The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods...
Transcript of The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods...
![Page 1: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/1.jpg)
ARTICLE
The GxSxG motif of Arabidopsis monoacylglycerol lipase(MAGL6 and MAGL8) is essential for their enzyme activities
Ryeo Jin Kim1 . Mi Chung Suh1
Received: 8 September 2016 / Accepted: 14 October 2016 / Published online: 25 October 2016
� The Korean Society for Applied Biological Chemistry 2016
Abstract Monoacylglycerol lipase (MAGL) catalyzes the
hydrolysis of monoacylglycerols (MAG) to free fatty acids
and glycerol, which is the last step of triacylglycerol
breakdown. Among sixteen members, Arabidopsis thaliana
MAGL6 (AtMAGL6) and AtMAGL8 showed strong lipase
activities, but several AtMAGLs including AtMAGL16
displayed very weak activities (Kim et al. in Plant. J
85:758–771, 2016). To understand the internal factors that
influence Arabidopsis MAGL activities, this study inves-
tigated the significance of ‘GxSxS motif,’ which is con-
served in MAGLs. First, we observed that the presence of a
serine protease inhibitor, phenylmethylsulfonyl fluoride,
decreased the enzyme activity of AtMAGL6 and
AtMAGL8 by IC50 values of 2.30 and 2.35, respectively.
Computational modeling showed that amino acid changes
of the GxSxG motif in AtMAGL6 and AtMAGL8 altered
the nucleophilic elbow structure, which is the active site of
MAGLs. Mutating the GxSxG motif in the recombinant
maltose binding protein (MBP):AtMAGL6 and MBP:At-
MAGL8 proteins to SxSxG, GxAxG, and GxSxS motifs
completely demolished the activities of the mutant
MAGLs. In contrast, no significant differences were
observed between the activities of AtMAGL16 wild type
form harboring the SxSxG motif, and mutant AtMAGL16
containing the GxSxG motif. These results revealed that
the glycine and serine residues of the GxSxG motif are
essential for AtMAGL6 and AtMAGL8 enzyme activities,
and that AtMAGL16 may not be involved in the hydrolysis
of lipid substrates.
Keywords Arabidopsis thaliana � GxSxG motif �Monoacylglycerol lipase (MAGL) � Storage oil �Triacylglycerol mobilization
Introduction
Triacylglycerol (TAG), a storage oil, is found in seeds, fruit
mesocarp, pollen grains, and senescing leaves (Huang
1992; Kaup et al. 2002; Kim et al. 2002). During seed and
pollen maturation, TAG synthesized on the endoplasmic
reticulum (ER) accumulates in the oil body, surrounded by
a single membrane through blebbing of the outer mem-
brane of the ER (Huang 1996; Li-Beisson et al. 2013).
When seeds and pollen grains germinate, the stored TAG is
mobilized to supply carbon and energy sources for growing
tissues (Graham 2008). In Arabidopsis thaliana, the initial
step of TAG breakdown that produces diacylglycerol
(DAG) and a free fatty acid from TAG is mediated by TAG
lipases, SUGAR-DEPENDENT1 (SDP1) or SDP1-LIKE
(SDP1L) (Eastmond 2006; Kelly et al. 2011; Theodoulou
and Eastmond 2012). DAG lipase, which catalyzes the
hydrolysis of DAG to MAG and free fatty acid, has not yet
been identified; but the molecular and biochemical char-
acterizations of MAGLs that produce the glycerol and free
fatty acid from MAG were recently reported (Kim et al.
2016). Fourteen recombinant MAGL proteins in-frame
with maltoase binding protein (MBP) were purified as a
soluble form, when 16 MAGL genes, which are present in
Arabidopsis acyl-lipid metabolism (http://aralip.plantbiol
ogy.msu.edu), were expressed in Escherichia coli. Upon
verifying lipase activities using a non-esterified fatty acid
(NEFA)-HR (2) colorimetric kit, AtMAGL6 and
AtMAGL8 exhibited nearly homologous activity to that of
& Mi Chung Suh
1 Department of Bioenergy Science and Technology, Chonnam
National University, Gwangju 61186, Republic of Korea
123
Appl Biol Chem (2016) 59(6):833–840 Online ISSN 2468-0842
DOI 10.1007/s13765-016-0232-1 Print ISSN 2468-0834
![Page 2: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/2.jpg)
human (Homo sapiens) MAGL (HsMAGL). Conversely,
the rest of the recombinant MAGL proteins exhibited rel-
atively low lipase activities (Kim et al. 2016). Therefore,
the internal factors that are able to affect Arabidopsis
MAGL activities should be further investigated.
