, G. J. Riggins, D. D. Bigner, R. Karchin, N. Papadopoulos, G.
Parmigiani, B. Vogelstein, V. E. Velculescu, and K. W. Kinzler. "An Integrated Genomic
Analysis of Human Glioblastoma Multiforme." Science 321, no. 5897 (2008): 1807-12.
Pastrana, E., V. Silva-Vargas, and F. Doetsch. "Eyes Wide Open: A Critical Review of Sphere-
Formation as an Assay for Stem Cells." Cell Stem Cell 8, no. 5 (2011): 486-98.
Patel, A. P., I. Tirosh, J. J. Trombetta, A. K. Shalek, S. M. Gillespie, H. Wakimoto, D. P. Cahill,
B. V. Nahed, W. T. Curry, R. L. Martuza, D. N. Louis, O. Rozenblatt-Rosen, M. L. Suva, A.
Regev, and B. E. Bernstein. "Single-Cell Rna-Seq Highlights Intratumoral Heterogeneity in
Primary Glioblastoma." Science 344, no. 6190 (2014): 1396-401.
Patel, M. A., J. E. Kim, J. Ruzevick, G. Li, and M. Lim. "The Future of Glioblastoma Therapy:
Synergism of Standard of Care and Immunotherapy." Cancers (Basel) 6, no. 4 (2014): 1953-85.
Perez-Vilar, J., and R. L. Hill. "Norrie Disease Protein (Norrin) Forms Disulfide-Linked
Oligomers Associated with the Extracellular Matrix." J Biol Chem 272, no. 52 (1997): 33410-5.
Phillips, H. S., S. Kharbanda, R. Chen, W. F. Forrest, R. H. Soriano, T. D. Wu, A. Misra, J. M.
Nigro, H. Colman, L. Soroceanu, P. M. Williams, Z. Modrusan, B. G. Feuerstein, and K. Aldape.
148
"Molecular Subclasses of High-Grade Glioma Predict Prognosis, Delineate a Pattern of Disease
Progression, and Resemble Stages in Neurogenesis." Cancer Cell 9, no. 3 (2006): 157-73.
Piccirillo, S. G., B. A. Reynolds, N. Zanetti, G. Lamorte, E. Binda, G. Broggi, H. Brem, A. Olivi,
F. Dimeco, and A. L. Vescovi. "Bone Morphogenetic Proteins Inhibit the Tumorigenic Potential
of Human Brain Tumour-Initiating Cells." Nature 444, no. 7120 (2006): 761-5.
Pina, C., C. Fugazza, A. J. Tipping, J. Brown, S. Soneji, J. Teles, C. Peterson, and T. Enver.
"Inferring Rules of Lineage Commitment in Haematopoiesis." Nat Cell Biol 14, no. 3 (2012):
287-94.
Plaks, V., N. Kong, and Z. Werb. "The Cancer Stem Cell Niche: How Essential Is the Niche in
Regulating Stemness of Tumor Cells?" Cell Stem Cell 16, no. 3 (2015): 225-38.
Planutis, K., M. Planutiene, and R. F. Holcombe. "A Novel Signaling Pathway Regulates Colon
Cancer Angiogenesis through Norrin." Sci Rep 4, (2014): 5630.
Planutis, K., M. Planutiene, M. P. Moyer, A. V. Nguyen, C. A. Perez, and R. F. Holcombe.
"Regulation of Norrin Receptor Frizzled-4 by Wnt2 in Colon-Derived Cells." BMC Cell Biol 8,
(2007): 12.
Podberezin, M., J. Wen, and C. C. Chang. "Cancer Stem Cells: A Review of Potential Clinical
Applications." Arch Pathol Lab Med 137, no. 8 (2013): 1111-6.
Polakis, P. "Wnt Signaling in Cancer." Cold Spring Harb Perspect Biol 4, no. 5 (2012).
Pollard, S. M., K. Yoshikawa, I. D. Clarke, D. Danovi, S. Stricker, R. Russell, J. Bayani, R.
Head, M. Lee, M. Bernstein, J. A. Squire, A. Smith, and P. Dirks. "Glioma Stem Cell Lines
Expanded in Adherent Culture Have Tumor-Specific Phenotypes and Are Suitable for Chemical
and Genetic Screens." Cell Stem Cell 4, no. 6 (2009): 568-80.
Prados, M. D., S. A. Byron, N. L. Tran, J. J. Phillips, A. M. Molinaro, K. L. Ligon, P. Y. Wen, J.
G. Kuhn, I. K. Mellinghoff, J. F. de Groot, H. Colman, T. F. Cloughesy, S. M. Chang, T. C.
Ryken, W. D. Tembe, J. A. Kiefer, M. E. Berens, D. W. Craig, J. D. Carpten, and J. M. Trent.
149
"Toward Precision Medicine in Glioblastoma: The Promise and the Challenges." Neuro Oncol
17, no. 8 (2015): 1051-63.
Pu, P., Z. Zhang, C. Kang, R. Jiang, Z. Jia, G. Wang, and H. Jiang. "Downregulation of Wnt2
and Beta-Catenin by Sirna Suppresses Malignant Glioma Cell Growth." Cancer Gene Ther 16,
no. 4 (2009): 351-61.
Quartararo, C. E., E. Reznik, A. C. deCarvalho, T. Mikkelsen, and B. R. Stockwell. "High-
Throughput Screening of Patient-Derived Cultures Reveals Potential for Precision Medicine in
Glioblastoma." ACS Med Chem Lett 6, no. 8 (2015): 948-52.
Rahman, M., H. Azari, L. Deleyrolle, S. Millette, H. Zeng, and B. A. Reynolds. "Controlling
Tumor Invasion: Bevacizumab and Bmp4 for Glioblastoma." Future Oncol 9, no. 9 (2013):
1389-96.
Rahman, M. S., N. Akhtar, H. M. Jamil, R. S. Banik, and S. M. Asaduzzaman. "Tgf-Beta/Bmp
Signaling and Other Molecular Events: Regulation of Osteoblastogenesis and Bone Formation."
Bone Res 3, (2015): 15005.
Rampazzo, E., L. Persano, F. Pistollato, E. Moro, C. Frasson, P. Porazzi, A. Della Puppa, S.
Bresolin, G. Battilana, S. Indraccolo, G. Te Kronnie, F. Argenton, N. Tiso, and G. Basso. "Wnt
Activation Promotes Neuronal Differentiation of Glioblastoma." Cell Death Dis 4, (2013): e500.
Raposo, Alexandre ASF, Francisca F. Vasconcelos, Daniela Drechsel, Corentine Marie, Caroline
Johnston, Dirk Dolle, Angela Bithell et al. "Ascl1 coordinately regulates gene expression and the
chromatin landscape during neurogenesis." Cell reports 10, no. 9 (2015): 1544-1556.
Reinartz, S., F. Finkernagel, T. Adhikary, V. Rohnalter, T. Schumann, Y. Schober, W. A.
