Choline Acetyltransferase Uses a Non-AUG Initiation Codon and ...
The Minimum Open Reading Frame, AUG-Stop, Induces Boron ... › content › plantcell › early ›...
Transcript of The Minimum Open Reading Frame, AUG-Stop, Induces Boron ... › content › plantcell › early ›...
1
RESEARCH ARTICLE
The Minimum Open Reading Frame, AUG-Stop, Induces Boron-Dependent Ribosome Stalling and mRNA Degradation
Mayuki Tanakaa, Naoyuki Sottaa, Yusuke Yamazumib, Yui Yamashitac,1, Kyoko Miwad, Katsunori Murotae,2, Yukako Chibac,f, Masami Yokota Hiraig, Tetsu Akiyamab, Hitoshi Onouchie, Satoshi Naitoc,e,3 and Toru Fujiwaraa,3
a Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan
b Institute of Molecular and Cellular Bioscience, The University of Tokyo, Tokyo 113-003, Japan
c Graduate School of Life Science, Hokkaido University, Sapporo 060-0810, Japan d Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810,
Japan e Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan f Faculty of Science, Hokkaido University, Sapporo 060-0810, Japan g RIKEN Center for Sustainable Resource Science, Yokohama 230-0045, Japan
1 Current address: Gene Center, Department of Chemistry and Biochemistry, University of Munich, Munich 81377, Germany.
2 Current address: Department of Medical Entomology, National Institute of Infectious Diseases, Tokyo 162-8640, Japan.
3Corresponding authors: Toru Fujiwara ([email protected]) and Satoshi Naito ([email protected])
Short Title: B-Dependent Gene Regulation via AUG-Stop
The author responsible for the distribution of materials integral to the findings of this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org), is: Toru Fujiwara ([email protected]).
One-sentence summary: AUG-Stops in the 5' untranslated regions of Arabidopsis genes including NIP5;1, which encodes a boron influx transporter, regulate B-dependent mRNA accumulation through ribosome stalling.
ABSTRACT Upstream open reading frames (uORFs) are often translated ahead of the main ORF of a gene and regulate gene expression, sometimes in a condition-dependent manner, but such a role for the minimum uORF (hereafter referred to as ‘AUG-stop’) in living organisms is currently unclear. Here, we show that AUG-stop plays an important role in the boron (B)-
Plant Cell Advance Publication. Published on October 19, 2016, doi:10.1105/tpc.16.00481
©2016 American Society of Plant Biologists. All Rights Reserved
2
dependent regulation of NIP5;1, encoding a boric acid channel required for normal growth under low B conditions in Arabidopsis thaliana. High B enhanced ribosome stalling at AUG-stop, which was accompanied by the suppression of translation and mRNA degradation. This mRNA degradation was promoted by an upstream conserved sequence present near the 5′-edge of the stalled ribosome. Once ribosomes translate a uORF, reinitiation of translation must take place in order for the downstream ORF to be translated. Our results suggest that reinitiation of translation at the downstream NIP5;1 ORF is enhanced under low B conditions. A genome-wide analysis identified two additional B-responsive genes, SKU5 and transcription factor gene ABS/NGAL1, which were regulated by B-dependent ribosome stalling through AUG-stop. This regulation was reproduced in both plant and animal transient expression and cell-free translation systems. These findings suggest that B-dependent AUG-stop-mediated regulation is common in eukaryotes. 1
INTRODUCTION 2
In eukaryotes, the scanning model predicts that ribosomes scan mRNAs from the 5′-end 3
and identify the first AUG codon to start translation (Jackson et al., 2010). However, the 4
first open reading frame (ORF) is not necessarily the main ORF of a gene. Short ORFs 5
present in the 5′-untranslated region (5′-UTR), known as upstream ORFs (uORFs), are 6
often translated ahead of the main ORF. uORFs affect the expression of the main ORF, 7
because translation of the main ORF occurs either by leaky scanning and/or reinitiation of 8
translation. During leaky scanning, the AUG codon of the uORF is not recognized and the 9
43S preinitiation complex (i.e., a complex of the 40S subunit, methionyl-tRMAIMet, and a 10
few initiation factors) continues scanning for a downstream AUG (Supplemental Figure 11
1A). During reinitiation of translation, the 40S subunit does not dissociate from the mRNA 12
after translation termination of the uORF and reinitiates translation at a downstream AUG 13
(Supplemental Figure 1B) (Hellens et al., 2016). 14
Among the translated uORFs, some simply downregulate the expression of the main 15
ORF, while others regulate the expression of the main ORF in a condition-dependent 16
manner (Morris and Geballe, 2000; Hinnebusch, 2005; Hood et al., 2009; Ebina et al., 17
2015). For example, in Arabidopsis thaliana, S-adenosylmethionine decarboxylase 1 18
(AdoMetDC1) is required for producing spermidine and spermine. The ribosome stalls at 19
the termination codon of a uORF of AdoMetDC1 in response to polyamine, leading to the 20
downregulation of AdoMetDC1 (Uchiyama-Kadokura et al., 2014). In another example, in 21
3
yeast (Sacharromyces serevisiae), the ribosome stalls at the termination codon of a uORF 22
of carbamyl phosphate synthetase 1 (CPA1) in an arginine-dependent manner, leading to 23
the repression of CPA1 production required for arginine biosynthesis (Gaba et al., 2005). 24
Ribosome stalling at the uORF adversely affects translation of the main ORF 25
(Supplemental Figure 1C), 26
Minimum ORFs, in which the start codon is directly followed by a stop codon, referred 27
to as “AUG-stops” in this article, are widely found in the 5′-UTRs of eukaryotic genes. 28
According to our calculations, 23% of mRNAs in Arabidopsis carry uORFs (excluding 29
those that overlap with the main ORF), of which 14% (i.e., 4% of Arabidopsis mRNA) 30
have at least one AUG-stop in their 5′-UTR. AUG-stop affects the expression of a 31
downstream ORF in human immunodeficiency virus type I (Krummheuer et al., 2007), but 32
the role of AUG-stops in condition-dependent gene expression remains unclear. 33
Arabidopsis NIP5;1 (Takano et al., 2006) is among the genes that carry AUGUAA in 34
their 5′-UTRs. NIP5;1 is a diffusion facilitator of boron (B) that is required for the efficient 35
uptake of B by the roots. B is an essential nutrient for plants (Warington, 1923), algae 36
(Smyth and Dugger, 1981) and cyanobacteria (Bonilla et al., 1990) that is also required for 37
some animals (Fort et al., 1998; Rowe and Eckhert, 1999; Lanoue et al., 2000) but is toxic 38
when present in excess (Blevins and Lukaszewski, 1998; Kabu and Akosman, 2013). B in 39
neutral solution exits mostly as boric acid (H3BO3), which is a very weak Lewis acid with a 40
pKa of 9.24 (Woods, 1996). B is directly or indirectly involved in crucial biological 41
processes in various organisms, including both plants and animals (Brown et al., 2002; 42
Chen et al., 2002; Dembitsky et al., 2002). In plants, B crosslinks rhamnogalacturonan II 43
(RG-II), a component of the pectic polysaccharides in the cell wall. The cis-diol groups of 44
apiose in RG-II form an ester with boric acid, creating a borate-dimeric RG-II complex, 45
which is important for normal growth in Arabidopsis (O’Neill et al., 2001, 2004). B is 46
essential for cell elongation, and a number of physiological changes have been reported for 47
plants under low B conditions (Blevins and Lukaszewski, 1998). Due to its essential nature 48
and toxicity at high concentrations, it is important for plants to maintain B homeostasis for 49
proper growth, and the regulation of the B transport process plays a crucial role in B 50
homeostasis. 51
4
NIP5;1 is essential for normal growth of Arabidopsis under a limited B supply, and 52
NIP5;1 mRNA accumulates to high levels under low B conditions but not under high B 53
conditions (Takano et al., 2006). NIP5;1 mRNA is destabilized under a high supply of B, 54
resulting in reduced B uptake (Tanaka et al., 2011). A 19 nucleotide (nt) region, −131 to 55
−113 nt (relative to the translation start site of NIP5;1) in the 5′-UTR is required for this 56
regulation (Supplemental Figure 2A and 2B), which plays an important role in normal 57
growth under excess B supply in Arabidopsis (Tanaka et al., 2011). NIP5;1 has four uORFs, 58
two of which are AUGUAA (i.e., the start codon is immediately followed by a stop codon), 59
located at −122 and −312 nt in its 5′-UTR (herein referred to as −122AUG-stop and 60 −312AUG-stop, respectively) (Supplemental Figure 2A and 2B). The region required for the 61
B-dependent NIP5;1 mRNA degradation includes −122AUG-stop (Tanaka et al., 2011). 62
In this study, we investigated the mechanisms of the AUG-stop-mediated regulation of 63
NIP5;1 expression in Arabidopsis. We found that AUG-stop plays crucial roles in B-64
dependent ribosome stalling and the regulation of transcript accumulation, as well as in the 65
translation of the main ORF of this gene. 66
67
RESULTS 68 69
B-Dependent Downregulation of NIP5;1 through AUG-Stop In Vivo 70
The −131 to −113 nt region in the NIP5;1 5′-UTR, which is responsible for its B-dependent 71
mRNA degradation (Supplemental Figure 2A and 2B) (Tanaka et al., 2011), includes 72 −122AUG-stop. We first examined the possible involvement of −122AUG-stop in the B-73
dependent regulation of NIP5;1. The −306 to −1 nt of the NIP5;1 5′-UTR sequence was 74
fused to the luciferase (LUC) reporter gene and placed downstream of a constitutive 35S 75
RNA promoter (referred to as Pro35S) of cauliflower mosaic virus [Pro35S:5′-76
NIP5;1(−306):LUC] (Figure 1A). The DNA was used to transfect Arabidopsis MM2d 77
suspension cells (Menges and Murray, 2002). A series of mutations were introduced into 78 −122AUG-stop, and their effects on reporter activities were examined under high and low B 79
conditions (Figure 1B). 80
In the construct carrying the wild-type −122AUG-stop, reporter activity was reduced to 81
5
approximately half under high B conditions compared to low B conditions (Figure 1B, 82
shaded in blue). Introduction of mutations into ATG abolished the response to high B 83
conditions, and the reporter activities became generally higher in both low and high B 84
conditions. Disruption of the stop codon (shaded in yellow) abolished the response to high 85
B conditions and, in this case, the reporter activities were much reduced in both low and 86
high B conditions, whereas changing TAA to other stop codons, i.e., TAG or TGA (shaded 87
in green), retained the B-dependent suppression of the reporter activity. Placing extra 88
codon(s) between ATG and TAA (shaded in purple) also abolished the response. These 89
results indicate that the −122AUG-stop sequence is required for B-dependent downregulation 90
and that the AUG codon needs to be directly followed by a stop codon. In the construct 91
carrying a mutation in the Kozak sequence (a consensus sequence for efficient translation 92
initiation) (Kozak, 1986; Joshi et al., 1997) of −122AUG-stop, the response to B was 93
maintained, although the reporter activities increased under both B conditions (Figure 1B, 94
shaded in gray). 95
The general upregulation of reporter activities observed in the AUG mutations can be 96
explained by the lack of ribosome assembly at uORF. The general upregulation in the 97
construct carrying a mutation in the Kozak sequence, which is likely to reduce recognition 98
of AUG in AUGUAA, can be explained by the increased leaky scanning. In the constructs 99
in which stop codons were disrupted, the ORF that starts from the −122AUG is extended into 100
the LUC reporter gene in a different reading frame (Supplemental Figure 2D). Therefore, 101
the downregulation of LUC activity in the stop codon disruption mutants suggests that most 102
of the ribosomes start translation at −122AUG and that leaky scanning does not contribute 103
much to the reporter activities observed in the wild-type construct (Supplemental Figure 1A 104
and 1B). 105
To test whether −122AUG-stop is necessary for the B response in vivo, we generated 106
transgenic Arabidopsis plants carrying the NIP5;1 5′-UTR (−306 to −1 nt) fused to a β-107
glucuronidase (GUS) reporter gene driven by Pro35S [Pro35S:5′-NIP5;1(−306):GUS] 108
(Figure 1C) and exposed the plants to high and low B conditions (Figure 1D). As a positive 109
control, we used one of the transgenic lines that we described previously (P35SUTR+7-GUS 110
#8) (Tanaka et al., 2011). In transgenic plants carrying the wild-type −122AUG-stop, the 111
6
reporter activity was reduced under high B conditions compared to low B conditions, 112
corroborating our previous report (Tanaka et al., 2011), while introduction of a mutation 113
into either ATG or TAA of the −122AUG-stop abolished the response. Thus, AUG-stop is 114
required for the B-dependent downregulation of NIP5;1 in vivo. 115
116
Detection of B-Dependent NIP5;1 mRNA Degradation Intermediates in Arabidopsis 117
Roots 118
It is possible that the degradation of NIP5;1 mRNA goes through a specific degradation 119
intermediate(s). To examine the positions of the 5′-ends of degradation intermediates, we 120
conducted primer extension analysis using mRNA extracted from the roots of Col-0 wild-121
type Arabidopsis (Figure 2A and 2B). The Arabidopsis Information Resource database 122
(TAIR9/10) (Lamesch et al., 2012) lists the transcription start site of NIP5;1 at −312 nt, 123
whereas our primer extension analysis positioned it at −558 (Figure 2B), which 124
corroborated well with that of the Plant Promoter Database (Hieno et al., 2014). Therefore, 125
we used −558 nt in the NIP5;1 5′-UTR as the position of the transcription start site in this 126
study. 127
Our primer extension analysis detected two major signals representing the 5′-end 128
points of mRNA degradation intermediates from plants grown under high B conditions 129
(Figure 2B, lane +B, 2C and 2D). Even stronger signals were detected in plants 10 min 130
after being transferred from low B to high B conditions (Figure 2B, lane T, 2C and 2D), 131
implying that mRNA degradation is temporarily activated in response to the increased B 132
concentration. These signals were found at in a region 13−14 nt upstream of both −312AUG-133
stop and −122AUG-stop (counting from the A of AUG), respectively (Figure 2C and 2D). No 134
mRNA degradation intermediate was detected under low B conditions (Figure 2B, lane 135
−B). 136
The mRNA degradation intermediates were detected in experiments independent from 137
ours. Degradome datasets available at the Parallel Analysis of RNA Ends (PARE) database 138
(German et al., 2008) provided us with information about the 5′-ends of mRNA decay 139
intermediates in plants grown in soil (note that normal soil culture conditions correspond to 140
a mild-high B condition in this study). Prominent 5′-ends of 5′-truncated NIP5;1 mRNA are 141
7
present at −326 and −134 nt of the 5′-UTR, and the signals are enhanced in the 142
exoribonuclease 4 (xrn4) mutant, which lacks 5′-3′ exoribonuclease activity (German et al., 143
2008) (Supplemental Figure 3A and 3B). These positions correspond to 14 and 12 nt 144
