The Nedd8-conjugated ROC1-CUL1 Core Ubiquitin Ligase UtilizesNedd8 Charged Surface Residues for Efficient Polyubiquitin ChainAssembly Catalyzed by Cdc34*

Received for publication, August 20, 2001, and in revised form, October 19, 2001Published, JBC Papers in Press, October 23, 2001, DOI 10.1074/jbc.M108008200

Kenneth Wu, Angus Chen‡, Peilin Tan§, and Zhen-Qiang Pan¶

From the Derald H. Ruttenberg Cancer Center, The Mount Sinai School of Medicine, New York, New York 10029-6574

Lysine 48-linked polyubiquitin chains are the princi-ple signal for targeting proteins for degradation by the26 S proteasome. Here we report that the conjugation ofNedd8 to ROC1-CUL1, a subcomplex of the SCF-ROC1 E3ubiquitin ligase, selectively stimulates Cdc34-catalyzedlysine 48-linked multiubiquitin chain assembly. We havefurther demonstrated that separate regions within thehuman Cdc34 C-terminal tail are responsible for multi-ubiquitin chain assembly and for physical interactionswith the Nedd8-conjugated ROC1-CUL1 to assemble ex-tensive ubiquitin polymers. Structural comparisons be-tween Nedd8 and ubiquitin reveal that six charged res-idues (Lys4, Glu12, Glu14, Arg25, Glu28, and Glu31) areuniquely present on the surface of Nedd8. Replacementof each of the six residues with the corresponding aminoacid in ubiquitin decreases the ability of Nedd8 to acti-vate the ubiquitin ligase activity of ROC1-CUL1. More-over, maintenance of the proper charges at amino acidpositions 14 and 25 are necessary for retaining wild typelevels of activity, whereas introduction of the oppositecharges at these positions abolishes the Nedd8 activa-tion function. These results suggest that Nedd8 chargedsurface residues mediate the activation of ROC1-CUL1to specifically support Cdc34-catalyzed ubiquitinpolymerization.

Nedd8 (or its orthologue Rub1) is a small ubiquitin (Ub)-likemolecule that modifies all members of the Cullin/Cdc53 proteinfamily (1, 2), resulting in the formation of an isopeptide bondlinkage between the �-amino group of a conserved Cullin lysineresidue and the C-terminal carboxyl group of Nedd8 glycine 76.The conjugation is an ATP-dependent reaction that requires aNedd8-specific E1 activating enzyme, composed of the APP-BP1 and Uba3 heterodimer, and Ubc12 as the E2 conjugatingenzyme (3). In addition, the Cullin-interacting RING fingerprotein, ROC1/Rbx1/Hrt1, is required for the reaction as dis-ruption of the RING domain abolishes the modification (4).

Two well characterized members of the Cullin family, CUL1and CUL2, serve as subunits of the two multisubunit E3 Ub

ligase complexes, SCF-ROC1 (5–8) and pVHL-elongin C/B-CUL2-ROC1 (9), respectively. It has now been well establishedthat the ROC1-CUL1 subassembly acts as a core ubiquitinligase, capable of supporting Ub polymerization (5, 6, 8, 10, 11).In addition, results from transient transfection experimentshave shown that ROC1 and its homologue ROC2 interact withall members of the Cullin protein family and that the resultingROC-Cullin complex is active in supporting Ub polymerization(6). Thus, while the biological roles of Cullin members includ-ing CUL3, CUL4A, CUL4B, and CUL5 remain elusive, it ishighly likely that all of the ROC-Cullin based complexes areinvolved in cellular Ub-dependent proteolysis pathways. It is,therefore, conceivable that Nedd8, through its conjugation toCullins, functions to regulate the stability of cellular proteins.

Accumulating genetic evidence has demonstrated a criticalrole for Nedd8 in the regulation of cell proliferation and devel-opment. In Saccharomyces cerevisiae, the Rub1 pathway isessential for cell growth when the function of the SCF is com-promised by mutations in cdc34, cdc4, cdc53, or skp1 (12). Infission yeast, the Nedd8-modifying pathway is essential for cellviability (13). A dramatic cell cycle effect was also observed inthe ts41 hamster cell line, where the Nedd8 pathway is defec-tive (14). This cell harbors a temperature-sensitive allele ofSMC1, a homologue of human APP-BP1. At a nonpermissivetemperature, the ts41 cell undergoes multiple rounds of DNAreplication without intervening mitoses. Furthermore, in Ara-bidopsis thaliana, recessive mutations in the AXR1 gene (ahomologue of APP-BP1) resulted in a decreased response toauxin, a hormone that regulates diverse developmental proc-esses by promoting changes in cell division and elongation (15).More recently, Deshaies and co-workers (16) and Deng andco-workers (17) have provided compelling genetic evidence thatthe COP9/signalosome promotes the cleavage of Nedd8 fromCUL1, suggesting a complex mechanism required for the re-moval of Nedd8 from its substrate Cullin proteins.

Read et al. (18) have initially reported that Nedd8 modifica-tion activates the SCF�-TRCP-dependent ubiquitination of I�B�.They further demonstrated that Nedd8 does not affect the Km

for SCF�-TRCP binding to I�B�, nor does it significantly alterthe ability of CUL1 to form complexes with ROC1, Skp1, and�-TRCP. In addition, Podust et al. (19) and Morimoto et al. (20)have shown that the Nedd8 conjugation pathway is essentialfor proteolytic targeting of p27 by ubiquitination. Recently, wehave provided biochemical evidence that the conjugation ofNedd8 to CUL1 at Lys720 activates the Ub ligase activity of theROC1-CUL1 complex (21), suggesting that Nedd8 is a novelregulator of the efficiency of polyubiquitin chain synthesis and,hence, promotes the rapid turnover of SCF-ROC1 substrates.

It remains to be determined, however, how Nedd8 activatesthe Ub ligase activity of the ROC1-CUL1 complex. In thisreport, we show that the conjugation of Nedd8 to the ROC1-

* This work was supported by Public Health Service Grant GM55059(to Z.-Q. P). The costs of publication of this article were defrayed in partby the payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734solely to indicate this fact.

‡ Supported in part by a National Institutes of Health predoctoraltraining grant in cancer biology.

§ Supported by a grant from the Peter Sharp Foundation.¶ An Irma T. Hirschl Scholar. To whom correspondence should be

addressed: Derald H. Ruttenberg Cancer Center, The Mount SinaiSchool of Medicine, One Gustave L. Levy Pl., New York, NY 10029-6574. Tel.: 212-659-5500; Fax: 212-849-2446; E-mail: zhen-qiang.pan@mssm.edu.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 1, Issue of January 4, pp. 516–527, 2002© 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org516

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

CUL1 complex selectively stimulates Cdc34-catalyzed, but notUbc4/5-catalyzed, Lys48-linked multiubiquitin chain assembly.Furthermore, we present evidence that Nedd8 charged surfaceresidues mediate the activation of ROC1-CUL1 in supportingubiquitin polymerization.

EXPERIMENTAL PROCEDURES

Plasmids

Construction of pET-His-HA-Cdc34 and Its C-terminally TruncatedDerivatives—To generate a plasmid for the expression of human Cdc34in Escherichia coli, the full-length cDNA sequence (obtained from M.Pagano) was subcloned into the pET-3a vector (Novagen). Both the HAand six-histidine tag sequences were inserted at the N terminus ofCdc34. To construct various C-terminal Cdc34 truncations, stop codonswere generated at the desired locations in the pET-His-HA-Cdc34 plas-mid using the QuickChangeTM site-directed mutagenesis kit (Strat-agene) as per the manufacturer’s instructions. Primers used for PCRwere as follows: Cdc34 (aa 1–208), GGGCTCAGACCTCTTCTACGAC-TAATACTACGAGGACGGCGAGGTGG (5�) and CCACCTCGCCGTCC-TCGTAGTATTAGTCGTAGAAGAGGTCTGAGCCC (3�); Cdc34 (aa1–194), GGCCGAGTACTGCGTGAAGACCTAGGCGCCGGCGCCCGA-CGAGGGC (5�) and GCCCTCGTCGGGCGCCGGCGCCTAGGTCTTC-ACGCAGTACTCGGCC (3�); and Cdc34 (aa 1–169), GACATCATCCG-GAAGCAGGTCTAGGGGACCAAGGTGGACGCCG (5�) and CGGCGT-CCACCTTGGTCCCCTAGACCTGCTTCCGGATGATGTC (3�).

