THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 268, No. 14, Issue of May 15, pp. 10380-10385,1993 Printed in U.S.A.

Tissue-specific Expression and Chromosomal Localization of the cx Subunit of Mouse Meprin A*

(Received for publication, October 21, 1992, and in revised form, December 18, 1992)

Weiping JiangSI, Philip M. SadlerS, Nancy A. Jenkinsfl, Debra J. Gilbertfl, Neal G. Copelandll, and Judith S. BondSII From the $Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061-0308 and the llMammalian Genetics Laboratory, Advanced BioScience Laboratories, Inc.-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21 702

Meprins, membrane-bound oligomeric metalloendo- peptidases, contain a and/or 8 subunits. Their activities have been found in the mouse and rat kidney. The cloned cDNA for the mouse a subunit of meprin A (EC 3.4.24.18) was used here to survey mRNA expression in kidney of different mouse strains and in various tissues of mice and rats. A single message of 3.6 kilo- bases was found in kidney of random bred (ICR) and inbred mice (C67BL/6, DBA/2) that contain high me- prin A activity and in Sprague-Dawley rat kidney. The a subunit message was undetectable in the kidney of C3H/He and CBA mice, inbred strains that do not ex- press meprin A activity. Therefore, meprin A activity in the kidney of mouse strains correlates with the amount of ct subunit mRNA present. The 3.6-kilobase mRNA meprin a subunit message was also detected in the small intestine of the rat but not in mice. No mes- sage was detected in brain, heart, skeletal muscle, liver, lung, or spleen of mice or rats. Polymerase chain reaction amplification or Southern blot analysis of ge- nomic DNA revealed that the gene for the a subunit is present in all mouse strains as well as in human, mon- key, rat, mouse, dog, cow, rabbit, and chicken, but it was not detected in yeast. There is one gene copy present in the mouse genome. The gene was localized to mouse chromosome 17 centromeric to the major histocompatibility complex (H-2) by the interspecific backcrossing method. The localization of this allele to Mep-1, the gene previously found to regulate the expression of meprin A activity in mice, supports the proposal that Mep-1 is the structural gene for the a subunit.

Meprins are cell surface oligomeric glycoproteins that have metalloendopeptidase activity. They were first isolated from mouse kidney and are expressed at high levels in the brush border membrane of kidney proximal tubule cells (Beynon et al., 1981). Meprin A (EC 3.4.24.18) refers to the enzyme

* This work was supported by the National Institutes of Health Grant DK 19691 (to J. S. B.) and by the National Cancer Institute, Department of Health and Human Services, under Contract N01- CO-74101 with Advanced Bioscience Laboratories, Inc. (to N. A. J.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address: Dept. of Biological Chemistry, Penn State Uni- versity College of Medicine, Hershey, PA 17033.

)I To whom correspondence and reprint requests should be ad- dressed. Present address: Dept. of Biological Chemistry, Penn State University College of Medicine, Hershey, PA 17033. Tel.: 717-531- 8586; Fax: 717-531-7072.

isolated from kidney of certain inbred mouse strains (such as C57BL/6) and from random bred mice (such as ICR mice) that exhibits high azocasein-degrading activity. Meprin B refers to the enzyme isolated from kidney of other inbred mouse strains (such as C3H/He) that has low and latent azocasein-degrading activity. Meprin B activity can be acti- vated in oitro by treatment with trypsin-like proteinases (Butler and Bond, 1988). An enzyme that is catalytically and structurally similar to mouse meprin A (previously called “endopeptidase-2”) has been isolated from rat kidney (Kenny and Ingram, 1987). Mouse and rat meprins are oligomeric glycosylated proteins with disulfide-linked subunits. They are capable of hydrolyzing proteins such as azocasein as well as polypeptides such as insulin B chain. Meprins are totally inhibited by metal chelators such as EDTA and 1,lO-phen- anthroline but not by phosphoramidon, an inhibitor of some metalloendopeptidases such as thermolysin and neprilysin (EC 3.4.24.11, formerly referred to as neutral endopeptidase 24.11, NEP, or enkephalinase).

Recent biochemical characterization of membrane-bound forms of mouse meprins revealed that they can exist as hetero- oligomeric or homo-oligomeric proteins (Gorbea et al., 1991). Three tetrameric forms, ad, a&, and p4, were identified in mouse kidney brush border membranes. The a4 and a& forms are associated with meprin A activity. The p4 form is associ- ated with meprin B activity. All mouse strains contain the p subunit (110 kDa), but only certain strains contain the CY

subunit (90 kDa). Rat meprin also contains two different types of subunits with molecular weights of 80,000 and 74,000 (Kenny and Ingram, 1987). Based on comparisons of the NH2- terminal sequences of these two subunits with those of the mouse subunits, it has been concluded that the 80-kDa sub- unit is equivalent to the mouse a subunit (90 kDa), and the 74-kDa subunit is equivalent to the mouse /3 subunit (110 kDa) (Jiang et al., 1992). Rat meprin appears to be a tetramer, as judged by gel filtration. Under nonreducing conditions, rat meprin can be dissociated into disulfide-linked heterodimers consisting of CY and /3 subunits (Johnson and Hersh, 1992).