upstream of −312AUG-stop and −122AUG-stop, respectively. These positions correspond well 145
with the 5′-ends of degradation intermediates detected in our primer extension analysis 146
(Figure 2C and 2D). 147
OsNIP3;1 and ZmNIP3;1, rice and maize orthologs, respectively, of Arabidopsis 148
NIP5;1, also carry AUGUAA sequences. The PARE database shows mRNA decay 149
intermediates at 12 and 13 nt upstream of the AUG-stops in these genes (Li et al., 2010; Liu 150
et al., 2014) (Supplemental Figure 3C and 3D), suggesting that the same mechanism is 151
exploited in these plant species as in Arabidopsis NIP5;1. 152
153
B-Dependent NIP5;1 mRNA Degradation Is Independent of the Nonsense-Mediated 154
mRNA Decay Pathway 155
uORFs sometimes induce the destabilization of mRNA through the nonsense-mediated 156
mRNA decay (NMD) mechanism, because the uORF’s stop codon may be recognized as a 157
premature termination codon (Amrani et al., 2006). UPF1 and UPF3 play critical roles in 158
the induction of mRNA degradation by NMD (Hori and Watanabe, 2005; Yoine et al., 159
2006b). We therefore determined the accumulation levels of NIP5;1 mRNA under high and 160
low B conditions in the upf1-1 missense mutant (Yoine et al., 2006a), upf3-1 knockout 161
mutant (Hori and Watanabe, 2005), and upf3-3 knockout mutant (Arciga-Reyws et al., 162
2006) in vivo (Supplemental Figure 4A). The upf3-1 knockout mutant was also used to 163
measure NIP5;1 mRNA stability (Supplemental Figure 4B and 4C). Neither NIP5;1 mRNA 164
accumulation levels nor NIP5;1 mRNA half-lives were affected by the mutations tested, 165
indicating that NMD is not responsible for the B-dependent regulation of NIP5;1 mRNA 166
decay. 167
168
B-Dependent NIP5;1 mRNA Degradation In Vitro 169
To establish an in vitro system to analyze B-dependent regulation through AUG-stop, we 170
used a wheat germ extract (WGE) in vitro translation system. In vitro-transcribed RNA 171
8
carrying −306 to −1 nt of the NIP5;1 5′-UTR fused to the LUC reporter gene [5′-172
NIP5;1(−306):LUC] was translated in the presence of various concentrations of B (Figure 173
3A and 3B). When a transcript containing the wild-type AUG-stop sequence was used, the 174
reporter activity was reduced as the B concentration increased, while no such change was 175
observed when −122AUG-stop was mutated (Figure 3B). These results establish that the in 176
vitro translation system is capable of reproducing the response to supplemental B. 177
We also investigated whether AUG-stop-mediated regulation is observed for other 178
elements. We tested the effects of major nutrients, nitrogen (KNO3), phosphorous 179
(KH2PO4) and potassium (KNO3, KH2PO4), together with NaCl. Addition of these salts to 180
WGE at a concentration of 500 µM, a concentration in which boric acid reduced reporter 181
expression by half (Figure 3B), showed no differential effect on reporter activity (Figure 182
3C). These results demonstrate that the response to boric acid is specific among the salts 183
and ions examined. 184
We then examined mRNA degradation in WGE. B-dependent signals of mRNA 185
degradation intermediates were detected by primer extension analysis using RNA extracted 186
from the in vitro translation mixture after 60 min of translation. B-dependent primer 187
extension signals were detected at 13−17 nt upstream of −122AUG-stop (Figure 3D, lanes 1 188
and 2), which overlapped with the end points detected in vivo (Figure 2C and 2D). No such 189
signal was detected when −122AUG-stop was mutated (Figure 3D, lanes 3 and 4). Extra 190
bands were also detected downstream of −122AUG-stop, but these bands do not represent a 191
part of the B-dependent downregulation mechanisms, because the signal intensities were 192
not dependent on B conditions (Supplemental Figure 5). These results indicate that the B-193
dependent downregulation via the −122AUG-stop observed in vivo is recapitulated in the 194
WGE in vitro translation system. 195
196
Either of the Two AUG-Stops in the 5′-UTR of NIP5;1 mRNA Is Sufficient for B-197
Dependent Regulation 198
Endogenous NIP5;1 mRNA carries two AUG-stops in its 5′-UTR, and two signals from 199
mRNA degradation intermediates were observed in vivo (Figure 2B), corresponding to the 200
two major mRNA 5′-ends listed in the PARE database (Supplemental Figure 3B). It is 201
9
likely that both −312AUG-stop and −122AUG-stop are functional. 202
To obtain experimental evidence for the function of −312AUG-stop in B-dependent 203
downregulation of the expression and degradation of mRNA, we conducted various 204
experiments using an in vitro-transcribed RNA carrying the full-length NIP5;1 5′-UTR 205
(−558 to −1 nt) (Supplemental Figure 6A). B-dependent downregulation of reporter activity 206
was observed when either or both of the AUG-stops were present, but not when both AUG-207
stops were deleted (Supplemental Figure 6B). Furthermore, primer extension signals were 208
detected at 13−17 nt upstream of the −312AUG-stop (Supplemental Figure 6C, lanes 3 and 4, 209
and 6E), indicating that −312AUG-stop is also functional in the B-dependent downregulation 210
of the expression and degradation of mRNA in vitro. 211
212
Ribosomes Stall at AUG-Stop in the 5′-UTR of NIP5;1 mRNA In Vitro in a B-213
Dependent Manner 214
The 5′-end points of the mRNA degradation intermediates (Figure 3D and Supplemental 215
Figure 6C; marked with magenta brackets) suggest that stalled ribosomes are involved in 216
mRNA degradation, because the 5′-ends of these mRNA degradation intermediates are 217
located near the 5′-edge of a ribosome when the ribosome’s P-site is positioned at AUG 218
(Sachs et al., 2002; Yamashita et al., 2014) (Figure 3F and Supplemental Figure 6E). To 219
obtain direct evidence for ribosome stalling, we performed primer extension inhibition 220
(toeprint) analysis using RNA from the in vitro translation mixture after 30 min of 221
translation in WGE. In a standard toeprint reaction, cycloheximide (CHX) was added after 222
the translation reaction to stabilize the ribosome (Sachs et al., 2002). B-dependent toeprint 223
signals were detected at 17−21 nt downstream of the −122AUG-stop (counting from the A of 224
AUG) (Figure 3E, lanes 5 and 6, and 3F). Consistent results were observed with RNA 225
carrying −312AUG-stop. B-dependent toeprint signals were detected at 14−16 nt 226
downstream of the −312AUG-stop (Supplemental Figure 6D, lanes 7 and 8, and 6E). Thus, 227
ribosomes stall at both AUG-stops in a B-dependent manner, representing an intriguing 228
regulatory role for AUG-stops through ribosome stalling. 229
We also carried out a toeprint analysis without CHX (Supplemental Figure 7). Toeprint 230
signals were detected at a similar position to that detected in the presence of CHX, and the 231
10
signals were stronger under B supplementation, although the overall signal intensities were 232
reduced (Supplemental Figure 7B and 7C). These results indicate that ribosome stalling is 233
dependent on B treatment and that CHX enhanced the toeprint signals. 234
235
Possible Involvement of Translation Reinitiation in B-Dependent Expression of the 236
Main ORF of NIP5;1 237
Translation of the main ORF in uORF-containing mRNA occurs via leaky scanning and/or 238
reinitiation of translation (Supplemental Figure 1A and 1B) (Hellens et al., 2016). As 239
mentioned above, the overall reduction in reporter activity in stop codon disruption mutant 240
constructs (Figure 1B) suggests that leaky scanning makes only a minor contribution to the 241
reporter activity observed in the wild-type construct, and that leaky scanning is not affected 242
by B conditions. This finding, in turn, suggests that reinitiation plays a major role in the 243
translation of the main ORF, and that the efficiency of reinitiation is affected by B 244
conditions. Thus, we tested whether reinitiation is affected by B conditions. The 245
involvement of reinitiation can be assessed by modulating the length between the site of 246
ribosome stalling and the main ORF, referred to as the spacer (Kozak, 1987, 2001; 247
Rajkowitsch et al., 2004). The efficiency of reinitiation is reduced if the spacer is less than 248
50 nt long (Child et al., 1999; Zhou et al., 2010). 249
Arabidopsis MM2d cells were transfected with plasmids containing a series of 3′-250
deletions of the 5′-UTR (Figure 4A). The B response was retained even when the spacer 251
was only 37 nt long, but LUC activity under low B conditions was reduced when the spacer 252
was 37 nt long compared to 67 nt or longer (Figure 4B). The extent of the B response was 253
reduced when a construct with a 37 nt spacer, which is expected to reduce reinitiation 254
efficiency, was used. These results corroborate the hypothesis that reinitiation is reduced 255
under high B conditions, although other possibilities remain (e.g., mRNA stability is 256
affected by changes in spacer length). 257
258
Insertion of AUG-Stop into the 5′-UTR of a Non-B-Responsive Gene Confers B-259
Dependent Regulation 260
To examine whether AUG-stop is capable of inducing B-dependent regulation, the 261
11
AUGUAA sequence was introduced into the 5′-UTR of non-B-responsive genes 262
MOLYBDATE TRANSPORTER2 (MOT2) (Gasber et al., 2011) and Dof zinc finger DNA-263
binding protein gene Dof1.8 (Yanagisawa, 2002) (Figure 5A and Supplemental Figure 8A), 264
both of which lack uORFs, including AUG-stops, in their 5′-UTRs and whose 5′-UTRs are 265
roughly the same size (333 nt and 296 nt, for MOT2 and Dof1.8, respectively) as that of our 266
experimental NIP5;1 constructs used to analyze the functions of −122AUGUAA (306 nt). 267
Since spacer length is important for B-dependent regulation (Figure 4B), we inserted 268
AUGUAA at −122 nt of their 5′-UTRs (Figure 5B and Supplemental Figure 8B), a position 269
identical to that of −122AUG-stop in NIP5;1. 270
Reporter assays in WGE revealed that introducing the AUGUAA sequence led to 271
B-dependent downregulation of the expression in both genes (Figure 5B and Supplemental 272
Figure 8B). To further examine the effect of AUG-stop insertion, primer extension and 273
toeprint analyses were performed using a construct carrying the MOT2 5′-UTR. Primer 274
extension and toeprint signals were detected 14−15 nt upstream (Figure 5C, lanes 3 and 4) 275
and 15−17 nt downstream (Figure 5D, lanes 7 and 8), respectively, of the introduced 276
AUGUAA sequence, and the signal intensities increased under high B conditions, 277
suggesting that ribosome stalling and mRNA degradation similar to those in NIP5;1 278
occurred at the introduced AUGUAA (Figure 5E). These gain-of-function experiments 279
suggest that AUG-stop is capable of inducing B-dependent ribosome stalling and the 280
mRNA degradation of non-B-responsive genes. 281
282
Genome-Wide Analysis of Ribosome Stalling at AUG-Stop in Arabidopsis 283
To examine genome-wide ribosome stalling at AUG-stops, we analyzed the Arabidopsis 284
ribosome profiling dataset (Juntawong et al., 2014). This data set was obtained from 285
Arabidopsis plants grown under “normal” conditions, which correspond to mild-high B 286
conditions. The extent of ribosome stalling at each combination of the two codons, which is 287
expected to be located in the P-site (codon 1) and A-site (codon 2), was estimated by 288
counting the number of reads. The counts were divided by the average read count of the 289
corresponding mRNA for normalization (Supplemental Figure 9). The presence of AUG at 290
the first codon and the stop codon at the second codon tend to cause ribosome stalling 291
12
(Supplemental Figure 9A). It is likely that ribosomes generally stall on AUG-stops with 292
high frequency compared to other two-codon combinations (Supplemental Figure 9B). 293
294
Identification of Other Genes that Are Regulated in a B-Dependent Manner through 295
AUG-Stop in Arabidopsis 296
To assess the generality of B-dependent mRNA degradation through AUG-stops, we looked 297
for Arabidopsis genes that are regulated in a similar manner to that of NIP5;1. Microarray 298
analysis was performed under high and low B conditions in Arabidopsis seedlings. Five 299
genes, NIP5;1, CONSERVED PEPTIDE UPSTREAM OPEN READING FRAME47 300
(CPuORF47), transcription factor gene ABS2/NGAL1, At4g19370 and cupredoxin 301
superfamily protein gene SKU5, that showed the strongest downregulation among those 302
carrying AUG-stops in their 5′-UTRs (Figure 6A, Supplemental Figure 10A, and 303
Supplemental Table 1) were used for the analysis. The level of downregulation was judged 304
by the FC+B/−B values, in which the expression levels under high B conditions were divided 305
by those under low B conditions. 306
The five genes were tested to determine whether they are regulated through AUG-stop. 307
All genes other than At4g19370 exhibited B-dependent suppression of translation (Figure 308
6B, Supplemental Figure 10B and Supplemental Table 1). Introduction of a mutation in the 309
AUG-stop eliminated the B-dependent responses in ABS2/NGAL1 and SKU5 (Figure 6B 310
and Supplemental Figure 10B), but not in CPuORF47 (Supplemental Table 1), in the 311
reporter assay and in vitro translation system. These results indicate that B-dependent 312
ribosome stalling is not specific to NIP5;1, while the results for CPuORF47 suggest the 313
presence of a B-dependent regulatory mechanism(s) other than AUG-stop-mediated 314
regulation. 315
SKU5 and ABS2/NGAL1 were analyzed in more detail. In both genes, toeprint and 316
primer extension signals were detected, and the distance from the AUG-stop of SKU5 and 317
ABS2/NGAL1 to the toeprint signals (15–18 and 16-17 nt, respectively) and to the 5′-ends 318
of the mRNA degradation intermediates (13 and 14 nt, respectively) corroborated well with 319
those in NIP5;1. The signal intensities were higher under high B conditions than under low 320
B conditions (Figure 6C-6E and Supplemental Figure 10C-10E). 321
13
322
SKU5, an AUG-Stop-Mediated B-Regulated Gene, Functions in Low-B Conditions in 323
Arabidopsis 324
SKU5 encodes a plant-specific transcription factor involved in directional root growth 325
(Sedbrook et al., 2002). Since cell expansion requires B, SKU5 expression may be 326
regulated in a B-dependent manner through AUG-stop. To assess the importance of SKU5 327
in B responses in Arabidopsis, we examined the growth of a sku5 knockout mutant 328
(Sedbrook et al., 2002) under low B conditions. The mutant seedlings exhibited growth 329
defects under low B, but not under high B conditions (Figure 6F), indicating that SKU5 330
functions under low B conditions as does NIP5;1 (Takano et al., 2006). The expression of 331
SKU5, as well as NIP5;1, could be effectively suppressed under high B conditions via 332
regulation through AUG-stop. 333
334
A Sequence Upstream of AUG-Stop Is Required for Promoting mRNA Degradation 335
Only a subset of genes containing AUGUAA in their 5′-UTRs are under the control of the 336
AUG-stop-mediated downregulation of mRNA accumulation, implying that sequences 337
other than AUGUAA are also required for this regulation. An alignment of NIP5;1, 338