Construction of Nedd8 Mutants—To construct Nedd8 point mutants,the QuickChangeTM site-directed mutagenesis kit was again employedas per the manufacturer’s instructions, using pET-Nedd8 (a kind giftfrom C. Pickart) as a template with the following primer sets: K4F,GAAGGAGATATACATATGCTAATATTTGTGAAGACGCTGACCGG-AAAGGAGATTG (5�) and CAATCTCCTTTCCGGTCAGCGTCTTCAC-AAATATTAGCATATGTATATCTCCTTC (3�); E12T, GTGAAGACGCT-GACCGGAAAGACAATTGAGATTGACATTGAACCTAC (5�) and GTA-GGTTCAATGTCAATCTCAATTGTCTTTCCGGTCAGCGTCTTCAC(3�); E14T, GACGCTGACCGGAAAGGAGATTACAATTGACATTGAA-CCTACAGAC (5�) and GTCTGTAGGTTCAATGTCAATTGTAATCTC-CTTTCCGGTCAGCGTC (3�); E14D, GACGCTGACCGGAAAGGAGAT-TGATATCGACATTGAACCTACAGAC (5�) and GTCTGTAGGTTCAA-TGTCGATATCAATCTCCTTTCCGGTCAGCGTC (3�); E14R, GACGC-TGACCGGAAAGGAGATTAGGATCGACATTGAACCTACAGAC (5�)and GTCTGTAGGTTCAATGTCGATCCTAATCTCCTTTCCGGTCAG-CGTC (3�); R25N, CCTACAGACAAGGTGGAGAACATCAAGGAGCG-TGTGGAGGAG (5�) and CTCCTCCACACGCTCCTTGATGTTCTCCA-CCTTGTCTGTAGG (3�); R25K, CCTACAGACAAGGTGGAGAAAATC-AAGGAGCGTGTGGAGGAG (5�) and CTCCTCCACACGCTCCTTGAT-TTTCTCCACCTTGTCTGTAGG (3�); R25E, CCTACAGACAAGGTGG-AGGAAATCAAGGAGCGTGTGGAGGAG (5�) and CTCCTCCACACG-CTCCTTGATTTCCTCCACCTTGTCTGTAGG (3�); E28A, CAAGGTG-GAGCGAATCAAGGCACGTGTGGAGGAGAAAGAGG (5�) and CCTC-TTTCTCCTCCACACGTGCCTTGATTCGCTCCACCTTG (3�); andE31Q, GAGCGAATCAAGGAGCGTGTGCAGGAGAAAGAGGGAATC(5�) and GATTCCCTCTTTCTCCTGCACACGCTCCTTGATTCGCTC(3�). The presence of the desired mutation in each construct was verifiedby DNA sequencing.

Protein Expression and Isolation

Preparation of His-HA-Cdc34 and Its C-terminally Truncated Deriv-atives—pET-3a plasmids expressing the wild type and mutant Cdc34proteins were transformed into the pJY2 (Affiniti)-containing BL21(DE3) cells and grown in LB (0.5 liter) with 0.4% glucose in the presenceof ampicillin and chloramphenicol at 37 °C. Cultures were then cooledto room temperature when the optical density at 600 nm reached 0.5.Isopropyl-1-thio-�-D-galactopyranoside at a final concentration of 0.8mM was added to induce the culture overnight (12–14 h) at 25 °C. Cellswere pelleted at 5,000 � g for 15 min at 4 °C, and the pellet wasresuspended in 1⁄25 culture volume of buffer A (20 mM Tris-HCl, pH 8.0,1% Triton X-100, 0.5 M NaCl, 5 mM imidazole, 2 mM phenylmethylsul-fonyl fluoride, 0.4 �g/ml antipain, and 0.2 �g/ml leupeptin). The resus-pension was then sonicated (four repetitive 20-s treatments) and cen-trifuged at 17,000 rpm in an SS-34 rotor for 30 min at 4 °C.

For the preparation of Cdc34, Cdc34 (aa 1–208), and Cdc34 (aa1–194), soluble extracts (10 ml) were mixed with Ni2�-nitrilotriaceticacid-agarose beads (3 ml; Qiagen) for �2 h at 4 °C. The beads were thenpacked into a column and washed consecutively with buffer A (30 ml)and 9 ml of buffer B (20 mM Tris-HCl, pH 8.0, 10% glycerol, and 0.5 M

NaCl) plus 5 mM imidazole. Bound protein was eluted with a 40-ml

linear gradient of 5–250 mM imidazole in buffer B. Fractions containingpeak levels of Cdc34, as judged by SDS-PAGE/Coomassie staining anal-ysis, were pooled and dialyzed overnight at 4 °C in buffer C (25 mM

Tris-HCl, pH 7.5, 1 mM EDTA, 0.01% Nonidet P-40, 10% glycerol, and1 mM DTT) plus 50 mM NaCl. The resulting material was then loadedonto a Q-Sepharose column (3 ml; Amersham Biosciences, Inc.). Afterwashing the column with 30 ml of buffer C plus 50 mM NaCl, boundCdc34 or Cdc34 (aa 1–208) was eluted by a 40-ml linear gradient of50–500 mM NaCl in buffer C, and the peak fractions were pooled. Cdc34(aa 1–194) was recovered in the flow-through. All three Cdc34 deriva-tives were concentrated using centrifugal filters and further purified byFPLC using a Sephadex-75 gel filtration column (Amersham Bio-sciences). A single peak of protein corresponding to Cdc34, Cdc34 (aa1–208), or Cdc34 (aa 1–194) monomer was pooled and used in thestudies described in this report.

The majority of Cdc34 (aa 1–169) was found in the insoluble inclusionbody. Prior to solubilization, the pellet was washed once with buffer A(25 ml) and twice with buffer D (50 mM Tris-HCl, pH 7.5, 20% sucrose,1% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 0.4 �g/ml anti-pain, and 0.2 �g/ml leupeptin). The washed pellet was then resus-pended in 20 ml of buffer E (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 5mM imidazole) plus 8 M urea, and the resulting mixture was incubatedat room temperature for 30 min. The solubilized material (10 ml) wasmixed with Ni2�-nitrilotriacetic acid-agarose beads (3 ml) for 2 h at4 °C, followed by washing the beads with progressively decreasingconcentrations of urea in buffer E. The bound protein was then elutedby imidazole and further purified using Q Sepharose and Sephadex-75gel filtration chromatography as described above. A single peak ofCdc34 (aa 1–169) monomer was pooled and used in the studies de-scribed in this report.

Expression and Purification of Nedd8 Mutants—The various Nedd8mutant proteins were prepared identically as the wild type proteinusing the procedure as previously described (21). The proteins wereconcentrated to �0.3 mg/ml.

Other Reagents—APP-BP1/UBA3 was affinity-purified as describedpreviously (21). For preparation of Ubc12, GST-fused Ubc12 was ex-pressed and isolated on glutathione beads as previously described (21).To cleave GST, the fusion protein that was immobilized to glutathionebeads was incubated with biotinylated thrombin (45 units/ml of beads)for 2 h at 4 °C. After centrifugation, the supernatant containing bothUbc12 and thrombin was mixed with streptavidin beads (AmershamBiosciences; 5 �l of beads/unit of thrombin), and the resulting suspen-sion was rocked for 1 h at 4 °C to allow the absorption of the biotiny-lated thrombin to the beads. Ubc12, free of GST and thrombin, wasobtained by centrifugation.

Human Ub E1 was prepared as described (5). The expression andpurification of Ubc5c were carried out as described by Ohta et al. (6).