The catalytic triad, which refers to three amino acid
residues, serine (S) in the GxSxG motif, aspartic acid (D),
and histidine (H), is known to act together at the active site
of hydrolase and transferase enzymes, such as proteases,
acylases, and lipases (Brumlik and Buckley 1996; Polgar
2005). The amino acid residues in the GxSxG motif of
mouse (Mus musculus) MAG lipase were reported to be
essential for their enzyme activity via site-directed muta-
genesis (Karlsson et al. 1997). Comparative analysis of
protein models of human MAG lipase to those of
chloroperoxidase F having substrate specificity for small
ions, and dog (Canis lupus) gastric and human pancreatic
lipases that utilize TAG as a specific substrate, revealed
that human MAG lipase may harbor substrate specificity
for other molecules than small ions and TAG, based on
their protein structural differences around the nucleophilic
serine residue in the GxSxG motif (Labar et al. 2010).
Although 9 of 11 Arabidopsis MAGL members harbor the
GxSxG motif, interestingly the levels of their MAG lipase
activities were very diverse (Kim et al. 2016). In particular,
AtMAGL14 and AtMAGL16, which contain the SxSxG
motif instead of the GxSxG motif, also displayed very low
lipase activities (Kim et al. 2016).
Therefore, to investigate the importance of the GxSxG
motif in Arabidopsis MAGLs, the enzyme activity of
Arabidopsis MAGLs was first measured in the presence of
a serine protease inhibitor, phenylmethylsulfonyl fluoride
(PMSF). Computational modeling of Arabidopsis MAGLs
(AtMAGL-6, -8, and -16) and their mutated proteins with
amino acid substitutions in a GxSxG motif suggested that
the GxSxG motif might be important for the enzymatic
activity of MAG lipases. More specifically, the GxSxG
motif of AtMAGL6 and AtMAGL8 was mutated to the
SxSxG, GxAxG, or GxSxS motif by PCR-based site-di-
rected mutagenesis. In addition, the first serine residue of
the SxSxG motif in AtMAGL16 was substituted by a
glycine residue, thereby creating the recombinant
AtMAGL16 protein with the GxSxG motif. As a result, we
observed that two glycine residues and one serine residue
in the GxSxG motif of AtMAGL6 and AtMAGL8 are vital
for their lipase activities. Even though the AtMAGL16 has
the GxSxG motif, no significant elevation in lipase enzyme
activity was observed, suggesting that there might be
unknown essential domains that influence the enzymatic
activity of AtMAGL16, or AtMAGL16 may act on other
substrates than lipid substrates, such as MAG. To the best
of our knowledge, this is the first report to demonstrate that
the GxSxG motif might be essential for plant MAG lipases.
Materials and methods
Site-directed mutagenesis of Arabidopsis MAGLs
We carried out a point mutation using an overlap extension
PCR to substitute the amino acid residues in the GxSxG
motif of AtMAGL6 and AtMAGL8 with SxSxG, GxAxG,
and GxSxS motifs (Ho et al. 1989). The mutagenic primers
were designed for substitution of the nucleotide sequences:
glycine to serine residues, or serine to alanine or glycine
residues (Table 1). According to Ho et al. (1989), three-step
PCR was carried out with the forward, reverse, and muta-
genic primers, and with MBP:AtMAGL6, MBP:AtMAGL8,
MBP:AtMAGL16, and MBP:HsMAGL clones as a template
(Kim et al. 2016): (1) the 50-mutated PCR fragments were
amplified with the forward and mutagenic reverse primers;
(2) the 30-mutated PCR fragments were amplified with the
mutagenic forward and reverse primers; and (3) the mutated
full-length PCR fragments were amplified with the forward
and reverse primers using the obtained 50- and 30-mutated
fragments as templates. The mutated AtMAGL6,
AtMAGL8, and AtMAGL16 PCR fragments were cloned in
the BamHI/PstI or BamHI/SalI enzyme sites of the pMAGL-
C2 vector (New England Biolabs, Hitchin, UK).
