f

d

Molecular and Cellular Neuroscience 17, 521–538 (2001)

doi:10.1006/mcne.2000.0953, available online at http://www.idealibrary.com on MCN

A

The Metabolism and Imaging in Live Cells of theBovine Prion Protein in Its Native Form orCarrying Single Amino Acid Substitutions

Alessandro Negro, Cristina Ballarin, Alessandro Bertoli,Maria Lina Massimino, and M. Catia Sorgato1

Dipartimento di Chimica Biologica, Centro C.N.R. di Studio delle Biomembrane andC.R.I.B.I., Universita di Padova, Viale G. Colombo 3, 35121 Padova, Italy

Prion diseases are probably caused by an abnormal formof a cellular glycoprotein, the prion protein. Recent evi-dence suggests that the prion strain causing BSE hasbeen transmitted to humans, thereby provoking a variantform of Creutzfeldt–Jacob disease. In this work, we ana-lyzed the behavior of normal and malformed isoforms ofthe bovine PrP in transfected mammalian cell lines. Bio-chemical and immunocytochemical assays were compli-mented with imaging of live cells expressing fusion con-structs between PrP and GFP. Bovine homologues ofhuman E200K and D178N (129M) mutations were used asmodels of pathogenic isoforms. We show that the GFPdoes not impair the metabolism of native and mutantbPrPs and is thus a valid marker of PrP cellular distribu-tion. We also show that each amino acid replacementprovokes alterations in the cell sorting and processing ofbPrP. These are different from those ascribed to bothmurine mutant homologues. However, human and bovinePrPs carrying the D178N genotype had similar cellularbehavior.

INTRODUCTION

Transmissible spongiform encephalopathies (TSE), orprion diseases, are a class of fatal neurodegenerativediseases of animals and humans with sporadic, ac-quired, or genetic aethiology. Within the tenets of the“protein only” hypothesis (Griffith, 1967; Prusiner,1991), these disorders originate because the constitu-tively expressed prion protein, PrPc, converts from an ahelix-rich structure into a predominantly b sheet con-ormation (Pan et al., 1993). The malformed structure is

1 To whom correspondence and reprint requests should be ad-ressed. Fax: 139 049 807 3310. E-mail: sorgato@civ.bio.unipd.it.

1044-7431/01 $35.00Copyright © 2001 by Academic Press

ll rights of reproduction in any form reserved.

typical of PrPSc, the major component of the novel in-fectious particle called prion (Prusiner, 1982). Severalpieces of evidence bolster this hypothesis, such as thecorrelation between inherited TSEs and point mutationsof the PrP gene, and resistance to infectivity of PrP-freeanimals (recently reviewed in Prusiner, 1998). It hasalso been found that PrPc and PrPSc have identicalamino acid sequence and covalent posttranslationalmodifications (Stahl et al., 1993), and that the structuralrearrangement imparts on PrPSc altered biochemicalfeatures (Bolton et al., 1982; Prusiner et al., 1983; Meyeret al., 1986).

The mechanistic details of the proposed conversionprocesses (Prusiner, 1991; Jarrett and Lansbury, 1993)are still ill-defined. According to the above concept,however, replaced amino acids of familial (f) TSEswould promote loss of the native stability of PrPc andpredispose PrPc to form PrPSc (Cohen et al., 1994; Huanget al., 1996). That protein instability is a strict conse-quence of inherited mutations has been refuted on thegrounds of the 3-D structure of recombinant PrP C-terminal domain (Riek et al., 1998). This conclusion is inline with the thermodynamic features of mutant PrPfragments generated in bacteria (Swietnicki et al., 1998;Liemann and Glockshuber, 1999). On the other hand,PrP with familial point mutations have been shown toundergo an altered metabolism in cultured mammaliancells (Lehmann and Harris, 1995, 1996a, 1996b, 1997;Petersen et al., 1996; Daude et al., 1997; Singh et al., 1997;Narwa and Harris, 1999).

Characterization of the behavior of wild-type andmutated PrPs in transfected cells was also the purpose

of this work. However, instead of using a strictly bio-chemical approach as used in previous studies, we took

521

wl

fvf

qa

t

pB

522 Negro et al.

advantage of fusion constructs with the green fluores-cent protein (GFP) to assess the spatial distribution ofPrP directly in single living cells (Tsien, 1998). Chime-rae, constructed using the bovine (b) isoform of PrPc,

ere expressed transiently or stably in mammalian cellines. bPrPc lacks the detailed cellular characterization

of the prion protein of other species, and was chosenbecause of its implication in bovine spongiform enceph-alopathy (BSE) and also perhaps in a variant form ofCreutzfeldt-Jacob disease (vCJD) (Collinge, 1999).

There are no known (disease-related) point mutationsin the gene that encodes bPrP that would enable eluci-dation of metabolic events of BSE prions in cell culturemodels. Recently, however, a much closer structuralsimilarity of human PrPc with the bovine isoform wasreported than with the PrPc of other species (Garcia etal., 2000). We thus mimicked pathologic forms of bPrPby constructing bovine homologues of E200K andD178N (129M) amino acid substitutions that are linkedto a subtype of fCJD and fatal familial insomnia (FFI),respectively. In this respect, application of the non in-vasive imaging technique to the study of bPrP mutantsalso had the aim of clarifying discordant results ob-tained with the corresponding human and murine D/Nvariants in cultured cells (Petersen et al., 1996; Lehmannand Harris, 1996a).

The GFP is a well established fluorescent probe usedto detect protein targeting, protein–protein interactionsand signal transduction pathways in living cells(Miyawaki et al., 1997; Tsien, 1998; Zaccolo et al., 2000).Accordingly, we tested the reliability of GFP fused tonative and mutant bPrPs, by stringent comparison ofGFP signalling with immunocytochemistry of cells syn-thesizing the various forms of bPrP alone or with GFP.In addition, chimerae were examined biochemically.

We report that GFP is indeed a reliable reporter ofnative and mutant bPrPs in living cells. We also showthat the cellular trafficking of bPrPc is in accordancewith the behaviour of endogenous PrPc and that aminoacid replacements responsible for FFI and fCJD in hu-mans provoke selective biochemical and distributionanomalies in bPrP. Contrary to the murine mutant ho-mologue, the bovine E/K mutant is mainly trappedinside the cell. Conversely, bovine D/N PrP is trans-ported to the plasma membrane although in reducedamounts than bPrPc. This finding and some biochemicaleatures are comparable in bovine and human D/Nariants. We also present data indicating that the con-

c

ormation of D/N bPrP is distinct from that of bPrP atthe plasma membrane.

th

RESULTS

Cellular Distribution of bPrPc, E/K bPrP,and D/N bPrP

To monitor the spatial distribution of native and mu-tant bPrPs in a live cell, cells were transfected withfusion constructs in which GFP is placed at the N-terminus of the bPrP sequence, within amino acids 42and 432 (detailed under Experimental methods) (Fig. 1).

bPrPc. Figure 2A shows how the transiently ex-pressed wild-type GFP-bPrP distributes in a live HeLacell of human epithelial origin, at steady state. Themolecule localizes predominantly to the cell surface andthe Golgi compartment. After incubation of cells withbrefeldin A (BFA), the chimera remains confined insidethe cell (Fig. 2B). This is expected, as BFA inducesfusion of endoplasmic reticulum (ER) and Golgi mem-branes (Lippincott-Schwartz et al., 1989), and conse-

uently prevents the export of secretory proteins, suchs PrPc, to the cell surface (Taraboulos et al., 1995).

2 Unless otherwise specified, numbering of amino acids relates tohe bovine sequence. Note that from position 103 to approximately

FIG. 1. Linear representation of the GFP-bPrP construct. The follow-ing features are indicated. Light grey box, N-terminal signal se-quence; OR, the six octarepeats; *, region (100–120) of possible phys-iologic cleavage; Squared boxes, b1 and b2 strands; Striped boxes, a1,a2, and a3 helices; Black box, carboxyl-terminal cleavage site for GPIattachment; M140, Met 140 corresponding to Met/Val 129 humanpolymorphic site; N192 and N208, Asn 192 and Asn 208 glycosylationsites; S-S, disulphide bond between Cys 190 and Cys 225; Arrows,position of D189N and E211K amino acid substitution. The maturebPrP product thus covers the amino acid stretch 25–242. To avoidinterference with N- and C-terminal signalling peptides and thehighly structured C-terminus of bPrP, GFP was inserted within theflexible N-terminus of the mature protein, i.e., within amino acids 42and 43, flanked by two short spacers (black), of 3 and 5 amino acidsat the N- and C-terminus, respectively. In this way, octapeptiderepeats were left fully uninterrupted to preserve their potential func-tional role (Brown et al., 1997). a Helices and b strands have been

ositioned according to Donne et al. (1997) and Garcia et al. (2000).ar, 20 amino acids.

he end, numbering increases by 11 or 12 with respect to the matureuman and murine isoform, respectively.

