526

http://journals.tubitak.gov.tr/biology/

Turkish Journal of Biology Turk J Biol(2017) 41: 526-534© TÜBİTAKdoi:10.3906/biy-1610-6

The jasmonate-ZIM domain protein FtJAZ2 interacts with the R2R3-MYBtranscription factor FtMYB3 to affect anthocyanin biosynthesis in tartary buckwheat

Xiao-Peng LUO *, Shuang-Jiang LI*, Pan-Feng YAO, Cheng-Lei LI, Hui CHEN, Qi WU, Hai-Xia ZHAO**College of Life Science, Sichuan Agricultural University, Ya’an, P.R. China

1. IntroductionActing as an important secondary metabolite, plant flavonoids are involved in a wide variety of biological functions. For example, flavonoids are responsible for the color of flower petals and fruit to attract insects and animals that will spread the plant’s pollen and seeds. Flavonoids also play a vital role in protecting plants from stress and help prevent damage from UV-B radiation and microbial diseases (Ishige et al., 2001; Reay and Lancaster, 2001; Koes et al., 2005). In other words, exposure to stressful conditions can stimulate the accumulation of flavonoids in order to stabilize the plant’s physiology (Chalker-Scott, 1999; Gould et al., 2006; Treutter, 2006). The biosynthesis of flavonoids can be induced by abiotic stressors and treatment with hormones; plants regulate the accumulation of flavonoids through transcription factors that modulate the expression of genes in the flavonoid-biosynthesis pathway (Winkel-Shirley, 2002; Loreti et al., 2008; Qi et al., 2011; Song et al., 2011; Sun et al., 2012; Afrin et al., 2015). Jasmonate (JA), an important stress hormone,

was reported to participate in the flavonoid biosynthesis pathway (Franceschi and Grimes, 1991; Loreti et al., 2008). Jasmonate-ZIM-domain (JAZ) proteins are important repressors of the JA signaling pathway, which mediates various JA-regulated secondary metabolic processes, including the biosynthesis of flavonoids via an interaction with various transcription factors (Thines et al., 2007; Shoji et al., 2008; Kazan and Manners, 2012). For example, JAZ could interact with MYB21, MYB24, and MYC2 to mediate JA response in Arabidopsis (Fernández-Calvo et al., 2011; Song et al., 2011). Research has shown that cold stress can induce an accumulation of endogenous JA (Pedranzani et al., 2007), while the JA signaling pathway was proven to play a role in flavonoid biosynthesis (Loreti et al., 2008; Horbowicz et al., 2009; An et al., 2015; Gumerova et al., 2015). Together, these molecules help plants adapt to stress.

Tartary buckwheat (Fagopyrum tataricum Gaertn.) is a type of minor cereal with dense flavonoid content and is mainly cultivated in cold mountainous areas such

Abstract: Tartary buckwheat is a type of coarse cereal that contains a rich supply of flavonoids. When suffering from certain stresses, tartary buckwheat can respond by promoting the biosynthesis of anthocyanins. It is well established that the jasmonate (JA) signaling pathway plays a critical role in plant resistance to disease by stimulating the production of anthocyanins; furthermore, the genes encoding the jasmonate-ZIM domain (JAZ) proteins have been shown to be key players in this process. However, the role of JAZ proteins in tartary buckwheat is poorly understood. In this study, we aimed to isolate FtJAZs from tartary buckwheat and identify FtJAZs that are involved in anthocyanin biosynthesis under cold-stress conditions based on an interaction with the known FtMYBs. We identified three novel FtJAZ genes in tartary buckwheat. According to a phylogenetic analysis, FtJAZ1 was organized into cluster I, while FtJAZ2 and FtJAZ3 were organized into cluster II. Interestingly, a yeast two-hybrid assay showed that FtMYB3 interacted only with FtJAZ2. Furthermore, our qRT-PCR results suggested that FtJAZ2, dihydroflavonol-4-reductase, and anthocyanin synthase had similar expression patterns, which is consistent with the accumulation of anthocyanins. Conversely, the expression of FtMYB3 showed an opposite trend, being negatively correlated with the anthocyanin level. In conclusion, by interacting with FtMYB3, FtJAZ2 plays a role in anthocyanin biosynthesis under cold stress.