Purification of recombinant proteins from E. coli
MBP, MBP:HsMAGL, MBP:AtMAGL6, MBP:AtMAGL6_
G111S, MBP:AtMAGL6_S113A, MBP:AtMAGL6_G115S,
MBP:AtMAGL8, MBP:AtMAGL8_G117S, MBP:AtMAGL8_
S119A, MBP:AtMAGL8_G121S, MBP:AtMAGL16, and
MBP:AtMAGL16_S139G vectors were transformed into
E. coliBL21 (DE3)-RIL strains (Kim et al. 2016). At an OD of
0.6–0.7, theE. coli cells were induced with 0.5 mM isopropyl-
b-D-thiogalactopyranoside. After 12 h of incubation at 37 �C,
E. coli cells were harvested and resuspended in buffer
(200 mM NaCl, 20 mM Tris–HCl, pH 7.4, 10 mM b-mer-
captoethanol, and 1 mM EDTA). After the addition of 100 lg
mL-1 lysozyme (Sigma-Aldrich, St. Louis, MO, USA),
resuspended cells were incubated on ice for 30 min. Incubated
cells were lysed on ice with a Vibra-Cell sonicator (Sonics and
Materials Inc., Newtown, CT, USA). MBP and MBP:MAGL
proteins were purified using amylose resin (New England
BioLabs) and electrophoresed on 12 % SDS–polyacrylamide
gels. Proteins were visualized by staining the gel with 0.2 %
Coomassie Brilliant Blue R-250 (Bio-Rad, Hercules, CA,
USA).
Measurement of MAGL activity
The lipase assay was performed as previously described by
Kim et al. (2016). The MBP:MAGL proteins were
834 Appl Biol Chem (2016) 59(6):833–840
123
![Page 3: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/3.jpg)
quantified using the Bradford methods (Bradford 1976).
The purified MBP:MAGL proteins (0.1 lg) were incubated
in 100 ll of 50 mM sodium phosphate buffer (pH 8.0) or
glycine–NaOH buffer (pH 9.0), 0.2 % Triton X-100, and
150 lM MAG (M7640; Sigma-Aldrich) containing an
linoleic acid at the sn-1 position for 5 min at 30 �C. The
released NEFAs were measured with the commercial
NEFA-HR kit (Wako Pure Chemicals, Osaka, Japan), using
Synergy H1 Hybrid Readers (BioTek, Winooski, USA) at
546 nm.
Inhibition assays
The MBP, MBP:HsMAGL, and MBP:AtMAGL proteins
(0.1 lg) were preincubated with a PMSF inhibitor for
10 min at 37 �C in assay buffer (50 mM sodium phosphate
buffer, pH 8.0, or glycine–NaOH buffer, pH 9.0).
Linoleoylglycerol (sn-1 MAG; M7640; Sigma-Aldrich)
substrates were emulsified at 0.2 % Triton X-100 by son-
ication for 30 s with three repeats. MAG substrates
(150 lM in final concentration) were added to the prein-
cubated samples, and the reaction mixtures were incubated
for an additional 5 min at 30�C. The released NEFA
products were measured with the NEFA-HR colorimetric
method assay kit, using Synergy H1 Hybrid Readers at
546 nm.
Prediction of 3-dimensional protein structures
The crystal structure of a human MAGL (PDB ID: 3HJU;
http://www.rcsb.org/pdb/) was used as a template for the
computational modeling. The modeling of AtMAGLs and
their mutated proteins was performed using the Protein
Homology/analogY Recognition Engine V 2.0 program
(PHYRE2; http://www.sbg.bio.ic.ac.uk/phyre2). Three-di-
mensional (3D) protein graphic images were produced
using the UCSF Chimera version 1.10.2 program (http://
www.cgl.ucsf.edu/chimera).
Results and discussion
Phylogenetic relationships of MAGLs
between Arabidopsis and other species
Given that there have been few studies on plant MAGLs,
we compared the phylogenetic relationship between Ara-
bidopsis and other species MAGLs. After obtaining the
amino acid sequences of human, mouse, rat (Rattus
norvegicus), and yeast (Saccharomyces cerevisiae) MAGL
genes from NCBI (http://www.ncbi.nlm.nih.gov), we con-
ducted multiple alignments on them with the amino acid