1

1c

t

523Native and Altered bPrPs in Live Cells

Importantly, the cell sorting of the chimera was inde-pendent of the mode of plasmid expression and thecellular context, because comparable data was obtainedalso with transiently transfected murine neuroblastomaN2a cells (Fig. 2C), and in stably or transiently trans-fected chinese hamster ovary (CHO) cells (Fig. 2D andTable 1). However, we had to ascertain that GFP fusionsmaintained the normal function of the attached bPrP.The metabolism of PrPc expressed in cell cultures iswell-documented (Stahl et al., 1987; Taraboulos et al.,990, 1995; Pan et al., 1992; Chen et al., 1995; Lehmann

and Harris, 1995, 1996a, 1996b, 1997; Petersen et al.,1996; Tatzelt et al., 1996; Daude et al., 1997; Singh et al.,997), and comparative analyses were carried out ac-

ordingly.

We then compared the immunocytochemical detec-

ion of the GFP fusion construct with authentic bPrPc inHeLa cells. Both proteins codistributed in the cell, asevident from comparing the GFP signal (Fig. 2A) withthe immunofluorescence of permeabilized cells labeledwith antibody to bPrP (Figs. 2E and 2F). Unchangedpatterns were observed in permeabilized N2a and CHOcells transiently expressing the chimera or bPrPc alone(Table 1). Identical distributions of the chimeric proteinwere obtained with another anti PrP antibody or withanti GFP antibody (Table 1). Presence of the wild-typefusion protein in the Golgi compartment was furthersupported by colocalization with the medial-Golgi en-zyme, mannosidaseII (MannII), both in HeLa (Figs.3A–3C) and N2a cells (Figs. 3D–3F). As expected, no

colocalization was found when permeabilized HeLacells expressing bPrPc, alone or linked to GFP, were

sS

524 Negro et al.

FIG. 2. Cellular localization of GFP-bPrP and bPrPc detected by GFP fluorescence (A–D) or by immunocytochemistry (E–H). GFP fluorescenceof live HeLa (A), N2a (C), and CHO (D) cells originates from the plasma membrane and an internal compartment (identified as the Golgiapparatus in Fig. 3). In BFA-treated HeLa cells, fluorescence is retained in the cell interior (B). Immunolabeling with antibody to bPrP ofpermeabilized HeLa cells expressing GFP-bPrP (E) or bPrPc (F) is identical with the pattern observed by GFP fluorescence. Immunolabeling ofintact HeLa cells with Mab L42 to PrP indicates that GFP-bPrP (G) or bPrPc (H) present on the plasma membrane are exposed to the exoplasmic

pace. Of the studied cells, HeLa and N2a cells were transiently transfected while CHO cells were stably transfected with the given construct.cale bars, 7.5 mm in (A–D), 10 mm in (E, F), and 5 mm in (G, H).

Tce

525Native and Altered bPrPs in Live Cells

tested with antibodies to PrP and the ER marker pro-tein, calnexin (not shown).

PrPc is exposed to the exoplasmic space through aglycosyl-phosphatidylinositol (GPI) anchor linked atthe C-terminus (Stahl et al., 1987). It is clear that with orwithout the fluorescent tag, bPrPc is present on the cellperiphery (Figs. 2A, 2C–2F), although none of theshown data reveals if molecules are effectively locatedon the outer leaflet of the plasma membrane. This wastested by adding antibodies to intact cells. As shown inFigs. 2G and 2H, the monoclonal antibody (Mab) L42 toPrP uniformly stained the plasma membrane of HeLacells expressing GFP-bPrP and bPrPc, respectively. Sur-prisingly, under the same conditions, Mab F89/160.1.5specific to bPrP epitope 150–153 (O’Rourke et al., 1998)failed to label all tested intact cells (Table 1). Immuno-labeling of the chimera was also positive with antibodyto GFP (Table 1). Together, these data indicate that the

FIG. 3. GFP-bPrP colocalizes with the mid-Golgi enzyme MannII in HRITC (B, E), are superimposed (C, F). In F, the red fluorescent sigonstruct. Fixed and permeabilized cells were incubated with anti-Maxperimental details were as in the legend to Fig. 2. Scale bar, 5 mm.

chimeric molecule is predominantly exposed to the exo-plasmic space, as does bPrPc.

E/K bPrP. bPrP carrying the E/K point mutationwas examined in HeLa, CHO (transiently or stablytransfected), and N2a cells. In all cells, the GFP signalprovided a localization pattern markedly different tothat of the wild-type chimera, primarily because therewas no fluorescent labeling of the plasma membrane(Fig. 4A and Table 1). Indeed, fusion molecules wereconfined inside the cell, probably at the ER and in theGolgi network (see below). We argue that GFP servedas a reliable live reporter also in the case of E/K bPrP,in view of identical immunostained patterns found incells expressing the chimera or E/K bPrP alone (Figs.4B, 4C, and Table 1). Further, accumulation of the mu-tant chimera in the ER and Golgi regions of HeLa cellswas confirmed by the overlapping of GFP fluorescencewith that of antibodies directed to either calnexin (Figs.5A–5C), or MannII (Figs. 5D–5F).

The absence of the bovine E/K mutant at the plasma

(A–C) and N2a (D–F) cells. GFP fluorescence (A, D) and anti-MannII,dicates that some N2a cells were not transfected with the chimeraantibody, followed by TRITC-conjugated secondary antibody. Other

eLanal innnII

membrane of CHO cells contrasts with reports that thecorresponding murine mutant is present at the cell sur-

526 Negro et al.

face (Lehmann and Harris, 1996a, 1996b; Daude et al.,1997). To exclude selective loss of fluorescence of chi-merae on the cell periphery, or immunostaining arti-facts, several controls were done. Consistent with theprevious observations, however, no labeling was de-tected in intact cells expressing E/K bPrP, or the parentchimera, when probed with antibody to PrP (L42 and

FIG. 4. Cellular localization of GFP-E/K bPrP and E/K bPrP de-tected by GFP fluorescence in live HeLa (A) and CHO (inset in A)cells or by immunocytochemistry (B, C). GFP fluorescence is evidentonly in the cell interior (A). Immunolabeling with antibody to bPrP ofpermeabilized HeLa cells expressing GFP-E/K bPrP (B) or E/K bPrP(C) is identical with the pattern observed in A. Other experimentaldetails were as in the legend to Fig. 2. Scale bar, 10 mm.

F89/160.1.5) and also to GFP, in the case of the chimera(Table 1). Detection failed even though cells had been

previously exposed to 6 M guanidine HCl (Tarabouloset al., 1990) (not shown).

D/N bPrP. A complex relationship between pointmutation and cell sorting was found in cells transientlyexpressing GFP-D/N bPrP. Figures 6A and 6B showthat the mutant chimera localizes inside the cell. How-ever, as better represented in Fig. 6B, a diffuse intracel-lular fluorescence was also frequently observed, withseveral dispersed bright clumps. Another intriguingfinding typical of D/N bPrP was its presence at theplasma membrane in some but not all cells (cfr. Figs. 6Aand 6B). Importantly, an analogous distribution wasdetected in live cells stably transfected with the mutantfusion construct (inset of Fig. 6B).

To clarify D/N bPrP internal distribution, we immu-nostained permeabilized cells expressing either the mu-tant chimera or D/N bPrP alone. In both cases, a similarpattern was observed, suggesting that much of the chi-mera intracellular fluorescence derived from accumula-tion of D/N bPrP in the ER and Golgi compartments(Figs. 6C, 6D, and Table 1). Colocalization of the chi-mera with anti-calnexin (Figs. 7A–7C) and anti-MannII(Figs. 7D–7F) antibodies, definitively proved that the

FIG. 5. GFP-E/K bPrP colocalizes with the ER marker calnexin(A–C) and the mid-Golgi enzyme MannII (D–F) in HeLa cells. GFPfluorescence (A, D) and anti-calnexin (B) or anti-MannII, TRITC (E),

are superimposed (C and F, respectively). Experimental procedureswere as described in the legend to Fig. 3. Scale bar, 7.5 mm.

micerim

527Native and Altered bPrPs in Live Cells

ER and Golgi networks are the main sites of D/N bPrP

FIG. 6. Cellular localization of GFP-D/N bPrP and D/N bPrP detecby immunocytochemistry (C–F). Whereas GFP fluorescence on the cinterior, either localized in a defined compartment (identified as thein several bright clumps (B, arrow). Immunolabeling with antibody to(C) or D/N bPrP (D) is likely retained in the ER. Immunolabeling of inbPrP (F) present on the plasma membrane are exposed to the exoplasfluorescence on the plasma membrane of cells shown in E. Other exp7.5 mm (C, D, and F), and 5 mm (E).

retention inside the cell. Conversely, we were unable toattribute the origin of the internal clumps to any par-

ticular subcellular compartment, or to the endosomal-

y GFP fluorescence in live HeLa (A, B) and CHO (inset in B) cells orrface is irregularly observed (A, B), it is always evident in the cell

i network in Fig. 7) (A, B), or with a diffuse pattern (B), or localizedP of permeabilized HeLa cells indicates that much of GFP-D/N bPrPells with Mab F89/160.1.5 indicates that GFP-D/N bPrP (E) and D/Nspace. Inset in E. It shows the absence or the partial presence of GFPental details were as in the legend to Fig. 2. Scale bar, 10 mm (A, B),

ted bell suGolg

bPrtact c

lysosomal pathway: no positive overlap was obtainedwith immunostained patterns by antibodies against g

osed

528 Negro et al.

adaptin (AP-1), caveolin-1 (N-20), V-ATPase, and ca-thepsin D (not shown).

