THE ROLE OF IMMUNE EFFECTOR CELLS IN THE 4T1.2 MURINE ...
Transcript of THE ROLE OF IMMUNE EFFECTOR CELLS IN THE 4T1.2 MURINE ...
The Pennsylvania State University
The Graduate School
College of Health and Human Development
THE ROLE OF IMMUNE EFFECTOR CELLS IN THE 4T1.2
MURINE MAMMARY TUMOR MODEL
A Thesis in
Nutritional Sciences
by
Shizhao Duan
© 2018 Shizhao Duan
Submitted in Partial Fulfillment of the Requirements
for the Degree of
Master of Science
December 2018
ii
The thesis of Shizhao Duan was reviewed and approved* by the following:
Connie Rogers Associate Professor of Nutrition and Physiology Thesis Advisor Gregory Shearer Associate Professor of Nutritional Sciences Laura Murray-Kolb Associate Professor of Nutritional Sciences Professor-in-Charge of the Nutritional Sciences Graduate Program
*Signatures are on file in the Graduate School
iii
ABSTRACT
Breast cancer is the most commonly diagnosed cancer among women and
the second leading cause of cancer related death in the US (1). Despite recent
advances made in breast cancer research, triple negative breast cancer (TNBC)
remains the subtype with the poorest prognosis due to limited treatment options.
The 4T1 murine mammary metastatic model has been widely used as a model for
TNBC, because of the similarities in hormone receptor profile to human TNBC (2).
One caveat of the 4T1 model is that there are few known tumor associated
antigens which has limited the use of this model in preclinical immunotherapeutic
studies (3, 4). The firefly luciferase gene, luc2, has been transfected into various
tumor cell lines as a reporter gene for imaging studies. However, previous studies
demonstrate that the luciferase epitope can induce CD8+ cytotoxic T cell specific
responses, thus may be serving as a tumor antigen for immune recognition (5-7).
The goal of the current study was to explore the role of luciferase in 4T1.2 cells, a
clone that was selected for greater metastatic potential, and a model used to
evaluate nutrition and exercise interventions in our laboratory. Specifically, we
compared in vitro and in vivo growth rates, the role of immune components in tumor
growth, metastatic progression and survival rate in the parental 4T1.2 and
luciferase transfected 4T1.2 clone (4T1.2luc).
The goal of the first study was to determine if luciferase expression by the
4T1.2luc cell line altered the in vitro proliferative capacity compared to the parental
4T1.2 cell line. We cultured both 4T1.2 and 4T1.2luc mammary tumor cell lines
iv
(2,500 cells/well in serial dilution) in triplicate for 72 hours, and assessed in vitro
proliferation using the MTS assay. The proliferation rate of 4T1.2luc cell line did not
differ significantly from 4T1.2 cell line, which indicated luciferase expressed by the
4T1.2luc cell line is not actively involved in signaling cascades mediating cell
proliferation.
In the second study, we examined in vivo growth rates of 4T1.2 and 4T1.2luc
cells in immunocompetent BALB/c mice. We demonstrated that 4T1.2luc tumor-
bearing mice had a significantly reduced primary tumor growth compared to 4T1.2
tumor-bearing mice. Next, we wanted to determine which immune subtype was
responsible for the delayed tumor growth observed in 4T1.2luc tumor-bearing mice,
and if any of these immune population were important in controlling metastatic
progression or survival. To this end, we depleted the major effector immune cell
populations, CD4+ T cells, CD8+ T cells and NK cells, in both 4T1.2 and 4T1.2luc
tumor-bearing animals. We observed that CD4+ T cell, CD8+ T cell and NK cell
depletion did not affect primary tumor growth in 4T1.2 tumor-bearing mice.
However, CD8+ T cell depletion increased primary tumor growth and NK cell
depletion decreased primary tumor growth in 4T1.2luc tumor-bearing mice.
Metastatic burden in the lung and femur was not significantly different among
isotype control, CD4+ T cell-depleted and CD8+ T cell-depleted, and NK cell-
depleted 4T1.2luc tumor-bearing mice.
The final aim of this study was to determine the role of CD4+ T cells, CD8+
T cells and NK cells in the survival of 4T1.2 and 4T1.2luc tumor-bearing mice. We
v
observed that 4T1.2luc tumor-bearing mice treated with PBS or the isotype control
antibody (LTF-2) had a significantly longer median survival than PBS or isotype
control antibody-treated 4T1.2 tumor-bearing mice. In 4T1.2 tumor-bearing mice,
CD4+ T cell, CD8+ T cell and NK cell depletion did not alter median survival.
However, CD4+ T cell, CD8+ T cell depletion reduced median survival in 4T1.2luc
tumor-bearing mice in comparison to control groups.
In conclusion, luciferase expression in the 4T1.2luc cell line did not alter the
in vitro proliferation rate but potentially served as an antigen for immune cell
recognition. In 4T1.2luc tumor-bearing mice, CD8+ T cells are important in
controlling primary tumor growth. Depletion of CD4+ T cells, CD8+ T cells and NK
cells did not significantly affect lung and femur metastatic burden. However, both
CD4+ T cell and CD8+ T cell populations are important for survival. In contrast, the
absence of CD4+ T cells, CD8+ T cells or NK cells did not significantly influence
primary tumor growth or survival in 4T1.2 model. Results from the current study
provide important information about the interaction between host immune
components and 4T1.2 and 4T1.2luc tumor cells.
vi
TABLE OF CONTENTS
LIST OF FIGURES...............................................................................................8
LIST OF ABBREVIATIONS.................................................................................9
ACKNOWLEDGEMENTS..................................................................................12
CHAPTER 1: LITERATURE REVIEW...............................................................13
1.1. Breast Cancer............................................................................................13 1.1.1. Overview of Mammary Gland........................................................13 1.1.2. Breast Cancer...............................................................................14
1.1.2.1. Overview...........................................................................14 1.1.2.2. Grade and Stage...............................................................15 1.1.2.3. Risk Factors......................................................................16 1.1.2.4. Current Treatment Strategies............................................18
1.1.2.4.1. Overview.......................................................................18 1.1.2.4.2. Surgical Resection........................................................18 1.1.2.4.3. Chemotherapy...............................................................19 1.1.2.4.4. Targeted Therapy..........................................................19 1.1.2.4.5. Immunotherapy..............................................................20
1.2. Immune System........................................................................................22 1.2.1. Overview........................................................................................22 1.2.2. Innate and adaptive immunity........................................................23
1.2.2.1. Innate Immunity...................................................................23 1.2.2.1.1. Overview........................................................................23 1.2.2.1.2. Innate Immunity Components........................................24
1.2.2.2. Adaptive Immunity...............................................................27 1.2.2.2.1. Overview........................................................................27 1.2.2.2.2. B Lymphocytes and Humoral Immunity.........................27 1.2.2.2.3. T Lymphocytes and Cellular Immunity...........................28
1.2.3. Immune Response to Malignancy…..............................................30 1.3. Animal Models of Breast Cancer..............................................................32
1.3.1. Overview........................................................................................32 1.3.2. 4T1 Breast Cancer Model Series...................................................34
1.4. Rationale of Current Study........................................................................37
CHAPTER 2: AIMS AND HYPOTHESES...........................................................38
2.1. Aim 1.........................................................................................................38
2.2. Aim 2.........................................................................................................39
2.3. Aim 3.........................................................................................................39
CHAPTER 3: MATERIAL AND METHODS.........................................................40
vii
3.1. Experimental Design.................................................................................40 3.2. Materials and Methods..............................................................................42
3.2.1. Cell Lines and Cell Culture..............................................................42 3.2.2. In vitro Cell Proliferation Assay.......................................................42 3.2.3. Animal Models and Tumor Implantation..........................................43 3.2.4. In vivo Immune Cell Depletion.........................................................43 3.2.5. Flow Cytometric Analyses...............................................................44 3.2.6. Metastatic Burden Quantification....................................................45
3.3. Statistical Analyses...................................................................................45
CHAPTER 4: RESULTS......................................................................................47
4.1. In Vitro Proliferation...................................................................................47 4.2. Depletion of Immune Cell Populations.......................................................49 4.3. Primary Tumor Growth..............................................................................51 4.4. Metastatic Burden Quantification...............................................................57 4.5. Survival Analyses......................................................................................59
CHAPTER 5: DISCUSSION.................................................................................64
CHAPTER 6: CONCLUSION AND FUTURE DIRECTIONS................................69
REFERENCES....................................................................................................70
viii
LIST OF FIGURES
Figure 3.1. Experimental design.............................................................
Figure 4.1. In vitro proliferation of 4T1.2 and 4T1.2luc cell lines............................
Figure 4.2. In vivo proliferation of 4T1.2 and 4T1.2luc cell lines............................
Figure 4.3. Splenic immune cell populations depletion in control and antibody
depleted mice........................................................................................
Figure 4.4. Tumor growth of individual mice in each treatment group by tumor
cell types..............................................................................................
Figure 4.5. Primary tumor growth in immunocompetent and immune cell
depleted 4T1.2 and 4T1.2luc tumor bearing mice.................................
Figure 4.6. Primary tumor growth of immune cell depleted groups compared to
control group of 4T1.2 and 4T1.2luc tumor bearing mice................................
Figure 4.7. Primary tumor growth comparison between 4T1.2 and 4T1.2luc tumor
bearing mice receiving the same treatment.................................
Figure 4.8. Lung and femur metastatic burden comparison of 4T1.2luc tumor
bearing mice treatment groups.................................
Figure 4.9. Survival curves in 4T1.2 tumor-bearing mice.................................
Figure 4.10. Survival curves in 4T1.2luc tumor-bearing mice.............................
Figure 4.11. Survival comparison between 4T1.2 and 4T1.2luc tumor-bearing
mice receiving the same treatment.............................................................
ix
LIST OF ABBREVIATIONS
2.43 Anti-mouse CD8α monoclonal antibody
4T1 Murine metastatic breast cancer model
ANOVA Analysis of variance
Asialo GM1 Anti Asialo ganglio-N-tetraosylceramide polyclonal antibody
APC Antigen-presenting cell
BCR B cell receptor
BRCA Breast cancer susceptibility gene
CD Cluster of differentiation
CLP Common lymphoid progenitor
CTLA-4 Cytotoxic T-lymphocyte-associated protein 4
DC Dendritic cell
DNA Deoxyribonucleic acid
ER Estrogen receptor
FBS Fetal bovine serum
FoxP3 Forkhead box O3
GK1.5 Anti-mouse CD4 monoclonal antibody
GM-CSF Granulocyte-macrophage colony-stimulating factor
HER2 Human epidermal growth factor 2
HSC Hematopoietic stem cell
HR Hormone receptor
IFN Interferon
IDO Indoleamine 2,3-dioxygenase
IGF Insulin-like growth factor
IgG Immunoglobulin G, isotype control
IL Interleukin
LTF-2 Rat IgG2b Isotype Control
MDSC Myeloid-derived suppressor cell
x
MHC Major histocompatibility complex
MMP Matrix metalloprotenase
MMTV Murine mammary tumor virus
NK Natural killer cell
NKG2D Natural-killer group 2, member D
NLR Nod-like receptor
ORR Objective response rate
PAMP Pathogen-associated molecular pattern
PBS Phosphate-buffered saline
PCR Polymerase chain reaction
PD-1 Programmed cell death protein-1
PD-L1 Programmed death-ligand 1
PFS Progression-free survival
PGE Prostaglandin E
PR Progesterone receptor
PRR Pathogen recognition receptor
PTHrp Parathyroid hormone-related protein
RLR RIG-like receptor
ROS Reactive oxygen species
SHBG Sex hormone binding globulin
TAA Tumor-associated antigens
TAM Tumor-associated macrophage
TCR T cell receptor
TERT Telomerase reverse transcriptase
TGF-β Transforming growth factor beta
TH Helper T cell
TIL Tumor infiltrating lymphocyte
TLR Toll-like receptor
TME Tumor microenvironment
xi
TNBC Triple-negative breast cancer
TNF Tumor necrosis factor alpha
Treg Regulatory T cell (CD4+CD25+FoxP3+ TH cells)
VEGF Vascular endothelial growth factor
xii
ACKNOWLEDGEMENT
First of all, I would like to thank my advisor Dr. Rogers. It would be
impossible for me to be where I am right now without her guidance, mentorship,
and support during the darkest time of my life. She helped me develop the
confidence to conduct my own research and to seek out my own answers. She
taught me not to get hung up on negative results
I would like to acknowledge my other committee members, Dr. Laura
Murray-Kolb and Dr. Gregory Shearer. I want to thank them for committing their
time and expertise to helping me complete my degree. Their guidance and advice
were valuable in completing my research and organizing my findings into a
coherent story.
I would like to thank my lab mates Yitong Xu for her help with my project,
Bill Turbitt, Shawntawnee Collins and Donna Sosnoski for their guidance on
experimental techniques; Hannah VanEvery and Ester Oh for their emotionally
support. I am lucky to have you all.
I would like to thank my parents for their support both mentally and
physically during my most difficult time, I would not be here without their
unconditionally support. Finally, I would like to thank my wife Yalu Zhang, she
gave up everything coming to the States to take care of me, she made my difficult
days easier to get through, while I made her life harder. I can never repay her
sacrifice. This degree is dedicated to her.
1
CHAPTER 1
LITERATURE REVIEW
1.1. Breast Cancer
1.1.1. Overview of Mammary Glands
Mammary glands are composed of various types of cells including
epithelial cells, adipocytes, fibroblasts, vascular endothelial cells and immune
cells (8, 9). Histologically, mammary tissue contains epithelium and stroma.
Mammary epithelium is primarily composed of luminal, basal epithelium and a
small population of stem cells. The inner luminal layer of epithelium faces a
central apical cavity and is surrounded by outer basal myoepithelial cells (10, 11).