sequences of AtMAGL6, AtMAGL8, and AtMAGL16
using ClustalW (http://www.genome.jp/tools/clustalw/)
Table 1 List of primers used in
this studyPrimer names Sequence information (50 to 30) Tm (�C)
AtMAGL6_BamH1_F GGAGGATCCATGGTTATGTATGAAGAGGATTTTGTGTTG 58
AtMAGL6_Pst1_R GCCCTGCAGTTATTTATGCTTCAAGAATCCATCATG 58
AtMAGL6_SxSxG_F AGGTTCCTACTTTCTGAATCCATGGGA 58
AtMAGL6_SxSxG_R TCCCATGGATTCAGAAAGTAGGAACCT 58
AtMAGL6_GxAxG_F CTACTTGGAGAAGCAATGGGAGGAGCA 58
AtMAGL6_GxAxG_R TGCTCCTCCCATTGCTTCTCCAAGTAG 58
AtMAGL6_GxSxS_F GGAGAATCCATGTCAGGAGCAGTTGTG 58
AtMAGL6_GxSxS_R CACAACTGCTCCTGACATGGATTCTCC 58
AtMAGL8_BamH1_F GGAGGATCCATGGCAAGTGAAACAGAGAACATCAAG 58
AtMAGL8_Pst1_R GCCCTGCAGCTACCCTTTCAAAGGAATACCATCATTTTTA 58
AtMAGL8_SxSxG_F AGGTTCTTGTTATCTGAATCAATGGGA 58
AtMAGL8_SxSxG_R TCCCATTGATTCAGATAACAAGAACCT 58
AtMAGL8_GxAxG_F TTGTTAGGAGAAGCAATGGGAGGAGCA 58
AtMAGL8_GxAxG_R TGCTCCTCCCATTGCTTCTCCTAACAA 58
AtMAGL8_GxSxS_F GGAGAATCAATGTCAGGAGCAGTGCTT 58
AtMAGL8_GxSxS_R AAGCACTGCTCCTGACATTGATTCTCC 58
AtMAGL16_BamH1_F GGAGGATCCATGGGGTTGCATCCAATTTCC 58
AtMAGL16_Sal1_R CCGGTCGACCTAAGCTGCTCCTCCATCAACG 58
AtMAGL16_Sal1_R CCGGTCGACCTAAGCTGCTCCTCCATCAACG 58
AtMAGL16_GxSxG_F TGTTTTCTCTACGGTGAATCCCTAGGC 58
AtMAGL16_GxSxG_R GCCTAGGGATTCACCGTAGAGAAAACA 58
Appl Biol Chem (2016) 59(6):833–840 835
123
![Page 4: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/4.jpg)
and subsequently generated their phylogenetic tree using
MEGA5.2 (Tamura et al. 2011). In Fig. 1A, the catalytic
triad was conserved in MAGLs from all species tested,
while the GxSxG lipase motif was shown in every MAGL
except AtMAGL16. In addition, the phylogenetic tree in
Fig. 1B showed that yeast MAGL branched into mam-
malian and plant MAGLs. The amino acid sequences of
mouse and rat MAGLs have approximately 92 % identity,
while the former and the latter have approximately 84 and
84 % identity with human MAGL, respectively. Ara-
bidopsis MAGL6 and MAGL8 have approximately 74 %
identity with each other, whereas they showed relatively
low identity (34–35 %) with AtMAGL16.
Computational modeling of Arabidopsis MAGLs
and their mutated proteins
To investigate the tertiary structure of the narrow region sur-
rounding the GxSxG motif in Arabidopsis MAGLs, compu-
tational modeling of Arabidopsis MAGL and their mutated
proteins was carried out using HsMAGL protein structure
(Labar et al. 2010) as a template and the PHYRE2 program.
The tertiary protein structure images were visualized by the
UCSF Chimera program. Figure 2A and B show the ribbon
structures of HsMAGL and AtMAGL8 proteins harboring the
GxSxG motif and Asp (D) and His (H) residues. Through a
cross-section of 3-dimensional AtMAGL6 and AtMAGL8
structures, a U-shaped nucleophilic elbow structure around
the nucleophilic serine residue in the GxSxG motif is high-
lighted (Fig. 2C, G). When the GxSxG motif in AtMAGL6
and AtMAGL8 proteins was replaced with the SxSxG,
GxAxG, or GxSxS motif, the shape of the nucleophilic elbow
around the nucleophilic serine changed to a wider W shape
(Fig. 2D–F, H–J). In addition, when the SxSxG motif of
AtMAGL16 was substituted with the GxSxG motif, the size of
the wide nucleophilic elbow reduced, but did not completely
recover to the U-shaped nucleophilic elbow structure
(Fig. 2K, L). Therefore, the computational modeling of Ara-
bidopsis MAGLs and their mutated proteins also indicates that
the GxSxG motif might exert effects on the enzymatic activity
of Arabidopsis MAGLs.