With regard to the irregular, low fluorescence sig-nalling of GFP-D/N bPrP frequently observed on thecell surface (Figs. 6A and 6B), the most reasonableexplanation is that generally the chimera is sparselypresent on the plasma membrane, and that the chro-mophore concentration is below the threshold ofdetectability (Tsien, 1998). This conclusion is inaccordance with previous observations on thecorresponding human variant (Petersen et al., 1996).However, immunostaining of intact cells expressingthe fusion construct or D/N bPrP alone (Figs. 6E, 6F,and Table 1) clearly demonstrates that, when at thecell surface, mutant molecules are effectively exposedto the exoplasmic space.

Another interesting aspect of this study relates tothe finding that, contrary to control cells, Mab F89/160.1.5 fully labeled intact cells expressing the mu-

FIG. 7. GFP-D/N bPrP colocalizes with the ER marker calnexin (A–C(A, D) and anti-calnexin (B) or anti-MannII, TRITC (E), are superimpin the legend to Fig. 3. Scale bar, 7.5 mm.

tant chimera or D/N bPrP alone (Figs. 6E, 6F, andTable 1).

Processing of bPrPc, E/K bPrP, and D/N bPrP

Chimerae were analyzed on a biochemical basis us-ing stably transfected CHO cells immunoblotted withanti bPrP antibody.

Glycosylation Pattern of Wild-Type and AlteredChimerae

Cellular PrPc can have either one or two heteroge-neous glycans N-attached to Asn residues or no glycansat all (Bolton et al., 1985; Caughey et al., 1989; Monari etal., 1994; Rudd et al., 1999), and these properties arefully maintained in cultured cells (Petersen et al., 1996;Lehmann and Harris, 1995, 1997; Singh et al., 1997).

We compared the glycosylation profile of the wild-type chimera following the addition of peptide N-gly-cosidase F (PNGase F) that cleaves N-linked oligosac-charides (Fig. 8A, lanes 1 and 2). We argue that GFP

the mid-Golgi enzyme MannII (D–F) in HeLa cells. GFP fluorescence(C and F, respectively). Experimental procedures were as described

) and

does not prevent the formation of bPrP complex gly-cans because sugar removal caused the disappearance

ucsconfirms that N-linked glycosylation is impaired in mutant bPrPs(lanes 3 and 5). After PNGase F, both mutants present a U-form with

ao

529Native and Altered bPrPs in Live Cells

of the high mass bands of around 54–66 kDa (lane 1)and the concomitant enrichment of a major band of 52kDa (lane 2). This latter value is in good agreement withthe calculated mass of the chimera, suggesting that itrepresents the unglycosylated (U) form of GFP-bPrP.With regard to the light 45-kDa band visible upon deg-lycosylation (lane 2), its mass implies that a chimerafragment lacking approximately 65 amino acids is con-cealed within the high mass glycoforms of the un-treated sample. This fragment is also labeled by anti-bodies to GFP (not shown). However, at this level ofanalysis it is not possible to establish whether proteol-ysis occurred at the N-terminus of the fusion construct,or at both ends.

Attentive consideration must be given to the fastermigrating diffuse band of around 32–39 kDa present inthe chimera in the absence of PNGase F (lane 1), and tothe 26-, 25-, and 19- to 17-kDa bands that become visibleafter addition of the enzyme (lane 2). The bands werenot labeled by anti GFP antibodies (not shown). Con-sidering the spectrum of molecular weights, the sim-plest explanation is that the bands are composed oftruncated forms, with (lane 1) or without (lane 2) sug-ars, deriving from proteolysis of the chimera down-stream of GFP. Notably, fragments of 20- to 17-kDamass have already been attributed to proteolysis at theN-terminus of PrPc of other species (Pan et al., 1992;Harris et al., 1993; Chen et al., 1995; Petersen et al., 1996;Singh et al., 1997). By analogy, it is feasible that the 19-to 17-kDa bovine fragments derive from proteolysis ofthe chimera within the amino acid stretch 100–120 ofbPrP (see Fig. 1). Conversely, the higher mass of the 26-and 25-kDa truncated forms implies that bPrP under-goes cleavage at two additional sites, upstream of theabove mentioned region. Alternatively, the 25-kDaband could result from a C-terminal truncation of the26-kDa fragment.

Not surprisingly, the deviant cell sorting of E/K andD/N chimerae was reflected in anomalous metabolism(Fig. 8A, lanes 3–6). With respect to glycosylation, the

mass identical with that of bPrPc (lanes 4 and 6). However, apart fromvanishingly low 25-kDa band in the D/N bPrP sample, none of thether bPrPc truncated forms are found in mutant cells. Note that the

processing of D/N bPrP is unique in view of the distinct band of 37kDa (lane 5) that, after deglycosylation, comigrates in part with theU-form and in part accumulates in a new product migrating behindthe U-form (lane 6) (see text). It is also to be noted that a small bandimmediately after the U-form is present in both wild-type and mutant

FIG. 8. Glycosylation profile of native and mutant bPrPs linked ornot to GFP. CHO cells, stably transfected with wild-type or mutantchimerae or transiently transfected with the corresponding bPrPsalone, were used. Lysed cells were either left untreated (2) or di-gested with PNGase F (1), prior to SDS–PAGE and immunoblottingwith antibody to bPrP. (A) The wild-type chimera is clearly subjectedto complex N-linked glycosylation, in view of the high mass bands(lane 1), ranging in size from approximately 54 to 66 kDa, thatconverge, after PNGase F, on the unglycosylated (U) form of GFP-bPrP (52 kDa) and on a smaller band of 45 kDa (lane 2). However,deglycosylation of the diffuse smear (of approximately 32–39 kDa),also present in the untreated sample (lane 1), gives rise to the fastermigrating fragments of 26, 25, and 19–17 kDa (lane 2). Their mass,and the lack of labeling by anti-GFP antibody (not shown), indicatethat the bands are fragments deriving from proteolysis of the chimeradownstream of GFP. Lanes 3 and 5 show that E/K and D/N chimeraehave a much reduced sugar attachment. Moreover, of the manyfragments present in the deglycosylated wild-type chimera, only thatof 45 kDa was observed in the mutant samples (lanes 4 and 6). Thesefindings indicate that both E/K and D/N substitutions impair theoverall metabolism of bPrP. (B) As judged from the high mass diffuseband ranging approximately from 32 to 45 kDa (lane 1), also bPrPc

alone is subjected to complex sugar attachments. After PNGase F, thediffuse band produces the U-form of 28 kDa (lane 2), and also bandsof mass equivalent to that observed in the corresponding chimera (26,25, 20–18 kDa). This finding implies that bPrPc, linked or not to GFP,

ndergoes a similar physiologic processing. With regard to the gly-osylation profile of bPrP carrying the E/K or the D/N amino acidubstitution, the absence of high mass glycoforms typical of bPrPc

cells, irrespective of PNGase F addition, and that a band furtherbelow is found only in E/K mutant cells (lanes 3 and 4).

11

opflvmDtpfb(2D

bOU8s(ete4

taru

SC

vtlPaalco

530 Negro et al.

overall reduced mass of the untreated bands of lanes 3and 5 indicates that both mutants do not undergo thecomplete heterogeneous N-linked modifications of thecore oligosaccharides of GFP-bPrP. Although the E/Kchimera is apparently more severely affected, the ob-served impaired maturation process may be reasonablyaccounted for by the vicinity of E/K and D/N aminoacid substitutions to the second (Asn 208) and first (Asn192) glycosylation site of bPrP, respectively. However,deglycosylation shows that the U-form of either mutanthas the same mass as the wild-type form (lanes 2, 4, and6). Finally, the absence in the mutant cells of the 32- to39-kDa smear (lanes 3 and 5) and of the unglycosylated,fast moving fragments (lanes 4 and 6) observed in thewild-type sample, implies that each point mutation alsoimpinges on the correct action of proteolytic enzymes.

Notably, comparable data was obtained using cellswhich transiently express the wild-type and mutantGFP fusions (not shown).

Glycosylation Pattern of Wild-Type and AlteredbPrPs Alone

To exclude interference of GFP on the metabolic pro-cessing of the fused bPrPs, we next analysed CHO cellstransiently transfected with bPrPs alone, in the absenceand in the presence of PNGase F (Fig. 8B).

Immunoblots of cells expressing native bPrPc (lanes 1and 2) revealed a glycosylation pattern closely reminis-cent of that displayed by the wild-type chimera. Indeed,the slowly migrating range of glycoforms of around32–45 kDa (lane 1) is consistent with the presence ofmature and intermediate bPrPc glycoforms, and recallsthe heterogeneous N-linked sugar attachments found inthe prion protein bound to GFP. It should also be notedthat, accounting for the presence of intact bPrPc glyco-forms and the consequent increment of the smearwidth, the diffuse 32- to 45-kDa band of bPrPc alone(Fig. 8B, lane 1) is in agreement with the 32-to 39-kDaglycoforms of the parent chimera (Fig. 8A, lane 1). Thisis further convincing evidence that the latter smear iscomposed of truncated, GFP-detached forms of bPrP.

