537

of this disease have been reported. Thedefects reside either in the osteoclast orstem cell itself 8,9 or in the osteoblastic orbone marrow environment.10-12 Os-teopetrosis has also been described inmice generated by homozygous gene dis-ruption.13-16 Mice lacking c-src gene de-velop osteopetrosis.13 Histologic analysisof the bones in src–/– mice show the pres-ence of a normal number of osteoclasts,13

which are nonfunctional and fail to formruffled borders.17 This model clearlydemonstrates a role of the p60c-Src pro-tein tyrosine kinase in osteoclastic boneresorption.

In several patients with malignant os-teopetrosis, the number of osteoclasts isnormal or increased and ruffled borderformation is reduced, suggesting similar-ity to the src–/– mouse model. The pur-pose of this study was to investigate thepotential role of this gene in the patho-genesis of the disease. We thus studiedp60c-Src protein expression and functionand sequenced the c-src gene in Epstein-Barr virus B-cell lines and fibroblasts of13 children who were first seen with ma-lignant osteopetrosis.

METHODS

Patient CharacteristicsThirteen children with the autosomal

recessive malignant form of osteopetrosiswere referred to Hôpital Necker from

Osteopetrosis is a rare metabolic bonedisease characterized by skeletal sclero-sis resulting from reduced osteoclast-me-diated bone resorption. In fact, osteopet-

TThe protein tyrosine kinase p60c-Src is not implicatedin the pathogenesis of the human autosomal recessiveform of osteopetrosis: A study of 13 childrenFrédéric Bernard, MD, Jean-Laurent Casanova, MD, PhD, Giulia Cournot, MD, PhD, Nada Jabado, MD,Jane Peake, MD, Sébastien Jauliac, Alain Fischer, MD, PhD, and Claire Hivroz, PhD

rosis is a generic term for a group of dis-orders sharing the common pathogenesisof altered osteoclast function or develop-ment. Nine forms of osteopetrosis aredistinguishable according to clinical andgenetic classification.1 The congenitalmalignant type has an autosomal reces-sive mode of inheritance and is usuallyfatal in early childhood. The medullaryspace is filled in with bone, which leadsto bone marrow failure and ex-tramedullary hematopoiesis with hyper-splenism.1,2 Bone histologic findings arevariable, particularly with regard to thenumber of osteoclasts and the presenceof ruffled membranes.3-5 Allogenic bonemarrow transplantation remains the onlycurative approach.6

The pathogenesis of osteopetrosis re-mains unclear, except for a distinct formcaused by carbonic anhydrase II defi-ciency,7 whereas different animal models

From Institut National de la Santé et de la RechercheMédicale U429 and Unité d’Immunologie et d’HématologiePédiatrique, Pavillon Kirmisson, Hôpital Necker-Enfants-Malades, Paris, France; and Centre National de laRecherche Scientifique, Unité de Recherche Associé 583,Hôpital Necker-Enfants-Malades, Paris, France.Supported by grants from the Programme Hospi-talier de Recherche Clinique and the Institut Na-tional de la Santé et de la Recherche Médicale. S.Jauliac is the recipient of a grant from “La LigueNationale contre le Cancer”.

Submitted for publication Jan 19, 1998; revisionsreceived May 6, 1998, and June 30, 1998; acceptedJuly 9, 1998.

Reprint requests: Frédéric Bernard, Centre Hospi-talier de Montpellier, Pédiatrie III, Hôpital Arnaudde Villeneuve, 371 Av du Doyen G. Giraud, 34295Montpellier Cedex 5, France.

Copyright © 1998 by Mosby, Inc.

0022-3476/98/$5.00 + 0 9/21/93290

EBV Epstein-Barr virusmAb Monoclonal antibodyPCR Polymerase chain reaction

Osteopetrosis has been described in mice generated by homozygous gene dis-ruption of c-src gene encoding for the p60c-Src protein tyrosine kinase (Src –/–

mice). The similarities of bone histologic findings in this murine model to thoseobserved in some patients first seen with autosomal recessive osteopetrosis,“malignant” osteopetrosis, led us to investigate the potential role of p60c-Src inthe pathogenesis of malignant osteopetrosis in 13 children. In 4 patients a c-srcmutation was ruled out by an intragenic microsatellite segregation study. In theother 9 we analyzed p60c-Src expression and function, as well as c-src sequence.The expression was normal in all of the patients tested. In addition, the tyrosinephosphorylation and kinase activity of p60c-Src were also normal in all of the pa-tients. Moreover, in these patients, sequences of the coding region of c-src wereidentical to the published sequence of the human c-src complementary DNA.These results exclude a role for c-src in the pathogenesis of human malignantosteopetrosis in the 13 patients analyzed. (J Pediatr 1998;133:537-43)