Inhibition of enzyme activities of AtMAGL6 and 8
in the presence of PMSF, which is a serine protease
inhibitor
To understand the role of the GxSxG motif in the activities of
Arabidopsis MAGLs, we investigated the effect of a serine
protease inhibitor, PMSF, on the lipase activities of
AtMAGL6 and AtMAGL8 (Muccioli et al. 2008). Figure 3A
shows that PMSF is able to produce an irreversible MAGL–
PMSF adduct and hydrofluoric acid (HF), by specifically
* (A)
Homo sapiens
AtMAGL8 AtMAGL6
AtMAGL16 Saccharomyces cerevisiae
Mus musculus Rattus norvegicus
: 128 : 128 : 138 : 119 : 125 : 147 : 129
: 273 : 273 : 283 : 267 : 273 : 296 : 285
* *
(B) Mus musculus Rattus norvegicus
Homo sapiens AtMAGL6
AtMAGL8 AtMAGL16
Saccharomyces cerevisiae
100
98
100 100
0.2
Fig. 1 Amino acid sequence alignment and phylogenetic relationship
of MAGLs from Arabidopsis and other species. The deduced amino
acid sequences of seven MAGL genes were aligned by CLUSTALX
version 2.1. The accession numbers of the aligned MAG lipases in
Arabidopsis database (http://www.arabidopsis.org) or GenBank
(http://www.ncbi.nlm.nih.gov/) are as follows: AtMAGL6;
At2g39400, AtMAGL8; At2g39420, AtMAGL16; At5g19290, human
(Homo sapiens) MAGL; AAH06230.1, mouse (Mus musculus)
MAGL; CAC69874.1, rat (Rattus norvegicus) MAGL; ALL87453.1
and yeast (Saccharomyces cerevisiae) MAGL; CAA81932.1. The
conserved and identical amino acid residues are shaded in gray and
black, respectively. (A) The GxSxG and SxSxG motifs are shown in
red box. The amino acid residues of the catalytic triad, Ser, Asp, and
His, are marked by asterisks. (B) The phylogenetic tree was generated
from alignments of deduced amino acid sequences of MAGLs from
Arabidopsis and other species, using the maximum likelihood method
based on the WAG model, and gamma distributed with invariant sites
(I) in the MEGA program (version 5.2; Tamura et al. 2011). The
bootstrap value percentages of 500 replicates are shown at the
branching points (Felsenstein 1985). The scale bar represents the
distance unit between sequence pairs
836 Appl Biol Chem (2016) 59(6):833–840
123
![Page 5: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/5.jpg)
binding to the hydroxyl group of the serine residue in the
active site of the serine protease, thereby inhibiting its enzy-
matic activity (Han et al. 2012). MBP, MBP:AtMAGL6,
MBP:AtMAGL8, and MBP:HsMAGL proteins were
expressed in E. coli and purified using amylose resin. Each
purified protein was incubated at different concentrations of
PMSF and further incubated in the reaction buffer with MAG
substrates. Finally, the amount of non-esterified fatty acid
(NEFA) products was measured using the NEFA assay kit. As
a result, the half maximal inhibitory concentration (IC50)
values for MBP:HsMAGL, MBP:AtMAGL6, and MBP:At-
MAGL8 proteins in response to PMSF were calculated to be
3.30, 2.30, and 2.35, respectively, indicating that Arabidopsis
MAGLs have a similar inhibition rate to that of human MAGL
at 10 times higher PMSF concentration (Fig. 3B). These
results suggest that the serine residue present in the active site
of Arabidopsis and human MAGLs is important for MAGL
lipase activity.
With respect to the activity of recombinant HsMAGL
proteins, the IC50 values in response to PMSF were 3.30
and 3.20, when 7-HCA (7-hydroxycoumarinyl arachido-
nate) and 4-NPA (4-nitrophenylacetate) substrates,
respectively, were used (Muccioli et al. 2008; Savinainen
et al. 2010). Rat MAG lipase had an IC50 value of 3.81 in
Fig. 2 Comparison of three-dimensional protein models between
Arabidopsis MAGLs and their mutated forms. (A, B) Three-dimen-
sional protein models of (A) HsMAGL, and (B) AtMAGL proteins,
which are represented by the catalytic triad, the Ser (S) in the GxSxG
motif, His (H), and Asp (D). (C–L) Transverse sections for
environments near the nucleophilic elbow serine residue in the
catalytic triad of Arabidopsis MAGLs and their mutated proteins. The
U- or W-shaped lines along the nucleophilic serine residues are
shown in red. (C) AtMAGL8 having the GxSxG motif, and mutated
AtMAGL8 containing (D) G117S, (E) S119A, or (F) G121S in the
GxSxG motif. (G) AtMAGL6 harboring the GxSxG motif, and
mutated AtMAGL6 having (H) G111S, (I) S113A, or (J) G115S in
the GxSxG motif. (K) AtMAGL16 having the SxSxG motif, and
(L) mutated AtMAGL16 containing S139G in the SxSxG motif
Appl Biol Chem (2016) 59(6):833–840 837
123
![Page 6: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/6.jpg)
response to PMSF, when 2-arachidonoylglycerol (2-AG)
was used as a substrate (Saario et al. 2004). The present
study also confirmed that even though a MAG substrate
was utilized, the IC50 value of MBP:HsMAGL in response
to PMSF was similar to the existing values.