Previous work demonstrated that several inbred strains of mice are deficient in meprin A and that the activity deficiency is associated with a lack of the 90-kDa a subunit protein in the kidney brush border membrane (Beynon and Bond, 1983, 1985). Recombinant and congeneic mouse strains were used to map the position of the gene involved in the expression of the a subunit (Reckelhoff et al., 1985). The gene, Mep-1, was localized to mouse chromosome 17 near the H-2 complex (Bond et al., 1984). Mep-1 could be the structural gene for the a subunit or it could regulate the expression of the CY structural gene located elsewhere in the genome. Until the present work, there was no additional information to support either of these two possibilities.

10380

Expression of the a Subunit of Meprin A 10381

Molecular cloning and sequencing of the a subunit of mouse meprin A has provided important information on the primary structure of the a subunit and probes to study the expression of the subunit (Jiang et al., 1992). Initial studies using the cloned cDNA for the a subunit revealed that a single mRNA species of 3.6 kilobases (kb)' was abundant in the kidney of C57BL/6 mice and absent in the kidney of C3H/He mice. This observation indicated that high and low meprin activity in the kidney of inbred mouse strains correlated with the amount of a subunit mRNA present. The present work ex- tends that observation to other mouse strains and explores the expression of the a subunit mRNA in mouse and rat tissues.

The data herein support the hypothesis that the deficiency of meprin A activity, and the meprin a subunit protein in certain mouse strains, is due to a lack of the mRNA for the subunit. The expression of the a subunit mRNA was found to be kidney-specific in mice that have meprin A activity and kidney- and intestine-specific in the rat. Furthermore, the 01

subunit gene is shown to be present in several higher orga- nisms and once in the mouse genome. In addition, the struc- tural gene ( M e p - l a ) for the a subunit of mouse meprin A was localized to the Mep-I locus of mouse chromosome 17 by the interspecific backcrossing method.

EXPERIMENTAL PROCEDURES

Materials-Enzymes, including restriction endonucleases and DNA polymerase (Klenow fragment), and Prime-a-Gene Labeling System were purchased from Promega. The GENECLEAN I1 kit was from BIO 101. The radioisotope-labeled compound ([a-32P]dCTP) was obtained from Du Pont-New England Nuclear. Pure nitrocellu- lose membranes and nylon membranes (Micron Separation Inc.) were from Bio-Rad and Fisher, respectively. X-ray films (type XAR 5) were obtained from Kodak. Solvents, including phenol, chloroform, and isopropyl alcohol, and chemicals such as guanidine thiocyanate (GITC) were purchased from Fisher. All other chemicals, including diethyl pyrocarbonate (DEPC), were from Sigma.

Sources of Animaki-Adult male mice (strains of C57BL/6, C3H/ He, ICR) were obtained from Dr. Francis Gwazdauskas of the De- partment of Dairy Science at Virginia Polytechnic Institute and State University. Other adult male mice (strains of CBA and DBA/2) were purchased directly from Jackson Laboratories. Rats (Sprague-Daw- ley) were obtained from Harlan Industries, Indianapolis, IN.

Isohtion and Labeling of the cDNA Fragments Used in Hybridiza- tion Experiments-Plasmid DNA was isolated from Escherichia coli using the alkaline lysis method (Birnboim and Doly, 1979). DNA preparations were digested with an appropriate restriction endonu- clease such as EcoRI and were then subjected to agarose gel electro- phoresis in the presence of ethidium bromide (0.5 pg/ml). The DNA fragments containing coding regions of the a subunit were excised from gels and purified using the GENECLEAN kit according to the manufacturer's procedure. Yields and concentrations of DNA frag- ments were estimated by running a sample on agarose gel electropho- resis and comparing signal intensities of these fragments with known DNA markers. The isolated DNA fragments (25 ng) were labeled with 32P (50 pCi) using the Prime-a-Gene System. Efficiencies of radioisotope incorporations were determined after thin layer chro- matography (TLC) (polyethyleneimine cellulose, Sigma). The TLC plates were developed in 1 N HC1. The plates were cut into two halves; the top half contained free nucleotides, and the bottom half contained labeled fragments. Radioactivities were measured in a scintillation counter, and incorporation efficiencies were calculated. More than 50% of the radioisotopes were incorporated into labeled fragments. Usually, 5 X lo' cpm were incorporated into labeled fragments. The labeled fragments were used directly, without further purification, in hybridization experiments.