BERNARD ET AL THE JOURNAL OF PEDIATRICS

OCTOBER 1998

1989 to 1993. Their ages ranged from 1to 7 months at the time of evaluation.Parental consanguinity was observed in11 cases (Table I). In all cases the diag-nosis was based on a characteristic fami-ly history or clinical symptoms, such asvisual impairment and enlargement ofliver and spleen, in combination with ab-normal blood cell counts. All showed theskeletal radiographic features of severeinfantile osteopetrosis with generalizeddense sclerosis of the skeletal structure.Five of the 13 children received an in-trafamilial bone marrow transplantation;among them the 3 who received anHLA-matched transplantation are alive.6

Patient 9 was treated with interferon-γwithout any benefit. Biologic samplesavailable for this study were fibroblasts

obtained from skin biopsy specimens(patients 6 to 10 and patient 12) or pe-ripheral blood mononuclear cells, whichallowed the generation of EBV B-celllines as described by Simon et al18 (pa-tients 2 to 6 and 11 to 13). In one case(patient 1) only genomic DNA wasavailable. Informed consent for thisstudy was obtained from the parents inall cases.

Immunoprecipitation andWestern Blotting

EBV B-cell lines or primary fibroblastswere lysed in RIPA buffer (50 mmol/LTris-HCl [pH 7.5], 150 mmol/L NaCl,0.5% sodium deoxycholate, 1% Nonidet P40, 2 mmol/L ethylenediaminetetraaceticacid, 0.1% sodium dodecylsulfate, 200

538

µmol/L sodium ortho vanadate, proteaseinhibitors). The same amount of proteinwas dissolved and boiled in reducingLaemmli buffer or submitted to preclear-ing with nonimmune murine immunoglob-ulins and protein G Sepharose beads(Pharmacia). After preclearing, c-Src wasimmunoprecipitated with monoclonal an-tibody 327 (Oncogene Science Laborato-ries). After separation on an 8% sodiumdodecylsulfate polyacrylamide gel, pro-teins were electrophoretically transferredto polyvinylidene difluoride membranes(Millipore). Membranes were probedwith 0.5 µg/mL mAb 327 or mAb 4G10(Upsate Biotechnology Inc), followed byanti-mouse immunoglobulins conjugatedto horseradish peroxidase (Amersham)and were revealed by the enhanced chemi-luminescence method according to themanufacturer’s instructions (Amersham).

In Vitro Kinase AssayKinase assays were essentially per-

formed as described by Hivroz et al.19

Autophosphorylation of p60c-Src was de-termined on mAb 327 immunoprecipi-tates in kinase buffer (50 mmol/L piper-azine-N, N´-bis[2-ethanesulfonic acid]-OH, pH 7.5, 10 mmol/L MnCl2 andMgCl2, and 0.1 mmol/L sodium orthovanadate, 2% aprotinin, 1 mmol/Lphenylmethylsulfonyl fluoride) contain-ing 10 µCi of [γ32 P] adenosine triphos-phate (6000 Ci/mmol, Amersham). Phos-phorylation of an exogenous substrate byp60c-src was conducted in the same man-ner, except that 2 mg of acid-denaturedenolase (Sigma) and 5 mmol/L coldadenosine triphosphate were added tothe kinase buffer. Radiolabeled proteins

Patient Age at Parental SpecificNo. diagnosis (mo) consanguinity treatment Outcome

1 1 Yes 0 Dead2 7 Yes mmBMT Dead3 2 Yes mBMT Alive4 4.5 Yes 0 Dead5 5 Yes mmBMT Dead6 2 Yes 0 Dead7 1 Yes 0 Dead8 4 Yes 0 Dead9 1 No INF-γ Dead

10 4 Yes 0 Dead11 1 Yes mBMT Alive12 4 Yes mBMT Alive13 4 No 0 Dead

mBMT, Matched related donor bone marrow transplantation; IFN-γ, interferon-γ therapy; mmBMTmismatched related donor bone marrow transplantation.

