THE JOURNAL OF BIOLOGICAL CHEMlSTRY Issue … JOURNAL OF BIOLOGICAL CHEMlSTRY 0 1993 by The American...

THE JOURNAL OF BIOLOGICAL CHEMlSTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 3, Issue of January 25, pp. 1965-1975,1993 Printed in U. S. A.

Characterization of a DNA Polymerase from the Hyperthermophile Archaea Thermococcus litoralis VENT DNA POLYMERASE, STEADY STATE KINETICS, THERMAL STABILITY, PROCESSIVITY, STRAND DISPLACEMENT, AND EXONUCLEASE ACTIVITIES*

(Received for publication, August 14, 1992)

Huimin Kong, Rebecca B. Kucera, and William E. Jack$ From the New England Biolabs, Inc., Beverly, Massachusetts 01915

We have isolated, cloned, and characterized a DNA polymerase from the hyperthermophile archaea Ther- mococcus Zitoralis, the Tli DNA polymerase (also referred to as Vent DNA polymerase). The enzyme is extremely thermostable, having a half-life of 8 h at 95 “C and about 2 h at 100 “C. Pseudo-first-order kinetics at 70 “C reveal an extremely low K,,, for a primed M13mp18 substrate (0.1 nM), coupled with a relatively high K , for dNTPs (50 MM). Accompanying extension rates are on the order of 1000 nucleotides/ min. Synthesis by the polymerase is largely distributive, adding an average of 7 nucleotides/initiation event. This distributive synthesis can generate products of at least 10,000 bases.

TZi DNA polymerase contains a 3‘ 5’ exonuclease activity that enhances the fidelity of replication by the enzyme (Mattila, P., Korpela, J., Tenkanen, T. and Pitkanen, K. (1991) Nucleic Acids Res. 19, 4967- 4973). A 2-amino acid substitution within the conserved exonuclease domain abolishes both double and single strand-dependent exonuclease activity, without altering kinetic parameters for polymerization on a primed single-stranded template. Strand displacement activity by the mutated and unmutated forms increases with increasing temperature and is enhanced in the exonuclease-deficient form of the enzyme.

Beginning with the discovery and characterization of DNA polymerase I from Escherichia coli by Kornberg and colleagues in the 1950s (Kornberg, 1980), a variety of DNA polymerases have been isolated from prokaryotic and eukaryotic sources. Study of these enzymes has provided key insights into nucleic acid metabolism. Additionally, DNA polymerases have been exploited in specialized molecular biology techniques. For example, DNA polymerase I has been the enzyme of choice for nick translation of DNA. Both the thermostable Taq DNA polymerase (Chien et al., 1976; Lawyer et al., 1989) and a modified version of T7 DNA polymerase (Tabor and Richard- son, 1989) have been useful for dideoxy sequencing of DNAs with secondary structure (Innis et al., 1988; Tabor and Rich-

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M74198.

$ T o whom correspondence and reprint requests should be ad- dressed New England Biolabs, Inc., 32 Tozer Rd., Beverly, MA 01915. Tel.: 508-927-5054: Fax: 508-921-1350.

ardson, 1987). Heat-stable polymerases such as Taq DNA polymerase have also been key elements in development of the polymerase chain reaction (Saiki et al., 1988).

To extend the repertoire of DNA polymerases available for use in molecular biology, we have isolated and cloned a DNA polymerase from the hyperthermophile Thermococcus litoralis (T l i DNA polymerase; Perler et al., 1992). Since this organism was isolated from a submarine thermal vent (Belkin and Jannasch, 1985), this polymerase has also been referred to as Vent DNA polymerase. Surprisingly, a 197-kDa protein was encoded by the polymerase open reading frame, over twice as large as the active peptide of 93 kDa observed by SDS-PAGE.’ Subsequent analysis strongly suggested that at least two processing events were required to form the mature enzyme (Perler et al., 1992). By comparing the predicted protein sequence with those derived from other polymerase genes, two candi- date processing sites were identified as large in-frame inser- tions within conserved primary protein sequence motifs. One processing event was mimicked by removing an intervening sequence (IVS1) from the expression clone, leaving a 135-kDa coding sequence. Extracts of E. coli cells carrying this construct yielded an active polymerase with an apparent molecular mass of 93 kDa, indicating that the second processing event occurred i n vivo in these recombinants. Subsequent removal of a second intervening sequence (IVS2) left an open reading frame encoding a 90-kDa protein. E. coli cells carrying this construct also produced an active polymerase which migrated as a 93-kDa protein on protein gels.

In order to determine whether the processing events had been correctly predicted and carried out in recombinant constructs, and to establish a basis for comparison with other DNA polymerases, we have compared physical and kinetic properties of the original and recombinant enzymes.

MATERIALS AND METHODS

Strains

BLZl(DE3)plysS (Studier et al., 1990) was obtained from W. Studier (Brookhaven Laboratories). The NS-C strain of T. litoralis (Belkin and Jannasch, 1985) was obtained from H. Jannasch (Woods Hole Oceanographic Institute). Culture densities were monitored using a Klett-Summerson colorimeter.

Plasmids

Plasmid pAII17 is a modified form of the T7 expression vector pETl l c (Studier et al., 1990). Sequences between the EcoRI and Hind111 sites of pETl l c were eliminated by cleaving with the two

The abbreviations used are: PAGE, polyacrylamide gel electrophoresis; IVS, intervening sequence; AdoMet, S-adenosylmethionine; dNTP, deoxyribonucleotide triphosphate; bp, base pair(s); Klenow, large fragment of E. coli DNA polymerase I.

1965

1966 Biochemical Properties of Tli DNA Polymerase

enzymes, repairing the termini with the large fragment of DNA polymerase I (Klenow), and recircularizing the plasmid. A 4-fold direct repeat of the rrnb transcription terminator was inserted upstream of the T7 promoter to block read-through transcription. pRS415 (Simons et al., 1987) was cut with Eco01091, the termini repaired with Klenow, and SphI linkers (New England Biolabs No. 1047) ligated to the ends. This fragment mixture was cleaved with RamHI and SphI. The -750-bp fragment containing the terminators was then isolated and ligated into the modified pETllc cut with SphI and EglII. The single EcoRI site transferred along with the rrnb fragment was eliminated by cutting with EcoRI, repairing the termini with Klenow, and recircularizing the plasmid. The resulting construct was named pAII17. Plasmid pNEB687, a pAII17 derivative containing the coding sequence for Tli DNA polymerase but lacking IVS1, and pAKK4, an analogous construct which also lacks IVS2, have been described previously (Perler et al., 1992). An exonuclease-deficient variant of the polymerase was created by replacing Dl41 and E143 with alanine residues. These changes were introduced by oligonucleotide-directed mutagenesis (Kunkel et al., 1987) using primer i listed in Table I. An additional silent mutation in codon 142 (ATT to ATC) introduced a PvuI site to aid in screening for the desired changes. The DNA fragment containing these changes was introduced into pNEB687 and pAKK4, creating pCAS4 and pALK1, respectively.

Single-stranded DNA Purification Single-stranded DNA templates were purified from M13mp18

phage particles as described by Schreier and Cortese (1979).

Oligonucleotides All oligonucleotides were obtained in purified form from New

England Biolabs Organic Synthesis Division and are listed in Table I. Primers 1202, 1224, and 1233 are commercially available, whereas the remaining oligonucleotides were custom synthesized. When required, oligonucleotides were end-labeled using [Y-~'P]ATP (6000 Ci/ mmol; Du Pont-New England Nuclear) and polynucleotide kinase (Sambrook et al., 1989).

Enzymes All restriction endonucleases and modifying enzymes were from

New England Biolabs. Taq DNA polymerase, in indicated instances, was obtained from Perkin-Elmer Cetus.

Polymerase Buffers Tli DNA polymerase buffer contained 10 mM KCI, 10 mM

(NH&SO,, 20 mM Tris-HC1 (pH 8.8 at 25 "C), 5 mM MgS04, 0.1% Triton X-100, 0.1 mg/ml bovine serum albumin. Taq DNA polymerase buffer contained 16.6 mM (NH),SO,, 67 mM Tris-HCI (pH 8.8 a t 25 "C), 6.7 mM MgC12, 10 mM 6-mercaptoethanol, 0.1 mg/ml bovine serum albumin. Klenow DNA polymerase buffer contained 10 mM Tris-HC1 (pH 7.5), 5 mM MgCI2, 7.5 mM dithiothreitol, 0.1 mg/ml bovine serum albumin. T4 DNA polymerase buffer contained 50 mM Tris-HCI (pH 8.0), 5 mM MgCI2, 5 mM dithiothreitol, 0.1 mg/ml bovine serum albumin.

Assays for Polymerase Activity

Tli DNA polymerase activity was determined using an acid precipitation assay. One unit of polymerase activity is defined as the amount required to incorporate 10 nmol of dNTP into an acid-insoluble form at 75 "C in 30 min. Assays contained Tli polymerase buffer, 0.2 mM each dNTP, [3H]TTP (0.1 Ci/mmol final concentration), 0.2 mg/ml activated calf thymus DNA (Aposhian and Kornberg, 1962). Under these conditions the enzyme showed a linear response up to 1.5 units/ ml.