Nockher, A. Nist, T. Stiewe, J. M. Jansen, U. Wagner, S. Muller-Brusselbach, and R. Muller. "A
Transcriptome-Based Global Map of Signaling Pathways in the Ovarian Cancer
Microenvironment Associated with Clinical Outcome." Genome Biol 17, no. 1 (2016): 108.
Reitman, Z. J., and H. Yan. "Isocitrate Dehydrogenase 1 and 2 Mutations in Cancer: Alterations
at a Crossroads of Cellular Metabolism." J Natl Cancer Inst 102, no. 13 (2010): 932-41.
150
Reya, T., S. J. Morrison, M. F. Clarke, and I. L. Weissman. "Stem Cells, Cancer, and Cancer
Stem Cells." Nature 414, no. 6859 (2001): 105-11.
Rheinbay, E., M. L. Suva, S. M. Gillespie, H. Wakimoto, A. P. Patel, M. Shahid, O. Oksuz, S. D.
Rabkin, R. L. Martuza, M. N. Rivera, D. N. Louis, S. Kasif, A. S. Chi, and B. E. Bernstein. "An
Aberrant Transcription Factor Network Essential for Wnt Signaling and Stem Cell Maintenance
in Glioblastoma." Cell Rep 3, no. 5 (2013): 1567-79.
Riemenschneider, M. J., R. A. Betensky, S. M. Pasedag, and D. N. Louis. "Akt Activation in
Human Glioblastomas Enhances Proliferation Via Tsc2 and S6 Kinase Signaling." Cancer Res
66, no. 11 (2006): 5618-23.
Robitaille, J., M. L. MacDonald, A. Kaykas, L. C. Sheldahl, J. Zeisler, M. P. Dube, L. H. Zhang,
R. R. Singaraja, D. L. Guernsey, B. Zheng, L. F. Siebert, A. Hoskin-Mott, M. T. Trese, S. N.
Pimstone, B. S. Shastry, R. T. Moon, M. R. Hayden, Y. P. Goldberg, and M. E. Samuels.
"Mutant Frizzled-4 Disrupts Retinal Angiogenesis in Familial Exudative Vitreoretinopathy." Nat
Genet 32, no. 2 (2002): 326-30.
Rock, K., O. McArdle, P. Forde, M. Dunne, D. Fitzpatrick, B. O'Neill, and C. Faul. "A Clinical
Review of Treatment Outcomes in Glioblastoma Multiforme--the Validation in a Non-Trial
Population of the Results of a Randomised Phase Iii Clinical Trial: Has a More Radical
Approach Improved Survival?" Br J Radiol 85, no. 1017 (2012): e729-33.
Rohle, D., J. Popovici-Muller, N. Palaskas, S. Turcan, C. Grommes, C. Campos, J. Tsoi, O.
Clark, B. Oldrini, E. Komisopoulou, K. Kunii, A. Pedraza, S. Schalm, L. Silverman, A. Miller,
F. Wang, H. Yang, Y. Chen, A. Kernytsky, M. K. Rosenblum, W. Liu, S. A. Biller, S. M. Su, C.
W. Brennan, T. A. Chan, T. G. Graeber, K. E. Yen, and I. K. Mellinghoff. "An Inhibitor of
Mutant Idh1 Delays Growth and Promotes Differentiation of Glioma Cells." Science 340, no.
6132 (2013): 626-30.
Rosenfeld, M. R., X. Ye, J. G. Supko, S. Desideri, S. A. Grossman, S. Brem, T. Mikkelson, D.
Wang, Y. C. Chang, J. Hu, Q. McAfee, J. Fisher, A. B. Troxel, S. Piao, D. F. Heitjan, K. S. Tan,
L. Pontiggia, P. J. O'Dwyer, L. E. Davis, and R. K. Amaravadi. "A Phase I/Ii Trial of
Hydroxychloroquine in Conjunction with Radiation Therapy and Concurrent and Adjuvant
151
Temozolomide in Patients with Newly Diagnosed Glioblastoma Multiforme." Autophagy 10, no.
8 (2014): 1359-68.
Roth, W., C. Wild-Bode, M. Platten, C. Grimmel, H. S. Melkonyan, J. Dichgans, and M. Weller.
"Secreted Frizzled-Related Proteins Inhibit Motility and Promote Growth of Human Malignant
Glioma Cells." Oncogene 19, no. 37 (2000): 4210-20.
Sadahiro, H., K. D. Kang, J. T. Gibson, M. Minata, H. Yu, J. Shi, R. Chhipa, Z. Chen, S. Lu, Y.
Simoni, T. Furuta, H. Sabit, S. Zhang, S. Bastola, S. Yamaguchi, H. Alsheikh, S. Komarova, J.
Wang, S. H. Kim, D. Hambardzumyan, X. Lu, E. W. Newell, B. DasGupta, M. Nakada, L. J.
Lee, B. Nabors, L. A. Norian, and I. Nakano. "Activation of the Receptor Tyrosine Kinase Axl
Regulates the Immune Microenvironment in Glioblastoma." Cancer Res 78, no. 11 (2018): 3002-
3013.
Sahm, F., D. Capper, A. Jeibmann, A. Habel, W. Paulus, D. Troost, and A. von Deimling.
"Addressing Diffuse Glioma as a Systemic Brain Disease with Single-Cell Analysis." Arch
Neurol 69, no. 4 (2012): 523-6.
Sahm, F., C. Koelsche, J. Meyer, S. Pusch, K. Lindenberg, W. Mueller, C. Herold-Mende, A.
von Deimling, and C. Hartmann. "Cic and Fubp1 Mutations in Oligodendrogliomas,
Oligoastrocytomas and Astrocytomas." Acta Neuropathol 123, no. 6 (2012): 853-60.
Sampson, J. H., A. B. Heimberger, G. E. Archer, K. D. Aldape, A. H. Friedman, H. S. Friedman,
M. R. Gilbert, J. E. Herndon, 2nd, R. E. McLendon, D. A. Mitchell, D. A. Reardon, R. Sawaya,
R. J. Schmittling, W. Shi, J. J. Vredenburgh, and D. D. Bigner. "Immunologic Escape after
Prolonged Progression-Free Survival with Epidermal Growth Factor Receptor Variant Iii Peptide
Vaccination in Patients with Newly Diagnosed Glioblastoma." J Clin Oncol 28, no. 31 (2010):
4722-9.
Sanders, R. P., R. Drissi, C. A. Billups, N. C. Daw, M. B. Valentine, and J. S. Dome.
"Telomerase Expression Predicts Unfavorable Outcome in Osteosarcoma." J Clin Oncol 22, no.
18 (2004): 3790-7.
152
Sandsmark, D. K., H. Zhang, B. Hegedus, C. L. Pelletier, J. D. Weber, and D. H. Gutmann.
"Nucleophosmin Mediates Mammalian Target of RapaMYCin-Dependent Actin Cytoskeleton
Dynamics and Proliferation in Neurofibromin-Deficient Astrocytes." Cancer Res 67, no. 10
(2007): 4790-9.
Sanson, M., Y. Marie, S. Paris, A. Idbaih, J. Laffaire, F. Ducray, S. El Hallani, B. Boisselier, K.