Isolation of Total RNA from Mammalian Tissues-Total RNA was

'The abbreviations used are: kb, kilobase(s); GITC, guanidine thiocyanate; DEPC, diethyl pyrocarbonate; PCR, polymerase chain reaction; RFLPs, restriction fragment length polymorphisms; nt, nucleotides; BMP-1, bone morphogenetic protein-1; ACE, angioten- sin I-converting enzyme; Ig, immunoglobulin(s); MHC, major histo- compatibility complex.

isolated from mouse and rat tissues using a modified acid guanidinium thiocyantate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987). All the solutions were prepared in baked glass containers with DEPC-treated water (Sambrook et al., 1989). Briefly, tissues (2 g) were excised from animals and immediately homogenized in 10 ml of GITC solution (4 M GITC, 25 mM sodium citrate, pH 7.0, 0.5% Sarcosyl, and 10 mM mercaptoethanol). Sodium acetate (2 ml of 1 M solution, pH 4.0), water-saturated phenol (10 ml), and chlo- roform (2 ml) were added to the homogenized solutions separately, vortexed, and cooled on ice for 15 min. The mixtures were centrifuged for 20 min in baked corex tubes at 12,000 rpm (4 "C). RNA in the aqueous phase was precipitated with equal volume of isopropyl alcohol at -20 "C. RNA was precipitated by centrifugation, dissolved in GITC solution, and then precipitated with isopropanol. RNA precipitates were washed with 75% ethanol, dried in a Speedvac, and dissolved in a minimal volume (1-2 ml) of DEPC-treated water. Concentrations of RNA samples were calculated based on absorbance at 260 nm. RNA samples were stored at -20 "C after 2 volumes (2-4 ml) of ethanol were added.

Isolation of Chromosomal DNA from Mouse-Genomic DNA was isolated from mouse kidneys using a modified standard procedure (Sambrook et al., 1989). Frozen kidney tissues (2 g) were homogenized in 20 ml of extraction buffer (10 mM Tris/HCl, pH 8.0,O.l M EDTA, 0.5% SDS, and 20 pg/ml RNase A). The homogenized solution was incubated at 37 "C for 1 h. Proteinase K (20 mg/ml) was added to the solution to a final concentration of 0.1 mg/ml. The mixture was incubated at 50 "C for 3 h. The mixture was then extracted with half- volume of phenol equilibrated with Tris/HCl, pH 8.0. Ammonium acetate (7.5 M ) was added to the aqueous phase to a final concentra- tion of 2.5 M. Two volumes of ethanol were layered on the top of the solution, and DNA was spooled by slowly mixing two phases with a Pasteur pipette. DNA was air-dried, eluted from the Pasteur pipette into water, and dissolved by shaking the tube overnight at room temperature. DNA was stored at 4 "C until use.

Northern Blots-RNA blotting experiments were performed essen- tially as described previously (Jiang et al., 1992). There were a few exceptions, however. For example, nylon membranes in addition to nitrocellulose membranes were used for transfer, RNA samples were immobilized on membranes by UV cross-linking instead of baking, and hybridizations of nylon membranes were performed in 30% formamide, 5 X SSPE (100 ml: 4.4 g of NaCl, 0.7 g of NaH2P04.H20, 0.2 g of EDTA, pH 7.4), 10 X Denhardt's reagent (100 ml: 0.2 g of Ficoll, 0.2 g of polyvinylpyrrolidone, 0.2 g of bovine serum albumin), 2% SDS, and 100 pg/ml denatured fragmented salmon sperm DNA.

Amplification of Genomic DNA-Genomic DNA was amplified using the GeneAmp polymerase chain reaction (PCR) kit with AmpliTaq DNA polymerase (Perkin-Elmer Cetus). The optimal MgClz concentration used was 4 mM. The initial denaturation of the genomic DNA (1 pg in 100 p l ) occurred at 94 "C, 5 min. Amplification on the GeneAmp PCR System 9600 (Perkin-Elmer Cetus) was per- formed in the first five cycles: 94 "C, 30 s; 40 "C, 30 s; 72 "C, 1 min. The next 25 cycles were 94 "C, 30 s; 55 "C, 30 s; 72 "C, 1 min with a 5-s increment every cycle. Two synthetic oligonucleotides, based on the a subunit cDNA sequence, were used as primers (100 pmol each) in the first round of the PCR. A portion of the products from the first round of the PCR was diluted 10-fold and was amplified with a different pair of primers using the same thermal cycle parameters. The products from the second round of the PCR were analyzed by agarose gel electrophoresis.

Southern Blots-Genomic DNA was digested with EcoRI or PstI, concentrated by precipitation with ethanol, and subjected to agarose gel electrophoresis. Gels were photographed to measure positions of DNA makers (HindIII-cleaved X DNA). Capillary transfer of DNA samples from gel to nitrocellulose membrane was performed with 10 x SSC (1 liter: 88 g of NaCl, 44 g of sodium citrate, pH 7.0) overnight. Membranes were baked for 1 h at 80 "C in a vacuum oven. Conditions of hybridization were the same as those for Northern blot experi- ments. A zoo blot containing EcoRI-cleaved genomic DNA from several species (Clontech) was also used for hybridization.