Key words: Tartary buckwheat, jasmonate-ZIM domain proteins (FtJAZ2), yeast two-hybrid, anthocyanin biosynthesis

Received: 03.10.2016 Accepted/Published Online: 17.01.2017 Final Version: 14.06.2017

Research Article

* These authors contributed equally to this work. ** Correspondence: zhaohaixia197708@163.com

LUO et al. / Turk J Biol

527

as southwestern China, the Himalayan hills, India, and Nepal (Tsuji and Ohnishi, 2001; Fabjan et al., 2003). Moreover, tartary buckwheat is characterized by a strong resistance to cold, drought, and other inhospitable conditions. Previous studies have shown that cold treatment can induce accumulation of flavonoids, especially anthocyanins, in tartary buckwheat (Crifò et al., 2011; Zhang et al., 2012; Li et al., 2015). Meanwhile, flavonoid biosynthesis was affected when exogenous MeJA was applied to a suspension of tartary buckwheat. There are few studies regarding flavonoid biosynthesis mediated by the JA signaling pathway in tartary buckwheat. In this study, we aimed to isolate the important JAZ genes in the JA signaling pathway in tartary buckwheat and utilized a yeast two-hybrid system to detect the interaction of FtJAZs with the known FtMYBs that are involved in flavonoid biosynthesis. FtMYB1 and FtMYB2 were identified to promote proanthocyanin biosynthesis (Bai et al., 2014), while FtMYB3 was predicted to function as a negative regulator in anthocyanin biosynthesis (unpublished data). We then further analyzed the accumulation of certain flavonoids, the expression level of transcription factors, and the relative structure of genes in plants exposed to cold stress. Based on this preliminary research, we can speculate on the possible roles of the JA signaling pathway in flavonoid biosynthesis.

2. Materials and methods2.1. Plant materialsTartary buckwheat (Fagopyrum tataricum Gaertn.) cultivar Xiqiao No. 2 was grown in the Sichuan Agricultural University experimental fields, Ya’an, Sichuan, China.

Flowers of tartary buckwheat were collected, and the samples were stored at –80 °C until further use.2.2. RNA extraction and cloning of three FtJAZ genesTotal RNA was isolated from the flowers of tartary buckwheat using an RNAout 2.0 Kit (Tiandz, China) according to the manufacturer’s protocol. The 5’-RACE and 3’-RACE cDNA templates were synthesized using a BD SMART RACE cDNA Amplification Kit (Takara, Japan). Clustal X and DNAman 5.0 were used to analyze the conserved sites according to the JAZ genes from Vitis rupestris (GenBank ID JF900329), Prunus persica (GenBank ID HQ825093), Hevea brasiliensis (GenBank ID GQ369508), and Dianthus caryophyllus (GenBank ID AB517646). A degenerate primer was designed based on the conserved site using Primer Premier 5 and gene-specific primers were utilized to amplify the full-length cDNA of FtJAZ1, FtJAZ2, and FtJAZ3. The primers used to amplify the full-length cDNAs are listed in Table 1.2.3. Bioinformatic analysis of FtJAZ1, FtJAZ2, and FtJAZ3The open reading frame (ORF) of the three FtJAZs was converted to an amino acid sequence using Primer Premier 5.0. Alignment of the amino acid sequences was performed using NCBI Blast-p (http://www.ncbi.nlm.nih.gov/). The online tools provided by ExPASy (http://www.expasy.org/tools/) were applied to analyze the chemical and physical properties of the proteins based on the amino acid sequence. SignalP was used to analyze the signaling peptides of the three FtJAZs and Plant-PLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant/) was used to determine the subcellular location of the three proteins. Multialignment was performed with the amino acid sequences of JAZ

Table 1. Primers used in FtJAZs gene cloning.

Name Sequence (5′-3′) Application

JAZfJAZr3JAZ-13JAZ-23JAZ-3Pmid5JAZ-15JAZ-25JAZ-3UPMJAZ1fJAZ1rJAZ2fJAZ2rJAZ3fJAZ3r

5’- GCCCAGATGACCATCttytaygvngg -3’5’- CTTTCTCTTCTCCAAraahckdkbvardga -3’5’- CTAACGCGAGTGTGTCTGATAAGA-3’5’-AACAATCAACCACGCCAGTCGTCA-3’5’-TCACCGATCTACCAATTGCTAGGAAA-3’5’- GCCTTAATGAACAATCAACCACGCCAGTCG-3’5’-TGACGACTGGCGTGGTTGATTGTTCATTAA-3’5’-TCGCGTTAGTAGTATTGACAACAGGGATGG-3’5’-CTCGAGCTGCAATCTCCATGATCTCCT-3’5’- CTAATACGACTCACTATAGGGC-3’5’- GGCTCTTCGATTGTGTTGGAGAT -3’ GCATCAAATTGAGCAGACAAGAAC -3’5’- TTCGCTTTTCTGTGAGGATTTTGT -3’5’- AAGCCATCTAAAAAAGCCTCCATT-3’5’- GTTTGAAGTTCGGTGAATTGTAGAGA -3’ 5’- CATCAGCACAAACATAATAAATCCAA-3’

Amplify the conserved region of FtJAZFtJAZ 3′RACE 1st roundFtJAZ 3′RACE 2nd roundFtJAZ 3′RACE 3rd round3′RACE universal primerFtJAZ 5′RACE 1st roundFtJAZ 5′RACE 2nd roundFtJAZ 5′RACE 3rd round5′RACE universal primer