Effect of amino acid substitutions on Arabidopsis
MAG lipase activity
The computational modeling of Arabidopsis MAGLs and
the inhibition of enzymatic activity of Arabidopsis MAGLs
in response to PMSF strongly prompted us to examine the
significance of each amino acid residue in the GxSxG motif
of Arabidopsis MAGLs in their enzymatic activity. Thus,
the GxSxG motif of AtMAGL6 and 8 was replaced with
the SxSxG, GxAxG, or GxSxS motif. In addition, the first
serine residue in the SxSxG motif of AtMAGL16 was
substituted with a glycine residue to investigate if very low
lipase activities of AtMAGL16 are caused by the presence
of the SxSxG motif instead of the GxSxG motif (Fig. 4).
After the transformation of all recombinant vectors in
E. coli, the induced proteins were purified and elec-
trophoresed on 12 % SDS-PAGE. Approximately 43 kDa
of MBP and approximately 72 kDa of MBP:AtMAGL6,
MBP:AtMAGL6_G111S, MBP:AtMAGL6_S113A, MBP:
AtMAGL6_G115S, MBP:AtMAGL8, MBP:AtMAGL8_
G117S, MBP: AtMAGL8_S119A, MBP: AtMAGL8_
G121S, MBP:AtMAGL16, and MBP: AtMAGL16_S139G
were identified (Fig. 5). Lipase activities of the purified
proteins were measured using the NEFA assay kit, when
the MAG substrates containing 18:2 fatty acids at the sn-1
position were supplemented.
In agreement with the findings of Kim et al. (2016), the
lipase activities of AtMAGL6 and AtMAGL8 were
observed to be 21.8 and 19.3 lmol mg-1 min-1, respec-
tively, but no lipase activity was observed in six types of
log[PMSF]
MBP HsMAGL
AtMAGL6
+
Ser
Ser HO
PMSF MAGL
MAGL-PMSF adduct
+ HF
AtMAGL8
0
20
40
60
80
100
-7 -6 -5 -4 -3 -2 -1 0
MA
GL
activ
ity
(% c
ontro
l)
(A)
(B)
Fig. 3 Effect of a serine protease inhibitor, PMSF on the activities of
maltose-binding protein (MBP) and the recombinant MBP:HsMAGL,
MBP:AtMAGL6, and MBP:AtMAGL8 proteins. (A) A proposed
mechanism for covalent inactivation of a MAGL protein by a PMSF
inhibitor. HF Hydrofluoric acid. (B) Dose-dependent inhibition of
MAGLs by a PMSF inhibitor. MBP, MBP:HsMAGL, MBP:At-
MAGL6, and MBP:AtMAGL8 proteins (0.1 lg) were preincubated
with a PMSF inhibitor (10-7–10-1 mM) for 10 min at 25 �C in lipase
assay buffer (Kim et al. 2016). Following preincubation, emulsified
MAG substrates containing an 18:2 fatty acid at the sn-1 position
were added, and incubated for an additional 5 min at 30 �C. The
values for MAGL activity are an average of three independent
experiments ± standard errors
malE
BamH1 Pst1
G117xS119xG121
AtMAGL8
MBP:AtMAGL8
malE
BamH1 Pst1
G117xS119xS121
AtMAGL8
MBP:AtMAGL8_G121S
malE
BamH1 Pst1
G117xA119xG121
AtMAGL8
MBP:AtMAGL8_S119A
malE AtMAGL16
BamH1 Sal1
S139xS141xG143
MBP:AtMAGL16
malE
BamH1 Sal1
G139xS141xG143
AtMAGL16
MBP:AtMAGL16_S139G
Tac_P
malE lacZα
rrnB_TBamH1 Pst1
G111xS113xG115
AtMAGL6
MBP:AtMAGL6
malE
BamH1 Pst1
G111xS113xS115
AtMAGL6
MBP:AtMAGL6_G115S
malEBamH1 Pst1
G111xA113xG115
AtMAGL6
MBP:AtMAGL6_S113A
malE
BamH1 Pst1
S111xS113xG115
AtMAGL6
MBP:AtMAGL6_G111S
malE
BamH1 Pst1
S117xS119xG121
AtMAGL8
MBP:AtMAGL8_G117S
Fig. 4 Schematic diagrams of expression vectors harboring the
recombinant MBP:MAGLs and their mutated proteins
838 Appl Biol Chem (2016) 59(6):833–840
123
![Page 7: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/7.jpg)
mutated proteins (Table 2). This result indicates that two
glycine residues and a serine residue in the GxSxG motif
present in AtMAGL6 and AtMAGL8 are integral to the
lipase activity. Although in the case of AtMAGL16 the
SxSxG motif was changed into the GxSxG, no significant
changes in the lipase activity were observed (Table 2),
suggesting that AtMAGL16 may be an enzyme that
degrades other substrates, not MAG.