Purification of Native Tli DNA Polymerase In Table 11, T. litoralis strain NS-C was grown by Finnzymes Oy

(Espoo, Finland) in medium containing, per liter, 10 g of tryptone, 5 g of yeast extract, 0.4 mg of resazurin, 0.4 g of cysteine chloride (C~HBC~NOZS.H~O) , 30 g of NaC1, 4.5 g of MgC12.6H20, 9 g of MgS04.7H20, 1.5 g of (NH4&S04, 0.3 g of NaHC03, 0.45 g of CaClz. 2H20, 0.75 g of KC1 a t 88 "C. Nitrogen was bubbled through the medium before inoculation to remove remaining oxygen. Cells were collected in a continuous flow centrifuge and lysed spontaneously following harvest. This material, representing 653 g of cells in a total volume of about 4.5 liters, was frozen at -20 "C. All subsequent procedures were performed at 4 "C. The lysed mixture from above was thawed and insoluble material removed by centrifugation in a Sharples Type 16 centrifuge a t 15,000 rpm for 40 min. The supernatant was dialyzed against 16 liters of 0.01 M KPO, (pH 7.4), 0.1 mM EDTA (Fraction I, 4.7 liters).

Affi-Gel Blue Chromatography-Fraction I was divided into three aliquots and separately chromatographed on an Affi-Gel Blue column (Bio-Rad 20 cm2 X 45 cm) equilibrated in 0.01 M KPO, (pH 7.4), 0.1 mM EDTA, 0.05% (v/v) Triton X-100, 10% (v/v) glycerol, 0.1 M NaCI. After loading, each column was washed with 1.8 liters of equilibration buffer and eluted with a 2-liter linear gradient of NaCl (0.1-2 M) in the same buffer. The peak of activity eluted a t about 1.2 M NaCl. Peak fractions from the three columns were pooled and dialyzed against buffer A (0.01 M KPO, (pH 6.9), 0.1 mM EDTA, 0.05% Triton X-100, 10% glycerol) and then against buffer A containing 0.1 M NaCl (Fraction 11, 1.4 liters).

Phosphocellulose Chromatography-Fraction I1 was applied to a phosphocellulose column (Whatman P11; 20 cm2 X 12 cm) equilibrated in buffer A containing 0.1 M NaCI. After washing with 0.7 liter of equilibration buffer, the polymerase was eluted with a 2-liter linear gradient of NaCl (0.1-0.8 M ) in buffer A. Fractions containing polymerase activity eluted near 0.4 M NaCl and were pooled and dialyzed against buffer A containing 0.1 M NaCl (Fraction 111, 0.6 liter).

Heparin-Sepharose CL-GB Chromatography-Fraction I11 was applied to a heparin-Sepharose CL-GB column (Pharmacia LKB Bio- technology Inc.; 5.3 cm2 X 7 cm) equilibrated in buffer A containing 0.1 M NaCI. After washing with 0.2 liter of equilibration buffer, polymerase was eluted with a 0.4-liter linear gradient of NaCl (0.1-1 M) in buffer A, yielding a polymerase peak a t approximately 0.5 M NaC1. Active fractions were pooled and dialyzed against buffer B (10 mM Tris-HC1 (pH 7.5), 0.1 mM EDTA, 0.05% Triton X-100, 10% glycerol) containing 0.07 M NaCl (Fraction IV, 46 ml).

DEAE Chromatography-Fraction IV was applied to a DEAE- Sepharose CL-GB column (Pharmacia; 2 cm2 X 7.5 cm) equilibrated with buffer B containing 0.07 M NaC1. Activity was found in the flow- through fractions, which were pooled (Fraction V, 48 ml).

S-Sepharose Chromatography-Fraction V was applied to an S- Sepharose column (Pharmacia; 2 cm2 X 5 cm) equilibrated in buffer C (10 mM KPO, (pH 7.0), 0.1 mM EDTA, 0.05% Triton X-100, 10% glycerol) containing 0.1 M NaC1. The column was washed with 40 ml of equilibration buffer, and the polymerase eluted with a 0.1-liter linear gradient of NaCl (0.1-1.0 M) in buffer C. The activity eluted a t about 0.3 M NaC1, although the activity peak was split by the presence of a DNA-binding protein. Fractions containing polymerase activity were pooled (Fraction VI, 16 ml).

GI00 Chromatography-Fraction VI was applied a t 10 ml/h to a Sepharose GlOO column (Pharmacia, 5 cm2 X 134 cm) equilibrated in 0.5 M NaC1, 10 mM KPO, (pH 7.2), 0.1 mM EDTA, 0.05% Triton X- 100, 10% glycerol and washed with the same buffer. Active fractions were pooled away from a contaminating endonuclease activity and dialyzed against 10 mM Tris-HCI (pH 7.5), 0.1 mM EDTA, 0.05% Triton X-100, 10% glycerol, 0.35 M NaCl (Fraction VII, 48 ml).

Affz-Gel Blue Chromatography-Fraction VI1 was split into two equal aliquots and separately loaded onto an Affi-Gel Blue column (2 cm2 X 6 cm) equilibrated and washed in the same buffer. Polymerase activity was found in the flow-through fractions and was free of the

TABLE I Oligonucleotides used in this work

i Exo- mutagenesis 5' GCTCCTTGCCTTTGCGATCGCAACGTTTTATCATG 3' ii Gap-filling assay downstream primer 5' CGTAATCATGGTCATAGCTGTTTCCTG 3'

iii T7 primer (complement to nucleotides 39,585-39,606) 5' GGGATGAAGTGGTGTGATGCAA 3' 1224 M13 primer 5' CGCCAGGGTTTTCCCAGTCACGAC 3' 1202 M13 primer 5' CACAATTCCACACAAC 3' 1233 M13 reverse primer 5'AGCGGATAACAATTTCACACAGGA 3'

Biochemical Properties of Tli DNA Polymerase 1967

TABLE I1 Purification of Tli DNA polymerase from T. litoralis

Fraction Step pz$L, 2::; Recovery Purification

mg unitsfmg % -fold I Crude supernatant 20,000 54 100 1

I1 Affi-Gel Blue 3400 170 53 3 111 Phosphocellulose 400 1200 42 21 IV Heparin-sepharose 210 1900 36 35 V DEAE 62 5000 28 94

VI S-Sepharose 24 9000 20 170 VI1 GlOO 8.9 23,000 19 430

VI11 Affi-Gel Blue 8.5 a Determined by the dye binding assay of Bradford (1976) using

bovine serum albumin as a standard.

TABLE 111 Purification of Tli DNA polymerase from E. coli

Fraction Step Total Specific Re Purifi- protein" activity cover' cation

mg unitslmg % -fold

I Crude supernatant 98,000 I1 Heat treated 5900 330 100 1

111 DEAE 2100 900 98 3 IV Phosphocellulose 590 2700 84 8 V Hydroxylapatite 380 3700 73 11

VI DEAE/Affi-Gel Blue 82 18,000 73 53 VI1 Heat-treated 46 21,000 50 63 Determined by the dye binding assay of Bradford (1976) using

bovine serum albumin as a standard.

contaminating endonuclease noted above. Active fractions were pooled (volume = 80 ml) and dialyzed against 50% (v/v) glycerol, 0.1 M KCI, 0.1 mM EDTA, 10 mM Tris-HC1 (pH 7.4), 1 mM dithiothreitol, 0.1% Triton X-100. Bovine serum albumin was added to a final concentration of 20 pg/ml (Fraction VIII, 34 ml) and the sample stored at -20 "C.

The preparation gave two major protein bands on Coomassie- stained SDS-PAGE, with the peptide at 93 kDa comprising about 60% of the total protein (Fig. IC). Incubation of 20 units of Fraction VI11 with 1 pg of Hind111 cut X DNA under Tli DNA polymerase assay conditions for 16 h showed no detectable change in the DNA banding pattern on agarose gels, indicating a lack of contaminating nuclease activity.

Purification of Tli DNA polymerase from E. coli recombinants In Table I11 all recombinants lacked IVSl and were grown in E.

coli BLPl(DE3)pIysS containing T7 promoter expression constructs. Purification was similar for polymerase produced from constructs containing or lacking IVS2 and for variants lacking exonuclease activity. A representative purification for a recombinant lacking IVS2 is presented.

E. coli BL21(DE3) ply& pAKK4 was grown in a 100-liter fermenter at 30 "C in medium containing, per liter, 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl and 0.1 g of ampicillin. When the culture reached a Klett reading of 360, expression of Tli DNA polymerase was induced by addition of isopropyl-1-thio-0-D-galactopyranoside to 0.4 mM. The culture was incubated at 30 "C for an additional 6 h, and cells were harvested by centrifugation and stored at -70 "C. All subsequent steps, except where indicated, were performed at 4 "C.