The immunoblot of normal cells after PNGase F (Fig.8B, lane 2) shows a major band of around 28 kDa, anda number of smaller bands. The 28-kDa band is un-doubtedly the U-form of native bPrPc because it collectsmost of the higher molecular mass isoforms and alsobecause a similar apparent molecular weight was attrib-uted to the purified bPrP generated in bacteria (Negroet al., 2000). With regard to the faster migrating bands,

their mass indicates that they are the same fragmentsproduced during the processing of the wild-type chi-

S

mera, i.e., they originate from proteolysis at bPrPc

N-terminus. Furthermore, the 26- and 25-kDa frag-ments confirm that bPrPc is processed at additional sitesto those described for PrPcs of other species (Pan et al.,992; Harris et al., 1993; Chen et al., 1995; Petersen et al.,996; Singh et al., 1997).By immunoblotting cells transfected with either E/K

r D/N bPrP (Fig. 8B, lanes 3–6), we argue that also therocessing of the mutant isoforms is independent of theuorescent tag. This conclusion is based on the obser-ation that, similarly to the parent chimerae, there is aarked reduction of complex glycans in both E/K and/N bPrPs (lanes 3 and 5), and that, of the two mu-

ants, the E/K form is the least glycosylated. Anotherroof consistent with this conclusion is the absence of

ragments in PNGase F-treated cells expressing mutantPrPs either alone (Fig. 8B, lanes 4 and 6) or with GFPFig. 8A, lanes 4 and 6). Indeed, only a vanishingly low5-kDa band was evident in cells transfected with the/N bPrP construct (Fig. 8B, lane 6).Small differences were found in the processing of

PrPs alone or linked to GFP (see also legend to Fig. 8).ne relates to the band that migrates slower than the-form in the deglycosylated D/N bPrP sample (Fig.

B, lane 6). This band is either missing in the corre-ponding chimeric molecule or is not properly resolvedFig. 8A, lane 6). Another difference is that no productquivalent to the 45-kDa fragment of the chimeric pro-eins (Fig. 8A, lanes 2, 4, 6) is found in cells which onlyxpress the wild-type or mutant bPrPs (Fig. 8B, lanes 2,, 6).In spite of these minor variations, we are confident

hat the major differences in the processing and glycanttachment between the wild-type and mutant chime-ae labeled with GFP are reproducibly retained in thenlabeled bPrPs (Fig. 8).

usceptibility to PIPLC of Wild-Type and Alteredhimerae

To verify on biochemical grounds the presence of thearious chimerae at the plasma membrane, we testedhe susceptibility to phosphatidyl-inositol phospho-ipase C (PIPLC) of normal and mutant intact cells.IPLC cleaves the diacyl glycerol portion of the GPInd releases (into the cell medium) PrP molecules thatre linked to the plasma membrane through the glyco-ipid anchor. Removal of the GPI hydrophobic moietyharacteristically reduces the electrophoretic mobilityf the prion protein (Lehmann and Harris, 1995, 1997;

ingh et al., 1997).The upper panels of Fig. 9 report on the application of

tw

531Native and Altered bPrPs in Live Cells

the test to intact cells expressing the wild-type chimera.They clearly show that the major proportion of GFP-bPrP is detached from the cell surface after PIPLC treat-ment, because the enzyme reduces the overall quantityof glycoforms retained in the cell (lysate) (cfr. lanes 1and 2), while augmenting that in the cell medium (cfr.lanes 3 and 4). With respect to the small quantity ofprotein found in the medium in the absence of addedPIPLC (lane 3), it probably consists of molecules whichconstitutively lack the glycolipid anchor, which arethen secreted (Stahl et al., 1993; Petersen et al., 1996).This test was carried out for several hours withoutattempting to halt the chimera production (at 37°C,

FIG. 9. Contrasting susceptibility of wild-type and mutant chimeraeo PIPLC. CHO cells stably expressing the different chimeric proteins

ere left untreated (2) or were treated (1) with PIPLC (4 h at 37°C).After separation of cells from the medium, chimerae still bound tocells or present in the medium were detected on blots with anti-bPrPantibody. After addition of PIPLC to cells expressing GFP-bPrP, therewas a diminution of the quantity of chimera associated with the celllysate, and a concomitant accumulation in the medium (upper panels,lanes 2 and 4). This indicates a correct linkage of GFP-bPrP to the cellsurface. As expected from the lack of intact GPI, the released fractionshows a reduced gel mobility. The minor band found in the mediumin the absence of PIPLC suggests that some molecules are GPI-free,and are therefore secreted (lane 3). Also, a small quantity of the E/Kchimera was secreted because it was found in the cell medium irre-spective of PIPLC addition to mutant cells (central panels, lanes 3 and4). This indicates that the E/K chimera is not cleaved by PIPLC.Conversely, GFP-D/N bPrP is not secreted (lower panels, lanes 3).Indeed, the band appearing in the medium after PIPLC (lane 4)indicates that, although present on the cell membrane to a minorextent, mutant molecules correctly associate to the cell surfacethrough the GPI anchor. Note that a similar loading of samples wasused in all blots. In each panel, molecular mass markers are 66 and 45kDa.

with no added inhibitor of protein synthesis). Theseconditions account for the observed nonstrict propor-

tionality between the accumulation in the medium ofthe released chimera and its disappearance from the celllysate (lanes 2 and 4). The results of this assay demon-strate that the GPI anchor is part of the wild-type chi-mera and that it correctly inserts into the outer leaflet ofthe plasma membrane. As an additional proof of thisconclusion, released molecules displayed a small butdistinct decrease in mobility (lane 4).

In contrast, no molecule was released from the cellsurface when PIPLC was added to cells expressing theE/K chimera (Fig. 9, central panels). This conclusionarises from the similar quantity of E/K chimera de-tected in the cell medium in the absence and in thepresence of PIPLC (lanes 3 and 4). Combined with thereduced mobility of the band, this result suggests theexistence of few GPI-free E/K glycoforms, as shownabove for the wild-type chimera. Together, this datareinforces the contention that E/K molecules fail toreach the plasma membrane in a detectable amount (seealso Fig. 4).

Finally, a minor fraction of D/N molecules was de-tected in the cell medium, but only when PIPLC wasadded (lane 4 of Fig. 9, lower panel). Thus, contrary towild-type and E/K fusion proteins, the D/N variant isnot secreted (see also Petersen et al., 1996). Rather, thelarge reduction in the amount of protein detached fromthe mutant cells relative to the normal cells has a two-fold interpretation. On the one hand it corroborates theunder-represented fluorescent signal of D/N chimeraeat the plasma membrane (Fig. 6); on the other it indi-cates that, when present, D/N chimerae correctly an-chors to the cell exterior through the glycolipid anchor.

Triton X-100 Solubility Assay of Wild-Type andAltered Chimerae

To test if the various chimerae properly associatewith cholesterol- and glycospingolipid-rich membranemicrodomains (rafts) (Brown and Rose, 1992; Simonsand Ikonen, 1997), we assayed their solubility in TritonX-100. As with other GPI-linked proteins, it is hypoth-esized that the anchor serves to sort and address PrPc

molecules to the cell surface, first by attaching to PrPc inthe ER, then by interacting with rafts in the Golgi com-partment where raft lipids assemble (van Meer, 1989). Itis this post-ER association that confers GPI-anchoredproteins with the characteristic insolubility in TritonX-100 at 4°C (Brown and Rose, 1992). Conversely, at37°C, or if rafts are disorganized by the cholesterolsequestering agent saponin (Cerneus et al., 1993), GPI

proteins dissociate from rafts and become detergentsoluble.

Bab(ptlbmmhpotb

532 Negro et al.

The upper panel of Fig. 10 (lanes 1 and 2) shows thatthe wild-type chimera was found almost solely in thepellet of cells lysed by cold Triton X-100. This insolu-bility indicates a correct connection of the chimera withrafts. Furthermore, the raise in temperature or saponinaddition provoked the expected change of solubility(lanes 3–6).

This behavior is in contrast with that of E/K chime-rae, because mutant molecules were equally soluble inTriton X-100 at 4 and 37°C, and in the presence ofsaponin (central panel of Fig. 10, lanes 1–6). Above, wehave provided evidence that E/K molecules are mainlyretained in the ER and also in the Golgi network (Figs.4 and 5), and that only a minor fraction, lacking theglycolipid anchor, is secreted from the cell (Fig. 9). E/KbPrP full solubility in the cold detergent is thus consis-tent with the predominant location of the mutant mol-ecule in the ER-cis Golgi region, where rafts are yet tobe formed. As for its presence in late compartments ofthe Golgi network (Fig. 5), the result of Fig. 9 mayindicate that, even if linked to GPI, the E/K construct is

FIG. 10. Different solubility in Triton X-100 of wild-type and mutantchimerae. CHO cells stably expressing the different chimeric proteinswere lysed in 1% Triton X-100 at 4 or 37°C, or at 4°C in 1% TritonX-100 plus 1% saponin. After centrifugation, the supernatant (SN) andthe precipitate (P) fractions were blotted with anti-bPrP antibody.While the majority of the wild-type chimera was insoluble in TritonX-100 at 4°C (upper panel, lane 2), the E/K chimera was as soluble at4°C as it was at 37°C (central panel, lanes 1 and 3). Contrary towild-type and E/K chimera, the D/N chimera treated with TritonX-100 at 4°C was found both in the SN and P fractions (lower panel,lanes 1 and 2). In each panel, molecular mass markers are 66 and 45kDa.

unable to segregate correctly with cholesterol-rich mi-crodomains.