Table I. Clinical presentation of the patients

Fig 1. PCR amplification of human c-src gene and localization of primers used. Five regions (A, B, C, D, and E) have been amplified by PCR and sequenced aftercloning in PCRII vector. Numbers in squares represent primers. For each amplified region, the primers used are indicated. A (294 bp), 1: 5´-CCGGCAGCCCTGC-CTGTTCCAGTGTCTTCTCTCTCTCCTG-3´; 2: 5´-CGCCCTCTGCGGGGAGGTGACGGTGTCCGAGGAGTTGAAG-3´. B (192 bp), 3: 5´- GAGCCCAAGCT-GTTCGGAG-3´; 4: 5´- CAGCCACCAGTCTCCCTCT-3´. C (384 bp), 5: 5´- AGCGGCTCCAGATTGTCAAC -3´. 6: 5´- GTGTTTGGAGTAGTAGGCCA-3´. D(958 bp), 7: 5´-GTTCAACAGCCTGCAGCAGCT-3´. 8: 5´- GCCCGCCTGTGCCTAGAGGTTCT-3´. E (459 bp), 9: 5´- CTGGTGGGAGAGAACCTGG-3´. 10: 5´-AAGCCGAGAAGCCGGTCT-3´. Genomic DNA was used for amplification of region A and cDNA for regions B, C, D, and E.

THE JOURNAL OF PEDIATRICS BERNARD ET AL

VOLUME 133, NUMBER 4

normal range or increased. The percent-age of osteoclasts with ruffled borderswas also variable. In 3 cases (patients 2, 9,and 12), expression and subcellular local-ization of p60c-Src were determined byusing high-resolution immuno electronmicroscopy with the anti-p60c-Src mAb32721 and were found to be normal.

Microsatellite AnalysisThe intrafamilial segregation of poly-

morphic microsatellites located inside thec-src gene was analyzed.22 Children bornto consanguineous parents are more like-ly to be homozygous for a mutant allele.Microsatellite homozygosity wouldprompt further investigation, and het-erozygosity would argue against a rolefor the c-src gene. Five children werescreened because of consanguinity andavailability of familial samples (Table II).Only patient 2 was homozygous and thusunderwent further evaluation.

Expression of p60c-Src inFibroblasts and EBV Cell Lines

We studied the expression of thep60c-Src protein in different cell typesfrom the 9 patients who could not be ex-

539

were resolved on 8% sodium dodecylsul-fate polyacrylamide gels, visualized by au-toradiography, and quantified with aPhosphor Imager (Molecular Dynamics).

Polymerase Chain ReactionAmplification of the Humanc-src Gene and Sequencing

Complementary DNA was obtainedby reverse-transcriptase PCR performedon RNA from EBV B-cell lines by usinga c-src–specific oligodeoxy nucleotide lo-cated at the 3´ site of the coding region ofthe c-src gene (5´- AAGCCGAGAAGC-CGGTCT-3´). Amplification of 4 regions(B, C, D, and E) of this cDNA (Fig 1)were obtained by PCR. Amplification ofthe most 5´ region (region A) was per-formed by PCR on genomic DNA fromthe patients, with an upstream primerchosen from the intronic region 5´ of theATG initiation codon. The genomic se-quence of the intronic region was ob-tained from a clone (pEco/Nco 1.0)kindly given by Dr Keith Bonham(Saskatoon Cancer Centre, Saskatoon,Saskatchewan, Canada), which contains1.0 kb of genomic DNA upstream of theNco I site found around the ATG initia-

tion site in exon 2. Amplification of thisregion by PCR was only possible withstringent conditions of annealing andelongation as described by Korge et al.20

PCR products were purified and sub-cloned into the pCRII vector (Invitro-gen) before DNA sequencing was per-formed with the Thermosequenase kitaccording to the manufacturer’s instruc-tions (Amersham).

RESULTS

Osteoclast StudyBiopsy specimens of iliac crests were

available in 10 cases; the percentage ofbone surface covered by osteoclasts andthe percentage of osteoclasts exhibitingruffled membranes were measured ontoluidine blue–stained sections as previ-ously described.4 Only extensively devel-oped ruffled membranes covering a largepart of the cell in contact with the bonesurface were measured because small cy-toplasmic folds are not visible by light mi-croscopy. For each patient, sections from2 to 3 blocs were examined. As shown inTable II, the percentage of bone surfacecovered by osteoclasts was variable, in the