Interspecific Backcross Mapping-Interspecific backcross progeny were generated by mating (C57BL/6 X Mus spretus)Fl females and C57BL/6 males as described (Copeland and Jenkins, 1991). A total of 205 N? progeny were obtained a random subset of these N, mice were used to map the Mep-la locus (see text for details). DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, Southern blot transfer, and hybridization were performed essentially as described (Jenkins et al., 1982). All blots were prepared with Zetabind nylon membrane (AMF-Cuno). The meprin a subunit probe, a 1.1-kb mouse cDNA, was labeled with [ O ~ - ~ ' P ] ~ C T P using a nick

10382 Expression of the cy Subunit of Meprin A translation labeling kit (Boehringer Mannheim); washing was done to a final stringency of 0.2 X SSC, 0.1% SDS, 65 "C. Fragments of 12.0, 6.0, and 4.0 kb were detected in Sad-digested C57BL/6 DNA, and fragments of 8.0, 6.8, and 3.6 kb were detected in Sad-cleaved M. spretus DNA. The three M. spretus-specific Sac1 fragments co- segregated, and their presence or absence was followed in backcross mice.

A description of the probes and restriction fragment length poly- morphisms (RFLPs) for the loci linked to Mep- la , including the H- 2 region and preferred integration site, Moloney virus-1 (Pim-I 1, has been reported (Siracusa et al., 1991). Recombination distances were calculated as described (Green, 1981) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns.

RESULTS

When the cloned cDNA for the mouse a subunit was used to probe total RNA isolated from the kidney of several strains of mice, the Q subunit mRNA of 3.6 kb was found to be abundant in three strains of mice (ICR, C57BL/6, and DBA/2) that have high meprin A activity (Fig. 1, left). The message was undetectable in the kidney of two mouse strains C3H/He and CBA that have meprin B but no meprin A activity. As a control, the same RNA blot was probed with the human @-actin cDNA (Fig. 1, right). All the mouse strains tested contained similar amounts of the actin message, indi- cating that the amount and quality of the RNA samples from the different strains of mice were similar. Therefore, the difference in the intensity of the signal for the a subunit message reflects its concentration in the kidney. These results indicate that the lack of meprin A activity in the kidneys of inbred mouse strains correlates with the absence of Q subunit mRNA.

The RNA from several additional tissues from C57BL/6 mice were also probed with the a subunit cDNA (Fig. 2, top). The 3.6-kb Q subunit mRNA was abundant in the kidney but was undetectable in the other tissues tested including brain, heart, liver, lung, skeletal muscle, small intestine, spleen, and testis. There was no a subunit signal detected in the E. coli RNA sample. The lack of detection of a subunit mRNA in mouse tissues other than kidney was not due to the quantity or quality of RNA samples obtained, as determined from probing the same blot with a human @-actin probe (Fig. 2, bottom). The same amount of RNA (20 pg) was present on the blot for each tissue except spleen, where more RNA was added to gels because of an observed partial RNA degradation.

L I L

1 2 3 4 5 1 2 3 4 5 FIG. 1. Expression of the a subunit of meprin A in the

kidney of various mouse strains. Total RNA was isolated using an established procedure (Chomczynski and Sacchi, 1987). RNA samples (20 pg) were subjected to formaldehyde-gel electrophoresis in the presence of ethidium bromide, transferred to nylon membranes, and hybridized to the 32P-labeled a subunit cDNA (left) and the human @-actin cDNA (right). An autoradiogram of 24-h exposure is shown here. Mouse strains were IC, ICR 3H, C3H/He; 57, C57BL/6; CB, CBA; and DB, DBA/2. The 18 and 28 S RNA makers were determined from ethidium bromide-stained gels.

T

I

3 4

I

7 8 9 5 6

0 1 2 3 4 5 6 7 8 9 FIG. 2. Northern Blots of total RNA from various tissues of

C57BL/6 mice. The method used was the same as that in Fig. 1. Total RNA (20 pg in each lane except for spleen where 100 pg was loaded) was probed with mouse a subunit cDNA (top) and with human &actin cDNA (bottom). Sources of RNA were: K, kidney; T, testis; B, brain; H, heart; V, skeletal muscle; V , liver; L, lung; S, spleen; I, small intestine; and E, E. coli. The ribosomal RNA markers (16 and 23 S from E. coli and 18 and 28 S from mouse tissues) were determined on ethidium bromide-stained gels.

Differences in the intensity of the signal for the @-actin message reflect differential expression of actin genes. Most tissues express a single @-actin mRNA of 2.0 kb, whereas heart and skeletal muscle produced a major message of lower molecule weight (a-actin) (Gunning et al., 1987). L' wer ex- pressed the least amount of @-actin message.

Total RNA was also isolated from various tissues of C3H/ He mice and probed with the meprin a subunit cDNA. This was done in order to see whether the a subunit was expressed in tissues other than kidney in these mice that express only meprin B activity in kidney. The a subunit mRNA was not detected in any of the tissues examined, including kidney, brain, heart, liver, lung, small intestine, spleen, and testis (data not shown). From the tissues examined, these results indicate that the expression of the a subunit mRNA is kidney- specific in mice that have meprin A activity and that there is no expression of the Q subunit mRNA in mice that have only meprin B activity.