Preparation of Cell Extract-Induced E. coli cells (692 g) were thawed and suspended in 2.1 liters of 50 mM NaC1, 10 mM Tris-HC1 (pH 7.8), 10% glycerol, 0.1 mM EDTA. Cells were lysed by three passages through a Manton Gaulin homogenizer, using a cooling coil to keep the homogenate temperature below 20 "C. The extract was clarified by centrifugation for 40 min in a Sharples Type 16 centrifuge at 15,000 rpm (Fraction I, 2.4 liters).

Heat Treatment-Fraction I was heated to 75 "C for 10 min and then cooled on ice. Insoluble matter was removed by centrifugation for 15 min in a Sharples Type 16 centrifuge at 15,000 rpm (Fraction 11, 1.9 liters).

DEAE-Cellulose Chromatography-Fraction I1 was applied to a DEAE Sepharose CL-GB column (64 cm2 x 10 cm) equilibrated with buffer D (10 mM Tris-HC1 (pH 7.8), 0.1 mM EDTA, 10% glycerol)

containing 0.05 M NaC1. The flow-through fractions from this column were pooled and adjusted to pH 6.9 by addition of 1 M KHzPO, to a final concentration of 10 mM (Fraction 111, 2.5 liters).

Phosphocellulose Chromatography-Fraction I11 was applied to a phosphocellulose column (20 cm2 X 24 cm) equilibrated with buffer E (10 mM Tris-HCI (pH 6.9), 10 mM KP04, 1 mM dithiothreitol, 0.1 mM EDTA, 10% glycerol) containing 0.1 M NaC1. After washing with 850 ml of equilibration buffer, the column was eluted with a 2-liter linear gradient of NaCl (0.1-1.0 M) in buffer E. Polymerase activity, eluting near 0.6 M NaC1, was pooled (Fraction IV, 970 ml).

Hydroxylapatite Chromatography-Fraction IV was applied to a hydroxylapatite column (Calbiochem, 5 cm2 X 14 cm) equilibrated with buffer D containing 0.1 M NaC1. After washing with 40 ml of equilibration buffer, the column was washed with 200 ml of buffer E containing 0.1 M NaCl and eluted with a 0.7-liter linear gradient of KPO, (0-0.5 M ) in buffer E. Polymerase activity eluted in a peak centered around 0.25 M KPO,. Active fractions were pooled and dialyzed against buffer D containing 0.1 M NaCl (Fraction V, 132 ml) .

DEAE-Sepharose/Affi-Gel Blue Chromatography-Fraction V was applied at room temperature to DEAE Sepharose (Pharmacia; 2 cm2 X 8 cm) and Affi-Gel Blue (2 cmz X 12 cm) columns linked in series and equilibrated with buffer D containing 0.1 M NaCI. The linked columns were washed with 140 ml of the equilibration buffer. The Affi-Gel Blue column was separated and the polymerase activity eluted from this column using a 570 ml linear gradient of NaCl (0.1- 1.2 M) in the same buffer. Active fractions, eluting at about 0.75 M NaC1, were pooled and dialyzed against 50% glycerol, 0.1 M KCI, 0.1 mM EDTA, 10 mM Tris-HC1 (pH 7.41, 0.1% Triton X-100 (Fraction VI, 48 ml).

Heat Treatment-Fraction VI was heat treated at 100 "C for 15 min and insoluble material removed by 10 min centrifugation at 12,000 X g (Fraction VII, 48 ml). This product was stored at -20 "C. Final purity was estimated by inspection of Coomassie Blue-stained SDS-PAGE and was found to be greater than 85% (Fig. IC). Incu- bation of 20 units of Fraction VI1 at 37 or 75 "C for 4.5 h with 1 Fg of 0x174 RFI DNA in Tli DNA polymerase assay buffer containing 0.4 mM dNTPs resulted in no detectable linearization or nicking of the substrate.

Protein Concentration Determination Tli DNA polymerase concentrations were estimated by comparing

the intensity of Coomassie Blue staining of the 90-kDa peptide with that of carbonic anhydrase standards run on the same gel. The stained gel was digitized with a Microtek Scanmaker 600ZS and analyzed with NIH Image 1.43 software. The concentration of carbonic anhydrase was determined spectroscopically prior to running using E:;",,, = 18 (Davis, 1961).

Exonuclease Activity Assays Exonuclease assays quantified the release of 3H from a X DNA

substrate uniformly labeled using [3H]AdoMet and the SssI methyltransferase, which methylates cytosine residues in the dinucleotide sequence CpG. Following methylation, the methyltransferase was inactivated by heating at 72 'C for 10 min. The DNA was then digested with HaeIII endonuclease, phenol-extracted, and ethanol- precipitated. Excess AdoMet was removed by gel filtration on Seph- adex G-50. Exonuclease assays contained reaction buffer and 0.03 mg/ml of the uniformly labeled X DNA (19,500 cpm/pg) and were incubated at 72 "C for 1 h. Release of acid-soluble nucleotides was scored by mixing 5 0 - ~ l aliquots with 100 p1 of 2.5 mg/ml herring sperm DNA and 150 pI of 10% trichloroacetic acid. After incubating on ice for at least 10 min, the sample was pelleted at 12,000 X g at 4 "C for 5 min. Acid-soluble radioactivity in 150 pl of the supernatant was quantified by liquid scintillation counting. One unit of exonuclease activity was defined as the amount of enzyme that catalyzed the acid solubilization of 10 nmol of total nucleotide in 30 min at 70 "C. The assay was linear with respect to added enzyme to greater than 8 units/ml.

Substrate for Determining the Directionality of Exonuclease Action The dual 3H/32P-labeled substrate for determining the direction-

ality of exonuclease action was prepared using the repair reaction of Klenow on EcoRI cut pBR322 in the presence of [3H]TTP, thus placing two 3H labels on each 3'-end of the molecule. Subsequently, a 3zP label was added to both of the 5' termini via the polynucleotide kinase exchange reaction (Sambrook et al., 1989). Free nucleotides


were removed by gel filtration on Sephadex G-50. The resulting

:l2P/pg of DNA. substrate had a specific activity of 9 X lo4 cpm 3H and 8 X lo4 cpm

Preparation of Primed M13mp18 DNA Template Polymerase reaction buffer containing 0.12 p M M13mp18 single-

stranded template and 1.2 p M M13 24-mer sequencing primer (1224, Table I) was heated at 93 "C for 3 min and annealed at 25 "C for 20 min. This concentrated stock was diluted into final reaction mixtures as indicated. Concentrations of the primed template are expressed as moles of single-stranded M13mp18.

Assays of Polymerase Strand Displacement 5'-"P-End-labeled 1224 primer (Table I) was annealed to

M13mp18 single-stranded DNA as described above. The gap-filling oligonucleotide (ii, Table I) was simultaneously annealed downstream to the template, leaving a 79-nt gap between the oligonucleotides. Klenow and T4 DNA polymerase reactions were performed a t 37 "C, whereas Tli DNA polymerase reactions were incubated at the indicated temperatures. Reactions were initiated by the addition of DNA polymerase, and aliquots were removed as a function of time, added to a stop solution containing formamide with 0.37% EDTA (pH 7.0), and incubated on ice until all samples were collected. Subsequently, samples were run on a 6% acrylamide, 6 M urea sequencing gel in Tris/borate/EDTA buffer (Peacock and Dingman, 1968) and visualized by autoradiography.

Kinetic Parameter Determinatiom Assays for Pzp and K S were carried out in the polymerase assay

buffers described above containing variable amounts of dNTPs and primed M13mp18 DNA template. In the case of dNTP parameters, DNA template was fixed a t 15 nM M13mp18 DNA annealed with the 1224 primer (Table I). In the case of DNA parameters, dCTP, dGTP, and dATP were present at 0.2 mM, and TTP was present a t 0.1 mM. Reactions were initiated by addition of enzyme to reactions prewarmed to 72 "C. Reactions which exceeded 15 min in length were overlaid with mineral oil to prevent evaporation of the sample. Samples were withdrawn as a function of time, spotted on 3-mm filter discs (Whatman), and incorporation of 3H into an acid-insoluble form was determined after unincorporated nucleotides were washed away with 10% trichloroacetic acid. Plots of the reaction time course were analyzed to determine initial rates and the data replotted using a Hanes-Woolf format. Kinetic parameters were derived after a weight- ing protocol (Wilkinson, 1961).

Processiuity Measurements Processivity (the average number of nucleotides added per initia-

tion event) was measured using the kinetic method described by Bambara et al. (1978). This method compares the rate of polymerization in the presence of all four dNTPs with that observed in the presence of one, two, or three dNTPs. The limited reaction gives a measure of the total number of polymerase initiation events at- t.empted, whereas the complete reaction measures the total polymerization. From these two rates, the processivity can be calculated. Since limiting the complement of nucleotides can also affect the cycling time of the enzyme between initiation events, both reactions are repeated in the presence of a reversible inhibitor. Comparison of initial polymerization rates in the presence and absence of this inhibitor allows a correction for this perturbation in cycling times.