Mokhtari, K. Hoang-Xuan, and J. Y. Delattre. "Isocitrate Dehydrogenase 1 Codon 132 Mutation
Is an Important Prognostic Biomarker in Gliomas." J Clin Oncol 27, no. 25 (2009): 4150-4.
Sarkaria, J. N., L. S. Hu, I. F. Parney, D. H. Pafundi, D. H. Brinkmann, N. N. Laack, C.
Giannini, T. C. Burns, S. H. Kizilbash, J. K. Laramy, K. R. Swanson, T. J. Kaufmann, P. D.
Brown, N. Y. R. Agar, E. Galanis, J. C. Buckner, and W. F. Elmquist. "Is the Blood-Brain
Barrier Really Disrupted in All Glioblastomas? A Critical Assessment of Existing Clinical Data."
Neuro Oncol 20, no. 2 (2018): 184-191.
Sasaki, M., C. B. Knobbe, M. Itsumi, A. J. Elia, I. S. Harris, Chio, II, R. A. Cairns, S.
McCracken, A. Wakeham, J. Haight, A. Y. Ten, B. Snow, T. Ueda, S. Inoue, K. Yamamoto, M.
Ko, A. Rao, K. E. Yen, S. M. Su, and T. W. Mak. "D-2-Hydroxyglutarate Produced by Mutant
Idh1 Perturbs Collagen Maturation and Basement Membrane Function." Genes Dev 26, no. 18
(2012): 2038-49.
Schuback, D. E., Z. Y. Chen, I. W. Craig, X. O. Breakefield, and K. B. Sims. "Mutations in the
Norrie Disease Gene." Hum Mutat 5, no. 4 (1995): 285-92.
Schuessler, A., C. Smith, L. Beagley, G. M. Boyle, S. Rehan, K. Matthews, L. Jones, T. Crough,
V. Dasari, K. Klein, A. Smalley, H. Alexander, D. G. Walker, and R. Khanna. "Autologous T-
Cell Therapy for Cytomegalovirus as a Consolidative Treatment for Recurrent Glioblastoma."
Cancer Res 74, no. 13 (2014): 3466-76.
Schulte, G., and V. Bryja. "The Frizzled Family of Unconventional G-Protein-Coupled
Receptors." Trends Pharmacol Sci 28, no. 10 (2007): 518-25.
Schumacher, T., L. Bunse, S. Pusch, F. Sahm, B. Wiestler, J. Quandt, O. Menn, M. Osswald, I.
Oezen, M. Ott, M. Keil, J. Balss, K. Rauschenbach, A. K. Grabowska, I. Vogler, J. Diekmann,
153
N. Trautwein, S. B. Eichmuller, J. Okun, S. Stevanovic, A. B. Riemer, U. Sahin, M. A. Friese, P.
Beckhove, A. von Deimling, W. Wick, and M. Platten. "A Vaccine Targeting Mutant Idh1
Induces Antitumour Immunity." Nature 512, no. 7514 (2014): 324-7.
Schwartzentruber, J., A. Korshunov, X. Y. Liu, D. T. Jones, E. Pfaff, K. Jacob, D. Sturm, A. M.
Fontebasso, D. A. Quang, M. Tonjes, V. Hovestadt, S. Albrecht, M. Kool, A. Nantel, C.
Konermann, A. Lindroth, N. Jager, T. Rausch, M. Ryzhova, J. O. Korbel, T. Hielscher, P.
Hauser, M. Garami, A. Klekner, L. Bognar, M. Ebinger, M. U. Schuhmann, W. Scheurlen, A.
Pekrun, M. C. Fruhwald, W. Roggendorf, C. Kramm, M. Durken, J. Atkinson, P. Lepage, A.
Montpetit, M. Zakrzewska, K. Zakrzewski, P. P. Liberski, Z. Dong, P. Siegel, A. E. Kulozik, M.
Zapatka, A. Guha, D. Malkin, J. Felsberg, G. Reifenberger, A. von Deimling, K. Ichimura, V. P.
Collins, H. Witt, T. Milde, O. Witt, C. Zhang, P. Castelo-Branco, P. Lichter, D. Faury, U.
Tabori, C. Plass, J. Majewski, S. M. Pfister, and N. Jabado. "Driver Mutations in Histone H3.3
and Chromatin Remodelling Genes in Paediatric Glioblastoma." Nature 482, no. 7384 (2012):
226-31.
Sequerra, E. B., M. R. Costa, J. R. Menezes, and C. Hedin-Pereira. "Adult Neural Stem Cells:
Plastic or Restricted Neuronal Fates?" Development 140, no. 16 (2013): 3303-9.
Sherry, M. M., A. Reeves, J. K. Wu, and B. H. Cochran. "Stat3 Is Required for Proliferation and
Maintenance of Multipotency in Glioblastoma Stem Cells." Stem Cells 27, no. 10 (2009): 2383-
92.
Shimojo, H., T. Ohtsuka, and R. Kageyama. "Oscillations in Notch Signaling Regulate
Maintenance of Neural Progenitors." Neuron 58, no. 1 (2008): 52-64.
Shinojima, N., K. Tada, S. Shiraishi, T. Kamiryo, M. Kochi, H. Nakamura, K. Makino, H. Saya,
H. Hirano, J. Kuratsu, K. Oka, Y. Ishimaru, and Y. Ushio. "Prognostic Value of Epidermal
Growth Factor Receptor in Patients with Glioblastoma Multiforme." Cancer Res 63, no. 20
(2003): 6962-70.
Sidaway, P. "Cns Cancer: Glioblastoma Subtypes Revisited." Nat Rev Clin Oncol 14, no. 10
(2017): 587.
154
Simon, M., I. Hosen, K. Gousias, S. Rachakonda, B. Heidenreich, M. Gessi, J. Schramm, K.
Hemminki, A. Waha, and R. Kumar. "Tert Promoter Mutations: A Novel Independent Prognostic
Factor in Primary Glioblastomas." Neuro Oncol 17, no. 1 (2015): 45-52.
Singh, S. K., C. Hawkins, I. D. Clarke, J. A. Squire, J. Bayani, T. Hide, R. M. Henkelman, M. D.
Cusimano, and P. B. Dirks. "Identification of Human Brain Tumour Initiating Cells." Nature
432, no. 7015 (2004): 396-401.
Smith, J. S., X. Y. Wang, J. Qian, S. M. Hosek, B. W. Scheithauer, R. B. Jenkins, and C. D.
James. "Amplification of the Platelet-Derived Growth Factor Receptor-a (Pdgfra) Gene Occurs
in Oligodendrogliomas with Grade Iv Anaplastic Features." J Neuropathol Exp Neurol 59, no. 6
(2000): 495-503.
Snuderl, M., L. Fazlollahi, L. P. Le, M. Nitta, B. H. Zhelyazkova, C. J. Davidson, S.
Akhavanfard, D. P. Cahill, K. D. Aldape, R. A. Betensky, D. N. Louis, and A. J. Iafrate. "Mosaic
Amplification of Multiple Receptor Tyrosine Kinase Genes in Glioblastoma." Cancer Cell 20,
no. 6 (2011): 810-7.