Amplify the FtJAZ1

Amplify the FtJAZ2

Amplify the FtJAZ3

LUO et al. / Turk J Biol

528

proteins from other plants using DNAman. A phylogenetic tree was constructed based on the three FtJAZs and JAZ proteins from Arabidopsis using the neighbor-joining method.2.4. The interaction between FtJAZs and FtMYBsThe ORF of the three FtJAZs was cloned into the bait vector pGBKT7 resulting in three GaL4-JAZ fusion proteins, named pGBKT7-FtJAZ1, pGBKT7-FtJAZ2, and pGBKT7-FtJAZ3. Moreover, three FtMYBs were cloned into the prey vector pGADT7, which contains an activation domain for GAL4, resulting in three fusion proteins named pGADT7-FtMYB1, pGADT7-FtMYB2, and pGADT7-FtMYB3. The primers designed to amplify FtJAZs and FtMYBs are listed in Table 2 for vector construction (the restriction enzyme contains NdeI, EcoRI, and BamHI). The recombinant bait vector and prey vector were transformed into yeast Y2HGold competent cells using the LiAc method. The pGBKT7-p53 and pGADT7-T vectors were used as a positive control, while the pGBKT7-lam and pGADT7-T vectors were used as a negative control. Yeast mating was conducted between the FtJAZ and FtMYB strains and the yeast was stationary-cultured at 30 °C for 4 days in SD/-Trp, SD/-Leu, and SD/-Trp/-Leu/X-α-gal media. Blue colonies were selected and transferred to SD/-Ade/-His/-Leu/-Trp/X-α-gal media and stationary-cultured at 30 °C for 4 days. Colonies were then observed for growth and color changes.2.5. Expression levels of anthocyanin-related genes during cold stressAccording to the results of the yeast two-hybrid screen, we further studied the expression of the MYB and JAZ genes that were found to interact and the genes involved in the flavonoid-biosynthesis pathway. Tartary buckwheat seeds were washed and soaked in distilled water at 40 °C for 30 min, and the seeds were then put in trays with filter

paper kept at 25 °C in the dark. The sprouts were nurtured under the following conditions: 16 h of light at 22 ± 2 °C and 8 h of darkness at 18 ± 2 °C, and relative humidity of 60%. Tartary buckwheat sprouts were treated with cold (4 °C) after 12 days of germination, while the cotyledons and hypocotyls were collected at various time points (0 h, 3 h, 6 h, 12 h, 24 h, and 48 h). Quantitative real-time PCR was used to measure the gene expression level of several transcription factors and FtCHI, FtFLS, FtDFR, and FtANS in the cotyledons and hypocotyls. The gene encoding FtH3 was used as a reference gene (Gao et al., 2016) . Real-time PCR was then performed in triplicate on a CFX96 Touch Deep Well Real-Time PCR Detection System (Bio-Rad Laboratories, USA) with a QuantiTect SYBR Green PCR Kit (QIAGEN, Germany). The PCR protocol was performed as follows: denaturation for 3 min at 95 °C, followed by 39 cycles of denaturation for 10 s at 95 °C and annealing for 30 s at 60 °C. Reactions were performed with three biological replicates. The primers used in the quantitative real-time PCR are listed in Table 3.2.6. Anthocyanin level during cold stressFtMYB1 and FtMYB2 have been shown to participate in the biosynthesis of proanthocyanins (Bai et al., 2014) and FtMYB3 was found to be involved in the anthocyanin biosynthesis pathway (unpublished data). Thus, anthocyanins were extracted from the cotyledons and hypocotyls of tartary buckwheat sprouts and measured after cold treatment according to the method described previously (Uimari and Strommer, 1998; Chu et al., 2013). The anthocyanins were extracted from 200 mg of powder overnight in 0.3 mL of acidic methanol [1% (v/v) HCl], and then 0.2 mL of water and an equal volume of chloroform were added. The anthocyanins were extracted from the chlorophyll by separation into the aqueous methanol phase. The anthocyanins were then measured at 530 and

Table 2. Primers used for vector construction.

Name Sequence (5′-3′) Application

JAZ1fJAZ1rJAZ2fJAZ2rJAZ3fJAZ3rMYB1fMYB1rMYB2fMYB2rMYB3fMYB3r

5’- CGCCATATGATGGAGAGAGATTTCCTAGGT-3’ 5’- GCGGGATCCTTAGCTCCTCCTAGCACCATTT-3’5’- CGCCATATGATGGCGAATTTGTCTGTTTCCG-3’5’-GCGGGATCCTCAAGAACGCGGAGCAGCAGC-3’5’- CCGGAATTCATGGCGAATTTGTCTGTTTCCG-3’ 5’-GCGGGATCCTTATTGCACATAGAGCATGTTT-3’5’-CCGGAATTCATGGTGAGAAAACCTTGCTGC-3’5’-GCGGGATCCCAAATCTCCAATCCAACCTCC-3’5’-CCGGAATTCATGGGGAGAAAACCATGCTG-3’5’-GCGGGATCCAACTTGAAGCCAATTTTCGAGC-3’5’-CCGGAATTCATGGGAAGGTCTCCATGCTGTG-3’5’-GCGGGATCCGATTATCGGAAAGAGTCAAGA-3’

Amplify the ORF of FtJAZ1

Amplify the ORF of FtJAZ2

Amplify the ORF of FtJAZ3

Amplify the ORF of FtMYB1

Amplify the ORF of FtMYB2

Amplify the ORF of FtMYB3

The underlined nucleotide are the restriction endonuclease sites.