M13mp18 single-stranded DNA (Matson et al., 1980), which allowed The substrate in these experiments was randomly primed

determination of processivity values independent of the sequence context of the initiating primer. Random primers were generated by cleaving M13mp18 RFI DNA (0.1 mg/ml) with DNase I (0.125 pg/ ml) for 15 min at 37 "C in 0.04 M Tris-HC1 (pH 7.6), 0.66 mM MnC12, conditions under which DNase I produced double-stranded breaks in the DNA. Fragments were sized by electrophoresis on a 2% agarose gel and found to be an average of 100 base pairs in length, a value that was used to calculate the molar concentration of the primer fragments. A 4-fold molar excess of primer fragments were annealed to the single-stranded M13mp18 template in buffer lacking dNTPs by heating at 93 "C for 3 min followed by cooling to 25 "C for 20 min.

The reversible inhibitor in these experiments was prepared from oligo(dG) and poly(dC) (Pharmacia). 10 PM oligo(dG) was mixed with 2 p~ poly(dC) in reaction buffer lacking dNTPs, heated to 93 "C for :3 min, and then annealed at 25 'C for 20 min.

Uninhibited reactions contained Tli DNA polymerase buffer and 0.2 mM dATP, dGTP, dCTP, 0.08 mM [3H]TTP (0.25 Ci/mmol), 0.15 p M M13mp18 single-stranded DNA, 0.6 p M random primer, and 1 unit/ml Tli DNA polymerase. Inhibited reactions also contained annealed oligo(dG) (1 p ~ ) poly(dC) (0.2 pM). The labeled nucleotide in these experiments was [3H]TTP, and thus incorporation into the inhibitor was not monitored. In addition to TTP, limited nucleotide reactions cont,ained dATP and dGTP or in some reactions only dGTP. Assays were performed at 72 "C, and aliquots of the reaction were sampled at 5,10, and 15 min after enzyme addition to determine the initial rate of label incorporation.

Processivity was quantified using equations 11, 18 and 27 of Bam- bara e t al. (1978) using the base composition values of ColEI DNA given therein and Newton's method (Hewlett-Packard, 1984) to solve Equation 27. For example, in one experiment Tli DNA polymerase yielded (in counts/min): V4 = 170, V , i = 82, V3 = 21, and V3.i = 15, and a calculated processivity of 8.

RESULTS

Tli DNA Polymerase Purification-Isolation of a DNA PO- lymerase from T. litoralis was hampered by the extreme growth conditions required for the native organism and by the number of column chromatography steps required to achieve a reasonable degree of purity. The initial preparation of polymerase from T. litoralis contained four major bands of molecular masses 93 kDa, 85 kDa, and a doublet at 18 kDa, with approximately equal quantities of each species (Fig. 1A). Gel elution experiments demonstrated that only the 93-kDa peptide contained polymerization and exonuclease activity (Fig. 1A). The purification from T. litoralis described here resulted in a mixture of 130, 93, 77, and 70 kDa species, with the polymerase polypeptide representing roughly 25% of the total protein (Table 11; Fig. IC, lane 4 ) . The amount of the 93-kDa species, and consequently the specific activity of 47,000 units/mg (Table IV), was estimated based on comparison of the Coomassie Blue staining intensity of the 93-kDa band compared with carbonic anhydrase protein standards run on the same gel.

Cloning of the gene in E. coli resulted in higher yields of the polymerase due to more facile growth of the organism and the high degree of purification afforded by a step in which greater than 90% of soluble E. coli proteins could be heat- denatured and precipitated (Table 111). While the final preparation was relatively homogeneous by Coomassie staining, a large number of smaller cross-reactive peptides appear on Western analysis, presumably resulting from premature translation termination, internal translation initiation, or protease degradation (Fig. 1, B and C). Accordingly, the concentration and specific activity of the recombinant polymerase have been estimated based on Coomassie Blue staining of the 93-kDa band, as was done for the enzyme isolated from T. litoralis. Despite this rather crude approximation, the specific activity (Table IV) is similar for the native and recombinant enzymes. Additionally, biochemical and kinetic char- acteristics are similar (see below).

Purification intermediates of Tli DNA polymerase isolated from E. coli (Table 111, Fraction VI) differ from the polymerase isolated from the native organism in that they display biphasic thermal stability at 90 "C and above; approximately 25-40% of the recombinant activity has a half-life at 95 "C of 5-10 min, whereas the remainder has a longer half-life of about 6- 8 h. Biphasic behavior was not observed at temperatures below 90 "C. Addition of a final 100 "C heat step eliminated this biphasic behavior (Table 111, Fraction VII).

Optimized Reaction Conditions-The Tli DNA polymerase displayed a broad salt optimum, with less than 2-fold differences in initial incorporation rates between 0 and 0.1 M KC1 and between 5 and 50 mM (NH&S04. M$+ concentrations


in the range of 1-10 mM also had minimal effects in incorporation assays, with SO:- and CI- counterions yielding similar rates of polymerization. M$+ was required for both polymerization and exonuclease activities; Zn" and Ca2+ (0.2-5 mM) could not substitute for M F . Mn2+ strongly inhibited nucleotide addition to an activated DNA template in the presence of 3 mM M F , with a 50% reduction in incorporation occurring at approximately 0.15 mM MnC12. Despite this inhibition of polymerization, 2 mM Mn2+ stimulated the exonuclease activity 2-fold on double-stranded substrate and 40- fold on a uniformly labeled substrate which had previously been denatured by heating a t 100 "C (data not shown). Activ-

A I a

a R

l 2 3 4 M W ' M W 1 2 3 4 M W

-208 -

5101 - 71 - - 4 4 - - 29 - - 18 - - 15 -

.96

.55 - 4 3

FIG. 1. Purity of preparations of ni DNA polymerase from native and recombinant sources. A , identification of Tli DNA polymerase. Polymerase purified from T. litoralis was separated by 10-2096 gradient SDS-PAGE (Daiichi, Tokyo, Japan). The Coo- massie Blue staining pattern is shown below the graph. An identical lane was cut into 18 slices, and protein from each slice was isolated and renatured by the method of Hager and Burgess (1980). Polym- erase assays utilized a 2.5-h incubation (0). Exonuclease assays utilized a 13.5-h incubation (A). B, Western blot analysis of purified polymerase samples. Electrophoresis was as in A. Anti-polymerase antibody and blotting methods were as described previously (Perler et al., 1992). Polymerase was isolated from E. coli BL21(DE3)plysS containing pALKl (AIVSlAIVS2exo-; lane I ) , pAKK4 (XVS1 AIVS2; lane 2) or pNEB687 (AIVS1; lane 3 ) or from T . litoralis (lane 4 ) . MW indicates molecular mass markers, the sizes of which are noted in kDa adjacent to the gel. The position of the mature intact Vent DNA polymerase is indicated by an arrow. The band of about 85 kDa in lane 4 is not antigenically related to Tli DNA polymerase but rather reflects the presence of this antigen in the protein mixture used for immunization.' C , purified Tli DNA polymerase preparations from native and recombinant sources. SDS-PAGE was as in A followed by staining with Coomassie Blue dye. Sample numbering is as in H.

ity was also affected by the pH of the reaction, increasing approximately 2-fold over the pH range of 5.9-7.9 at 70 "C. Addition of reducing agents, either 1 mM dithiothreitol or 10 mM P-mercaptoethanol, had no effect on the activity (data not shown). Several compounds were found to stabilize the enzyme during extended incubations, yielding an apparent increase in enzyme activity in each case by about 10%. These compounds included bovine serum albumin (0.1 mg/ml), gelatin (0.1 mg/ml), and Triton X-100 (0.15%, v/v). Thus, a wide variety of reaction conditions allowed high rates of nucleotide incorporation with the Tli DNA polymerase. Tli DNA polymerase buffer was optimized based on the individual optima observed.

Thermal Stability-As would be expected from an enzyme isolated from a hyperthermophile, Tli DNA polymerase was stable and active a t high temperatures. Inactivation at 95 "C of the purified enzyme was monophasic and first-order with a half-life of about 8 h for enzymes isolated from both the native and recombinant sources, compared with a 1.6-h half- life seen for Tuq DNA polymerase a t this temperature (Fig. MI.

Stability over a wider range of temperatures was assayed by incubating the enzyme for 2 h at different temperatures and then quantifying the remaining activity (Fig. 2R). Vir- tually no loss of activity was noted in incubations up to 80 "C. Even after incubation a t 100 "C, >50% of the original Tli DNA polymerase activity remained, indicating a half-life of about 2 h. This behavior contrasted with that of Tuq DNA polymerase which retained no detectable activity following this incubation (Fig. 2R). Identical Tli DNA polymerase inactivation curves were observed at 100 "C in HEPES buffer (pH 8.8 at 25 "C), and thus pH does not appear to play a major role in this inactivation. At 100 "C the polymerases from recombinant and native sources showed minor differences in stability (Fig. 2R).