We have shown that some D/N chimerae are trans-ported to the plasma membrane, and that the rest aretrapped in intracellular compartments, and sometimesalso in cytosolic clumps (Figs. 6, 7, and 9). For thosemolecules that reach the cell surface through the mat-uration pathway, one would then expect a proper in-teraction with rafts and cold detergent-insolubility,while the opposite should be found for the mutantpopulation located inside the cell, e.g., in the ER, andpossibly also in the cytosolic clumps. The result of thedetergent solubility assay (lower panel of Fig. 10, lanes1 and 2) fully agrees with this presumed dual behavior,in that some D/N chimerae were found in the pellet,and some in the supernatant of cells treated with coldTriton X-100. As expected, insolubility of D/N mole-cules disappeared when membrane lipids were disor-ganized (lanes 3–6).

DISCUSSION

To set a cellular background for understanding themolecular mechanism of BSE prions transmissibility,the key questions addressed in this work regarded thephysiologic and altered metabolism of the bovine PrPisoform in cultured mammalian cells.

Evidence has accumulated that the causative agentsof BSE and vCJD have a common origin (Collinge et al.,1996; Will et al., 1996; Bruce et al., 1997; Hill et al., 1997;

ons et al., 1999; Scott et al., 1999). Prion transmissioncross the bovine-to-human species barrier is likely toe favored by genetic predisposition of the recipiente.g., homozygous for methionine at codon 129), butossibly also by the capacity of human and bovine PrPs

o give rise to common pathologic conformers (Col-inge, 1999). In an attempt to gain direct information onPrP metabolism, we expressed wild-type bPrPc inammalian cells. In the absence of known inheritedutations in the bovine PrP gene, we used bovine

omologues of human familial mutations to simulateathogenic bPrP molecules. The additional availabilityf GFP fusion proteins provided a unique opportunityo combine biochemical studies with live detection ofPrP targeting by noninvasive means.With regards to the spatial distribution of bPrPc, our

results demonstrate that the wild-type chimeric proteinlocalizes to the Golgi network and the plasma mem-brane, as shown for bPrPc (Figs. 2A, 2C–2F, and Table 1)and other PrPc isoforms on immunological grounds(Stahl et al., 1987; Taraboulos et al., 1990; Lehmann and

Harris, 1995, 1997; Singh et al., 1997; Madore et al., 1999).These findings were independent of the origin of the

ww

cpa(ri

G

m

gsetsewgv1ctatlIDh1n

533Native and Altered bPrPs in Live Cells

transfected cell line [e.g., human (HeLa), hamster(CHO), and murine (N2a)], suggesting that, at least inthese cells, the bovine PrP underwent similar metabolicprocessing. Importantly, GFP fusions maintained themain traits of the normal glycosylation and processingof bPrPc (Fig. 8), including proteinase K (PK) sensitivity(not shown). However, it is interesting to note thatbPrPc undergoes an as yet undescribed posttransla-tional cleavage as part of the normal metabolism togenerate the 26- and 25-kDa fragments. This informa-tion may be of value because these fragments hold acentral amino acid segment (which in the human se-quence approximately encompasses residues 90–140)that has been implicated in the conversion process toPrPSc (reviewed in Prusiner, 1998). It therefore seemscritical to establish if indeed these fragments are uniqueto bPrPc, their exact site of origin, and their role, if any,in the metabolic events that develop BSE.

In humans, E/K and D/N genotypes are associatedwith distinct neuronal targeting and degeneration (Me-dori et al., 1992; Telling et al., 1996). Although not nec-essarily related to the pathogenesis of fCJD and FFI,E/K and D/N replacements in the bovine isoform ofPrP also gave rise to selective biochemical and distri-bution anomalies. E/K bPrP is detected in the ER andGolgi compartments, while the distribution of D/NbPrP includes the cell surface, and sometimes also thecytoplasm with a punctuate pattern (Figs. 4–7 and Ta-ble 1). Biochemical features such as sensitivity to PIPLCand association with cholesterol-rich membrane mi-crodomains (Figs. 9 and 10), all support the cellularevidence obtained immunologically or with GFP fluo-rescence. Notably, the altered features are not symp-tomatic of the formation of PrPSc-like material in the cell(Bolton et al., 1982), because the two variants (alone or

ith GFP) were as sensitive to PK as the correspondingild-type forms (not shown).Retention of both mutants in the ER may be ac-

ounted for by an inability to fold correctly and thusass the quality control (QC) mechanism that stopsberrant proteins from entering the secretory pathwayEllgaard et al., 1999). N-linked oligosaccharides areegarded as important adjuvants for the efficient fold-ng of glycoproteins (Ellgaard et al., 1999), and also as

factors which stabilise the structure of mutated PrPs(Gambetti and Parchi, 1999). In this respect, the lessmodified glycans typical of E/K bPrP support the no-tion that the mutant is particularly unstable and istherefore retained in the ER to a greater extent than

D/N bPrP. Indeed, when cells were kept at lower tem-peratures (24°C) to favor proper folding, the expression

of

on the cell surface of D/N, but not E/K, chimeric pro-tein greatly improved (not shown).

In studying another amino acid substitution linked tofamilial prion diseases, Q217R, Singh et al. (1997)showed that the mutation gave rise to two variants incell cultured models, one of which, although carryingthe GPI signal peptide, is devoid of the GPI anchor. Thisform is unable to exit the ER compartment. In principle,this same reason could explain why E/K molecules arealso trapped in the ER, and also the mutant’s full solu-bility in cold Triton X-100 (Figs. 4, 5, and 10). However,the observation that the unglycosylated form of E/KbPrP migrates with an apparent mass identical withthat of wild-type bPrP (Fig. 8) favors the concept thatfor the most part E/K bPrP is correctly anchored to theGPI moiety. On the other hand, deglycosylation of D/NbPrP did produce a band with slower gel mobility thanthe U-form (Fig. 8B, lane 6). This product could origi-nate from an unstable GPI-free glycoform, and be re-tained in the ER as is the Q217R mutant (Singh et al.,1997). Alternatively, the band could result from incom-plete sugar removal. The D/N mutation site is posi-tioned within the second a helix of the highly struc-tured C-terminus of the protein (Donne et al., 1997;

arcia et al., 2000), close to the first glycosylation site(Asn 192) (Fig. 1). With this topology, either the mutantconformation and/or an anomalous composition of thenegatively charged oligosaccharides (Rudd et al., 1999)

ay structurally impinge on PNGase F full activity.The presence of E/K bPrP in the Golgi complex sug-

ests that structural defects are also recognised by QCites operating beyond the ER, from where mutant mol-cules are likely to be rerouted for degradation. Clearly,he presence of D/N bPrP on the cell surface argues thatome D/N molecules escape all QC. Judging from thelectrophoretic mobility, the fraction of D/N bPrP,hich is correctly associated with rafts, is more highly

lycosylated (Fig. 10). Consistent with previous obser-ations of the human D/N homologue (Petersen et al.,996), it thus appears that a necessary (albeit insuffi-ient) condition to facilitate transport of D/N bPrP tohe cell surface is the reduction of the protein instabilityccomplished by extensive sugar attachment. Impor-antly, however, the ability to reach the intended cellocation is not axiomatic of the mutant’s correct folding.ndeed, perturbation of PrP native conformation by the/N amino acid substitution has been inferred for theuman variant on a biochemical basis (Petersen et al.,996) and is here more explicitly proven by the immu-ological evidence that epitope of Mab F89/160.1.5,

ccluded in normal intact cells, is available on the sur-ace of cells expressing D/N bPrP (Fig. 6 and Table 1).

ct(1

t

534 Negro et al.

We are currently investigating the molecular basis ofthis finding. For the time being, however, it may beuseful to underline that Mab L42, raised against theovine amino acid segment 145–163 (Harmeyer et al.,1998), recognizes the corresponding bovine epitope(153–171) in both normal and mutant intact cells, andthat this epitope encompasses the first helix of bPrP(Garcia et al., 2000). In contrast, the 150–153 epitope ofMab F89/160.1.5 (O’Rourke et al., 1998) is positioned ina region that lacks regular secondary structure (Garciaet al., 2000). Hence, unlike a helices, this segment isflexible and may orientate differently depending on theoverall conformation of the protein. Exposure to, orshielding from, the extracellular space of the 150–153epitope, may thus explain why D/N bPrP, but notbPrPc, reacts with Mab F89/160.1.5.

The sorting and biochemistry of bPrP mutants showdiscrepant features with respect to murine variants car-rying the homologous E/K and D/N mutations (Leh-mann and Harris 1996a, 1996b; Daude et al., 1997. Seealso Narwa and Harris, 1999). The murine E/K variant,the only other mutant of this type so far studied in cellcultures, was found at the plasma membrane (fromwhere it was partly releasable by PIPLC), and found topossess a partial resistance to PK, as did murine D/NPrP. Biochemical analysis of several other insertionaland point mutations, ultimately led Daude et al. (1997)to propose a unitary mechanism of pathogenesis,whereby PrP variants acquire deviant features sequen-tially, en route to the cell surface. Clearly, our resultsindicate that the two studied bovine variants have adistinct cellular fate. Therefore, as previously proposedby comparing murine and human mutants (Petersen etal., 1996), discrepancies are probably related to distincttertiary structure conformers of cellular murine andbovine PrPs (see also Garcia et al., 2000).