To determine whether the gene for the a subunit is present in the genomes of mice that do not express its message, a PCR approach was employed to amplify portions of the gene. For the first round of the PCR, the following primer pairs were synthesized. The first pair, PN1 (sense and nt 245-264: CTCGTCAGAATTCGAAATGCCATGCGAGATCCC) and PC1 (antisense and nt 820-840: ATACGGATCCTA- ATGTGTTGCGGTGCAGTTGTA), encode the N and C ter- mini of the protease domain of the a subunit (nucleotides underlined match exactly with the cDNA or its complemen- tary sequence and nt numbers correspond to the positions in the cDNA sequence as reported by Jiang et al., 1992). The second pair, EN1 (sense and nt 2062-2085: GGACGAATT- CATATGTACTTCAGAGACCCCTGTGACCCA) and aC1 (antisense and nt 2279-2299: GAGAGGATCCTCACTGC-

Expression of the cy Subunit of Meprin A 10383

CGCAGCTTTCCGT, encode the N terminus of the epidermal growth factor-like domain and the C terminus of the a sub- unit. Genomic DNA was isolated from mouse kidneys and amplified using these two primer pairs. A portion of the first round of PCR products was amplified using a different pair of primers. For the PNl/PCl amplified products, PN1 and oligo(A) (antisense and nt 373-401: CTCTCTCCTTCATAG- GGCTTGAAATCCAC) were used. For the ENl/aCl ampli- fied products, EN1 and EC1 (antisense and nt 2189-2211:

CATGG) were used. The products from the second round of the PCR were analyzed by agarose gel electrophoresis in the presence of ethidium bromide (Fig. 3). It is clear that the same products were amplified from all mice, including two strains (C3H/He and CBA, lanes 3 and 5 ) that have no a subunit mRNA and two strains (C57BL/6 and ICR, lunes 2 and 4 ) that express abundant a subunit mRNA. The amplified regions are located near the N and C terminus of the a subunit. Therefore, the gene for the a subunit is present in all mouse strains tested, including the mice that do not express the a subunit mRNA. In addition, the corresponding genomic DNA fragments from the second round PCR amplification do not contain introns, because their amplified products have the same length as those from a recombinant plasmid con- taining the a subunit cDNA (lane 1 ).

The cloned cDNA for the mouse a subunit was used to probe RNA isolated from various rat tissues (Fig. 4, top). The rat a subunit message was clearly detected in the kidney (lane 1 ). Some message was also present in the small intestine (lane 4 ) . There was no message detected in the brain, heart, liver, lung, spleen, and muscle (lunes 2, 3, and 5-8). The same rat RNA blot was probed again with the human @-actin cDNA to assess the quality of the RNA isolated from different tissues (Fig. 4, bottom). The tissue distribution of rat actin mRNA was similar to that of mouse actin mRNA. Most tissues expressed a single @-actin mRNA of 2.0 kb, whereas heart and muscle produced a major message of lower molecule weight. Liver expressed the least amount of @-actin message. Overall, the data indicate that the lack of detection of the a subunit mRNA in many rat tissues is not due to the quality or quantity of RNA samples prepared from these tissues. From the tissues examined, these results indicate that expres- sion of the a subunit mRNA of rat meprin is kidney- and intestine-specific; the level of a subunit mRNA is much higher in the kidney than in the small intestine.

The cloned mouse a subunit cDNA was used to probe genomic DNA fragments from several species (Fig. 5). The a subunit gene was detected in human, monkey, rat, mouse,

ATTCTAGAGGATCCTCACAAGCTGCCGTGCACGTG-

1 2 3 4 5 1 2 3 4 5

FIG. 3. PCR amplification of mouse genomic DNA. Products of the second round of the PCR (see text) were detected on ethidium bromide-stained agarose gels. The DNA samples were a plasmid containing the (Y subunit cDNA (P, lune I ) and genomic DNA from C57BL/6 (57), C3H/He ( 3 H ) , ICR ( I C ) , and CBA (CB) mice (lunes 2-5). The primers used were PNl/PCl followed by PNl/oligo(A) ( lef t ) and ENl/aC followed by ENl/ECl (r ight) . bp, base pairs.

28s-

18s-

-I

1 2 3 4 5 6 7 8

K B H I V L S U

28s- q>. I -. i

18s-

- I 1 2 3 4 5 6 7 8

FIG. 4. Northern blots of total RNA from various tissues of Sprague-Dawley rats. The procedure was as described in Fig. 1. Total RNA (20 pg in each lane) was probed with the (Y subunit cDNA ( top) and with human p-actin cDNA (bottom). The abbreviations are: K, kidney; B, brain; H, heart; I, small intestine; V, liver; L, lung; S, spleen; and U, skeletal muscle.

9.4 - 1 6.6 - 4.4 - 2.3 - 2.0 -

;

1 2 3 4 5 6 7 8 9

FIG. 5. Southern blot of chromosomal DNA from several species. The genomic DNA fragments were hybridized with the 32P- labeled clone 713 insert (Jiang et al., 1992). Abbreviations are as follows: H , human; K, monkey; R, rat; M, mouse; D, dog; W, cow; B, rabbit; C, chicken; and Y, yeast.

dog, cow, rabbit, and chicken but was not detectable in yeast (lane 9). These results indicate that the a subunit gene is widely distributed in higher organisms.

