The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.
-
Upload
claude-douglas -
Category
Documents
-
view
223 -
download
0
Transcript of The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.
![Page 1: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/1.jpg)
The Role of Fluorescence in situ hybridization (FISH)
in Sequencing the Tomato Genome
![Page 2: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/2.jpg)
Short arm
Centromere
Long arm India
17 16 10 13 1124 26 26 19 11 20 27
Japan
Spain
Italy
euchromatinheterochromatinAT-rich satellite DNA
Mb1 10 11 129
USA C
hin
a
UK
Chin
a
USA Kore
a France
62 3 4 7
The N
eth
erl
ands
5 8
![Page 3: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/3.jpg)
Maize 1C = 2634 Mb
Tomato 1C = 916 Mb
Arabidopsis 1C = 157 Mb
![Page 4: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/4.jpg)
![Page 5: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/5.jpg)
77% of the DNA is in heterochromatin 23% of DNA is in euchromatin
![Page 6: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/6.jpg)
77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin
Thus,
0.23 x 916 Mb = 211 Mb
![Page 7: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/7.jpg)
77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin
Thus,
0.23 x 916 Mb = 211 Mb
Arabidopsis 1C = 157 Mb
![Page 8: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/8.jpg)
HindIII library
15 tomato genome equivalents129,000 clones
Averaging 117 kb
![Page 9: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/9.jpg)
EXPEN 2000 MolecularLinkage Map of Tomato Chromosome 10(SGN)
![Page 10: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/10.jpg)
Anchor (seed) BAC LE_HBa0234C10 Probe TG285
![Page 11: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/11.jpg)
Anchor (seed) BAC LE_HBa0234C10 Probe TG285
aatgcctaggcatgaatcttggccatc
![Page 12: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/12.jpg)
Anchor (seed) BAC LE_HBa0234C10 Probe TG285
aatgcctaggcatgaatcttggccatcgctacgcttagaa
![Page 13: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/13.jpg)
Seed BAC LE_HBa0234C10 Probe TG285
![Page 14: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/14.jpg)
Seed BAC LE_HBa0234C10 Probe TG285
![Page 15: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/15.jpg)
Seed BAC LE_HBa0234C10 Probe TG285
![Page 16: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/16.jpg)
Seed BAC
Contig
LE_HBa0234C10 Probe TG285
![Page 17: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/17.jpg)
![Page 18: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/18.jpg)
Fluorescence in situ Hybridization(FISH)
ChinaFrance
The NetherlandsKoreaJapanUSA
![Page 19: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/19.jpg)
Fluorescence in situ Hybridization(FISH)
ChinaFrance
The NetherlandsKoreaJapanUSA
![Page 20: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/20.jpg)
![Page 21: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/21.jpg)
![Page 22: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/22.jpg)
![Page 23: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/23.jpg)
Nick translation
biotin- digoxygenin-
dinitrophenol-labeled nucleotides
FISH Probes
BAC DNA
![Page 24: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/24.jpg)
Hybridization mixture50-100-fold excess of
unlabeled tomato Cot 100 DNA
Chromosomal in situ Suppression(CISS) Hybridization
![Page 25: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/25.jpg)
![Page 26: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/26.jpg)
![Page 27: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/27.jpg)
Functions of FISH in Sequencing the Tomato Genome
1. To determine the locations of anchor BACs2. To define eu-heterochromatin borders3. To determine distances in Mb4. To locate problem BACs
![Page 28: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/28.jpg)
Green LabelSpread % Distance
126-06 86.23126-28 81.92126-29 82.28126-30 84.27126-32 85.77126-33 85.2126-34 83.9126-37 87.63126-38 87.2
Mean 84.93Std. Dev. 2.02
BAC 116C14, Slide 126, Chromosome 9, Short (p) Arm
%
%
![Page 29: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/29.jpg)
Pachytene Chromosome 9
![Page 30: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/30.jpg)
Pachytene chromosome 9
![Page 31: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/31.jpg)
Functions of FISH in Sequencing the Tomato Genome
1. To determine the locations of anchor BACs2. To define eu-heterochromatin borders3. To determine distances in Mb4. To locate problem BACs
![Page 32: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/32.jpg)
![Page 33: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/33.jpg)
![Page 34: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/34.jpg)
Functions of FISH in Sequencing the Tomato Genome
1. To determine the locations of anchor BACs2. To define eu-heterochromatin borders3. To determine distances in Mb4. To locate problem BACs
![Page 35: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/35.jpg)
![Page 36: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/36.jpg)
Functions of FISH in Sequencing the Tomato Genome
1. To determine the locations of anchor BACs2. To define eu-heterochromatin borders3. To determine distances in Mb4. To locate problem BACs
![Page 37: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/37.jpg)
177 BACs FISHED
RESULTS SO FAR
![Page 38: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/38.jpg)
177 BACs FISHED
126 BACS (74%) successfully localized.
RESULTS SO FAR
![Page 39: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/39.jpg)
177 BACs FISHED
51 failed to localize because they either gave no FISH signal or there was more than one signal in spite of CISS hybridization.
126 BACS (74%) successfully localized.
RESULTS SO FAR
![Page 40: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/40.jpg)
Of 126 BACs localized22 (17.5%) FISHed to wrong chromosomes
![Page 41: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/41.jpg)
Of 126 BACs localized22 (17.5%) FISHed to wrong chromosomes
Of these, 11 have been checked by sequencing:7 were overgo false positives1 was due to a picking error 1 was due to a typographical error 2 were due to mapping errors
![Page 42: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/42.jpg)
Of 126 BACs localized22 (17.5%) FISHed to wrong chromosomes
Of these 11 have been checked by sequencing:7 were overgo false positives1 were due to a picking error 1 were due to a typographical error 2 were due to mapping errors
Suggesting ≤ 3% mapping errors on the EXPEN 2000 linkage map
![Page 43: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/43.jpg)
FUTURE ACTIVITIES
an increasing emphasis on defining the size of gaps in sequencing
1) within BACs,2) between contigs,3) between contigs and euchromatin-
heterochromatin borders
![Page 44: The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.](https://reader036.fdocuments.net/reader036/viewer/2022062309/56649d1b5503460f949f1684/html5/thumbnails/44.jpg)
Senior Personnel UndergraduatesLorrie Anderson Madeline FujishiroSong-Bin Chang Lauren LarsenSuzanne Royer Dylan Westfall Lindsay Shearer Jessica WuSteve Stack
The Role of BAC Fluorescence in situ hybridization (FISH)
in Sequencing the Tomato Genome