Temperature Optima-Polymerization by Tli DNA polymerase occurred over a broad range of temperatures, reaching a maximum a t about 80 "C on an activated calf thymus DNA template (Fig. 3A). Since the enzyme is stable at temperatures up to 100 "C, this optimum appears to reflect denaturation of the template at higher temperatures. Consistent with this rationale, an M13mp18 template primed with a 24-nucleotide oligomer had a lower temperature optimum (75 "C), presumably reflecting the greater thermal stability of the calf thymus substrate. This differential behavior was more markedly seen at 90 "C, where the calf thymus template supported 20% of the maximal activity, compared with 10% for the primed M13mp18 substrate. At temperatures lower than this maximum, a smooth decrease in activity was observed, with only 2% of the maximal activity remaining at 30 "C. An Arrhenius plot of the temperature dependence (Fig. 3R) indicates an apparent activation energy (Ea) of 22 kcal/mol over this temperature range (30-75 "C), with an apparent enthalpy of activation (AHt) of 21 kcal/mol, a value comparable with that seen between 4 and 40 "C for DNA polymerase I (E, = 17 kcal/mol; McClure and Jovin, 1975).

TABLE IV Polymerase and exonuclease specific activities

Polymerase, M13 substrate

Polymerase, Calf thymus Calf thymus activity/M13 Exonuclease Polymerase/Exonuclease

substrate activitv

unitslmg unitn/mg T . litoralis 16,000 47,000 2.9 3300 14 Recombinant 6700 18,000 2.7 1500 12 Exonuclease- 4500 34,000 7.6 <3 >11,000


70 75 80 85 90 95 1 0 0 time at 95% (h) Temperature ('C)

FIG. 2. Thermal stability of Tli and Taq DNA polymerases. A , 40 units/ml of Tli was incubated a t 95 "C in Tli DNA polymerase reaction buffer that lacked dNTPs and DNA. At the indicated times, aliquots were diluted 4-fold into reaction buffer a t 72 "C which contained dNTPs and primed M13mp18 DNA substrate (final concentrations 0.2 mM and 20 nM, respectively), and the initial rate of ,"H incorporation into acid insoluble material was monitored. Tag DNA polymerase (Perkin-Elmer Cetus) was treated in the same manner in buffer containing 50 mM KCI, 10 mM Tris-HC1 (pH 8.3 a t 25 "C), 1.5 mM MgC12, 0.001% gelatin (Perkin-Elmer Cetus). Activity is expressed relative to the activity present prior to treatment at 95 "C. Curves correspond to half-lives of 9.7, 6.7, and 1.6 h for the native Tli DNA polymerase (0), recombinant TLi DNA polymerase (0) and Tug DNA polymerase (a), respectively. B, 20 units/ml of Tli or Tag DNA polymerase was incubated in the reaction buffers indicated above lacking DNA and dNTPs at the indicated temperatures for 2 h. Following this incubation the remaining polymerase activity was determined as described in A . Activity remaining was calculated relative to DNA polymerase samples incubated a t 0 "C for 2 h. 0, Tli DNA polymerase; 0, recombinant Tli DNA polymerase; 0, Taq DNA polymerase.

A .

Temperature ('C)

B i ! F l 2 4

I - - c 2

1

0 2.8 2.9 3 3.1 3,2 3.3 3.4

1iT. K'

FIG. 3. Temperature dependence of the polymerization

ccnditions using activated calf thymus DNA (A)or 0.1 p M M13mp18 rate. A , reactions were performed under standard polymerase assay

single-stranded DNA primed with 1 PM 1224 primer (0). Reactions were prewarmed to the indicated temperatures and the reaction initiated by adding native Tli DNA polymerase to a final concentration of 2.7 units/ml. Time points were taken 5 and 10 min after polymerase addition, and the initial rate of 3H incorporation determined. B, replot of values from 30 to 75 "C in an Arrhenius format.

Characterization of a 3' 4 5' Exonuclease Actiuity-Incu- bation of large amounts of the purified Tli DNA polymerase in the absence of dNTPs with DNA restriction fragments led to degradation of the fragments, indicating the existence of a n exonuclease activity in the preparation. The existence of the exonuclease was quantified by assaying 3H release from a uniformly labeled substrate. Polymerase isolated from the native organism and from the recombinant showed an identical ratio of polymerization to exonuclease activity, strongly suggesting that the activity is inherent in the polymerase and that the recombinant enzyme faithfully mirrors the native enzyme (Table IV). As would be expected of a 3' + 5' exonuclease, DNA digestion by Tli DNA polymerase was inhibited by the addition of dNTPs, with a 50% reduction occurring at about 1 ~ L M dNTP (Fig. 4). Reduction in the assay temperature from 75 to 37 "C resulted in about a 3-fold reduction in exonuclease activity, in contrast to the 20-fold decrease in polymerase activity noted over the same temper-

f 1-"J 11-1 I

0 2 4 6 8 " 6 6 200 ,.

WTPI. UM

FIG. 4. Inhibition of exonuclease activity by dNTPs. Reac- tions were performed at 72 "C in mixtures containing reaction buffer, Tli DNA polymerase at 10 units/ml, 15 rg/ml HaeIII digested uniformly 3H-labeled A DNA (see "Materials and Methods"), and indicated concentrations of an equimolar mixture of the four dNTPs. Reactions were incubated for 90 min at 72 "C and acid-soluble radioactivity determined. The results of two independent experiments are plotted.

0 20 40 60 80 100 percent l3 H] released

FIG. 5. Directionality of Tli DNA polymerase exonuclease. Exonuclease reactions contained 14 pg/rnl dual-labeled linearized pBR322, Tli polymerase reaction buffer, and 1 unit of the indicated DNA polymerases. Incubation was at 72 "C for Tli (0) and Taq (A) DNA polymerases and 37 "C for DNA polymerase I (0). Aliquots were withdrawn over a 2-h time course and acid-soluble radioactivity determined.

ature interval (data not shown). As a further verification of the exonuclease directionality,

Tli DNA polymerase was incubated with adenovirus-2 DNA, which is resistant to 5' + 3' exonuclease digestion due to the covalent attachment of a 55-kDa protein to the 5' termini. Following phenol extraction and ethanol precipitation, the treated adenovirus genome was fragmented by cleavage with HpaI endonuclease and analyzed by gel electrophoresis. The terminal HpaI fragments were preferentially degraded by Tli and T4 DNA polymerases and by exonuclease 111, all of which display 3' + 5' exonuclease activity. No digestion of these fragments was observed upon incubation with Taq DNA polymerase, consistent with the absence of 3' -+ 5' exonuclease activity in that enzyme (data not shown; Tindall and Kunkel, 1988).

To further confirm the directionality of the exonuclease, we prepared a linear DNA substrate with 5'-32P- and 3'-3H- terminal labels (Adler and Modrich, 1979) and monitored the solubilization of the two labels during incubation with Tli and Taq DNA polymerases and DNA polymerase I. Tli DNA polymerase preferentially degraded the 3'-3H termini of this substrate, evidenced in the ratio of 3H/32P solubilized (Fig. 5 ) . 32P label was eventually released as the entire substrate was solubilized. In contrast, Taq polymerase preferentially solubilized the 5'-32P-end label, as would be expected due to its 5' -+ 3' exonuclease activity (Tindall and Kunkel, 1988). DNA polymerase I showed degradation of both 5 ' - and 3'- end labels, resulting from the combined 5' -+ 3' and 3' -+ 5' activities present in this enzyme (Kornberg, 1980).

Characterization of a Single Strand-dependent Exonuclease Actiuity-The preceding experiments characterized the dou-


ble strand-dependent exonuclease activity. To explore single strand-dependent exonuclease activity we visualized the degradation of a 5'-"P-labeled single stranded oligonucleotide using PAGE. At high enzyme to oligonucleotide ratios a significant degradation occurred that was independent of added dNTPs (0.2 mM; Fig. 6). A somewhat stable reaction intermediate of about 12-16 nucleotides was observed, possi- bly corresponding to the length of DNA needed by the polymerase for substrate binding. The same size intermediate was also observed with 24- and 60-nucleotide oligomers of differ- en t sequence and thus appears to be a characteristic of the polymerase rather than of the DNA sequence (data not shown). Based on the band intensities, the relative amount of single strand exonuclease to polymerase activity was slightly less than that found in the Klenow fragment of DNA polymerase I and much less than that seen with T4 or T7 DNA polymerases. As observed with double strand-dependent activity, varying the temperature between 25 and 72 "C affected activity a t most %fold (Fig. 6).

Creation of an Exo- Tl i DNA Polymerase Variant-Se- quence similarities between the Tli DNA polymerase and other known polymerases (Blanco et al., 1991; Perler et al., 1992) suggested that the exonuclease activity could be abolished by specific mutations in the putative metal binding domain. Accordingly, a double mutation, D141A and E143A, was created using oligonucleotide-directed mutagenesis. Anal- ogous mutations in E. coli DNA polymerase I (Derbyshire et al., 1988), Saccharomyces cereuisiae DNA polymerase I1 (Mor- rison et al., 1991), and 029 (Bernad et al., 1990) and T7 (Pate1 et al., 1991) DNA polymerases led to loss of all detectable 3' + 5 ' exonuclease activity. This was also the case with the Tli DNA polymerase double mutant (Table IV), confirming the identity of the exonuclease domain. Despite the loss of exonuclease activity, the specific activity for polymerization and kinetic affinity parameters were comparable with those of the unmutated enzyme (Tables IV and V).