To date, little is known about alterations in enzyme
activities by a point mutation of the amino acid residues in
the GxSxG motif present in the MAG lipases. However, the
essential role of GxSxG motif existing in various types of
lipases has been reported (Kurat et al. 2006; Rabin and
Hauser 2005; Wada et al. 2009). As evidenced, the com-
plete deletion of the GxSxG motif in mouse phospholipase
A2 (PLA2) almost eliminated its enzymatic activity (Wada
et al. 2009). Also, mutating the serine residue in the GxSxG
motif of Pseudomonas aeruginosa patatin-like phospholi-
pase and yeast triglyceride lipase 4 with an alanine residue
almost demolished their lipase activities (Rabin and Hauser
2005; Kurat et al. 2006).
In conclusion, very few studies have been reported
about plant MAG lipases, because their functions could
not be inferred from amino acid sequence similarity. In
the current study, we revealed that glycine residues, as
well as a serine residue within the GxSxG motif in
Arabidopsis MAGL6 and MAGL8, are critical for MAG
lipase activity. Although AtMAGL16 was mutated to
contain the GxSxG motif in its active site, its MAG lipase
activity was not significantly increased, suggesting that
AtMAGL16 may not be a MAG lipase. Taken together,
this study provides information about the essential motif
of plant MAGLs, which among the genes involved in
plant lipid metabolism have been least studied (McGlew
et al. 2015).
Table 2 Effect of amino acid
substitutions on MAG lipase
activity
Proteins Motifs Activity
(lmol mg-1 min-1)
Mutated motifs Activity
(lmol mg-1 min-1)
MBP – ND – ND
AtMAGL6 GxSxG 21.8 ± 0.98 SxSxG ND
GxAxG ND
GxSxS ND
AtMAGL8 GxSxG 19.3 ± 0.60 SxSxG ND
GxAxG ND
GxSxS ND
AtMAGL16 SxSxG 0.13 ± 0.00 GxSxG 0.20 ± 0.00
ND Non-detected
The recombinant AtMAGLs, mutated AtMAGLs by point mutations, and MBP were incubated with lipid
substrate containing 18:2 fatty acids at the sn-1 MAG at 30 �C for 5 min, and the released non-esterified
fatty acid products were measured using the NEFA assay kit (Wako Pure Chemicals)
Lipid substrate was emulsified with 0.2 % Triton X-100 by sonication. The values (lmol mg-1 min-1) are
an average of three independent experiments ± standard errors
M MBP 1 2 3 4 5 6 7 8 9 10 KDa
10
72
34
130
Fig. 5 SDS-polyacrylamide gel electrophoresis of the purified MBP,
MBP:MAGLs, and mutated MBP:MAGLs. MBP and MBP:MAGLs
were purified from E. coli, electrophoresed on a 12 % SDS-PAGE
gel, and stained with Coomassie blue R-250. MBP and MBP:MAGLs
are indicated by black arrowheads. M Molecular weight standard
[Fermentas, kilodalton (kDa)]; MBP *43 kDa; 1 MBP:AtMAGL6; 2
MBP:AtMAGL6_G111S; 3 MBP:AtMAGL6_S113A; 4 MBP:At-
MAGL6_G115S; 5 MBP:AtMAGL8; 6 MBP:AtMAGL8_G117S; 7
MBP: AtMAGL8_S119A; 8 MBP: AtMAGL8_G121S; 9 MBP:At-
MAGL16; 10 MBP: AtMAGL16_S139G
Appl Biol Chem (2016) 59(6):833–840 839
123
![Page 8: The GxSxG motif of Arabidopsis monoacylglycerol lipase ......quantified using the Bradford methods (Bradford 1976). The purified MBP:MAGL proteins (0.1 lg) were incubated in 100](https://reader035.fdocuments.net/reader035/viewer/2022071515/6137168c0ad5d206764864c3/html5/thumbnails/8.jpg)
Acknowledgments This work was supported by grants from the
National Research Foundation (NRF-2016R1A2B2010068) of Korea
and the Next-Generation BioGreen 21 Program (No. PJ011052) of the
Rural Development Administration, Republic of Korea.