The gene copy number of the a subunit was determined for the mouse genome. The EcoRI- and PstI-cleaved mouse chro- mosomal DNA was probed with a 200-base pair cDNA frag- ment (Fig. 6). A single mouse genomic fragment generated by either EcoRI or PstI hybridized to this probe. This result indicates that there is one gene copy for the a subunit present in the mouse genome.

The mouse chromosomal location of Mep-la was deter- mined by interspecific backcross analysis using progeny de- rived from matings of [ (C57BL/6 X Mus spretus)F, X C57BL/ 61 mice. This interspecific backcross mapping panel has been typed for over 1000 loci that are well distributed among all the autosomes as well as the X chromosome (Copeland and Jenkins, 1991). C57BL/6 and M . spretus DNAs were cleaved with several enzymes and analyzed by Southern blot hybrid-

10384 Expression of the N Subunit of Meprin A ::R 4.4 -

2.3 - 2.0 -

1 2 FIG. 6. Southern blot of mouse genome DNA. Genomic DNA

was isolated from mouse kidney (Sambrook et al., 1989). DNA samples (10 pg) were digested with EcoRI (lane E) and PstI ( l a n e P) and were subjected to agarose gel electrophoresis. Samples were subsequently transferred to a nitrocellulose membrane and hybridized to a 3zP- labeled 200-base pair cDNA coding for the the NH2 terminus of mature a subunit.

ization for informative RFLPs using a meprin a subunit probe. The 8.0-, 6.8-, and 3.6-kb M. spretus Sac1 RFLPs (see “Materials and Methods”) were used to follow the segregation of the Mep-la locus in backcross mice. The mapping results indicated that Mep-la is located toward the middle region of mouse chromosome 17 linked to Pim-1 and H-2. Although 119 mice were analyzed for all three loci and are shown in the segregation analysis (Fig. 7), up to 164 mice were typed for some pairs of loci. Each locus was analyzed in pairwise com- binations for recombination frequencies using the additional data. The ratios of the total number of mice exhibiting recom- binant chromosomes to the total number of mice were ana- lyzed for each pair of loci, and the most likely gene order is: centromere > Pim-1 > 51164 > H-2 > 61124 > Mep-la. The recombination frequencies (expressed as genetic distances in centimorgans & the standard error) are: Pim-1 (3.1 f 1.3) > H-2 > (4.8 & 1.9) > Mep-la.

DISCUSSION

The work herein shows that inbred mouse strains that contain high or low meprin A activity contain the allele for the meprin a subunit in the genome. However, only the mice that have high levels of kidney meprin A activity, and the 90- kDa a subunit protein, have high levels of the a subunit mRNA. The reason for the lack of a subunit mRNA in low activity mice is unknown. It could result from a lack of transcription of the gene or from instability of the message. We suggest that the lack of message in low activity mice is due to lack of transcription because no fragments of the a subunit mRNA (degradation products) were observed on Northern blots of kidney tissue from those mice, and the quality and quantity of the mRNA isolated from different mouse strains was the same.

The work also demonstrates that the meprin a subunit is clearly expressed in a tissue-specific manner. This is true in mice and rats from the tissues examined. Of the mouse tissues tested, only kidney had significant amounts of the a subunit message, where as both kidney and intestine contained the message in the rat. These data confirm conclusions drawn from immunohistochemical data, indicating that only kidney contained abundant a subunit protein in mice (Bond et al., 1988) and that rats contained detectable protein in kidney and intestine (Barnes et al., 1989). The later study presented some data showing that the a subunit protein was also present in mouse intestine, but the mRNA studies presented here support the contention that the subunit is not present in this mouse tissue. Interestingly, immunohistochemical studies with human tissues indicate that the a subunit is expressed

17

t R

Pim-1 6p21

H-2 6p21.3

4.8

Mepda

FIG. 7. Chromosomal localization of the a subunit structural gene of mouse meprin A. The segregation patterns of Mep-la and flanking genes in 119 backcross animals that were typed for all loci are shown at the top of the figure. For individual pairs of loci, up to 164 mice were typed (see text). Each column represents the chromo- some identified in the backcross progeny that was inherited from the (C57BL/6 X M. spretw) FI parent. The black boxes represent the presence of a C57BL/6 allele, and white boxes represent the presence of M. spretus allele. The number of offspring inheriting each type of chromosome is listed at the bottom of each column. A partial chro- mosome 17 linkage map showing the location of Mep-la in relation to linked genes is shown at the bottom of the figure. Recombination distances between loci in centimorgans are shown to the left of the chromosome, and the positions of loci in human chromosomes, where known, are shown to the right. References for the human map positions of loci mapped in this study can be obtained from GDB (Genome Data Base), a computerized data base of human linkage information maintained by The William H. Welch Medical Library of The Johns Hopkins University (Baltimore).

primarily in the intestine and not in the kidney? The different tissue distributions may indicate specific functions for the enzyme in the different species.

Previous immunohistochemical and in situ hybridization studies indicated that the a subunit of the mouse and rat is only expressed in specific cell types of the kidney (Craig et al., 1991; Corbeil et al., 1992). Thus, the protein and mRNA for the a subunit is found only in the juxtamedullary region of the kidney cortex. This is further evidence for the highly specific expression of the protein subunit. This seems to be a pattern for the other related metalloproteinases, the “astacin family” members (Dumermuth et al., 1991). Members of this family include astacin, bone morphogenetic protein-1 (BMP- l), tolloid, BP 10, SpAN, UVS.2, N-benzoyl-L-tyrosyl-p-ami- nobenzoic acid hydrolase, the a and p subunits of mouse and rat meprins. Several of the members of this family are in- volved in developmental processes. These proteins are highly inducible and are expressed only a t specific stages of devel- opment. The Drosophila dorsal-ventral patterning gene, tol- loid, is only expressed dorsally at the bastoderm stage during early embryogenesis (Shimell et al., 1991). The transcription

E. E. Sterchi, personal communication. -

Expression of the a Subunit of Meprin A 10385

of the sea urchin BP 10 gene is transiently activated around the 16- to 32-cell stage and is also spatially controlled during embryogenesis (Lepage et al., 1992). The second sea urchin gene, SpAN, is expressed only during embryogenesis and spatially restricted along the animal-vegetal axis of embryos (Reynolds et al., 1992). The Xenopus laeuis gene, WVS.2, is expressed exclusively in the anterior neural fold of neurula stage during the dorsoanterior development (Sato and Sar- gent, 1990). The human BMP-1 is also inducible and involved in bone formation (Wozney et al., 1988). Astacin is found exclusively in the digestive tract of the crayfish. Overall, these metalloproteinases are subject to highly specialized expres- sion.

The a subunit gene occurs in a wide range of higher orga- nisms. The stronger hybridization of human and chicken chromosomal DNA fragments to the mouse probe observed in Southern blots might indicate that there are multiple copies of the a subunit gene present in these genomes. Preliminary results indicate that there is more than one copy of the CY

subunit gene in the human g e n ~ m e . ~ There was, however, no detectable mRNA for the a subunit in E. coli nor was the gene in yeast. These observations indicate that either an ancestral gene for the a subunit in E. coli or yeast is very different from the mammalian and bird a subunit, or the a subunit gene evolved later than bacteria or lower eukaryotes. We recently found that a group of bacterial metalloendopeptidases contain a putative zinc-binding site that is similar to astacin and meprins and different from other metalloendopeptidases such as thermolysin (Jiang and Bond, 1992). Thus, the mode of binding zinc found in astacin and other family members has roots in prokaryotes, although the primary structures of the eukaryotic and prokaryotic metalloendopeptidases show little or no similarity.

The localization of the Mep-la gene to chromosome 17 supports the possibility that the CY subunit structural gene is the same as the Mep-1 gene, which was found previously to be the locus associated with meprin A deficiency in certain mouse strains (Bond et al., 1984). Mep-1 was mapped telom- eric to H-2D near the Tla gene and between Pgk-2 and Ce-2 genes on mouse chromosome 17 using congeneic and recom- binant mouse strains (Reckelhoff et al., 1988). The linkage study revealed that Mep-1 is 2.1 crossover units telomeric to H-2D and 0.6 crossover unit from Tla (Reckelhoff et al., 1985). The present study using an interspecific backcrossing method showed that Mep-la was localized telomeric to H-2, between Otf-3g and Pim-2. The same location of Mep-la and Mep-1 on the mouse chromosome supports the proposal that Mep-1 is the structural gene for the a subunit. It is possible that this gene not only encodes the structural part for the CY subunit but also contains the regulatory region which determines the expression o f the a subunit of mouse meprin A. However, it is also possible that Mep-1 encodes a separate protein which regulates Mep-la gene expression.

In addition to the close proximity of the CY subunit structural gene to the H-2 complex on the mouse chromosome, there is other evidence that strengthens the tie between the CY subunit of meprin A and immunoglobulin-major histocompatibility complex (Ig.MHC) proteins. There is an Ig.MHC protein signature, (F, Y)XCX(V, A)XH, present in the CY subunit primary structure (YNCTATH). This signature is found in all immunoglobulin-related proteins, and the cysteine residue is involved in the formation of a disulfide bond in all these

W. Jiang and J. S. Bond, unpublished data.

proteins. The cysteine in the a subunit is predicted to form a disulfide bridge from comparison with astacin (Dumermuth et al., 1991).

Mouse and rat meprins provide two new examples of me- talloproteinases that have different isozymic forms and tissue- specific expression. Other examples include thimet oligopep- tidase (EC 3.4.24.15) and peptidyl-dipeptidase A (angiotensin I-converting enzyme, ACE, EC 3.4.15.1). Thimet oligopepti- dase exists in two forms in tissues and cell lines, a predomi- nant soluble form, and a minor membrane-bound form. The cDNA encoding the soluble form was cloned from the rat testes (Pierotti et al., 1990). Northern blot analyses using this cDNA indicated the presence of mRNA encoding the enzyme in rat testes but not in other rat tissues. There are two isozymes of ACE, which are translated from two different mRNAs that are differentially expressed (Ehlers and Riordan, 1991). ACEp is synthesized in the endothelial cells of blood vessels as well as kidney and in several other tissues. ACEt is synthesized exclusively in testicular sperm cells. The different isozymic forms and tissue-specific expression may be respon- sible for specific physiological functions in different cellular compartments or tissues.

Acknowledgments-We thank Dr. Won Oh for providing E. coli RNA samples, Dr. Thomas Sitz for providing DBA/2 mice, and B. Cho and D. A. Swing for excellent technical assistance.

REFERENCES Barnes, K., Ingram, J., and Kenny, A. J. (1989) Biochem. J . 264,335-346 Beynon, R. J., and Bond, J. S. (1983) Science 219,1351-1353 Beynon, R. J., and Bond, J. S. (1985) Intracellular Protein Catabolism

(Khairallah, E., Bond, J. S., and Bird, J. W. C., eds) pp. 185-194, Alan R.

Beynon, R. J., Shannon, J. D., and Bond, J. S. (1981) Biochem. J. 199, 591- LISS, Inc., New York

wm ”“- Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7,1513-1523 Bond. J. S.. Bevnon. R.. J.. Reckelhoff. J. F.. and David. C. S. (1984) Proc.

Natl. Acah. 5%. U.’S. A. dl, 5541-5545 ’ ~ ~ ~ ~ ’ Bond, J. S., Stroupe, T., Macadam, G. C., Hall, J. L., and Beynon, R. J. (1988)

in Mammalinn Brwh Border Membrane Proteirw (Lentze, M. J., and Sterchi, E. E., eds) pp. 139-147, Thieme Medical Publishers Inc., New York

Butler, P. E.. and Bond. J. S. (1988) J. B~ol. Chem. 263.13419-13426

I~ I

Chomczyns!&, P., and Sacchi, N. (1987) Anal. Biochem. iS2,156-159 Copeland, N. G., and Jenkins, N. A. (1991) Trends Genet. 7 , 113-118 Corbeil, D., Gaudoux, F., Wainwright, S., Ingram J., Kenny, A. J., Boileau, G.,

Craig, S. S., Mader, C., and Bond, J. S. (1991) J. Histochem. Cytochem. 39, and Crine, P. (1992) FEBS Lett. 309,203-20;

123-129 Dumermuth E. Sterchi, E. E., Jiang, W., Wolz R. L., Bond, J. S., Flannery,

A. V., and’BeGnon, R. J. (1991) J. Biol. Chem.’266, 21381-21385 Ehlers. M. W.. and Riordan. J. F. (1991) Biochemistrv 30. 7118-7126 Gorbea, C. M.; Flannery, A.V., and Bond, J. S. (1991j Arch. Biochem. Biophys.

Green, E. L. (1981) in Genetics and Probability in Animal Breeding Experiments,

Gunning, P., Hardeman, E., Wide, R., Ponte, P., Bains, W., Blau, H. M., and

Jenkins, N. A., Copeland, N. G., Taylor, B. A,, and Lee, B. K. (1982) J. Virol.

290,549-553

pp. 77-113, Oxford Universitv Press, New York

Kedes, L. (1987) Mol. Cell. Biol. 7 , 4100-4114

43.26-36 Jiang, W., and Bond, J. S. (1992) FEBS Lett. 312 , 110-114 Jiang, W., Gorbea, C. M., Flannery, A. V., Beynon, R. J., Grant, G. A,, and

Johnson, G. D., and Hersh, L. B. (1992) J . Biol. Chem. 267,13505-13512

Lepage, T., Ghiglione, C., and Gache, C. (1992) Development (Camb.) 114 , Kenny, A. J., and Ingram, J. (1987) Blochem. J. 246,525-524

. ~ . ..

Bond, J. S. (1992) J. Biol. Chem. 267,9185-9193

147-164 Pierotti, A,, Dong, K.-W., Glucksman M. J., Orlowski, M., and Roberts, J. L.

(1990) Biochemistry 29,10323-103i9 Reckelhoff, J. F., Bond, J. S., Beynon, R. J., Savarirayan, S., and David, C. S.

(1985) Immunogenetics 22,617-623 Reckelhoff, J. F., Butler, P. E., Bond J. S., Beynon, R. J., and Passmore, H. C.

(1988) Immunogenetics 27,298-360 Reynolds, S. D., Angerer, L. M., Palis J., Nasir, A,, and Angerer, R. C. (1992)

Development (Camb.) 114,769-78d Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Moleculur Cloning: A

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring

Sato, S. M., and Sargent, T. D. (1990) Deu. Biol. 137, 135-141 Harbor, NY

Shimell, M. J., Fergfuson, E. L., Childs, S. R., and O’Connor, M. B. (1991) Cell

Siracusa, L. D., Jenkins, N. A., and Copeland, N. G. (1991) Genetics 127,169-

Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock L. M., Whitters, M. J., Kriz,

67,469-481

179

R. W., Hewick, R. M., and Wang, E. A. (1988) ’Science 2 4 2 , 1528-1534