In contrast, the D/N amino acid substitution deter-mines the close behavioural traits of human and bovinePrPs (this study, and Petersen et al., 1996). These includeanomalous metabolic processing, requirement of heter-ogeneous glycosylation for competent transport to thecell surface, overall reduced presence on the plasmamembrane, accessibility to PIPLC, absence of secretedforms, PK sensitivity, and abnormal structure on thecell surface. This finding suggests that, in addition tothe close native structure (Garcia et al., 2000), humanand bovine PrPs may acquire a similar altered confor-mation at least under some cellular conditions.

We monitored the localization of native and mutantbPrPs in live cells transfected with GFP fusion proteins.

The benefits of studying a protein directly in a physio-logic environment should however not obscure poten-

tial risks inherent to transfected cells, in primis inade-quacy of cell surveillance systems to control proteinoverloads efficiently. We are confident that this did nothappen in our study on the basis of several pieces ofevidence. With respect to bPrPc, for example, the bio-hemistry and cell sorting well compare with the func-ional properties of the endogenous prion proteinCaughey et al., 1989; Scott et al., 1988; Taraboulos et al.,992; Harris et al., 1993; Tatzelt et al., 1996; Lehmann

and Harris, 1997). As for bPrP carrying E/K and D/Nsubstitutions, such a comparison is obviously impossi-ble. However, we observed identical features in cellseither transiently or stably expressing each mutantform. This result thus strongly favours the conclusionthat the transfection procedure per se is not the cause ofthe altered metabolism displayed by bPrP variants.

In conclusion, our data shows that the use of GFPchimeric proteins to monitor the live behaviour of theprion protein in its native or altered form is useful andvalid. This result opens the way to the challengingperspective of using GFP fusions to study the dynamicbehaviour of PrP in response to cell activation. Like-wise, chimerae can be exploited in ScN2a cells, chroni-cally infected by scrapie, that continuously form PrPSc

from PrPc (Race et al., 1988). Immunofluorescence de-ection of PrPSc requires denaturation of the molecule to

enhance antigenicity (Taraboulos et al., 1990). Con-versely, GFP-PrP chimerae may help to understand thespatial and temporal conversion process in intact ScN2acells.

EXPERIMENTAL METHODS

bPrP and GFP Fusion Constructs

We constructed an expression vector for eukaryoticcells, under the control of the cytomegalovirus pro-moter, that contains the coding bPrP sequence alone orfused to GFP. The bovine sequence is naturally poly-morphic for the number of octapeptide repeats (5 or 6),and the version with 6 was always used here. Flankedby spacers at the N- and C-end, GFP was inserted afterthe first 18 amino acids of the mature bovine sequence(Fig. 1). The same constructs were used for bPrP vari-ants carrying the amino acid substitutions D189N orE211K, homologous to the D178N and E200K humanmutations, respectively. In humans, the phenotype ofthe disease linked to the D/N mutation is determinedby the natural polymorphism of codon 129 in the mu-

tant allele (valine or methionine). With 129M the dis-ease manifests as FFI (Goldfarb et al., 1992), while with

Tmtia4blRoNw

F

sIea(

A

535Native and Altered bPrPs in Live Cells

129V as a subtype of fCJD (Gambetti et al., 1995). In ourconstructs, methionine was always at the correspond-ing bovine (140) codon.

The bPrP coding sequence was obtained by PCRamplification of cDNA generated from bovine brainmRNA. The following primers flanking the entire genewere used: A, 59TCCGCTAGCATGGTGAAAAGCCA-CATAGGCA39; B, 59GAGAATTCTATCCTACTAT-GAGAAAAATG39. Amplified products were cut atNheI and EcoRI sites and subsequently cloned in thephEGFP plasmid (Clontech) in the same restrictionsites. This produced the pcDNAPrP plasmid. Con-structs expressing GFP-PrP chimerae were obtained asfollows. First, the sequence coding for the 1–42 aminoacid stretch of bPrP was cloned upstream of the GFPsequence between restriction sites NheI and PinAI, us-ing primer A (described above) and primer C, 59 GC-GACCGGTGATCGGCTCCCCCCAGTGTTC39. This gen-erated the pleaderGFP plasmid. Primers D (59CTCA-GATCTGGACAGGGCAGTCCTGGAGGCCAA39) and E(59AATAAGCTTGGGATTCTCTCTGG39) were thenused to amplify the bPrP amino acid sequence 43–235.The amplified product was then cut with BglII andHindIII and cloned in the pleaderGFP plasmid, thuscreating the pGFP-DPrP plasmid. Finally, the nucleo-tide sequence for bPrP C-terminal end (amino acids236–264) was amplified using primer F (59CTCAAGCT-TATTACCAACGAGGGGC39) and primer B (reportedabove), cut with HindIII and EcoRI and cloned in thepGFP-DPrP plasmid. The construct consisting of thecomplete bPrP sequence carrying the inserted GFP, wasnamed pGFP-bPrP.

To introduce point mutations, inverse PCR was per-formed on pGFP-bPrP or pcDNAPrP plasmid as tem-plate, using the following primers: for the D189Nreplacement, 59TTTGTGCACAACTGTGTCAACATC-ACAGTCAAGG39 and 59GTCGTGCACAAAGTTGT-TCTGGTTACTATA39; for the E211K replacement,59ACTGATATCAGGATGATGGAGCGAGTGG39 and59CTTGATATCAGTTTTGGTGAAGTTCTCCCCCT39.After amplification, DNA fragments were cut with SnoIand EcoRV and themselves ligated. Plasmid construc-tions were checked by double stranded dideoxynucle-otide sequencing, using a 477a Perkin–Elmer modelDNA sequenator.

Cell Cultures

CHO, HeLa, and N2a cells were cultured at 37°C, ina humidified incubator under 5% CO2 using DMEM

(for HeLa and N2a cells) or Ham’s F12 (for CHO cells)medium containing 10% fetal calf serum, penicillin (100 w

U/ml), and streptomycin (100 mg/ml). At approxi-mately 80% confluence, cells were transfected with thedesidered expression plasmid using lipofectamine Plusreagent (Gibco-BRL), following the manufacturer in-structions. To generate antibiotic-resistant CHO clones,cells were selected in a medium containing 500 mg/mlgeneticin (G418, Calbiochem), subcloned once andmaintained in the same dose of antibiotic. For eachexperiment, cells, removed from the flask with trypsin,were counted, seeded into plates in identical numbersand grown to approximately 95% confluence. Reportedexperiments with CHO clones were carried out using atleast two cell lines expressing each construct. Cells atsteady state were either observed using the fluorescencemicroscope or treated further for the purposes de-scribed below. When needed, BFA (5 mg/ml) wasadded to cells for 2 h at 37°C.

Immunocytochemistry

Immunostaining of intact cells. Transfected cells weregrown on glass coverslips, rinsed with phosphatebuffer saline (PBS), and incubated for 2 h at 4°C withthe desidered antibody diluted in Opti-MEM (GIBCO).After being rinsed twice with PBS, cells were fixed (30min, 4°C) with paraformaldehyde [2% in PBS (w/v)],rinsed again, and finally treated with 50 mM NH4Cl.

his was followed by incubation (1 h, RT) with rhoda-ine isothiocyanate (TRITC)-conjugated secondary an-

ibody (Dako, Milano). Immunostaining of permeabil-zed cells. After being washed, fixed, and quenched asbove, cells were treated with 0.1% Triton X-100 (5 min,°C). Cells were then incubated with the desired anti-ody (diluted in PBS with BSA 0.5%) (1 h, 37°C), fol-

owed by TRITC-conjugated secondary antibody (1 h,T). Finally, coverslips were mounted in glycerol forbservation of cells using the fluorescence microscope.o immunoreactivity was observed in cells transfectedith the vector alone.

luorescence Microscopy and Image Analysis

Fluorescence microscopy (excitation at 488 nm; emis-ion at 509 nm) was carried out using an OlympusMT-2 set-up, equipped with a 12-bit digital CCD vid-ocamera (Micromax, Princeton Instruments). Data wascquired and analyzed using the Metamorph softwareUniversal Imaging).

ntibodies

In immunocytochemistry, the following antibodiesere used (in parentheses, the used dilution is given).

w(wcw

B

B

B

B

B

C

536 Negro et al.

Anti PrP: Mab F89/160.1.5 (1/400) raised against thebovine 146–159 sequence, and Mab L42 (1/200), raisedagainst the ovine amino acid stretch 145–163 (kindlygiven by Drs K. I. O’Rourke, Pullman, and M. H. Gros-chup, Tubingen, respectively); anti GFP: Mab (RocheDiagnostic) (1/100) or rabbit polyclonal antibody (kind-ly given by Dr. N. Lebot, Heidelberg); antibodies toMannII (1/400) and to calnexin (1/100) were kind giftsof Drs. M. G. Farquhar (San Diego) and A. Helenius(ETH, Zurich), respectively.