Bone phenotype*

Bone surface Osteoclasts Microsatellite Protein profilePatient covered with ruffled Immuno study SequenceNo. by osteoclasts (%) borders (%) EM and results† WB IP IVKA cDNA

1 —‡ — – +‡ Excluded – – – –2 10.5 36 + + Excluded + + + +3 13.3 29 – + Excluded – – – +4 17 — – + Excluded – – – –5 4.4 31 – + Excluded – – + +6 — — – – + – + –7 4.8 28 – – + – +NS‡ +8 6 40 – – + – +NS +9 32 17 + – + + +NS +

10 13 38 – – + + – +11 7 75 – – + – – –12 33.9 53 + – + – – +13 — — – – + – + –

Immuno EM, Immuno electron microscopy; WB, Western blot analysis on total postnuclear lysates; IP, Immunoprecipitation; IVKA, in vitro kinase assay.*In control subjects of 4 years of age, percent bone covered with osteoclasts ranges from 4.1 to 5.9 and the percent of osteoclasts with ruffled borders is from

46% to 53%.5†Microsatellite study was performed by using the src 11 markers (Genbank, mnemonics HUM SRC20Q) as described in reference 22.‡Plus sign (+), Done; +NS, done not shown; minus sign (–), not done.

Table II. Biologic studies of the patients

BERNARD ET AL THE JOURNAL OF PEDIATRICS

OCTOBER 1998

540

cluded by microsatellite study. Postnu-clear lysates of EBV B-cell lines or fi-broblasts were directly immunoblottedwith mAb 327 (Fig 2, A) or submitted toanti-p60c-Src immunoprecipitation andthen immunoblotted with mAb 327 (Fig2, C). Results obtained on p60c-Src im-munoprecipitates or postnuclear lysatesshowed normal p60c-Src expression in allthe patients tested.

Phosphorylation and KinaseActivity of p60c-Src in EBV B-cellLines

As shown in Fig 2, B, a normal patternof tyrosine phosphorylation was ob-served on lysates from EBV B cells ob-tained from all the patients tested. Nosignificant difference in intensity wasseen for a highly tyrosine phosphorylat-ed band migrating at an apparent molec-ular weight of 60 kd and correspondingto the band revealed by the anti-p60c-Src

mAb 327. The protein tyrosine kinasep60c-Src was similarly tyrosine phospho-rylated and expressed in EBV B-celllines from 3 patients and in a control B-cell line (Fig 2, D and E). Similar resultswere observed on immunoprecipitatesobtained from primary fibroblasts andfrom other patients (data not shown).

Finally, to directly assess the kinase ac-tivity of p60c-Src in the patients’ cells, weperformed in vitro kinase assays on mAb327 immunoprecipitates. Autophosphor-ylation of p60c-src and phosphorylation ofenolase were comparable in the 4 patientsand in the 2 control EBV cell lines shownin Fig 3. Similar results were obtained oncells from other patients (data not shown).

Sequence of the Coding RegionRecent studies showed that c-Src ki-

nase activity is not required for c-Srcfunction in fibroblasts23 or in osteo-clasts.24 Thus normal activity of p60c-src

does not formally rule out the presenceof mutations that can play a role in itsfunction. We thus sequenced the wholecoding region of the c-src gene in 8 pa-tients, including patient 2 who could notbe excluded by the microsatellite study.*

Sequences obtained from the 8 pa-tients were identical to the published se-

Fig 2. p60c-src is normally expressed and phosphorylated in cells from the patients. A, Postnuclear lysatesfrom patients and control EBV B-cell lines (CTL) were submitted to Western blot analysis in the presenceof the anti-p60c-Src mAb 327. B, After stripping and blocking, the membrane was probed with the anti-phosphotyrosine mAb 4G10. C, Postnuclear lysates from EBV B-cell lines or primary fibroblasts of normaldonors (CTL2 and CTL3) or of patients were immunoprecipitated with mAb 327. Immune complexes wereprobed with mAb 327. p60c-Src immunoprecipitate obtained from the lysate of platelets is shown as con-trol (CTL1). D, Postnuclear lysates from EBV B-cell lines of a normal donor (CTL) or of 3 patients were im-munoprecipitated with mAb 327. Immune complexes were probed with mAb 327, or after stripping, withthe 4G10 mAb as shown in E. M.W., Molecular weight. *References 2, 3, 5, 7-10, and 12.

THE JOURNAL OF PEDIATRICS BERNARD ET AL

VOLUME 133, NUMBER 4

mains elusive. Any abnormality in thebone resorptive process would potential-ly lead to osteopetrosis. Indeed, thisprocess involves numerous factors, in-cluding osteoblast-osteoclast interac-tions, extracellular matrix molecules, andcorrect differentiation of osteoclasts. Al-terations in the composition of the bonematrix proteins can alter osteoclast re-cruitment and activity, as shown in theosteopetrotic rat model in which the levelof osteocalcin is reduced.32 Because inte-grin is required for proper bone resorp-tion,33 any defect in matrix-derivedsignal and adhesion steps involving per-turbation between membrane receptorsof the integrin family, located on osteo-clasts, and bone matrix proteins can im-pair resorption.34-36

It has been shown in osteoclasts thatc-Cbl is downstream of c-src in a signal-ing pathway necessary for bone resorp-tion and is not phosphorylated in thecells derived from src–/– mice.37 Thus

541

c-Cbl may be another gene candidate inosteopetrosis.

Bone remodeling and resorption mayalso be regulated by the bone marrowmicroenvironment. Lajeunesse et al38

identified an osteoblast defect in 2 pa-tients who were first seen with malignantosteopetrosis. The osteoblast defect wascorrected after bone marrow transplan-tation, suggesting that it may restore across-talk between donor osteoclasts andrecipient osteoblasts, rescuing the func-tion of the latter.

Many genetic and metabolic defects in-terfering with osteoclast adhesion andsignaling pathways or defects of the bonemarrow environment may account forthe disease. Direct assessment of thefunction of the osteoclasts in the patientsmay allow better characterization of thedefects in malignant osteopetrosis. Un-fortunately, collection and in vitro ex-pansion of mature functional human os-teoclasts are not routinely performed and

quence of the human c-src cDNA (TableII).25,26

DISCUSSION

We chose to study the role of p60c-Src inthe pathogenesis of the autosomal reces-sive form of osteopetrosis because thisform shows striking similarities to an ani-mal model of osteopetrosis, the src–/–

mouse.13 As previously reported in os-teopetrosis,3 some patients exhibit osteo-clasts with few or no ruffled borders.4,5 Inour study, patients were heterogeneouswith respect to osteoclast number andpercentage of ruffled borders, as reportedby other investigators.3-5 Although inmost of our patients the percentage of os-teoclasts with ruffled borders was de-creased, suggesting a phenotype similar tothe src–/– mouse, mutation of src was notresponsible for their disease. It is worthnoting that in the src–/– mice no ruffledborder formation was observed13; thus, itis possible that some patients with os-teopetrosis who present with a completeabsence of ruffled borders may be shownto have src mutations.

A previous study ruled out a role for c-src in the pathogenesis of malignanthuman osteopetrosis.27 However, thisstudy was performed on the fibroblastsof only 3 children, and only biochemicaldata were available. The diversity of his-tologic presentations suggests that “auto-somal recessive osteopetrosis” may beconsidered as more of a generic termthan as a unique model. This is support-ed by the vast number of animal modelsfor the disease. In the osteopetrotic op/opmouse, the mutation is in the coding re-gion of the CSF-1 gene,28 resulting in theabsence of M-CSF in serum and tissuesof these animals.29 It is unlikely that asimilar defect exists in human beings, be-cause normal M-CSF serum levels havebeen reported in a large group of patientsby Orchad et al30 and in 10 patients fromour hospital.31 In the fos–/– mouse andthe double-knockout mouse NFκB1–/–,NF-κB2–/–,a complete absence of osteo-clast formation is reported and associat-ed with immunologic disorders.14-16

In the human malignant form of os-teopetrosis, the pathogenesis thus re-

Fig 3. In vitro kinase assays show normal activity of p60c-Src in EBV B-cell lines of patients with osteope-trosis. Lysates from EBV B-cell lines of 2 normal donors (CTL1, CTL2) or 4 patients were immunoprecipitat-ed with mAb 327. Immune complexes and purified p60c-Src enzyme, used as a control for the assay, wereincubated with 10 µCi of [γ32 P] adenosine triphosphate in the absence (A) or presence of acidic dena-tured enolase (B). Phosphorylation of p60c-Src and enolase was analyzed and quantified with a PhosphorImager (Molecular Dynamics).

BERNARD ET AL THE JOURNAL OF PEDIATRICS

OCTOBER 1998

542

were not available for investigation inthis study.