ABS2/NGAL1, SKU5 and the rice and maize orthologs of Arabidopsis NIP5;1 sequences 339
around AUGUAA (Supplemental Table 2) showed that the region 12−19 nt upstream of 340
AUGUAA is well conserved (UUU[C/A]AA[A/C]A), and U is present 9 nt downstream of 341
AUGUAA, while no such occurrence was observed in AUGUAA-containing non-B-342
responding genes (Figure 7). The upstream conserved region covers the positions of the 5′-343
ends of mRNA degradation intermediates (Figure 3F), and we hypothesized that the 344
upstream conserved sequence is necessary for promoting mRNA degradation. To 345
investigate this hypothesis, we conducted an in vitro translation study (Figure 8A). 346
Disruption of the upstream conserved sequence strongly decreased the mRNA degradation 347
intermediate signals under both high and low B conditions (Figure 8B, lanes 5 and 6, and 348
8D), although the effect was less prominent than when AUG-stop was mutated, when 349
virtually no signal was detected irrespective of B conditions (Figure 8B, lanes 3 and 4). It 350
should also be noted that disruption of the upstream conserved sequence had little or no 351
14
effect on B-dependent toeprint signals (Figure 8C, lanes 7, 8, 11 and 12, and 8D). These 352
results suggest that the upstream conserved sequence acts in enhancing mRNA degradation, 353
but not in ribosome stalling. 354
To further examine whether the upstream conserved sequence is capable of promoting 355
B-dependent mRNA degradation in a context different from that of NIP5;1, the upstream 356
conserved sequence was introduced into the 5′-UTR of MOT2 (Supplemental Figure 11A). 357
The insertion of the upstream conserved sequence increased mRNA degradation 358
intermediate signals under both high and low B conditions (Supplemental Figure 11B, lanes 359
3 to 6, and 11D), while little or no effect on B-dependent toeprint signals was observed 360
(Supplemental Figure 11C, lanes 9 to 12, and 11D), suggesting that the upstream conserved 361
sequence is necessary for enhancing mRNA degradation, but not for ribosome stalling in 362
the context of MOT2 5′-UTR, corroborating the observations with NIP5;1 (Figure 8B and 363
8C). 364
We also investigated whether the conserved U at the 9 nt downstream of AUGUAA is 365
involved in B-dependent regulation. Replacement of U by C at this position did not affect 366
the B response (Supplemental Figure 12), suggesting that the conserved U at 9 nt 367
downstream of AUGUAA is not involved in B-dependent downregulation. 368
To further confirm the importance of the upstream conserved sequence in the B-369
dependent regulation of NIP5;1 mRNA accumulation in vivo, a construct carrying a NIP5;1 370
genome sequence (−1669 to +3587) [ProNIP5;1:5′-NIP5;1(−558):NIP5;1] (Figure 8E) was 371
introduced into nip5;1-1 mutant plants, in which the NIP5;1 mRNA level was reduced to 372
approximately 1% that of wild-type Col-0 plants (Takano et al., 2006). Since one of the 373
AUG-stops is sufficient for B-dependent downregulation (Supplemental Figure 6), 374 −312AUG-stop was deleted in all of the constructs (−321 to −307). Mutations were then 375
introduced into −122AUG-stop or the upstream conserved sequence (14−17 nt upstream of 376 −122AUG-stop), and their effects on mRNA accumulation were examined (Figure 8F). In 377
transgenic plants carrying wild-type −122AUG-stop, NIP5;1 mRNA accumulation was 378
significantly reduced under high B conditions compared to low B conditions, whereas B-379
dependent NIP5;1 mRNA accumulation was abolished or very much weakened in 380
transgenic plants carrying mutations either in −122AUG-stop or in the upstream conserved 381
15
sequence. These results demonstrate that the upstream conserved sequence plays a role in 382
B-dependent NIP5;1 mRNA accumulation in vivo. 383
384
Physiological Importance of the AUG-Stop-Mediated Regulation of NIP5;1 385
We examined the roles of AUG-stop and the upstream conserved sequence in the growth of 386
Arabidopsis under different B conditions. Transgenic plants used in Figure 8E were grown 387
on plates containing B at 0.3 μM (low B), 100 μM (high B) and 3,000 μM (excess B), and 388
their root growth was examined (Figure 9). Under the 0.3 µM B conditions, all of the 389
transgenic plants we tested showed growth recovery compared to nip5;1-1 mutant plants 390
(Figure 9A), suggesting that mutations in −122AUG-stop and the upstream conserved 391
sequence do not affect NIP5;1 (the trans-gene) functions under low B conditions, in which 392
B-dependent downregulation through NIP5;1 5′-UTR does not occur. The growths of all 393
plants was indistinguishable under 100 µM B conditions, in which the nip5;1-1 mutant 394
grew normally (Figure 9B). In contrast, under 3,000 μM B conditions, in which wild-type 395
growth was reduced by the toxic effect of B, the root growth of transgenic plants carrying 396
the deletion of −122AUG-stop was poorer than that of Col-0 (Figure 9C), suggesting that 397
impairment of AUG-stop-mediated regulation is important for avoiding the toxic effect of 398
B. This pattern is identical to that observed with transgenic plants carrying a larger deletion 399
of NIP5;1 5′-UTR that we reported previously (Tanaka et al., 2011). One of the two 400
independent lines carrying the construct with a mutation in the upstream conserved 401
sequence (line #12) exhibited poorer growth than wild-type Col-0, while the other 402
transgenic line (#16) did not show significant differences from wild type (Figure 9C). 403
Together, these results suggest that the effect of the upstream conserved sequence may have 404
weaker physiological importance than the presence of AUG-stop, corroborating the results 405
of in vitro experiments examining the regulation of B-dependent ribosome stalling and 406
mRNA degradation (Figure 8B and 8C). 407
408
B-Dependent Regulation via AUG-Stop in Animal Systems 409
To examine whether this regulatory mechanism also functions in animals, we conducted in 410
vitro translation and transfection experiments. For the in vitro translation study, we used a 411
16
rabbit reticulocyte lysate (RRL) in vitro translation system (Figure 10A and 10B). The 412
results demonstrate that B-dependent suppression of reporter activity was observed in RRL. 413
To determine if the regulatory mechanism is also active in animal cells, HeLa cells were 414
transfected with a plasmid containing NIP5;1 5′-UTR (−231 to −1 nt) fused to the LUC 415
reporter gene driven by the SV40 early promoter [ProSV40:5′-NIP5;1(−231):LUC] (Figure 416
10C). When the cells were transfected with the construct carrying −122AUG-stop, reporter 417
activity was reduced to ~80% under high B conditions compared with the activity without 418
B addition, although the extent of the reduction was less than that observed in plants, 419
presumably due to the low B concentration in animal cells (Ayres and Hellier, 1998). The 420
deletion of the ATGTAA sequence abolished the response to high B conditions (Figure 421
10D). These results suggest that B-dependent regulation through AUG-stop is also 422
functional in animals, and that regulation through AUG-stop is a ubiquitous system. 423
424
Negative Selection Pressure against AUG-Stop in Plant 5′-UTRs 425
Because AUG-stop consists of only six nucleotides, it frequently appears in the genome. If 426
AUG-stop functios in the regulation of gene expression, the presence of AUG-stop at a high 427
frequency in the 5′-UTR may not be beneficial to the organism. The frequency of AUG-428
stops is lower than that expected from random occurrence in Arabidopsis (von Arnim et al., 429
2014). 430
To investigate the frequency of AUG-stop within the 5′-UTRs of various species, we 431
conducted in silico analysis using whole genome sequences and annotations of 12 432
organisms available in public databases. We calculated the length of every uORF in 433
individual organisms and compared the distribution with that obtained after randomization 434
of the 5′-UTR sequences (Figure 11). In all of the plant species examined, the frequency of 435
AUG-stops (i.e., uORF with one amino acid in length in Figure 11) was lower than that 436
expected from random occurrence. This was not the case in animals, with the exception of 437
soil-borne nematodes. It is intriguing that Chlamydomonas reinhardtii and zebrafish (Danio 438
rerio) share similar habitats in that they both live in paddy fields, whereas Chlamydomonas 439
shows bias against AUG-stop but zebrafish does not. B concentrations in cells are generally 440
higher in plants than in animals (Ayres and Hellier, 1998), and the former depends largely 441
17
on the soil B concentrations. Undesired B responses may exert negative selection pressure 442
on the occurrence of AUG-stops in organisms that are exposed to soil B conditions leading 443
to reasonable B accumulation in cells. It is intriguing that nematode is the only animal 444
examined in this study that has a reduced frequency of AUG-stops. B concentrations in soil 445
solution can fluctuate due to water conditions via a dilution effect. 446
447
DISCUSSION 448
449
In the present study, we identified AUGUAA as the sequence necessary for B-dependent 450
regulation of NIP5;1 transcript accumulation. We then demonstrated that ribosome stalling 451
at AUG-stops in the 5′-UTR of NIP5;1 was enhanced under high B conditions and that the 452
stalling was coupled with mRNA degradation. An upstream conserved sequence of AUG-453
stop required for enhancing mRNA degradation was identified. AUG-stop is a minimum 454
ORF, consisting of only initiation and termination codons; this process is illustrated in 455
Figure 12. 456
457
Sensing the Cytoplasmic B Concentration Required to Regulate NIP5;1 Expression 458
NIP5;1 encodes a transporter that is necessary under low B conditions but is undesirable 459
under high B conditions (Figure 9; Tanaka et al., 2011). The B-dependent regulation of 460
NIP5;1 expression is thus important for maintaining B homeostasis and growth under a 461
wide range of soil B concentrations. In vitro translation systems allow translation reactions 462
that occur in the cytoplasm to be investigated. In the present study, B-dependent regulation 463
was observed in both the WGE and RRL in vitro translation systems, suggesting that the 464
expression of NIP5;1 is regulated in response to cytoplasmic B concentrations, not to 465
extracellular B concentrations after signal transduction. 466
A number of plant mineral nutrient transporters are regulated under different nutritional 467
conditions, which are considered to represent adaptive responses to nutritional conditions. 468
However, except for NRT1.1, a nitrate transporter that responds to extracellular nitrate 469
concentrations (Ho et al., 2009), it is not clear whether gene regulation occurs in response 470
to external or internal nutrient concentrations. The results of the present study indicate that, 471
18
in the case of NIP5;1, the cytoplasmic B concentration is sensed during translation. Sensing 472
internal (cytosolic) nutrient conditions is probably more beneficial than detecting external 473
concentrations from the viewpoint that most of biological reactions occur within the cell. 474
However, the detection of external nutrient concentrations may have a different benefit, 475
enabling transporters to respond to environmental changes in advance. B is relatively 476
membrane permeable (Takano et al., 2006), which allows intracellular B concentrations to 477
be rapidly influenced by external concentrations. Given such circumstances, sensing the 478
internal concentrations of B may be more beneficial for plants than sensing extracellular B 479
concentrations. 480
481
Effect of B on AUG-Stop-Mediated Ribosome Stalling and Reinitiation of Translation 482
Our study demonstrated two effects of B on NIP5;1 expression. One is B-dependent 483
ribosome stalling (Figure 3E), followed by mRNA degradation (Figure 3D). The other is 484
the possible inhibition of reinitiation (Figure 4B), but not leaky scanning (Figure 1B). In the 485
experiments described in Figure 4B, the sequence around the AUG-stop was common 486
among constructs, and thus, it is very unlikely that the extent of ribosome stalling at AUG-487
stop under high B conditions is different among constructs, which makes it likely that a 488
high B level negatively regulates the process of reinitiation. In yeast, the efficiency of 489
reinitiation is higher for the uORFs with fewer codons (Rajkowitsch et al., 2004). It is 490
reasonable to assume that the efficiency of reinitiation is high for AUG-stop, a uORF with 491
the fewest codons, and that such a process may be the target of regulation under high B 492
conditions. It is not clear how B affects reinitiation, but it is possible that ribosomes stalled 493
on AUG-stop under high B conditions are in a state that does not allow efficient resumption 494
of scanning for the downstream AUG (Figure 12). 495
Our findings allow us to consider possible mechanisms of B action. The disruption of 496
the Kozak sequence at AUG-stop resulted in higher reporter activity under both high and 497
low B conditions (Figure 1B). The disruption of the Kozak sequence at AUG-stop 498
adversely affected the recognition of AUG in AUG-stop, but not that of the main ORF. The 499
observation that the disruption of the Kozak sequence at AUG-stop affects the translation of 500
the main ORF suggests that the AUG codon of AUG-stop is recognized as a start codon. 501
19
This recognition could be affected by B, although other possibilities, including the possible 502
effects of B on the efficiency of termination, cannot be excluded. 503
The present data do not allow us to discuss the molecular target(s) of B action. 504
However, the finding that the B-response is recapitulated in the in vitro translation systems 505
suggests that boron or boric acid acts on the translation machinery. In this regard, it is worth 506
noting that boric acid forms a complex with the cis-diol group (Power and Woods, 1997; 507
Amaral et al., 2008), two hydroxyl groups positioned in cis-conformation, which is found 508
in the 3′-end ribose moiety of RNA, including the cis-diol groups in rRNAs and deacylated 509
tRNA produced after the peptydiltransfer reaction, as well as upon termination of 510
translation at the stop codon. 511
512
Degradation of mRNA Is Associated with B-Dependent Ribosome Stalling at AUG-513
Stop 514
Ribosome stalling through AUG-stops was accompanied by mRNA degradation. One of the 515
possible pathways of degradation is NMD (Amrani et al., 2006); however, NMD mutant 516
analysis indicated that NMD does not function in the B-dependent regulation of NIP5;1 517
(Supplemental Figure 4). Considering that the induction of NMD by uORFs in plants is 518
efficient if the uORF encodes a peptide longer than 34 amino acids (Nyikó et al., 2009), it 519
is reasonable to assume that a mechanism other than NMD is responsible for AUG-stop-520
mediated mRNA degradation. 521
In the present study, we identified an upstream conserved sequence that is responsible 522