We also compared the behavior of the wild type and exo-

- dNTP +dNTP

25" 37" 72" 25" 37" 72" Time (m)-o -- 1 3 1030 1 3 1030 1 3 1030

"-

24 nt-

15 nt-

FIG. 6. Single strand-dependent single strand exonuclease activity. Reactions contained Tli polymerase buffer and 12.5 nM ""P-end-labeled 1224 primer DNA. Reactions marked +dNTP were supplemented with 0.2 mM of an equimolar mixture of dNTPs. Reactions were initiated at the indicated temperatures by addition of recombinant Tli DNA polymerase to a final concentration of 30 units/ml. At indicated times aliquots were withdrawn and added to EDTA/formamide a t 0 "C. The reaction products were separated by 6% denaturing PAGE and detected by autoradiography.

nuclease-deficient polymerases on truncated templates to test for addition of nontemplated 3' nucleotides, as has been noted with Taq DNA polymerase (Clark, 1988) and Klenow (Clark et al., 1987). A double-stranded pUC19 template was cut with SphI endonuclease, and a 5'-end-labeled primer (1233, Table I) was annealed 35 nucleotides from the 3' terminus. After the extension reaction, products were analyzed using denaturing PAGE (Fig. 7). With the unmutated Tli DNA polymerase, greater than 90% of the reaction products corresponded to full-length templated addition, with the remainder corresponding to products one nucleotide short of full length. As would be predicted from these results, termini created by synthesis or repair of cohesive ends using Tli DNA polymerase were substrates for blunt-end ligation (Garrity and Wold, 1992; data not shown), confirming the absence of the extra 3' nucleotide.

In contrast, the exonuclease-deficient mutant produced an additional product corresponding to extension beyond the template by one nucleotide (Fig. 7). This (nucleotide + 1) product was approximately 30% of the total extension product and would not be expected to efficiently ligate to blunt-ended termini.

Strand Displacement by Tli D N A Polymerase Is Dependent on Temperature-While monitoring incorporation of dNTPs into a primed single-stranded M13mp18 template, we noted that the rate of polymerization decreased, but did not cease, when the equivalent of one round of replication had occurred. We therefore examined the properties of the polymerase in a gap-filling assay, specifically designed to ask whether the enzyme was capable of strand displacement. Synthesis from a 5"end-labeled primer (1224, Table I ) annealed to an M13mp18 single-stranded DNA was monitored in the presence of a blocking oligonucleotide which annealed 79 nucleotides downstream of the first primer (Primer ii, Table I). Under this regimen, synthesis from both primers occurred simultaneously, and the fate of the upstream extension upon encountering the downstream oligonucleotide was assessed (Davey and Faust, 1990). Examples of enzymes which either do not (T4 DNA polymerase) or do (Klenow) perform strand displacement served as controls in the reaction (Davey and Faust, 1990). As expected a t 37 "C, the T4 DNA polymerase synthesis tract stopped upon reaching the 5' boundary of the downstream oligonucleotide. In the absence of the downstream primer, product accumulated that corresponded to full-

A T G C 3 ' 7 ' 3 ' 7 ' exo+ exo-

- N+l "N - N-I

FIG. 7 . T l i DNA polymerase produces blunt DNA termini. The behavior of the polymerase when encountering DNA termini was evaluated by priming synthesis on a linear double-stranded pUC19 template with a :'>P-end-labeled 1224 primer (Table I). 0.8 nM template was mixed with 12 nM primer in Tli polymerase assay buffer, heated to 93 "C for 3 min, then incubated at 37 "C for 10 min. An equal volume of 0.4 mM dNTPs, 0.2 mg/ml bovine serum albumin, and 1.4 nM Tli DNA polymerase in Tli DNA polymerase buffer was added, and the reaction was incubated at 72 "C. At 3 and 7 min following polymerase addition, 10-rl aliquots were removed and added to 7 p1 of a formamide stop solution. These samples were subsequently separated by 6 M urea, 6% PAGE using dideoxy sequencing ladders in adjacent lanes. Reaction products were visualized by autoradiography. Numbers above the lanes indicate the duration of the reaction.


length synthesis of the M13mp18 circle. In contrast to T4 DNA polymerase, Klenow produced a disperse series of bands centered about 200 nucleotides past the downstream primer (data not shown).

At 50 or 55 "C Tli DNA polymerase synthesis halted upon reaching the downstream primer, indicating a lack of strand displacement activity (Fig. 8). The additional bands noted may be due to thermal fraying of the termini at these elevated temperatures. When an alternate downstream primer which left a 125-bp gap was used in the same assay (1202, Table I) polymerization again halted near the 5' border of the downstream primer, indicating that the halt in polymerization was due to the primer and not to elements of DNA structure (data not shown).

At higher temperatures (63 and 72 "C) polymerization products extended beyond the blocking primer but still stopped short of full-length extension, centering on extensions of approximately 150 and 250 nucleotides, respectively (Fig. 8). Parallel reactions in which the downstream blocking primer was 5'-"P-end-labeled showed extension of this primer without loss of label, confirming that strand displacement and not degradation had occurred. The blocks to replication depended on the presence of the downstream primer, since similar blocks did not occur in the absence of this primer (Fig. 8).

The exonuclease-deficient variant showed greater strand displacement activity a t all temperatures tested; even a t 55 "C,

exonuclease+ exonuclease- 55" 63' 72' "- 5 V 63" 72'

Time (min) ==~x 5r0 5% FA T o c s 5 z 51015 510 ?, + - + - + - "-

Primer + - + -

7250 nt-

250 nt-

150 nt-

79 nt-

ry

i 1

FIG. 8. Strand displacement activity is dependent on temperature. M13mp18 single-stranded DNA (24 nM) was annealed in Tli reaction buffer with 12 nM "'P-end-labeled 1224 primer in the presence or absence of 640 nM of the downstream primer (Table I) by heating to 93 "C for 3 min, followed by incubation a t 37 "C for 10 min. Polymerization was initiated by adding 3 volumes of Tli reaction buffer, Tli DNA polymerase, and dNTPs, yielding a final concentration of 0.2 mM dNTPs and 58 units/ml polymerase. Reactions were incubated a t 55,63, or 72 "C, as indicated, and aliquots withdrawn at 5, 10, and 15 min for analysis on denaturing polyacrylamide gels. f indicates the presence/absence of the downstream primer. Use of the recombinant polymerase (exonuclease') or exonuclease-deficient mutant polymerase (exonuclease-) is also indicated. The central lanes display the dideoxy sequencing pattern from the same 1224 primer. Numbers to the left indicate the number of nucleotides added to the primer.

strand displacement could be observed (Fig. 8). A similar increase in strand displacement activity has also been noted on inactivation of the exonuclease domain of T7 DNA polymerase (Tabor and Richardson, 1989).

Kinetic Determinations-Steady state kinetic parameters were determined for the various forms of the polymerase. As a basis for comparison with similar enzymes, the same eval- uations were made for the thermostable Taq polymerase. Since the enzymes utilize two substrates, pseudo-first-order conditions were created by determining constants for one substrate in the presence of an excess of the second substrate. The three forms of the Tli DNA polymerase gave comparable W,PP values for both DNA and dNTP substrates (Table V). Although these determinations used an M13mp18 primed substrate, measurements on an activated calf thymus DNA template using the enzyme isolated from T. litoralis gave comparable kinetic values (data not shown). Parallel experiments utilizing Taq DNA polymerase yielded kinetic values consistent with those reported in preliminary form elsewhere (Table V; Innis et al., 1988 Abramson et al., 1990).

The major limitation in these studies is an accurate meas- urement of polymerase concentration, subsequently limiting the validity of turnover number interpolations. Although extension rates derived from kinetic determinations were consistent for dNTP and DNA substrates, the values were 3-4- fold lower than those derived in independent assays. To circumvent these limitations, extension rates were determined using saturating enzyme concentrations on M13mp18 and T7 DNA templates. One complete round of synthesis on primed single-stranded M13mp18 DNA template (7226 nucleotides) required 5-10 min, corresponding to an extension rate of about 1000 nucleotides/min. The rate of primer extension on a primed double-stranded template was evaluated using a T7 DNA template terminated at discrete loci by restriction endonuclease cleavage (Fig. 9). Timed appearance of appropriate products was again consistent with an extension rate of about 1000 nucleotides/min. The appearance of 10,000-nt products also indicated that this extension rate could be maintained over extended distances.

Processiuity-Processivity measurements on a variety of enzymes have revealed vast differences in the average number of nucleotides added by polymerases during a single binding event. In order to directly quantify the processivity of Tli DNA polymerase we adopted protocols which compare the levels of polymerization in the presence of a full or partial complement of nucleotides (Bambara et al., 1978). During a single binding event, steps leading to the incorporation of the first nucleotide are generally slow compared with subsequent nucleotide addition. Accordingly, leaving out one or more nucleotides radically slows incorporation by a processive enzyme because reinitiation must occur more frequently. In contrast, a distributive enzyme will show little perturbation, since dissociation and reinitiation is already a frequent event.