We thank Dr Keith Bonham from the SaskatoonCancer Centre, who provided us with a clone con-taining genomic DNA of the human c-src gene.

REFERENCES1. Whyte MP. Recent advances in osteope-

trosis. In: Calcium regulating hormonesand bone metabolism. Elsevier SciencePublishers BV; 1992. p. 563-89.

2. Loria-Cortès R, Quesada-Calvo E,Cordero-Chaverri C. Osteopetrosis inchildren: a report of 26 cases. J Pediatr1977;91:43-7.

3. Felix R, Hofstetter W, Cechini MG. Re-cent developments in the understandingof the pathophysiology of osteopetrosis.Eur J Endocrinol 1996;134:143-56.

4. Cournot G, Trubert-Thil CL, PetrovicM, Boyle A, Cormier C, Girault D, et al.Mineral metabolism in infants with ma-lignant osteopetrosis: heterogeneity inplasma 1,25-dihydroxyvitamin D levelsand bone histology. J Bone Miner Res1992;7:1-10.

5. Shapiro, F, Key LL, Anast C. Variableosteoclast appearance in human infantileosteopetrosis. Calcif Tissue Int1988;43:67-76.

6. Gerritsen E, Vossen M, Fasth A,Friedrich W, Morgan G, Padmos A, et al.Bone marrow transplantation for autoso-mal recessive osteopetrosis. J Pediatr1994;125:896-902.

7. Sly WS, Whyte MP, Sundaram V,Tashiam RE, Hewett-Emmet D,Guibaud P, et al. Carbonic anhydrase IIdeficiency in 12 families with the autoso-mal recessive syndrome of osteopetrosiswith renal tubular acidosis and cerebralcalcifications. N Engl J Med 1985;313:139-45.

8. Mark SC Jr, Walker DG. The hematoge-nous origin of osteoclasts: experimentalevidence from osteopetrotic (microph-thalmic) mice treated with spleen cellsfrom beige mouse donors. Am J Anat1981;161:1-10.

9. Marks SC Jr, Schneider GB. Transfor-mations of osteoclast phenotype in ia ratscured of congenital osteopetrosis. J Mor-phol 1982;174:141-7.

10. Marks SC Jr, Seifert MF, McGuire JL.Congenitally osteopetrotic (op/op) miceare not cured by transplants of spleen orbone marrow cells from normal litter-mates. Metab Bone Dis Relat Res1984;5:183-6.

11. Mark SC Jr. Osteopetrosis in the tooth-less (tl) rat: presence of osteoclasts butfailure to respond to parathyroid extractor to be cured by infusion of spleen or

bone marrow cells from normal litter-mates. Am J Anat 1977;149:289-97.

12. Popoff SN, Marks SC Jr. Congenitallyosteosclerotic (os/os) rabbits are notcured by bone marrow transplantationfrom normal littermates. Am J Anat1991;192:274-80.

13. Soriano P, Montgomery C, Geske R,Bradley A. Targeted disruption of the c-src proto-oncogene leads to osteopetrosisin mice. Cell 1991;64:693-702.

14. Wang ZQ, Ovitt C, Grigoriadis AE,Möhle-Steinlein U, Rüther U, WagnerEF. Bone and haematopoietic defects inmice lacking c-fos. Nature 1992;360:741-5.

15. Franzoso G, Carlson L, Xing L, PoljakL, Shores EW, Brown KD, et al. Re-quirement for NF-kB in osteoclast andB-cell development. Genes Dev 1997;11:3482-96.

16. Iotsova V, Caamano J, Loy J, Yang Y,Lewin A, Bravo R. Osteopetrosis in micelacking NF-κB1 and NF-κB2. NatureMed 1997;3:1285-9.

17. Boyce BF, Yoneda T, Lowe C, Soriano P,Mundy GR. Requirement of pp60 c-srcexpression for osteoclasts to form ruffledborders and resorb bone in mice. J ClinInvest 1992;90:1622-7.

18. Simon H, Mills GB, Hashimoto S, Simi-novitch KA. Evidence for defectivetransmembrane signalling in B cells frompatients with Wiscott Aldrich syndrome.J Clin Invest 1992;90:1396-401.

19. Hivroz C, Mazerolles F, Soula M, Fa-gard R, Graton S, Meloche S, et al.Human immunodeficiency virus gp120and derived peptides activate protein ty-rosine kinase p56lck in human CD4 Tlymphocytes. Eur J Immunol 1993;23:600-7.