Immunoblotting

Transfected cells were grown on 10-ml plates, rinsedtwice with PBS at 4°C, harvested, and centrifuged. Pel-lets were then lysed in SDS sample buffer, boiled (5min), and subjected to SDS–PAGE (12%) (Laemmli,1970), at a concentration of 25–50 mg total protein perlane. Slab gels were transferred electrophoretically ontonitrocellulose membranes (Bio-Rad). Unspecific bind-ing sites were blocked by PBS containing 5% low-fatdried milk and 0.1% Tween 20 (1 h, RT), before incu-bation with either Mab F89/160.1.5 (1/10000) or anti-GFP Mab (1/3000). After 1 h at RT, membranes wererinsed twice, incubated further (1 h, RT) with horserad-ish peroxidase-conjugated secondary antibody (SantaCruz), and viewed by enhanced chemiluminescenceperformed according to the manufacturer (Amersham).Protein concentrations were determined by a Bio-Radprotein assay.

Enzymic Digestion

Before SDS–PAGE and immunoblot analyses, cellswere treated according to the desired enzymic diges-tion. PNGase F. Approximately 100 mg of cell totalprotein was lysed with 1% SDS, boiled (5 min), anddiluted eightfold with a 20 mM sodium phosphate (pH8), containing 0.6% N P-40, 1% b-mercaptoethanol, 25mM EDTA, 0.1 % SDS, and 1 % Triton X-100. Samples

ere then incubated (24 h, 37°C) with PNGase F (5 U)Roche). PIPLC. Cells, rinsed twice with ice-cold PBS,

ere incubated (4 h, 37°C) in serum-free Opti-MEMontaining 0.5 U/ml of PIPLC (Sigma). The mediumas removed and centrifuged (10 min, 4°C) at 290g to

remove any cells. The proteins in the medium wereprecipitated with trichloroacetic acid (TCA) (10%) andthen washed with acetone. The cells were washed ex-

tensively with PBS, scraped and lysed in SDS samplebuffer. C

Solubility in Triton X-100

Confluent cells growing on a 10-cm plate, were rinsedtwice with ice-cold PBS, scraped, divided in three equalfractions and transferred to eppendorf tubes kept onice. Two aliquots were lysed with 0.5 ml of ice-coldTriton X-100 lysis buffer [1% Triton X-100, 150 mMNaCl, 5 mM EDTA, 25 mM Tris–HCl (pH 7.8), contain-ing the protease inhibitor cocktail Complete (Roche)].While one sample was kept on ice for a total of 60 min,the other sample was first kept on ice for 20 min, andthen at 37°C for further 40 min. The third sample waskept on ice for 60 min with the cold Triton X-100 lysisbuffer supplemented with saponin (1%). The lysateswere then centrifuged in an eppendorf centrifuge atmaximal speed, at 4°C or at R.T. as needed. The pelletswere resuspended in SDS sample buffer while the pro-teins in the supernatant were precipitated with coldTCA (10%) and washed in acetone. Samples were thenprocessed as described above for SDS–PAGE and im-munoblot analyses.

ACKNOWLEDGMENTS

The authors thank Dr. J. Tatzelt for helpful discussions. M.C.S.gratefully acknowledges fundings from the EU (Biomed-2 BMH4-ct98-6050), Telethon Onlus (E.0945), CNR (98.03612.ST74), and Re-gione Veneto (740/97).

REFERENCES

Bolton, D. C., McKinley, M. P., and Prusiner, S. B. (1982). Identifica-tion of a protein that purifies with the scrapie prion. Science 218:1309–1311.

olton, D. C., Meyer, R. K., and Prusiner, S. B. (1985). Scrapie PrP27–30 is a sialoglycoprotein. J. Virol. 53: 596–606.

ons, N., Mestre-Frances, N., Belli, P., Gajdusek, D. C., and Brown, P.(1999). Natural and experimental oral infection of nonhuman pri-mates by bovine spongiform encephalopathy agents. Proc. Natl.Acad. Sci. USA 96: 4046–4051.

rown, D. A., and Rose, J. K. (1992). Sorting of GPI-anchored proteinsto glycolipid-enriched membrane subdomains during transport tothe apical cell surface. Cell 68: 533–544.

rown, D. R., Qin, K., Herms, J. W., Madlung, A., Manson, J., Strome,R., Fraser, P. E., Kruck, T. A., von Bohlen, A., Schulz-Schaeffer, W.,Giese, A., Westaway, D., and Kretzschmar, H. (1997). The cellularprion protein binds copper in vivo. Nature 390: 684–687.

ruce, M. E., Will, R. G., Ironside, J. W. et al. (1997). Transmission tomice indicate that ‘new variant’ CJD is caused by the BSE agent.Nature 389: 498–501.

aughey, B., Race, R. E., Ernst, D., Buchmeier, M. J., and Chesebro, B.(1989). Prion protein biosynthesis in scrapie-infected and unin-

fected neuroblastoma cells. J. Virol. 63: 175–181.

erneus, D. P., Ueffing, E., Posthuma, G., Strous, G. J., and van der

C

C

C

C

D

D

E

G

G

G

G

G

H

H

H

H

J

L

L

L

L

L

L

L

M

M

M

M

N

P

537Native and Altered bPrPs in Live Cells

Ende, A. (1993). Detergent insolubility of alkaline phosphataseduring biosynthetic transport and endocytosis. Role of cholesterol.J. Biol. Chem. 268: 3150–3155.

hen, S. G., Teplow, D. B., Parchi, P., Teller, J. K., Gambetti, P., andAutilio-Gambetti, L. (1995). Truncated forms of the human prionprotein in normal brain and in prion diseases. J. Biol. Chem. 270:19173–19180.

ohen, F. E., Pan, K. M., Huang, Z., Baldwin, M., Fletterick, R. J., andPrusiner, S. B. (1994). Structural clues to prion replication. Science264: 530–531.

ollinge, J., Sidle, K. C. L., Meads, J., Ironside, J., and Hill, A. F. (1996).Molecular analysis of prion strain variation and the aethiology of‘new variant’ CJD. Nature 383: 685–690.

ollinge, J. (1999). Variant Creutzfeldt-Jacob disease. Lancet 354: 317–323.aude, N., Lehmann, S., and Harris, D. A. (1997). Identification ofintermediate steps in the conversion of a mutant prion protein to ascrapie-like form in cultured cells. J. Biol. Chem. 272: 11604–11612.onne, D. G., Viles, J. H., Groth, D., Mehlhorn, I., James, T. L., Cohen,F. E., Prusiner, S. B., Wright, P. E., and Dyson, H. J. (1997). Structureof the recombinant full-length hamster prion protein PrP(29-231):The N-terminus is highly flexible. Proc. Natl. Acad. Sci. USA 94:13452–13457.

llgaard, L., Molinari, M., and Helenius, A (1999). Setting the stan-dards: quality control in the secretory pathway. Science 286: 1882–1888.ambetti, P., Parchi, P., Petersen, R. B., Chen, S. G., and Lugaresi, E.(1995). Fatal familial insomnia and familial Creutzfeldt-Jakob dis-ease: Clinical, pathological and molecular features. Brain Pathol. 5:43–51.ambetti, P., and Parchi, P. (1999). Insomnia in prion diseases: Spo-radic and familial. N. Engl. J. Med. 340: 1675–1677.arcia, F. L., Zahn, R., Riek, R., and Wuthrich, K. (2000). NMRstructure of the bovine prion protein. Proc. Natl. Acad. Sci. USA 97:8334–8339.oldfarb, L. G., Petersen, R. B., Tabaton, M., Brown, P., LeBlanc, A. C.,Montagna, P., Cortelli, P., Julien., J., Vital, C., Pendelbury, W. W., etal. (1992). Fatal familial insomnia and familial Creutzfeldt-Jakobdisease: Disease phenotype determined by a DNA polymorphism.Science 258: 806–808.riffith, J. S. (1967). Self-replication and scrapie. Nature 215: 1043–1044.armeyer, S., Pfaff, E., and Groschup, M. H. (1998). Synthetic peptidevaccines yield monoclonal antibodies to cellular and pathologicalprion proteins of ruminants. J. Gen. Virol. 79: 937–945.arris., D. A., Huber, M. T., van-Dijken, P., Shyng, S. L., Chait, B. T.,and Wang, R. (1993). Processing of a cellular prion protein: identi-fication of N- and C-terminal cleavage sites. Biochemistry 32: 1009–1016.ill, A. F., Desbruslais, M., Joiner, S., Sidle, K. C. L., Gowland, I., andCollinge, J. (1997). The same prion strain causes vCJD and BSE.Nature 389: 448–450.uang, Z., Prusiner, S. B., and Cohen, F. E. (1996). Scrapie prions: Athree-dimensional model of an infectious fragment. Folding Des. 1:13–19.

arrett, J. T., and Lansbury, P. T., Jr. (1993). Seeding “one-dimensionalcrystallization” of amyloid: A pathogenic mechanism in Alzhei-mer’s disease and scrapie? Cell 73: 1055–1058.

aemmli, U. K. (1970). Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227: 680–685.

ehmann, S., and Harris, D. A. (1995). A mutant prion protein dis-P

plays an aberrant membrane association when expressed in cul-tured cells. J. Biol. Chem. 270: 24589–24597.

ehmann, S., and Harris, D. A. (1996a). Mutant and infectious prionproteins display common biochemical properties in cultured cells.J. Biol. Chem. 271: 1633–1637.

ehmann, S., and Harris, D. A. (1996b). Two mutant prion proteinsexpressed in cultured cells acquire biochemical properties reminis-cent of the scrapie isoform. Proc. Natl. Acad. Sci. USA 93: 5610–5614.