Son, M. J., K. Woolard, D. H. Nam, J. Lee, and H. A. Fine. "Ssea-1 Is an Enrichment Marker for
Tumor-Initiating Cells in Human Glioblastoma." Cell Stem Cell 4, no. 5 (2009): 440-52.
Sonenberg, N., and A. Pause. "Signal Transduction. Protein Synthesis and Oncogenesis Meet
Again." Science 314, no. 5798 (2006): 428-9.
Sottoriva, A., I. Spiteri, S. G. Piccirillo, A. Touloumis, V. P. Collins, J. C. Marioni, C. Curtis, C.
Watts, and S. Tavare. "Intratumor Heterogeneity in Human Glioblastoma Reflects Cancer
Evolutionary Dynamics." Proc Natl Acad Sci U S A 110, no. 10 (2013): 4009-14.
Srivastava, A., A. Jain, P. Jha, V. Suri, M. C. Sharma, S. Mallick, T. Puri, D. K. Gupta, A.
Gupta, and C. Sarkar. "Mgmt Gene Promoter Methylation in Pediatric Glioblastomas." Childs
Nerv Syst 26, no. 11 (2010): 1613-8.
Stommel, J. M., A. C. Kimmelman, H. Ying, R. Nabioullin, A. H. Ponugoti, R. Wiedemeyer, A.
H. Stegh, J. E. Bradner, K. L. Ligon, C. Brennan, L. Chin, and R. A. DePinho. "Coactivation of
155
Receptor Tyrosine Kinases Affects the Response of Tumor Cells to Targeted Therapies." Science
318, no. 5848 (2007): 287-90.
Stupp, R., M. E. Hegi, W. P. Mason, M. J. van den Bent, M. J. Taphoorn, R. C. Janzer, S. K.
Ludwin, A. Allgeier, B. Fisher, K. Belanger, P. Hau, A. A. Brandes, J. Gijtenbeek, C. Marosi, C.
J. Vecht, K. Mokhtari, P. Wesseling, S. Villa, E. Eisenhauer, T. Gorlia, M. Weller, D. Lacombe,
J. G. Cairncross, and R. O. Mirimanoff. "Effects of Radiotherapy with Concomitant and
Adjuvant Temozolomide Versus Radiotherapy Alone on Survival in Glioblastoma in a
Randomised Phase Iii Study: 5-Year Analysis of the Eortc-Ncic Trial." Lancet Oncol 10, no. 5
(2009): 459-66.
Stupp, R., W. P. Mason, M. J. van den Bent, M. Weller, B. Fisher, M. J. Taphoorn, K. Belanger,
A. A. Brandes, C. Marosi, U. Bogdahn, J. Curschmann, R. C. Janzer, S. K. Ludwin, T. Gorlia, A.
Allgeier, D. Lacombe, J. G. Cairncross, E. Eisenhauer, and R. O. Mirimanoff. "Radiotherapy
Plus Concomitant and Adjuvant Temozolomide for Glioblastoma." N Engl J Med 352, no. 10
(2005): 987-96.
Sturm, D., H. Witt, V. Hovestadt, D. A. Khuong-Quang, D. T. Jones, C. Konermann, E. Pfaff,
M. Tonjes, M. Sill, S. Bender, M. Kool, M. Zapatka, N. Becker, M. Zucknick, T. Hielscher, X.
Y. Liu, A. M. Fontebasso, M. Ryzhova, S. Albrecht, K. Jacob, M. Wolter, M. Ebinger, M. U.
Schuhmann, T. van Meter, M. C. Fruhwald, H. Hauch, A. Pekrun, B. Radlwimmer, T. Niehues,
G. von Komorowski, M. Durken, A. E. Kulozik, J. Madden, A. Donson, N. K. Foreman, R.
Drissi, M. Fouladi, W. Scheurlen, A. von Deimling, C. Monoranu, W. Roggendorf, C. Herold-
Mende, A. Unterberg, C. M. Kramm, J. Felsberg, C. Hartmann, B. Wiestler, W. Wick, T. Milde,
O. Witt, A. M. Lindroth, J. Schwartzentruber, D. Faury, A. Fleming, M. Zakrzewska, P. P.
Liberski, K. Zakrzewski, P. Hauser, M. Garami, A. Klekner, L. Bognar, S. Morrissy, F. Cavalli,
M. D. Taylor, P. van Sluis, J. Koster, R. Versteeg, R. Volckmann, T. Mikkelsen, K. Aldape, G.
Reifenberger, V. P. Collins, J. Majewski, A. Korshunov, P. Lichter, C. Plass, N. Jabado, and S.
M. Pfister. "Hotspot Mutations in H3f3a and Idh1 Define Distinct Epigenetic and Biological
Subgroups of Glioblastoma." Cancer Cell 22, no. 4 (2012): 425-37.
156
Sun, Y., W. Kong, A. Falk, J. Hu, L. Zhou, S. Pollard, and A. Smith. "Cd133 (Prominin)
Negative Human Neural Stem Cells Are Clonogenic and Tripotent." PLoS One 4, no. 5 (2009):
e5498.
Suva, M. L., E. Rheinbay, S. M. Gillespie, A. P. Patel, H. Wakimoto, S. D. Rabkin, N. Riggi, A.
S. Chi, D. P. Cahill, B. V. Nahed, W. T. Curry, R. L. Martuza, M. N. Rivera, N. Rossetti, S.
Kasif, S. Beik, S. Kadri, I. Tirosh, I. Wortman, A. K. Shalek, O. Rozenblatt-Rosen, A. Regev, D.
N. Louis, and B. E. Bernstein. "Reconstructing and Reprogramming the Tumor-Propagating
Potential of Glioblastoma Stem-Like Cells." Cell 157, no. 3 (2014): 580-94.
Szerlip, N. J., A. Pedraza, D. Chakravarty, M. Azim, J. McGuire, Y. Fang, T. Ozawa, E. C.
Holland, J. T. Huse, S. Jhanwar, M. A. Leversha, T. Mikkelsen, and C. W. Brennan.
"Intratumoral Heterogeneity of Receptor Tyrosine Kinases Egfr and Pdgfra Amplification in
Glioblastoma Defines Subpopulations with Distinct Growth Factor Response." Proc Natl Acad
Sci U S A 109, no. 8 (2012): 3041-6.
Tanaka, K., I. Babic, D. Nathanson, D. Akhavan, D. Guo, B. Gini, J. Dang, S. Zhu, H. Yang, J.
De Jesus, A. N. Amzajerdi, Y. Zhang, C. C. Dibble, H. Dan, A. Rinkenbaugh, W. H. Yong, H.
V. Vinters, J. F. Gera, W. K. Cavenee, T. F. Cloughesy, B. D. Manning, A. S. Baldwin, and P. S.
Mischel. "Oncogenic Egfr Signaling Activates an Mtorc2-Nf-Kappab Pathway That Promotes
Chemotherapy Resistance." Cancer Discov 1, no. 6 (2011): 524-38.