Assays

Nedd8-dependent Ub Ligase Activation Assay—To conjugate Nedd8or its mutant form to ROC1-CUL1, E. coli extracts containing GST-ROC1-CUL1 (aa 324–776) (21) were mixed with glutathione-Sepharose4B (Amersham Biosciences) for 1 h at 4 °C. Bacterial proteins wereremoved by washing the beads three times with 0.5 ml of buffer F (50mM Tris-HCl, pH 8.0, 1% Triton X-100, 0.5 M NaCl, 10 mM EDTA, 10 mM

EGTA, 10% glycerol, 2 mM phenylmethylsulfonyl fluoride, 0.4 �g/mlantipain, and 0.2 �g/ml leupeptin) and twice with buffer C plus 50 mM

NaCl. Glutathione beads containing �1 �g of GST-ROC1-CUL1 (aa324–776) were used in the assay. For Nedd8 conjugation, the immobi-lized GST-ROC1-CUL1 (aa 324–776) was incubated with 50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM ATP, 0.6 mM DTT, 0.1 mg/ml bovineserum albumin, APP-BP1/UBA3 (25 ng), Nedd8 (0.6 �g), and Ubc12 (1�g) at 37 °C for 60 min. Excess Nedd8 modification agents were re-moved by washing the beads three times with 0.5 ml of buffer F andtwice with buffer C plus 50 mM NaCl.

The GST-ROC1-CUL1 (aa 324–776) complex, conjugated with thewild type or mutant Nedd8 protein, was then incubated in a reactionmixture (30 �l) that contained 50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 2mM NaF, 10 nM okadaic acid, 2 mM ATP, 0.6 mM DTT, 5 �g of 32P-Ub,E1 (0.6 pmol), and the indicated E2 Ub-conjugating enzyme. The incu-bation was at 37 °C for 30 min or, as otherwise specified, on a thermo-mixer (Eppendorf). The bound protein was released by boiling the beadswith 20 �l of Laemmli loading buffer in the presence of 12 mM DTT for3 min. This treatment was sufficient to abolish the majority of theDTT-sensitive Ub-linked thiol-esters, resulting in an identical patternof Ub ligation products as observed when the DTT concentration wasincreased to 0.1 M (data not shown). Thus, the 32P-Ub conjugates,

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 517

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

visualized by autoradiography following 10% SDS-PAGE, were predom-inantly those linked via isopeptide bonds.

Ub Conjugation Assay—The reaction mixture (20 �l) contained 50mM Tris-HCl, pH 7.4, 5 mM MgCl2, 0.2 mM DTT, 2 mM ATP, 3 �g of32P-Ub, E1 (0.6 pmol), and 0.5 �g of the wild type or C-terminallytruncated Cdc34 protein. Reactions were incubated at 37 °C for 30 minand terminated by the addition of Laemmli loading buffer. The finalconcentration of SDS was adjusted to 0.5%. The reaction products werethen separated by 10% SDS-PAGE.

RESULTS

Conjugation of Nedd8 to CUL1 Activates Cdc34-catalyzed,but Not Ubc5c-catalyzed, Polyubiquitin Chain Assembly—We

have recently demonstrated that Nedd8 modification activatesthe ability of ROC1-CUL1 to support Ub polymerization in thepresence of Cdc34 (21). Previous studies have shown that bothUbc4 and -5 are also capable of mediating ROC1-dependentpolyubiquitin chain assembly (6). To determine whether Nedd8activation was E2-specific, we compared Cdc34 and Ubc5c intheir ability to catalyze Ub polymerization in the presence ofthe Nedd8-conjugated ROC1-CUL1 complex. For this purpose,the unmodified GST-ROC1-CUL1 (aa 324–776) complex, ex-pressed and assembled in E. coli, was immobilized on glutathi-one-Sepharose 4B. To conjugate Nedd8 to the CUL1 (aa 324–

FIG. 1. Conjugation of Nedd8 to CUL1 activates Cdc34-catalyzed, but not Ubc5c-catalyzed, polyubiquitin chain assembly. GST-ROC1-CUL1 (aa 324–776), immobilized on glutathione-Sepharose beads, was conjugated with (lanes 1 and 6–9) or without (lanes 2–5) Nedd8, asdescribed under “Experimental Procedures.” Following treatment, the immobilized complex was measured for its ability to convert monomeric Ubinto high molecular weight Ub conjugates in the presence of Cdc34 (A) or Ubc5c (B) using an established assay detailed under “ExperimentalProcedures.” 0.5 �g of the E2 protein was used. C, the effect of Nedd8 was analyzed using subsaturating levels of Ubc5c (amounts indicated).Aliquots of each reaction were separated by 10% SDS-PAGE followed by autoradiography. The high molecular weight Ub polymers (greater than100 kDa) were quantitated using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). The results are presented in graphs.

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly518

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

776) fragment, the immobilized GST-ROC1-CUL1 (aa 324–776) complex was incubated with a solution containing purifiedNedd8, (APP-BP1)/Uba3, and Ubc12. To test the effect ofNedd8 modification on the Ub polymerization reaction, theunmodified (Fig. 1, A and B, lanes 2–5) or Nedd8-conjugated(Fig. 1, A and B, lanes 6–9) complex was incubated for theindicated times with purified E1, 32P-labeled Ub, and eitherCdc34 (Fig. 1A) or Ubc5c (Fig. 1B). In all cases, the Ub ligaseactivity of GST-ROC1-CUL1 (aa 324–776) was quantified fol-lowing autoradiographic/PhosphorImager analysis by meas-uring the levels of accumulated high molecular weight 32P-Ubconjugates derived from the monomeric Ub. The high molecularweight mass Ub conjugates formed were complex and likelyincluded free Ub chains (5, 10) and autoubiquitinated E2 (7, 8).

Consistent with our previous observation (21), Nedd8 modi-fication activated the Cdc34-catalyzed assembly of 32P-Ubchains by 19-fold within 9 min of incubation (Fig. 1A). Surpris-ingly, Ubc5c-catalyzed Ub polymerization was not significantlyaffected by Nedd8 modification at all of the time points tested(Fig. 1B). Furthermore, Nedd8 activation was not observedwith Ubc5c that was present in subsaturating levels (Fig. 1C).This excludes the possibility that the apparent absence of ac-tivation by Nedd8 with Ubc5c was due to the use of saturatinglevels of the E2 protein. Similarly, no Nedd8 activation wasdetected when Ubc4, which shares a high degree of sequencehomology with Ubc5, was used as the E2 in the reaction (datanot shown). These results demonstrate that the conjugation ofNedd8 to CUL1 selectively activates Cdc34-catalyzed, but notUbc4/5c-catalyzed, polyubiquitin chain formation.

We next explored the difference between Cdc34 and Ubc5c inthe utilization of Ub lysine receptor residue(s) for the assemblyof polyubiquitin chains. Consistent with our previous observa-tion (5), when UbK48R was used in place of the wild type Ub,Cdc34-catalyzed polyubiquitin chain formation was almostcompletely inhibited (Fig. 2A), confirming that Cdc34 assem-bles Lys48-linked Ub chains. In contrast, when Ubc5c was usedas the E2, polyubiquitin chains were still assembled efficiently(Fig. 2B, lanes 2–5). Conjugation of Nedd8 to CUL1 had nosignificant effect on the Ubc5c-catalyzed synthesis of non-Lys48-linked (most likely Lys29-linked; Refs. 22 and 23) Ubchains (lanes 6–9). Taken together, these results show thatNedd8 specifically activates the Cdc34 catalyzed synthesis ofLys48-linked multi-Ub chains.

The C Terminus of Human Cdc34 Is Required for Mediatingthe Nedd8-stimulated and ROC1-CUL1-dependent Assembly ofPolyubiquitin Chains—The above studies suggest a specificcooperation between Nedd8 and Cdc34 that promotes the Ubpolymerization reaction. Previous studies have demonstratedthat the C terminus of S. cerevisiae Cdc34 is required for cellcycle control (24, 25) and that residues 171–209 constitute aminimal motif both necessary and sufficient for binding to theSCF components (26). These findings prompted us to examinethe role of the C-terminal tail of human Cdc34 in mediating theNedd8 stimulated and ROC1-CUL1-dependent Ub polymeriza-tion by deletion analysis. Based on sequence alignment to its S.cerevisiae counterpart, the human Cdc34 contains a C-terminaltail spanning residues 171–236. Both the wild type and thethree C-terminally truncated Cdc34 proteins (Cdc34 residues1–169, 1–194, and 1–208) were expressed in bacteria and pu-rified to homogeneity as judged by Coomassie staining analysis(Fig. 3A).