ehmann, S., and Harris, D. A. (1997). Blockade of glycosylationpromotes acquisition of scrapie-like properties by the prion proteinin cultured cells. J. Biol. Chem. 272: 21479–21487.

iemann, S., and Glockshuber, R. (1999). Influence of amino acidsubstitutions related to inherited human prion diseases on thethermodynamic stability of the cellular prion protein. Biochemistry38: 3258–3267.

ippincott-Schwartz, J., Yuan, L. C., Bonifacino, J. S., and Klausner,R. D. (1989). Rapid redistribution of Golgi proteins into the ER incells treated with brefeldin A: Evidence for membrane cycling fromGolgi to ER. Cell 56: 801–813.adore, N., Smith, K. L., Graham, C. H., Jen, A., Brady, K., Hall, S.,and Morris, R. (1999). Functionally different GPI proteins are orga-nized in different domains on the neuronal surface. EMBO J. 18:6917–6926.edori, R., Tritschler, H. J., LeBlanc, A., Villare, F., Manetto, V., Chen,H. Y., Xue, R., Leal, S., Montagna, P., Cortelli, P. et al. (1992). Fatalfamilial insomnia, a prion disease with a mutation at codon 178 ofthe prion protein gene. N. Engl. J. Med. 326: 444–449.eyer, R. K., McKinley, M. P., Bowman, K. A., Braunfeld, M. B.,Barry, R. A., and Prusiner, S. B. (1986). Separation and properties ofcellular and scrapie prion proteins. Proc. Natl. Acad. Sci. USA 83:2310–2314.iyawaki, A., Llopis, J., Heim, R., McCaffery, J. M. Adams, J. A.,Ikura, M., and Tsien, R. Y. (1997). Fluorescent indicators for Ca21

based on green fluorescent proteins and calmodulin. Nature 388:882–887.

Monari, L., Chen, S. G., Brown, P., Parchi, P., Petersen, R. B., Mikol, J.,Gray, F., Cortelli, P., Montagna, P., Ghetti, B. et al. (1994). Fatalfamilial insomnia and familial Creutzfeldt-Jakob disease: Differentprion proteins determined by a DNA polymorphism. Proc. Natl.Acad. Sci. USA 91: 2839–2842.arwa, R., and Harris, D. A. (1999). Prion proteins carrying patho-genic mutations are resistant to phospholipase cleavage of theirglycolipid anchors. Biochemistry 38: 8770–8777.

Negro, A., Meggio, F., Bertoli, A., Battistutta, R., Sorgato, M. C., andPinna, L. A. (2000). Susceptibility of the prion protein to enzymicphosphorylation. Biochem. Biophys. Res. Commun. 271: 337–341, doi:10.1006/bbrc.2000.2628.

O’Rourke, K. I., Baszler, T. V., Miller, J. M., Spraker, T. R., Sadler-Riggleman, I., and Knowles, D. P. (1998). Monoclonal antibodyF89/160.1.5 defines a conserved epitope on the ruminant prionprotein. J. Clin. Microbiol. 36: 1750–1755.

Pan, K. M., Stahl, N., and Prusiner, S. B. (1992). Purification andproperties of the cellular prion protein from Syrian hamster brain.Protein Sci. 1: 1343–1352.

an, K. M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A., Groth, D.,Mehlhorn, I., Huang, Z., Fletterick, R. J., Cohen, F. E., and Prusiner,S. B. (1993). Conversion of alpha-helices into beta-sheets features inthe formation of the scrapie prion proteins. Proc. Natl. Acad. Sci.USA 90: 10962–10966.

etersen, R. B., Parchi, P., Richardson, S. L., Urig, C. B., and Gambetti,P. (1996). Effect of the D178N mutation and the codon 129 poly-

P

P

P

P

R

R

R

S

S

S

S

S

S

S

T

T

T

T

T

T

v

W

Z

538 Negro et al.

morphism on the metabolism of the prion protein. J. Biol. Chem. 271:12661–12668.

rusiner, S. B. (1982). Novel proteinaceous infectious particles causescrapie. Science 216: 136–144.

rusiner, S. B., McKinley, M. P., Bowman, K. A., Bolton, D. C.,Bendheim, P., Groth, D. F., and Glenner, G. G. (1983). Scrapieprions aggregate to form amyloid-like birefringent rods. Cell 35:349–358.

rusiner, S. B. (1991). Molecular biology of prion diseases. Science 252:1515–1522.

rusiner, S. B. (1998). Prions. Proc. Natl. Acad. Sci. USA 95: 13363–13383.

ace, R. E., Caughey, B., Graham, K., Ernst, D., and Chesebro, B.(1988). Analyses of frequency of infection, specific infectivity, andprion protein biosynthesis in scrapie-infected neuroblastoma cellclones. J. Virol. 62: 2845–2849.

iek, R., Wider, G., Billeter, M., Hornemann, S., Glockshuber, R., andWuthrich, K. (1998). Prion protein NMR structure and familialhuman spongiform encephalopathies. Proc. Natl. Acad. Sci. USA 95:11667–11672.

udd, P. M., Endo, T., Colominas, C., Groth, D., Wheeler, S. F.,Harvey, D. J., Wormald, M. R., Serban, H., Prusiner, S. B., Kobata,A., and Dwek, R. A. (1999). Glycosylation differences between thenormal and pathogenic prion protein isoforms. Proc. Natl. Acad. Sci.USA 96: 13044–13049.

cott, M. R., Butler, D. A., Bredesen, D. E., Walchli, M., Hsiao, K. K.,and Prusiner, S. B. (1988). Prion protein gene expression in culturedcells. Protein Eng. 2: 69–76.

cott, M. R., Will, R., Ironside, J., Nguyen, H. O. B., Tremblay, P.,DeArmond, S. J., and Prusiner, S. B. (1999). Compelling transge-netic evidence for transmission of bovine spongiform encephalop-athy prions to humans. Proc. Natl. Acad. Sci. USA 96: 15137–15142.

imons, K., and Ikonen, E. (1997). Functional rafts in cell membranes.Nature 387: 569–572.

ingh, N., Zanusso, G., Chen, S. G., Fujioka, H., Richardson, S.,Gambetti, P., and Petersen, R. B. (1997). Prion protein aggregationreverted by low temperature in transfected cells carrying a prionprotein gene mutation. J. Biol. Chem. 272: 28461–28470.

tahl, N., Borchelt, D. R., Hsiao, K., and Prusiner, S. B. (1987). Scrapie

prion protein contains a phosphatidylinositol glycolipid. Cell 51:229–240.

tahl, N., Baldwin, M. A., Teplow, D. B., Hood, L., Gibson, B. W.,Burlingame, A. L and Prusiner, S. B. (1993). Structural analysis ofthe scrapie prion protein using mass spectrometry and amino acidsequencing. Biochemistry 32: 1991–2002.

wietnicki, W., Petersen, R. B., Gambetti, P., and Surewicz, W. K.(1998). Familial mutations and the thermodynamic stability ofthe recombinant human prion protein. J. Biol. Chem. 273: 31048 –31052.

araboulos, A., Serban, D., and Prusiner, S. B. (1990). Scrapie prionproteins accumulate in the cytoplasm of persistently infected cul-tured cells. J. Cell Biol. 110: 2117–2132.

araboulos, A., Raeber, A. J., Borchelt, D. R., Serban, D., and Prusiner,S. B. (1992). Synthesis and trafficking of prion proteins in culturedcells. Mol. Biol. Cell 3: 851–863.

araboulos, A., Scott, M., Semenov, A., Avrahami, D., Laszlo, L.,Prusiner, S. B., and Avraham, D. (1995). Cholesterol depletion andmodification of COOH-terminal targeting sequence of the prionprotein inhibit formation of the scrapie isoform. J. Cell Biol. 129:121–132.

atzelt, J., Prusiner, S. B., and Welch, W. J. (1996). Chemical chaper-ones interfere with the formation of scrapie prion protein. EMBO J.15: 6363–6373.

elling, G. C., Parchi, P., DeArmond, S. J., Cortelli, P., Montagna, P.,Gabizon, R., Mastrianni, J., Lugaresi, E., Gambetti, P., and Prusiner,S. B. (1996). Evidence for the conformation of the pathologic iso-form of the prion protein enciphering and propagating prion di-versity. Science 274: 2079–2082.

sien, R. Y. (1998). The green fluorescent protein. Annu. Rev. Biochem.67: 509–544.

an Meer, G. (1989). Lipid traffic in animal cells. Annu. Rev. Cell Biol.5: 247–275.ill, R. G., Ironside, J. W., Zeidler, M., Cousens, S. N., Estibeiro, K.,Alperovich, A., Pose, S., Pocchiari, M., Hofman, A., and Smith, P. G.(1996). A new variant of Creutzfeldt-Jakob disease in the UK. Lancet347: 921–925.

accolo, M., De Giorgi, F., Cho, C. Y., Feng, L., Knapp, T., Negulescu,P. A., Taylor, S. S., Tsien, R. Y., and Pozzan, T. (2000). A genetically

encoded, fluorescent indicator for cyclic AMP in living cells. Nat.Cell Biol. 2: 25–29.

Received October 3, 2000Revised November 24, 2000Accepted December 8, 2000

Published online February 21, 2001