LUO et al. / Turk J Biol

529

657 nm in a spectrometer (UNICO WFJ2000, China). The anthocyanin level was normalized to the fresh weight. 2.7. Statistical analysisThe 2–ΔΔCT method was used to analyze the quantitative real-time PCR relative gene expression level (Livak and Schmittgen, 2001; Jami et al., 2012). QAnthocyanins = (A530 – 0.25 × A657) × M–1, where QAnthocyanins is the content of anthocyanins, A530 and A657 are the absorptions at the indicated wavelengths, and M is the weight of the plant material used for extraction (g). All samples were measured as triplicates. Error bars represent the standard error of the mean. The correlation between the anthocyanin content and the expression level of transcription factors was analyzed with Pearson double variables using SPSS 20.0. Differences between treatments were evaluated by SPSS 20.0 using Duncan’s multiple comparisons test, and the P-value (0.05 or 0.01) indicated the significant differences between the control and treatment.

3. Results3.1. Molecular characterization of FtJAZ1, FtJAZ2, and FtJAZ3We have obtained the full-length cDNA of three FtJAZs from tartary buckwheat by homology cloning and RACE. The ORF of FtJAZ1, FtJAZ2, and FtJAZ3 contained 813 bp, 669 bp, and 648 bp, respectively. The amino acid sequence of FtJAZ1 shares 41% homology with that of JAZ (AFL46172) from tobacco, FtJAZ2 shares 47% homology with JAZ (BAG68657) from tobacco, and FtJAZ3 shares 48% homology with JAZ (BAG68657) from tobacco. The results showed that we have obtained three FtJAZ genes from tartary buckwheat.

The deduced FtJAZ1, FtJAZ2, and FtJAZ3 proteins had calculated molecular weights of 31.8 kDa, 24.5 kDa, and 23.6 kDa, respectively. Their isoelectric points were at

pH 9.14, 9.42, and 7.01, respectively. The FtJAZ proteins showed different contents of secondary structure as follows: 11.90%, 21.25%, and 25.49% of α-helices; 10.20%, 6.73%, and 5.19% of β-turn; 23.47%, 17.94%, and 21.70% of extended strand; and 54.42%, 53.81%, and 47.17% of random coil, respectively. All three FtJAZs were predicted to be localized to the nucleus and did not have a signaling peptide. A multiple sequence alignment revealed that FtJAZ1, FtJAZ2, and FtJAZ3 all have conserved NT (N-terminal), ZIM (zinc-finger expressed in inflorescence meristem), and Jas (jasmonate) domains, while there are some differences among the three FtJAZs in the C-terminal Jas motif (Figure 1A). Using the neighbor-joining method in MEGA 5.0 software, we established a phylogenetic tree of JAZ proteins (Figure 1B). The phylogenetic tree consisted of clusters I, II, and III. FtJAZ1 belonged to cluster I along with AtJAZ9, AtJAZ3 AtJAZ4, AtJAZ7, AtJAZ8, and AtJAZ10; cluster II included the FtJAZ2 and FtJAZ3 proteins along with AtJAZ2, AtJAZ5, and AtJAZ6 from Arabidopsis; and cluster III contained 3 Arabidopsis JAZ proteins. 3.2. The interaction between FtJAZs and FtMYBsThe FtJAZs proteins were used as bait to screen FtMYBs using a yeast two-hybrid system. First, the toxicity and self-activation of pGBKT7, pGADT7, pGBKT7-FtJAZs, and pGADT7-FtMYBs in yeast cells were determined (Supplementary Figures S1 and S2). The presence of clover-shaped yeast indicated that the yeast had mated successfully (Figure 2A). The growth and color development of Y2HGold [pGBKT7-FtJAZs] mated with Y187 [pGADT7-FtMYBs] on a QDO/X-α-gal petri dish is shown in Figure 2B. No color change was observed in the negative control, while all colonies in the positive control were blue. We observed blue colonies in the cross between Y2HGold [pGBKT7-FtJAZ2] and Y187 [pGADT7-

Table 3. Primers used in real-time PCR.