Morphologically, the mammary gland consists of 15 to 20 lobes, each lobe is
made up of milk production units called lobules that are built up by ductal and
alveolar luminal epithelial cells (12). Growth and development of the mammary
gland is a complex process that is tightly controlled by hormones and growth
factors, which induce cell differentiation and proliferation (13). For example,
postnatal development is regulated by growth hormone and insulin-like growth
factor-1 (IGF-1) and estrogen plays an important role in breast development
during puberty. After reaching adulthood, progesterone is responsible for
alvelogenesis that prepares the breast tissue for pregnancy and lactation (9).
Mammary gland epithelium undergoes dramatic morphogenetic changes over
2
the lifespan. Exposure to carcinogens or/and genetic predisposition can disrupt
intracellular signaling cascades that could trigger tumorigenesis (11).
1.1.2. Breast Cancer
1.1.2.1. Overview
Breast cancer is the most common diagnosed cancer among women in
the US and the second leading cause of cancer related death (1). It is estimated
266,120 new cases of breast cancer (15.3% of all new cancer cases) and 40,920
breast cancer deaths (6.7% of all cancer deaths) are to occur among US women
in 2018 (1, 14). Breast cancer, originates from the epithelial cells of the milk ducts,
is a heterogeneous disease in terms of histology, response to treatments,
metastatic patterns, prognosis and clinical outcome (15). Molecular subtypes of
breast cancer are primarily based on the expression of estrogen receptor (ER),
progesterone receptor (PR) and human epidermal growth factor 2 (HER2 also
known as ERBB2), which can provide important information in treatment
selection and prognosis (16-18). These subtypes include luminal A (ER+, PR+),
luminal B (ER+, PR+, HER+), HER2+ (ER-, PR-, HER2+) and Basal-like (Triple-
negative). Luminal A has the best prognosis mainly because this subtype is less
aggressive and more responsive to endocrine therapy, followed by luminal B
subtype (19-21). HER2+ subtype is negative in hormone receptors expression but
overexpresses human epidermal growth factor 2 (HER2+), which has been
3
exploited for targeted therapy development (21-23). Basal-like subtype is usually
considered a synonym of the triple-negative subtype (TNBC), and lack
expression of sex hormone receptors and HER2. Treatment options are limited
to conventional chemotherapy and radiation therapy and has the poorest
prognosis relative to other subtypes (21, 23, 24). TNBC subtype itself is a group
of heterogeneous tumors that can be, based on molecular expression profile,
further classified into basal-like, mesenchymal, luminal androgen receptor, and
immune-enriched subtypes. Subclassification of TNBC provides crucial
information that may be important in determining the most effective treatment and
in exploring new therapeutic targets (25).
1.1.2.2. Grade and Stage of Breast Cancer
Tumor grade is a pathological method of tumor classification which
indicates the tendency of tumor cells to grow and spread based on the
resemblance of tumor cells appearance compared to the tissue of origin (26). In
general, tissues obtained from biopsy or surgical resection are graded as G1
through G4, with G1 tumor cells being low grade and well differentiated meaning,
while G4 tumor cells being poorly differentiated or undifferentiated that are
morphologically abnormal (tubule formation, nuclear morphology, mitotic figures
etc.) and may lack normal tissue structure (26). The most widely used grading
system for breast cancer is Nottingham grading system (27, 28), which classifies
tumors into three grades namely, low (Grade I), intermediate (Grade II), high
4
(Grade III) based on differentiation or tubule formation, pleomorphism (shape and
size of tumor cells), hyperchromatic and mitotic nuclei (28).
1.1.2.3. Risk Factors
The etiology of breast cancer usually involves combinations of multiple
contributing factors (29, 30). Population based epidemiological studies have
identified a number of breast cancer risk factors including age, age at menarche
and menopause, age at first pregnancy, family history, lifestyle factors (diet,
weight, alcohol intake), smoking and hormone replacement therapy etc. (31, 32).
Breast cancer risk factors mentioned above can be classified into
nonmodifiable and modifiable (or life-style related) risk factors (29). The
nonmodifiable risk factors include age, sex, family and personal BC history, race
and ethnicity, genetic alterations, higher breast density, early menstruation or late
menopause and environmental exposures such as ionizing radiation (29, 33).
Among these factors, age is the most significant non-modifiable risk factor.
Female breast cancer is most frequently diagnosed in women aged from 55 to
64 years old with the median age of 61-years-old (14). Being female significantly
increases the risk of breast cancer as less than 1% of all breast cancer cases are
diagnosed in males (34). Family history, especially having a first-degree relative
(mother, sister or daughter) with breast cancer is associated with a two to three
fold increase in breast cancer risk (35).
5
Disparities of breast cancer occurrence among ethnic groups are
significant: i.e. African American women tend to develop more aggressive breast
cancer and poorer prognosis than Caucasian women. In contrast, Asian,
Hispanic, and Native American women have a lower risk of developing and dying
from breast cancer than African and Caucasian American women (33, 36).
The most common genetic alterations associated with breast cancer is an
inheritable mutation in the BRCA1 or BRCA2 genes which are involved in DNA
repair (33). Mutation of either is associated with increased breast cancer and
ovarian cancer risks (37, 38). Higher breast density, characterized by higher
percentage of fibroglandular tissue and less adipose tissue, is also associated
with higher breast cancer risk (39). Starting menstruation younger than age 12 or
going through menopause older than 55 increase risk of breast cancer later in life
possibly due to increased exposure to ovarian hormones (40, 41).
Modifiable risk factors include diets, alcohol consumption, overweight or
obesity, physical inactivity, nulliparity, breast feeding, menopausal hormone
replace therapy (29, 33). Alcohol consumption, even at moderate level, is a risk
factor for multiple cancer types including breast cancer, and the association can
be extended to multiple ethnic groups (42, 43). An increase in BMI is associated
with postmenopausal breast cancer but does not increase breast cancer risk in
premenopausal women (33, 44), which can be partially explained by obesity
induced insulin resistance. Hyperinsulinemia followed by obesity decreases
circulating insulin-like growth factor binding proteins (IGFBPs) and sex hormone
6
binding globulin (SHBG), which in turn, increase the availability of insulin-like
growth factor (IGF) and estrogen in blood circulation. These hormones together
with increased circulating insulin, significantly promote cell proliferation which
might lead to mutation of breast epithelial cells into malignancy (33, 45, 46).
Obesity induced low-grade chronic inflammation is associated with increased
proinflammatory cytokines, enhanced aromatase expression and hormone
receptors expression which also contribute to the development of breast cancer
(47). Physical inactivity together with increased BMI elevate breast cancer risk by
negatively affecting energy balance in terms of energy intake and expenditure,
insulin sensitivity, circulating IGF and IGFBPs and steroid sex hormones (48, 49).
Reproductive factors such as early full-term pregnancy and breast feeding have
been associated with decreased breast cancer (33, 50).
1.1.2.4. Current Treatment Strategies
1.1.2.4.1 Overview
Multiple therapeutic options are available for breast cancer patients and
can be classified into local and systemic treatments. Surgery and radiation
therapy are considered local treatments while chemotherapy, hormone therapy,
targeted therapy and immunotherapy are classified as systemic treatments due
to their treatment agents being transported throughout the body via the
bloodstream.
7
1.1.2.4.2 Surgical Resection
Surgical approaches to remove breast cancer include breast-conserving
surgery (also known as lumpectomy) and mastectomy (51). Lumpectomy or
partial mastectomy is a surgical procedure that only the cancer and some
surrounding normal tissue are removed while mastectomy is a radical surgical
procedure in which the entire breast and sometimes other nearby tissues are
resected (51, 52). Clinical trials indicate that the combination of lumpectomy with
radiation therapy (using ionizing radiation to damage DNA of fast dividing cancer
cells) is associated with reduced recurrence and improved survival over
lumpectomy or mastectomy alone; therefore, lumpectomy with radiation is an
appropriate therapeutic strategy for early stage breast cancer patients (53, 54).
1.1.2.4.3 Chemotherapy
Chemotherapy is one of the systemic therapy strategies for breast cancer,
aiming to control the primary tumor growth and eliminate distant metastasized
microscopic tumors or single cancer cells circulating within the body. Based on
the mechanism of action and chemical structure, chemotherapy can be classified
into alkylating agents, antimetabolites, anti-microtubule, and topoisomerase
inhibitors (55-58). Despite the side effects and toxicity, chemotherapy remains a
standard systemic therapeutic strategy for triple-negative breast cancer (TNBC)
in neoadjuvant, adjuvant and metastatic settings (24, 59).
8
1.1.2.4.4 Targeted Therapy
With better understanding of the underlying breast cancer biology and
molecular subtypes of breast cancer, a great number of targeted therapeutic
agents have been developed in recent years (21, 60). Based on hormone
receptor expression (i.e. ER+, PR+) of breast cancer patients, hormone receptor
antagonists such as ER inhibitor tamoxifen and degrading agents such as
fulvestrant (by binding to the hormone receptor and causing the cell's normal
protein degradation processes) can be used to block sex hormones from binding
to their receptors (60). HER2+ subtypes are generally resistant to hormone-based
therapies despite the expression of hormone receptors (HR). HER2 blockers
such as monoclonal antibodies pertuzumab and trastuzumab (Herceptin) are
effective in HER2+ subtype patients, and combination strategies such as HER2
blocker with HR inhibitors significantly reduces the risk of progression (18, 61).
1.1.2.4.5 Immunotherapy
Breast cancer was originally considered non-immunogenic or less
inflamed than those cancer types with high somatic mutation rates such as lung
squamous carcinoma (62). However, after decades of research focused on the
role of the immune system in breast cancer development and progression, the
field of breast cancer immunotherapy has been expanding dramatically (63).
ER+ or luminal breast cancer subtypes are less immunogenic compared
to TNBC subtype. Some successful immunotherapeutic approaches on other
9
cancer types including checkpoint inhibitors, and adoptive T cell transfer are
being investigated pre-clinically (64).
HER2+ subtype is considered more immunogenic and has more tumor
infiltrating lymphocytes (TILs) compared to luminal subtypes (65) which led to the
investigation efficacy of several immunotherapeutic strategies on HER2+ breast
cancer, including immune checkpoint inhibitors. Immune checkpoints are
molecules expressed by immune cells that are crucial for self-tolerance which
prevent autoimmunity but can also limit immune cells from killing cancer cells.
Preclinical studies have shown that antibodies against immune checkpoint
(checkpoint inhibitors) such as anti-PD-1 can increase the effectiveness of anti-
HER2 therapy, which led to the initiation of several phase I and II trials (66, 67),
to evaluate the potential superiorities of checkpoint inhibitors and anti-HER2
monoclonal antibodies (mAbs) combinations versus single anti-HER2 antibody
treatment (65, 68).
Among subtypes of breast cancer, TNBC is considered most immunogenic
among all the breast cancer subtypes due to the significant amount of genetic
mutations and subsequent immunogenic protein products such as MAGE-A3 and
NY-ESO-1(69, 70). These neoantigens can be recognized by the immune system
as foreign invaders therefore more likely to attract greater number of antigen
specific lymphocytes (tumor-infiltrating lymphocytes or TILs) into tumor
microenvironment (TME) (65, 71). Efficacy of Immune checkpoint inhibitors in
breast cancer have been clinically investigated including monoclonal antibodies
10
(mAb) targeting Programmed Cell Death 1 (PD-1) or Programmed Cell Death
Ligand 1 (PD-L1) (72, 73), showing preliminary evidence of clinical activity and
acceptable safety profile; there is an ongoing phase III trial aimed to compare
overall survival (OS) and progression-free survival (PFS) between participants
receiving pembrolizumab and chemotherapy (74). In addition to single agent
immunotherapy, combination approaches of chemotherapy and checkpoint
inhibitors have also been extensively studied. Some chemotherapeutic drugs can
selectively inhibit the proliferation of regulatory T cells (Tregs) and myeloid-
derived suppressor cells (MDSCs) so that relieving the suppression of antigen
specific response against cancer cells. Moreover, by causing cancer cell death,
chemotherapy promotes the release of neoantigens that can be taken up and
presented by antigen presenting cells (APCs) and therefore increases antigen
specific CD8+ T cell infiltration and activation (75-77). Based on these findings,
several phase I and II clinical trials were conducted to evaluate the combination
of different chemotherapy drugs and PD-1 or PD-L1 inhibitors in metastatic TNBC
patients, preliminary results showed promising objective response rate (ORR)
and good tolerance, which paved the way for the ongoing phase III double-
blinded randomized controlled trials (78, 79).
11
1.2 Immune System
1.2.1. Overview
The immune system is a host defense system comprising various
specialized organs, tissues, cells, and proteins that protect against foreign
pathogenic agents and transformed self-cells (80). Specialized immune cells are
differentiated from bone-marrow-dwelling hematopoietic precursor cells, and the
differentiation processes are a tightly controlled intricate series of highly regulated
signaling events. The immune system is divided into two parts determined by the
rapidity and specificity of the reaction, namely innate and adaptive immune
systems (81).
1.2.2. Innate and Adaptive Immunity
1.2.2.1. Innate Immunity
1.2.2.1.1 Overview
Innate immunity is a primitive host defense mechanism and the first-line of
defense against foreign invaders. After breaching host’s anatomic barriers,
pathogens will encounter a series of antimicrobial enzymes and peptides that can
digest bacterial structural components such as cell wall and membrane and the
complement system will target pathogens that facilitate phagocytosis by cellular
components of innate immunity. Most of the cellular components of the innate
12
immune system are derived from the common myeloid progenitor cells, including
macrophages (mature form of monocytes), granulocytes (including neutrophils,
eosinophils, basophils and mast cells) and dendritic cells. Natural Killer cells (NK
cells) of lymphoid lineage are also part of innate immunity (82). These immune
cells recognize pathogens by various mechanisms including Fc receptors,
scavenger receptors and pathogen recognition receptors (PRRs). PRRs include
Toll-like receptors (TLRs), Nod-like receptors (NLRs), C type lectin receptors and
RIG-like receptors (RLRs). Microbes contain classes of molecules including
lipopolysaccharides, endotoxins, viral DNA and double-stranded RNA; these
molecules, called pathogen-associated molecular patterns (PAMPs), can be
recognized by innate immunity as foreign via their cell surface or cytoplasm PRRs
to trigger phagocytosis and subsequent inflammatory responses that are
characterized by proinflammatory cytokine and chemokine production (81, 83).