for promoting mRNA degradation through AUG-stop (Figure 8 and Supplemental Figure 523
11). The sequence covers the position of the 5′-edge of the ribosome stalled at AUG-stop 524
where the 5′-ends of the mRNA degradation intermediates are located. This sequence does 525
not affect the efficiency of B-dependent ribosome stalling, suggesting that the upstream 526
conserved sequence affects mRNA degradation at a step(s) after ribosome stalling. The 527
presence of a sequence that affects mRNA degradation suggests the involvement of a 528
ribonuclease that recognizes the upstream conserved sequence directly or indirectly. 529
530
20
AUG-Stop-Mediated B-Dependent Regulation Is Common in Eukaryotes 531
Although only a subset of genes containing AUG-stops in their 5′-UTRs were regulated by 532
ribosome stalling through AUG-stops, we discovered at least three genes, NIP5;1, SKU5 533
and ABS2/NGAL1, that are regulated by this mechanism in Arabidopsis. Additionally, the 534
introduction of AUG-stop into non-B-responsive genes conferred B-dependent suppression 535
of gene expression (Figure 5 and Supplemental Figure 11). These findings suggest that 536
AUG-stop-mediated B-dependent regulation is a common mechanism in Arabidopsis. 537
Moreover, the fact that PARE lists mRNA decay intermediates at 12–13 nt upstream of 538
AUGUAA in rice and maize orthologs of Arabidopsis NIP5;1 (Supplemental Figure 3) 539
suggests that the same mechanism functions in rice and maize. Therefore, the AUG-stop-540
mediated B-dependent regulatory mechanism operates in the plant kingdom. 541
B-dependent gene regulation through AUG-stop in NIP5;1 5′-UTR was also observed 542
in the RRL in vitro translation system and in HeLa cells (Figure 10), although the B-543
response was weaker than in the Arabidopsis systems. A trans-acting factor(s) may be 544
involved in this regulation, and a plant-specific factor(s) may be more effective than the 545
animal one. Our results suggest that AUG-stop-mediated gene regulation in response to B is 546
not limited to plants but is a common system in eukaryotes. 547
548
METHODS 549
550
Plasmids Used for Transient Assay 551
pMT101 (Supplemental Table 3) carries Pro35S, −306 to −1 nt (relative to the translation 552
start site of the main ORF of NIP5;1) of the wild-type ProNIP5;1 5′-UTR [5′-553
NIP5;1(−306)] and the LUC reporter gene. To construct pMT101, the 5′-NIP5;1(−306) 554
region was amplified by PCR using pMW1 (Takano et al., 2006), which carries the wild-555
type NIP5;1 5′-UTR, as a template with primers MT1f and MT12r (Supplemental Table 4). 556
The amplified DNA fragment was digested with BamHI and AvrII and inserted into 557
pBI221-LUC+ (Matsuo et al., 2001) between the BamHI and AvrII sites. 558
pMT104, pMT105, pMT107, pMT108, pMT109, pMT110, pMT148, pMT151, 559
pMT152, pMT153 and pMT154 (Supplemental Table 3), each of which carries a different 560
21
mutation in and around the −122AUG-stop in NIP5;1 5′-UTR, were generated by inserting 561
the −306 to −1 nt fragment with different mutations into pBI221-LUC+. For pMT104, 562
pMT105, pMT107, pMT108 pMT109, pMT151, pMT152, pMT153 and pMT154, DNA 563
fragments with mutations were generated by overlap extension PCR (Ho et al., 1989) with 564
the internal primers listed in Supplemental Table 4 and the flanking primers MT1f and 565
MT12r using pMW1 as a template. For pMT110 and pMT148, the same procedure was 566
used except that pMT109 and pMT101 were used as a template, respectively. The resulting 567
DNA fragments with mutations were inserted into pBI221-LUC+ in the same way as for 568
the construction of pMT101. 569
pMT141, pMT142 and pMT143 (Supplemental Table 3), which have deletions of −41, 570
−65, and −95 nt, respectively, upstream from the translation start site of NIP5;1, were 571
generated by inserting DNA fragments with deletions. The DNA fragments were generated 572
by PCR using pMW1 as a template with primers listed in Supplemental Table 4. The PCR-573
amplified fragments were inserted into pBI221-LUC+ in the same way as for the 574
construction of pMT101. The plasmids described above contain 18 nt (5′-575
GGGGACTCTAGAGGATCC-3′) and a 15 nt (5′-CCTAGGAAGCTTTCC-3′) linkers 576
derived from pBI221-LUC+ at the 5′ and 3′, respectively, of NIP5;1 5′-UTR. pBI221-577
LUC+ was used as the ‘Vector 5′-UTR’ negative control (Supplemental Table 3). These 578
plasmids were used for transfection experiments in Arabidopsis suspension cells. 579
The plasmid pKM75 (Supplemental Table 3) carries a RLUC reporter gene under the 580
control of Pro35S and was used as an internal control for transfection experiments in 581
Arabidopsis suspension cells. To construct pKM75, the PCR fragment amplified from pIE0 582
(Ebina et al. 2015) with primers 1832f and 1801r (Supplemental Table 4) was digested with 583
XbaI and BstBI and inserted into pIE0 between the XbaI and BstBI sites to replace the 5′-584
UTR. The resulting RLUC gene in pKM75 carries additional Met-Val codons at its N-585
terminus. 586
For transient assay in HeLa cells, we used a −231 to −1 nt fragment of the NIP5;1 5′-587
UTR that contains only one uORF, −122AUGUAA, to simplify the 5′-UTR structure to avoid 588
the possible masking effects of other uORFs in animal systems. pMT139 and pMT140 589
(Supplemental Table 3) carry ProSV40, −231 to −1 nt of NIP5;1 5′-UTR [5′-NIP5;1(−231)] 590
22
with and without −122AUGUAA, respectively, and the LUC reporter gene. The pRL-SV40 591
(Promega) carries ProSV40 and the RLUC reporter gene and was used as an internal 592
control. For pMT139 and pMT140, the 5′-NIP5;1(−231) region was amplified by PCR 593
using pMT101 and pMT117 (see below), respectively, as templates with primers listed in 594
Supplemental Table 4. pMT101 and pMT117 carry wild-type NIP5;1 5′-UTR and NIP5;1 595
5′-UTR without AUG-stop, respectively. The amplified fragments were digested with 596
HindIII and inserted into the corresponding HindIII site of pGL3 Promoter vector 597
(Promega). The plasmids thus constructed contain a 35 nt linker (5′-598
AAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACC-3′) between the NIP5;1 5′-UTR 599
and the LUC reporter gene. The 3′ end of the linker carries an optimized Kozak sequence 600
for the reporter ORF. 601
602
Plasmids Used for In Vitro Translation 603
pMT131 (Supplemental Table 3) carries −306 to −1 nt of the wild-type NIP5;1 5′-UTR [5′-604
NIP5;1(−306)] and the LUC reporter gene. For the construction of pMT131, the 5′-605
NIP5;1(−306) region was amplified by PCR using pMW1 as a template with primers 606
MT51f and MT34r (Supplemental Table 4). The amplified DNA fragment was digested 607
with XbaI and NcoI and inserted into the pSP64 Poly(A) vector (Promega)-based plasmid 608
pMI21 (Chiba et al., 2003) between the XbaI and NcoI sites. 609
pMT132, pMT144 and pMT156 (Supplemental Table 3), which carry different 610
mutations in and around the −122AUG-stop in NIP5;1 5′-UTR, were generated by inserting 611
−306 to −1 nt fragments with different mutations into pMI21. To construct pMT132, a 612
DNA fragment with the corresponding mutation was amplified by PCR using pMT105 as a 613
template with primers MT51f and MT34r (Supplemental Table 4). pMT105 carries a 614
mutation in −122AUG-stop in the NIP5;1 5′-UTR (Supplemental Table 3). For pMT144, a 615
DNA fragment with mutations was generated by overlap extension PCR with the internal 616
primers listed in Supplemental Table 4 and the flanking primers MT51f and MT34r using 617
pMT131 as a template. To construct pMT156, DNA fragments with mutations were 618
generated by overlap extension PCR with the internal primers listed in Supplemental Table 619
4 and the flanking primers MT51f and MT34r using pMW1 as a template. The amplified 620
23
DNA fragments were inserted into pMI21 in the same way as for the construction of 621
pMT131. 622
pMT114 (Supplemental Table 3) carries a −558 to −1 nt fragment of the wild-type 623
NIP5;1 5′-UTR [5′-NIP5;1(−558)] and the LUC reporter gene. To construct pMT114, the 624
5′-NIP5;1(−558) region was amplified by PCR using pMW1 as a template with primers 625
MT25f and MT34r (Supplemental Table 4). The amplified DNA fragment was inserted into 626
pMI21 in the same way as for the construction of pMT131. 627
pMT115, pMT117 and pMT116 (Supplemental Table 3) carry deletions of either of the 628 −312AUG-stop and −122AUG-stop or both in the NIP5;1 5′-UTR(−558), respectively. For 629
pMT115 and pMT117, DNA fragments with corresponding mutations were generated by 630
overlap extension PCR with the internal primers listed in Supplemental Table 4 and the 631
flanking primers MT25f and MT34r using pMW1 as a template. For pMT116, the same 632
procedure was followed except that pMT115 was used as a template. The amplified DNA 633
fragments were inserted into pMI21 in the same way as for the construction of pMT131. 634
pMT125, pMT127, pMT129, pMT161, pMT163 and pMT157 (Supplemental Table 3) 635
carry 5′-UTRs of MOT2, SKU5, ABS2/NGAL1, CPuORF47, At4g19370 and Dof1.8 636
respectively, and the LUC reporter gene. To construct pMT125, pMT127, pMT129, 637
pMT161, pMT163 and pMT157, the 5′-UTRs of corresponding genes were amplified by 638
PCR using Arabidopsis genomic DNA as a template with primers listed in Supplemental 639
Table 4. The amplified DNA fragments were inserted into pMI21 in the same way as for the 640
construction of pMT131. 641
pMT126, pMT128, pMT130, pMT162 and pMT158 (Supplemental Table 3) carry a 642
mutation of AUG-stop in the 5′-UTR of MOT2, SKU5, ABS2/NGAL1, CPuORF47 and 643
Dof1.8, respectively. To construct pMT126, pMT128, pMT130, pMT162 and pMT158, 644
DNA fragments with corresponding mutations were generated by overlap extension PCR 645
with the internal primers listed in Supplemental Table 4 and the flanking primers MT32f 646
and MT41r, MT43f and MT47r, MT45f and MT49r, and MT52f and MT59, and MT87f and 647
MT95, respectively, using Arabidopsis genomic DNA as a template. The amplified DNA 648
fragments were inserted into pMI21 in the same way as for the construction of pMT131. 649
pMI27 (Chiba et al., 2003; Supplemental Table 3) carries a RLUC reporter gene in 650
24
pSP64 Poly(A) vector. pMI27 was used as an internal control for the in vitro translation 651
experiments. 652
653
Construction of Transgenic Plants 654
pMT100 (Supplemental Table 3) carries Pro35S, −306 to −1 nt of the wild-type NIP5;1 5′-655
UTR [5′-NIP5;1(−306)] and the GUS reporter gene, and was described as P35SUTR+7-GUS 656
in Tanaka et al. (2011). pMT113 and pMT155 (Supplemental Table 3), which carries a 657
mutation in the −122AUG-stop in NIP5;1 5′-UTR, were generated by inserting −306 to −1 nt 658
with a mutation in AUGUAA into pMDC140 (Curtis and Grossniklaus, 2003). To construct 659
pMT113 and pMT155, the 5′-NIP5;1(−306) region was amplified by PCR using pMT104 660
and pMT152, respectively, as a template with primers MT23f and MT24r (Supplemental 661
Table 4). pMT104 and pMT152 carry a mutation in −122AUG-stop in the NIP5;1 5′-UTR 662
(Supplemental Table 3). The amplified fragment was subcloned into the pENTR/D-TOPO 663
vector via the TOPO cloning reaction (Invitrogen). The 5′-NIP5;1(−306) region was then 664
subcloned into pMDC140 using the Gateway system (Curtis and Grossniklaus, 2003). The 665
gateway vector contains a 37 nt linker (5′-TCTAGAACTAGTTAATTAAGAATTATC-3′) 666
and a 59 nt linker (5′-667
TTGATAGCTTGGCGCGCCTCGACTCTAGAGGATCGATCCCCGGGTACGGTCAGT668
CCCTT-3′) at the 5′ and 3′, respectively, of NIP5;1 5′-UTR. 669
Transformation of Arabidopsis thaliana plants was performed using the floral-dip 670
method (Clough and Bent, 1998). Homozygous T3 generation plants were established and 671
used for analyses. Transgenic lines #4, #8 and #10 refer to independently transformed lines 672
carrying Pro35S:5′-NIP5;1(−306):GUS with a mutation in the AUG codon of −122AUG-673
stop. Transgenic lines #2 #18 and #19 refer to independently transformed lines carrying 674
Pro35S:5′-NIP5;1(−306):GUS with a mutation in the stop codon of −122AUG-stop. 675
Transgenic line, WT#8, which carries Pro35S:5′-NIP5;1(−306):GUS with wild-type 676 −122AUG-stop, has been described (Tanaka et al., 2011). 677
pMT145 (Supplemental Table 3) carries ProNIP5;1 (−1669 to −559), the NIP5;1 5′-678
UTR (−558 to −1) with deletion of −312AUG-stop region and the NIP5;1 (+1 to +3578). To 679
construct pMT145, a DNA fragment with the corresponding mutations was generated by 680
25
overlap extension PCR with the internal primers MT26f and MT35r and the flanking 681
primers MT78f and MT79r using pYK02 (Kato et al., 2009) as a template. The amplified 682
DNA fragment was digested with SalI and inserted into a pTbar vector-based pPZP212 683
(Hajdukiewicz et al., 1994) at the SalI site. 684
pMT146 and pMT147 (Supplemental Table 3) which carry different mutations in and 685
around the −122AUG-stop in NIP5;1 5′-UTR, were generated by inserting −1669 to +3578 nt 686
in NIP5;1 region with different mutations. To construct pMT146 and pMT147, DNA 687
fragments with corresponding mutations were generated by overlap extension PCR with the 688
internal primers MT27f and MT36r, and MT73f and MT74r, respectively and with the 689
flanking primers MT78f and MT79r using pMT145 as a template. The amplified DNA 690
fragments were inserted into pPZP212 in the same way as for the construction of pMT145. 691
After transformation of Arabidopsis, homozygous T3 generation plants were 692
established and used for analyses. Transgenic lines WT#15 and WT#18 refer to 693
independently transformed lines carrying the wild-type −122AUG-stop in NIP5;1 5′-UTR. 694
Transgenic lines #6 and #11 refer to independently transformed lines carrying deletion of 695 −122AUG-stop in NIP5;1 5′-UTR, and transgenic lines, #12 and #16 refer to independently 696
transformed lines carrying the wild-type −122AUG-stop in NIP5;1 5′-UTR carrying a 697
mutation in the upstream conserved sequence (14 to 17 nt upstream of −122AUG-stop). 698
699
B Conditions 700
Boric acid was used for B treatments, with different boric acid concentrations used 701
depending on the organism and experimental system. Responses of different organisms to 702
the range of B concentrations vary widely, and we selected B concentrations depending on 703
the response of organisms to different B concentrations. In experiments using intact plants, 704
0.3 µM B and 100 µM B conditions were used for the plant treatments as low B (−B) and 705
high B (+B) conditions, respectively. This is based on the reports by Takano et al., (2006). 706
In transfection assay using Arabidopsis MM2d suspension cells, we first examined reporter 707
activities under 1, 100 and 500 µM B conditions. The reporter activities were reduced to 708
approximately 70% and 50% under 100 and 500 µM B conditions, respectively, compared 709
to 1 µM B condition (Supplemental Figure 13). Since the B-dependent downregulation was 710
26
weaker under 100 µM B conditions than under 500 µM B conditions, 1 µM B and 500 µM 711
B were selected as low B (−B) and high B (+B) conditions, respectively. For the 712