Purified Cdc34 protein possesses a number of biochemicalactivities. These include the ability of Cdc34 to conjugate Ub inthe presence of E1, to catalyze autoubiquitination (27), to di-rectly interact with ROC1-CUL1 for assembling Lys48-linkedmulti-Ub chains (11), and to cooperate with Nedd8 for the

activated synthesis of Ub polymers (Ref. 21; Fig. 1). In keepingwith the notion that the Ubc domain (spanning amino acidresidues 1–170 in human Cdc34; Ref. 28) is responsible for Ubconjugation activity, all three truncated Cdc34 proteins re-tained their ability to conjugate Ub in the presence of E1 (Fig.3B). The observed DTT-insensitive Cdc34-Ub conjugates aremonoubiquitinated species (see below).

Banerjee et al. (27) have previously shown that the purifiedS. cerevisiae Cdc34 protein catalyzes its own ubiquitination toassemble a multi-Ub chain on a lysine residue within its Cterminus. As shown, human Cdc34 alone produced an array ofUb conjugates (Fig. 3C, lane 4). While the predominant reac-tion product was the monoubiquitinated Cdc34 that migratedas a doublet of �47 kDa, other Ub conjugates included the E2protein linked with chains composed of up to five Ub moieties.Cdc34 (aa 1–208) was more active than the wild type protein incatalyzing autoubiquitination, producing Ub conjugates withmolecular masses up to 200 kDa (lane 6). Cdc34 (aa 1–194)catalyzed autoubiquitination with an efficiency comparablewith that observed with the wild type protein (compare lanes 4and 8). Interestingly, while Cdc34 (aa 1–169) was still capableof mono- and diubiquitination, it did not form multi-Ub chains(lane 10), suggesting a processivity deficiency in polymerizing

FIG. 2. Ubc5c, but not Cdc34, assembles non-Lys48-linkedpolyubiquitin chains. GST-ROC1-CUL1 (aa 324–776), immobilizedon glutathione-Sepharose beads, was assayed for its ability to supportCdc34-catalyzed (A) or Ubc5c-catalyzed (B) polyubiquitin chain assem-bly using 32P-labeled UbK48R in place of the wild type Ub. 0.5 �g of theE2 protein was used. The reactions were carried out and analyzed asdescribed in Fig. 1.

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 519

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

FIG. 3. Multiple biochemical activities are associated with the C terminus of human Cdc34 protein. A, Coomassie staining analysisof the wild type and C-terminally truncated Cdc34 proteins. Bacterially expressed and purified Cdc34 (lane 1), Cdc34 (aa 1–208) (lane 2), Cdc34(aa 1–194) (lane 3), and Cdc34 (aa 1–169) (lane 4) (1 �g of protein each) were electrophoresed on 12.5% SDS-PAGE followed by Coomassie staining.B, Ub conjugation activity of the wild type and C-terminally truncated Cdc34 proteins. The Ub conjugation assay was carried out as describedunder “Experimental Procedures” in the presence or absence of the indicated components. When samples were treated with 0.1 M DTT (lanes 3,

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly520

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

Ub. Taken together, these results implicate a role for Cdc34residues 170–194 in promoting the formation of polyubiquitinchains.

In the presence of ROC1-CUL1, but in the absence of Nedd8modification, Cdc34 (aa 1–208) supported multi-Ub chain as-sembly, albeit with �100-fold lower efficiency compared withthe wild type (Fig. 3D, compare lanes 4 and 5 and lanes 10 and11). Under these conditions, both the wild type and Cdc34 (aa1–208) assembled Ub chains with molecular mass greater than200 kDa, demonstrating a role for ROC1-CUL1 in promotingthe assembly of extensive polyubiquitin chains. Cdc34 (aa1–194) was only barely stimulated by ROC1-CUL1 (comparelanes 15 and 17). Furthermore, in contrast to both the wild typeand Cdc34 (aa 1–208), Ub polymers formed by Cdc34 (aa1–194) and ROC1-CUL1 were predominantly those of limitedlengths that migrated in the range of 70–100 kDa. Finally, theaddition of ROC1-CUL1 could not activate Cdc34 (aa 1–169) toassemble multi-Ub chains (Fig. 3D, lanes 20–23). These resultsdemonstrate that the extreme C terminus of human Cdc34(residues 209–236) is required for its maximal activity in cat-alyzing ROC1-CUL1-dependent synthesis of Ub polymers. Fur-thermore, assembly of extensive polyubiquitin chains byROC1-CUL1 requires Cdc34 residues 195–208. This suggests

that Cdc34 (aa 195–208) may constitute a motif that interactswith the ROC1-CUL1 complex.

Similar to that observed with the wild type Cdc34 (Fig. 3D,lanes 4–7; see 2-h exposure), Cdc34 (aa 1–208)-catalyzed Ubpolymerization was stimulated up to 10-fold when the ROC1-CUL1 complex was conjugated with Nedd8 (compare lanes 11and 13). Production of Ub conjugates by Cdc34 (aa 1–194) wasonly slightly increased by Nedd8 modification (compare lanes16 and 18). Moreover, Nedd8 did not increase the mass of Ubpolymers produced by Cdc34 (aa 1–194) from �100 to 200 kDa.No effect by Nedd8 was observed with Cdc34 (aa 1–169) (Fig.3D, lanes 22–25). These data are consistent with the notionthat Nedd8 acts to increase the efficiency with which Cdc34and ROC1-CUL1 polymerize Ub. Furthermore, the observationthat Nedd8 activated the wild type and Cdc34 (aa 1–208) to asimilar extent (maximally 10–20-fold) suggests that Cdc34 res-idues 208–236 are not critically involved in mediating theinteraction with Nedd8. Of note, like the wild type protein, bothCdc34 (aa 1–208) and Cdc34 (aa 1–194) assembled Lys48-linkedpolyubiquitin chains (data not shown).

A GST-based pull-down assay was employed to test the abil-ity of the wild type and C-terminally truncated Cdc34 proteinsto interact with glutathione bead-immobilized GST-ROC1-

FIG. 4. A, the effects of C-terminal trun-cation on the capacity of Cdc34 to bind toROC1-CUL1. The binding reaction wascarried out as described previously (11).Glutathione-Sepharose beads were boundwith GST-ROC1-CUL1 (aa 324–776) (�5�g; lanes 1, 4, 7, 10, and 13) or GST (�10�g; lanes 3, 6, 9, and 12). Following incu-bation with the wild type or C-terminallytruncated Cdc34 protein (1 �g), the beadswere washed, and bound proteins werereleased and separated by 10% SDS-PAGE and transferred to a nitrocellulosemembrane. Western blots were probedwith an antibody (Novagen) recognizingthe T7 tag that is present at the N termi-nus of the wild type and mutant Cdc34proteins. Lanes 2, 5, 8, and 11 contained10% of the input of each Cdc34 derivative.B, structural domains within the humanCdc34. Shown is a schematic representa-tion of domains within the human Cdc34that are responsible for catalysis,multi-Ub chain assembly, and interac-tions with ROC1-CUL1 for the efficientsynthesis of Ub polymers.