To avoid artifacts due to sequence dependence of processivity, we used random primers for the synthesis reaction. We also measured the processivity of Tuq DNA polymerase and DNA polymerase I, deriving numbers of 40 and 97 nucleotides/initiation event, respectively, which agree well with previously reported values (Abramson et al., 1990; Bambara et al., 1978). Tli DNA polymerase has a relatively low level of processivity, about 7 nucleotides/initiation event. Unlike T7 DNA polymerase (Tabor and Richardson, 1989), this degree of processivity was not affected by inactivation of the exonuclease domain (Table V).

Biochemical Properties of Tl i DNA Polymerase 1973

TABLE V Comparison of kinetic parameters DNA polymerases

k indicates 95% confidence intervals. Values separated by commas indicate individual determinations. Numbers in parentheses indicate the number of independent trials.

Polymerase DNA" dNTPb Processivity,

residues Averaee Ranae Averaee Ranee

nM

Tli DNA polymerase: Native 0.07 k 0.04 (3) Recombinant 0.12 k 0.08 (4) Exonuclease- 0.09 t 0.04 (4)

Taq DNA polymerase 1.4 1.0, 1.8 (2) DNA polymerase I' 5 Klenowd T 4 DNA polymerase' T 7 DNA polymerase' 18

Moles of template, in the presence of an excess of annealed primer. Moles of each nucleotide in an equimolar mixture of the four nucleotides. McClure and Jovin (1975). Bambara et al. (1978).

41 57

t 27 (3) 7 t 3 (13)

39 k 30 (3) ? 13 (3) 5, 9 (2)

16 14, 17 (2) 42 ? 30 (7) 1-2 50

2.3 12 2 12

18 >loo0

. , Polesky et al. (1990); Kornberg (1982).

'Gillin and Nossal (1975), Kornberg (1982). f Pate1 et al. (1991), Tabor et al. (1987).

DISCUSSION

One of the initial goals of these studies was to compare the behavior of Tli DNA polymerase produced in T . litoralis and in E. coli. We questioned whether the folding and processing required to produce this hyperthermophilic archaeal protein would occur a t physiological temperatures in eubacteria, par- ticularly since at least two processing events occur in the native organism (Perler et al., 1992). Recombinant enzymes produced in E. coli from constructs lacking IVSl and either containing or lacking IVS2 had physical and kinetic properties comparable to those of the enzyme isolated from T. litoralis. Thus, IVSl and IVS2 junctions appear to have been correctly predicted and IVS2 can be correctly removed i n vivo from E. coli recombinants. Additionally, any post-translational modi- fications required for activity are carried out in E. coli.

Production of the mature polymerase in E. coli was accom- panied by the appearance of a number of smaller polymerase- related peptides, presumably due to proteolysis or premature transcription or translation termination (Fig. 1B). The protease sensitivity may arise from incorrect or slowed folding of the protein or may reflect proteases present in E. coli but not in T. litoralis. The abundance of rare E. coli codons in the polymerase coding sequence* may also disrupt translation, leading to premat.ure termination. This population of smaller polymerase products may also account for the biphasic thermal stability of the partially purified recombinant polymerase, e.g. truncated or nicked versions of the peptide may retain polymerase activity, but be less heat-stable.

A number of thermophilic DNA polymerases have been isolated previously and characterized from both mesophilic and archaea sources. Those that have been analyzed are monomeric in solution with molecular masses of 80-115 kDa (Klimczak et al., 1986; Rossi et al., 1986; Elie et al., 1989; Lawyer et al., 1989). As expected, these enzymes have elevated temperature optima and have thermal stabilities that roughly correspond to the thermal extremes of the environment from which they were isolated. Despite the fact that thermal stabilities of the native proteins vary among the enzymes, an optimal temperature for polymerization of 70-80 "C is com- mon. As has been pointed out by others, this suggests that template stability rather than intrinsic enzyme stability de-

' F. Perler, unpublished observations.

termines the optimal temperature for polymerization (Rossi et al., 1986; Elie et al., 1989).

Taq DNA polymerase is the best characterized of the thermophilic polymerases and in several aspects resembles the Tli DNA polymerase. Both are characterized by relatively high K, values for dNTPs and display limited processivity. Taq DNA polymerase has an extension rate similar to that of Tli DNA polymerase (4000 nucle~tides/min).~ The persistence of high extension rates for both enzymes in the absence of extensive processivity attests to the ability of these enzymes to efficiently cycle between polymerization tracts, presumably enhanced by the increased thermal energy available for entry into an activated transition state. In contrast, the two enzymes have significantly different thermal stabilities, K, values for DNA and associated exonuclease activities. In fact, the Tli DNA polymerase K,,, for DNA is the lowest we have been able to find in the literature and should give the polymerase an enhanced ability to efficiently replicate extremely low concentrations of DNA template. The low K,,, for DNA does not appear to be a general property of thermostable polymerases since the Taq DNA polymerase K, is in the same range as that observed for E. coli DNA polymerase I (Table V) nor does the low K, seem to be characteristic for archaea thermophiles, since the polymerase from Pyrococcus furiosus (Pfu DNA polymerase; Lundberg et al., 1991) has a K, in the same range as Taq DNA polymerase, and that from Pyrococ- cus species (Deep Vent DNA polymerase; New England Bio- labs) has a K, even lower than that for Tli DNA p~lymerase .~ The low K, does not appear to be a critical parameter in determining processivity, since DNA polymerase I has similar processivity values and yet has a K, in the nM range.

Previous mutational studies on DNA polymerases from a variety of sources have identified an amino acid motif associated with exonuclease activity. Analogous mutations in the Tli DNA polymerase abolished detectable exonuclease activity. Other polymerization functions appear to be unaltered by these mutations as measured by the specific activity and K,,, values (Tables IV and V). Thus, exonuclease and polymerase domains can act independently, as shown previously for DNA polymerase I (Derbyshire et al., 1988). This independence is

H. M. Kong, R. B. Kucera, and W. E. Jack, unpublished observations.


Temolate;

30,447 bp

19,871 bp 16.044 bp

10,219 bp

5,825 bp

3,999 bp

1,877 bp

Product:

-15,693 nt

- 9.868 nt

- 5,474 nt

- 3,648 nt

- 1.526 nt

FIG. 9. Tli DNA polymerase extends a primer over 10,000 bases on a T7 DNA template. Polymerization was primed with a 5'-"'P-labeled oligonucleotide which annealed 351 nucleotides from the right end of the T7 genome (positions 39,606-39,585). T7 DNA was fragmented with restriction endonucleases to give run-off polymerization products of 1877 bp (PmlI), 3999 bp (SfiI) , 5825 bp (ApaLI), 10,219 bp (NcoI), 16,044 bp (BssHI), 19,871 bp (BstEII), and 30,447 h p (MluI). An equimolar mixture of restriction fragments (final concentration 0.4 nM of each fragment) was mixed with 3 nM oligonucleotide and Tli DNA polymerase reaction buffer containing 0.2 mM dNTP. This mixture was heated at 96 "C for 3 min, 37 "C for 15 min, and 72 "C for 1 min. An initial sample was taken and added to an equal volume of 0.01% SDS, 0.05 M EDTA, mixed, and kept on ice until all samples were collected. The reaction was initiated by adding Tli DNA polymerase to a final concentration of 44 units/ml and then incubated at 72 "C. Aliquots were sampled as described above as a function of time. Reaction products were identified by agarose gel electrophoresis followed by autoradiography of the dried gel. Numbers to the left of the autoradiograph indicate the mobility of the oligonucleotide annealed to the DNA fragment prior to polymerization. Numbers to the right of the autoradiograph indicate the length of the synthesized tract after polymerase extension. The disperse intermediate extension products cannot be visualized, since they are distributed throughout the gel.

also seen in different temperature profiles for polymerase and exonuclease activities, a property noted previously for DNA polymerases isolated from the thermophilic archaea Ther- moplasma acidophilum (Hamal et al., 1990) and Methanobac- terium thermoautotrophicum (Klimczak et al., 1986). Notwith- standing the independence of the domains, during normal polymerization reactions exonuclease action is minimized (Fig. 4) and acts to enhance the fidelity of replication rather than to destroy the template (Kornberg, 1980). In fact, the error rate of the exonuclease deficient Tli DNA polymerase is 5-fold higher than that of the native enzyme (Mattila et al., 1991). However, not all archaea polymerases possess 3' + 5' exonuclease function (Rossi et al., 1986; Elie et al., 1989; Salhi et al., 1989).

Al'hough recombinant polymerases containing or lacking exonuclease have comparable kinetic values, they display different activities on a primed single-stranded M13mp18 uersus a denatured calf thymus DNA template (Table IV). The ratio of activities were similar for the enzyme from T. litoralis and the unmutated recombinant. In contrast, the exonuclease-deficient mutant had a higher relative activity on the denatured calf thymus DNA template. This difference may be related to the greater strand displacement activity of

the exonuclease-deficient form of the enzyme. Strand displacement reactions showed several discrete

blocks to polymerization, especially with the unmutated enzyme. The fact that synthesis is unimpeded on templates lacking the downstream primer (Fig. 8, lanes marked -) makes it unlikely that cruciforms or hairpin loops serve as synthesis blocks. These discrete bands may reflect preferred sites of template switching, allowing the polymerase to switch from copying the M13mp18 template to copying the extended downstream primer. Analogous duplexes between the 3'-end of the strand synthesized from the upstream primer and the 5'-end of the strand originating with the downstream oligonucleotide could also be formed a t inverted repeats during thermal fraying of the termini. It may also be relevant to note that replication pauses have been seen without identifiable secondary structure with other enzymes (Simon Kaguni and Clayton, 1982; Weaver and DePamphillis, 1982).