Besides eliminating pathogens at the sites of infection, professional antigen
presentation cells will migrate to lymphoid organs and present antigens to
activate adaptive immune cell populations including T cells and B cells will be
activated to carry out prolonged antigen-specific immune responses (81).
1.2.2.1.2 Innate Immunity Components
Macrophages, together with granulocytes and dendritic cells, comprises
phagocyte types of immune system and also play an important role in activating
adaptive immunity by presenting antigens (82). These cell populations can
recognize pathogens (bacteria, virus and transformed cells) and pathogen
13
components (LPS, viral DNA, and neoantigen etc.) via cell surface receptors
including PRRs, Fc receptors, C-type lectin receptors and scavenger receptors
and ingest pathogens via phagocytosis. Despite their similarities, macrophages
are usually the first defensive cell population that pathogens encounter after
breaching physical barrier. Upon recognition and phagocytosis, macrophages
are activated, pathogens are killed and degraded by lysozymes and reactive
oxygen species (ROS) contained in lysosomes. Pathogen components are
processed into small immunogenic molecules and conjugated with MHCII (major
histocompatibility complex II) to present on the cell surface. Simultaneously,
activated macrophages secrete pro-inflammatory cytokines and chemokines
such as IL-1β, IL-6, TNF-α and GM-CSF to initiate inflammatory response by
recruiting other immune cells to the site of infection for pathogen clearance (81,
82).
Granulocytes (include neutrophils, eosinophils, basophils and mast cells)
contain specialized granules that are either low in pH or holding reactive oxygen
species (ROS), lysozymes and antimicrobial peptides to kill microbes or initiate
allergic reactions (81). Neutrophils are the most abundant granulocytes in
circulation and the first to be recruited to the site of infection, primarily in response
to GM-CSF secreted by macrophages (81, 82). Besides the importance in killing
pathogens, neutrophils are also professional antigen presenting cells (APC) that
present antigens via MHCII in response to cytokines such as GM-CSF, IFN-γ,
TNF-α (84). Eosinophils and basophils are less abundant than neutrophils and
14
eosinophils mainly focus on battling parasitic infection while basophils and mast
cells are involved in allergic reactions (82).
Dendritic cells (DCs), of either lymphoid or myeloid lineage, are also
phagocytes, their functions are more focused on antigen presentation rather than
pathogen clearance (85, 86). A large number of dendritic cells migrate to infection
sites in response to the cytokines and chemokines secreted by macrophages and
other tissue residence immune cell types (81, 85). After encountering infectious
agents, dendritic cells recognize pathogens via various surface receptors
including opsonin receptors, Fc receptors, scavenger receptors and pattern
recognition receptors (PRRs) (86). After encountering pathogens, dendritic cells
mature into potent antigen presenting cells that are characterized by increased
expression of cell adhesion molecules such as E-selectin, ICAM-1 and VCAM-1
that facilitate dendritic cells’ migration to secondary lymphoid organs, expression
of antigen-conjugated MHC molecules and costimulatory ligands such as B7 that
are crucial to prime and activate naïve T cells (83, 85, 87).
Common lymphoid progenitor (CLP) derived Natural Killer cells (NKs) are
important first line innate effector cells against foreign or mutated cells (81). NK
cells are nonspecific effector cells that recognize pathogens and transformed
cells via multiple mechanisms including Fc receptor binding to antibody coated
cells and NK activating receptors such as natural-killer group 2, member D
(NKG2D) binding to NKG2D ligands (81, 88). Healthy body cells express major
histocompatibility complex I (MHCI) on their surface that can bind to inhibitory
15
receptors of NK cells thus prevent NK cells from attacking healthy tissue, while
transformed cells or pathogens that lack self MHCI can activate NK cell (88). The
pathogen-killing effects of NK cell are carried out by their cytoplasmic granules
that contain cytotoxic proteins such as granzyme and perforin (89). After binding
of activating receptors to target cells which lack MHCI expression, and in
response to macrophage derived cytokines such as IFNs and IL-12, NK cells
release cytotoxic proteins to induce apoptosis of the targets and secrete large
amount of IFN-γ to contain infection before adaptive immunity is activated (89-
91).
1.2.2.2. Adaptive Immunity
1.2.2.2.1 Overview
The adaptive immune system is composed of T and B lymphocytes and is
characterized by their ability to specifically respond to immunogenic proteins
expressed on pathogenic foreign microorganisms and transformed cells (63). The
pathogen recognition receptors of innate immunity undergo somatic
hypermutation that reshuffles the genetic coding of variable region of T cell
receptors (TCR) and B cell receptors (BCR), which enable them to recognize
specific antigenic molecules (92).
16
1.2.2.2.2 B Lymphocytes and Humoral Immunity
B cells are derived from common lymphoid progenitor cells (CLPs) that
can be traced back to hematopoietic stem cells (HSCs). In the bone marrow, in
response to various cytokine signals, CLPs give rise to pre-B cells which undergo
several developmental stages that involve specific transcription factors into
immature B cells and leave the bone marrow; Immature B cells will arrive in
spleen and proceed through transitional stages namely T1 and T2, then into
mature B cells in germinal center and migrate to lymphatic system. In this
process, heavy chain and light chain genes of pre-BCRs proceed through
somatic hypermutation and transcribe into antigen specific BCRs. Mature/naïve
B cells express IgM and IgD on their cell surface (81, 92, 93).
B cells are activated after encounter with antigen and become either
memory B cells or plasma cells, the activation processes are either T cell
dependent or independent (92). B cells can recognize antigen by the surface
BCRs and then internalize, process and present the antigen on MHCII that can
be recognized by T cells (T follicular helper cells) in secondary lymphoid organs,
T cells in turn produce cytokines that are essential for B cells maturation and
activation into memory or plasma cells (94). On the other hand, some molecules
can interact with BCRs without the assistance of T cells and elicit an activating
signal, with additional cytokines or other cells (such as DCs) in contact, B cells
can be activated into memory or plasma cells (95).
17
Antibodies produced by B cells are the key mediators of humoral immunity.
Antibodies can prevent pathogens such as viruses and intracellular bacteria from
entering host cells by binding to their surface molecules (96). Antibodies also
facilitate phagocytosis by coating pathogen surfaces (97). Last but not the least,
antibodies binding to pathogens can activate the complement system to enhance
phagocytes recognition via complement receptors (97).
1.2.2.2.3 T Lymphocytes and Cellular Immunity
T cells are also derived from CLPs from bone marrow but the maturation
process takes place in the thymus where individual T cells with specific binding
capacity are formed.
In order to be activated, mature yet naïve T cells need to interact with
antigenic molecules in the context of MHC molecules on APCs. There are two
types of MHC that T cell receptors bind: MHCI expressed on all nucleated cell
surfaces that presents endogenous such as viral or tumor antigens, and MHCII
on APCs that present exogenous antigen by endocytosis (92). Besides
interaction between TCRs and MHC/peptide complex, costimulatory molecules
such as CD28 (binds to CD80/CD86 (B7)) from APCs are also required to activate
T cells (81). Lastly, various cytokines can drive the differentiation of CD4+ T cells
into various subsets with distinct functions, including T helper 1 (TH1), T helper 2
(TH2), T helper 9 (TH9), T helper 17 (TH17), T helper 22 (TH22), follicular helper T
cells (TFH), and regulatory T cells (Tregs) (92).
18
The major functions of CD4+ helper T cells are regulating immune
responses via cytokine secretion, including B cell antibody class switching,
cytotoxic T cell activation, and phagocytes pathogen clearing activities (81, 92).
Activated CD8+ cytotoxic T cell population can eliminate bacteria or virus infected,
stressed, and tumor cells by recognizing antigens presented on MHC class I
molecules and inducing apoptosis via the release of cytotoxins, perforins, and
granzymes or through the expression of surface proteins such as Fas ligand (92,
98).
1.2.3. Immune Response to Malignancies
The interaction between the immune system and cancer is a complex
process that involves the balance between pro- and anti-tumor mediators. Based
on the initial concept of ‘immune surveillance’ introduced by Burnett and Thomas,
the interaction of the immune system and cancer now includes three phases:
elimination, equilibrium and escape phase (99-102).
Elimination phase of cancer immunoediting is the process that innate and
adaptive immune components recognize and eliminate transformed cells from
developing into visible tumors. Both innate and adaptive immune cells are
involved in killing of cancer cells, major effectors include NK cell of innate
immunity, and adaptive immunity mainly CD8+ cytotoxic T cell with the assistance
of CD4+ Helper T, especially TH1 cells (99). NK cells are activated when tumor
cells (usually with reduced MHCI expression) are recognized via surface binding
19
of activating receptor NKG2D to NKG2D ligands such as MICA/B of human and
H60, Rae-1 of mouse (99, 103). Initial recognition of cancer cells by innate
immune cells such as NK, NKT, macrophages and dendritic cells (DCs) triggers
the production of proinflammatory cytokines such as IFN-γ, which increases anti-
tumor activity in multiple ways such as upregulating tumor cells’ MHCI expression
that facilitates CD8+ T cell’s recognition and killing process (99). Activated DCs
migrate to secondary lymphoid organs to initiate the production of tumor-specific
T cells (99). Classic tumor antigens include differentiation (i.e. melanocyte
differentiation antigen), mutation (i.e. mutated p53), overexpressed (i.e.
HER2/neu) testis (i.e. MAGE) and viral antigens (104-106). Activated NK, CD8+
T cell and other immune cell populations target and kill tumor cells by releasing
perforin, granzyme from secretory lysosome, increasing expression of TNF-
related apoptosis-inducing ligand (TRAIL) and First apoptosis signal Ligand
(FasL) inducing apoptosis of tumor cells (99, 107).
The equilibrium phase is the immunity-tumor interaction where cancer is
stably controlled by immune system or becomes dormant but not eliminated.
Tumor cells in the equilibrium phase will eventually be eliminated or escape from
immunosurveillance and develop into visible tumors (99).
The escape phase describes the failure of the immune system to eradicate
transformed cells and the outgrowth of these cells into clinically detectable
tumors. Cancer cells achieve evasion of destruction by the immune system via a
combination of various mechanisms. Cancer cells are rapidly mutating due to the
20
unstable genome that will eventually contribute to heterogeneity of tumor cells,
therefore it is likely that the immune system fails to recognize and eliminate all
the variants, such as the ones that lack TAAs, NKG2D ligands expression, or the
variants with increased expression of PD-L1 including breast cancer cells (108,
109). Tumor cells together with tumor associated macrophages (TAMs) can also
generate an immunosuppressive microenvironment by producing anti-
inflammatory cytokines, such as TGF-β, IL-10, and recruit regulatory T cells
(Tregs) that can prevent the activation of DCs, NK cells, T cells and B cells (99,
110). Cytokines such as granulocyte-macrophage colony-stimulating factor (GM-
CSF), interleukin-1β (IL-1β), vascular endothelial growth factor (VEGF), and
prostaglandin E2 (PGE2) are responsible to recruit myeloid-derived suppressor
cells (MDSCs) to TME, which are another source of immunosuppressive
cytokines such as TGF-β. MDSCs can also deplete arginine (essential for T cell
function) by secreting arginase, and debilitate T cell receptor (TCR) function by
nitrosylation (80, 111). Lastly, tumor cells can directly inhibit T cell proliferation
by producing indoleamine 2,3-dioxygenase (IDO) to deplete tryptophan leading
to cell cycle arrest (112).
21
1.3 Animal Models of Breast Cancer
1.3.1 Overview
For decades, animal models have been used to study primary tumor
growth and metastatic spread with and without therapeutic interventions (113)..
Current available in vivo murine models for metastatic breast cancer can be
classified into two categories: experimental metastasis models and spontaneous
(metastasis arises spontaneously from primary tumor) models including
transgenic and transplantable models (114). Experimental metastatic models are
designated for the investigation of tumor colonization mechanisms at a secondary
site, by injecting tumor cells into circulation or specific organs. Transgenic models
have several advantages that allow researchers to study the entire process of
cancer progression including tumor initiation, pre-metastatic niche as well as
distant colonization, additional oncogene or tumor suppressor genes can also be
inserted to study oncogenic pathways (113-116). Compared to transgenic
models, transplantable models allow researchers to quickly assess metastatic
process, because of their short metastatic onset latency and multiple metastatic
sites such as brain, liver and bone that most transgenic models lack. Tumor cell
lines of transplantable models usually can be modified in vitro before inoculation,
such as transfection of a foreign gene (114).
Murine transplantable models can be divided into two groups, xenograft
and syngeneic transplantable models (113). Xenograft models involve
22
transplanting human cell lines or cells isolated directly from patients into
immunocompromised hosts. However, several limitations weaken the predictive
power of xenograft models as pre-clinical cancer models. First,species specificity
sets a boundary for tumor-stromal interaction which is critical for clinically relevant
cancer progression and metastasis (113, 117). Secondly, in order to prevent host
rejection of human cell implantation, the murine host must be
immunocompromised which makes it impossible to investigate the role of
immune system in tumor progression (118). Lastly, immunocompromised mice
such as nude mice have been reported containing impaired or altered
angiogenesis within transplanted tumors (119, 120). Syngeneic transplantable
model tumor cell lines are isolated from spontaneous tumors triggered by
carcinogens and can be repeatedly and orthotopically injected into the host
animal to initiate primary tumor growth and metastasis (121, 122). Currently, the
4T1 series is the most widely used transplantable breast cancer model.Tumor
cells can be injected into mammary gland as allograft with genetic and
immunological compatibility while spontaneous metastasis to distant organs can
be achieved quickly (2, 114, 121).