Thakkar, J. P., T. A. Dolecek, C. Horbinski, Q. T. Ostrom, D. D. Lightner, J. S. Barnholtz-Sloan,
and J. L. Villano. "Epidemiologic and Molecular Prognostic Review of Glioblastoma." Cancer
Epidemiol Biomarkers Prev 23, no. 10 (2014): 1985-96.
Tirosh, I., A. S. Venteicher, C. Hebert, L. E. Escalante, A. P. Patel, K. Yizhak, J. M. Fisher, C.
Rodman, C. Mount, M. G. Filbin, C. Neftel, N. Desai, J. Nyman, B. Izar, C. C. Luo, J. M.
Francis, A. A. Patel, M. L. Onozato, N. Riggi, K. J. Livak, D. Gennert, R. Satija, B. V. Nahed,
W. T. Curry, R. L. Martuza, R. Mylvaganam, A. J. Iafrate, M. P. Frosch, T. R. Golub, M. N.
Rivera, G. Getz, O. Rozenblatt-Rosen, D. P. Cahill, M. Monje, B. E. Bernstein, D. N. Louis, A.
Regev, and M. L. Suva. "Single-Cell Rna-Seq Supports a Developmental Hierarchy in Human
Oligodendroglioma." Nature 539, no. 7628 (2016): 309-313.
157
Tso, C. L., W. A. Freije, A. Day, Z. Chen, B. Merriman, A. Perlina, Y. Lee, E. Q. Dia, K.
Yoshimoto, P. S. Mischel, L. M. Liau, T. F. Cloughesy, and S. F. Nelson. "Distinct Transcription
Profiles of Primary and Secondary Glioblastoma Subgroups." Cancer Res 66, no. 1 (2006): 159-
67.
Tsukamoto, A. S., R. Grosschedl, R. C. Guzman, T. Parslow, and H. E. Varmus. "Expression of
the Int-1 Gene in Transgenic Mice Is Associated with Mammary Gland Hyperplasia and
Adenocarcinomas in Male and Female Mice." Cell 55, no. 4 (1988): 619-25.
Tunici, P., L. Bissola, E. Lualdi, B. Pollo, L. Cajola, G. Broggi, G. Sozzi, and G. Finocchiaro.
"Genetic Alterations and in Vivo Tumorigenicity of Neurospheres Derived from an Adult
Glioblastoma." Mol Cancer 3, (2004): 25.
Turcan, S., D. Rohle, A. Goenka, L. A. Walsh, F. Fang, E. Yilmaz, C. Campos, A. W. Fabius, C.
Lu, P. S. Ward, C. B. Thompson, A. Kaufman, O. Guryanova, R. Levine, A. Heguy, A. Viale, L.
G. Morris, J. T. Huse, I. K. Mellinghoff, and T. A. Chan. "Idh1 Mutation Is Sufficient to
Establish the Glioma Hypermethylator Phenotype." Nature 483, no. 7390 (2012): 479-83.
Urist, M. R. "Bone Morphogenetic Protein: The Molecularization of Skeletal System
Development." J Bone Miner Res 12, no. 3 (1997): 343-6.
van den Bent, M. J., A. A. Brandes, R. Rampling, M. C. Kouwenhoven, J. M. Kros, A. F.
Carpentier, P. M. Clement, M. Frenay, M. Campone, J. F. Baurain, J. P. Armand, M. J.
Taphoorn, A. Tosoni, H. Kletzl, B. Klughammer, D. Lacombe, and T. Gorlia. "Randomized
Phase Ii Trial of Erlotinib Versus Temozolomide or Carmustine in Recurrent Glioblastoma:
Eortc Brain Tumor Group Study 26034." J Clin Oncol 27, no. 8 (2009): 1268-74.
van Meerbeeck, J. P., R. Gaafar, C. Manegold, R. J. Van Klaveren, E. A. Van Marck, M.
Vincent, C. Legrand, A. Bottomley, C. Debruyne, and G. Giaccone. "Randomized Phase Iii
Study of Cisplatin with or without Raltitrexed in Patients with Malignant Pleural Mesothelioma:
An Intergroup Study of the European Organisation for Research and Treatment of Cancer Lung
Cancer Group and the National Cancer Institute of Canada." J Clin Oncol 23, no. 28 (2005):
6881-9.
158
Vasconcelos, F. F., and D. S. Castro. "Transcriptional Control of Vertebrate Neurogenesis by the
Proneural Factor Ascl1." Front Cell Neurosci 8, (2014): 412.
Venere, M., H. A. Fine, P. B. Dirks, and J. N. Rich. "Cancer Stem Cells in Gliomas: Identifying
and Understanding the Apex Cell in Cancer's Hierarchy." Glia 59, no. 8 (2011): 1148-54.
Verhaak, R. G., K. A. Hoadley, E. Purdom, V. Wang, Y. Qi, M. D. Wilkerson, C. R. Miller, L.
Ding, T. Golub, J. P. Mesirov, G. Alexe, M. Lawrence, M. O'Kelly, P. Tamayo, B. A. Weir, S.
Gabriel, W. Winckler, S. Gupta, L. Jakkula, H. S. Feiler, J. G. Hodgson, C. D. James, J. N.
Sarkaria, C. Brennan, A. Kahn, P. T. Spellman, R. K. Wilson, T. P. Speed, J. W. Gray, M.
Meyerson, G. Getz, C. M. Perou, and D. N. Hayes. "Integrated Genomic Analysis Identifies
Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in Pdgfra, Idh1,
Egfr, and Nf1." Cancer Cell 17, no. 1 (2010): 98-110.
Vivanco, I., H. I. Robins, D. Rohle, C. Campos, C. Grommes, P. L. Nghiemphu, S. Kubek, B.
Oldrini, M. G. Chheda, N. Yannuzzi, H. Tao, S. Zhu, A. Iwanami, D. Kuga, J. Dang, A. Pedraza,
C. W. Brennan, A. Heguy, L. M. Liau, F. Lieberman, W. K. Yung, M. R. Gilbert, D. A. Reardon,
J. Drappatz, P. Y. Wen, K. R. Lamborn, S. M. Chang, M. D. Prados, H. A. Fine, S. Horvath, N.
Wu, A. B. Lassman, L. M. DeAngelis, W. H. Yong, J. G. Kuhn, P. S. Mischel, M. P. Mehta, T.
F. Cloughesy, and I. K. Mellinghoff. "Differential Sensitivity of Glioma- Versus Lung Cancer-
Specific Egfr Mutations to Egfr Kinase Inhibitors." Cancer Discov 2, no. 5 (2012): 458-71.
Vivanco, I., D. Rohle, M. Versele, A. Iwanami, D. Kuga, B. Oldrini, K. Tanaka, J. Dang, S.
Kubek, N. Palaskas, T. Hsueh, M. Evans, D. Mulholland, D. Wolle, S. Rajasekaran, A.
Rajasekaran, L. M. Liau, T. F. Cloughesy, I. Dikic, C. Brennan, H. Wu, P. S. Mischel, T. Perera,
and I. K. Mellinghoff. "The Phosphatase and Tensin Homolog Regulates Epidermal Growth
Factor Receptor (Egfr) Inhibitor Response by Targeting Egfr for Degradation." Proc Natl Acad
Sci U S A 107, no. 14 (2010): 6459-64.