6, 9, and 12) following the conjugation reaction, the mixture was boiled for 3 min prior to 12.5% SDS-PAGE. C, Cdc34 residues 170–194 arerequired for multi-Ub chain assembly. The autoubiquitination of the wild type (lanes 3 and 4) and C-terminally truncated (lanes 5–10) Cdc34proteins was assayed by incubating 1 �g of the E2 protein in a solution containing 50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM NaF, 10 nM okadaicacid, 2 mM ATP, 0.6 mM DTT, and 5 �g of 32P-Ub, in the presence (lanes 4, 6, 8, and 10) or absence (lanes 3, 5, 7, and 9) of E1 (0.6 pmol). The reactionwas incubated at 37 °C for 30 min, and products were separated by 10% SDS-PAGE. D, the ROC1-CUL1-dependent polyubiquitin chain assemblyby Cdc34 requires a minimal motif spanning residues 195–208 within the E2 protein. The Nedd8-stimulated and ROC1-CUL1-dependent Ubpolymerization by Cdc34 was carried out as described in the legend to Fig. 1. The incubation time was 30 min. Two levels of the wild type andmutant Cdc34 proteins, 0.25 �g (lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24) and 0.5 �g (lanes 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, and 25),were used. The autoradiogram containing reactions 1–13 is shown with both long (48-h) and short (2-h) exposures for better comparison of theeffects of Nedd8 modification.

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 521

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

CUL1 (aa 324–776). As shown in Fig. 4A, the wild type Cdc34was specifically bound to the complex (lanes 3 and 4), in keep-ing with our previous observation (11). It was estimated thatunder the conditions used, �8% of the Cdc34 input was re-tained by the GST-ROC1-CUL1 (aa 324–776) complex. Whileremoval of residues 209–236 reduced the binding by 60% (com-pare lanes 4 and 7), further deletions eliminated the interac-tion (lanes 9, 10, 12, and 13). For unknown reasons, Cdc34 (aa1–169) was found to interact with GST substantially, whereasthe other Cdc34 derivatives did not (lane 12). Since the replace-ment of GST by GST-ROC1-CUL1 (aa 324–776) did not furtherincrease the binding of Cdc34 (aa 1–169) (compare lanes 12 and13), the observed interaction between Cdc34 (aa 1–169) andGST-ROC1-CUL1 (aa 324–776) was due to an affinity of thetruncated E2 protein for GST, but not ROC1-CUL1 (aa 324–776). Taken together, these results suggest the presence ofROC1-CUL1-interacting residues within the region spanningamino acids 195–208 of Cdc34. However, the extreme C-termi-nal portion (residues 209–236) plays a significant role in en-hancing the interaction. This is entirely consistent with theobservation that while Cdc34 residues 195–208 were essentialfor the ROC1-CUL1-dependent synthesis of Ub polymers, themaximal activity requires residues 209–236 within the E2protein (Fig. 3D).

A data base search identified putative Cdc34 orthologs fromDrosophila and C. elegans. Sequence analysis reveals an ex-pected conservation in the catalytic Ubc domain among human,Drosophila, C. elegans, and S. cerevisiae Cdc34 proteins (Fig.5). Interestingly, an additional homologous region, correspond-ing to the human Cdc34 residues 170–208, was found amongthese four Cdc34 orthologs (29% similarity at amino acid lev-

els). This suggests that Cdc34 may utilize this evolutionaryconserved region for interacting with the Nedd8-conjugatedROC1-CUL1 core Ub ligase to assemble multi-Ub chains.

Substitution of Nedd8 Charged Surface Amino Acids with theCorresponding Ub Residues Inhibits Nedd8 Activity—To fur-ther understand the role of Nedd8 in activating the ROC1-CUL1 mediated, Cdc34-catalyzed Ub polymerization, wesought to identify Nedd8 amino acid residue(s) that are re-quired for this activity. Comparison of the crystal structuresbetween Nedd8 and Ub identified unique amino acids withinNedd8 that may contribute to its function. Like Ub, Nedd8displays an asymmetric distribution of charged residues thatare organized to form “acidic” and “basic” faces (29). Mostnoticeably, some of these charged Nedd8 residues are con-served among the various Nedd8 orthologs but differ from Ubat the corresponding positions. As illustrated, on helix 1 ofNedd8, Glu28 and Glu31 form an electronegative surface that isnot present on Ub (Fig. 6). There are also Glu12 and Glu14 on �strand 2 that form another electronegative surface. Other no-table differences between Ub and Nedd8 include an Asn to Argsubstitution on residue 25 and a Phe to Lys substitution onresidue 4. Intriguingly, these six charged Nedd8-specific resi-dues (Lys4, Glu12, Glu14, Arg25, Glu28, and Glu31) are arrangedin two surface patches that lie along each side of the Nedd8molecule (Fig. 6), suggesting a possible role for these residuesinvolved in electrostatic interactions with other proteins.

To determine whether residues Lys4, Glu12, Glu14, Arg25,Glu28, and Glu31 were required for Nedd8 function, point mu-tants were generated by site-directed mutagenesis, replacingcharged amino acids with the corresponding Ub residues, des-ignated as K4F, E12T, E14T, R25N, E28A, and E31Q. Mutant

FIG. 5. Alignment of the human Cdc34 protein sequence with three orthologs from S. cerevisiae, Drosophila (Q9VUR4), and C.elegans (CE26258). Sequence alignment was performed using the ClustalX program. Both the identical and conserved amino acids are indicated.The putative Drosophila and C. elegans Cdc34 protein sequences were obtained from the Berkeley Drosophila Genome Project (available on theWorld Wide Web at www.fruitfly.org) and C. elegans Genome Project at the Sanger Center (available on the World Wide Web at www.sanger.ac.uk/Projects/C_elegans/), respectively.

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly522

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

proteins were expressed in bacteria, and the purified Nedd8variants were compared with the wild type protein for theirability to conjugate to CUL1 and for their capacity to activatethe Ub ligase activity of ROC1-CUL1.

Immunoblot analysis revealed that all six purified mutantNedd8 proteins were conjugated to CUL1 (aa 324–776) withsimilar efficiencies compared with the wild type protein (Fig.7A, compare lanes 3 and lanes 4–9). Consistent with our pre-vious observation (21), the conjugation reaction converted�50% of CUL1 (aa 324–776) into two slow migrating speciesconjugated with one or two Nedd8 moieties. Of note, no conju-gate was formed between CUL1 (aa 324–776) and twoNedd8E31Q moieties (Fig. 7A, lane 9). It is presently unclearwhether the ROC1-CUL1 complex conjugated with two Nedd8moieties is more efficient than that with one Nedd8 molecule inactivating Ub polymerization. It should be noted that onlysingle Nedd8 conjugates of CUL1 are detected in cells.

Next, the mutant Nedd8 variants were compared with thewild type protein for their ability to activate the ROC1-CUL1Ub ligase. As shown in Fig. 7B, all of the mutants were lesseffective than the wild type, albeit at varying degrees, in ac-tivating ROC1-CUL1. While the effects of Nedd8K4F and

Nedd8E14T were the most dramatic, reducing the Nedd8 acti-vation function by 4-fold, Nedd8E12T and Nedd8E31Q appearedto possess modest effects, decreasing the Nedd8 activity by lessthan 25%. These results suggest that Nedd8 charged surfaceresidues are critical in activating the ability of ROC1-CUL1 topromote Ub polymerization.

Maintenance of Proper Electrostatic Potential at Positions 14and 25 Is Critical for Nedd8 Activity—We next determinedwhether the Nedd8 activity was critically dependent on thetype of electrostatic potential possessed by the charged surfaceamino acid residues. For this purpose, Nedd8 residues Glu14

and Arg25 were each replaced by a residue of the same chargegroup, or a residue with the opposite electrostatic potential.Purified Nedd8 mutant proteins were compared with the wildtype for their ability to conjugate to CUL1 as well as to activatethe Ub ligase activity of ROC1-CUL1. As shown (Fig. 8A),Nedd8 variants containing aspartate (lane 5) or arginine (lane6) in place of glutamate at position 14 were conjugated to CUL1(aa 324–776) with approximately equal efficiency as the wildtype (lane 3) or Nedd8E14T (lane 4). When examined for theirability to activate the Ub ligase activity of ROC1-CUL1,Nedd8E14T or Nedd8E14R reduced the level of activation by 5- or30-fold, respectively, in comparison with the wild type protein(Fig. 8B, compare lane 3 with lanes 4 and 6). In contrast,Nedd8E14D, maintaining the same charge at position 14, had aminimal effect, reducing the Nedd8 activity by 1.5-fold (lane 5).These results suggest that the presence of an acidic residueand, presumably, its negative charge at position 14 is criticalfor the Nedd8-mediated activation of the ROC1-CUL1 ubiq-uitin ligase.