References
Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 72:248–254
Brumlik MJ, Buckley JT (1996) Identification of the catalytic triad of
the lipase/acyltransferase from Aeromonas hydrophila. J Bacte-
riol 178:2060–2064
Eastmond PJ (2006) SUGAR-DEPENDENT1 encodes a patatin
domain triacylglycerol lipase that initiates storage oil breakdown
in germinating Arabidopsis seeds. Plant cell 18:665–675
Felsenstein J (1985) Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39:783–791
Graham IA (2008) Seed storage oil mobilization. Annu Rev Plant
Biol 59:115–142
Han Q, Robinson H, Li J (2012) Biochemical identification and
crystal structure of kynurenine formamidase from Drosophila
melanogaster. Biochem J 446:253–260
Ho SN, Hunt HD, Horton RM, Pullen JK, Peasea LR (1989) Site-
directed mutagenesis by overlap extension using the polymerase
chain reaction. Gene 77:51–59
Huang AH (1992) Oil bodies and oleosins in seeds. Annu Rev Plant
Physiol Plant Mol Biol 43:177–200
Huang AH (1996) Oleosins and oil bodies in seeds and other organs.
Plant Physiol 110:1055–1061
Karlsson M, Contreras JA, Hellman U, Tornqvist H, Holm C (1997)
cDNA Cloning, tissue distribution, and identification of the
catalytic triad of monoglyceride lipase. J Biol Chem
272:27218–27223
Kaup MT, Froese CD, Thompson JE (2002) A role for diacylglycerol
acyltransferase during leaf senescence. Plant Physiol
129:1616–1626
Kelly AA, Quettier AL, Shaw E, Eastmond PJ (2011) Seed storage oil
mobilization is important but not essential for germination or
seedling establishment in Arabidopsis. Plant Physiol
157:866–875
Kim HU, Hsieh K, Ratnayake C, Huang AH (2002) A novel group of
oleosins is present inside the pollen of Arabidopsis. J Biol Chem
277:22677–22684
Kim RJ, Kim HJ, Shim D, Suh MC (2016) Molecular and
biochemical characterizations of the monoacylglycerol lipase
gene family of Arabidopsis thaliana. Plant J 85:758–771
Kurat CF, Natter K, Petschnigg J, Wolinski H, Scheuringer K, Scholz
H, Zimmermann R, Leber R, Zechner R, Kohlwein SD (2006)
Obese yeast: triglyceride lipolysis is functionally conserved from
mammals to yeast. J Biol Chem 281:491–500
Labar G, Bauvois C, Borel F, Ferrer JL, Wouters J, Lambert DM (2010)
Crystal structure of the human monoacylglycerol lipase, a key
actor in endocannabinoid signaling. ChemBioChem 11:218–227
Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V,
Bates PD, Baud S, Bird D, Debono A, Durrett TP, Franke RB,
Graham IA, Katayama K, Kelly AA, Larson T, Markham JE,
Miquel M, Molina I, Nishida I, Rowland O, Samuels L, Schmid
KM, Wada H, Welti R, Xu C, Zallot R, Ohlrogge J (2013) Acyl-
lipid metabolism. Arabidopsis Book 11:e0161
McGlew K, Shaw V, Zhang M, Kim RJ, Yang W, Shorrosh B, Suh
MC, Ohlrogge J (2015) An annotated database of Arabidopsis
mutants of acyl lipid metabolism. Plant Cell Rep 34:519–532
Muccioli GG, Labar G, Lambert DM (2008) CAY10499, a novel
monoglyceride lipase inhibitor evidenced by an expeditious
MGL assay. ChemBioChem 9:2704–2710
Polgar L (2005) The catalytic triad of serine peptidases. Cell Mol Life
Sci 62:2161–2172
Rabin SD, Hauser AR (2005) Functional regions of the Pseudomonas
aeruginosa cytotoxin ExoU. Infect Immun 73:573–582
Saario SM, Savinainen JR, Laitinen JT, Jarvinen T, Niemi R (2004)
Monoglyceride lipase-like enzymatic activity is responsible for
hydrolysis of 2-arachidonoylglycerol in rat cerebellar mem-
branes. Biochem Pharmacol 67:1381–1387
Savinainen JR, Yoshino M, Minkkila A, Nevalainen T, Laitinen JT
(2010) Characterization of binding properties of monoglyceride
lipase inhibitors by a versatile fluorescence-based technique.
Anal Biochem 399:132–134
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
(2011) MEGA5: molecular evolutionary genetic analysis using
maximum likelihood, evolutionary distance, and maximum
parsimony methods. Mol Biol Evol 28:2731–2739
Theodoulou FL, Eastmond PJ (2012) Seed storage oil catabolism: a
story of give and take. Curr Opin Plant Biol 15:322–328
Wada H, Yasuda T, Miura I, Watabe K, Sawa C, Kamijuku H, Kojo
S, Taniguchi M, Nishino I, Wakana S, Yoshida H, Seino K
(2009) Establishment of an improved mouse model for infantile
neuroaxonal dystrophy that shows early disease onset and bears a
point mutation in Pla2g6. Am J Pathol 175:2257–2263
840 Appl Biol Chem (2016) 59(6):833–840
123