I t is not clear whether the relatively low processivity of Tli DNA polymerase reflects the behavior of the enzyme in vivo or whether it reflects the difficulties of reproducing biological conditions in uitro. For example, if Tli DNA polymerase functions as a repair enzyme similar to DNA polymerase I, there may be no requirement for extensive processivity. Al- ternatively, additional cellular components may be required to increase processivity, as has been seen with DNA polymerase I11 from E. coli (Fay et al., 1981). Indeed, additional cellular structures must be involved in some aspect of replication, since we observe no polymerization in vitro at the extremes of T. litoralis growth temperatures (98 "C). The lack of processivity does not seem to be a major impediment in the use of the enzyme. Indeed, our in vitro experiments with a T 7 template demonstrate that extended synthesis tracts can be formed in the absence of high processivity. This extended replication may be assisted by the reduction of inhibitory DNA secondary structure at high temperatures, a characteristic also noted in uniform dideoxy sequencing patterns using the enzyme (Sears et al., 1992).

Acknowledgments-We gratefully acknowledge the contributions of a large number of New England Biolabs personnel. In particular, we thank Kay Hempstead for purification of the modified (exonuclease-deficient) form of Tli DNA polymerase and Julie Forney and Paul Riggs for assistance in construction of overproducing strains. Addi- tionally, the constructive criticisms of Don Comb, Ira Schildkraut, Elisabeth Raleigh, Chris Noren, Robert Hodges, Fran Perler, Barton Slatko, and Julie Forney are acknowledged in preparation of this manuscript.

REFERENCES Abramson, R. D., Stoffel, S., and Gelfand, D. H. (1990) FASEB J. 4, A2293 Adler, S., and Modrich, P. (1979) J. Biol. Chem. 254,11605-11614 Aposhian, H. V., and Kornberg, A. (1962) J. Biol. Chem. 237,519-525 Bambara, R. A., Uyemura, D., and Choi, T. (1978) J. Bid. Chem. 253, 413-

Belkin, S., and Jannasch, H. W. (1985) Arch. Microbiol. 141, 181-186 Bernad, A., Lazaro, J. M., Salas, M., and Blanco, L. (1990) Proc. Natl. Acad.

Blanco, L., Bernad, A., Blasco, M. A., and Salas, M. (1991) Gene (Amst.) 100,

423

Sci. U. S. A. 87,4610-4614

37-?A BridGid, M. M. (1976) Anal. Biochem. 72,248-254 Chien, A., Edgar, D. B., and Trela, J. M. (1976) J. Bacteriol. 127, 1550-1557 Clark, J. M. (1988) Nucleic Acids Res. 16,9677-9686 CI?!\, J. M., Joyce, C. M., and Beardsley, G. P. (1987) J. Mol. Biol. 198, 123-

Davey, S. K., and Faust, E. A. (1990) J. Biol. Chem. 265,4098-4104 Davis, R. P. (1961) The Enzymes (Boyer, P. D., Lardy, H., and Myrback, K.,

Derbyshire, V., Freemont, P. S., Sanderson, M. R., Beese, L., Friedman, J. M.,

Elie, C., de Recondo, A. M., and Forterre, P. (1989) Eur. J. Blochem. 178,619-

Fay, P. J., Johanson, K. O., McHenry, C. S., and Bambara, R. A. (1981) J. Biol.

Garrity, P. A., and Wold, B. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,1021-

Gillin, F. D., and Nossal, N. G. (1975) Biochem. Biophys. Res. Commun. 64,

Hager, D. A,, and Burgess, R. R. (1980) Anal. Biochem. 109,76-86

1z I

eds) 2nd Ed., Vol. 5, Academic Press, Inc., New York

Joyce, C. M., and Steitz, T. A. (1988) Science 240, 199-201

626

Chem. 256,976-983

1025

467-464

Biochemical Properties of Tli DNA Polymerase 1975 Hamal, A,, Forterre, P., and Elie, C. (1990) Eur. J. Biochem. 190,517-521 Hewlett-Packard Comnanv (1984) HP-llC Owner's Handbook and Problem ~~~ ~~~~

Solving Guide, pp. 1$4-<58' ~ ~ '

Natl. Acad. Sci. U. S. A. 85,9436-9440 Innis, M. A,, Myambo, K. B., Gelfand, D. H., and Brow, M. A. D. (1988) Proc.

Klimczak, L. J., Grummt, F., and Burger, K. J. (1986) Biochemistry 25,4850-

Kornberg, A. (1980) DNA Replication, pp. 1-4 and 101-166, W. H. Freeman

Kornberg, A. (1982) 1982 Supplement to DNA Replication, W. H. Freeman and

Kunkel, T. A,, Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154 ,

Lawyer, F. C., Stoffel, S., Saiki, R. K., Myambo, K., Drummond, R., and

Lundberg, K. S., Shoemaker, D. D., Adams, M. W. W., Short, J. M., Sorge, J.

Matson, S. W., Fay, P. J., and Bambara, R. A. (1980) Bioehemistry 19, 2089-

Mattila, P., Korpela, J., Tenkanen, T., and Pitkanen, K. (1991) Nueleie Acids

McClure, W. R., and Jovin, T. M. (1975) J. Biol. Chem. 250,4073-4080 Morrison, A,, Bell, J. B., Kunkel, T. A,, and Sugino, A. (1991) Proc. Natl. Acad.

Patel, S. S., Wong, I., and Johnson, K. A. (1991) Biochemistry 30,511-525 Peacock, A. C., and Dingman, C. W. (1968) Biochemistry 7,668-674 Perler, F. B., Comb, D. G., Jack, W. E., Moran, L. S., Qiang, B.-Q., Kucera, R.

B., Benner, J., Slatko, B. E., Nwankwo, D. O., Hempstead, S. K., Carlow, C.

4855

and Company, San Francisco

Company, San Francisco

367-382

Gelfand, D. H. (1989) J. Biol. Chem. 264,6427-6437

A., and Mathur, E. J. (1991) Gene ( A m t . ) 1 0 8 , l - 6

2096

Res. 19,4967-4973

Sci. U. S. A. 88,9473-9477

Polesky, A. H., Steitz, T. A., Grindley, N. D. F., and Joyce, C. M. (1990) J . K. S., and Jannasch, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,5577-5581

Rossi, M., Rella, R., Pensa, M., Bartolucci, S., de Rosa, M., Gambacorta, A., Biol. Chern. 265,14579-14591

Raia, C. A,, and Dell'Aversano Orabona, N. (1986) System. Appl. Microbiol. 7. 337-341

Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higucbi, R., Horn, G. T.,

Salhi, S., Elie, C., Forterre, P., de Recondo, A,"., and Rossignol, J:M. (1989) Mullis, K. B., and Erlich, H. A. (1988) Science 2 3 9 , 487-491

Sambrook, J., Fritscb, E. F., and Maniatis, T. (1989) Molecular Cloning: A J . Mol. Biol. 2 0 9 , 635-644

Laboratory Manual, Second Ed., Cold Spring Harbor Laboratory, Cold Spring Hnrhor. NY

-, ~~~

~. - Schreier, P. H., and Cortese, R. (1979) J. Mol. Biol. 129,169-172 Sears, L. E., Moran, L. S., Kissinger, C., Creasey,T., Perry-OKeefe, H., Roskey,

M., Sutberland, E., and Slatko, B. E. (1992) BioTechniques 13,626-633 Simon Kaguni, L., and Clayton, D. A. (1982) Proe. Natt. Acad. Sci. U. S. A. 7 9 ,

983-987 Simons, R. W., Houman, F., and Kleckner, N. (1987) Gene (Amst.) 53,85-96 Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990)

Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 8 4 ,

Tabor, S., and Richardson, C . C. (1989) J. Bid. Chem. 264,6447-6458 Tabor, S., Huber, H. E., and Richardson, C. C. (1987) J. BWl. Chem. 262 ,

Tindall, K. R., and Kunkel, T. A. (1988) Biochemistry 27,6008-6013 Weaver, D. T., and DePamphiIis, M. L. (1982) J. Biol. Chem. 257,2075-2086 Wilkmson, G. N. (1961) Blochem. J. 80,324-332

Methods Enzymoi. 185,60-89

4767-4771

16212~-16223

THE JOURNAL OF BIOLOGICAL CHEMlSTRY Issue … JOURNAL OF BIOLOGICAL CHEMlSTRY 0 1993 by The American...

Documents

Transcript of THE JOURNAL OF BIOLOGICAL CHEMlSTRY Issue … JOURNAL OF BIOLOGICAL CHEMlSTRY 0 1993 by The American...