1.3.2 4T1 Breast Cancer Model Series
The 4T1 transplantable model mimics human stage IV triple negative
breast cancer; the 4T1 cell line was originally isolated by Miller et al. and was one
of four sublines (67NR, 168FARN, 4T07, and 4T1) derived from 410.4 tumor
23
(121, 123). The 410.4 cell line was isolated from a spontaneously initiated
mammary tumor of a BALB/c female mouse triggered by murine mammary tumor
virus (MMTV) infection (123). These four cell lines display different metastatic
capacities: with 67NR being nonmetastatic, 168FARN being local micro-
metastatic, 4TO7 being weakly metastatic to distant organs but unable to form
metastatic nodules and 4T1 cell line being highly tumorigenic and can
spontaneously metastasize from primary mammary tumor also form visible
nodules in distant organs including lung, liver, bone and brain (121, 124, 125).
The 4T1.2 transplantable tumor cell line is a single cell clone derived from
the 4T1 cell line as a site-specific metastatic breast cancer model to the bone
(122). 4T1.2 is currently one of a few transplantable models with molecular
features of a human triple-negative and basal like phenotype (ERα-, PR-, HER2-
and EGFR+) (2), which makes it a valuable model for investigating bone
metastasis and developing new therapeutic strategies to the triple-negative and
basal like human breast cancer patients (20). Interaction with surrounding stroma
is important to initiate metastasis. 4T1.2 cell adhere to collagen I, IV, fibronectin
and especially stronger to vitronectin and lamin-511 than its non-metastatic
cousin 67NR (126). Matrix metalloproteinases (MMPs) are an enzyme family that
are crucial for cancer metastasis by degrading basement membrane in human
breast cancer, it was reported 4T1.2 cells produce more active MMP-9 than 67NR
with the stimulation of its substrate laminin-511 (127, 128). It has also been
reported that compared to 67NR, metabolic plasticity and adaptivity enables 4T1
24
cells to better adapt in the tumor microenvironment which is important to establish
metastasis (125). As a bone metastatic model and similar to human breast cancer
cells, 4T1.2 cell line is also characterized by elevated parathyroid hormone-
related protein (PTHrP) secretion compare to other 4T1 family cell lines, and Ca2+
circulation of 4T1.2 tumor bearing mice is also significantly increased relative to
other 4T1 family tumor bearing mice (122, 129).
4T1 transplantable model family are valuable tools to study breast cancer
metastasis due to their similarity with human TNBC in molecular profile; yet unlike
human TNBC, mouse 4T1.2 breast cancer model lacks identifiable tumor
associated antigen (3, 4) which limits the model’s applicability in investigating the
interaction of immune system especially antigen-specific immunity with tumor
cells. To preclinically examine immunotherapeutic approaches against TNBC,
modifications to 4T1 series were done aimed to increase the immunogenicity,
such as introducing human TAAs to these cell lines (130).
4T1.2luc cell line was originally developed by Lou and Dedhar (131) by
transfecting a plasmid shuttle vector containing luciferase reporter gene luc2 into
4T1.2 cells and thus established a luciferase-expressing cell line (132). Firefly
luciferase gene luc2, as a reporter gene, was first reported more than three
decades ago and later adopted by scientists as an approach to design
informative, noninvasive yet cost-effective in vivo studies (133). In the field of
cancer research, transfection of luc2 into transplantable tumor cell line allows
scientists to track metastasis and micro-metastasis noninvasively with the aids of
25
bioluminescent imaging and PCR technologies (134-136). Despite the benefits
brought by luciferase reporter gene in the application of orthotopic transplantable
models, it has been suggested that reporter transgenes including β-
galactosidase, Enhanced green fluorescent protein (EGFP) and luciferase
epitopes can induce CD8+ T cell specific response that is characterized by
increased interferon-γ (IFN-γ) secretion (5). Moreover, it has been reported that
4T1 cell lines labeled with luciferase reporter gene displayed a reduced tumor
growth rate and a suppressed metastatic activity in immunocompetent BALB/c
mice, which could potentially compromise the utility of these models, but it may
also provide important information for immunotherapy development (6, 7).
Until now, no study has been published characterizing the in vivo
tumorigenesis, metastasis and immunogenicity of 4T1.2luc cell line compared to
the parental 4T1.2 cell line. With the preliminary evidence that firefly luciferase
may be immunogenic in the 4T1 model, it is reasonable to hypothesize similar
antigenic effect of luciferase expressed by 4T1.2 cells will be observed.
1.4 Rationale of Current Study
The 4T1.2 transplantable model is the most widely used for modeling
human triple negative breast cancer (TNBC) due to the similarities in molecular
profile (Lacking in ER, PR and HER2 expression) and sites of metastases. Unlike
human breast cancer, however, the 4T1.2 tumor cell line lacks defined tumor
associated antigens (TAAs) which limits its utility in immunotherapeutic research.
26
Previous studies demonstrate that luciferase (as a foreign protein) can elicit CD8+
T cell specific response in vitro and reduce primary tumor growth in both the 4T1
and other tumor models (5, 7), but no studies have been done to directly
characterize the role of luciferase in the luciferase-expressing 4T1.2luc model.
Therefore, the primary goal of this study was to explore the in vitro and in vivo
growth rates of 4T1.2 vs. the 4T1.2luc mammary tumor cells. In addition, we also
investigated the role of major cancer immunosurveillance components (CD4+ T
cells, CD8+ T cells and NK cells) in primary tumor growth, metastatic progression
and survival rate. Findings of this study can provide important information for
future pre-clinical research in immunotherapeutic strategies targeting TNBC.
27
CHAPTER 2
AIMS AND HYPOTHESES
2.1. Aim 1
Determine if the expression of luciferase in the 4T1.2 clone (4T1.2luc), alters
the in vitro or in vivo proliferative capacities compared to the parental cell
line 4T1.2.
Hypothesis 1: Luciferase serves only as an antigen and has no known functions
in mediating signaling cascades that govern tumor cell proliferation. Therefore,
we hypothesize 4T1.2 and 4T1.2luc cell lines will have similar in vitro proliferation
rates.
Hypothesis 2: In an immunocompetent host, luciferase will be recognized as a
foreign antigen. Thus, primary tumor growth of 4T1.2luc cells will be reduced
compared to the growth of 4T1.2 cells.
2.2. Aim 2
Determine the role of CD4+ T cells, CD8+ T cells and NK cells in controlling
primary tumor growth and metastatic progression in 4T1.2luc and 4T1.2
tumor-bearing mice.
Hypothesis 1: Depletion of CD4+ T cells, CD8+ T cells and NK cells in 4T1.2luc
tumor-bearing mice will enhance 4T1.2luc tumor growth and metastatic burden.
28
Hypothesis 2: Depletion of CD4+ T cells, CD8+ T cells and NK cells in 4T1.2
tumor-bearing mice will have no effect on 4T1.2 tumor growth and metastatic
burden.
2.3. Aim 3
Determine if the absence of CD4+ T cells, CD8+ T cells and NK cells alters
the survival rate of 4T1.2 and 4T1.2luc tumor-bearing mice respectively.
Hypothesis 1: Immunocompetent 4T1.2luc tumor-bearing mice (i.e. mice treated
with PBS or isotype control antibody, LTF-2) will have a significantly higher
survival rate compared to 4T1.2 tumor-bearing mice.
Hypothesis 2: Depletion of CD4+ T cells, CD8+ T cells or NK cells will not
significantly affect the survival rate of 4T1.2 tumor-bearing mice.
Hypothesis 3: Depletion of CD4+ T cells, CD8+ T cells or NK cells will significantly
decrease the survival rate of 4T1.2luc tumor-bearing mice.
29
CHAPTER 3
MATERIAL AND METHODS
3.1. Experimental Design
The study was designed to investigate the role of CD4+ T cells, CD8+ T cells
and NK cells in controlling primary tumor growth, metastatic burden, and survival
in 4T1.2 and 4T1.2luc tumor-bearing mice. Two cohorts of female BALB/c mice
were used for either 4T1.2 and 4T1.2luc tumor cell inoculation. Each cohort was
randomized into five treatment groups, including PBS control (intraperitoneal
injection [i.p.] with PBS), isotype control (i.p. injected with 100 µg LTF-2 antibody),
CD4+ T cell depletion (i.p. injected with 100 µg GK1.5 antibody), CD8+ T cell
depletion (i.p. injected with 100 µg 2.43 antibody) and NK cell depletion (i.p.
injected with 20 µl anti-asialo GM1 antibody). Injection of PBS and the
aforementioned antibodies started three days prior to tumor cell inoculation and
was maintained every three days until day 23 post tumor implantation. 4T1.2 or
4T1.2luc cells (5 × 104 tumor cells in 50 l of PBS) were implanted into the fourth
mammary gland of each mouse at day zero. Primary tumor growth was measured
two-three times per week using digital caliper until the day 35 post tumor
implantation. The experimental design and sample size of each group are shown
in Figure 3.1.
30
Figure 3.1. Experimental design. Two groups of BALB/c mice were orthotopically injected with either 5 X 104 4T1.2 or 4T1.2luc tumor cells into the fourth mammary gland. Each treatment group was injected with depleting antibodies for specific immune cell population starting three days before tumor cell inoculation and maintained every three days until day 23 post tumor implantation. Primary tumor volume was measured every two-three days. Mice were sacrificed on day 35, spleens were collected to confirm immune cell depletion, lungs and femurs of 4T1.2luc tumor bearing mice were collected to quantify metastatic burden.
31
3.2. Materials and Methods
3.2.1. Cell Lines and Cell Culture
The 4T1.2 murine breast cancer cell line was maintained in α minimum
essential medium (Life Technologies; Grand Island, NY) supplemented with 10%
fetal bovine serum (Gemini Bio-Products, Sacramento, CA), 2 mM L-glutamine
(Mediatech; Manassas, VA) 100U/ml penicillin (Mediatech) and 100 μg/ml
streptomycin (Mediatech) and incubated at 37°C with 5% CO2. The 4T1.2luc cell
line was maintained in Dulbecco’s modified Eagle’s medium (Life Technologies;
Grand Island, NY) containing 10% fetal bovine serum (Gemini Bio-Products,
Sacramento, CA), 2 mM L-glutamine (Mediatech; Manassas, VA), nonessential
amino acid (Mediatech), and 8 μg/ml puromycin (Mediatech) and incubated at
37°C with 5% CO2.
3.2.2. In Vitro Cell Proliferation Assay
Trypsin/EDTA (0.25%/2.21 mM) in HBSS was added to culture flasks to
harvest 4T1.2 and 4T1.2luc cells. Tumor cells were washed twice in their
respective media, adjusted to 2.5×103/ml, and plated using serial dilutions in a 96
well plate. Cells were allowed to proliferate for 48 prior to the removal of 70 l of
supernatant for cytokine analysis. 50 µl media and 20µl/well of CellTiter 96®
AQueous One Solution Reagent (Promega) were added back to well to quantify
proliferative capacity of the cells. After incubation for 90 minutes the plate was
32
read using an Epoch™ microplate spectrophotometer (BioTek, Winooski, VT) to
quantify absorbance at 490nm. Each assay was performed in triplicate.
3.2.3. Animal Model
Six-week-old female BALB/c mice were purchased from Jackson
Laboratory (Bar Harbor, MA). Mice were orthotopically injected either with 5×104
4T1.2 cells (parental cell line) or 4T1.2 cells transfected with luciferase (4T1.2luc)
into the fourth mammary gland. Primary tumor growth was measured two-three
times/week using digital caliper until the endpoint day 35 post tumor implantation
and tumor volume was calculated following the equation of v=(short2×long)/2.
For the survival study, mice were sacrificed when either the tumor size reached
the ethical limit (1.5cm3) or if the mice were moribund. All mice were housed at
The Pennsylvania State University in the Chandlee Laboratory animal facility and
maintained on a 12-hour light/dark cycle with free access to AIN-76A diet
(Research Diets, New Brunswick, NJ) and water. The Institutional Animal Care
and Use Committee of The Pennsylvania State University approved all animal
experiments.
33
3.2.4. Depletion of immune Cells
Two cohorts of female BALB/c mice were orthotopically injected into the
fourth mammary gland with either 5X104 4T1.2 or 4T1.2luc tumor cells (Figure
4.2). Within each cohort mice were randomized into five treatment groups:
control (i.p. injected with PBS), isotype control (i.p. injected with 100 µg LTF-2
antibody), CD4+ T cell depletion (i.p. injected with 100 µg GK1.5 antibody), CD8
T cell depletion (i.p. injected with 100 µg 2.43 antibody) and NK cell depletion
(i.p. injected with 20 µl anti asialo GM1 antibody). Injection of PBS and antibodies
started three days prior to tumor cell inoculation and was maintained every three
days until day 23 post tumor implantation. Primary tumor growth was measured
two-three times per week using digital caliper until the day 35 post tumor injection.
3.2.5. Flow Cytometric Analyses
Single cell suspensions of splenocytes were washed twice in PBS
containing 0.01% bovine serum albumin (flow buffer) at 4°C. Cells were
incubated with Fc block (Biolegend) and 1×106 cells were stained with saturating
concentrations of conjugated antibodies for 30 min at 4°C. Fluorescent dye
conjugated antibodies used in flow cytometric analyses were hamster α-mouse
CD3 (145-2C11), rat α-mouse CD4 (RM4-5), rat α-mouse CD8 (53-6.7), mouse
α-mouse NK1.1 (PK136); hamster IgG1 (A19-3), Rat IgG2a (RTK2758) and
mouse IgG2a (MG2a-53) were used as isotype controls. Following incubation
with the conjugated antibodies, cell samples were washed twice in flow buffer
34
and fixed in 1% paraformaldehyde (BD Biosciences) in flow buffer and analyzed
on a BD LSR-Fortessa (BD Bioscience) flow cytometer by collecting 50,000
events for each sample analyzed. Flow cytometric data were analyzed using
FlowJo software (Tree Star; Ashland, OR).