Volak, A., S. G. LeRoy, J. S. Natasan, D. J. Park, P. S. Cheah, A. Maus, Z. Fitzpatrick, E. Hudry,
K. Pinkham, S. Gandhi, B. T. Hyman, D. Mu, D. GuhaSarkar, A. O. Stemmer-Rachamimov, M.
Sena-Esteves, C. E. Badr, and C. A. Maguire. "Virus Vector-Mediated Genetic Modification of
Brain Tumor Stromal Cells after Intravenous Delivery." J Neurooncol, (2018).
159
Wang, H., T. Xu, Y. Jiang, H. Xu, Y. Yan, D. Fu, and J. Chen. "The Challenges and the Promise
of Molecular Targeted Therapy in Malignant Gliomas." Neoplasia 17, no. 3 (2015): 239-55.
Wang, J., H. Wang, Z. Li, Q. Wu, J. D. Lathia, R. E. McLendon, A. B. Hjelmeland, and J. N.
Rich. "C-MYC Is Required for Maintenance of Glioma Cancer Stem Cells." PLoS One 3, no. 11
(2008): e3769.
Wang, M. Y., K. V. Lu, S. Zhu, E. Q. Dia, I. Vivanco, G. M. Shackleford, W. K. Cavenee, I. K.
Mellinghoff, T. F. Cloughesy, C. L. Sawyers, and P. S. Mischel. "Mammalian Target of
RapaMYCin Inhibition Promotes Response to Epidermal Growth Factor Receptor Kinase
Inhibitors in Pten-Deficient and Pten-Intact Glioblastoma Cells." Cancer Res 66, no. 16 (2006):
7864-9.
Wang, Q., B. Hu, X. Hu, H. Kim, M. Squatrito, L. Scarpace, A. C. deCarvalho, S. Lyu, P. Li, Y.
Li, F. Barthel, H. J. Cho, Y. H. Lin, N. Satani, E. Martinez-Ledesma, S. Zheng, E. Chang, C. G.
Sauve, A. Olar, Z. D. Lan, G. Finocchiaro, J. J. Phillips, M. S. Berger, K. R. Gabrusiewicz, G.
Wang, E. Eskilsson, J. Hu, T. Mikkelsen, R. A. DePinho, F. Muller, A. B. Heimberger, E. P.
Sulman, D. H. Nam, and R. G. W. Verhaak. "Tumor Evolution of Glioma-Intrinsic Gene
Expression Subtypes Associates with Immunological Changes in the Microenvironment." Cancer
Cell 32, no. 1 (2017): 42-56 e6.
Wang, R. N., J. Green, Z. Wang, Y. Deng, M. Qiao, M. Peabody, Q. Zhang, J. Ye, Z. Yan, S.
Denduluri, O. Idowu, M. Li, C. Shen, A. Hu, R. C. Haydon, R. Kang, J. Mok, M. J. Lee, H. L.
Luu, and L. L. Shi. "Bone Morphogenetic Protein (Bmp) Signaling in Development and Human
Diseases." Genes Dis 1, no. 1 (2014): 87-105.
Wang, S. C., and M. C. Hung. "Nuclear Translocation of the Epidermal Growth Factor Receptor
Family Membrane Tyrosine Kinase Receptors." Clin Cancer Res 15, no. 21 (2009): 6484-9.
Wang, Y., D. Huso, H. Cahill, D. Ryugo, and J. Nathans. "Progressive Cerebellar, Auditory, and
Esophageal Dysfunction Caused by Targeted Disruption of the Frizzled-4 Gene." J Neurosci 21,
no. 13 (2001): 4761-71.
160
Ward, P. S., J. Patel, D. R. Wise, O. Abdel-Wahab, B. D. Bennett, H. A. Coller, J. R. Cross, V.
R. Fantin, C. V. Hedvat, A. E. Perl, J. D. Rabinowitz, M. Carroll, S. M. Su, K. A. Sharp, R. L.
Levine, and C. B. Thompson. "The Common Feature of Leukemia-Associated Idh1 and Idh2
Mutations Is a Neomorphic Enzyme Activity Converting Alpha-Ketoglutarate to 2-
Hydroxyglutarate." Cancer Cell 17, no. 3 (2010): 225-34.
Watanabe, T., A. Vital, S. Nobusawa, P. Kleihues, and H. Ohgaki. "Selective Acquisition of Idh1
R132c Mutations in Astrocytomas Associated with Li-Fraumeni Syndrome." Acta Neuropathol
117, no. 6 (2009): 653-6.
Weber, R. G., M. Sabel, J. Reifenberger, C. Sommer, J. Oberstrass, G. Reifenberger, M.
Kiessling, and T. Cremer. "Characterization of Genomic Alterations Associated with Glioma
Progression by Comparative Genomic Hybridization." Oncogene 13, no. 5 (1996): 983-94.
Weller, M., J. Felsberg, C. Hartmann, H. Berger, J. P. Steinbach, J. Schramm, M. Westphal, G.
Schackert, M. Simon, J. C. Tonn, O. Heese, D. Krex, G. Nikkhah, T. Pietsch, O. Wiestler, G.
Reifenberger, A. von Deimling, and M. Loeffler. "Molecular Predictors of Progression-Free and
Overall Survival in Patients with Newly Diagnosed Glioblastoma: A Prospective Translational
Study of the German Glioma Network." J Clin Oncol 27, no. 34 (2009): 5743-50.
Weller, M., W. Wick, K. Aldape, M. Brada, M. Berger, S. M. Pfister, R. Nishikawa, M.
Rosenthal, P. Y. Wen, R. Stupp, and G. Reifenberger. "Glioma." Nat Rev Dis Primers 1, (2015):
15017.
Wen, P. Y., S. M. Chang, K. R. Lamborn, J. G. Kuhn, A. D. Norden, T. F. Cloughesy, H. I.
Robins, F. S. Lieberman, M. R. Gilbert, M. P. Mehta, J. Drappatz, M. D. Groves, S. Santagata,
A. H. Ligon, W. K. Yung, J. J. Wright, J. Dancey, K. D. Aldape, M. D. Prados, and K. L. Ligon.
"Phase I/Ii Study of Erlotinib and Temsirolimus for Patients with Recurrent Malignant Gliomas:
North American Brain Tumor Consortium Trial 04-02." Neuro Oncol 16, no. 4 (2014): 567-78.
Wend, P., J. D. Holland, U. Ziebold, and W. Birchmeier. "Wnt Signaling in Stem and Cancer
Stem Cells." Semin Cell Dev Biol 21, no. 8 (2010): 855-63.
161
Wick, W., C. Meisner, B. Hentschel, M. Platten, A. Schilling, B. Wiestler, M. C. Sabel, S.
Koeppen, R. Ketter, M. Weiler, G. Tabatabai, A. von Deimling, D. Gramatzki, M. Westphal, G.