Name Sequence (5′-3′) Application

FtJAZ2qfFtJAZ2qrFtMYB3qfFtMYB3qrFtCHIqfFtCHIqrFtFLSqfFtFLSqrFtDFRqfFtDFRqrFtANSqfFtANSqrFtH3qfFtH3qr

5’- AGGAGATCATGGAGATTGCAGC -3’5’- TCCTCTAGTACCTCTAACGTCG -3’5’- CTAACGCGAGTGTGTCTGATAAGA-3’5’-AACAATCAACCACGCCAGTCGTCA-3’5’- TACTTTGAGGAATCCGCTGTGA-3’5’-AGGGCTTCAACATGGTGATCTG-3’5’- CATGTCCACACTCACCATCCTTG-3’5’- GTACTTTCCGTTGCTCATAATCTCA-3’5’- GCTCCGAAACAAGTATCCCGA-3’5’- GTCTCCACAGCACCAACAAACA-3’5’- TCGGGCTAGAAGAAGACAGGC -3’ 5’-GAAGGTCAAGGCACTCACATCAG -3’5’-CGCAGAAAG TACCAGAAGAGC -3’5’-GAG AGC AGACAC AGC AGA GC-3’

Amplify the partial gene segment of FtJAZ2

Amplify the partial gene segment of FtMYB3

Amplify the partial gene segment of FtCHI

Amplify the partial gene segment of FtFLS

Amplify the partial gene segment of FtDFR

Amplify the partial gene segment of FtANS

Amplify the partial gene segment of FtH3

LUO et al. / Turk J Biol

530

FtMYB3]; this result indicated that the downstream reporter genes of HIS3, ADE2, and MEL1 were activated. Therefore, we identified FtJAZ2 as the primary interaction partner with FtMYB3 in the yeast.3.3. The interaction effect on anthocyanin biosynthesisFurther analysis of the interaction between FtJAZ2 and FtMYB3 and their effects on anthocyanins was conducted

during cold stress. Gene expression levels of anthocyanin-related genes during cold stress are shown in Figure 3. Expression of FtJAZ2 was sharply increased during the early phase of the cold stress and was reduced from 24 h to 48 h; moreover, FtMYB3 expression decreased in both the cotyledons and the hypocotyls. Meanwhile, the structural genes FtDFR and FtANS showed a similar expression

Figure 1. (A) Amino acid sequence alignment of FtJAZ with JAZ from various other plants and (B) Phylogenetic tree based on the JAZ amino acid sequences from Arabidopsis. The conserved ZIM motif and Jas motif are marked with a rectangle. The following are the GenBank numbers for related proteins: Nicotiana tabacum NtJAZ3 (BAG68657); Vitis rupestris VrJAZ3 (AEP60134); Arabidopsis thaliana AtJAZ1 (NP_564075), AtJAZ2 (NP_565096, AtJAZ3 (AEE76018), AtJAZ4 (AEE32304), AtJAZ5 (Q9LDU5), AtJAZ6 (NP_565043), AtJAZ7 (AEC08997), AtJAZ8 (AEE31184), AtJAZ9 (Q8W4J8), AtJAZ10 (AED91867), AtJAZ11 (AEE77796), and AtJAZ12 (AED92902).

Figure 2. (A) Image showing the successful mating of the yeast. (B) Image showing the growth and color development of Y2HGold [pGBKT7-FtJAZs] × Y187 [pGADT7-FtMYBs] yeast on QDO/X-α-gal petri dish.

LUO et al. / Turk J Biol

531

profile to FtJAZ2. The expression of FtFLS had a similar expression pattern to that of FtMYB3. However, the FtCHI expression level showed no significant difference between the treatment and pretreatment in cotyledons and hypocotyls.

Anthocyanin levels were measured and are shown in Figure 4. The anthocyanin level was higher in the cotyledons than in the hypocotyls during cold treatment. The anthocyanin level increased during the early stage of cold treatment, with a maximum yield observed at 12 h. The anthocyanin level then decreased over time in both the cotyledons and hypocotyls. In other words, the anthocyanin level and the expression level of FtJAZ2 showed a similar trend over time. 3.4. Statistical analysisThe correlation between the relative expression levels of FtJAZ2, FtMYB3, and anthocyanin was examined using SPSS 20.0. The expression level of FtJAZ2 was positively correlated with the anthocyanin level in both cotyledons and hypocotyls (correlation coefficient = 0.748 and 0.965, respectively). However, FtMYB3 expression was negatively correlated with the anthocyanin level in both the cotyledons and hypocotyls (correlation coefficient = –0.869 and –0.580, respectively). The correlation coefficients of the relative gene expression level and the anthocyanin level are listed in Table 4.

4. DiscussionPlant hormones can stimulate secondary metabolism (Bais et al., 2001; Jeong et al., 2004; Lin-Wang et al., 2010). As a new type of plant hormone, the influence of JA on secondary metabolism has been widely studied (Zhou and Memelink, 2016). Methyl-JA was used to affect the accumulation of phenolic acids in Salvia miltiorrhiza (Xiao et al., 2009) and tartary buckwheat (Gumerova et al., 2015), while anthocyanins and PAs were affected when various jasmonates were applied to common buckwheat (Horbowicz et al., 2009). The JAZ (jasmonate ZIM-domain) proteins are important repressors of the JA pathway (Chini et al., 2007; Shan et al., 2007; Pauwels and Goossens, 2011). Previous studies have shown that JAZ proteins can interact with R2R3-MYB MYB21, MYB24, and MYB75 to influence various physiological processes in Arabidopsis (Thines et al., 2007; Pauwels and Goossens, 2011; Zhou and Memelink, 2016). Consequently, an interaction between FtJAZ2 and FtMYB3 was detected in our study using a yeast two-hybrid assay. According to the reports of previous researchers, this interaction could occur between the Jas domain of FtJAZ2 and the R2R3 domain of FtMYB3 (Melotto et al., 2008; Song et al., 2011). We found that FtJAZ2 has an integrated Jas motif, whereas FtJAZ3 has an imperfect Jas motif at the C-terminus. This difference may explain why FtJAZ3 did not interact