experiments using HeLa cells, for the low B condition, B was not applied, as B is not an 713
essential element for animal cells. For the high B conditions, 500 and 1,000 µM B were 714
applied to HeLa cells during the incubation period after transfection. Since the B response 715
in RRL (Figure 10A) is relatively weak compared to that in WGE (Figure 3B) in the in 716
vitro translation assay, we included 1,000 µM B conditions to ascertain B-excess 717
conditions. For in vitro assays including primer extension and toeprint analyses, 0 µM B 718
and 300 µM B were used as a low B (−B) and a high B (+B) conditions, respectively. This 719
is based on the results of reporter activities in the in vitro translation assay (Figure 3B), in 720
which the reporter activities were reduced to 79% and 50% under 100 µM B and 500 µM B 721
conditions, respectively, compared 0 µM B. To avoid excess B concentrations in WGE for 722
primer extension and toeprint analyses, we selected 300 µM B, which is the average of 100 723
µM and 500 µM. 724
725
Plant Materials and Growth Conditions 726
Arabidopsis thaliana (L.) Heynh. ecotype Columbia (Col-0) was used as a wild-type plant 727
in this study, except for Figure 6F, in which ecotype Wassilewskija (Ws) was used as a 728
wild-type plant for corresponding T-DNA insertion lines. Transgenic plants carrying 729
Pro35S:5′-NIP5;1(−306):GUS and ProNIP5;1:5′-NIP5;1(−558):NIP5;1 with or without 730
mutations in the NIP5;1 5′-UTR were generated as described above. For primer extension 731
analysis, Arabidopsis plants were grown on hydroponic culture medium (Takano et al., 732
2005) containing 1% (w/v) sucrose and 0.3 μM B solidified with 0.15% (w/v) gellan gum 733
(Wako Pure Chemicals) for 28 d, and then transferred to hydroponic culture medium 734
containing the same concentration of B for 1 d at 22°C under short-d conditions (10 h 735
light/14 h dark with fluorescent lamps, 100-160 μmol photons m-2 s-1). The plants were 736
then transferred to 0.3 µM or 100 µM B for 10 min before RNA extraction. For the GUS 737
assay, qRT-PCR analyses and root length measurement, plants were grown on hydroponic 738
culture medium containing 1% (w/v) sucrose and 0.3, 100 or 3,000 μM B solidified with 739
1% (w/v) gellan gum at 22°C under long-d conditions (16 h light/8 h dark cycle) for 10 to 740
27
14 d. For microarray analysis, plants were grown on hydroponic culture medium containing 741
1% (w/v) sucrose and 100 μM B solidified with 1% (w/v) gellan gum at 22°C under long-d 742
conditions for 12 d and then transferred to 0.3 µM or 100 µM B conditions for 2 d. For 743
mRNA half-life measurement, plants were grown on hydroponic culture medium 744
containing 1% (w/v) sucrose and 0.3 or 100 μM B solidified with 1% (w/v) gellan gum at 745
22°C under long-d conditions for 10 d, followed by transfer to hydroponic culture medium 746
containing 0.3 or 100 µM B for 10 min. At least three independently grown plant samples 747
were examined in all experiments. 748
749
Transient Expression Analysis of Arabidopsis Suspension Cell Cultures and Reporter 750
Assay 751
Arabidopsis MM2d suspension cells (Menges and Murray 2002) were cultured in LS 752
medium (Nagata et al., 1992) at 26°C. To prepare protoplasts, MM2d cells were suspended 753
in LS medium containing 1% (w/v) cellulase Onozuka RS (Yakult Pharmaceutical 754
Industry), 0.5% (w/v) pectolyase Y23 (Seishin Pharmaceutical) and 0.4 M mannitol and 755
incubated at 26°C with gentle shaking until the suspension became turbid with protoplasts 756
(approximately 3 h). The protoplasts were washed five times with Wash Buffer (0.4 M 757
mannitol, 5 mM CaCl2 and 12.5 mM NaOAc, pH 5.8) and suspended in Electroporation 758
Buffer (5 mM morpholinoethanesulfonic acid, 70 mM KCl and 0.3 M mannitol, pH 5.8). 759
Electroporation was performed as described previously (Ishikawa et al., 1993) with some 760
modifications. Ten micrograms each of tester plasmid carrying the LUC reporter and 761
internal control plasmid pKM75, carrying the RLUC reporter, were gently mixed with 1.5 × 762
106 protoplasts in 500 µl of Electroporation Buffer in an electroporation cuvette with a 4-763
mm electrode distance. Electroporation was performed using an Electro Cell Manipulator 764
600 (BTX) with voltage, capacitance and resistance settings at 190 V, 100 µF and 480 Ω, 765
respectively. The protoplasts were kept on ice for 30 min and then incubated at 25°C for 5 766
min, centrifuged (60 × g, 2 min at 25°C), and resuspended in 1 ml of LS medium 767
containing 0.4 M mannitol with 500 µM or 1 µM B. After 2 d of incubation at 23°C in the 768
dark, the protoplasts were disrupted as described previously (Chiba et al., 1999), and LUC 769
and RLUC activities were assayed using a PicaGene Dual-Luciferase Assay kit (PG-DUAL 770
28
SP; Toyo Ink). LUC activity was normalized with RLUC activity to obtain relative LUC 771
activity. 772
773
Transient Expression of HeLa Cell Cultures and Reporter Assay 774
HeLa cells were cultured in complete Dulbecco’s Modified Eagle's Medium (Nissui) 775
supplemented with 10% fetal bovine serum. Plasmids were transfected into HeLa cells with 776
Lipifectamine 2000 (Invitrogen). HeLa cells were transfected with the plasmid constructs 777
carrying LUC reporter, along with internal control plasmid carrying RLUC reporter, in the 778
presence of 500 µM or 1,000 µM B (high B conditions) or without B (low B condition). 779
Twenty-four hours after transfection, the cells were lysed and LUC activities were 780
measured. LUC and RLUC assays were performed with the Dual-Luciferase Reporter 781
Assay System (Promega). LUC activities were normalized with the RLUC activities of the 782
co-transfected internal controls to obtain relative LUC activities. 783
784
In Vitro Transcription 785
DNA templates in pSP64 Poly(A) vector were linearized with EcoRI and purified using a 786
QIAquick Nucleotide Removal kit (Qiagen). In vitro transcription was performed using an 787
AmpliCap SP6 High Yield Message Maker kit (Epicentre Technologies) in the presence of 788
cap analog m7G[5′]ppp[5′]GTP (Epicentre Technologies) as described previously (Chiba et 789
al., 2003). Following in vitro transcription, RNA was purified using an RNeasy mini kit 790
(Qiagen) and was poly(A)-selected using a GenElute mRNA miniprep kit (Sigma-Aldrich) 791
prior to the in vitro translation reactions. 792
793
In Vitro Translation and Reporter Assays 794
RNA was denatured for 5 min at 67°C and rapidly chilled on ice water. Each reaction 795
mixture (10 μl) contained 5 µl WGE (Promega), 0.8 µl of 1 mM amino acid mixture 796
lacking methionine (Promega), 80 µM L-methionine, 1 unit µl−1 RNasin (Promega), 2 fmol 797
µl−1 tester RNA carrying LUC reporter, 0.2 fmol µl−1 internal control RNA carrying RLUC 798
reporter and various concentrations of boric acid or 500 µM sodium chloride, potassium 799
dihydrogenphosphate and potassium nitrate. All reactions were carried out at 25°C for 120 800
29
min. In vitro translation in RRL was performed with a protocol similar to WGE with a few 801
modifications. Each reaction mixture (10 µl) contained 6.6 µl RRL (Promega), 0.2 µl of 1 802
mM amino acid mixture lacking methionine, 80 µM L-methionine, 1 unit µl−1 RNasin, 70 803
mM KOAc, 2 fmol µl−1 LUC RNA, 0.2 fmol µl−1 RLUC RNA, and various concentrations 804
of B. All reactions were carried out at 30°C for 120 min. LUC and RLUC activities were 805
assayed using a Dual Luciferase reporter assay kit, and the LUC activity was normalized 806
with RLUC activity to obtain relative LUC activity. The relative LUC activity was then 807
normalized with the data obtained without addition of B. For the sake of interpolation, 808
three-parameter log-logistic function, 809 = + (1 − )/(1 + ( / ) ) , with optimum parameters, a, b and c, was applied and shown in each graph. The 810
concentration of B added to the reaction mixture is represented by x. 811
812
Primer Extension Analysis 813
The primer extension analysis of mRNA shown in Figure 2B was performed using poly(A) 814
RNA extracted from Arabidopsis plants grown under 100 µM B, 0.3 µM B, or from plants 815
grown under 0.3 µM B and transferred to 100 µM B for 10 min. Primer-1 (Supplemental 816
Table 4) was used. Poly(A) RNA (500 ng) was annealed with 32P-labeled primer in 40 μl of 817
annealing buffer (Chiba et al., 2003) at 58°C for 2 h, and the reverse transcription reaction 818
was carried out using Thermoscript RNase H− reverse transcriptase (Invitrogen) at 58°C for 819
60 min. 820
Primer extension analysis of RNA following in vitro translation was performed as 821
described previously (Chiba et al., 2003), using RNA extracted from an in vitro translation 822
reaction without RLUC RNA. To detect primer extension signals corresponding to 823 −312AUG-stop in Supplemental Figure 6, the 32P-labeled Primer-2 (Supplemental Table 4) 824
was used. For other primer extension analyses, 32P-labeled ZW4 primer (Wang and Sachs, 825
1997) (Supplemental Table 4), which anneals with the LUC coding region, was used. 826
Following phenol-chloroform extraction, the samples were separated on a 6% 827
polyacrylamide/7 M urea gel. DNA sequence ladders were prepared using the DNA Cycle 828
Sequencing System (Promega). The intensities of primer extension signals are presented 829
30
after normalizing with those of the full-length mRNA, and the relative primer extension 830
signals were then normalized with those under −B conditions. The sequence ladder was 831
generated using the same primer and the RNA construct carrying AUGUAA sequence as a 832
template. 833
834
Toeprint Analysis 835
In vitro translation in WGE was carried out using 200 fmol μl−1 LUC RNA, but without 836
RLUC RNA, in a 20 µl reaction mixture at 25°C in the presence or absence of 300 µM B 837
for 30 min. Following in vitro translation, toeprint analysis was performed as described 838
previously (Onouchi et al., 2005) using SuperScriptIII RNase H− reverse transcriptase 839
(Invitrogen). To detect toeprint signal corresponding to −312AUG-stop, 32P-labeled Primer-2 840
was used (Supplemental Figure 6). For other toeprint analyses, 32P-labeled ZW4 primer was 841
used. The pre-reaction mixture (16.4 µl) contained 4 µl 5× first-strand buffer (Invitrogen), 2 842
µl 2.5 mM dNTPs, 1 µl 0.1 M dithiothreitol and 20 units of RNasin, with or without 1 µl of 843
10 mg ml−1 CHX, and was placed on ice. One microliter of in vitro translation reaction 844
mixture was added to the pre-reaction mixture and placed on ice for 2 min. Two microliters 845
of 5′-32P-labeled primer (0.2 µM) was added to the reaction mixture and incubated at 37°C 846
for 3 min. After adding 10 units reverse transcriptase, the reaction mixture (20 µl) was 847
incubated at 37°C for 30 min. Following phenol-chloroform extraction, the products were 848
separated on a 6% polyacrylamide/7 M urea sequencing gel. The toeprint signals are 849
presented as for the primer extension experiment. Representative results of triplicate 850
experiments are presented. The sequence ladder was generated as in primer extension 851
analyses. 852
853
Measurement of B Concentration in WGE 854
The B concentration in WGE was determined using inductively coupled plasma-mass 855
spectrometry (ICP-MS) (SPQ-9000; Seiko Instruments) as previously described (Takano et 856
al., 2006). 100 µl of WGE was digested with nitric acid and the digest was dissolved in 1 857
mL of 0.08 M nitric solution, but the signal intensities from ICP-MS analysis corresponding 858
to both 10B and 11B were not distinguishable from the background. In our ICP-MS analysis, 859
31
the detection limit for boric acid in solution is in the range of 0.05 µM, suggesting that the 860
concentration of boric acid in WGE we used in our study was below 0.005 µM. This is 861
much lower than the boric acid concentrations we used in our present study. 862
863
Fluorometric Assays of GUS Activity 864
For GUS assays, five to ten transgenic Arabidopsis seedlings were combined, and GUS 865
activity was assayed as described (Jefferson et al., 1987). 866
867
Quantification of Transcript Accumulation by Quantitative RT-PCR 868
Arabidopsis plants were grown on solid medium containing 0.3 or 100 µM B for 10 d. 869
Total RNA from root samples was extracted using an RNeasy Plant Mini kit (Qiagen), and 870
500 ng was reverse-transcribed in a 20-µl reaction mixture using an ExScript RT reagent kit 871
(Takara Bio) with oligo-dT16 primers. The cDNA was amplified by qRT-PCR using a 872
Thermal Cycler Dice Real Time System TP800 (Takara Bio) with a SYBR Premix Ex Taq 873
kit (Takara Bio). The primers used for qRT-PCR analysis are listed in Supplemental Table 874
4. We used three reference genes (eEF1α, Actin10 and Ubq10) in the initial phase of the 875
experiments (Supplemental Table 5). Since similar data were obtained with the three genes, 876
we used eEF1α as a reference gene for subsequent analyses. Quantification was performed 877
on three independently grown plant materials (n=3). 878
879
Half-Life Measurement of mRNA 880
mRNA half-lives were determined as described previously (Tanaka et al., 2011). Briefly, 881
Arabidopsis plants grown on solid medium for 10 d were pre-incubated with hydroponic 882
culture medium containing 0.3 or 100 µM B for 10 min. Following pre-incubation, 3′-883
deoxyadenosine (cordycepin) (Funakoshi) was added to the hydroponic culture medium at 884
a final concentration of 0.6 mM (t = 0 min), and the sample was immediately vacuum 885
infiltrated for 45 s. Root samples were harvested at 0, 10, 30 and 60 min and frozen in 886
liquid nitrogen. Total RNA was isolated and analyzed by qRT-PCR. The amount of RNA 887
remaining at each time point was determined relative to the amount at the zero time point. 888
The mRNA half-lives were determined by fitting the remaining amounts of the mRNA to a 889
32
linear line after log-conversion by the least-square method. 890
891
Microarray Analysis 892
Total RNA was prepared from Col-0 roots of 12-d-old seedlings that were grown under 100 893
µM B conditions for 10 d and then transferred to 0.3 µM or 100 µM B conditions for 2 d. 894
Microarray analysis was performed with a GeneChip Arabidopsis ATH1 genome array 895
(Affymetrix). From the raw data, 15,074 genes with quality flag value of “Present” for both 896
0.3 µM and 100 µM B samples were selected. A list of genes whose 5′-UTR sequences 897
contain AUG-stops was generated from the Arabidopsis Information Resource ver. 10 898
(TAIR10) database (Lamesch et al., 2012) using a custom R script (R version 3.2.2). 899
900
Degradome Data Processing 901
Degradome sequencing datasets from Arabidopsis, rice and maize were downloaded from 902
the PARE database (German et al., 2008). The datasets used were as follows: inflorescence 903
tissue of Arabidopsis (wild-type Col-0 and xrn4 mutant) grown on soil (GSE11094; 904
GSM280227); rice (Oryza sativa cv. Nipponbare) seedlings gown in hydroponic culture for 905
three weeks (GSE17398; GSM434596); ears of maize (Zea mays, inbred line B73) at stage 906
IV grown in a controlled environment (GSE47837; GSM1160282). In the datasets, 907