Schackert, M. Loeffler, M. Simon, G. Reifenberger, and M. Weller. "Prognostic or Predictive
Value of Mgmt Promoter Methylation in Gliomas Depends on Idh1 Mutation." Neurology 81,
no. 17 (2013): 1515-22.
Wick, W., M. Platten, C. Meisner, J. Felsberg, G. Tabatabai, M. Simon, G. Nikkhah, K.
Papsdorf, J. P. Steinbach, M. Sabel, S. E. Combs, J. Vesper, C. Braun, J. Meixensberger, R.
Ketter, R. Mayer-Steinacker, G. Reifenberger, and M. Weller. "Temozolomide Chemotherapy
Alone Versus Radiotherapy Alone for Malignant Astrocytoma in the Elderly: The Noa-08
Randomised, Phase 3 Trial." Lancet Oncol 13, no. 7 (2012): 707-15.
Wilkinson, G., D. Dennis, and C. Schuurmans. "Proneural Genes in Neocortical Development."
Neuroscience 253, (2013): 256-73.
Willert, K., and R. Nusse. "Wnt Proteins." Cold Spring Harb Perspect Biol 4, no. 9 (2012):
a007864.
Wilson, T. A., M. A. Karajannis, and D. H. Harter. "Glioblastoma Multiforme: State of the Art
and Future Therapeutics." Surg Neurol Int 5, (2014): 64.
Woolard, K., and H. A. Fine. "Glioma Stem Cells: Better Flat Than Round." Cell Stem Cell 4,
no. 6 (2009): 466-7.
Wu, M., J. Guan, C. Li, S. Gunter, L. Nusrat, S. Ng, K. Dhand, C. Morshead, A. Kim, and S.
Das. "Aberrantly Activated Cox-2 and Wnt Signaling Interact to Maintain Cancer Stem Cells in
Glioblastoma." Oncotarget 8, no. 47 (2017): 82217-82230.
Wu, Q., and J. Yao. "Bmp4, a New Prognostic Factor for Glioma." World J Surg Oncol 11,
(2013): 264.
Xu, Q., Y. Wang, A. Dabdoub, P. M. Smallwood, J. Williams, C. Woods, M. W. Kelley, L.
Jiang, W. Tasman, K. Zhang, and J. Nathans. "Vascular Development in the Retina and Inner
162
Ear: Control by Norrin and Frizzled-4, a High-Affinity Ligand-Receptor Pair." Cell 116, no. 6
(2004): 883-95.
Xu, S., F. Cheng, J. Liang, W. Wu, and J. Zhang. "Maternal Xnorrin, a Canonical Wnt Signaling
Agonist and Tgf-Beta Antagonist, Controls Early Neuroectoderm Specification in Xenopus."
PLoS Biol 10, no. 3 (2012): e1001286.
Yan, H., D. W. Parsons, G. Jin, R. McLendon, B. A. Rasheed, W. Yuan, I. Kos, I. Batinic-
Haberle, S. Jones, G. J. Riggins, H. Friedman, A. Friedman, D. Reardon, J. Herndon, K. W.
Kinzler, V. E. Velculescu, B. Vogelstein, and D. D. Bigner. "Idh1 and Idh2 Mutations in
Gliomas." N Engl J Med 360, no. 8 (2009): 765-73.
Yan, K., Q. Wu, D. H. Yan, C. H. Lee, N. Rahim, I. Tritschler, J. DeVecchio, M. F. Kalady, A.
B. Hjelmeland, and J. N. Rich. "Glioma Cancer Stem Cells Secrete Gremlin1 to Promote Their
Maintenance within the Tumor Hierarchy." Genes Dev 28, no. 10 (2014): 1085-100.
Yang, H. W., L. G. Menon, P. M. Black, R. S. Carroll, and M. D. Johnson. "Snai2/Slug Promotes
Growth and Invasion in Human Gliomas." BMC Cancer 10, (2010): 301.
Ye, X., P. Smallwood, and J. Nathans. "Expression of the Norrie Disease Gene (Ndp) in
Developing and Adult Mouse Eye, Ear, and Brain." Gene Expr Patterns 11, no. 1-2 (2011): 151-
5.
Ye, X., Y. Wang, H. Cahill, M. Yu, T. C. Badea, P. M. Smallwood, N. S. Peachey, and J.
Nathans. "Norrin, Frizzled-4, and Lrp5 Signaling in Endothelial Cells Controls a Genetic
Program for Retinal Vascularization." Cell 139, no. 2 (2009): 285-98.
Ye, X., Y. Wang, and J. Nathans. "The Norrin/Frizzled4 Signaling Pathway in Retinal Vascular
Development and Disease." Trends Mol Med 16, no. 9 (2010): 417-25.
Yecies, J. L., and B. D. Manning. "Mtor Links Oncogenic Signaling to Tumor Cell Metabolism."
J Mol Med (Berl) 89, no. 3 (2011): 221-8.
Yoon, C., H. Song, T. Yin, D. Bausch-Fluck, A. P. Frei, S. Kattman, N. Dubois, A. D. Witty, J.
A. Hewel, H. Guo, A. Emili, B. Wollscheid, G. Keller, and P. W. Zandstra. "Fzd4 Marks Lateral
163
Plate Mesoderm and Signals with Norrin to Increase Cardiomyocyte Induction from Pluripotent
Stem Cell-Derived Cardiac Progenitors." Stem Cell Reports 10, no. 1 (2018): 87-100.
Young, R. M., A. Jamshidi, G. Davis, and J. H. Sherman. "Current Trends in the Surgical
Management and Treatment of Adult Glioblastoma." Ann Transl Med 3, no. 9 (2015): 121.
Zbinden, M., A. Duquet, A. Lorente-Trigos, S. N. Ngwabyt, I. Borges, and A. Ruiz i Altaba.
"Nanog Regulates Glioma Stem Cells and Is Essential in Vivo Acting in a Cross-Functional
Network with Gli1 and P53." EMBO J 29, no. 15 (2010): 2659-74.
Zhan, T., N. Rindtorff, and M. Boutros. "Wnt Signaling in Cancer." Oncogene 36, no. 11 (2017):
1461-1473.
Zhang, C., M. B. Lai, L. Khandan, L. A. Lee, Z. Chen, and H. J. Junge. "Norrin-Induced
Frizzled4 Endocytosis and Endo-Lysosomal Trafficking Control Retinal Angiogenesis and
Barrier Function." Nat Commun 8, (2017): 16050.
Zhang, C. L., T. Huang, B. L. Wu, W. X. He, and D. Liu. "Stem Cells in Cancer Therapy:
Opportunities and Challenges." Oncotarget 8, no. 43 (2017): 75756-75766.
Zhang, J., and L. Li. "Bmp Signaling and Stem Cell Regulation." Dev Biol 284, no. 1 (2005): 1-
11.
Zhang, N., P. Wei, A. Gong, W. T. Chiu, H. T. Lee, H. Colman, H. Huang, J. Xue, M. Liu, Y.
Wang, R. Sawaya, K. Xie, W. K. Yung, R. H. Medema, X. He, and S. Huang. "Foxm1 Promotes
Beta-Catenin Nuclear Localization and Controls Wnt Target-Gene Expression and Glioma
Tumorigenesis." Cancer Cell 20, no. 4 (2011): 427-42.
Zhang, N., X. Wu, L. Yang, F. Xiao, H. Zhang, A. Zhou, Z. Huang, and S. Huang. "Foxm1
Inhibition Sensitizes Resistant Glioblastoma Cells to Temozolomide by Downregulating the
Expression of DNA-Repair Gene Rad51." Clin Cancer Res 18, no. 21 (2012): 5961-71.
Zheng, H., H. Ying, R. Wiedemeyer, H. Yan, S. N. Quayle, E. V. Ivanova, J. H. Paik, H. Zhang,
Y. Xiao, S. R. Perry, J. Hu, A. Vinjamoori, B. Gan, E. Sahin, M. G. Chheda, C. Brennan, Y. A.
164
Wang, W. C. Hahn, L. Chin, and R. A. DePinho. "Plagl2 Regulates Wnt Signaling to Impede
Differentiation in Neural Stem Cells and Gliomas." Cancer Cell 17, no. 5 (2010): 497-509.
Zheng, H., H. Ying, H. Yan, A. C. Kimmelman, D. J. Hiller, A. J. Chen, S. R. Perry, G. Tonon,
G. C. Chu, Z. Ding, J. M. Stommel, K. L. Dunn, R. Wiedemeyer, M. J. You, C. Brennan, Y. A.
Wang, K. L. Ligon, W. H. Wong, L. Chin, and R. A. DePinho. "P53 and Pten Control Neural
and Glioma Stem/Progenitor Cell Renewal and Differentiation." Nature 455, no. 7216 (2008):
1129-33.
Zhou, Y., and J. Nathans. "Gpr124 Controls Cns Angiogenesis and Blood-Brain Barrier Integrity
by Promoting Ligand-Specific Canonical Wnt Signaling." Dev Cell 31, no. 2 (2014): 248-56.
Zhou, Y., Y. Wang, M. Tischfield, J. Williams, P. M. Smallwood, A. Rattner, M. M. Taketo, and
J. Nathans. "Canonical Wnt Signaling Components in Vascular Development and Barrier
Formation." J Clin Invest 124, no. 9 (2014): 3825-46.
165
Appendices
Abbreviations
AKT2 AKT Serine/Threonine Kinase 2
APC Adenomatous Polyposis Coli
ASCL1 Achaete-Scute Family BHLH Transcription Factor 1
ATP Adenosine Triphosphate
ATRX X-linked ATP-dependent helicase
BBB blood-brain barrier
bFGF basic Fibroblast Growth Factor
bHLH basic Helix-Loop-Helix
BMP Bone Morphogenetic Protein
BMPR Bone Morphogenetic Protein Receptor
BSA Bovine Serum Albumin
CCLE Cancer Cell Line Encyclopaedia
CDK Cyclin Dependent Kinase
CDKN2A Cyclin Dependent Kinase Inhibitor 2A
cDNA Complimentary-DNA
CIC Drosophila Homologue of Capicua
CKI Casein kinase 1
CSC Cancer Stem Cells
166
CT value Cycle Threshold value
DDL3 Delta-like 3
DNA Deoxyribonucleic Acid
DVL Dishevelled
EdU 5-ethynyl-2'-deoxyuridine
EGF Epidermal Growth Factor
EGFR Epidermal Growth Factor Receptor
ELDA Extreme Limited Dilution Assay
EMT Epithelial-Mesenchymal Transition
FACS Fluorescence-Activated Cell Sorting
FAT1 FAT Atypical Cadherin 1
FGF Fibroblast Growth Factor
FOXM1 Forkhead Box M1
FUBP1 Far Upstream Element-Binding Protein 1
FZD Frizzled
GAPDH Glyceraldehyde 3-Phosphate Dehydrogenase
GBM Glioblastoma
G-CIMP Glioma CpG Island Methylator Phenotype
GDC Genomic Data Commons
GFAP Glial Fibrillary Acidic Protein
167
GFP Green Fluorescence Protein
GNS Patient-derived glioblastoma stem cells
GSEA Gene Set Enrichment Analysis
GSK Glycogen Synthase Kinase
H3F3 H3 Histone Family Member 3A
HEK-293T Human Embryonic Kidney-293T cells
HES1 Hairy And Enhancer Of Split 1,
hNSCs human fetal Neural Stem Cells
hPRT2 hypoxanthine Phosphoribosyltransferase 2
ICC Immunocytochemistry
IDH Isocitrate dehydrogenase
IgG Immunoglobulin G
L1CAM L1 Cell Adhesion Molecule
LEF Lymphoid Enhancer Factor
LGG Lower Grade Glioma
LOH Loss of Heterozygosity
LRP Low-density lipoprotein receptor-related protein
MAL Myelin And Lymphocyte Protein
MAP2 Microtubule Associated Protein 2
MB Medulloblastoma
168
MBP Myelin Basic Protein
MDM-2 Mouse Double Minute 2 Homolog
MGMT O-6-Methylguanine-DNA Methyltransferase
mTOR Mammalian Target Of Rapamycin
MYC Avian Myelocytomatosis Viral Oncogene Homolog
NADPH Nicotinamide Adenine Dinucleotide Phosphate
NANOG Homeobox Transcription Factor Nanog
NDP Norrie Disease Pseudoglioma
NF1 Neurofibromin 1
NF-κB Nuclear Factor kappa-light-chain-enhancer of activated B cells
NSCs Neural Stem Cells
NSG mice NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ mice
O4 Oligodendrocyte Markers O4
Olig2 Oligodendrocyte Transcription Factor 2
PARP Poly [ADP-ribose] polymerase 1
PBS Phosphatase Buffered Saline
PDGFRA Platelet-Derived Growth Factor Receptor Alpha
PFA Paraformaldehyde
PI3K Phosphatidylinositol-4,5-bisphosphate 3-Kinase
PLAGL2 Pleiomorphic Adenoma Gene-Like 2
169
PLO Poly L-Ornithin
Ptch Patched gene
PTEN Phosphatase and Tensin Homolog
PVDF Polyvinylidene Fluoride membrane
qRT-PCR quantitative Real-Time Polymerase Chain Reaction
RIPA Radioimmunoprecipitation Assay buffer
RNA Ribonucleic Acid
ROS Reactive Oxygen Species
sFRPs soluble Frizzled-Related Proteins
Shh-MB Sonic hedgehog subtype of Medulloblastoma
SOX2 SRY-Box 2
STAT3 Signal Transducer and Activator of Transcription 3
TCF T-Cell Factor
TCGA The Cancer Genome Atlas
TERT Telomerase Reverse Transcriptase
TGF-β Transforming growth factor-beta
TMZ Temozolomide
TP53 Tumor Protein p53
TSPAN12 Tetraspanin 12
TU-J Tubulin Beta 3 Class III
170
TUNEL Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling assay
VEGF Vascular Endothelial Growth Factor
WB Western Blotting
WHO World Health Organization
YKL40 Chitinase 3 Like 1
α-KG α-Ketoglutarate
ΔΔCT Double Delta CT