When Nedd8 residue Arg25 was mutated to lysine or gluta-mate, immunoblot analysis revealed that neither substitutionaffected the conjugation of Nedd8 to CUL1 (aa 324–776) (Fig.9A, lanes 3–6). While Nedd8R25K, retaining the same charge asthe wild type, was as active as the wild type protein (Fig. 9B,compare lanes 3 and 5), Nedd8R25E, containing the oppositecharge at position 25, reduced the level of activation by 10-fold(Fig. 9B, compare lanes 3 and 6). These results strongly supportthe notion that specific types of electrostatic potential at properpositions on the surface of Nedd8 are involved in the activationof ROC1-CUL1 to support Ub polymerization.

DISCUSSION

Distinct Role of Cdc34 in the Assembly of Nedd8-stimulatedPolyubiquitin Chains—In this report, we have shown thatNedd8 selectively activates the Cdc34-catalyzed synthesis ofLys48-linked Ub polymers and that this effect is mediated byNedd8 charged surface residues.

Cdc34 is a member of the class II E2 ubiquitin-conjugatingenzymes, which are characterized by the presence of a C-ter-minal extension in addition to the N-terminally located con-served catalytic domain (Ubc domain) (28). The budding yeastCdc34 is an essential gene product that primarily acts at the G1

to S-phase transition by mediating the ubiquitin-dependentdegradation of the cyclin-dependent kinase inhibitor Sic1 in aprocess that requires the participation of the SCFCdc4-ROC1/Rbx1 E3 ubiquitin ligase (30–33).

We have shown that in the presence of ROC1-CUL1, Ubc4/5is capable of assembling Ub polymers in a reaction that is notstimulated by Nedd8 modification. The Ubc4/5 family of pro-teins, required for stress response, belongs to the class I sub-type E2 conjugating enzymes, which are primarily composed ofthe Ubc core catalytic domain without a C-terminal tail (28).Cdc34 and Ubc4/5 differ in that while the former enzyme cat-alyzes Lys48-linked Ub polymer formation, the latter assemblesboth Lys48- and Lys29-linked multi-Ub chains (5, 22, 23, 27).While the precise role of Lys29-linked chains remains to be

FIG. 6. Nedd8 charged surface residues reside on two distinctsurfaces. The three-dimensional structures of Nedd8 and Ub wereobtained from the PDBTM data base (PDB ID numbers 1NDD for Nedd8and 1UBI for Ub) at the Research Collaboratory for Structural Bioin-formatics Web site and visualized using the Swiss-PDBViewer soft-ware. The final image was rendered using the POV-ray 3 software. Theside chains for Nedd8 amino acids Lys4, Glu12, Glu14, Arg25, Glu28, andGlu31 as well as the corresponding Ub residues are displayed asindicated.

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 523

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

determined, it is evident, however, that uniform Lys29-linkedchains cannot be broadly used in proteolytic targeting. This isbecause yeast cells expressing UbK29R as the sole source of Ubexhibit unaltered proteolytic competence (35). In contrast,yeast cells induced to express UbK48R are arrested in late G2 orM phase of the cell cycle and are defective in the turnover ofshort lived proteins, demonstrating that the Lys48-linkedchains are the principal signal for targeting proteins for deg-radation by the 26 S proteasome (reviewed in Ref. 34). Itremains to be determined whether Cdc34 functions as thepredominant E2 conjugating enzyme for SCF-ROC1 in vivo toassemble Lys48-linked polyubiquitin chains for targeting sub-strate degradation.

Our data is consistent with the hypothesis that Nedd8 spe-cifically up-regulates the Cdc34-dependent proteolytic path-way. We demonstrate that Nedd8 acts to increase the rate andefficiency with which Cdc34 and ROC1-CUL1 polymerize Ub(Fig. 1). This is in keeping with the observed effects of Nedd8 onthe Cdc34-catalyzed ubiquitination of I�B� in vitro. Reed et al.(18) have shown that the SCF�-TRCP complex containing aCUL1K720R mutant subunit exhibited a decreased efficiency inthe ubiquitination of I�B� with both Cdc34 and UbcH5a pres-ent. However, the overall pattern of polyubiquitin chains pro-duced by this non-Nedd8-modified E3 complex resembles thoseformed by the Nedd8-conjugated complex. Consistent with this,we have observed that in the presence of Cdc34, while SCF�-

TRCP-ROC1 conjugated with Nedd8 promotes the ubiquitina-

tion of I�B� more efficiently than the mutant SCF�-TRCP-ROC1complex containing CUL1K720R, the polyubiquitin chains gen-erated by both complexes are similar (data not shown). Thesedata suggest that in the Cdc34-catalyzed ubiquitination reac-tions, Nedd8 functions to increase the efficiency of polyubiq-uitin chain synthesis.

Role of the C-terminal Tail of Human Cdc34 in PolyubiquitinChain Assembly—The distinct function of S. cerevisiae Cdc34in cell cycle control has been attributed to its C-terminal tail(amino acids 170–295). Both the Ellison (24) and Gonda (25)laboratories have shown that a chimeric Ubc2-Cdc34 protein,containing Ubc2 residues 1–151 (the Ubc domain) and Cdc34residues 171–244, possesses both Ubc2 and Cdc34 activities invivo. In subsequently published studies, the Ellison (36) andGoebl (26) groups have further defined residues 171–209 as aminimal motif (called CCD) that is required for Cdc34 functionin vivo and for binding to the SCF components. These findingssuggest a unique role for the C terminus of S. cerevisiae Cdc34in mediating its cell cycle function by interacting with the SCF.

Previous studies have shown that the human Cdc34 cDNAcan functionally substitute for the S. cerevisiae cdc34 gene (37),demonstrating a functional conservation between the two or-thologs. In this study, we presented evidence implicating thatthe C terminus of human Cdc34 contains multiple biochemicalactivities (summarized in Fig. 4B). Based on results with bothyeast (27) and human (this study) Cdc34, it is evident that thisE2 enzyme possesses an intrinsic ability to assemble Ub

FIG. 7. Substitution of Nedd8charged surface residues with thecorresponding Ub residues inhibitsNedd8 activity. (GST-ROC1)-FLAG-CUL1 (aa 324–776), immobilized on glu-tathione-Sepharose 4B, was modified bypurified Nedd8 wild type protein or mu-tant variants as indicated (0.6 �g of pro-tein used in each case) using the proce-dure described under “ExperimentalProcedures.” The resulting beads were in-cubated with the ubiquitination compo-nents including 0.5 �g of Cdc34, 20 ng ofE1, 3 �g of 32P-Ub, and other componentsas described under “Experimental Proce-dures.” Aliquots of the reaction productswere separated by 10% SDS-PAGE fol-lowed by immunoblot analysis using anti-FLAG antibodies (A) or by direct auto-radiography (B). Production of highmolecular mass Ub polymers (�100 kDa)were quantitated using a PhosphorIm-ager and shown in bar graphs. The activ-ity shown in lane 2 was considered as thebasal value that had been subtractedwhen the wild type and mutant Nedd8were compared for their ability to activatethe Ub ligase activity of ROC1-CUL1 (see“Results”).

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly524

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

chains. In humans, this activity appears to require Cdc34amino acid residues 170–194. The Ellison group has previouslyproposed a Cdc34 dimerization model to account for its abilityto catalyze the Ub ligation reaction (36). It was suggested thatCCD (residues 171–209) directly contacts the catalytic domainof the other monomer, bringing two conjugated Ub moleculesinto proximity for ligation. In support of this, cross-linkinganalysis indicates a critical role of CCD for the yeast Cdc34oligomerization reaction (36). Whether the human Cdc34 resi-dues 170–194 are directly involved in an intermolecular inter-action with the catalytic domain of another Cdc34 monomerremains to be determined.