3.2.6. Metastatic Burden Quantification
At sacrifice, lungs and femurs of mice were collected, flash frozen in liquid
nitrogen and stored at -80°C. Tissues were homogenized and genomic DNA was
isolated using DNeasy Blood and Tissue Kit (Qiagen; Valencia, CA) according to
manufacturer’s instructions. DNA concentration of each sample was measured
using Nanodrop ND-2000c spectrophotometer (Thermo Scientific; Wilmington,
DE). Luciferase copies for each individual tissue were quantified using TaqMan™
assay on StepOnePlus™ (Life Technologies) real-time PCR system to determine
metastatic burden. Forward and reverse primers for luciferase sequence were
CAGCTGCACAAAGCCATGAA, and CTGAGGTAATGTCCACCTCGATATG
and probe was TACGCCCTGGTGCCCGGC with 5’ FAM reporter and 3’ BHQ
quencher. Mouse telomerase reverse transcriptase (TERT) was used as
reference gene for normalizing luciferase data and was analyzed using the
TaqMan™ Copy Number Reference Assay TERT (Life Technologies). The
standard curve was performed with five 10-fold serial dilutions (200ng-20pg) of
DNA extracted from cultured 4T1.2luc cells. TERT and luciferase reactions for
35
Standard curve and 200ng of each tissue sample were performed in duplicate on
StepOnePlus™ real-time PCR system.
3.3. Statistical Analyses
All data are presented as the mean plus or minus the standard error mean.
Tumor volume and metastatic burden were assessed for normality and equal
variances and either parametric or nonparametric analyses were used based on
sample distribution to detect differences between treatment groups. In vitro
proliferation of 4T1.2 and 4T1.2luc, and primary tumor growth was assessed using
2-way ANOVA, followed by Bonferroni correction for multiple comparisons where
appropriate. Metastatic burden among treatment groups was assessed using
Kruskal-Wallis test, followed by Dunn's multiple comparisons test. Survival of
tumor-bearing mice in all treatment groups were analyzed using Kaplan-Meier
curves with subsequent log rank (Mantel-Cox) test. Significance was accepted at
p<0.05.
36
CHAPTER 4
RESULTS
4.1. In Vitro and in vivo Proliferation of 4T1.2 and 4T1.2luc tumor cells
The expression of luciferase in the 4T1.2 cell line did not alter the in vitro
proliferation rate as the proliferation rates of 4T1.2 and 4T1.2luc cells were similar
(Fig. 4.1; 2-way ANOVA, time × cell number, F (7, 28) =1.768, p=0.137).
Mean tumor volume of PBS-treated 4T1.2luc tumor-bearing mice was
significantly reduced compared to PBS treated 4T1.2 tumor-bearing mice (Fig 4.2;
n=5/group; 2-way ANOVA, time × treatment, F (12, 96) =1.876, p=0.047).
37
S ta rt in g C e ll N u m b e r
Ab
so
rb
an
ce
0 5 0 0 1 0 0 0 1 5 0 0 2 0 0 0 2 5 0 0
0 .0
0 .5
1 .0
1 .5
2 .04 T 1 .2
4 T 1 .2lu c
Figure 4.1. In vitro proliferation of 4T1.2 and 4T1.2luc cell lines. 4T1.2 or 4T1.2luc
mammary tumor cells (2,500 cells/well in serial dilution) were cultured for 72 hours and
quantified proliferation. The in vitro proliferation rates were similar between 4T1.2 and
4T1.2luc cell lines (2-way ANOVA, time × cell number, F (7, 28) =1.768, p=0.137).
Figure 4.2. In vivo tumor growth of 4T1.2 and 4T1.2luc mammary tumor cell lines.
Primary tumor growth of PBS-treated 4T1.2luc tumor-bearing mice was significantly
reduced compared to PBS-treated 4T1.2 tumor-bearing mice (n=5/group; 2-way ANOVA,
time × treatment, F (12, 96) =1.876, p=0.047).
38
4.2. Immune Cell Depletion
Splenocytes from each treatment group were stained with anti-CD3, anti-
CD4, anti-CD8 or NK1.1 to quantify the number of CD4+ T cells, CD8+ T cells and
NK cells, respectively, in the spleens of either PBS or antibody-depleted mice
(Figure 4.3). In PBS-treated mice, 27.8% of splenocytes were CD3+/CD4+ T cells,
whereas in GK1.5-treated mice, only 0.28% of splenocytes were CD3+/CD4+ T
cells (Figure 4.3A). In PBS-treated mice, 13.3% of splenocytes were CD3+/CD8+
T cells, whereas in 2.43-treated mice 1.42% of splenocytes were CD3+/CD8+ T
cells (Figure 4.3B). Lastly, in PBS-treated mice 12.28% of splenocytes were
NK1.1+, whereas in anti-asialo GM-treated mice 1.91% of splenocytes were
NK1.1+ cells (Figure 4.3C).
39
Figure 4.3. Splenic immune cell depletion in control and antibody depleted mice. At
sacrifice on day 35 post tumor implantation, spleens were harvested and single cell
suspension of splenocytes were prepared for flow cytometric analysis. CD3+/CD4+ helper
T cells (A), CD3+/CD8+ cytotoxic T cells (B) and NK1.1+ NK cells (C) populations were
quantified in PBS treated (left column) and antibody-depleted mice (right column).
40
4.3. Primary Tumor Growth
Individual tumor growth curves demonstrate the variability that was
observed in 4T1.2 and 4T1.2luc tumor growth among different animals (Fig.4.4).
In 4T1.2 tumor bearing mice, administration of an isotype control antibody
(Figure 4.5A; ANOVA, time × treatment, F (9, 99) = 1.184, p=0.313); depletion of
CD4+ T cells (Figure 4.5B; 2-way ANOVA, time × treatment, F (7, 77) = 1.763,
p=0.107); depletion of CD8+ T cells (Figure 4.5C; 2-way ANOVA, time ×
treatment, F (9, 90) = 0.9577, p=0.480); and depletion of NK cells (Figure 4.5D; 2-
way ANOVA, time × treatment, F (9, 99) = 1.874, p=0.065) did not significantly alter
primary tumor growth compared to PBS treated 4T1.2 tumor-bearing mice.
In 4T1.2luc tumor bearing mice, administration of an isotype control
antibody (Figure 4.6A; 2-way ANOVA, time × treatment, F (12, 384) = 0.2934, p=
0.990) and depletion of CD4+ T cells (Figure 4.6B; 2-way ANOVA, time ×
treatment, F (12, 420) = 0.5773, p=0.861) did not significantly alter tumor growth
compared to PBS treated mice. However, depletion of CD8+ T cells (Figure 4.6C;
2-way ANOVA, time × treatment, F (12, 408) = 1.847, p=0.039) significantly
enhanced 4T1.2luc tumor growth while NK cell depletion significantly reduced
4T1.2luc tumor growth (Figure 4.6D; 2-way ANOVA, time × treatment, F (12, 408)
=1.878, p=0.035).
When 4T1.2 and 4T1.2luc tumor growth was compared within each
antibody treatment group, 4T1.2luc tumor growth was significantly lower than
41
4T1.2 tumor growth in PBS-treated (Figure 4.7A; PBS; n=5/group; 2-way ANOVA,
time × treatment, F(12, 96)=1.876, p= 0.047); isotype control-treated (Figure 4.7B;
LTF-2; n=8/group; 2-way ANOVA, time × treatment, F (12, 168)=4.845, p<0.001);
CD4+ T cell depleted (Figure 4.7C; GK1.5; n=8/group; 2-way ANOVA, time ×
treatment, F(12, 168)=3.118, p<0.001) and NK cell depleted (Figure 4.7E; anti-
asialo GM1; n=7-8/group; 2-way ANOVA, time × treatment, F(12, 156)=3.560,
p<0.001) mice. However, 4T1.2luc tumor growth was similar to 4T1.2 tumor
growth in CD8+ T cell depleted mice.
42
Figure 4.4. Tumor growth of individual mice in each treatment group by tumor cell types. Individual tumor growth curves of
BALB/c mice inoculated with (A-E) 5X104 4T1.2 or (F-J) 5X104 4T1.2luc cells and treated with either PBS (n=5-6/group), isotype
control antibody (LTF-2; n=8/group), anti-CD4 antibody (GK1.5; n=8/group), anti-CD8α antibody (2.43; n=8/group) or anti-asialo
GM1 antibody (n=8/group) antibodies.
43
Figure 4.5. Primary tumor growth of 4T1.2 cells in control and immune cell depleted
mice. (A) Isotype control (LTF-2; 2-way ANOVA, time × treatment, F (9, 99) = 1.184,
p=0.313), (B) CD4+ T cell depletion (GK1.5; 2-way ANOVA, time × treatment, F (7, 77) =
1.763, p=0.107), (C) CD8+ T cell depletion (2.43; 2-way ANOVA, time × treatment, F (9, 90)
= 0.9577, p=0.480) and (D) NK cell depletion (anti-asialo GM1; 2-way ANOVA, time ×
treatment, F (9, 99) = 1.874, p=0.065) did not significantly change 4T1.2 tumor growth
compared to PBS-treated mice.
44
Figure 4.6. Primary tumor growth of 4T1.2luc cells in control and immune cell
depleted mice. In 4T1.2luc tumor bearing mice, (A) Isotype control (LTF-2; 2-way ANOVA,
time × treatment, F (12, 420) = 0.3230, p=0.985), and (B) CD4+ T cell depletion (GK1.5; 2-
way ANOVA, time × treatment, F (12, 420) = 0.5773, p=0.861) did not alter tumor growth.
However, (C) CD8+ T cell depletion significantly increased primary tumor growth (2.43; 2-
way ANOVA, time × treatment, F (12, 408) = 1,765, p=0.039) and (D) NK cell depletion
significantly reduced tumor growth compared to the PBS-treated control group (anti-asialo
GM1; 2-way ANOVA, time × treatment, F (12, 408) = 1.878, p=0.035).
45
Figure 4.7. Primary tumor growth in 4T1.2 and 4T1.2luc tumor bearing mice receiving
control or immune cell depleting antibodies. (A) control (PBS; n=5/group; 2-way
ANOVA, time × treatment, F (12, 96) =1.876, p=0.047), (B) isotype control (LTF-2; n=8/group;
2-way ANOVA, time × treatment, F (12, 168) = 4.85, p<0.001), (C) CD4+ depletion (GK1.5;
n=8/group; 2-way ANOVA, time × treatment, F (12, 168) = 3.118, p<0.001), (D) CD8+ T cell
depletion (2.43; n=6-8/group; 2-way ANOVA, time × treatment, F (12, 144) = 0.5127,
p=0.904).and (E) NK cell depletion (anti-asialo GM1; n=7-8/group; 2-way ANOVA, time ×
treatment, F (12, 156) = 3.560, p<0.001) in 4T1.2 and 4T1.2luc tumor bearing mice. Tumor
growth was significantly reduced in 4T1.2luc tumor-bearing mice compared to 4T1.2 tumor-
bearing mice in all treatment groups except in CD8* T cell depleted mice.
46
4.4. Metastatic Burden
Metastatic burden in the lung (Figure. 4.8A; Kruskal-Wallis, KW=8.452,
p=0.076) and the femur (Figure. 4.8B; Kruskal-Wallis, KW=3.073, p=0.546) was
not significantly different among treatment groups.
47
Figure 4.8. Metastatic burden in the lung and femur in 4T1.2luc tumor-bearing mice.
Lung (A) metastatic burden was not significantly different among treatment group
(Kruskal-Wallis, KW=8.452, p=0.076). Femur (B) metastatic burden was not significantly
different among treatment groups (Kruskal-Wallis, KW=3.073, p=0.546).
48
4.5. Survival Analyses
The median survival of PBS-treated 4T1.2luc tumor-bearing mice was
significantly longer than 4T1.2 tumor-bearing mice (Figure 4.9; n=6-18, log-rank
test, p=0.045).
In 4T1.2 tumor bearing mice, the median survival of PBS and LTF-2
treated were not significantly different (Figure 4.10A; n=6-8/group, log-rank test,
p=0.431). Depletion of CD4+ T cells (Figure 4.10B; GK1.5; n=6-8/group, log-rank
test, p=0.385), CD8+ T cells (Figure 4.10C; 2.43; n=6-8/group, log-rank test,
p=0.135) or NK cells (Figure 4.10D; anti-asialo GM1, n=6-8, log-rank test,
p=0.709) did not significantly change the median survival in 4T1.2 tumor-bearing
mice compared to PBS treated mice.
In 4T1.2luc tumor-bearing mice, the median survival of isotype control
(Figure 4.11A; LTF-2; n=5-8/group, log-rank test, p=0.899) and NK cell depleted
(Figure 4.11D; anti-asialo GM1, n=5-8, log-rank test, p=0.825) mice were not
significantly different than PBS–treated mice. CD4+ T cell depletion (Figure
4.11B; GK1.5; n=8-16/group, log-rank test, p=0.004) and CD8+ T cell depletion
(Figure 4.11C; 2.43; n=8-16/group, log-rank test, p=0.025) significantly reduced
median survival in 4T1.2luc tumor bearing mice compared to PBS-treated mice.
49
Figure 4.9. Median survival of 4T1.2 and 4T1.2luc tumor-bearing mice. Median survival
of PBS-treated 4T1.2luc tumor-bearing mice was significantly higher than 4T1.2 tumor-
bearing mice (PBS, n=6-18, log-rank test, p=0.045).
50
Figure 4.10. Median survival in antibody depleted 4T1.2 tumor-bearing mice
compared to PBS treated mice. Median survival of (A) isotype control (LTF-2; n=6-
8/group, log-rank test, p=0.431), (B) CD4+ T cell depleted (GK1.5; n=6-8/group, log-rank
test, p=0.385), (C) CD8+ T cell depleted (2.43; n=6-8/group, log-rank test, p=0.135) and
(D) NK cell depleted (anti-asialo GM1, n=6-8, log-rank test, p=0.709) mice were not
significantly different than PBS-treated mice.
51
Figure 4.11. Median survival of antibody-treated 4T1.2luc tumor-bearing mice
compared to PBS-treated control mice. Median survival of (A) isotype control (LTF-2;
n=8-16/group, log-rank test, p=0.899), (B) CD4+ T cell depleted (GK1.5; n=8-16/group,
log-rank test, p=0.004), (C) CD8+ T cell depleted (2.43; n=8-16/group, log-rank test,
p=0.025) and (D) NK cell depleted (anti-asialo GM1, n=8-16, log-rank test, p=0.825) mice.
CD4+ and CD8+ T cell depletion significantly reduced median survival compared to PBS-
treatment.
52
CHAPTER 5
DISCUSSION
Breast cancer is the most commonly diagnosed cancer and the second
leading cause of cancer related deaths among American women (1). Despite
recent advances in breast cancer therapeutics, triple negative breast cancer
(TNBC) remains the subtype with poorest prognosis due to limited treatment
options. The 4T1 murine mammary metastatic model has been widely used as a
model for TNBC because of the similarities in hormone receptor profile to human
TNBC (2). One caveat of the 4T1 model is that there are few known tumor
associated antigens which has limited the use of this model in preclinical
immunotherapeutic studies (3, 4). The firefly luciferase gene, luc2, has been
transfected into various tumor cell lines as a reporter gene for imaging studies.
However, previous studies demonstrate that the luciferase epitope can induce
CD8+ cytotoxic T cell specific responses, thus may be serving as a tumor antigen
for immune recognition (5-7). Therefore, the first goal of this study was to explore
the in vitro and in vivo growth rates of the parental 4T1.2 cell line and the
luciferase transfected clone (4T1.2luc). In addition, we also investigated the role
of CD4+ T cells, CD8+ T cells, and NK cells in primary tumor growth, metastatic
progression and survival.
Consistent with our hypothesis, we found that 4T1.2 and 4T1.2luc cell lines
had similar in vitro proliferation rates suggesting that luciferase expression by
4T1.2luc cells does not interfere with pathways important in cell proliferation.
53
However, in vivo tumor growth differed in 4T1.2 and 4T1.2luc tumor-bearing mice.
4T1.2luc tumor-bearing mice had significantly reduced primary tumor growth
compared to 4T1.2 tumor-bearing mice. Thus, in an immunocompetent host, the
4T1.2luc cell line may be more immunogenic than the 4T1.2 cell line, i.e. 4T1.2luc
cell line was more effectively recognized by the host immune system than the
parental 4T1.2 cell line. Baklaushev et al. reported similar in vitro growth rates
between the parental 4T1 cell line and two luciferase-expressing 4T1 cell lines.
However, significantly lower growth rates were observed in luciferase-expressing
4T1 tumor cells compared to the parental 4T1 in vivo in BALB/c mice (7).
Moreover, luciferase-specific IFN-γ production was detected in the two luciferase-
expressing clones of 4T1 in tumor-bearing mice, but not in the mice implanted
with the parental 4T1 cell line (7). In summary, our data are similar to the results
reported by Baklaushev et al., and demonstrate that expression of luciferase did
not alter the in vitro proliferative capacity of 4T1.2luc cell line, but luciferase could
be recognized by the immune system as a foreign protein in vivo. This recognition
likely influences tumor growth as 4T1.2luc tumor growth was slower than 4T1.2
tumor growth in BALB/c mice.
Both innate and adaptive immune components are actively involved in the
elimination phase of cancer immunosurveillance and the major immune cell
populations involved are CD4+ helper T cells, CD8+ cytotoxic T cells and NK cells
(99). By depleting each immune cell type in 4T1.2 tumor-bearing mice, we found
that the absence of any aforementioned immune cell types did not significantly
54
alter the trajectory of primary tumor growth compared to immunocompetent
controls. However, in 4T1.2luc tumor-bearing mice, depletion of CD8+ cytotoxic T
cells significantly increased primary tumor growth in comparison to the PBS-
treated control group. Furthermore, we demonstrated that NK cell depletion
significantly reduced primary tumor growth compared to PBS-treated group.
Our results confirm that CD8+ T cells are key effector cells of anti-tumor
immunity in the 4T1.2luc model. In breast cancer patients, tumor-infiltrating CD8+
T cells are significantly inversely correlated with advanced tumor stages,
positively correlated with relapse free survival (RFS) and overall survival (OS),
while the CD4+:CD8+ ratio is negatively correlated with RFS and OS (137-139).
Baklaushev et al. demonstrated that immunization of mice using a epitope from
luciferase that is recognized by CD8+ T cells resulted in growth inhibition of
luciferase-expressing 4T1 primary tumors (7). In the current study, the absence
of CD8+ T cells augmented 4T1.2luc primary tumor growth suggesting that CD8+
cytotoxic T cells are important in mediating host anti-tumor effector immune
responses in the 4T1.2luc tumor model.
Contrary to our hypothesis, depletion of CD4+ T cells did not result in
increased primary tumor growth in both 4T1.2 and 4T1.2luc tumor-bearing mice.
CD4+ T cells are a heterogeneous group of immune cells including T helper 1
(TH1), T helper 2 (TH2), T helper 9 (TH9), T helper 17 (TH17), T helper 22 (TH22),
follicular helper T cell (TFH), and regulatory T cells (Tregs). Among these CD4+ T
cell subsets, TH 1 provide help to activate CD8+ cytotoxic T cells, while Tregs are
55
potent inhibitors of antigen-specific immunity (140). Huang et al. demonstrated
that in the 4T1 and EO771 mammary tumor models, both tumor-infiltrating CD4+
and CD8+ T cells accumulated with the progression of tumor, but CD4+ TILs
became increasingly high in the CD4+CD25+Foxp3+ Treg subset late in tumor
progression, and the CD4+:CD8+ ratio also increased with tumor progression
(139). It is possible that TH1 plays an important role in the 4T1.2luc model, but
depleting all subsets may have masked the effect of the loss of TH1 cells.
Therefore, depletion of TH1 cells and Tregs separately in subsequent
experiments may reveal more about the role CD4+ cell subsets in the 4T1.2 and
4T1.2luc tumor models.
In the current study, depletion of NK cells did not affect 4T1.2 primary
tumor growth which supported our hypothesis. However, depletion of NK cells
resulted in decreased tumor growth in 4T1.2luc tumor bearing mice, suggesting a
pro-tumorigenic role for NK cells in this model. These findings contradict the
evidence in some tumor models that NK cells exert an anti-tumor effect. Based
previous data collected in the Rogers laboratory, the expression of major
histocompatibility complex I (MHCI) by 4T1.2 and 4T1.2luc cell lines is negligible.
All healthy nucleated cells express MHCI on their surface which can bind to
inhibitory receptors of NK cells, thus preventing NK cells from attacking healthy
tissue. In contrast, transformed, tumor cells often lack MHCI which can activate
NK cell recognition of tumors (88). Therefore, since 4T1.2 and 4T1.2luc lack MHCI
expression, we do not believe these tumors are recognized by NK cells. One
56
possible explanation for our findings is that NK cells can inhibit CD8+ T cell activity
(141) and depletion of NK cells may allow a greater CD8+ T cell cytotoxicity
against 4T1.2luc tumors. It is reported that NK cells can regulate T cell immunity
via secretion of cytokines or direct lysing of T cells (142, 143). NK cells have been
reported to increase IL-10 secretion after various infections (144, 145). NK cells
can also interact with T cells by engaging NKG2D to NKG2D ligands on T cells
and can kill activated T cells via cytolytic granules or death ligand pathways such
as TRAIL or FasL (141, 142). Therefore, examining the interaction between NK
cells and CD8+ T cells in the 4T1.2a model is necessary to explain the
protumorigenic role of NK cells we observed in this study.
In 4T1.2luc tumor bearing mice, no statistically significant increase in lung
and femur metastatic burden was observed in CD4+ T cell, CD8+ T cell and NK
cell depleted groups. The current study was designed to examine the role of key
immune components in 4T1.2 and 4T1.2luc models. Thus, we collected lungs and
femurs at the end of study (day 35) based on our previous metastatic burden data.
However, there were a large number of mice that were taken off prior to day 35
because their tumors reached the ethical limit or they were moribund. This may
have introduced a bias in that animals with the lowest metastatic burden may
have survived until day 35 post tumor implantation. Future studies are aimed at
examining the metastatic burden of immune-depleted mice at an earlier time point
to avoid a survival bias in the data. Also, we did not examine the metastatic
burden of 4T1.2 tumor bearing mice, therefore we cannot compare to what extent
57
does immune system influence metastases between 4T1.2 and 4T1.2luc tumor-
bearing mice.
PBS-treated 4T1.2luc tumor-bearing mice had a significantly longer median
survival than PBS-treated 4T1.2 tumor-bearing mice. One reason that PBS-
treated 4T1.2luc tumor-bearing mice exhibit a significantly greater median survival
compared to 4T1.2 group may be greater recognition of the tumor by the immune
system due to the expression of luciferase. This immune control of the tumor may
prevent accelerated tumor growth and/or the initiation of cachexia which
contribute to survival. Consistent with our hypothesis, depletion of CD4+ T cells,
CD8+ T cells and NK cells did not alter the median survival in 4T1.2 tumor-bearing
mice compared to PBS-treated group. These results can also be explained by
the lack of tumor antigens of 4T1.2 tumors, thus the importance of CD4+ T cells,
and CD8+ T cells is less prominent in this tumor model.
In 4T1.2luc tumor-bearing mice, CD4+ T cell and CD8+ T cell depletion
groups had significantly reduced median survival compared to the PBS-treated
group. NK cell depleted mice had identical survival rate with PBS-treated 4T1.2luc
tumor-bearing mice. It is reported CD8+ T cells and NK cells are crucial in 4T1
tumor-bearing mice survival, while CD4+ T cells are negatively associated with
patient overall survival and the inhibitory CD4+/FOXP3+ Treg subset is reported
to be dominant in the late tumor stage (139, 146, 147). However, our data
demonstrated that CD4+ T cells and CD8+ T cells are important immune cell
populations to maintain survival in the 4T1.2luc tumor model. Eventhough our
58
results contradict published data that CD4+ T cells are negatively associated with
survival, it is possible that total number and percentage of Treg cells are low in
the CD4+ T cell population in the 4T1.2luc model, so that most of the CD4+ T cells
may be performing a protective role. Future experiments need to be conducted
to confirm the proportion of pro- or anti-tumor CD4+ T cell subsets at sacrifice and
the effect of depleting these CD4+ T cell subsets on tumor growth and survival in
4T1.2luc tumor-bearing mice.
59
CHAPTER 6
CONCLUSION
In summary, 4T1.2 and 4T1.2luc tumor cell lines are widely used as TNBC
models due to the similarity of cell surface expression of hormone receptors to
human TNBC. Here we found both cell lines have comparable in vitro proliferation
rates. More importantly 4T1.2luc had significantly reduced in vivo proliferation rate
compared to 4T1.2 tumor cells and we demonstrated that this is due to
recognition of luciferase on 4T1.2luc cells by CD8+ T cells. As a TNBC model,
4T1.2 cell line lacks defined tumor associated antigens, but 4T1.2luc cell line is
more immunogenic which potentially expands its use to immunotherapeutic
studies. Our data also suggest a pro-tumorigenic role of NK cells in this model.
Future studies need to be conducted to clarify the interaction between NK cells,
CD8+ T cells and tumor cells. We did not observe a significant increase in
metastatic burden in the lung or femur in immune cell depleted 4T1.2luc tumor-
bearing mice. Additional studies with a larger sample size are needed to clarify
the roles that CD4+, CD8+ T cells and NK cells in controlling metastases in
4T1.2luc tumor bearing mice. Lastly, we demonstrated that CD4+ T cells and CD8+
T cells are crucial for the survival of 4T1.2luc tumor-bearing mice but not for 4T1.2
tumor-bearing which suggests an important role for antigen-specific immunity in
tumor growth and survival.
60
Results from the current study have solidified our understanding of the role
of CD4+ and CD8+ T cells and NK cells in tumor growth, metastases, and survival
in the 4T1.2luc model. This information will enable our laboratory to investigate
the immune mechanisms underlying the diet and exercise effects on tumor
progression and survival previously reported. Specifically, future studies are
aimed at determining if our diet and exercise interventions are enhancing the anti-
luciferase response to 4T1.2luc tumors, or may be preventing the emergence of
immune suppressive cells, such as regulatory T cells.
61
REFERENCES
1. DeSantis CE, Ma J, Goding Sauer A, Newman LA, Jemal A. Breast cancer statistics, 2017,
racial disparity in mortality by state. CA Cancer J Clin. 2017;67(6):439-48.
2. Johnstone CN, Smith YE, Cao Y, Burrows AD, Cross RS, Ling X, et al. Functional and
molecular characterisation of EO771. LMB tumours, a new C57BL/6-mouse-derived model of
spontaneously metastatic mammary cancer. Disease models & mechanisms. 2015;8(3):237-51.
3. Chen L, Huang T-G, Meseck M, Mandeli J, Fallon J, Woo SL. Rejection of metastatic 4T1
breast cancer by attenuation of Treg cells in combination with immune stimulation. Molecular
Therapy. 2007;15(12):2194-202.
4. Rivera A, Fu X, Tao L, Zhang X. Modification of a popular syngeneic murine mammary
tumor model for immunotherapy studies. ISRN Immunology. 2011;2011.
5. Limberis M, Bell C, Wilson J. Identification of the murine firefly luciferase-specific CD8 T-
cell epitopes. Gene therapy. 2009;16(3):441-7.
6. Podetz-Pedersen KM, Vezys V, Somia NV, Russell SJ, McIvor RS. Cellular Immune
Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo.
Human gene therapy. 2014;25(11):955-65.
7. Baklaushev V, Kilpeläinen A, Petkov S, Abakumov M, Grinenko N, Yusubalieva G, et al.
Luciferase Expression Allows Bioluminescence Imaging But Imposes Limitations on the
Orthotopic Mouse (4T1) Model of Breast Cancer. Scientific reports. 2017;7(1):7715.
8. Muschler J, Streuli CH. Cell–matrix interactions in mammary gland development and
breast cancer. Cold Spring Harbor perspectives in biology. 2010;2(10):a003202.
9. Macias H, Hinck L. Mammary gland development. Wiley Interdiscip Rev Dev Biol.
2012;1(4):533-57.
62
10. Deugnier M-A, Teulière J, Faraldo MM, Thiery JP, Glukhova MA. The importance of being
a myoepithelial cell. Breast Cancer Research. 2002;4(6):224.
11. Visvader JE. Keeping abreast of the mammary epithelial hierarchy and breast
tumorigenesis. Genes Dev. 2009;23(22):2563-77.
12. Russo J, Russo IH. Development of the human breast. Maturitas. 2004;49(1):2-15.
13. JENA MK, MOHANTY AK. NEW INSIGHTS OF MAMMARY GLAND DURING DIFFERENT
STAGES OF DEVELOPMENT. 2017.
14. National Cancer Institute. Bethesda M. SEER Cancer Stat Facts: Female Breast Cancer
[Available from: https://seer.cancer.gov/statfacts/html/breast.html.
15. Prat A, Perou CM. Deconstructing the molecular portraits of breast cancer. Molecular
oncology. 2011;5(1):5-23.
16. Visvader JE. Keeping abreast of the mammary epithelial hierarchy and breast
tumorigenesis. Genes & development. 2009;23(22):2563-77.
17. Howlader N, Altekruse SF, Li CI, Chen VW, Clarke CA, Ries LA, et al. US Incidence of
Breast Cancer Subtypes Defined by Joint Hormone Receptor and HER2 Status. JNCI Journal of
the National Cancer Institute. 2014;106(5).
18. Loibl S, Gianni L. HER2-positive breast cancer. The Lancet. 2017;389(10087):2415-29.
19. Anderson KN, Schwab RB, Martinez ME. Reproductive risk factors and breast cancer
subtypes: a review of the literature. Breast cancer research and treatment. 2014;144(1):1-10.
20. Foulkes WD, Smith IE, Reis-Filho JS. Triple-negative breast cancer. New England journal
of medicine. 2010;363(20):1938-48.
63
21. Sørlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, et al. Gene expression
patterns of breast carcinomas distinguish tumor subclasses with clinical implications.
Proceedings of the National Academy of Sciences. 2001;98(19):10869-74.
22. Phipps AI, Malone KE, Porter PL, Daling JR, Li CI. Body size and risk of luminal, HER2-
overexpressing, and triple-negative breast cancer in postmenopausal women. Cancer
Epidemiology and Prevention Biomarkers. 2008;17(8):2078-86.
23. Perou CM, Sørlie T, Eisen MB, Van De Rijn M, Jeffrey SS, Rees CA, et al. Molecular
portraits of human breast tumours. Nature. 2000;406(6797):747.
24. Penault-Llorca F, Viale G. Pathological and molecular diagnosis of triple-negative breast
cancer: a clinical perspective. Annals of oncology. 2012;23(suppl_6):vi19-vi22.
25. Ahn SG, Kim SJ, Kim C, Jeong J. Molecular classification of triple-negative breast cancer.
Journal of breast cancer. 2016;19(3):223-30.
26. Stephen Edge DRB, Carolyn C. Compton, April G. Fritz, Frederick L. Greene, Andrew
Trotti. AJCC Cancer Staging Manual. 8th ed: Springer; 2018.
27. Elston CW, Ellis IO. pathological prognostic factors in breast cancer. I. The value of
histological grade in breast cancer: experience from a large study with long-term follow-up.
Histopathology. 1991;19(5):403-10.
28. Bloom H, Richardson W. Histological grading and prognosis in breast cancer: a study of
1409 cases of which 359 have been followed for 15 years. British journal of cancer.
1957;11(3):359.
29. Fentiman I. Fixed and modifiable risk factors for breast cancer. International journal of
clinical practice. 2001;55(8):527-30.
64
30. Mansfield CM. A review of the etiology of breast cancer. Journal of the National Medical
Association. 1993;85(3):217.
31. Key TJ, Verkasalo PK, Banks E. Epidemiology of breast cancer. The lancet oncology.
2001;2(3):133-40.
32. McPherson K, Steel C, Dixon J. ABC of breast diseases: breast cancer—epidemiology, risk
factors, and genetics. BMJ: British Medical Journal. 2000;321(7261):624.
33. Rojas K, Stuckey A. Breast cancer epidemiology and risk factors. Clinical obstetrics and
gynecology. 2016;59(4):651-72.
34. Fentiman IS, Fourquet A, Hortobagyi GN. Male breast cancer. The Lancet.
2006;367(9510):595-604.
35. Evans DGR, Moran A, Hartley R, Dawson J, Bulman B, Knox F, et al. Long-term outcomes
of breast cancer in women aged 30 years or younger, based on family history, pathology and
BRCA1/BRCA2/TP53 status. British journal of cancer. 2010;102(7):1091.
36. Danforth Jr DN. Disparities in breast cancer outcomes between Caucasian and African
American women: a model for describing the relationship of biological and nonbiological
factors. Breast cancer research. 2013;15(3):208.
37. King M-C, Marks JH, Mandell JB. Breast and ovarian cancer risks due to inherited
mutations in BRCA1 and BRCA2. Science. 2003;302(5645):643-6.
38. Fackenthal JD, Olopade OI. Breast cancer risk associated with BRCA1 and BRCA2 in
diverse populations. Nature Reviews Cancer. 2007;7(12):937.
39. McCormack VA, dos Santos Silva I. Breast density and parenchymal patterns as markers
of breast cancer risk: a meta-analysis. Cancer Epidemiology and Prevention Biomarkers.
2006;15(6):1159-69.
65
40. Bernstein L, Ross RK. Endogenous hormones and breast cancer risk. Epidemiologic
reviews. 1993;15(1):48-65.
41. Brown SB, Hankinson SE. Endogenous estrogens and the risk of breast, endometrial, and
ovarian cancers. Steroids. 2015;99:8-10.
42. Bagnardi V, Rota M, Botteri E, Tramacere I, Islami F, Fedirko V, et al. Alcohol
consumption and site-specific cancer risk: a comprehensive dose–response meta-analysis.
British journal of cancer. 2015;112(3):580.
43. Park SY, Kolonel LN, Lim U, White KK, Henderson BE, Wilkens LR. Alcohol consumption
and breast cancer risk among women from five ethnic groups with light to moderate intakes:
the Multiethnic Cohort Study. International journal of cancer. 2014;134(6):1504-10.
44. Renehan AG, Tyson M, Egger M, Heller RF, Zwahlen M. Body-mass index and incidence
of cancer: a systematic review and meta-analysis of prospective observational studies. The
Lancet. 2008;371(9612):569-78.
45. Renehan AG, Zwahlen M, Minder C, T O'Dwyer S, Shalet SM, Egger M. Insulin-like
growth factor (IGF)-I, IGF binding protein-3, and cancer risk: systematic review and meta-
regression analysis. The Lancet. 2004;363(9418):1346-53.
46. Rose D, Komninou D, Stephenson G. Obesity, adipocytokines, and insulin resistance in
breast cancer. Obesity reviews. 2004;5(3):153-65.
47. Iyengar NM, Hudis CA, Dannenberg AJ, editors. Obesity and inflammation: new insights
into breast cancer development and progression. American Society of Clinical Oncology
educational book/ASCO American Society of Clinical Oncology Meeting; 2013: NIH Public Access.
48. Saxton JM. Diet, physical activity and energy balance and their impact on breast and
prostate cancers. Nutrition research reviews. 2006;19(2):197-215.
66
49. Thune I, Brenn T, Lund E, Gaard M. Physical activity and the risk of breast cancer. New
England Journal of Medicine. 1997;336(18):1269-75.
50. Kelsey JL, Gammon MD, John EM. Reproductive factors and breast cancer.
Epidemiologic reviews. 1993;15(1):36.
51. Society AC. Surgery for Breast Cancer [cited 2018 2/3]. Available from:
https://www.cancer.org/cancer/breast-cancer/treatment/surgery-for-breast-cancer.html.
52. M MMaG. Diseases of the Breast. Philadelphia: Wolters Kluwer Health; 2014.
53. Hwang ES, Lichtensztajn DY, Gomez SL, Fowble B, Clarke CA. Survival after lumpectomy
and mastectomy for early stage invasive breast cancer. Cancer. 2013;119(7):1402-11.
54. Fisher B, Anderson S, Bryant J, Margolese RG, Deutsch M, Fisher ER, et al. Twenty-year
follow-up of a randomized trial comparing total mastectomy, lumpectomy, and lumpectomy
plus irradiation for the treatment of invasive breast cancer. New England Journal of Medicine.
2002;347(16):1233-41.
55. Beranek DT. Distribution of methyl and ethyl adducts following alkylation with
monofunctional alkylating agents. Mutation Research/Fundamental and Molecular Mechanisms
of Mutagenesis. 1990;231(1):11-30.
56. Fowden L, Lewis D, Tristram H. Toxic amino acids: their action as antimetabolites.
Advances in Enzymology and Related Areas of Molecular Biology, Volume 29. 1967:89-163.
57. Rowinsky EK, Cazenave LA, Donehower RC. Taxol: a novel investigational
antimicrotubule agent. JNCI: Journal of the National Cancer Institute. 1990;82(15):1247-59.
58. Pommier Y. Topoisomerase I inhibitors: camptothecins and beyond. Nature Reviews
Cancer. 2006;6(10):789.
67
59. Cleator S, Heller W, Coombes RC. Triple-negative breast cancer: therapeutic options.
The lancet oncology. 2007;8(3):235-44.
60. Higgins MJ, Baselga J. Targeted therapies for breast cancer. The Journal of clinical
investigation. 2011;121(10):3797-803.
61. Lipton A, Ali S, Leitzel K, Demers L, Chinchilli V, Engle L, et al. Elevated serum Her-2/neu
level predicts decreased response to hormone therapy in metastatic breast cancer. Journal of
Clinical Oncology. 2002;20(6):1467-72.
62. Kandoth C, McLellan MD, Vandin F, Ye K, Niu B, Lu C, et al. Mutational landscape and
significance across 12 major cancer types. Nature. 2013;502(7471):333.
63. Disis ML, Stanton SE. Immunotherapy in breast cancer: an introduction. The Breast.
2018;37:196-9.
64. Monnot GC, Romero P. Rationale for immunological approaches to breast cancer
therapy. The Breast. 2018;37:187-95.
65. Nathan MR, Schmid P. The emerging world of breast cancer immunotherapy. The
Breast. 2018;37:200-6.
66. A Study to Evaluate the Efficacy and Safety of Trastuzumab Emtansine in Combination
With Atezolizumab or Atezolizumab-Placebo in Participants With Human Epidermal Growth
Factor-2 (HER2) Positive Locally Advanced or Metastatic Breast Cancer (BC) Who Received Prior
Trastuzumab and Taxane Based Therapy (KATE2) 2016 [updated April 25, 2018. Ongoing Phase II
Clinical Trial, Investigator: Hoffmann-La Roche]. Available from:
https://clinicaltrials.gov/ct2/show/NCT02924883.
67. Safety and Pharmacokinetics of Atezolizumab Combination Treatments in Participants
With HER2-Positive and HER2-Negative Breast Cancer 2015 [updated April 10, 2018; cited 2018
68
4/30]. Ongoing Phase I trial, PI: Hoffmann-La Roche]. Available from:
https://clinicaltrials.gov/ct2/show/NCT02605915.
68. Stagg J, Loi S, Divisekera U, Ngiow SF, Duret H, Yagita H, et al. Anti–ErbB-2 mAb therapy
requires type I and II interferons and synergizes with anti–PD-1 or anti-CD137 mAb therapy.
Proceedings of the National Academy of Sciences. 2011;108(17):7142-7.
69. Adams S, Greeder L, Reich E, Shao Y, Fosina D, Hanson N, et al. Expression of cancer
testis antigens in human BRCA-associated breast cancers: potential targets for
immunoprevention? Cancer immunology, immunotherapy. 2011;60(7):999.
70. Curigliano G, Viale G, Ghioni M, Jungbluth A, Bagnardi V, Spagnoli G, et al. Cancer–testis
antigen expression in triple-negative breast cancer. Annals of oncology. 2010;22(1):98-103.
71. Disis M, Stanton S, editors. Triple-negative breast cancer: immune modulation as the
new treatment paradigm. American Society of Clinical Oncology educational book American
Society of Clinical Oncology Meeting; 2015.
72. Nanda R, Chow LQ, Dees EC, Berger R, Gupta S, Geva R, et al. Pembrolizumab in patients
with advanced triple-negative breast cancer: phase Ib KEYNOTE-012 study. Journal of Clinical
Oncology. 2016;34(21):2460-7.
73. Schmid P, Cruz C, Braiteh FS, Eder JP, Tolaney S, Kuter I, et al. Atezolizumab in
metastatic TNBC (mTNBC): long-term clinical outcomes and biomarker analyses. AACR; 2017.
74. Winer EP, Dang T, Karantza V, Su S-C. KEYNOTE-119: A randomized phase III study of
single-agent pembrolizumab (MK-3475) vs single-agent chemotherapy per physician's choice for
metastatic triple-negative breast cancer (mTNBC). American Society of Clinical Oncology; 2016.
75. Ghiringhelli F, Menard C, Puig PE, Ladoire S, Roux S, Martin F, et al. Metronomic
cyclophosphamide regimen selectively depletes CD4+ CD25+ regulatory T cells and restores T
69
and NK effector functions in end stage cancer patients. Cancer immunology, immunotherapy.
2007;56(5):641-8.
76. Alizadeh D, Trad M, Hanke NT, Larmonier CB, Janikashvili N, Bonnotte B, et al.
Doxorubicin eliminates myeloid-derived suppressor cells and enhances the efficacy of adoptive
T-cell transfer in breast cancer. Cancer research. 2014;74(1):104-18.
77. Bracci L, Schiavoni G, Sistigu A, Belardelli F. Immune-based mechanisms of cytotoxic
chemotherapy: implications for the design of novel and rationale-based combined treatments
against cancer. Cell death and differentiation. 2014;21(1):15.