Figure 3. The gene expression level of anthocyanin-related genes in the cotyledons and hypocotyls. The expression levels were normalized to the tartary buckwheat FtH3 gene and expression at hour 0 was set as 1. Error bars represent the standard error of the mean. *P < 0.05 and **P < 0.01 indicate significant differences between the control and the treatment.

LUO et al. / Turk J Biol

532

with FtMYBs despite the high level of homology between FtJAZ3 with FtJAZ2. Furthermore, a previous structural analysis indicated that FtMYB3 is clustered in subgroup IV of Arabidopsis with the typical repression motif (pdLNLD/ELxiG/S) in the C-terminus (Kazan, 2006). Furthermore, transgenic tobacco of FtMYB3 showed color fading compared to the control and a similar phenomenon was observed in VvMYB4-like transgenic tobacco (Pérez-Díaz et al., 2016). Therefore, an interaction between FtJAZ2 and FtMYB3 was implicated to have an effect on anthocyanin biosynthesis.

In this study, anthocyanin accumulation showed a remarkable increase after tartary buckwheat was treated

with cold stress. Furthermore, FtANS, FtDFR, and FtJAZ2 exhibited an increasing expression level, while the FtMYB3 expression was decreased during the course of cold treatment. The statistical analysis indicated that FtJAZ2 expression had a positive correlation with anthocyanin content, but FtMYB3 showed a negative correlation with it. Hence, we speculate that the interaction between FtMYB3 and FtJAZ2 would lead to the depression of FtANS and FtDFR expression through  removing FtMYB3 or its compound from the MYB binding sites in their promoters. As a result, more anthocyanin was biosynthesized. A similar phenomenon was also reported in Arabidopsis thaliana (Qi et al., 2011). Careful and persuasive study in

Figure 4. The level of anthocyanins during cold stress. Error bars represent the standard error of the mean. *P < 0.05 and **P < 0.01 indicate significant differences between the control and the treatment.

Table 4. Correlation coefficients between gene expression levels and anthocyanin contents in tartary buckwheat. **: Correlation is significant at the 0.01 level (2-tailed).

FtJAZ2 in hypocotyls

FtMYB3 in hypocotyls

Anthocyanin in hypocotyls

FtJAZ2 in cotyledons

FtMYB3 in cotyledons

Anthocyanin in cotyledons

FtJAZ2 in hypocotyls 1.000 –0.470 0.965** 0.559 –0.655 0.897 FtMYB3 in hypocotyls –0.470 1.000 –0.580 –0.963 0.880 –0.696 Anthocyanin in hypocotyls 0.965 –0.580 1.000 0.674 –0.748 0.942 FtJAZ2 in cotyledons 0.559 –0.963 0.674 1.000 –0.925 0.748 FtMYB3 in cotyledons –0.655 0.880 –0.748 –0.925 1.000 –0.869 Anthocyanin in cotyledons 0.897 –0.696 0.942 0.748 –0.869 1.000

LUO et al. / Turk J Biol

533

the future should help to clarify the molecular mechanism for the flavonoid metabolism mediated by the JA signaling pathway in tartary buckwheat.

In conclusion, we identified a new JAZ-interacting R2R3-MYB transcription factor in tartary buckwheat. Further analysis implied that the anthocyanin accumulation could be promoted while the FtDFR and

FtANS expressions are activated by the interaction between FtMYB3 and FtJAZ2 during cold stress.

AcknowledgmentWe thank the Science and Technology Department of Sichuan Province, P.R. China (2015HH0047) for supporting this work.

References

Afrin S, Huang JJ, Luo ZY (2015). JA-mediated transcriptional regulation of secondary metabolism in medicinal plants. Sci Bull 60: 1062-1072.

An XH, Tian Y, Chen KQ, Liu XJ, Liu DD, Xie XB, Cheng CG, Cong PH, Hao YJ (2015). MdMYB9 and MdMYB11 are involved in the regulation of the JA-induced biosynthesis of anthocyanin and proanthocyanidin in apples. Plant Cell Physiol 56: 650-662.

Bai YC, Li CL, Zhang JW, Li SJ, Luo XP, Yao HP, Chen H, Zhao HX, Park SU, Wu Q (2014). Characterization of two tartary buckwheat R2R3‐MYB transcription factors and their regulation of proanthocyanidin biosynthesis. Physiol Plantarum 152: 431-440.

Bais H, Sudha G, George J, Ravishankar G (2001). Influence of exogenous hormones on growth and secondary metabolite production in hairy root cultures of Cichorium intybus L. cv. Lucknow local. In Vitro Cell Dev-Pl 37: 293-299.

Chalker‐Scott L (1999). Environmental significance of anthocyanins in plant stress responses. Photochem Photobiol 70: 1-9.

Chini A, Fonseca S, Fernandez G, Adie B, Chico J, Lorenzo O, Garcia-Casado G, Lopez-Vidriero I, Lozano F, Ponce M (2007). The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448: 666-671.

Chu H, Jeong JC, Kim WJ, Chung DM, Jeon HK, Ahn YO, Kim SH, Lee HS, Kwak SS, Kim CY (2013). Expression of the sweetpotato R2R3‐type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiol Plantarum 148: 189-199.

Crifò T, Petrone G, Lo Cicero L, Lo Piero AR (2011). Short cold storage enhances the anthocyanin contents and level of transcripts related to their biosynthesis in blood oranges. J Agr Food Chem 60: 476-481.

Fabjan N, Rode J, Košir IJ, Wang Z, Zhang Z, Kreft I (2003). Tartary buckwheat (Fagopyrum tataricum Gaertn.) as a source of dietary rutin and quercitrin. J Agr Food Chem 51: 6452-6455.

Fernández-Calvo P, Chini A, Fernández-Barbero G, Chico JM, Gimenez-Ibanez S, Geerinck J, Eeckhout D, Schweizer F, Godoy M, Franco-Zorrilla JM (2011). The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell 23: 701-715.

Franceschi VR, Grimes HD (1991). Induction of soybean vegetative storage proteins and anthocyanins by low-level atmospheric methyl jasmonate. P Natl Acad Sci USA 88: 6745-6749.

Gao F, Zhao H, Yao H, Li C, Chen H, Wang A, Park S, Wu Q (2016). Identification, isolation and expression analysis of eight stress-related R2R3-MYB genes in tartary buckwheat (Fagopyrum tataricum). Plant Cell Rep 35: 1385-1396.

Gould K, Lister C, Andersen Ø, Markham KR (2006). Flavonoid functions in plants. In: Andersen OM, Markham KR, editors. Flavonoids: Chemistry, Biochemistry and Applications. Boca Raton, FL, USA: CRC Press, pp. 397-441.

Gumerova E, Akulov A, Rumyantseva N (2015). Effect of methyl jasmonate on growth characteristics and accumulation of phenolic compounds in suspension culture of tartary buckwheat. Russ J Plant Physiol 62: 195-203.

Horbowicz M, Mioduszewska H, Koczkodaj D, Saniewski M (2009). The effect of cis-jasmone, jasmonic acid and methyl jasmonate on accumulation of anthocyanins and proanthocyanidins in seedlings of common buckwheat [Fagopyrum esculentum Moench]. Acta Soc Bot Pol 78: 271-277.

Ishige K, Schubert D, Sagara Y (2001). Flavonoids protect neuronal cells from oxidative stress by three distinct mechanisms. Free Radical Bio Med 30: 433-446.

Jami SK, Clark GB, Ayele BT, Roux SJ, Kirti P (2012). Identification and characterization of annexin gene family in rice. Plant Cell Rep 31: 813-825.

Jeong ST, Goto-Yamamoto N, Kobayashi S, Esaka M (2004). Effects of plant hormones and shading on the accumulation of anthocyanins and the expression of anthocyanin biosynthetic genes in grape berry skins. Plant Sci 167: 247-252.

Kazan K (2006). Negative regulation of defence and stress genes by EAR-motif-containing repressors. Trends Plant Sci 11: 109-112.

Kazan K, Manners JM (2012). JAZ repressors and the orchestration of phytohormone crosstalk. Trends Plant Sci 17: 22-31.

Koes R, Verweij W, Quattrocchio F (2005). Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci 10: 236-242.

Li SJ, Bai YC, Li CL, Yao HP, Chen H, Zhao HX, Wu Q (2015). Anthocyanins accumulate in tartary buckwheat (Fagopyrum tataricum) sprout in response to cold stress. Acta Physiol Plantarum 37: 1-8.

Lin-Wang K, Bolitho K, Grafton K, Kortstee A, Karunairetnam S, McGhie TK, Espley RV, Hellens RP, Allan AC (2010). An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol 10: 50.

LUO et al. / Turk J Biol

534

Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC

T method. Methods 25: 402-408.

Loreti E, Povero G, Novi G, Solfanelli C, Alpi A, Perata P (2008). Gibberellins, jasmonate and abscisic acid modulate the sucrose‐induced expression of anthocyanin biosynthetic genes in Arabidopsis. New Phytol 179: 1004-1016.