However, in the absence of ROC1-CUL1, the Ub chains as-sembled by the human Cdc34 are both inefficient and of limitedlengths. Evidence provided by this study and previous worksstrongly suggests that ROC1-CUL1 contacts Cdc34 at residues195–208 and that this interaction is critical for the assembly ofextensive polyubiquitin chains. First, while human Cdc34 (aa1–194) catalyzed autoubiquitination with an efficiency compa-

rable with the wild type and Cdc34 (aa 1–208) (Fig. 3C), it wasnot activated by ROC1-CUL1 to form Ub chains of extensivelengths (Fig. 3D). Second, results from a GST-based pull-downexperiment indicated that human Cdc34 residues 195–208were required for a stable association between ROC1-CUL1and the E2 protein (Fig. 4A). Third, GST-fused CCD is suffi-cient to interact with the SCF in yeast cells (26). Fourth,physical analysis has shown that the CCD domain is proteo-lytically accessible and structurally distinct from the C-termi-nal portion of the tail of yeast Cdc34 (36), suggesting an avail-ability of CCD for interactions with other protein(s), such asthe ROC1-CUL1 complex. Last, a significant evolutionary con-servation is found in the region corresponding to the humanCdc34 residues 170–208 (Fig. 5).

Based on data presented in this report, while the humanCdc34 residues 209–236 played no role in autoubiquitination,they were required for the efficient synthesis of Ub polymers inthe presence of ROC1-CUL1. Intriguingly, while Cdc34 (aa1–208) retained nearly 40% of the capacity of the wild typeprotein to bind to ROC1-CUL1 (Fig. 4A), it only possessed 1% ofthe wild type level of activity in promoting ROC1-CUL1-de-

FIG. 8. Requirement of a negatively charged side chain onNedd8 residue 14 for activating the Ub polymerization activityof ROC1-CUL1. (GST-ROC1)-FLAG-CUL1 (aa 324–776), immobilizedon glutathione-Sepharose 4B, was modified by purified Nedd8 wild typeprotein or mutant derivatives as indicated (0.6 �g of protein used ineach case) using a procedure as described under “Experimental Proce-dures.” The efficiency with which the various Nedd8 proteins wereconjugated to FLAG-CUL1 (aa 324–776) (shown in A by immunoblot)and the efficiency with which they activated the Ub ligase activity of theROC1-CUL1 (shown in B by autoradiography) were determined asdescribed in the legend to Fig. 7. The activity shown in lane 2 wasconsidered as the basal value that had been subtracted when the wildtype and mutant Nedd8 were compared for their ability to activate theUb ligase activity of ROC1-CUL1 (see “Results”).

FIG. 9. Requirement of a positively charged side chain onNedd8 residue 25 for activating the Ub polymerization activityof ROC1-CUL1. Effects of Nedd8 Arg25 mutants on conjugation toFLAG-CUL1 (aa 324–776) (shown in A by immunoblot) and on theactivation of the Ub ligase activity of the ROC1-CUL1 (shown in B byautoradiography) were determined as described in Fig. 7. The activityshown in lane 2 was considered as the basal value that had beensubtracted when the wild type and mutant Nedd8 were compared fortheir ability to activate the Ub ligase activity of ROC1-CUL1 (see“Results”).

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 525

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

pendent polyubiquitin chain assembly (Fig. 3D). These datasuggest a role for Cdc34 residues 209–236 in stabilization ofthe interaction between Cdc34 and ROC1-CUL1 and in facili-tating the efficient assembly of extensive Ub polymers.

Taken together, the results from this study help identifycritical regions within the C terminus of human Cdc34 forcooperation with ROC1-CUL1 and Nedd8 for the polyubiquitinchain assembly. However, it remains unanswered how the con-tacts between Cdc34 and ROC1-CUL1 lead to Ub polymeriza-tion. Ellison’s group (36) has noted that the interaction ofCdc34 with itself in vitro is weak, and they postulated thatsuch an interaction might be stabilized in vivo by other factors.Whether ROC1-CUL1 acts to enhance the association betweenCdc34 molecules for Ub chain assembly remains an intriguingpossibility to be explored in future studies.

As determined by previous studies (5, 7, 8, 10), Ub ligationproducts synthesized by ROC1-CUL1 and Cdc34 include bothunanchored free chains and autoubiquitinated E2. We do notknow, however, the distribution between these two species.Further studies are required to delineate the mode of action ofROC1-CUL1. Does it primarily promote the elongation of Ubchains initially assembled on Cdc34 or function to assemblefree Ub polymers, or both?

Role of Nedd8 in the Activation of Cdc34-catalyzed Ub ChainAssembly—We have presented evidence that Nedd8 chargedsurface residues Lys4, Glu12, Glu14, Arg25, Glu28, and Glu31 arerequired for the stimulation of Ub polymerization. Moreover,maintenance of the proper charges at amino acid positions 14and 25 are necessary for retaining wild type levels of activity.These findings suggest that specific types of electrostatic po-tential at proper positions on the surface of Nedd8 mediate thefunction of Nedd8 to activate the ability of ROC1-CUL1 insupporting Ub polymerization by Cdc34.

The structure of the c-Cbl-UbcH7 complex (38) provides in-sights as to how the RING domain interacts with an E2. Thec-Cbl RING domain provides a shallow groove into which thetips of the L1 and L2 loops of UbcH7 bind. The ROC1 RINGfinger may form a similar groove. Ubc4/5, of the class I E2enzymes without a tail, may efficiently contact the “groove.”However, Cdc34, containing a long C-terminal extension, maybind the groove inefficiently. This may explain our observationthat in the absence of Nedd8 modification, Ubc5c catalyzed Ubpolymerization more rapidly than Cdc34 with equal amounts ofROC1-CUL1 present (Fig. 1).

However, the presence of a Nedd8 moiety, conjugated toCUL1 at Lys720, may significantly alter the kinetics of theinteraction between the ROC1 RING finger and Cdc34. Insupport of this, we have observed that the Nedd8-conjugatedROC1-CUL1 promoted the Cdc34-catalyzed Ub polymerizationmore rapidly than the untreated complex, whereas this modi-fication had no effect on the Ubc5c-mediated multi-Ub chainassembly (Fig. 1). It is therefore conceivable that Nedd8 mayutilize its charged surface residues, such as Glu14 and Arg25, tobind to the C-terminal tail of Cdc34, presumably at a regionspanning amino acids 170–208. However, despite repeated at-tempts using GST pull-down assays, we have been unsuccess-ful in detecting any significant effect of Nedd8 modification onthe interaction between ROC1-CUL1 and Cdc34 either in itsfree or Ub-conjugated forms (the latter was produced by incu-bating Cdc34 with ATP, Ub, and E1). In light of these findings,we propose that Nedd8 may mediate an electrostatic interac-tion with Cdc34 that transiently stabilizes the association be-tween the RING “groove” and the E2 protein. Alternatively,Nedd8 charged surface residues might facilitate the Ub trans-fer reaction in a mechanism yet to be determined. We favor theformer model, since the Nedd8 effect is critically dependent on

the concentrations of both ROC1-CUL1 and Cdc34. Elevatedlevels of ROC1-CUL1 (21) or Cdc34 (data not shown) can obvi-ate the requirement of Nedd8 for the efficient synthesis of Ubpolymers in vitro. These observations can be explained by pos-tulating that high concentrations of ROC1-CUL1 or Cdc34promote a more efficient interaction between the two compo-nents, thus leading to Nedd8-independent synthesis of Ub poly-mers. It may prove to be informative to analyze the effects ofNedd8 modification on the interaction between ROC1-CUL1and Cdc34 under equilibrium conditions using techniques suchas BIAcore.

While this study has demonstrated a role for Nedd8 in in-creasing the efficiency of polyubiquitin chain assembly inCdc34-catalyzed reactions, Kawakami et al. (39) have recentlyshown that Nedd8 helps recruit Ubc4 to ROC1-SCF�-TRCP forthe efficient ubiquitination of I�B�. We have previously dem-onstrated that Cdc34 and Ubc4/5 produce distinct Ub conjugatepatterns in the ubiquitination of I�B� (10), suggesting thatthese two different classes of E2 act differently in assemblingpolyubiquitin chains. Further studies are required to deter-mine whether Nedd8 exhibits different modes of action to ac-tivate ubiquitination reactions catalyzed by divergent E2 con-jugating enzymes.