abundances of the decay intermediates were expressed in transcripts per 10 million via 908
normalization with the number of total genome-matched reads (except for those mapped to 909
t/r/sn/snoRNA). The relevant region in the 5′-UTR of each gene of interest was plotted 910
using custom R scripts. 911
912
Sequence Logo 913
For B-responsive genes, NIP5;1, ABS2/NGAL1 and SKU5 of Arabidopsis, and OsNIP3;1 914
and ZmNIP3;1, rice and maize orthologs of Arabidopsis NIP5;1, respectively, were used. 915
For non-B-responsive genes, 100 genes whose FC+B/−B values were close to 1.0 were used. 916
Sequence logos were generated with the Sequence_logo_v03.R package using the pooled 917
sequences. 918
919
33
Ribosome Footprint Data Analysis 920
The ribosome stalling frequency for every 6-nucleotide sequence (combination of two 921
codons) in the 5′-UTR was estimated from a public ribosome footprint dataset of 922
Arabidopsis whole seedlings (Juntawong et al., 2014; accession: SRR966474, RF#2). The 923
FASTQ file was processed using a custom R script to remove 3′-poly(A) tail and was 924
mapped to Arabidopsis genome sequence (TAIR10) by tophat2 algorithm with the default 925
parameter settings. The resultant SAM file was subjected to further analysis with custom R 926
scripts. 927
As a criterion for ribosome stalling at each combination of two codons, the number 928
of reads that start from 15 nt upstream of codon 1, which corresponds to the 5′-end of the 929
ribosome stalled with the P-site on codon 1, was counted and normalized by average read 930
count of the mRNA to cancel the read depth variation caused by different expression levels 931
(designated as Ribosome Arrest Value, RAV). RAV was calculated for each instance of any 932
combinations of 2 codons in 5′-UTRs, and the number of instances that satisfy RAV > 2 933
was tabulated. 934
935
In Silico Analysis of uORF Length Distribution in Various Organisms 936
The distribution of uORF lengths in various organisms was calculated using a custom R 937
script. The algorithm searches 5′-UTR sequences of each transcript to find all ATGs and the 938
nearest downstream in-frame stop codon (TAA, TAG, and TGA), and output is the length of 939
each uORF. The distribution without bias was estimated by repeating the same calculation 940
10 times with randomization of 5′-UTR sequences and rescaling the total uORF number to 941
that of the actual ones. As input data, masked genomic DNA sequence (sequence type 942
‘dna_rm’) and gene annotation files were downloaded from the public Ensembl database. 943
For animals, FASTA and GTF files were downloaded from ftp://ftp.ensembl.org (release-944
77), and for plants, FASTA and GFF3 files were downloaded from 945
ftp://ftp.ensemblgenomes.org (release-23). 946
947
Phylogenetic Analysis 948
The phylogenetic tree in Figure 11 was generated using MEGA6 software (Tamura et 949
34
al., 2013) by applying the neighbor-joining method (Saitou and Nei, 1987) to 18S rRNA 950
sequences for each organism, with the phylogenetic analysis parameters “Test of 951
Phylogeny”, “None”; “Substitution Model - Model/Method”, “No. of difference”; 952
“Substitution Model - Substitutions to Include”, “d: Transitions + Transversions”; “Rates 953
and Patterns - Rates among Sites”, “Uniform rates”; “Data Subset to Use - Gaps/Missing 954
Data Treatment”, “Complete deletion”. The resulting alignment is provided in 955
Supplemental File 1. The tree was drawn to scale, with branch lengths in the same units as 956
those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary 957
distances were computed using the number of differences method (Nei and Kumar, 2000) 958
and are in the units of the number of base differences per sequence. Those positions that 959
contain gaps and missing data in any of the organisms tested were eliminated. A total of 960
1,667 nt were analyzed. 961
962
Statistical Methods 963
To evaluate B-dependent reductions in reporter activity and mRNA accumulation levels, 964
statistical analyses were performed using two-tailed two-sample Student’s t-tests. To 965
evaluate root length differences, statistical analyses were performed using Tukey’s test. To 966
evaluate changes in signal intensities in primer extension and toeprint experiments, the 967
signal intensities were normalized with the respective full-length signals. The values 968
obtained under +B conditions were divided with those under −B conditions and were used 969
for one-tailed one-sample Student’s t-tests after log-conversion. In all figures, the error bars 970
represent standard deviations (SD). 971
972
Accession Numbers 973
Microarray data from this article have been deposited in NCBI’s the Gene Expression 974
Omnibus data library under accession number GSE52208. PARE data from this article can 975
be found in the Gene Expression Omnibus data library under the following accession 976
numbers: Arabidopsis, GSE11094; rice, GSE17398; maize, GSE47837. Ribosome profiling 977
data from this article can be found in DRASearch under the following accession number: 978
SRR966474. Arabidopsis sequence data from this article can be found in the Arabidopsis 979
35
Genome Initiative and GenBank/EMBL/DDBJ database under the following accession 980
numbers: NIP5;1, At4g10380; CPuORF47, At5g03190; ABS2/NGAL1, At2g46080; 981
At4g19370; SKU5; At4g12420, MOT2, At1g80310, Dof1.8, At1g64620, OsNIP3;1, 982
Os10g36924; ZmNIP3;1, GRMZM2G176209. 983
984
Supplemental Data 985
Supplemental Figure 1. General Effects of uORF on Translation of the Main ORF. 986
987
Supplemental Figure 2. Positions of uORFs, RNA Sequence of NIP5;1 5′-UTR, and a 988
Portion of the NIP5;1 Coding Region. 989
990
Supplemental Figure 3. Positions of 5′-Ends of mRNA Decay Intermediates in the 5′-991
UTRs of NIP5;1 and Its Rice and Maize Orthologs. 992
993
Supplemental Figure 4. B-Dependence of NIP5;1 mRNA Accumulation and Half-Lives in 994
NMD Mutants. 995
996
Supplemental Figure 5. The Extra Bands in the Primer Expression Assay Do Not Respond 997
to B Conditions. 998
999
Supplemental Figure 6. Both −312AUG-Stop and −122AUG-Stop Are Responsive to B in a 1000
Wheat Germ Extract In Vitro Translation System. 1001
1002
Supplemental Figure 7. B-Dependent Toeprint Signals Are Strengthened by CHX 1003
Treatment. 1004
1005
Supplemental Figure 8. B-Dependent Downregulation Is Conferred by Introduction of 1006
AUG-Stop into Dof1.8 5′-UTR. 1007
1008
36
Supplemental Figure 9. Tendency of Two Codon Combinations to Trigger Ribosome 1009
Arrest in 5′-UTRs. 1010
1011
Supplemental Figure 10. Role of AUG-stop in B-Dependent Downregulation of 1012
ABS2/NGAL1. 1013
Supplemental Figure 11. B-Dependent mRNA Degradation Is Enhanced by Introduction 1014
of the Upstream Conserved Sequence into MOT2 5′-UTR. 1015
1016
Supplemental Figure 12. Nine-nt Region Downstream of AUGUAA Is not Involved in B-1017
Dependent Downregulation in the 5′-UTR of NIP5;1 in the In Vitro Translation Assay. 1018
1019
Supplemental Figure 13. B-Dependent Downregulation of NIP5;1 under Different B 1020
Conditions. 1021
1022
Supplemental Table 1. List of B-responsive Genes Carrying AUGUAA in their 5′-UTRs. 1023
1024
Supplemental Table 2. Sequences around AUG-Stops of B-Responsive Genes. 1025
1026
Supplemental Table 3. Plasmids Used in This Study and the Primers Used to Construct the 1027
Plasmids. 1028
1029
Supplemental Table 4. Primers Used in This Study. 1030
1031
Supplemental Table 5. Relative NIP5;1 mRNA Levels Obtained Using Different 1032
Reference Genes. 1033
1034
Supplemental File 1. Alignment Used to Produce the Phylogenetic Tree in Figure 11. 1035
1036
ACKNOWLEDGMENTS 1037
We thank Drs. R. Beckmann, D. N. Wilson and J. Takano for their critical reading of the 1038
37
manuscript as well as for valuable discussions. Arabidopsis uORF information and 1039
Arabidopsis upf1 and upf3 mutant seeds were provided by Drs. K. Mineta and Y. Watanabe, 1040
respectively. T-DNA insertion lines were provided by the Arabidopsis Biological Resource 1041
Center. We are also grateful to Y. Kawara, S. Oyama, H. Nagano and Y. Ohashi for 1042
technical assistance. This work was supported in part by Grants-in-Aid for Scientific 1043
Research (Nos. 22119006 and 15H01525 to S.N., and No. 25221202 to T.F.) from the 1044
Ministry of Education, Culture, Sports, Science and Technology of Japan. We used the 1045
Radioisotope Laboratory at the Graduate School of Agriculture, Hokkaido University. 1046
1047
AUTHOR CONTRIBUTIONS 1048
M.T., Y. Yamashita, Y.C., T.A., H.O., S.N. and T.F. designed the experiments. M.T., H.O., 1049
K. Murota, K. Miwa, Y. Yamazumi, Y. Yamashita and M.Y.H. performed the experiments. 1050
N.S. conducted in silico analysis. M.T., K. Miwa, N.S., M.Y.H., Y.C., H.O., S.N. and T.F. 1051
analyzed data. M.T., N.S., K. Miwa, Y. Yamashita, H.O., S.N. and T.F. wrote the 1052
manuscript. 1053
1054
REFERENCES 1055
Amrani, N., Sachs, M.S., and Jacobson, A. (2006). Early nonsense: mRNA decay solves 1056
a translational problem. Nat. Rev. Mol. Cell. Biol. 7: 415–425. 1057
Amaral, A.F., Marques, M.M., da Silva, J.A.L., and da Silva, J.J.R.F. (2008). 1058
Interactions of D-ribose with polyatomic anions, and alkaline and alkaline-earth cations: 1059
possible clues to environmental synthesis conditions in the pre-RNA world. New J. Chem. 1060
32: 2043–2049. 1061
Arciga-Reyws, L., Wootton, L., Kieffer, M., and Davies, B. (2006). UPF1 is required for 1062
nonsense-mediated mRNA decay (NMD) and RNAi in Arabidopsis. Plant J. 47: 480–489. 1063
Ayres, D.C., and Hellier, D.G. (1998). Boron. In Dictionary of Environmentally Important 1064
Chemicals. (London: Blackie Academic and Professional), pp. 64–65. 1065
38
Blevins, D.G., and Lukaszewski, K.M. (1998). Boron in plant structure and function. 1066
Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 481–500. 1067
Bonilla, I., Garcia-González, M., and Mateo, P. (1990). Boron requirement in 1068
cyanobacteria: its possible role in the early evolution of photosynthetic organisms. Plant 1069
Physiol. 94: 1554–1560. 1070
Brown, P.H., Bellaloui, N., Wimmer, M.A., Bassil, E.S., Ruiz, J., Hu, H., Pfeffer, H., 1071
Dannel, F., and Römheld, V. (2002). Boron in plant biology. Plant Biol. (Stuttg.) 4: 205–1072
223. 1073
Chen, X., Schauder, S., Potier, N., Van Dorsselaer, A., Pelczer, I., Bassler, B.L., and 1074
Hughson, F.M. (2002). Structural identification of a bacterial quorum-sensing signal 1075
containing boron. Nature 415: 545–549. 1076
Chiba, Y., Sakurai, R., Yoshino, M., Ominato, K., Ishikawa, M., Onouchi, H., and 1077
Naito, S. (2003). S-Adenosyl-L-methionine is an effector in the post-transcriptional 1078
autoregulation of the cystathionine γ-synthase gene in Arabidopsis. Proc. Natl. Acad. Sci. 1079
USA 100: 10225–10230. 1080
Chiba, Y., Ishikawa, M., Kijima, F., Tyson, R.H., Kim, J., Yamamoto, A., Nambara, E., 1081
Leustek, T., Wallsgrove, R.M, and Naito, S. (1999). Evidence for autoregulation of 1082
cystathionine γ-synthase mRNA stability in Arabidopsis. Science 286: 1371–1374. 1083
Child, S.J., Miller, M.K., and Geballe, A.P. (1999). Translational control by an upstream 1084
open reading frame in the HER-2/neu transcript. J. Biol. Chem. 274: 24335-24341. 1085
Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-1086
mediated transformation of Arabidopsis thaliana. Plant J. 16: 735–743. 1087
Curtis, M.D., and Grossniklaus, U.A. (2003). A gateway cloning vector set for high-1088
throughput functional analysis of genes in planta. Plant Physiol. 133: 462–469. 1089
39
Dembitsky, V.M., Smoum, R., Al-Quntar, A.A., Ali, H.A., Pergament, I., and Srebnik, 1090
M. (2002). Natural occurrence of boron-containing compounds in plants, algae and 1091
microorganisms. Plant Sci. 163: 931–942. 1092
Ebina, I., Takemoto, M., Watanabe, S., Koyama, H., Endo, Y., Kimata, K., Igarashi, 1093
T., Murakami, K., Kudo, R., Osumi, A., et al. (2015). Identification of novel Arabidopsis 1094
thaliana upstream open reading frames that control expression of the main coding 1095
sequences in a peptide sequence-dependent manner. Nucleic Acids Res. 43: 1562–1576. 1096
Fort, D.J., Propst, T.L., Stover, E.L., Strong, P.L., and Murray, F.J. (1998). Adverse 1097
reproductive and developmental effects in Xenopus from insufficient boron. Biol. Trace 1098
Elem. Res. 66: 237–259. 1099
Gaba, A., Jacobson, A., and Sachs, M.S. (2005). Ribosome occupancy of the yeast CPA1 1100
upstream open reading frame termination codon modulates nonsense-mediated mRNA 1101
decay. Mol. Cell 20: 449–460. 1102
Gasber, A., Klaumann, S., Trentmann, O., Trampczynska, A., Clemens, S., Schneider, 1103
S., Sauer, N., Feifer, I., Bittner, F., Mendel, R.R., et al. (2011). Identification of an 1104
Arabidopsis solute carrier critical for intracellular transport and inter-organ allocation of 1105
molybdate. Plant Biol. (Stuttg.) 13: 710–718. 1106
German, M.A., Pillay, M., Jeong, D.H., Hetawal, A., Luo, S., Janardhanan, P., 1107
Kannan, V., Rymarquis, L.A., Nobuta, K., German, R., et al. (2008). Global 1108
identification of microRNA-target RNA pairs by parallel analysis of RNA ends. Nat. 1109
Biotechnol. 26: 941–946. 1110
Hajdukiewicz, P, Svab, Z., and Maliga, P. (1994). The small, versatile pPZP family of 1111
Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25: 989–994. 1112
Hellens, R.P., Brown, C.M., Chisnall, M.A., Waterhouse, P.M., and Macknight, R.C. 1113
(2016). The emerging world of small ORFs. Trends Plant Sci. 21: 317–328. 1114
40
Hieno, A., Naznin, H.A., Hyakumachi, M., Sakurai, T., Tokizawa, M., Koyama, H., 1115
Sato, N., Nishiyama, T., Hasebe, M., Zimmer, A.D., et al. (2014). ppdb: plant promoter 1116
database version 3.0. Nucleic Acids Res. 42: D1188–D1192. 1117
Hinnebusch, A.G. (2005). Translational regulation of GCN4 and the general amino acid 1118
control of yeast. Annu. Rev. Microbiol. 59: 407–450. 1119
Ho, C.H., Lin S.H., Hu H.C., and Tsay, Y.F. (2009). CHL1 functions as a nitrate sensor in 1120
plants. Cell 138: 1184-1194. 1121
Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K., and Pease, L,R. (1989). Site-directed 1122
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51–59. 1123
Hood, H.M., Neafsey, D.E., Galagan, J., and Sachs, M.S. (2009). Evolutionary roles of 1124
upstream open reading frames in mediating gene regulation in fungi. Annu. Rev. Microbiol. 1125
63: 385–409. 1126
Hori, K., and Watanabe, Y. (2005). UPF3 suppresses aberrant spliced mRNA in 1127
Arabidopsis. Plant J. 43: 530–540. 1128
Ishikawa, M., Naito, S., and Ohno, T. (1993). Effects of the tom1 mutation of Arabidopsis 1129
thaliana on the multiplication of tobacco mosaic virus RNA in protoplasts. J. Virol. 67: 1130
5328–5338. 1131
Jackson, R.J., Hellen, C.U., and Pestova, T.V. (2010). The mechanism of eukaryotic 1132
translation initiation and principle of its regulation. Nat. Rev. Mol. Cell. Biol. 11: 113–127. 1133
Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fusions: β-1134
glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 1135
3901–3907. 1136
Joshi, C.P., Zhou, H., Huang, X., and Chiang, V.L. (1997). Context sequences of 1137
translation initiation codon in plants. Plant Mol. Biol. 35: 993–1001. 1138