78. Adams S, Diamond J, Hamilton E, Pohlmann P, Tolaney S, Molinero L, et al., editors.
Safety and clinical activity of atezolizumab (anti-PDL1) in combination with nab-paclitaxel in
patients with metastatic triple-negative breast cancer. Proceedings of the Thirty-Eighth Annual
CTRC-AACR San Antonio Breast Cancer Symposium; 2015.
79. Twelves C, Cortes J, Vahdat L, Olivo M, He Y, Kaufman PA, et al. Efficacy of eribulin in
women with metastatic breast cancer: a pooled analysis of two phase 3 studies. Breast cancer
research and treatment. 2014;148(3):553-61.
80. Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ. Natural innate and adaptive
immunity to cancer. Annual review of immunology. 2011;29:235-71.
81. Parkin J, Cohen B. An overview of the immune system. The Lancet.
2001;357(9270):1777-89.
82. Beutler B. Innate immunity: an overview. Molecular immunology. 2004;40(12):845-59.
83. Hayashi T, Nakamura T, Takaoka A. Pattern recognition receptors. Nihon Rinsho Men'eki
Gakkai kaishi= Japanese journal of clinical immunology. 2011;34(5):329-45.
70
84. Vono M, Lin A, Norrby-Teglund A, Koup RA, Liang F, Loré K. Neutrophils acquire the
capacity for antigen presentation to memory CD4+ T cells in vitro and ex vivo. Blood.
2017;129(14):1991-2001.
85. Savina A, Amigorena S. Phagocytosis and antigen presentation in dendritic cells.
Immunological reviews. 2007;219(1):143-56.
86. Liu Y-J. Dendritic cell subsets and lineages, and their functions in innate and adaptive
immunity. Cell. 2001;106(3):259-62.
87. Alvarez D, Vollmann EH, von Andrian UH. Mechanisms and consequences of dendritic
cell migration. Immunity. 2008;29(3):325-42.
88. Pegram HJ, Andrews DM, Smyth MJ, Darcy PK, Kershaw MH. Activating and inhibitory
receptors of natural killer cells. Immunology & Cell Biology. 2011;89(2):216-24.
89. Trapani JA, Smyth MJ. Functional significance of the perforin/granzyme cell death
pathway. Nature Reviews Immunology. 2002;2(10):735.
90. Dokun AO, Kim S, Smith HR, Kang H-SP, Chu DT, Yokoyama WM. Specific and nonspecific
NK cell activation during virus infection. Nature immunology. 2001;2(10):951.
91. Borg C, Jalil A, Laderach D, Maruyama K, Wakasugi H, Charrier S, et al. NK cell activation
by dendritic cells (DCs) requires the formation of a synapse leading to IL-12 polarization in DCs.
Blood. 2004;104(10):3267-75.
92. Bonilla FA, Oettgen HC. Adaptive immunity. Journal of Allergy and Clinical Immunology.
2010;125(2):S33-S40.
93. Tobón GJ, Izquierdo JH, Cañas CA. B lymphocytes: development, tolerance, and their
role in autoimmunity—focus on systemic lupus erythematosus. Autoimmune diseases.
2013;2013.
71
94. Allen CD, Okada T, Cyster JG. Germinal-center organization and cellular dynamics.
Immunity. 2007;27(2):190-202.
95. Richards S, Watanabe C, Santos L, Craxton A, Clark EA. Regulation of B‐cell entry into
the cell cycle. Immunological reviews. 2008;224(1):183-200.
96. Burton DR, Williamson RA, Parren PW. Antibody and virus: binding and neutralization.
Virology. 2000;270(1):1-3.
97. Verbrugh H, Peterson P, Nguyen B, Sisson S, Kim Y. Opsonization of encapsulated
Staphylococcus aureus: the role of specific antibody and complement. The Journal of
Immunology. 1982;129(4):1681-7.
98. Kroemer G, Senovilla L, Galluzzi L, André F, Zitvogel L. Natural and therapy-induced
immunosurveillance in breast cancer. Nature medicine. 2015;21(10):1128.
99. Dunn GP, Old LJ, Schreiber RD. The immunobiology of cancer immunosurveillance and
immunoediting. Immunity. 2004;21(2):137-48.
100. Burnet M. Cancer—a biological approach: I. The processes of control. II. The significance
of somatic mutation. British medical journal. 1957;1(5022):779.
101. Burnet F. The concept of immunological surveillance. Immunological Aspects of
Neoplasia. 13: Karger Publishers; 1970. p. 1-27.
102. Thomas L. On immunosurveillance in human cancer. The Yale journal of biology and
medicine. 1982;55(3-4):329.
103. Diefenbach A, Jamieson AM, Liu SD, Shastri N, Raulet DH. Ligands for the murine NKG2D
receptor: expression by tumor cells and activation of NK cells and macrophages. Nature
immunology. 2000;1(2):119.
72
104. Boon T. Human tumor antigens recognized by T lymphocytes. The Journal of
experimental medicine. 1996;183(3):725-9.
105. Odunsi K, Jungbluth AA, Stockert E, Qian F, Gnjatic S, Tammela J, et al. NY-ESO-1 and
LAGE-1 cancer-testis antigens are potential targets for immunotherapy in epithelial ovarian
cancer. Cancer research. 2003;63(18):6076-83.
106. Rosenberg SA. A new era for cancer immunotherapy based on the genes that encode
cancer antigens. Immunity. 1999;10(3):281-7.
107. Topham NJ, Hewitt EW. Natural killer cell cytotoxicity: how do they pull the trigger?
Immunology. 2009;128(1):7-15.
108. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. cell.
2011;144(5):646-74.
109. Hasan A, Ghebeh H, Lehe C, Ahmad R, Dermime S. Therapeutic targeting of B7-H1 in
breast cancer. Expert opinion on therapeutic targets. 2011;15(10):1211-25.
110. Whiteside TL. Immune responses to malignancies. Journal of Allergy and Clinical
Immunology. 2010;125(2):S272-S83.
111. Lesokhin AM, Merghoub T, Wolchok JD. Myeloid-derived suppressor cells and the
efficacy of CD8+ T-cell immunotherapy. Oncoimmunology. 2013;2(2):e22764.
112. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. Evidence for
a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2, 3-
dioxygenase. Nature medicine. 2003;9(10):1269.
113. Khanna C, Hunter K. Modeling metastasis in vivo. Carcinogenesis. 2005;26(3):513-23.
73
114. Eckhardt BL, Francis PA, Parker BS, Anderson RL. Strategies for the discovery and
development of therapies for metastatic breast cancer. Nature reviews Drug discovery.
2012;11(6):479-97.
115. Shepard C, Kassis J, Whaley D, Kim H, Wells A. PLCγ contributes to metastasis of in situ-
occurring mammary and prostate tumors. Oncogene. 2007;26(21):3020-6.
116. Yeh ES, Yang TW, Jung JJ, Gardner HP, Cardiff RD, Chodosh LA. Hunk is required for
HER2/neu-induced mammary tumorigenesis. The Journal of clinical investigation.
2011;121(3):866.
117. DeRose YS, Wang G, Lin Y-C, Bernard PS, Buys SS, Ebbert MT, et al. Tumor grafts derived
from women with breast cancer authentically reflect tumor pathology, growth, metastasis and
disease outcomes. Nature medicine. 2011;17(11):1514-20.
118. Clarke R. Human breast cancer cell line xenografts as models of breast cancer—the
immunobiologies of recipient mice and the characteristics of several tumorigenic cell lines.
Breast cancer research and treatment. 1996;39(1):69-86.
119. Alani RM, Silverthorn CF, Orosz K. Tumor angiogenesis in mice and men. Cancer biology
& therapy. 2004;3(6):498-500.
120. Takizawa Y, Saida T, Tokuda Y, Dohi S, Wang Y-L, Urano K, et al. New immunodeficient
(nude-scid, beige-scid) mice as excellent recipients of human skin grafts containing
intraepidermal neoplasms. Archives of dermatological research. 1997;289(4):213-8.
121. Aslakson CJ, Miller FR. Selective events in the metastatic process defined by analysis of
the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer research.
1992;52(6):1399-405.
74
122. Lelekakis M, Moseley JM, Martin TJ, Hards D, Williams E, Ho P, et al. A novel orthotopic
model of breast cancer metastasis to bone. Clinical & experimental metastasis. 1999;17(2):163-
70.
123. Dexter DL, Kowalski HM, Blazar BA, Fligiel Z, Vogel R, Heppner GH. Heterogeneity of
tumor cells from a single mouse mammary tumor. Cancer research. 1978;38(10):3174-81.
124. Pulaski BA, Ostrand-Rosenberg S. Reduction of established spontaneous mammary
carcinoma metastases following immunotherapy with major histocompatibility complex class II
and B7. 1 cell-based tumor vaccines. Cancer research. 1998;58(7):1486-93.
125. Simões RV, Serganova IS, Kruchevsky N, Leftin A, Shestov AA, Thaler HT, et al. Metabolic
plasticity of metastatic breast cancer cells: adaptation to changes in the microenvironment.
Neoplasia. 2015;17(8):671-84.
126. Eckhardt BL, Parker BS, van Laar RK, Restall CM, Natoli AL, Tavaria MD, et al. Genomic
analysis of a spontaneous model of breast cancer metastasis to bone reveals a role for the
extracellular matrix. Molecular Cancer Research. 2005;3(1):1-13.
127. Tester AM, Ruangpanit N, Anderson RL, Thompson EW. MMP-9 secretion and MMP-2
activation distinguish invasive and metastatic sublines of a mouse mammary carcinoma system
showing epithelial-mesenchymal transition traits. Clinical and Experimental Metastasis.
2000;18(7):553-60.
128. Pal S, Moulik S, Dutta A, Chatterjee A. Extracellular matrix protein laminin induces
matrix metalloproteinase-9 in human breast cancer cell line mcf-7. Cancer microenvironment.
2014;7(1-2):71-8.
129. Guise TA. Parathyroid hormone‐related protein and bone metastases. Cancer.
1997;80(S8):1572-80.
75
130. Danishmalik SN, Lee S-H, Sin J-I. Tumor regression is mediated via the induction of
HER263-71-specific CD8+ CTL activity in a 4T1. 2/HER2 tumor model: no involvement of CD80 in
tumor control. Oncotarget. 2017;8(16):26771.
131. Chen YC, Prabhu KS, Das A, Mastro AM. Dietary selenium supplementation modifies
breast tumor growth and metastasis. International journal of cancer. 2013;133(9):2054-64.
132. Lou Y, Preobrazhenska O, Sutcliffe M, Barclay L, McDonald PC, Roskelley C, et al.
Epithelial–mesenchymal transition (EMT) is not sufficient for spontaneous murine breast cancer
metastasis. Developmental Dynamics. 2008;237(10):2755-68.
133. Ow DW, DE WET JR, HELINSKI DR, HOWELL SH, WOOD KV, DELUCA M. Transient and
stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science.
1986;234(4778):856-9.
134. Roda A, Pasini P, Mirasoli M, Michelini E, Guardigli M. Biotechnological applications of
bioluminescence and chemiluminescence. TRENDS in Biotechnology. 2004;22(6):295-303.
135. Sperisen P, Wang SM, Reichenbach P, Nabholz M. A PCR-based assay for reporter gene
expression. Genome Research. 1992;1(3):164-70.
136. Suff N, Waddington SN. The power of bioluminescence imaging in understanding host-
pathogen interactions. Methods. 2017;127:69-78.
137. Mahmoud SM, Paish EC, Powe DG, Macmillan RD, Grainge MJ, Lee AH, et al. Tumor-
infiltrating CD8+ lymphocytes predict clinical outcome in breast cancer. Journal of clinical
oncology. 2011;29(15):1949-55.
138. Liu S, Lachapelle J, Leung S, Gao D, Foulkes WD, Nielsen TO. CD8+ lymphocyte
infiltration is an independent favorable prognostic indicator in basal-like breast cancer. Breast
cancer research. 2012;14(2):R48.
76
139. Huang Y, Ma C, Zhang Q, Ye J, Wang F, Zhang Y, et al. CD4+ and CD8+ T cells have
opposing roles in breast cancer progression and outcome. Oncotarget. 2015;6(19):17462.
140. Ostrand-Rosenberg S. CD4+ T lymphocytes: a critical component of antitumor immunity.
Cancer investigation. 2005;23(5):413-9.
141. Rabinovich BA, Li J, Shannon J, Hurren R, Chalupny J, Cosman D, et al. Activated, but not
resting, T cells can be recognized and killed by syngeneic NK cells. The Journal of Immunology.
2003;170(7):3572-6.
142. Crouse J, Xu HC, Lang PA, Oxenius A. NK cells regulating T cell responses: mechanisms
and outcome. Trends in immunology. 2015;36(1):49-58.
143. Lang PA, Lang KS, Xu HC, Grusdat M, Parish IA, Recher M, et al. Natural killer cell
activation enhances immune pathology and promotes chronic infection by limiting CD8+ T-cell
immunity. Proceedings of the National Academy of Sciences. 2012;109(4):1210-5.
144. Lee S-H, Kim K-S, Fodil-Cornu N, Vidal SM, Biron CA. Activating receptors promote NK
cell expansion for maintenance, IL-10 production, and CD8 T cell regulation during viral
infection. Journal of Experimental Medicine. 2009;206(10):2235-51.
145. Perona-Wright G, Mohrs K, Szaba FM, Kummer LW, Madan R, Karp CL, et al. Systemic
but not local infections elicit immunosuppressive IL-10 production by natural killer cells. Cell
host & microbe. 2009;6(6):503-12.
146. Liu F, Lang R, Zhao J, Zhang X, Pringle GA, Fan Y, et al. CD8+ cytotoxic T cell and FOXP3+
regulatory T cell infiltration in relation to breast cancer survival and molecular subtypes. Breast
cancer research and treatment. 2011;130(2):645-55.
77
147. Gao X, Wang X, Yang Q, Zhao X, Wen W, Li G, et al. Tumoral expression of IL-33 inhibits
tumor growth and modifies the tumor microenvironment through CD8+ T and NK cells. The
Journal of Immunology. 2014:1401344.