Acknowledgments—We thank M. Pagano for human Cdc34 cDNAand Jose Trincao for expert assistance in FPLC gel filtration analysis.

REFERENCES

1. Hochstrasser, M. (1998) Genes Dev. 12, 901–9072. Hori, T., Osaka, F., Chiba, T., Miyamoto, C., Okabayashi, K., Shimbara, N.,

Kato, S., and Tanaka, K. (1999) Oncogene 18, 6829–68343. Gong, L., and Yeh, E. T. (1999) J. Biol. Chem. 274, 12036–120424. Kamura, T., Conrad, M. N., Yan, Q,. Conaway, R. C., and Conaway, J. W.

(1999) Genes Dev. 13, 2928–29335. Tan, P., Fuchs, S. Y., Chen, A., Wu, K., Gomez, C., Ronai, Z., and Pan, Z.-Q.

(1999) Mol. Cell 3, 527–5336. Ohta, T., Michel, J. J., Schottelius, A. J., and Xiong, Y. (1999) Mol. Cell 3,

535–5417. Skowyra, D., Koepp, D. M., Kamura, T., Conrad, M. N., Conaway, R. C.,

Conaway, J. W., Elledge, S. J., and Harper, J. W. (1999) Science 284,662–665

8. Seol, J. H., Feldman, R. M., Zachariae, W., Shevchenko, A., Correll, C. C.,Lyapina, S., Chi, Y., Galova, M., Claypool, J., Sandmeyer, S., Nasmyth, K.,and Deshaies, R. J. (1999) Genes Dev. 13, 1614–1626

9. Kamura, T., Koepp, D. M., Conrad, M. N., Skowyra, D., Moreland, R. J.,Iliopoulos, O., Lane, W. S., Kaelin, W. G., Jr., Elledge, S. J., Conaway, R. C.,Harper, J. W., and Conaway, J. W. (1999) Science 284, 657–661

10. Wu, K., Fuchs, S. Y., Chen, A., Tan, P., Gomez, C., Ronai, Z., and Pan, Z.-Q.(2000) Mol. Cell. Biol. 20, 1382–1393

11. Chen, A., Wu, K., Fuchs, S. Y., Tan, P., Gomez, C., and Pan, Z.-Q. (2000)J. Biol. Chem. 275, 15432–15439

12. Lammer, D., Mathias, N., Laplaza, J. M., Jiang, W., Liu, Y., Callis, J., Goebl,M., and Estelle, M. (1998) Genes Dev. 12, 914–926

13. Osaka, F., Saeki, M., Katayama, S., Aida, N., Toh-e, A., Kominami, K., Toda,T., Suzuki, T., Chiba, T., Tanaka, K., and Kato, S. (2000) EMBO J. 19,3475–3484

14. Handeli, S., and Weintraub, H. (1992) Cell 71, 599–61115. Pozo, J. C., Timpte, C., Tan, S., Callis, J., and Estelle, M. (1998) Science 280,

1760–176316. Lyapina, S., Cope, G., Shevchenko, A., Serino, G., Tsuge, T., Zhou, C., Wolf,

D. A., Wei, N., Shevchenko, A., and Deshaies, R. J. (2001) Science 292,1382–1385

17. Schwechheimer, C., Serino, G., Callis, J., Crosby, W. L., Lyapina, S., Deshaies,R. J., Gray, W. M., Estelle, M., and Deng, X. W. (2001) Science 292,1379–1382

18. Read, M. A., Brownell, J. E., Gladysheva, T. B., Hottelet, M., Parent, L. A.,Coggins, M. B., Pierce, J. W., Podust, V. N., Luo, R. S., Chau, V., andPalombella, V. J. (2000) Mol. Cell. Biol. 20, 2326–2333

19. Podust, V. N., Brownell, J. E., Gladysheva, T. B., Luo, R. S., Wang, C., Coggins,M. B., Pierce, J. W., Lightcap, E. S., and Chau, V. (2000) Proc. Natl. Acad.Sci. U. S. A. 97, 4579–4584

20. Morimoto, M., Nishida, T., Honda, R., and Yasuda, H. (2000) Biochem. Bio-phys. Res. Commun. 270, 1093–1096

21. Wu, K., Chen, A., and Pan, Z.-Q. (2000) J. Biol. Chem. 275, 32317–3232422. Mastrandrea, L. D., You, J., Niles, E. G., and Pickart, C. M. (1999) J. Biol.

Chem. 274, 27299–2730623. You, J., and Pickart, C. M. (2001) J. Biol. Chem. 276, 19871–1987824. Silver, E. T., Gwozd, T. J., Ptak, C., Goebl, M., and Ellison, M. J. (1992) EMBO

J. 11, 3091–309825. Kolman, C. J., Toth, J., and Gonda, D. K. (1992) EMBO J. 11, 3081–309026. Mathias, N., Steussy, C. N., and Goebl, M. G. (1998) J. Biol. Chem. 273,

4040–404527. Banerjee, A., Gregori, L., Xu, Y., and Chau, V. (1993) J. Biol. Chem. 268,

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly526

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

5668–567528. Scheffner, M., Smith S., and Jentsch, S. (1998) in Ubiquitin and the Biology of

the Cell (Peters, J.-M., Harris, J. R., and Finley, D., eds) pp. 65–98, Plenum,New York

29. Whitby, F. G., Xia, G., Pickart, C. M., and Hill, C. P. (1998) J. Biol. Chem. 273,34983–34991

30. Dutcher, S. K., and Hartwell, L. H. (1982) Genetics 100, 175–18431. Goebl, M. G., Yochem, J., Jentsch, S., McGrath, J. P., Varshavsky, A., and

Byers, B. (1988) Science 241, 1331–133532. Skowyra, D., Craig, K., Tyers, M., Elledge, S. J., and Harper, J. W. (1997) Cell

91, 209–21933. Feldman, R. M. R., Correll, C. C., Kaplan, K. B., and Deshaies, R. J. (1997) Cell

91, 221–230

34. Pickart, C. M. (1998) in Ubiquitin and the Biology of the Cell (Peters, J.-M.,Harris, J. R., and Finley, D., eds) pp. 19–63, Plenum, New York

35. Spence, J., Sadis, S., Haas, A. L., and Finley, D. (1995) Mol. Cell. Biol. 15,1265–1273

36. Ptak, C., Prendergast, J. A., Hodgins, R., Kay, C. M., Chau, V., and Ellison,M. J. (1994) J. Biol. Chem. 269, 26539–26545

37. Plon, S. E, Leppig, K. A., Do, H. N., and Groudine, M. (1993) Proc. Natl. Acad.Sci. U. S. A. 90, 10484–10488

38. Zheng, N., Wang, P., Jeffrey, P. D., and Pavletich, N. P. (2000) Cell 102,533–539

39. Kawakami, T., Chiba, T., Suzuki, T., Iwai, K., Yamanaka, K., Minato, N.,Suzuki, H., Shimbara, N., Hidaka, Y., Osaka, F., Omata, M., and Tanaka,K. (2001) EMBO J. 20, 4003–4012

Nedd8 Activates Cdc34-catalyzed Polyubiquitin Chain Assembly 527

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from

Kenneth Wu, Angus Chen, Peilin Tan and Zhen-Qiang PanSurface Residues for Efficient Polyubiquitin Chain Assembly Catalyzed by Cdc34

The Nedd8-conjugated ROC1-CUL1 Core Ubiquitin Ligase Utilizes Nedd8 Charged

doi: 10.1074/jbc.M108008200 originally published online October 23, 20012002, 277:516-527.J. Biol. Chem. 

  10.1074/jbc.M108008200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/277/1/516.full.html#ref-list-1

This article cites 37 references, 27 of which can be accessed free at

by guest on Novem

ber 3, 2020http://w

ww

.jbc.org/D

ownloaded from