41
Juntawong, P., Girke, T., Bazin, J., and Bailey-Serres, J. (2014). Translational dynamics 1139
revealed by genome-wide profiling of ribosome footprints in Arabidopsis. Proc. Natl. Acad. 1140
Sci. USA 111: E203-E212. 1141
Kabu, M., and Akosman, M.S. (2013). Biological effects of boron. Rev. Environ. Contam. 1142
Toxicol. 225: 57–75. 1143
Kato, Y., Miwa, K., Takano, J., Wada, M., and Fujiwara, T. (2009). Highly boron 1144
deficiency tolerant plants generated by enhanced expression of NIP5;1, a boric acid 1145
channel. Plant Cell Physiol. 50: 58–66. 1146
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that 1147
modulates translation by eukaryotic ribosomes. Cell 44: 283–292. 1148
Kozak, M. (1987). Effects of intercistronic length on the efficiency of reinitiation by 1149
eucaryotic ribosomes. Mol. Cell. Biol. 7: 3438–3445. 1150
Kozak, M. (2001). Constrains on reinitiation of translation in mammals. Nucleic Acids 1151
Res. 29: 5226–5232. 1152
Krummheuer, J., Johnson, A.T., Hauber, I., Kammler, S., Anderson, J.L., Hauber, J., 1153
Purcell, D.F., and Schaal, H. (2007). A minimal uORF within the HIV-1 vpu leader allows 1154
efficient translation initiation at the downstream env AUG. Virology 363: 261-271. 1155
Lamesch, P., Berardini, T.Z., Li, D., Swarbreck, D., Wilks, C., Sasidharan, R., Muller, 1156
R., Dreher, K., Alexander, D.L., Garcia-Hernandez, M., et al. (2012). The Arabidopsis 1157
Information Resource (TAIR): improved gene annotation and new tools. Nucleic Acids Res. 1158
40: D1202–D1210. 1159
Lanoue, L., Trollinger, D.R., Strong, P.L., and Keen, C.L. (2000). Functional 1160
impairments in preimplantation mouse embryos following boron deficiency. FASEB J. 1161
14A: 539. 1162
42
Li, Y.F., Zheng, Y., Addo-Quaye, C., Zhang, L., Saini, A., Jagadeeswaran, G., Axtell, 1163
M.J., Zhang, W., and Sunkar, R. (2010). Transcriptome-wide identification of microRNA 1164
targets in rice. Plant J. 62: 742–759. 1165
Liu, H., Qin, C., Chen, Z., Zuo, T., Yang, X., Zhou, H., Xu, M., Cao, S., Shen, Y., Lin, 1166
H., et al. (2014). Identification of miRNAs and their target genes in developing maize ears 1167
by combined small RNA and degradome sequencing. BMC Genomics 15: 25. 1168
Matsuo, N., Minami, M., Maeda, T., and Hiratsuka, K. (2001). Dual luciferase assay for 1169
monitoring transient gene expression in higher plants. Plant Biotechnol. 18: 71–75. 1170
Menges, M., and Murray, J.A. (2002). Synchronous Arabidopsis suspension cultures for 1171
analysis of cell-cycle gene activity. Plant J. 30: 203–212. 1172
Morris, D.R., and Geballe, A.P. (2000). Upstream open reading frames as regulators of 1173
mRNA translation. Mol. Cell. Biol. 20: 8635–8642. 1174
Nagata, T., Nemoto, Y., and Haswzawa, S. (1992). Tobacco BY-2 cell line as the “HeLa” 1175
cell in the cell biology of higher plants. Int. Rev. Cytol. 132: 1–30. 1176
Nei, M., and Kumar, S. (2000). Molecular Evolution and Phylogenetics. (Oxford 1177
University Press), pp. 352. 1178
Nyikó, T., Sonkoly, B., Mérai, Z., Benkovics, A.H., and Silhavy, D. (2009). Plant 1179
upstream ORFs can trigger nonsense-mediated mRNA decay in a size-dependent manner. 1180
Plant Mol. Biol. 71: 367–378. 1181
O’Neill, M.A., Eberhard, S., Albersheim, P., and Darvill, A.G. (2001). Requirement of 1182
borate cross-linking of cell wall rhamnogalacturonan II for Arabidopsis growth. Science 1183
294: 846–849. 1184
O’Neill, M.A., Ishii, T., Albersheim, P., and Darvill, A.G. (2004). Rhamnogalacturonan 1185
II: structure and function of a borate cross-linked cell wall pectic polysaccharide. Annu. 1186
Rev. Plant Biol. 55: 109–139. 1187
43
Onouchi, H., Nagami, Y., Haraguchi, Y., Nakamoto, M., Nishimura, Y., Sakurai, R., 1188
Nagao, N., Kawasaki, D., Kadokura, Y., and Naito, S. (2005). Nascent peptide-mediated 1189
translation elongation arrest coupled with mRNA degradation in the CGS1 gene of 1190
Arabidopsis. Genes Dev. 19: 1799–1810. 1191
Power, P.P., and Woods W.G. (1997). The chemistry of boron and its speciation in plants 1192
Plant Soil 193: 1–13. 1193
Rajkowitsch, L., Vilela, C., Berthelot, K., Ramirez, C.V., and McCarthy, J.E.G. (2004). 1194
Reinitiation and recycling are distinct processes occurring downstream of translation 1195
termination in yeast. J. Mol. Biol. 335: 71–85. 1196
Rowe, R.I., and Eckhert, C.D. (1999). Boron is required for zebrafish embryogenesis. J. 1197
Exp. Biol. 202: 1649–1654. 1198
Sachs, M.S., Wang, Z., Gaba, A., Fang, P., Belk, J., Ganesan, R., Amrani, N., and 1199
Jacobson, A. (2002). Toeprint analysis of the positioning of translation apparatus 1200
components at initiation and termination codons of fungal mRNAs. Methods 26: 105–114. 1201
Saitou, N., and Nei, M. (1987). The neighbor-joining method: A new method for 1202
reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–425. 1203
Sedbrook, J.C., Carroll, K.L., Hung, K.F., Masson, P.H., and Somerville, C.R. (2002). 1204
The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-1205
anchored glycoprotein involved in directional root growth. Plant Cell 14: 1635–1648. 1206
Smyth, D.A., and Dugger, W.M. (1981). Cellular changes during boron deficient culture 1207
of the diatom Cylindrotheca fusiformis. Physiol. Plant. 51: 111–117. 1208
Takano, J., Miwa, K., Yuan, L., von Wirén, N., and Fujiwara, T. (2005). Endocytosis 1209
and degradation of BOR1, a boron transporter of Arabidopsis thaliana, regulated by boron 1210
availability. Proc. Natl. Acad. Sci. USA 102: 12276–12281. 1211
44
Takano, J., Wada, M., Ludewig, U., Schaaf, G., von Wirén, N., and Fujiwara, T. 1212
(2006). The Arabidopsis major intrinsic protein NIP5;1 is essential for efficient boron 1213
uptake and plant development under boron limitation. Plant Cell 18: 1498–1509. 1214
Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: 1215
Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30: 2725–2729. 1216
Tanaka, M., Takano, J., Chiba, Y., Lombardo, F., Ogasawara, Y., Onouchi, H., Naito, 1217
S., and Fujiwara, T. (2011). Boron-dependent degradation of NIP5;1 mRNA for 1218
acclimation to excess boron conditions in Arabidopsis. Plant Cell 23: 3547–3559. 1219
Uchiyama-Kadokura, N., Murakami, K., Takemoto, M., Koyanagi, N., Murota, K., 1220
Naito, S., and Onouchi, H. (2014). Polyamine-responsive ribosomal arrest at the stop 1221
codon of an upstream open reading frame of the AdoMetDC1 gene triggers nonsense-1222
mediated mRNA decay in Arabidopsis thaliana. Plant Cell Physiol. 55: 1556-1567. 1223
von Arnim, A.G., Jia, Q., and Vaughn, J.N. (2014). Regulation of plant translation by 1224
upstream open reading frames. Plant Sci. 214: 1–12. 1225
Wang, Z., and Sachs, M. S. (1997). Ribosome stalling is responsible for arginine-specific 1226
translational attenuation in Neurospora crassa. Mol. Cell. Biol. 17: 4904–4913. 1227
Warington, K. (1923). The effect of boric acid and borax on the broad bean and certain 1228
other plant. Ann. Bot. 37: 629–672. 1229
Woods, W.G. (1996). Review of possible boron speciation relating to its essentiality. J. 1230
Trace Elem. Exp. Med. 9: 153–163. 1231
Yamashita, Y., Kadokura, Y., Sotta, N., Fujiwara, T., Takigawa, I., Satake, A., 1232
Onouchi, H., and Naito, S. (2014). Ribosomes in a stacked array: elucidation of the step in 1233
translation elongation at which they are stalled during S-adenosyl-L-methionine-induced 1234
translation arrest of CGS1 mRNA. J. Biol. Chem. 289: 12693–12704. 1235
45
Yanagisawa, S. (2002). The Dof family of plant transcription factors. Trends Plant Sci. 7: 1236
555-560. 1237
Yoine, M., Nishii, T., and Nakamura, K. (2006a). Arabidopsis UPF1 RNA helicase for 1238
nonsense-mediated mRNA decay is involved in seed size control and is essential for 1239
growth. Plant Cell Physiol. 47: 572-580. 1240
Yoine, M., Ohto, M.A., Onai, K., Mita, S., and Nakamura, K. (2006b). The lba1 1241
mutation of UPF1 RNA helicase involved in nonsense-mediated mRNA decay causes 1242
pleiotropic phenotypic changes and altered sugar signalling in Arabidopsis. Plant J. 47: 49–1243
62. 1244
Zhou, F., Roy, B., and von Arnim, A.G. (2010). Translation reinitiation and development 1245
are compromised in similar ways by mutations in translation initiation factor eIF3h and the 1246
ribosomal protein RPL24. BMC Plant Biol. 10: 193. 1247
1 2 3
A
C
Dwild-type
AUG mutation
Relative GUS activityTransgenic lines 0 1
WT#8
TTGTAA
ATGTAA
#4
#8
#10
2
Pro35S–1–306
LUC
ATGTAA–122
B0
Relative LUC activityConstructs
Transfection
* +B
–1
ATGTAAGUSPro35S
–306
–122Pro35S:5'-NIP5;1(–306):GUS DNA
0 0.01 0.02 0.03
#2
#18
#19
ATGGGA
stop codon disruption#2
#18
#19
vector 5'-UTR
ATCATGTAAwild-type
AUG mutations
TTCATGTAAKozak
TTGTAA
ATCTAA
add codon(s)ATG-1cdn-TAA
ATG-3cdn-TAA
AAGTAA
stop codon disruptionsATGGGA
ATGCAA
ATGTAC
–B+B*
other stopsATGTAG
ATGTGA
**
*
0 0.05 0.1 0.15 0.2 0.25
ATGGGA
ATGCAA
ATGTAC
Pro35S:5'-NIP5;1(–306):LUC DNA
–B
Figure 1. B-Dependent Downregulation of NIP5;1.
(A) Schematic representation of Pro35S:5′-NIP5;1(−306):LUC DNA. Open boxes represent uORFs. The thick line represents the sequence corresponding to the 5′-UTR of NIP5;1. Nucleotide numbers are relative to the translation start site (+1). The thin lines represent 18-nt and 15-nt linker sequences at the 5′ and 3′ ends, respectively, of the 5′-UTR. (B) Transfection experiments using Arabidopsis cultured cells. Constructs represent the sequences of, and around, the AUGUAA in each construct with the altered nucleotides shown in red. Transfected protoplasts were incubated under 500 μM B (+B) or 1 μM B (−B) conditions. The LUC activity of each transfected cell extract was normalized with RLUC activity from the co-transfected internal control plasmid and shown as the relative LUC activity. Means ± SD of relative LUC activities are shown (n = 3). Asterisks indicate a significant reduction in +B compared with −B conditions (p < 0.05). The ‘vector 5′-UTR’ negative control carries only the vector’s 5′-UTR sequence. The nucleo-tide and corresponding amino acid sequences of ATG-1cdn-TAA and ATG-3cdn-TAA are shown in Supplemental Figure 2C. (C) Schematic representation of Pro35S:5′-NIP5;1(−306):GUS DNA. The thin lines represent 37-nt and 59-nt linker sequences at the 5′ and 3′ ends, respectively, of the 5′-UTR. (D) Effect of B on GUS activities in transgenic plants. Transgenic plants were grown under 100 µM B (+B) or 0.3 µM B (−B) conditions. Relative GUS activities in roots were determined. Transgenic line WT#8 carries wild-type −
122AUG-stop (Tanaka et al., 2011). Three each of independent transgenic lines were used for the mutant constructs. Means ± SD of GUS activities relative to that of WT#8 under −B are shown (n = 4−5). Asterisks indicate significant reductions under +B condition (p < 0.05).
...UUUAUAAAAAUCUUUCAAAGCAUGUAAAUUUAAGUCCU...
T
A
0
5
10
Rel
ativ
e PE
sig
nal
15
B Primer extension(PE)C AGU
Ladder
–312AU
GU
AA–122
AUG
UAA
Full-length
PE signal
PE signal
NIP5;1 mRNA in vivo
20
0
5
10
15
–B +BT
20
–B +BT
C
D
–1
NIP5;1
–558
ProNIP5;1
ATGTAAATGTAA –122–312
**
**
Rel
ativ
e PE
sig
nal
B– +
...AAUUUAUAAAAAUUUCAAAUCAUGUAAAUUUCGUCUCU...PE signal –122
RibosomeP
siteA
site
PE signal –312
RibosomeP
siteA
site
Figure 2. B-Dependent NIP5;1 mRNA Degradation Intermediates In Vivo
(A) Schematic representation of the NIP5;1 5′-UTR region. (B) Primer extension analysis. Col-0 plants were grown for 28 d with 100 µM B (+B) or 0.3 µM B (−B). For the sample in lane T, Col-0 plants grown for 28 d with 0.3 µM B were transferred to 100 µM B for 10 min. Total RNA extracted from the roots was used for primer extension reaction. Loading was adjusted to ensure full-length signal intensities were at similar levels. A sequence ladder was generated using the same primer. The open arrowhead marks the 5′-end of the full-length mRNA. Primer extension signals corresponding to the 5′-ends of RNA degrada-tion intermediates upstream of −312AUG-stop and −122AUG-stop are marked with magenta brackets. (C) and (D) Means ± SD (n = 3) of relative primer extension signal intensities are shown for −122AUG-stop (C) and
−312AUG-stop (D). Asterisks indicate significant differences (p < 0.05). Nucleotide sequences around the AUG-stops, with primer extension signal positions, are shown. Ribosomes occupying the RNA having the AUG codon posi-tioned at the P-site are shown.
A
B
F
E Toeprint (TP)
5'-NIP5;1(–306):LUC RNA
D
1 2+ B
Rel
ativ
ePE
sig
nal
0
1
2
+ B
Rel
ativ
eTP
sig
nal
0
1
2
+ B5 6
+ B
GCA
1 2 3 4
AUGUAA
UAUCUAA
Ladder
Full-length
PE signal
B– + – +
AUG
UAA
–122
GCA
5 6 7 8
ULadder AUGUAA
AUCUAA
Full-length
TP signal
B– + – +
AUG
UAA
–122
Primer extension(PE)
LUC A30
AUGUAA
–1–306
Added B (µM)
Rel
ativ
e LU
C a
ctiv
iy
0
0.5
1
AUGUAA
*
*
*
10 100 1,0001
TP signal
AUCUAA
AUCUAA–122
* *
B– B–B– B–
...AAUUUAUAAAAAUUUCAAAUCAUGUAAAUUUCGUCUCUAUCAAUUU...PE signal –122
RibosomeP
siteA
site
1 2 5 6
Extra band-1Extra band-2
0
0.5
1
NaCl KNO3 KH2PO4
AUGUAA AUCUAA
500 µM
C
Rel
ativ
e LU
C a
ctiv
iy
Figure 3. AUG-Stop Affects B-Dependent Downregulation of NIP5;1.
(A) Schematic representation of 5′-NIP5;1(−306):LUC RNA. The thick line represents the mRNA sequence and open boxes represent uORFs. (B) Effect of B on translation in vitro. RNA carrying 5′-NIP5;1(−306):LUC with or without a mutation in AUGUAA was translated in WGE. Means ± SD of relative LUC activities under various B conditions are shown (n = 3). Asterisks indicate significant reductions in RNA carrying −122AUGUAA (p < 0.05). (C) Effects of NaCl, KNO3 and KH2PO4 at 500 μM on reporter expression in vitro. RNA carrying 5′-NIP5;1(−306):LUC with or without a mutation in AUGUAA was translated in WGE. Means ± SD of relative LUC activities are shown (n = 3)(D) and (E) Primer extension (PE) (D) and toeprint (TP) (E) analyses in WGE with 300 µM B (+B) or without B supplementation (−B). Signals are enlarged under the main image of the AUGUAA lane, and their means ± SD (n = 3) of relative intensities are shown. Asterisks indicate significant differences (p < 0.05). (F) Nucleotide sequence around −122AUG-stop. Positions of PE (magenta) and TP signals (green) are marked. Ribo-some occupation of RNA having the AUG codon positioned at the P-site is shown.
A Pro35S:5'-NIP5;1(–306):LUC DNA
Pro35S LUC
ATGTAA
LUC
LUC
LUC
wild-type–306
–40
–65
–94
–1
–40
–65
–94
–1
–122
wild-type–1
3’ deletions
vector 5’-UTR
–B+B
B
131 nt
37 nt
Spacer length
Relative LUC activity0
91 nt
0.5 1
–40
–65
–94
1.5
67 nt
*
*
*
*
3’ deletions
Transfection
Pro35S
Pro35S
Pro35S
Figure 4. B-Dependent Reinitiation of NIP5;1.
(A) Schematic representation of 3′-deletion series of Pro35S::5′-NIP5;1(−306):LUC DNA. The thick line represents the sequence corresponding to NIP5;1 mRNA. The thin lines represent the 18-nt and 15-nt linker sequences at the 5′ and 3′ ends, respectively, of the 5′-UTR. (B) Effects of spacer deletions on the B response in transfection experiments. Transfected protoplasts were incu-bated under 500 μM B (+B) or 1 μM B (−B) conditions and means ± SD of relative LUC activities (n = 8) are shown. Asterisks indicate significant reductions under +B compared with −B conditions (p < 0.05). The ‘vector 5′-UTR’ neg-ative control carries only the vector’s 5′-UTR sequence.