Melotto M, Mecey C, Niu Y, Chung HS, Katsir L, Yao J, Zeng W, Thines B, Staswick P, Browse J (2008). A critical role of two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine‐and jasmonoyl isoleucine‐dependent interactions with the COI1 F‐box protein. Plant J 55: 979-988.

Pauwels L, Goossens A (2011). The JAZ proteins: a crucial interface in the jasmonate signaling cascade. Plant Cell 23: 3089-3100.

Pedranzani H, Sierra-de-Grado R, Vigliocco A, Miersch O, Abdala G (2007). Cold and water stresses produce changes in endogenous jasmonates in two populations of Pinus pinaster Ait. Plant Growth Regul 52: 111-116.

Pérez-Díaz JR, Pérez-Díaz J, Madrid-Espinoza J, González-Villanueva E, Moreno Y, Ruiz-Lara S (2016). New member of the R2R3-MYB transcription factors family in grapevine suppresses the anthocyanin accumulation in the flowers of transgenic tobacco. Plant Mol Biol 90: 63-76.

Qi T, Song S, Ren Q, Wu D, Huang H, Chen Y, Fan M, Peng W, Ren C, Xie D (2011). The jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 23: 1795-1814.

Reay P, Lancaster J (2001). Accumulation of anthocyanins and quercetin glycosides in ‘Gala’ and ‘Royal Gala’ apple fruit skin with UV-B–visible irradiation: modifying effects of fruit maturity, fruit side, and temperature. Sci Hortic 90: 57-68.

Shan XY, Wang ZL, Xie D (2007). Jasmonate signal pathway in Arabidopsis. J Integr Plant Biol 49: 81-86.

Shoji T, Ogawa T, Hashimoto T (2008). Jasmonate-induced nicotine formation in tobacco is mediated by tobacco COI1 and JAZ genes. Plant Cell physiol 49: 1003-1012.

Song S, Qi T, Huang H, Ren Q, Wu D, Chang C, Peng W, Liu Y, Peng J, Xie D (2011). The jasmonate-ZIM domain proteins interact with the R2R3-MYB transcription factors MYB21 and MYB24 to affect jasmonate-regulated stamen development in Arabidopsis. Plant Cell 23: 1000-1013.

Sun Z, Hou S, Yang W, Han Y (2012). Exogenous application of salicylic acid enhanced the rutin accumulation and influenced the expression patterns of rutin biosynthesis related genes in Fagopyrum tartaricum Gaertn leaves. Plant Growth Regul 68: 9-15.

Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J (2007). JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature 448: 661-665.

Treutter D (2006). Significance of flavonoids in plant resistance: a review. Environ Chem Lett 4: 147-157.

Tsuji K, Ohnishi O (2001). Phylogenetic relationships among wild and cultivated Tartary buckwheat (Fagopyrum tataricum Gaert.) populations revealed by AFLP analyses. Genes Genet Syst 76: 47-52.

Uimari A, Strommer J (1998). Anthocyanin regulatory mutations in pea: effects on gene expression and complementation by R-like genes of maize. Mol Gen Genet 257: 98-204.

Winkel-Shirley B (2002). Biosynthesis of flavonoids and effects of stress. Curr Opin Plant Biol 5: 218-223.

Xiao Y, Gao S, Di P, Chen J, Chen W, Zhang L (2009). Methyl jasmonate dramatically enhances the accumulation of phenolic acids in Salvia miltiorrhiza hairy root cultures. Physiol Plantarum 137: 1-9.

Zhang B, Hu Z, Zhang Y, Li Y, Zhou S, Chen G (2012). A putative functional MYB transcription factor induced by low temperature regulates anthocyanin biosynthesis in purple kale (Brassica Oleracea var. acephala f. tricolor). Plant Cell Rep 31: 281-289.

Zhou M, Memelink J (2016). Jasmonate-responsive transcription factors regulating plant secondary metabolism. Biotechnol Adv 34: 441-449.

LUO et al. / Turk J Biol

1

Supplementary Figure S1. Toxicity test of FtJAZs and FtMYBs for yeast cell:(A–D) Transformation results of plasmid pGBKT7, pGBKT7-FtJAZ1, pGBKT7-FtJAZ2, and pGBKT7-FtJAZ3 into

Y2HGold; (E–I) Transformation results of plasmid pGADT, pGADT7-FtMYB1, pGADT7-FtMYB2, and pGADT7-FtMYB3.

Supplementary Figure S2. Self-activation detection of FtJAZs and FtMYBs for reported genes in yeast: (A–D) The growth and color development of Y2HGold [pGBKT7], Y2HGold [pGBKT7-FtJAZ1], Y2HGold [pGBKT7-FtJAZ2], and Y2HGold [pGBKT7-FtJAZ3] on SD/-Trp/X-α-gal petri dishes; (E–I) The growth and color change of Y187 [pGADT7], Y187 [pGADT7-FtMYB1], Y187 [pGADT7-FtMYB2], and Y187 [pGADT7-FtMYB3] on SD/-Leu/X-α-gal petri dishes.