20. Korge BP, Gan SQ, McBride OW, Mis-chke D, Steinert PM. Extensive sizepolymorphism of the human keratin 10chains resides in the C-terminal V2 sub-domain due to variable numbers andsizes of glycine loops. Proc Natl Acad SciUSA 1992;89:910-4.

21. Trubert C-L, Bernard F, Hivroz C, Car-lioz A, Fischer A, Cournot G. PP60c-Srcexpression in osteoclasts from os-teopetrotic children and giant tumorcells. Eur J Histochem 1997;41:169-76.

22. Xiang K, Philippe G, Seino M, BonhamK, Fugita DJ, Bell GI. Dinucleotide re-peat polymorphism in the human SRCgene on chromosome 20. Nucleic AcidsRes 1991;19:6967-8.

23. Kaplan, KB, Swedlow JR, Morgan DO,Varmus HE. c-Src enhances the spread-ing of src -/- fibroblasts on fibronectin bya kinase-independent mechanism. GenesDev 1995;9:1505-17.

24. Schwartzberg PL, Xing L, Hoffmann O,Lowell CA, Garett L, Boyce BF, et al.Rescue of osteoclast function by trans-

genic expression of kinase-deficient Srcin src-/- mutant mice. Genes Dev 1997;11:2835-44.

25. Tanaka A, Gibbs CP, Arthur RR, Ander-son SK, Kung HJ, Fujita DJ. DNA se-quence encoding the amino-terminal re-gion of the human c-src protein:implications of sequence divergenceamong src-type kinase oncogenes. MolCell Biol 1987;7:1978-83.

26. Anderson SK, Gibbs CP, Tanaka A,Kung HJ, Fujita DJ. Human cellularsrc gene: nucleotide sequence and de-rived amino acid sequence of the regioncoding for the carboxy-terminal two-thirds of pp60 c-src. Mol Cell Biol1985;5:1122-9.

27. Meyerson G, Dahl N, Pahlman S. Malig-nant osteopetrosis: c-src kinase is not re-duced in fibroblasts. Calcif Tissue Int1993;53:69-70.

28. Yoshida H, Hayashi S, Kunisada T,Ogawa M, Nishikawa S, Okamura H, etal. The murine mutation osteopetrosis isin the coding region of the macrophagecolony stimulating factor gene. Nature1990;345:442-4.

29. Wiktor-Jedrzedjczak W, Bartocci A,Ferrante AW Jr, Ahmed-Ansari A, SellKW, Polaard JW, et al. Total absence ofcolony-stimulating factor 1 in themacrophage-deficient osteopetrotic (op/op)mouse. Proc Natl Acad Sci USA 1990;87:4828-32.

30. Orchad PJ, Dahl N, Aukerman SL,Blazar BR, Key LL. Circulatingmacrophage-colony stimulating factor isnot reduced in malignant osteopetrosis.Exp Hematol 1992;20:103-5.

31. Naffakh N, Le Gall S, Cournot G, VilmerE, Danos O, Heard JM. Macrophage-colony stimulating factor: serum levelsand cDNA structure in malignant os-teopetrosis. Blood 1993;81:2817-8.

32. Lian JB, Marks SC Jr. Osteopetrosis inthe rat: coexistence of reductions in os-teocalcin and bone resorption. En-docrinology 1990;126:955-62.

33. Davies J, Warwick J, Totty N, Philp R,Helfrich M, Horton M. The osteoclastfunctional antigen, implicated in the reg-ulation of bone resorption, is biochemi-cally related to the vitronectin receptor.J Cell Biol 1989;109:1817-26.

34. Ross FP, Chappel J, Alvarez JI, SanderD, Butler WT, Farach-Carson MC, et al.Interactions between the bone matrixproteins osteopontin and bone sialopro-tein and the osteoclast integrin αvβ3 po-tentiate bone resorption. J Biol Chem1993;268:9901-7.

35. Zambonin Zallone A, Teti A, Grano M,Rubinacci A, Abbadini M, Gaboli M, etal. Immunocytochemical distribution ofextracellular matrix receptors in humanosteoclast. A β3 integrin is colocalizedwith vinculin and talin in the podosomes

THE JOURNAL OF PEDIATRICS BERNARD ET AL

VOLUME 133, NUMBER 4

543

of osteoclastoma giant cells. Exp Cell Res1989;182:645-52.

36. Chenu C, Colucci S, Grano M, ZigrinoP, Barattolo R, Zambonin G, et al. Os-teocalcin induces chemotaxis, secretionof matrix proteins, and calcium-mediatedintracellular signaling in human osteo-

clast-like cells. J Cell Biol 1994;127:1149-58.

37. Tanaka S, Amling M, Neff L, Peyman A,Uhlmann E, Levy JB, et al. c-Cbl isdownstream of c-src in a signalling path-way necessary for bone resorption. Na-ture 1996;383:528-31.

38. Lajeunesse D, Busque L, Ménard P,Brunette MG, Bonny Y. Demonstrationof an osteoblast defect in two cases ofhuman malignant osteopetrosis. J ClinInvest 1996;98:1835-42.

50 Years Ago in The Journal of PediatricsPERTUSSIS IN INFANCY

Rizzo ND. J Pediatr 1948;33:300-12

Fifty years ago, Rizzo reported 137 infants aged less than 2 years, hospitalized in Boston, with pertussis during 1931 to 1945.This study was performed during the prevaccine and pre-erythromycin era, when pertussis incidence peaked at 260,000 re-ported cases and 9000 deaths in 1934. Laboratory diagnosis of pertussis was difficult, that is, positive cultures of Bordet-Gengou plates and nasopharyngeal swabs. Complications occurred frequently, including pneumonia, encephalitis, andseizures. Most cases developed after exposures to siblings with pertussis. Seven patients received “prophylactic injections ofpertussis antigen.” Two had adequate injections of the “Sauer vaccine,” and both recovered. Therapies included supportivemeasures in 71 patients; supportive measures and sulfonamides in 12; pertussis hyperimmune serum, supportive care, and sul-fonamides in 29; and serum with supportive therapy in 16. There was no difference in mortality between serum-treated andnon-serum–treated cases. In Massachusetts, pertussis mortality declined during the period, possibly because of introduction ofsulfonamides for treatment of pneumonia complication and pertussis immunization, as well as improved supportive care.

Pertussis remains a major cause of morbidity and mortality worldwide, with more than 60,000,000 reported cases andmore than 355,000 deaths annually. Use of whole-cell DTP vaccines had resulted in a decline in pertussis incidence. Therehas been a resurgence of pertussis in highly immunized1 and underimmunized populations; 7796 cases were reported in1996, the most in 29 years. Reduced efficacy of 36% and 48% of one major whole-cell pertussis vaccine in the United Stateswas confirmed in 2 NIH-sponsored, randomized, double-blind, controlled trials.2,3 Today, 17% to 26% of adults with pro-longed cough have pertussis with waning immunity over 3 to 12 years, resulting from reduced vaccine efficacy. Adults are themajor reservoir of Bordetella pertussis to susceptible infants. This recent pertussis resurgence in the United States is attributedto increased surveillance and reduced potency of 1 of 2 major whole cell DTP vaccines.1-3 Several acellular pertussis vaccineswith increased safety and efficacy profiles2,3 have been licensed and approved for all 5 doses of the childhood immunizationschedule in the United States. At present, many suggest use of acellular pertussis vaccines in adults as the most cost-effectivemethod to control disease. Therefore investigation of the safety and efficacy of acellular pertussis vaccines in adults in anNIH-sponsored, multicenter, randomized, controlled trial is underway. Pertussis diagnosis is improved with the use of sero-logic and polymerase chain reaction tests. Clarithromycin and newer macrolides are available, in addition to erythromycinprophylaxis and therapy, and a modern controlled trial of pertussis-specific immunoglobulin is in progress.

Celia D. C. Christie, MDAssociate Professor of Pediatrics

Infectious Diseases and EpidemiologyUniversity of Cincinnati College of Medicine

Cincinnati, OH 45229

REFERENCES1. Christie CD, Marx ML, Marchant CD, Reising SR. The 1993 epidemic of pertussis in Cincinnati: resurgence of disease in

a highly immunized population of children. N Engl J Med 1994;331:16-21.2. Greco D, Salmaso S, Mastrantonio P, Giuliano M, Tozzi AE, Anemona A, et al. A controlled trial of two acellular vaccines

and one whole-cell vaccine against pertussis. N Engl J Med 1996;334;341-8.3. Gustafsson L, Hallander HO, Olin P, Reizenstein E, Storsaeter J. A controlled trial of a two-component acellular, a five-

component acellular, and a whole-cell pertussis vaccine. N Engl J Med 1996;334:349-55.