B
E
5'-MOT2(–333):LUC RNA
DC Primer extension(PE)
Toeprint (TP)
A MOT2 mRNAin vivo
3 4+B
7 8+B
Rel
ativ
ePE
sig
nal
0
1
2
+B 0
1
Rel
ativ
eTP
sig
nal
+B
1 2 3 4
G CALadderU
Full-length
PE signal
+ +CAGUGU
AUGUAA
B– –
AU
GU
AA
–122
+ +
5 6 7 8
G CALadderU
CAGUGU
AUGUAA
Full-length
TP signal
B– –
AU
GU
AA
–122
Rel
ativ
e m
RN
A le
vel
0
0.5
1
+B
A30LUC
CAGUGU
AUGUAAA30
LUC–333
–122
–1
Rel
ativ
e LU
C a
ctiv
ity
10 100 1,0000
0.5
1
1
* **
CAGUGUAUGUAA
AddedB (µM)
–122
* *
B–B– B–B–
B–
TP signal...GUUAGGACAUUGGACUCGUCAUGUAACUGAAAGCCGUCUUU...
PE signal –122
RibosomeP
siteA
site
3 4 7 8
Figure 5. B-Dependent Downregulation Conferred by Introduction of AUG-Stop into MOT2 5′-UTR.
(A) mRNA accumulation in Col-0 roots under 100 µM B (+B) and 0.3 µM B (−B) conditions. Means ± SD of relative mRNA accumulation (n = 3) are shown. (B) Schematic representation of 5′-MOT2(−333):LUC RNA and the effect of AUGUAA introduction on the B response. RNA carrying 5′-MOT2(−333):LUC with or without AUGUAA was translated in WGE in the presence of various B concentrations. Means ± SD of relative LUC activities (n = 3) are shown. Asterisks indicate significant reduction of reporter activity in RNA having an AUGUAA than that in RNA having the original MOT2 5′-UTR sequence (p < 0.05). (C) and (D) Primer extension (PE) (C) and toeprint (TP) (D) analyses in WGE with 300 µM B (+B) or without B supplementation (−B). Signals are enlarged under the main image of the AUGUAA lane, and means ± SD of relative intensities are shown (n = 3). Asterisks indicate significant differences (p < 0.05). (E) Nucleotide sequence around AUG-stop and the positions of PE (magenta) and TP signals (green). Ribosome occupation of RNA having the AUG codon positioned at the P-site is shown.
5'-SKU5(–206):LUC RNA
E
D
A BSKU5 mRNA in vivo
C
Rel
ativ
ePE
sig
nal
–B +B0
1R
elat
ive
TP s
igna
l
–B +B1 2
+B–B5 6
+B–B
Rel
ativ
e m
RN
A le
vel
0
0.5
–B +B
*
Rel
ativ
e LU
C a
ctiv
ity
0
0.5
1
AddedB(µM)10 100 1,0001
AUGUAAAUCUAA
**
Primer extension(PE)
– ++
1 2 3 4
GCALadderU
Full-length
PE signal
AUGUAA
B–AUCUAA
AU
GU
AA
–104
Toeprint (TP)
+ +
5 6 7 8
GCALadderU
Full-length
TP signal
AUGUAA
AUCUAA
B– –
AU
GU
AA
–104
FWs sku5
+ B–Bsku5
*
0
1
2*
0
10
Wssku5
–B +B
Roo
t len
gth
(cm
)
5
*
sku5Ws
TP signal...UUUCCCGAAUCUUGAUAAUGUAAAUUCACAACAAAUCUG...
PE signal –104
RibosomeP
siteA
site
A30LUC–206
AUGUAA
–1
AUCUAA–104
1 2 5 6
Ws
Figure 6. Role of AUG-Stop in B-Dependent Downregulation of SKU5.
(A) mRNA accumulation in Col-0 roots under 100 µM B (+B) and 0.3 µM B (−B). Means ± SD of relative mRNA accu-mulation (n = 3) are shown. An asterisk indicates significant reduction under +B condition (p < 0.05). (B) Schematic representation of the 5′-SKU5(−206):LUC RNA. Open boxes represent uORFs. 5′-SKU5(−206):LUC RNA was translated in WGE, and means ± SD of relative LUC activities (n = 3) are shown. Asterisks indicate signifi-cant reductions of releative reporter activity in RNA carrying AUGUAA (p < 0.05). (C) and (D) Primer extension (PE) (C) and toeprint (TP) (D) analyses in WGE with 300 µM B (+B) or without B supplementation (−B). Signals are enlarged below the main image of the AUGUAA lane, and means ± SD of relative signal intensities are shown (n = 3). Asterisks indicate significant differences (p < 0.05). (E) Nucleotide sequence around AUG-stop and the positions of PE (magenta) and TP signals (green) are marked. Ribosome occupation of RNA having the AUG codon positioned at the P-site is shown. (F) Arabidopsis Ws and sku5 mutant plants were grown with 0.3 µM B (−B) or 100 µM B (+B) conditions for 10 d, and root length was measured. Means ± SD of root length (n = 5−10) are shown. Asterisks indicate significant reductions in root lengths of sku5 mutants as compared with wild-type Ws (p < 0.05). Scale bar: 10 mm.
Info
rmat
ion
cont
ent
B-responsive genes
non-B-responsive genes
-19 -16 +1-1-13 -10 -7 -4 7 252210 13 16 194
A
B RibosomeP
siteA
site
RibosomeP
siteA
site
0
1
2
0
1
2
Info
rmat
ion
cont
ent
-19 -16 +1-1-13 -10 -7 -4 7 252210 13 16 194
Figure 7. Sequence Consensus around AUG-Stop in B-Responsive Genes.
(A) and (B) Sequence logos around AUGUAA. NIP5;1, ABS2/NGAL1, SUK5, and the rice and maize orthologs of Arabidopsis NIP5;1 that are subject to B-dependent AUG-stop-mediated mRNA degradation (Supplemental Table 2) (A), and non-B-responsive genes represented by 100 genes whose FC+B/−B value was closest to 1.0 by microarray analysis (B) were used to construct sequence logo. Positions are shown with the A of AUG as +1. Ribo-some occupation of RNA having the AUG codon positioned at the P-site is shown.
11 12
++
C Toeprint (TP)B
GCAUAUA/A
UGUAA
UUAUA/A
UCUAA
Ladder
Full-length
PE signal
B– –
AUG
UAA
–122
GCAULadder
Full-length
TP signal
AUG
UAA
–122
Primer extension(PE)
+–CCCC/A
UGUAA
A 5'-NIP5;1(–306):LUC RNA
D
++UAUA/A
UGUAA
UAUA/AUCUAA
B– – +–CCCC/A
UGUAA
Rel
ativ
e m
RN
A le
vels
WT#15 WT#18 #11 #6 #12 #16
ProNIP5;1:5'-NIP5;1(–558):NIP5;1 mRNA in vivoE
–B+B
F–307
NIP5;1ProNIP5;1–558 –1
AUGUAA
–139UAUA /–122AUGUAA
–139UAUA CCCC–321
0
1
2
Rel
ativ
ePE
sig
nal
1 2 3 4 5 6
1 2 5 6
AUGUAAΔ
2
0
1
–B + – +Rel
ativ
eTP
sig
nal
7 8 9 10 11 12
7 8
–122
–139UAUA / –122AUGUAAΔ
–139CCCC /–122AUGUAA
–139UAUA
LUC A30
CCCC–306
* * *
TP signal...AAUUUAUAAAAAUUUCAAAUCAUGUAAAUUUCGUCUCUAUCAAUUU...
PE signal –122
RibosomeP
siteA
site
...AAUUCCCCAAAAUUUCAAAUCAUGUAAAUUUCGUCUCUAUCAAUUU...
– + – +1 2 5 6 11 127 8
–1AUGUAA AUCUAA–122
* *
0
0.5
1
1.5
*
– +– +– +– +
TP signalweak
Figure 8. The Upstream Conserved Sequence Affects B-Dependent mRNA Degradation.
(A) Schematic representation of 5′-NIP5;1(−306):LUC RNA. Open boxes represent uORFs. (B) and (C) RNA carrying 5′-NIP5;1(−306):LUC with or without a mutation in AUGUAA or with a mutation in the region 17–14 nt upstream of −122AUG-stop was translated in WGE. Primer extension (PE) (B) and toeprint (TP) (C) analyses in WGE with 300 µM B (+B) or without B supplementation (−B). Signals are enlarged under the main image of the AUGUAA lane, and their relative intensities are shown. Means ± SD are shown (n = 3). Asterisks indicate significant differences (p < 0.05). (D) Nucleotide sequence around −122AUG-stop. Positions of PE (magenta) and TP signals (green) are marked. Ribo-some occupation of RNA having the AUG codon positioned at the P-site is shown. (E) Schematic representation of ProNIP5;1::5′-NIP5;1(−558):NIP5;1. Deletion of −312AUGUAA, a mutation in the upstream conserved sequence, and the deletion of −122AUGUAA are indicated. (F) mRNA accumulation in transgenic plant roots grown under 100 µM B (+B) and 0.3 µM B (−B) conditions. Means ± SD of relative mRNA accumulation (n = 3) are shown. Asterisks indicate significant reductions under +B condition (p < 0.05). Two independently transformed lines are used for each construct.
WT15 #6 #12nip5;1-1Col-0
nip5;1-1
–139UAUA /
–122AUGUAA
–139UAUA /
–122AUGUAA Δ
–139CCCC /
–122AUGUAA
none
none
wild-type
C
B
A
trans-gene
back-ground
0.3 µM B (low B condition)
0
2
4
6
8
10 Root length (cm
)
aa a
a a a
b
c
Col-0
WT#15
WT#18
# 6
# 11# 12# 16
nip5;1-1
0
2
4
6
8a
abcab bc
cdd
bc abc
Root length (cm
)
3,000 µM B (excess B condition)
nip5;1-1
–139UAUA /
–122AUGUAA
–139UAUA /
–122AUGUAA Δ
–139CCCC /
–122AUGUAA
0
2
4
6
8
10
Root length (cm
)
100 µM B (high B condition)
nonenone
wild-type
Col-0 WT18 #11 #16nip5;1-1
–139UAUA /
–122AUGUAA
–139UAUA /
–122AUGUAA Δ
–139CCCC /
–122AUGUAA
none
none
nip5;1-1wild-type
Col-0
WT#15
WT#18
# 6
# 11# 12# 16
nip5;1-1
Col-0
WT#15
WT#18
# 6
# 11# 12# 16
nip5;1-1
Figure 9. AUG-Stop Affects Root Growth under Excess B condition.
(A) to (C) Col-0, nip5;1-1 and the transgenic lines used in Figure 8F were grown on plates containing 0.3 μM B for 13 days (A), 100 μM B for 10 days (B), and 3,000 μM B for 14 days (C) and root lengths were measured. Pictures were taken after the roots of Col-0 plants reached more than 6 cm. Means ± SD are shown (n = 4–10). Different letters indicate significant differences (p < 0.05) by Tukey-test. Bars = 10 mm.
A 5'-NIP5;1(–306):LUC RNA
Added B (µM)
B
1 10 100 1,0000
0.5
1
**
**
AUGUAAAUCUAA
RRL
LUC A30
AUCUAAAUGUAA
–1–306
ProSV40:5'-NIP5;1(–231):LUC DNAC
D
–122
–231LUC
ATGTAAATGTAA
–1
–122
ProSV40
Δ
Rel
ativ
e LU
C a
ctiv
ity
0 µM500 µM1,000 µM
Rel
ativ
e LU
C a
ctiv
ity
0
1
2
ATGTAA (wild-type)
ATGTAA Vector 5’-UTR
**
40
60
20
0Δ
Figure 10. B-Dependent Downregulation through the AUG-Stop of NIP5;1 in Animal Systems.
(A) Schematic representation of 5′-NIP5;1(−306):LUC RNA. Open boxes represent uORFs. (B) 5′-NIP5;1(−306):LUC RNA was translated in RRL, and means ± SD of relative LUC activities (n = 3) are shown. Asterisks indicate significant reductions in RNA carrying −122AUGUAA (p < 0.05). (C) Schematic representation of ProSV40::5′-NIP5;1(−231):LUC RNA. The thick line represents the sequence derived from the NIP5;1 5′-UTR and the thin line represents the 35-nt linker sequence. (D) Effect of B on reporter activities in transfected HeLa cells. Transfected HeLa cells were incubated under various B conditions, and means ± SD of relative LUC activities (n = 6) are shown. Asterisks indicate significant reductions in +B compared with no supplementation of B (p < 0.05). The ‘vector 5′-UTR’ negative control carries only the vector’s 5′-UTR sequence.
ArthropodaNem
atoda BryophytaCh
lorop
hyta
50
Oryza sativa
uORF length (codons)
Arabidopsis thaliana Glycine max
Vitis vinifera
Zea mays
Physcomitrellapatens
Chlamydomonasreinhardtii
Caenorhabditiselegans
Drosophilamelanogaster
Danio rerio
Mus musculus Homo sapiens
Mammalia Dicotyledoneae
Monocot
yledo
neae
Chor
data
Magnoliophyta
P
la
nt
ae
An
ima
l i a
060
1 5 10 15 20 020
1 5 10 15 20 015
0
1 5 10 15 20
015
1 5 10 15 20
050
1 5 10 15 20
050
1 5 10 15 20040
1 5 10 15 2005
1 5 10 15 2008
1 5 10 15 20
050
1 5 10 15 20
040
1 5 10 15 20
035
1 5 10 15 20O
ccur
renc
e x
10−2
Figure 11. Distribution of uORF Lengths in Various Eukaryotic Species.
Distributions of uORF lengths in the annotated transcripts are shown in bar plots. The calculated distributions of uORF lengths after randomization of 5′-UTR sequences are shown in blue plots (mean ± SD). Frequency of AUG-stops lower than expected is shown in red.
-122AUGUAANIP5;1 main ORF
AUG reco
gnition
Reinitia
tion
Upstream conservedsequence
Stop codon
reco
gnition
mRNA
degrad
ation
Stallin
g
+B
–B
A
C
B Resumptio
n of
sca
nning
Figure 12. Scheme of NIP5;1 Expression Regulation through B-Dependent Ribosome Stalling at AUG-Stop.
(A) Schematic representation of -122AUGUAA to the NIP5;1 main ORF region. The upstream conserved sequence, -122AUGUAA and the main ORF of NIP5;1 are shown. (B) Under the low B condition (−B), the 40S subunit (the 43S preinitiation complex) scans mRNA and finds the AUG of AUGUAA where it assembles into 80S ribosome. Ribosome dissociates but some of the 40S subunit remains on the mRNA and resumes scanning for the downstream AUG. The 80S ribosome is reassembled and reinitiates trans-lation at the AUG codon of the main ORF. (C) Under the high B condition (+B), ribosome mainly stalls at the AUGUAA. The stalling would inhibit resumption of scanning by the 40S subunit, thereby reducing the possibility of reinitiation of translation at the main ORF. mRNA degradation event is induced near the 5′-edge of the stalled ribosome, and translation of the main ORF becomes no longer possible. The upstream conserved sequence is responsible for enhancing the mRNA degradation.
DOI 10.1105/tpc.16.00481; originally published online October 19, 2016;Plant Cell
Yukako Chiba, Masami Yokota Hirai, Tetsu Akiyama, Hitoshi Onouchi, Satoshi Naito and Toru FujiwaraMayuki Tanaka, Naoyuki Sotta, Yusuke Yamazumi, Yui Yamashita, Kyoko Miwa, Katsunori Murota,
mRNA DegradationThe Minimum Open Reading Frame, AUG-Stop, Induces Boron-Dependent Ribosome Stalling and
This information is current as of July 23, 2020
Supplemental Data /content/suppl/2016/10/19/tpc.16.00481.DC1.html
Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs http://www.plantcell.org/cgi/alerts/ctmain
Sign up for eTOCs at:
CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain
Sign up for CiteTrack Alerts at:
Subscription Information http://www.aspb.org/publications/subscriptions.cfm
is available at:Plant Physiology and The Plant CellSubscription Information for
ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists