THE GHRELIN RECEPTOR ISOFORMS (GHS-R1a AND GHS-R1b) … · 2011. 1. 6. · R1a and GHS-R1b, which...
236
THE GHRELIN RECEPTOR ISOFORMS (GHS-R1a AND GHS-R1b) AND GPR39: AN INVESTIGATION INTO RECEPTOR DIMERISATION Peter Stephen Cunningham Bachelor of Applied Science (Hons) Institute of Health and Biomedical Innovation School of Life Sciences, Queensland University of Technology A thesis submitted for the degree of Doctor of Philosophy of the Queensland University of Technology 2010 AGE
Transcript of THE GHRELIN RECEPTOR ISOFORMS (GHS-R1a AND GHS-R1b) … · 2011. 1. 6. · R1a and GHS-R1b, which...
i
THE GHRELIN RECEPTOR ISOFORMS
(GHS-R1a AND GHS-R1b) AND GPR39:
AN INVESTIGATION INTO RECEPTOR
DIMERISATION
Peter Stephen Cunningham
Bachelor of Applied Science (Hons)
Institute of Health and Biomedical Innovation
School of Life Sciences, Queensland University of Technology
A thesis submitted for the degree of Doctor of Philosophy of
the Queensland University of Technology
2010
AGE
ii
KEYWORDS
Ghrelin, GHS-R1a, GHS-R1b, GPR39, zinc, GPCR, receptor dimerisation, resonance
energy transfer, BRET2, FRET, signalling, MAPK, ERK1/2, AKT, apoptosis,
prostate cancer.
iii
ABSTRACT
Prostate cancer is the second most common cause of cancer-related deaths in
Western males. Current diagnostic, prognostic and treatment approaches are not ideal
and advanced metastatic prostate cancer is incurable. There is an urgent need for
improved adjunctive therapies and markers for this disease. GPCRs are likely to play
a significant role in the initiation and progression of prostate cancer. Over the last
decade, it has emerged that G protein coupled receptors (GPCRs) are likely to
function as homodimers and heterodimers. Heterodimerisation between GPCRs can
result in the formation of novel pharmacological receptors with altered functional
outcomes, and a number of GPCR heterodimers have been implicated in the
pathogenesis of human disease. Importantly, novel GPCR heterodimers represent
potential new targets for the development of more specific therapeutic drugs.
Ghrelin is a 28 amino acid peptide hormone which has a unique n-octanoic acid post-
translational modification. Ghrelin has a number of important physiological roles,
including roles in appetite regulation and the stimulation of growth hormone release.
The ghrelin receptor is the growth hormone secretagogue receptor type 1a, GHS-
R1a, a seven transmembrane domain GPCR, and GHS-R1b is a C-terminally
truncated isoform of the ghrelin receptor, consisting of five transmembrane domains.
Growing evidence suggests that ghrelin and the ghrelin receptor isoforms, GHS-R1a
and GHS-R1b, may have a role in the progression of a number of cancers, including
prostate cancer. Previous studies by our research group have shown that the truncated
ghrelin receptor isoform, GHS-R1b, is not expressed in normal prostate, however, it
is expressed in prostate cancer. The altered expression of this truncated isoform may
reflect a difference between a normal and cancerous state. A number of mutant
GPCRs have been shown to regulate the function of their corresponding wild-type
receptors. Therefore, we investigated the potential role of interactions between GHS-
R1a and GHS-R1b, which are co-expressed in prostate cancer and aimed to
investigate the function of this potentially new pharmacological receptor.
In 2005, obestatin, a 23 amino acid C-terminally amidated peptide derived from
preproghrelin was identified and was described as opposing the stimulating effects of
ghrelin on appetite and food intake. GPR39, an orphan GPCR which is closely
iv
related to the ghrelin receptor, was identified as the endogenous receptor for
obestatin. Recently, however, the ability of obestatin to oppose the effects of ghrelin
on appetite and food intake has been questioned, and furthermore, it appears that
GPR39 may in fact not be the obestatin receptor. The role of GPR39 in the prostate is
of interest, however, as it is a zinc receptor. Zinc has a unique role in the biology of
the prostate, where it is normally accumulated at high levels, and zinc accumulation
is altered in the development of prostate malignancy. Ghrelin and zinc have
important roles in prostate cancer and dimerisation of their receptors may have novel
roles in malignant prostate cells.
The aim of the current study, therefore, was to demonstrate the formation of GHS-
R1a/GHS-R1b and GHS-R1a/GPR39 heterodimers and to investigate potential
functions of these heterodimers in prostate cancer cell lines. To demonstrate
dimerisation we first employed a classical co-immunoprecipitation technique. Using
cells co-overexpressing FLAG- and Myc- tagged GHS-R1a, GHS-R1b and GPR39,
we were able to co-immunoprecipitate these receptors. Significantly, however, the
receptors formed high molecular weight aggregates. A number of questions have
been raised over the propensity of GPCRs to aggregate during co-
immunoprecipitation as a result of their hydrophobic nature and this may be
misinterpreted as receptor dimerisation. As we observed significant receptor
aggregation in this study, we used additional methods to confirm the specificity of
these putative GPCR interactions.
We used two different resonance energy transfer (RET) methods; bioluminescence
resonance energy transfer (BRET) and fluorescence resonance energy transfer
(FRET), to investigate interactions between the ghrelin receptor isoforms and
GPR39. RET is the transfer of energy from a donor fluorophore to an acceptor
fluorophore when they are in close proximity, and RET methods are, therefore,
applicable to the observation of specific protein-protein interactions. Extensive
studies using the second generation bioluminescence resonance energy transfer
(BRET2) technology were performed, however, a number of technical limitations
were observed. The substrate used during BRET2 studies, coelenterazine 400a, has a
low quantum yield and rapid signal decay. This study highlighted the requirement for
the expression of donor and acceptor tagged receptors at high levels so that a BRET
v
ratio can be determined. After performing a number of BRET2 experimental controls,
our BRET2 data did not fit the predicted results for a specific interaction between
these receptors. The interactions that we observed may in fact represent ‘bystander
BRET’ resulting from high levels of expression, forcing the donor and acceptor into
close proximity. Our FRET studies employed two different FRET techniques,
acceptor photobleaching FRET and sensitised emission FRET measured by flow
cytometry. We were unable to observe any significant FRET, or FRET values that
were likely to result from specific receptor dimerisation between GHS-R1a, GHS-
R1b and GPR39.
While we were unable to conclusively demonstrate direct dimerisation between
GHS-R1a, GHS-R1b and GPR39 using several methods, our findings do not exclude
the possibility that these receptors interact. We aimed to investigate if co-expression
of combinations of these receptors had functional effects in prostate cancers cells. It
has previously been demonstrated that ghrelin stimulates cell proliferation in prostate
cancer cell lines, through ERK1/2 activation, and GPR39 can stimulate ERK1/2
signalling in response to zinc treatments. Additionally, both GHS-R1a and GPR39
display a high level of constitutive signalling and these constitutively active receptors
can attenuate apoptosis when overexpressed individually in some cell types. We,
therefore, investigated ERK1/2 and AKT signalling and cell survival in prostate
cancer the potential modulation of these functions by dimerisation between GHS-
R1a, GHS-R1b and GPR39. Expression of these receptors in the PC-3 prostate
cancer cell line, either alone or in combination, did not alter constitutive ERK1/2 or
AKT signalling, basal apoptosis or tunicamycin-stimulated apoptosis, compared to
controls.
In summary, the potential interactions between the ghrelin receptor isoforms, GHS-
R1a and GHS-R1b, and the related zinc receptor, GPR39, and the potential for
functional outcomes in prostate cancer were investigated using a number of
independent methods. We did not definitively demonstrate the formation of these
dimers using a number of state of the art methods to directly demonstrate receptor-
receptor interactions. We investigated a number of potential functions of GPR39 and
GHS-R1a in the prostate and did not observe altered function in response to co-
expression of these receptors. The technical questions raised by this study highlight
vi
the requirement for the application of extensive controls when using current methods
for the demonstration of GPCR dimerisation. Similar findings in this field reflect the
current controversy surrounding the investigation of GPCR dimerisation. Although
GHS-R1a/GHS-R1b or GHS-R1a/GPR39 heterodimerisation was not clearly
demonstrated, this study provides a basis for future investigations of these receptors
in prostate cancer. Additionally, the results presented in this study and growing
evidence in the literature highlight the requirement for an extensive understanding of
the experimental method and the performance of a range of controls to avoid the
spurious interpretation of data gained from artificial expression systems. The future
development of more robust techniques for investigating GPCR dimerisation is
clearly required and will enable us to elucidate whether GHS-R1a, GHS-R1b and
GPR39 form physiologically relevant dimers.
vii
TABLE OF CONTENTS
KEYWORDS ............................................................................................................... ii
ABSTRACT ................................................................................................................ iii
TABLE OF CONTENTS ........................................................................................... vii
LIST OF FIGURES .................................................................................................. xiii
LIST OF TABLES .................................................................................................... xvi
LIST OF ABBREVIATIONS .................................................................................. xvii
LIST OF PRESENTATIONS .................................................................................... xx
STATEMENT OF ORIGINAL AUTHORSHIP ...................................................... xxi
ACKNOWLEDGEMENTS ..................................................................................... xxii
CHAPTER 1 - INTRODUCTION AND LITERATURE REVIEW ..................... 1
1.1 PROSTATE CANCER ...................................................................................... 2
1.2 G-PROTEIN COUPLED RECEPTORS ........................................................... 2
1.2.1 GPCRs in Prostate Cancer .......................................................................... 9
1.3 THE GHRELIN RECEPTOR FAMILY .......................................................... 10
1.3.1 The growth hormone secretagogue receptor ............................................. 11
1.3.2 Ghrelin ...................................................................................................... 14
1.3.2.1 The ghrelin axis in cell proliferation and apoptosis ....................................... 17
1.3.2.2 The Ghrelin/GHSR axis in prostate cancer .................................................... 18
1.3.2.3 Ghrelin signalling ........................................................................................... 20
1.3.2.4 Ghrelin O-acyl transferase (GOAT) ............................................................... 21
1.3.2.5 Des-acyl ghrelin ............................................................................................. 21
1.3.2.6 Obestatin ........................................................................................................ 22
1.3.3 GPR39 ....................................................................................................... 24
1.4 ZINC IN THE PROSTATE ............................................................................. 27
1.5 GPCR DIMERISATION ................................................................................. 31
1.5.1 Functional outcomes of GPCR dimerisation ............................................ 35
1.5.2 GPCR dimers in pathophysiological conditions ....................................... 37
1.5.3 Experimental methods to demonstrate GPCR dimerisation ..................... 38
1.5.4 Important considerations regarding techniques used to identify GPCR
dimerisation and the requirement for control experiments ................................ 43
1.6 GHS-R DIMERSATION ................................................................................. 46
viii
1.7 SUMMARY AND RELEVANCE TO THE PROJECT .................................. 48
1.7.1 Hypotheses ................................................................................................ 49
1.7.2 Aims .......................................................................................................... 50
CHAPTER 2 - GENERAL MATERIALS AND METHODS .............................. 51
2.1 INTRODUCTION ............................................................................................ 52
2.2 GENERAL REAGENTS AND CHEMICALS ................................................ 52
2.3 CELL LINES .................................................................................................... 52
2.4 CELL CULTURE ............................................................................................ 52
2.4.1 Cell maintenance ....................................................................................... 52
2.4.2 Cell counting ............................................................................................. 52
2.4.3 Cell transfections ....................................................................................... 53
2.5 CLONING ........................................................................................................ 53
2.5.1 Polymerase chain reaction (PCR) ............................................................. 53
2.5.2 PCR amplicon gel excision and purification ............................................. 53
2.5.3 Ligation of PCR amplicons into pGEM-T Easy vectors ........................... 54
2.5.4 Transformation of DH5α subcloning efficiency chemically competent
E. coli by heat-shock .......................................................................................... 54
2.5.5 Plating of transformed cultures onto LB/Ampicillin/X-Gal plates ........... 54
2.5.6 Identification of positive colonies ............................................................. 55
2.5.7 Extraction of plasmid DNA....................................................................... 55
2.5.8 DNA sequencing ....................................................................................... 55
2.5.9 Subcloning into target vectors ................................................................... 55
2.6 PROTEIN ANALYSIS .................................................................................... 56
2.6.1 Protein extraction and membrane fraction preparation ............................. 56
2.6.2 Protein quantification by Bicinchoninic Acid (BCA) assay ..................... 56
2.6.3 Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-
PAGE) .............................................................................................................. 56
2.6.4 Western blotting analysis .......................................................................... 57
2.6.5 Densitometry ............................................................................................. 58
2.7 STATISTICAL ANALYSIS ............................................................................ 58
CHAPTER 3 - INITIAL CHARACTERISATION OF INTERACTIONS
ix
BETWEEN THE GHRELIN RECEPTOR ISOFORMS (GHS-R1a AND
GHS-R1b) AND GPR39 .......................................................................................... 59
3.1 INTRODUCTION ........................................................................................... 60
3.2 MATERIALS AND METHODS ..................................................................... 63
3.2.1 Cell Culture ............................................................................................... 63
3.2.2 Amplification of full lenght GPR39 by PCR ............................................ 63
3.2.3 GPR39 Immunohistochemistry (IHC) of PC-3 prostate cancer cells ....... 63
3.2.4 GHS-R1a and GPR39 co-immunoprecipitation from native PC-3
prostate cancer cell lysate .................................................................................. 64
3.2.5 FLAG and Myc tagged construct design .................................................. 64
3.2.6 PCR and cloning of FLAG and Myc tagged pcDNA3.1 constructs ......... 65
3.2.7 Cell Transfections for Co-Immunoprecipitation ....................................... 66
3.2.8 Initial Protein A immunoprecipitation of FLAG and Myc tagged
receptors ............................................................................................................. 66
3.2.9 Modified SDS-PAGE method to investigate the effect of temperature
on GPCR aggregation during SDS-PAGE ......................................................... 66
3.2.10 Anti-FLAG affinity gel immunoprecipitation using optimised SDS-
PAGE sample preparation .................................................................................. 67
3.3 RESULTS ........................................................................................................ 68
3.3.1 GPR39 is expressed in prostate cancer cell lines ...................................... 68
3.3.2 GHS-R1a and GPR39 co-immunoprecipitation in native PC-3 prostate
cancer cells ......................................................................................................... 69
3.3.3 Cloning of FLAG and Myc tagged full length receptor sequence into
pcDNA3.1 (+) .................................................................................................... 70
3.3.4 Immunoprecipitation and Immunoblotting of tagged protein aggregates . 71
3.3.5 Heating of samples in SDS-PAGE sample buffer during sample
preparation leads to aggregation of ghrelin receptor family members .............. 72
3.3.6 Immunoprecipitation demonstrates protein-protein interactions of
GHS-R1a, GHS-R1b and GPR39 ...................................................................... 74
3.4 DISCUSSION .................................................................................................. 77
CHAPTER 4 - BIOLUMINESCENT RESONANCE ENERGY TRANSFER
x
(BRET) STUDIES OF INTERACTIONS BETWEEN THE GHRELIN
RECEPTOR ISOFORMS (GHS-R1a AND GHS-R1b) AND GPR39 ................ 81
4.1 INTRODUCTION ............................................................................................ 82
4.2 MATERIALS AND METHODS ..................................................................... 84
4.2.1 Cell Culture ............................................................................................... 84
4.2.2 BRET2 vector construct design, PCR and cloning of full lenght
receptor constructs.............................................................................................. 84
4.2.3 Cell Transfections for BRET experiments ................................................ 85
4.2.4 Luminescence/Fluorescence Detection ..................................................... 86
4.2.5 Standard BRET2 assays of receptor-receptor interactions ........................ 86
4.2.6 BRET2 receptor-luciferase saturation assays ............................................ 87
4.2.7 BRET2 variation of surface density expression experiments .................... 87
4.2.8 BRET2 unlabeled competition assays ....................................................... 88
4.2.9 Statistical analysis ..................................................................................... 88
4.3 RESULTS ......................................................................................................... 89
4.3.1 Cloning of GHS-R1a, GHS-R1b, GPR39 and PAR2 BRET2 constructs .. 89
4.3.2 Comparison of BRET2 N- and C- vector constructs ................................. 89
4.3.3 Identification of experimental variation during initial optimisation of
BRET2 method in the CWR22RV1 prostate cancer cell line ............................. 90
4.3.4 The BRET2 substrate, Coelenterazine 400a, shows rapid signal decay
with significant practical implications ............................................................... 92
4.3.5 Standard BRET2 assays illustrate potential GHS-R1a/GHS-R1a,
GPR39/GHS-R1a and GPR39/PAR2 interactions ............................................. 95
4.3.6 BRET2 saturation of receptor-receptor interactions .................................. 96
4.3.7 Surface density BRET2 experiments indicate positive results as a
function of bystander BRET2 ............................................................................. 99
4.3.8 BRET2 competition of GHS-R1a-Rluc/GHS-R1a-GFP2 and GPR39-
Rluc/GHS-R1a-GFP2 with excess native GHS-R1a ........................................ 101
4.4 DISCUSSION ................................................................................................ 103
CHAPTER 5 - FLUORESCENCE RESONANCE ENERGY TRANSFER
(FRET) STUDIES OF INTERACTIONS BETWEEN THE GHRELIN
RECEPTOR ISOFORMS (GHS-R1a AND GHS-R1b) AND GPR39 .............. 111
5.1 INTRODUCTION .......................................................................................... 112
xi
5.2 MATERIALS AND METHODS ................................................................... 114
5.2.1 Cell culture .............................................................................................. 114
5.2.2 FRET vector construct design and cloning ............................................. 114
5.2.3 Cell transfections for Acceptor Photobleaching Fluorescent
Resonance Energy Transfer (abFRET) ............................................................ 115
5.2.4 Slide Preparation for abFRET ................................................................. 115
5.2.5 abFRET Confocal Microscopy ............................................................... 115
5.2.6 Cell Transfections for Flow Cytometric Fluorescent Resonance
Energy Transfer (fcFRET) ............................................................................... 115
5.2.7 Flow Cytometry for fcFRET ................................................................... 116
5.2.8 Assessment of the effect of ligand treatment on receptor conformation,
assayed by FRET ............................................................................................. 116
5.2.9 Statistical analysis ................................................................................... 117
5.3 RESULTS ...................................................................................................... 118
5.3.1 Cloning of GHS-R1a, GHS-R1b and GPR39 FRET constructs ............. 118
5.3.2 abFRET method to show resonance energy transfer from a CFP
donor to an YFP acceptor fluorophore ............................................................. 118
5.3.3 CFP and YFP tagged GHS-R1a, GHS-R1b and GPR39 are
co-localised in the cytoplasm. .......................................................................... 120
5.3.4 CFP and YFP tagged GHS-R1a, GHS-R1b and GPR39 when
co-expressed do not produce significant FRET ............................................... 122
5.3.5 Ghrelin and zinc treatments had no effect on abFRET efficiency in
transfected HEK293 cells ................................................................................. 127
5.3.6 Flow cytometric FRET (fcFRET) experimental controls define the region
of FRET positive cells resulting from specific CFP and YFP interactions ..... 129
5.3.7 GHS-R1a, GHS-R1b and GPR39 do not show significant FRET
when analysed by fcFRET ............................................................................... 136
5.3.8 Ligand treatments had no effect on fcFRET in transfected HEK293
cells ............................................................................................................ 140
5.4 DISCUSSION ................................................................................................ 142
xii
CHAPTER 6 - INVESTIGATIONS INTO THE FUNCTIONAL EFFECTS OF
POTENTIAL INTERACTIONS BETWEEN THE GHRELIN RECEPTOR
ISOFORMS (GHS-R1a AND GHS-R1b) AND GPR39 ...................................... 147
6.1 INTRODUCTION .......................................................................................... 148
6.2 MATERIALS AND METHODS ................................................................... 152
6.2.1 Cell culture .............................................................................................. 152
6.2.2 Cell Signalling ......................................................................................... 152
6.2.3 Cell apoptosis .......................................................................................... 153
6.2.4 Statistical analysis ................................................................................... 153
6.3 RESULTS ....................................................................................................... 155
6.3.1 Overexpression of GHS-R1a, GHS-R1b or GPR39, alone, or in
combination does not increase constitutive ERK1/2 or AKT
phosphorylation in PC-3 prostate cancer cells ................................................. 155
6.3.2 Overexpression of the ghrelin receptor, GHS-R1a, alone or in
combination with GHS-R1b or GPR39 does not alter PC-3 cell apoptosis ..... 157
6.4 DISCUSSION ................................................................................................ 163
CHAPTER 7 - GENERAL DISCUSSION ........................................................... 168
CHAPTER 8 - REFERENCES ............................................................................. 178
xiii
LIST OF FIGURES
Figure 1.1 The current paradigm of signal transduction by GPCRs .....7
Figure 1.2 The ghrelin receptor family. ...10
Figure 1.3 The growth hormone segretagouge receptor gene and mRNA
variants. ...12
Figure 1.4 Amino acid sequence of mature human ghrelin. ...14
Figure 1.5 Genomic organisation of the human ghrelin gene. ...15
Figure 1.6 Schematic representation of full length preproghrelin and
exon 3-deleted preproghrelin. ...23
Figure 1.7 GPR39 expression in prostate cancer. ...25
Figure 1.8 Zinc concentration in normal prostate, benign prostatic
hyperplasia (BPH) and prostate cancer tissue. ...28
Figure 1.9 Metabolic pathways and bioenergetics in the prostate. ...30
Figure 1.10 Zinc in the progression of prostate cancer. ...31
Figure 1.11 Heterodimerisation of GABAB receptor. ...33
Figure 1.12 Basic model describing the use of RET methods to measure
GPCR dimerisation. ...39
Figure 1.13 Acceptor photobleaching (ab) FRET. ...41
Figure 1.14 Principles underlying BRET experimental controls. ...45
Figure 3.1 Demonstration of GHS-R1a/GHS-R1b heterodimerisation
in native LNCaP prostate cancer cells by
co-immunoprecipitation ...60
Figure 3.2 Expression of GPR39 transcript in LNCaP prostate
cancer cells and GPR39 protein in PC-3
prostate cancer cells. ...68
Figure 3.3 Co-immunoprecipitation of GHS-R1a and GPR39 in the
native PC-3 prostate cancer cell line. ...70
Figure 3.4 Initial FLAG Immunoprecipitation of HEK293 cell lysates
to identify interactions between GHS-R1a and GPR39. ...72
Figure 3.5 The formation of GHS-R1a aggregates during SDS-PAGE
when samples in gel loading buffer are heated prior to
electrophoresis. ...74
xiv
Figure 3.6 Co-immunoprecipitation (IP) and Western immunobloting
(WB) of FLAG- and myc- tagged GHS-R1a, GHS-R1b
and GPR39 receptors in HEK293 cells. ...76
Figure 3.7 Proposed mechanism for SDS-resistant aggregation of
hydrophobic membrane proteins. ...79
Figure 4.1 Comparison of luminescence generated by BRET2 N-
and C- vector constructs after the injection of coelenterazine
400a substrate. ...90
Figure 4.2 Initial BRET2 ratios in the CWR22RV1 prostate cancer
cell line. ...91
Figure 4.3 BRET2 time course following addition of coelenterazine
400a in HEK293 cells. ...94
Figure 4.4 BRET2 ratios from GHS-R1a-Rluc standard BRET2 assays in
HEK293 cells. ...95
Figure 4.5 GPR39-Rluc standard BRET2 assays in HEK293 cells. ...96
Figure 4.6 BRET2 saturation curves in HEK293 cells. ...98
Figure 4.7 GHS-R1a-Rluc/GHS-R1a-GFP2 BRET2 in HEK293 cells at
a range of receptor levels at equal donor/acceptor ratios. ..100
Figure 4.8 BRET2 competition assays in HEK293 cells. ..102
Figure 5.1 Representative example of acceptor photobleaching FRET
using the positive control, CFP-linker-YFP construct, which
produces a fusion protein of acceptor and donor proteins with
significant FRET, in HEK293 cells. ..119
Figure 5.2 Representative examples of receptor and control wild type
cellular localization in HEK293 cells. ..121
Figure 5.3 Quantitative abFRET data for HEK293 cells expressing
YFP-GHS-R1a. ..123
Figure 5.4 Quantitative abFRET data for HEK293 cells expressing
YFP-GHS-R1b. ..124
Figure 5.5 Quantitative abFRET data for HEK293 cells expressing
YFP-GPR39. ..125
Figure 5.6 Quantitative abFRET data for the negative control
YFP-CB1 construct in HEK293 cells. ..126
Figure 5.7 Ghrelin and zinc treatments of GHS-R1a and GPR39
xv
expressing cells resulted in no change in abFRET. ..128
Figure 5.8 Demonstration of the fcFRET method to illustrate resonance
energy transfer from a CFP to YFP fluorophore. ..132
Figure 5.9 fcFRET controls. ..135
Figure 5.10 fcFRET in HEK293 cells expressing CFP-GHS-R1a. ..137
Figure 5.11 fcFRET in HEK293 cells expressing CFP-GHS-R1b. ..138
Figure 5.12 fcFRET in HEK293 cells expressing CFP-GPR39. ..139
Figure 5.13 Representative fcFRET experiment with ligand treated cells. ..141
Figure 6.1 Overexpression of GHS-R1a, GHS-R1b or GPR39 alone,
or in combination, does not lead to an increase in constitutive
ERK1/2 or AKT phosphorylation in PC-3 prostate
cancer cells. ..156
Figure 6.2 Basal apoptosis in PC-3 cells overexpressing GHS-R1a alone,
or in combination with GHS-R1b or GPR39, treated with
ghrelin, obestatin or zinc. ..158
Figure 6.3 Overexpression of GHS-R1a and GPR39 alone, or in
combination, did not attenuate apoptosis induced by
tunicamycin in PC-3 prostate cancer cells. ..160
Figure 6.4 The MEK inhibitor, U0126, did not stimulate an increase in
apoptosis in PC-3 cells overexpressing GHS-R1a alone, or in
combination with GHS-R1b, or GPR39 and treated with
ghrelin, obestatin or zinc. ..162
xvi
LIST OF TABLES
Table 3.1 Reverse Primer Sequences used for FLAG-tag and Myc-tag
cloning ...65
Table 4.1 Primer Sequences for BRET2 vector cloning ...85
xvii
LIST OF ABBREVIATIONS
°C Degrees Celsius
3D Exon 3-deleted
µg Microgram(s)
µl Microlitre(s)
µM Micromolar
AA Amino Acid
abFRET Acceptor Photobleaching Fluorescent Resonance Energy
Transfer
ANOVA Analysis Of Variance
BCA Bicinchoninic Acid
bp Base pair(s)
BPH Benign Prostate Hyperplasia
BRET Bioluminescence Resonance Energy Transfer
BSA Bovine Serum Albumin
cAMP Cyclic Adenosine Monophosphate
CB1 Cannabinoid Receptor-1
cDNA Complementary DNA
CFP Cyan Fluorescent Protein
CRE cAMP-responsive element
DMEM Dulbecco's Modified Eagle Medium
DNA Deoxyribonucleic Acid
dNTP Deoxynucleotide triphosphate
ECM Extracellular Matrix
EDTA Ethylenediaminetetraacetic acid
ER Endoplasmic Reticulum
ERK1/2 Extracellular Signal-Regulated Kinase 1/2
fcFRET Flow Cytometric Fluorescent Resonance Energy Transfer
FCS Foetal Calf Serum
FRET Fluorescent Resonance Energy Transfer
g Gram(s)
g G-force
xviii
GABA γ-Aminobutyric Acid
GFP Green Fluorescent Protein
GH Growth Hormone
GHS Growth Hormone Secretagogue
GHS-R Growth Hormone Secretagogue Receptor
GOAT Ghrelin O-Acyl Transferase
GPCR G Protein Coupled Receptor
GPR39 G Protein Coupled Receptor 39
hr Hour(s)
HEK Human Embryonic Kidney
kb Kilo base pair(s)
kDa Kilo Dalton(s)
M Molar
MAPK1/2 Mitogen Activated Protein Kinases 1/2
mg/mL Milligram Per Milliliter
min Minute(s)
mL Millilitre(s)
mM Millimolar
mRNA Messenger Ribonucleic Acid
MW Molecular Weight
ng Nanogram(s)
nm Nanometres
PAGE Polyacrylamide Gel Electrophoresis
PAR Protease-activated Receptor
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PSA Prostate Specific Antigen
RET Resonance Energy Transfer
Rluc Renilla reniformis luciferase
RNA Ribonucleic Acid
RPMI Roswell Park Memorial Institute
RT Room Temperature
s Second(s)
SDS Sodium Dodecyl Sulfate
xix
SEM Standard Error of the Mean
SRE Serum Response Element
TBE Tris Borate Ethylene
TBS Tris Buffered Saline
TBST Tris Buffered Saline with Tween
TE Tris EDTA buffer
TM Transmembrane domain
Tris Tris(hydroxymethyl)aminomethane
U Unit(s)
UTR Untranslated region
v/v Volume Per Volume
w/v Weight Per Volume
wt Wild Type
YFP Yellow Fluorescent Protein
xx
LIST OF PRESENTATIONS
Cunningham P.S., Ross F.B., Carter S.L., Herington A.C., Chopin L.K. (2008) The
Ghrelin Receptor GHSR1a Heterodimerises with GPR39, a Zinc Receptor, in
Prostate Cancer. ENDO08, The Endocrine Society’s Annual Meeting, San Francisco,
USA.
Cunningham P.S., Ross F.B., Carter S.L., Herington A.C., Chopin L.K. (2008) The
Ghrelin Receptor GHSR1a Heterodimerises with GPR39, a Zinc Receptor, in
Prostate Cancer. Australian Health and Medical Research Congress, Brisbane,
Australia.
xxi
STATEMENT OF ORIGINAL AUTHORSHIP
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To the
best of my knowledge and belief, the thesis contains no material previously
published or written by any other person except where due reference is made.
Signed: _______________________________________
Peter Cunningham
Date: 26/7/2010
xxii
ACKNOWLEDGEMENTS
Firstly, I would like to sincerely thank my principal supervisor, A/Prof. Lisa Chopin,
for the opportunity to undertake this project and for advice and encouragement
during the course of my studies. I am very grateful for all your effort and patience
throughout my PhD. I would also like to acknowledge my associate supervisors,
Prof. Adrian Herington, A/Prof. Fraser Ross and Dr. Jon Harris for their expert
scientific advice and discussions during my studies.
I would like to acknowledge the financial support provided by the Australian
Government for my Australian Postgraduate Award scholarship, and the Cancer
Council Queensland for funding our research group during the course of this study.
I would like to thank the past and present members of the Ghrelin Research Group;
Dr. Inge Seim, Carina Walpole, Laura Amorim, Rachael Murray, Peter Josh, Dr.
Penny Jeffery, Russell Duncan, Dan Abrahmsen, Katie Buzacott and Samia Taufiq
for their helpful advice and many chats. I would also like to thank the entire
Hormone Dependent Cancer Program for the many formal and informal discussions.
I must also acknowledge the lab support team; Sonya Winnington-Martin, Scott
Tucker and David Smith who keep the labs running smoothly and Dr. Leo de Boer
from the Cell Imaging Facility for her confocal microscopy and flow cytometry
expertise.
Special thanks must go to a number of other people who have provided friendship
and support during my time at QUT. I would like to thank; Shea, Suzelle, YuPei,
Nigel, JY, Mel and Brett for the many chats and rants that have helped me through
this PhD. I would also like to thank my non-QUT friends for keeping me entertained
and sane over the years. I must also thank my parents and extended family for their
support and encouragement.
Finally, I would like to thank my wife, Eeron, for your never-ending love and
support. I know putting up with me through this PhD has not been easy, but I truly
appreciate all your encouragement and more importantly for making these years fun.
1
CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW
2
1.1 PROSTATE CANCER
Prostate cancer is the second most common cause of cancer related deaths in Western
males (Jemal et al. 2008). Each year in Australia there are approximately 18,700 new
cases of prostate cancer and 3,000 prostate cancer related deaths, and current
statistics indicate that one in nine Australian men will develop prostate cancer in
their lifetime (Prostate_Cancer_Foundation_of_Australia 2009). The diagnosis and
treatment of prostate cancer is a substantial financial burden for healthcare providers
and also places a significant physical and emotional burden on patients and their
families (Fitzpatrick et al. 2009). Many questions currently remain regarding the
ultimate cause of prostate cancer, the diagnosis of prostate cancer and the most
efficacious treatment options at different cancer stages. During early stage prostate
cancer, treatment options include radical prostatectomy, radiation therapy, androgen
withdrawal therapy and watchful waiting (Wilt et al. 2008). The choice of treatments
is complex and there is often a trade-off between the potential benefit and chance of
negative side effects that can be associated with the treatment (Gomella et al. 2009).
In late stage prostate cancer, invasive/metastatic cells can undergo androgen-
independent growth and the cancer is incurable. There is currently an urgent need for
a greater understanding of the underlying mechanisms of prostate cancer progression,
the identification of better prognostic and diagnostic markers and for better adjuvant
therapies for this disease.
1.2 G-PROTEIN COUPLED RECEPTORS
G-protein coupled receptors (GPCRs) are a versatile family of membrane receptors
and are the largest family of proteins in the mammalian genome (Lander et al. 2001;
Venter et al. 2001). GPCRs are historically important drug targets and they currently
represent the target protein for approximately 30% of approved therapeutic drugs
(Overington et al. 2006). There is a remarkable variety of GPCR ligands including
ions, organic compounds, amines, peptides, proteins, lipids, nucleotides and photons
(Fredriksson et al. 2003). Two main characteristics define a GPCR. All GPCRs
contain seven transmembrane domains that are each composed of approximately 25-
35 amino acid residues that show a high degree of hydrophobicity (Fredriksson et al.
2003). GPCRs are, therefore, also referred to as seven transmembrane domain (7TM)
receptors. The transmembrane sequences of GPCRs form α-helices that span the
plasma membrane in a counter-clockwise manner to form the receptor unit
3
(Fredriksson et al. 2003). The second defining characteristic of GPCRs is the ability
to interact with a heterotrimeric guanine nucleotide-binding protein (G-protein, with
α, β and γ subunits) which act as the molecular switches for signalling pathways
activated by the GPCRs (Fredriksson et al. 2003; Oldham and Hamm 2006).
The A-F classification system is a commonly used method for classifying GPCRs
(Kolakowski 1994) which has also been adopted by the International Union of
Pharmacology Committee on Receptor Nomenclature and Drug Classification (NC-
IUPHAR) (Foord et al. 2005). The A-F classification system covers both vertebrate
and invertebrate GPCRs, however, only classes A-C exist in humans (Fredriksson et
al. 2003). The class A, or rhodopsin-like GPCR family is the largest family of
GPCRs, containing approximately 670 full length receptors in humans (Gloriam et
al. 2007), and about 40 of these receptors are recognised as major drug targets
(Lagerström and Schiöth 2008). Class A GPCRs characteristically have a short N-
terminal sequence, however, a large amount of heterogeneity is observed within this
family with respect to both their primary structure and ligand preference (Lagerström
and Schiöth 2008). The diverse class A family of GPCRs contains the opsins,
olfactory GPCRs, small-molecule/peptide hormone GPCRs and glycoprotein
hormone GPCRs, and the primary binding site of their ligands is located within the
seven transmembrane domain bundle (Jacoby et al. 2006). The class B family of
GPCRs are characterised by relatively long N-terminals, which are the site of ligand
binding and contains ~50 receptors for ligands which include secretin, calcitonin and
parathyroid hormone (Jacoby et al. 2006). The class C GPCR family contains 22
receptors, including the metabotropic glutamate receptors, the γ-aminobutyric acid
(GABA) receptors, the calcium-sensing receptor and the sweet and umami taste
receptors (Lagerström and Schiöth 2008). Class C receptors often have very long N-
and C- terminal tails and bind their ligands through the N-terminal domain (Jacoby et
al. 2006). Recently a phylogenetic analysis of GPCRs has proposed a new
classification system for this receptor superfamily, the GRAFS system, which
classifies GPCRs into five subfamilies; glutamate, rhodopsin, adhesion,
frizzled/taste2 and secretin (Fredriksson et al. 2003). The classification system
further divided the class B receptors into new secretin and adhesion families and
included the frizzled and the recently discovered bitter taste 2 (Taste2) receptors as
their own subgroup (Fredriksson et al. 2003; Lagerström and Schiöth 2008). Both
4
classification systems are widely used.
The primary role of all GPCRs is to activate downstream effectors in response to an
extracellular stimulus. Primarily this is performed through the activation of
heterotrimeric G proteins, comprised of an α, β and γ subunit. Heterotrimeric G
proteins, therefore, act as molecular switches to convert signals at the cell surface
into intracellular responses (Oldham and Hamm 2006). In an inactive state the Gα
subunit binds guanosine diphosphate (GDP) and the Gαβγ heterotrimer is not
associated with a GPCR (Bridges and Lindsley 2008). Upon ligand activation, a
GPCR undergoes a conformational change resulting in an increased affinity for the
G-proteins (Bridges and Lindsley 2008). The G-proteins interact with the
intracellular face and the C-terminus of the activated GPCR, which catalyses GDP
release from the Gα subunit and the exchange for guanosine triphosphate (GTP)
which destabilises the trimeric complex (Oldham and Hamm 2006; Bridges and
Lindsley 2008). The Gα(GTP) complex and the dimeric Gβγ are now active and will
interact with specific downstream effector proteins. The activation of the Gα and
Gβγ is completed by the hydrolysis of GTP to GDP and the reassociation of the
subunits into an inactive GDP-bound Gαβγ heterotrimer (Pierce et al. 2002). The
hydrolysis of GTP to GDP is regulated by RGS (regulators of G-protein signalling)
proteins that enhance the GTPase activity of the Gα subunit (De Vries et al. 2000;
Jacoby et al. 2006).
There are four main classes of Gα proteins, Gαs, Gαi, Gαq and Gα12 and each class
has a specific downstream effector target. The Gαs family couples to adenylyl
cyclase to stimulate an increase in cAMP (cyclic adenosine monophosphate) (Jacoby
et al. 2006). The Gαi family primarily acts by inhibiting adenylyl cyclase, however, it
can trigger other signalling events (Pierce et al. 2002; Jacoby et al. 2006; Bridges
and Lindsley 2008). The primary effector of the Gαq subfamily is phospholipase Cβ
(PLCβ) (Smrcka et al. 1991). Active PLCβ catalyses the hydrolysis of
phosphatidylinositol-4,5-bisphosphate (PIP2) to inositol-1,4,5-triphosphate (IP3) and
diacylglycerol (DAG), which both act as secondary messengers to trigger the release
of Ca2+ from intracellular stores and activate protein kinase C (PKC) (Jacoby et al.
2006). Members of the Gα12 family regulate the activation of Rho guanine-nucleotide
exchange factors (GEFs) (Pierce et al. 2002; Jacoby et al. 2006). In addition to the
5
Gα(GTP) subunits, the dimeric Gβγ subunit also acts as an effector by activating a
number of downstream targets including ion channels, G-protein regulated inward
rectifying K+ channels (GIRKs), phosphatidylinositol 3-kinase (PI3K),
phospholipases and adenylyl cyclase (Bridges and Lindsley 2008).
Once activated, GPCRs are desensitized by two families of proteins, the G protein
coupled receptor kinases (GRKs) and the arrestins. GRKs phosphorylate agonist
bound or activated GPCRs, and this phosphorylation promotes binding of the
inhibitory proteins, the arrestins (Pitcher et al. 1998). There are currently seven
known GRKs (GRK1-7) (Lefkowitz 2007). GRK1 and GRK7 are found exclusively
in the retinal rods and cones and GRKs 2, 3, 5 and 6 are more ubiquitously
distributed (Lefkowitz 2007). The classical function of the arrestin family of proteins
is to bind to phosphorylated GPCRs, blocking further G protein binding, and
therefore, blocking signalling, by steric inhibition (DeWire et al. 2007). There are
four members of the arrestin family; cone arrestin and rod arrestin, which are found
exclusively in retinal cells, and β-arrestin-1 (arrestin-2) and β-arrestin-2 (arrestin-3),
which are expressed ubiquitously in other tissues (Krupnick and Benovic 1998). In
addition to their role in GPCR desentisation, GRK and arrestin proteins also play a
role in receptor internalisation (endocytosis) (Drake et al. 2006).
It has recently been identified that in addition to classical G protein mediated
signalling, GPCRs can activate downstream effectors through a mechanism which is
independent of G proteins. These alternative signalling pathways are primarily
activated by the transducer molecules, β-arrestins 1 and 2, adding an additional level
of complexity to the understanding of GPCR signalling (Lefkowitz and Shenoy
2005). In G protein-independent signalling, β-arrestin is believed to act as a scaffold
protein to bring elements of different signalling pathways into close proximity
(DeWire et al. 2007). This β-arrestin-dependent signalling activates a number of
signalling pathways, including the mitogen activated protein kinases (MAPKs),
including the extracellular signalling-regulated kinases (ERKs), c-jun N-terminal
kinases (JNK) and p38 pathways and also the AKT, PI3K and RhoA pathways
(DeWire et al. 2007). The different GPCR signalling mechanisms have recently been
illustrated for the angiotensin II receptor for example (Ahn et al. 2004). In this study
the authors found that upon activation of the receptor there were two distinct waves
6
of ERK1/2 activation. The first wave was a rapid (peaking <2 min), transient
activation of ERK1/2, that was dependent on G protein activation, however, a slower
and more persistent wave of ERK1/2 phosporylation, (peaking 5-10 min), was
shown to be modulated by β-arrestin 2 activation (Ahn et al. 2004). Interestingly, in
addition to the different kinetic patterns of these signalling mechanisms, the authors
determined that the G protein-dependent activation led to nuclear translocation of the
activated ERK1/2, whereas, the β-arrestin 2 activated ERK1/2 was confined entirely
to the cytoplasm. This suggests that different spatial patterns of ERK1/2 activation
arise though the two different activation pathways (Ahn et al. 2004). Studies such as
these have prompted a new paradigm of signalling transduction by GPCRs (Figure
1.1). These alternative signalling pathways have increased our understanding of the
therapeutic possibilities for GPCRs. The potential for biased agonists, that is,
agonists that differentially regulate the different signalling pathways are currently
being investigated (Lefkowitz 2007). These signalling mechanisms, however, are
unlikely to be common to each receptor in each cell type. It is becoming increasingly
apparent that there is no generic GPCR signalling mechanism and receptor signalling
will need to be determined on a case by case basis (Gurevich and Gurevich 2008c).
7
Figure 1.1 The current paradigm of signal transduction by GPCRs. In addition
to the classical mechanism of G protein activation upon agonist binding of the GPCR
(7TMR), which is desensitised by G protein coupled receptor kinases (GRKs) and
the arrestins, a G protein-independent signalling pathway is shown, whereby β-
arrestin can independently modulate different signalling pathways. Gα activation can
activate second messenger pathways including; cyclic adenosine monophosphate
(cAMP), diacylglycerol (DAG) and inositol-1,4,5-triphosphate (IP3). β-arrestin-
dependent signalling can activate the mitogen activated protein kinases (MAPKs),
tyrosine kinases, the AKT pathway, phosphatidylinositol 3-kinase (PI3K) and the
nuclear factor-κB (NFκB) pathway. Adapted from Lefkowitz and Shenoy (2005).
Recently a number of factors have expanded the traditional two-state model of
receptor theory, which proposes that a GPCR exists in either an active or an inactive
state. In addition to agonist regulation of GPCRs, a number of GPCRs are known to
signal without an external trigger, and are, therefore, constitutively active (Smit et al.
2007). More than 60 wild type GPCRs have been shown to demonstrate some degree
of constitutive activity (Seifert and Wenzel-Seifert 2002). Additionally, a number of
mutant GPCRs, often with single point mutations, have altered levels of constitutive
activity and have been associated with pathophysiological conditions (Seifert and
Wenzel-Seifert 2002; Smit et al. 2007). An interesting new field of GPCR research is
8
the identification of inverse agonists, which are agonists that stabilise the inactive
state. They are particularly interesting, as they may be applicable for the treatment of
diseases which are caused by mutant GPCRs with increased constitutive activity
(Smit et al. 2007). Another factor adding to the degree of complexity of GPCR
activity is the concept of allosteric modulation. The binding site of a receptor’s
endogenous agonist is termed the orthosteric site, whereas a ligand binding site that
is distinct from the orthosteric binding site is an allosteric site (Bridges and Lindsley
2008). Allosteric ligands can bind at allosteric sites and function independently of the
orthosteric ligand, or can act as positive or negative allosteric modulators of the
native ligand to regulate GPCR function (Bridges and Lindsley 2008). Allosteric
ligands and inverse agonists of constitutive activity represent new fields for GPCR
drug discovery, however, they also add an increased level of complexity when
considering the mechanisms of GPCR regulation.
High resolution structural information for GPCRs has become increasingly available
in recent years. The first crystal structure of a GPCR, bovine rhodopsin in its inactive
state, was published in 2000 (Palczewski et al. 2000). This structure provided
valuable information about GPCR structure and the future identification of structures
for activated rhodopsin (Salom et al. 2006), opsin, the ligand-free form of rhodopsin
(Park et al. 2008), and opsin in its G protein interacting conformation (Scheerer et al.
2008) has provided additional information about GPCR structure in different
conformational states. The generation of crystal structures for non-rhodopsin GPCRs,
however, proved significantly more difficult due the inherent structural flexibility of
these receptors, their instability in detergent solutions and a natural low abundance,
particularly when compared with rhodopsin (Rasmussen et al. 2007). Recently,
however, using different techniques to stabilise the GPCRs, such as monoclonal
antibody binding of the intracellular loops (Rasmussen et al. 2007), replacement of
the intracellular loop 3 sequence with a well-folded protein (T4 lysozyme) to
stabilise the flexible transmembrane helices (TMs 5 and 6) (Cherezov et al. 2007;
Hanson et al. 2008; Jaakola et al. 2008) and conformational thermostabilisation by
mutagenesis (Hanson et al. 2008; Warne et al. 2008), crystal structures have been
determined for the human β2-adrenergic receptor (β2AR) (Cherezov et al. 2007;
Rasmussen et al. 2007; Hanson et al. 2008), the turkey β1-adrenergic receptor
(β1AR) (Warne et al. 2008) and the human adenosine A2A receptor (Jaakola et al.
9
2008). Analysis of the structures of these class A receptors; rhodopsin, opsin, β2AR,
β1AR and the adenosine A2A receptor, reveal areas of similarly and areas of
divergence. The highest degree of similarly is observed within the transmembrane
helices, as may be predicted, as this is the core structure and the most highly
conserved region of the receptors (Hanson and Stevens 2009). In contrast, quite a
degree of divergence has been noted in the extracellular region, the ligand binding
pocket and the intracellular loops (Hanson and Stevens 2009). With crystal structures
now available, there is the potential to apply structure-based drug discovery methods,
however, as even within this small subset of GPCRs where the crystal structures are
available, there are significant structural differences and these models, therefore, may
not extrapolate well to other GPCRs (Kobilka and Schertler 2008).
Until recently, GPCRs were widely thought to function as monomers. Increasingly,
however, GPCRs are being recognised to functions as dimers, highlighting an
expanding level of complexity of the functionality of these membrane proteins. The
ability of GPCRs to exist and function as dimers will be discussed in more detail
later in this review (Chapter 1.5).
1.2.1 GPCRs in Prostate Cancer
GPCRs can regulate an enormous variety of biological and pathological processes.
Stimulation of GPCRs can play key roles in cell survival, cell proliferation and
angiogenisis, which are key functions implicated in prostate cancer progression (Raj
et al. 2002). Extracellular hormones acting through GPCRs may be important in the
maintenance of androgen-independent prostate cancer (Raj et al. 2002; Daaka 2004).
Furthermore, inhibition of G protein signalling has been shown to attenuate prostate
cancer growth in a number of cell types, and the MAPK pathway is emerging as a
critical signalling pathway (Raj et al. 2002; Daaka 2004). A number of GPCRs have
been shown to be overexpressed in malignant prostate cancer including the prostate-
specific GPCR (Xu et al. 2000), the bradykinin receptor (Taub et al. 2003), the
Dresden G protein-coupled receptor (Weigle et al. 2004), the CC chemokine receptor
2 (CCR2) (Lu et al. 2007), the protease-activated receptors (PAR-1, PAR-2 and
PAR-4) (Black et al. 2007; Zhang et al. 2009) and the cannabinoid receptor-1 (CB1)
(Chung et al. 2009; Czifra et al. 2009). GPCRs may, therefore, play a significant role
in the initiation and progression of prostate cancer.
10
1.3 THE GHRELIN RECEPTOR FAMILY
The ghrelin receptor family is a small subfamily of G-protein coupled receptors
within the Class A, or Rhodopsin, family of GPCRs. The receptors in the ghrelin
receptor family are; the ghrelin receptor (also known as the growth hormone
secretagogue receptor 1a, GHS-R1a or GRLN-R), the motilin receptor (GPR38), the
neurotensin receptors (neurotensin R1 and neurotensin R2), the neuromedin U
receptors (neuromedin U- R1 and neuromedin U- R2) and GPR39 (Holst et al. 2004).
A phylogenic tree showing the ghrelin receptor family and a serpentine and helical
wheel diagram of the ghrelin receptor are shown in Figure 1.2.
Figure 1.2 The ghrelin receptor family. A) Phylogenic tree of the ghrelin receptor
family. B) Serpentine and helical wheel diagram of the ghrelin receptor, GHS-R1a.
Residues that are identical (white on black) or structurally conserved (white on grey)
between GHS-R1a and the motilin receptor, its closest homologue are indicated. The
motilin receptor also contains a long insertion of 39 amino acids in extracellular loop
2 (indicated by the arrow) which is not found in the GHS-R1a. Adapted from Holst
et al. (2003); Holst et al. (2004).
11
1.3.1 The growth hormone secretagogue receptor
The ghrelin receptor, GHS-R, was originally described as the receptor for growth
hormone secretagogues (GHSs), before the identification of its native ligand, ghrelin.
In the 1980s and 1990s, synthetic peptide and non-peptide compounds were
developed that stimulated growth hormone release via a mechanism independent of
growth hormone releasing hormone (GHRH) and these GHSs were proposed to act
through a specific receptor (Bowers et al. 1984; Smith et al. 1993; Patchett et al.
1995). The growth hormone secretatagogue receptor (GHS-R) was identified in the
pituitary and hypothalamus in 1996 (Howard et al. 1996). The full length GHS-R
contains many typical GPCR characteristics, including conserved cysteine residues
in the first and second extracellular loops, the E/DRY aromatic triplet sequence
located in the second intracellular loop and a number of potential sites for
posttranslational modification (Kojima and Kangawa 2005). In 1999, the endogenous
ligand for GHS-R, ghrelin, was identified as an acylated peptide from the stomach
(Kojima et al. 1999).
The human GHS-R gene is located on chromosome 3q26.2 and it consists of two
exons and a single intron (Howard et al. 1996; McKee et al. 1997b). The first exon
encodes transmembrane domains 1-5 and the second exon encodes transmembrane
domains 6 and 7 (Howard et al. 1996; McKee et al. 1997b). Two splice variants of
GHS-R are known. The first, GHS-R1a, is the full length isoform and encodes a
seven transmembrane domain receptor of 366 amino acids (Howard et al. 1996;
McKee et al. 1997b). GHS-R1b is a C-terminally truncated isoform of 289 amino
acids, consisting of five transmembrane domains encoded by exon one. It also retains
part of the intron, encoding 24 amino acids of unique sequence prior to a stop codon
(Howard et al. 1996; McKee et al. 1997b) (Figure 1.3). In contrast to GHS-R1a,
GHS-R1b does not bind GHSs or ghrelin and they do not activate downstream
signalling from GHS-R1b (Howard et al. 1996). The GHS-R gene is highly
conserved between human, chimpanzee, swine, bovine, rat and mouse genomic DNA
(Howard et al. 1996).
12
Figure 1.3 The growth hormone secretagogue receptor gene and mRNA
variants. Full length GHS-R1a mRNA encodes seven transmembrane domains from
exons one and two. The truncated mRNA variant, GHS-R1b, retains intronic
sequence and encodes a five transmembrane domain protein with a unique C-
terminus. Adapted from Jeffery et al. (2003).
The growth hormone secretagogue receptor subtypes are widely expressed. GHS-
R1a expression was initially characterised in the pituitary and the hypothalamus
(Howard et al. 1996) where it is highly expressed, and this reflects the actions of the
full length receptor which mediates growth hormone release and appetite regulation
(Soares and Leite-Moreira 2008). GHS-R1a is also expressed in numerous peripheral
tissues including the stomach, intestine, pancreas, spleen, thyroid, gonads, adrenal
gland, kidney, heart, lung, liver, adipose tissue and bone (Gnanapavan et al. 2002;
Kojima and Kangawa 2005; Camina 2006; Soares and Leite-Moreira 2008).
Additionally, GHS-R1a is expressed in the prostate (Jeffery et al. 2002). The
truncated ghrelin receptor isoform, GHS-R1b, is also widely expressed, often at
higher levels than GHS-R1a (Gnanapavan et al. 2002). Interestingly, in the prostate,
GHS-R1b expression was not observed in a normal prostate cDNA library, but could
be detected in a number of prostate cancer cell lines, and this may represent a
difference between a normal and cancerous state (Jeffery et al. 2002). Initially, GHS-
R1b was thought to be non-functional, however, more recently, GHS-R1b has been
shown to interact with other GPCRs to modulate their function (Chapter 1.6)
GHS-R1a signalling is primarily mediated by the Gαq (also known as the Gαq/11)
subclass of G proteins (Howard et al. 1996; McKee et al. 1997b; Camina 2006).
Isolated studies have also suggested potential GHS-R1a signalling via Gαs (Kohno et
13
al. 2003) and Gαi (Camina et al. 2007b) protein coupling. Our understanding of the
pathways involved in ghrelin-mediated signalling is becoming increasingly complex
(Chapter 1.3.2.3). Significantly, however, GHS-R1a displays a high degree of
ghrelin-independent constitutive signalling. This constitutive activity was initially
overlooked, as earlier studies of GHS-R1a activation had primarily investigated
receptor signalling using intracellular calcium mobilisation assays, where
constitutive signalling is difficult to detect (Holst et al. 2003). Using alternative
signalling assays in COS-7 or HEK293 cells which were transiently transfected with
GHS-R1a, a high degree (~50% of maximal activity) of ligand-independent inositol
phosphate turnover (Gαq signalling through the phospholipase C pathway) and
activation of cAMP-responsive element (CRE) gene transcription was observed,
indicating a high degree of GHS-R1a constitutive signalling (Holst et al. 2003).
Additional studies by the same group also determined that GHS-R1a displayed a
degree of constitutive signalling through the serum response element (SRE) pathway
and that the receptor is constitutively internalised in the absence of ligand (Holst et
al. 2004). Interestingly, constitutive phosphorylation of ERK1/2, a pathway which is
implicated in ghrelin mediated signalling in a number of cell types, was not observed
in COS-7 cells transiently transfected with GHS-R1a (Holst et al. 2004). The
constitutive activity of GHS-R1a results from an aromatic cluster on the inner face of
the extracellular ends of transmembrane domains 6 and 7, which holds the receptor
in an active conformation (Holst et al. 2004).
A recent study has provided evidence that the constitutive activity of GHS-R1a may
be physiologically relevant. A natural mutation, Ala204Glu, that results in a loss of
constitutive activity while maintaining ghrelin affinity, segregated with the
development of short stature in two unrelated Moroccan families (Pantel et al. 2006).
These studies suggested that the high degree of constitutive signalling observed for
GHS-R1a, and indeed a number of other GPCRs, is not simply an in vitro artefact but
is likely to be physiologically relevant (Holst and Schwartz 2006). Additionally, the
constitutive signalling of GHS-R1a has been described to play a role in cell survival
(Lau et al. 2009). One of the hallmarks of cancer is the ability to evade apoptosis,
resulting in an increase in malignant cells (Hanahan and Weinberg 2000). In
HEK293 cells stably overexpressing seabream GHS-R1a, the expression of GHS-
R1a significantly attenuated cadmium-induced apoptosis and this protective effect
14
was not modulated by GHS-R1a ligands (Lau et al. 2009). The protective role of
constitutive GHS-R1a activity was mediated via a protein kinase C-dependent
pathway (Lau et al. 2009).
Recently, the ghrelin receptor isoforms, GHS-R1a and GHS-R1b, have been found to
modulate the action of a number of other GPCRs through the formation of functional
heterodimers (Chapter 1.6).
1.3.2 Ghrelin
The endogenous ligand for GHS-R1a, ghrelin, was discovered in 1999 and over the
last decade has been the focus of a great deal of research in a number of biological
systems. Ghrelin, a 28 amino acid peptide, was initially identified in the rat stomach
and was shown to specifically release growth hormone both in vivo and in vitro
(Kojima et al. 1999). Ghrelin-stimulated dose-dependent growth hormone release
was subsequently demonstrated in humans (Takaya et al. 2000). The name ghrelin is
derived from the Proto-Indo-European root “ghre” meaning grow (Kojima et al.
1999). Interestingly, ghrelin has a unique post-translational modification where the
third residue, serine, is esterified by an n-octanoic acid (Kojima et al. 1999) (Figure
1.4).
Figure 1.4 Amino acid sequence of mature human ghrelin. Ghrelin is a 28 amino
acid peptide with a unique post-translational modification, n-octanoylation, of the
third residue (serine). Adapted from Jeffery et al. (2003).
Mature human ghrelin is derived from a 117 amino acid preprohormone,
preproghrelin (Kojima et al. 1999). The human ghrelin gene is located on
chromosome 3p25-26 and was originally described as containing four exons (1-4).
Recently, however, two 5’ exons (-1 and 0) have been described that encode
additional 5’ untranslated sequence (Wajnrajch et al. 2000; Kanamoto et al. 2004;
Seim et al. 2007). The genomic structure of the ghrelin gene is shown in Figure 1.5.
15
The preproghrelin signal sequence is encoded by a part of exon 1, and exons 1 to 4
encode preproghrelin (Seim et al. 2007). In addition to the full length gene, a number
of alternative ghrelin splice variants have also been described in different human
tissues, including some that do not code for ghrelin (Seim et al. 2007). Notably, an
exon 3-deleted variant has been described that is upregulated in prostate (Yeh et al.
2005) and breast (Jeffery et al. 2005) cancers. In addition to ghrelin, a number of
alternative preproghrelin peptides are produced (Chapter 1.3.2.5-6). Ghrelin is most
highly expressed in the stomach, where it is produced and secreted from the X/A-like
cells (Date et al. 2000). Ghrelin mRNA is also highly expressed in other parts of the
gut and is generally expressed in most tissues (Gnanapavan et al. 2002). Ghrelin
mRNA and protein are expressed in the prostate (Jeffery et al. 2002; Cassoni et al.
2004; Yeh et al. 2005).
Figure 1.5 Genomic organisation of the human ghrelin gene. Originally described
as consisting of four exons, the ghrelin gene structure has recently been revised to
include two 5’ exons that encode untranslated sequence. The size of each exon (bp)
is shown. Preproghrelin is encoded by exons 1-4. Adapted from Seim et al. (2007).
While ghrelin was originally described as an endogenous growth hormone
secretagogue, ghrelin is also an important orexigenic hormone. Treatment with
ghrelin stimulates appetite and food intake and promotes weight gain (Tschöp et al.
2000; Wren et al. 2001). Ghrelin appears to play a role in meal initiation, as levels of
circulating ghrelin increase preprandially and then decrease postprandially
(Cummings et al. 2001; Tschöp et al. 2001a). Circulating ghrelin concentrations are
decreased in obese people and increased in lean people and people with anorexia
nervosa or bulimia nervosa (Otto et al. 2001; Tschöp et al. 2001b; Shiiya et al. 2002;
Tanaka et al. 2003). The role of ghrelin in appetite regulation is primarily mediated
by stomach-derived ghrelin which stimulates the neuropeptide Y (NPY) and agouti-
related peptide (AgRP) neurons in the hypothalamic arcuate nucleus (ARC) to
stimulate the release of these potent orexigenic peptides, however, additional indirect
mechanisms of appetite regulation have also been proposed (Asakawa et al. 2001b;
16
Nakazato et al. 2001; Shintani et al. 2001; Cowley et al. 2003; Inui et al. 2004;
Kojima and Kangawa 2008). As it is a potent stimulator of appetite, antagonism of
ghrelin function is considered to be an attractive approach for anti-obesity drug
design. Ghrelin receptor antagonists and vaccination against ghrelin have been
previously demonstrated to have some effect on food intake and weight gain
(Asakawa et al. 2003; Zorrilla et al. 2006; Esler et al. 2007). The effects of such
treatments have been questioned, however. In ghrelin or GHS-R1a knock-out mice
no significant change in appetite occurs compared to wild-type controls, suggesting
that other factors may compensate for ghrelin loss, and appetite is maintained (Sun et
al. 2003; Sun et al. 2004; Kojima and Kangawa 2008). Furthermore, ghrelin levels
are already reduced in obese patients (Tschöp et al. 2001b; Kojima and Kangawa
2008). Conversely, ghrelin treatments may be useful for conditions where weight
gain is desirable, such as cachexia associated with cancer, heart failure, chronic
kidney disease and acquired immunodeficiency syndrome (DeBoer 2008). Limited
human trials have shown some improvement in appetite and body mass with ghrelin
treatment, however, longer term studies are required to confirm sustained effects
(DeBoer 2008).
In addition to stimulating growth hormone release and appetite, ghrelin has a number
of other functions. The many roles of ghrelin have been extensively reviewed (Inui et
al. 2004; van der Lely et al. 2004; Kojima and Kangawa 2005; Hosoda et al. 2006;
Higgins et al. 2007; Leite-Moreira and Soares 2007; Katergari et al. 2008; Kojima
and Kangawa 2008; Pazos et al. 2008; Soares and Leite-Moreira 2008). Ghrelin has
been shown to have a role in cardiac function, significantly decreasing mean arterial
blood pressure without significantly changing heart rate (Nagaya et al. 2001a) and
improving left ventricular dysfunction (Nagaya et al. 2001b). Ghrelin, therefore, has
potential as a treatment for severe chronic heart failure (Nagaya and Kangawa 2003).
There has been conflicting evidence about the role of ghrelin in insulin release, with
some studies reporting that ghrelin stimulates insulin release (Adeghate and Ponery
2002; Date et al. 2002; Lee et al. 2002), whereas other studies suggest that ghrelin
reduces insulin secretion (Broglio et al. 2001; Reimer et al. 2003). Similarly, ghrelin
has been shown to both stimulate (Li et al. 2007) and inhibit angiogensis (Baiguera
et al. 2004; Conconi et al. 2004). Ghrelin may play a role in adipogenesis, as ghrelin
has been reported to stimulate the differentiation of preadipocytes and antagonises
17
lipolysis (Choi et al. 2003). Ghrelin has a range of gastrointestinal roles and can
stimulate gastric acid secretion and gastric motility (Masuda et al. 2000). Ghrelin
may also regulate anxiety and memory retention (Asakawa et al. 2001a; Carlini et al.
2002), promote slow wave sleep (Weikel et al. 2003), inhibit the expression of pro-
inflammatory cytokines (Dixit et al. 2004; Li et al. 2004), stimulate bone formation
(Fukushima et al. 2004) and relax the sphincter and dilator muscles of the iris
(Rocha-Sousa et al. 2006). Significantly, ghrelin also plays a role in cell proliferation
and apoptosis in both normal and cancerous cells.
1.3.2.1 The ghrelin axis in cell proliferation and apoptosis
Since the discovery of ghrelin, the role of this peptide on cellular proliferation and
apoptosis has been studied in a number of normal and cancer cell types and both
stimulatory and inhibitory effects have been described. Ghrelin has largely been
shown to stimulate proliferation in normal cell lines including; the H9c2
cardiomyocyte cell line (Pettersson et al. 2002), rat adrenal cortical zona glomerulosa
cells (Andreis et al. 2003; Mazzocchi et al. 2004), the GH3 rat pituitary somatotroph
cell line (Nanzer et al. 2004), mouse splenic T lymphocytes (Xia et al. 2004), 3T3-
L1 adipocytes (Kim et al. 2004), osteoblastic MC3T3-E1 cells (Kim et al. 2005), rat
osteoblastic cells (Fukushima et al. 2004; Maccarinelli et al. 2005), oral
keratinocytes (Groschl et al. 2005), primary cultured cells from rat foetal spinal cord
(Sato et al. 2006), pancreatic β-cells (Granata et al. 2007), human aortic endothelial
cells (Rossi et al. 2008) and human osteoblastic TE85 cells (Wang et al. 2009).
Ghrelin also inhibits the proliferation of immature Leydig cells in the rat testis
(Barreiro et al. 2004). Ghrelin has a protective effect against apoptosis in a number
of normal cell types (induced in a variety of ways) including; doxorubicin and serum
deprivation-induced apoptosis in cardiomyocytes and endothelial cells (Baldanzi et
al. 2002), apoptosis induced by serum deprivation in adrenal zona glomerulosa cells
(Mazzocchi et al. 2004) and adipocytes (Kim et al. 2004), tumor necrosis factor
(TNF)α-induced apoptosis in mouse osteoblastic MC3T3-E1 cells (Kim et al. 2005)
and vascular smooth muscle cells (Zhang et al. 2008b), doxorubicin-induced
apoptosis in pancreatic β cells (Zhang et al. 2007b), serum deprivation and
interferon-γ/TNFα-induced apoptosis in pancreatic β-cells and human pancreatic
islets (Granata et al. 2007), oxygen-glucose deprivation-induced apoptosis in
hypothalamic neuronal cells (Chung et al. 2007) and oxidative stress-induced
18
apoptosis in cardiomyocytes from adult rats (Liu et al. 2009). The largely
proliferative and pro-survival effects of ghrelin suggest that ghrelin may play a role
in the modulation of growth of a number of peripheral cell types.
There is conflicting data regarding the effect of ghrelin on proliferation in cancer
cells. A number of endocrine and non-endocrine cancers have been shown to express
components of the ghrelin axis and respond to ghrelin treatments (Lanfranco et al.
2008; Soares and Leite-Moreira 2008). Ghrelin has an anti-proliferative effect on a
number of cancer cell lines including breast (Cassoni et al. 2001), thyroid (Volante et
al. 2003) and small cell lung carcinoma (Cassoni et al. 2006) cell lines. Conversely,
ghrelin has also been shown to stimulate proliferation in the HepG2 human
hepatocellular carcinoma cell line (Murata et al. 2002), the HEL human
erythroleukemic cell line (De Vriese et al. 2005), the MDA-MB-435 and MDA-MB-
231 breast cancer cell lines (Jeffery et al. 2005) and the SW-13 and NCI-H295R
adrenocortical carcinoma cell lines (Delhanty et al. 2007) and it stimulates
proliferation and invasiveness in a variety of pancreatic adenocarcinoma cell lines
(Duxbury et al. 2003). In the SW-13 adrenocortical carcinoma cell line, ghrelin
treatment suppressed basal apoptosis (Delhanty et al. 2007), however, ghrelin has
pro-apoptotic effects in the H345 small cell lung carcinoma cell line (Cassoni et al.
2006). The regulation of proliferation by ghrelin in cancer cell types that express
ghrelin and GHS-R1a suggests that locally synthesised hormone may have an
autocrine/paracrine role in cancer proliferation (Jeffery et al. 2003; Soares and Leite-
Moreira 2008).
1.3.2.2 The Ghrelin/GHSR axis in prostate cancer
Ghrelin and the ghrelin receptor isoforms are expressed in prostate cancer. Ghrelin is
expressed in prostate cancer tissue and in the ALVA-41, LNCaP, DU-145 and PC-3
prostate cancer cell lines (Jeffery et al. 2002; Cassoni et al. 2004; Yeh et al. 2005).
Importantly, prostate cancer histopathological sections showed increased expression
of ghrelin when compared to normal prostate tissues, and prostate cancer cell lines
secrete ghrelin (Yeh et al. 2005). While our studies have shown that GHS-R1a is
expressed in normal prostate and in the prostate cancer cell lines (Jeffery et al. 2002),
other studies detected GHS-R1a only in the DU-145 cell line and not in cancer
tissues tested (Cassoni et al. 2004). The truncated ghrelin receptor isoform, GHS-
19
R1b, was not observed in a normal prostate cDNA library, however, could be
detected in a number of prostate cancer cell lines (Jeffery et al. 2002) and prostate
cancer specimens (unpublished, Ghrelin Research Group, Queensland University of
Technology) and this may represent a difference between a normal and cancerous
state (Jeffery et al. 2002).
There is conflicting data regarding the effects of ghrelin on prostate cancer
proliferation. Studies performed by our research group have shown that ghrelin
stimulates proliferation of the PC-3 and LNCaP prostate cancer cell lines at close to
physiological levels (Jeffery et al. 2002; Yeh et al. 2005). Another study, however,
suggested that exogenous ghrelin inhibited DU145 cell proliferation, displayed a
biphasic effect in PC-3 cells and was ineffective in LNCaP cells (Cassoni et al.
2004). The reasons for these differences is not immediately apparent, however, these
studies varied in the concentrations of ghrelin used and in the assay method.
Variations were noted to depend on dose and this may represent a difference between
the physiological dose and the pharmacological dose of ghrelin (Lanfranco et al.
2008). Similarly, the differences noted between the different cell lines may be
dependent on androgen-dependent status or different expression of signal transducers
and transcription activators, however, this remains to be determined (Lanfranco et al.
2008). Studies into the potential pro-survival effect of ghrelin in prostate cancer have
been limited, however, a study from our laboratory suggested that ghrelin had no
protective effect on apoptosis induced by actinomycin D (Yeh et al. 2005).
Recently, the potential diagnostic value of ghrelin as a serum marker for the
detection of prostate cancer was assessed. No statistical significance was observed in
serum ghrelin levels between patients with benign prostate hyperplasia and prostate
cancer, however, insufficient secretion of ghrelin into the serum or ghrelin from
other sources could affect this outcome (Mungan et al. 2008). In another study of
prostate cancer patients receiving hormone suppressive treatments, no correlation
was observed between circulating ghrelin and testosterone levels (Bertaccini et al.
2009). Despite conflicting data regarding the role of ghrelin in prostate cancer, it is
clear that ghrelin plays a role in prostate cancer growth and may provide a novel
target for new anti-neoplastic agents, however, further studies are required
(Lanfranco et al. 2008).
20
1.3.2.3 Ghrelin signalling
GHS-R1a intracellular signalling was initially found to be mediated by Gαq/11 protein
coupling (Howard et al. 1996; McKee et al. 1997b). Phosphatidylinositol-specific
phospholipase C (PI-PLC) mediated intracellular calcium mobilisation remains the
best characterised intracellular mechanism of ghrelin signalling (Pazos et al. 2008).
Ghrelin may also signal through other pathways. In NPY-containing neurons, an
alternative calcium mobilisation pathway has been demonstrated where calcium
influx is mediated by protein kinase A and N-type channel-dependent mechanisms in
response to ghrelin treatment (Kohno et al. 2003). Activation of adenosine mono-
phosphate activated protein kinase (AMPK), which plays a critical role in the
regulation of energy metabolism, has also been shown to play a role in ghrelin-
mediated control of food intake (Andersson et al. 2004). Additionally, ghrelin
administration increases the levels of nitric oxide synthase in the hypothalamus,
suggesting a role of nitric oxide (NO) as a regulator of food consumption (Gaskin et
al. 2003). Ghrelin can also stimulate GHS-R1a signalling through non-G protein
coupled, β-arrestin/ERK1/2 signalling (Camina et al. 2007b)
Ghrelin stimulated cell proliferation has been shown to be mediated by a number of
different signalling mechanisms including; cAMP/protein kinase A signalling
(Granata et al. 2007), activation of a tyrosine kinase dependent pathway (Andreis et
al. 2003; Mazzocchi et al. 2004; Nanzer et al. 2004), ERK1/2 phosphorylation
(Murata et al. 2002; Andreis et al. 2003; Kim et al. 2004; Mazzocchi et al. 2004;
Nanzer et al. 2004; Kim et al. 2005; Yeh et al. 2005; Granata et al. 2007; Rossi et al.
2008), AKT phosphorylation (Duxbury et al. 2003; Kim et al. 2004; Granata et al.
2007; Rossi et al. 2008) and activation of nitric oxide (NO)/cyclic guanosine
monophosphate (cGMP) signalling (Wang et al. 2009). Ghrelin mediated cell
survival is mediated by both the ERK1/2 and AKT signalling pathways (Baldanzi et
al. 2002; Kim et al. 2004; Mazzocchi et al. 2004; Chung et al. 2007; Granata et al.
2007; Zhang et al. 2007b; Liu et al. 2009), which have previously been described to
play critical roles in apoptosis regulation (Xia et al. 1995; Dudek et al. 1997).
Studies in the prostate have shown that ghrelin can stimulate ERK1/2
phosphorylation in the PC-3 and LNCaP prostate cancer cell lines (Yeh et al. 2005).
21
1.3.2.4 Ghrelin O-acyl transferase (GOAT)
Very recently the enzyme that acylates ghrelin, ghrelin O-acyl transferase (GOAT),
was identified (Gutierrez et al. 2008; Yang et al. 2008). This enzyme is a conserved
member the membrane-bound O-acyl transferase (MBOAT) family and it
specifically octanoylates serine-3 of ghrelin (Gutierrez et al. 2008). Confirming the
role of this enzyme in ghrelin acylation, GOAT knockout mice showed a complete
lack of octanoylated ghrelin in contrast to their wild-type littermates (Gutierrez et al.
2008). Additionally, human GOAT is predominantly expressed in tissues that also
highly express ghrelin; the stomach and pancreas (Gutierrez et al. 2008).
Interestingly, GOAT appears to be regulated by nutrient availability. It depends on
specific dietary lipids as acylation substrates and it links ingested lipids to energy
expenditure and body fat mass (Kirchner et al. 2009). The recent identification of
GOAT expands our understanding of the ghrelin axis and may provide a new target
for anti-obesity and anti-diabetic drugs (Gualillo et al. 2008). GOAT studies are still
in their infancy, however, and further research is required to elucidate the role of
GOAT in peripheral tissues and malignant cells.
1.3.2.5 Des-acyl ghrelin
In addition to ghrelin, des-acyl ghrelin, an un-acylated form of the 28 amino acid
peptide is also produced from preproghrelin. The des-acyl form represents a
significant proportion of total ghrelin in the stomach and 80% of ghrelin in
circulation (Date et al. 2000; Hosoda et al. 2000). Des-acyl ghrelin does not bind
GHS-R1a or stimulate growth hormone release and des-acyl ghrelin was originally
thought to be inactive (Kojima et al. 1999; Hosoda et al. 2000). More recently,
however, it has been recognised that des-acyl ghrelin has physiological effects that
mirror the effects of ghrelin and unique functions which are independent of GHS-
R1a. Importantly, as des-acyl ghrelin is unable to bind GHS-R1a, an alternative, as
yet unidentified receptor for des-acyl ghrelin is proposed. The role of des-acyl
ghrelin on appetite is unclear and reports have been conflicting, some suggesting that
des-acyl ghrelin can reduce feeding (Asakawa et al. 2005; Chen et al. 2005), have no
effect (Neary et al. 2006) or induce feeding (Toshinai et al. 2006). An explanation of
these discrepancies has not been established and further studies are required (Inhoff
et al. 2009). In glucose-stimulated conditions, exogenous des-acyl ghrelin acts dose
22
dependently as a potent insulin secretagogue (Gauna et al. 2007). Des-acyl ghrelin
has some similar effects to ghrelin on cellular proliferation including; inhibition of
proliferation in breast cancer (Cassoni et al. 2001) and small cell lung carcinoma cell
lines (Cassoni et al. 2006) and stimulation of proliferation of primary cultured cells
from the foetal spinal cord (Sato et al. 2006). Additionally, des-acyl ghrelin has
similar effects to ghrelin in other cellular functions including: inhibition of apoptosis
in cardiomyocytes and endothelial cells (Baldanzi et al. 2002) and pancreatic β-cells
and human pancreatic islets (Granata et al. 2007), the reduction of tension in cardiac
papillary muscles (Bedendi et al. 2003), the promotion of adipogenesis (Thompson et
al. 2004), the stimulation of human osteoblast growth (Delhanty et al. 2006),
decreasing luteinising hormone secretion (Martini et al. 2006) and the promotion of
differentiation of skeletal muscle cells (Filigheddu et al. 2007). Interestingly, in a
number of these examples ghrelin was shown to have similar GHS-R1a independent
effects to des-acyl ghrelin, suggesting that the potential alternative des-acyl ghrelin
receptor may also be an alternative receptor for ghrelin (Cassoni et al. 2001;
Baldanzi et al. 2002; Bedendi et al. 2003; Cassoni et al. 2004; Cassoni et al. 2006;
Delhanty et al. 2006; Martini et al. 2006; Sato et al. 2006; Filigheddu et al. 2007;
Granata et al. 2007)
1.3.2.6 Obestatin
In 2005, the discovery of obestatin generated great interest in the ghrelin research
field. Obestatin is a 23 amino acid, C-terminally amidated peptide derived from
preproghrelin (Zhang et al. 2005). Significantly, obestatin was originally thought to
oppose ghrelin’s stimulatory effects of appetite and food intake - suppressing food
intake, inhibiting gastric transit and decreasing body weight (Zhang et al. 2005). The
obestatin peptide is encoded entirely within exon 3 of the ghrelin gene (Figure 1.6).
Interestingly, an exon 3-deleted splice variant has been described that is upregulated
in prostate (Yeh et al. 2005) and breast cancers (Jeffery et al. 2005) and this
transcript would not produce obestatin (Figure 1.6).
23
Figure 1.6 Schematic representation of full length preproghrelin and exon 3-
deleted preproghrelin. Full length preproghrelin may produce two peptides, ghrelin
and obestatin. Obestatin is coded by exon 3 of the preproghrelin gene and would not
be produced by exon 3-deleted preproghrelin.
While initially showing promise as a target for the control of appetite, there has been
great controversy regarding the role of obestatin since its initial description. Limited
studies have supported a role of obestatin in decreasing food intake (Zhang et al.
2005; Brescianu et al. 2006; Green et al. 2007; Lagaud et al. 2007), while the
majority of studies have shown that obestatin does not affect food intake (Gourcerol
et al. 2006; Seoane et al. 2006; Sibilia et al. 2006; Nogueiras et al. 2007; Tremblay
et al. 2007; Zizzari et al. 2007; Kobelt et al. 2008; Mondal et al. 2008). Similarly,
while the initial study and one subsequent study suggested that obestatin decreased
gastric motility (Zhang et al. 2005; Ataka et al. 2008), a role for obestatin in gastric
motility has not been observed by other researchers (Bassil et al. 2006; Gourcerol et
al. 2006; De Smet et al. 2007; Chen et al. 2008). Indeed, due to a lack of specific
effects on food intake, it has been suggested that obestatin (from the latin “obedere”
meaning devour and “statin” denoting suppression (Zhang et al. 2005)) be renamed
ghrelin-associated peptide (GAP) (Gourcerol et al. 2007). Furthermore, studies have
24
shown no evidence for a circulating human obestatin peptide (Bang et al. 2006), and
obestatin is rapidly degraded and unable to cross the blood-brain-barrier (Pan et al.
2006). Despite this, locally synthesised obestatin may have autocrine/paracrine
effects and indeed some studies have suggested other functional roles for this
peptide.
Obestatin has been shown to inhibit thirst (Samson et al. 2007) and may play a role
in the physiological regulation of fluid and electrolyte homeostasis (Samson et al.
2008). Additionally, obestatin opposes the role of ghrelin in regulating sleep
(Szentirmai and Krueger 2006), improves memory performance, reduces anxiety
(Carlini et al. 2007) and stimulates the secretion of pancreatic juices via a vagal
pathway (Kapica et al. 2007). In pancreatic β-cells and human pancreatic islets,
obestatin treatment reduces apoptosis, induced by either serum withdrawal or by
cytokines, through the ERK1/2 and AKT signalling (Granata et al. 2008). Obestatin
stimulates proliferation in primary human retinal epithelial cells (Camina et al.
2007a) and a human gastric cancer cell line (KATO-III) (Pazos et al. 2007) and
inhibits the proliferation of a medullary thyroid carcinoma cell line (TT) and a
pancreatic neuroendocrine tumour cell line (BON-1) (Volante et al. 2009).
The initial description of obestatin as a peptide with opposing effects to ghrelin,
stated that obestatin was the ligand for the orphan GPCR, GPR39, a member of the
ghrelin receptor family (Zhang et al. 2005).
1.3.3 GPR39
GPR39 was originally described as an orphan member of the ghrelin receptor family
(McKee et al. 1997a). The GPR39 gene is located on chromosome 2q21-22 and
encodes a 453 amino acid GPCR (McKee et al. 1997a). GPR39 contains an overall
amino acid identity of 27% and similarity of 52% to GHS-R1a (McKee et al. 1997a).
It contains a signature aromatic triplet sequence adjacent to TM-3 and two potential
palmitoylation sites that are not observed in GHS-R1a (McKee et al. 1997a). Like
GHS-R, GPR39 is encoded by two exons and recently, it has been shown that in
addition to the full length seven transmembrane GPR39, an alternative transcript that
retains intronic sequence and would result in the translation of a five transmembrane
C-terminally truncated isoform (GPR39-1b) is also produced (Egerod et al. 2007).
25
The full length receptor is now termed GPR39-1a, however, for the purposes of this
manuscript we will refer to it as GPR39. Interestingly, GPR39 was originally
described as being widely expressed (McKee et al. 1997a). Recent evidence,
however, has shown that an antisense gene, LYPD1, overlaps the GPR39 gene and
that the original description of GPR39 expression as determined by Northern blot
could have been complicated by the presence of this gene (Egerod et al. 2007).
Current evidence suggests that GPR39 is not expressed to a significant degree in the
central nervous system, (where LYPD1 is highly expressed) and is expressed mainly
in peripheral tissues, most highly in the liver and the gastrointestinal tract (Egerod et
al. 2007). The truncated isoform, GPR39-1b, is more widely expressed with higher
levels observed in the stomach and small intestine (Egerod et al. 2007). Preliminary
studies in our research group have demonstrated GPR39 expression in prostate
cancer cell lines (Chapter 3.3.1) and prostate cancer tissue samples (Figure 1.7).
Figure 1.7 GPR39 expression in prostate cancer. Representative prostate
histopathological specimen showing granular, GPR39-specific immunoreactivity
(arrows; brown staining) in the cytoplasm of prostate cancer cells. Non staining
nuclei are counterstained with haematoxylin. (Performed by Ms Rachael Murray,
Ghrelin Research Group, Queensland University of Technology).
Like GHS-R1a, GPR39 has a high degree of constitutive activity. GPR39 displays
constitutive inositol phosphate turnover (Gαq signalling through the phospholipase C
pathway) and activation of cAMP-responsive element (CRE) gene transcription,
however, the degree of constitutive signalling is lower than that for GHS-R1a (Holst
et al. 2004). GPR39 has a higher level of constitutive signalling through the serum
26
response element (SRE) pathway compared with GHS-R1a (Holst et al. 2004). Like
GHS-R1a, constitutive phosphorylation of ERK1/2 was not observed in COS-7 cells
transiently transfected with GPR39 (Holst et al. 2004). Interestingly, in contrast to
GHS-R1a, GPR39 is not constitutively internalised and in the absence of agonist it
remains at the cell surface (Holst et al. 2004). This difference in constitutive
internalisation between GHS-R1a and GPR39 was determined to be due to
differences in the structure of their C-terminal tails (Holliday et al. 2007). GPR39
has been reported to have a role in the regulation of apoptosis resulting from its
constitutive activity (Dittmer et al. 2008). Overexpression of GPR39 in the mouse
hippocampal HT22 cell line protected against apoptosis induced by a number of
stimuli, including glutamate toxicity, hydrogen peroxide-induced oxidative stress,
tunicamycin treatment and the direct activation of the caspase cascade by the
overexpression of Bax (Dittmer et al. 2008). siRNA GPR39 knockdown had the
opposite effect (Dittmer et al. 2008). It was also determined that the protective effect
of GPR39 was due to constitutive signalling through the Gα13/RhoA/SRE pathway
leading to an increased secretion of pigment epithelium-derived growth factor
(PEDF) (Dittmer et al. 2008).
As previously mentioned, GPR39 was thought to be the endogenous receptor for
obestatin (Zhang et al. 2005), but this is also controversial. Subsequent studies were
unable to replicate obestatin binding to GPR39 (Lauwers et al. 2006; Chartrel et al.
2007; Holst et al. 2007). Indeed, the original authors later reported that the initial
batch of obestatin contained impurities and that a new, iodinated obestatin
preparation was unable to bind GPR39 (Zhang et al. 2007a). More recently,
however, they have suggested that specifically purified, monoiodo-obestatin can bind
GPR39 and that previously described inconsistent binding of iodinated obestatin to
GPR39 was due to variable loss of obestatin bioactivity after iodination (Zhang et al.
2008a). Further investigations by independent sources are required to clarify the
binding of obestatin to GPR39.
Despite this controversy, interest in GPR39 has increased in recent years. A number
of groups have created GPR39 knockout mice to try to determine its physiological
role. Initial reports suggested that GPR39-/- mice had accelerated gastric emptying,
partially confirming a role for obestatin, however, no change in food intake was
27
observed (Moechars et al. 2006). Studies by another group showed no difference in
body weight, adiposity and food intake between GPR39+/+ and GPR39-/- mice
(Tremblay et al. 2007). More recent studies have focused on a potential role of
GPR39 in insulin secretion. GPR39-/- mice had a decreased plasma insulin response
to oral glucose (Holst et al. 2009), and GPR39 is required for increased insulin
secretion in vivo under conditions of increased demand (Tremblay et al. 2009). This
suggests a potential role for GPR39 in pancreatic islet function and this might
provide a novel target for treatment of type 2 diabetes (Holst et al. 2009; Tremblay et
al. 2009).
While the identification of an endogenous peptide ligand for GPR39 remains to be
determined, zinc is a ligand of GPR39 (Holst et al. 2004; Lauwers et al. 2006; Holst
et al. 2007; Yasuda et al. 2007; Storjohann et al. 2008b; Storjohann et al. 2008a).
Zinc was first shown to activate GPR39 in 2004, stimulating inositol phosphate
turnover, CRE and SRE gene transcription above the basal constitutive levels and
stimulating ERK1/2 phosphorylation in cells overexpressing GPR39 (Holst et al.
2004). Subsequent studies have confirmed that GPR39 is functionally responsive to
zinc, suggesting that it is a physiological agonist (Lauwers et al. 2006; Holst et al.
2007; Yasuda et al. 2007; Storjohann et al. 2008b; Storjohann et al. 2008a).
Recently, the proposed molecular mechanism of Zn2+ agonism has been described.
Instead of acting as a direct agonist of GPR39, by stabilising an active combination,
Zn2+ binds His17 and His19 in the N-terminal domain and potentially diverts Asp313
from functioning as a tethered inverse agonist (Storjohann et al. 2008a). While the
exact physiological role of zinc-induced GPR39 stimulation is currently unclear, in
the context of prostate function, the potential role of GPR39 as a zinc sensing
receptor is particularly interesting, as zinc plays a central role in prostate metabolism.
1.4 ZINC IN THE PROSTATE
Zinc has a unique role in the biology of the prostate where it is normally accumulated
at high levels, however, the level of zinc accumulation is significantly altered in the
development of prostate malignancy. It was first noted that prostate tissue
accumulates high concentrations of zinc as early as the 1920s (Bertrand and
Vladesco 1921). Later studies of zinc levels in the prostate found that while levels
were high in the normal prostate compared to other soft tissues, levels of zinc were
28
much lower in malignant tissue (Mawson and Fischer 1952). A recent compilation of
17 published reports on zinc levels in the prostate showed an average decrease in
zinc levels of approximately 68% in prostate cancer samples compared to normal
prostate tissue, despite the fact that this data was sourced using a large diversity of
analytical methods (Costello and Franklin 2006). The level of zinc in the normal
peripheral zone of the prostate is ~3000 nmol/g, compared with ~500 nmol/g in the
malignant peripheral zone (Costello and Franklin 2009). Interestingly, the relative
changes in zinc levels also correspond with levels in the prostatic fluid. Normal
prostatic fluid contains ~9000 nmol/g, compared with prostate cancer prostatic fluid
which contains ~1000 nmol/g (Costello and Franklin 2009). The average level of
zinc in other soft tissues (~200 nmol/g) and in plasma (~15nmol/g) is much lower
than that observed in normal prostate tissue and prostatic fluid (Costello and Franklin
2009). It appears that the reduction of zinc concentration is an early event in the
development of prostate cancer (Habib et al. 1979) and does not occur in benign
prostatic hyperplasia (BPH) (Zaichick et al. 1997) (Figure 1.8). Importantly, in the
study by Zaichick et al. (1997) no prostate cancer samples retained high levels of
zinc compared to the normal prostate and BPH samples (Figure1.8), suggesting that
zinc levels may provide a novel biomarker, that unlike the prostate specific antigen
(PSA) test, would not be complicated by erroneous results which are often observed
in patients with BPH (Costello and Franklin 2009).
Figure 1.8 Zinc concentration in normal prostate, benign prostatic hyperplasia
(BPH) and prostate cancer tissue. The high zinc concentrations observed in normal
prostate and BPH tissue samples are not observed in prostate cancer tissues. Adapted
from Zaichick et al. (1997).
29
The ZIP family of zinc transporters play a role in accumulating zinc in the prostate.
ZIP1 gene and protein levels are down-regulated in cancerous cells, reflecting the
altered accumulation of zinc in prostate cancer (Franklin et al. 2005). Furthermore,
overexpression of ZIP1 induces regression of prostate tumour growth (Golovine et
al. 2008). The ZIP2 and ZIP3 zinc transporters are also down-regulated in prostate
cancer compared to normal prostate and BPH samples (Desouki et al. 2007). The
ZIP1, ZIP2 and ZIP3 genes, therefore, are involved in the accumulation of zinc
observed in the normal prostate and their down-regulation in prostate cancer results
in reduced zinc levels.
The high levels of zinc in the prostate play a critical role in the accumulation of high
levels of citrate for luminal secretion to the prostatic fluid. The ability to accumulate
citrate is unique to the prostate glandular epithelium (Costello and Franklin 2009).
The high levels of zinc observed in the prostate inhibit mitochondrial (m)-aconitase
and this truncates the Krebs cycle, minimising the oxidation of citrate, leading to the
accumulation of citrate (Costello et al. 1997) (Figure 1.9). Importantly, as a
consequence of this citrate accumulation, normal prostate cells sacrifice
approximately 60% of the potential energy derived from normal glucose oxidation
(Costello and Franklin 2006). In prostate cancer, where zinc is no longer
accumulated at high levels, normal glucose utilisation through the Krebs cycle is
recovered, meaning that these cells gain a metabolic advantage compared with
normal prostate cells (Costello and Franklin 2006).
30
Figure 1.9 Metabolic pathways and bioenergetics in the prostate. Accumulation
of high levels of zinc in the normal prostate (green) inhibits m-aconitase (ACON),
truncating the Krebs cycle, and this leads to net citrate production. Citrate is
concentrated in the prostatic fluid. The reduced zinc levels observed in prostate
cancer lifts the inhibition of m-aconitase and results in normal glucose oxidisation,
increasing the potential energy generated. Adapted from Costello and Franklin
(2006).
Altered zinc levels in prostate cancer also have proliferative, apoptotic and invasive
effects. In the prostate, zinc inhibits proliferation and induces apoptosis by inducing
mitochondrial apoptogenesis (Liang et al. 1999; Feng et al. 2000). Zinc also
inhibited the ability the of LNCaP prostate cancer cell line to invade through
Matrigel (Ishii et al. 2004). In the prostate, therefore, zinc has tumour suppressor
effects on prostate metabolism, proliferation and invasion and the reduction of zinc
observed in malignant cells would eliminate these anti-tumour effects (Costello and
Franklin 2006). Altered zinc levels, therefore, have a clear role in the development of
prostate cancer (Figure 1.10).
31
Figure 1.10 Zinc in the progression of prostate cancer. In normal prostate tissue,
zinc is accumulated at high levels via the ZIP family of zinc transporters. The high
levels of zinc inhibit m-aconitase, truncating the Krebs cycle and leading to net
citrate production. The down regulation of the ZIP family of zinc transporters in
prostate cancer development leads to reduced prostatic zinc and citrate levels. In
prostate cancer, the Krebs cycle is no longer inhibited, and this gives rise to a
metabolic advantage in malignant prostate cells. Adapted from Costello and Franklin
(2006).
1.5 GPCR DIMERISATION
The past decade has seen a dramatic change in our understanding of how GPCRs
function and there has been significant research focus into the emerging concept of
GPCR dimerisation. GPCRs were classically thought to function as monomeric units,
although cell surface receptor dimerisation was considered to be an integral part of
receptor function for other receptor families (Salahpour et al. 2000). The original
GPCR model proposed a 1:1:1 stoichiometery, with a ligand interacting with a
monomeric GPCR, and activating a single G protein to stimulate downstream
cascades (Dalrymple et al. 2008). It was noted, however, that this model could not
explain the observed complexity of receptor signalling (Dalrymple et al. 2008). It has
been suggested recently that most, if not all GPCRs exist as dimeric complexes
(Dalrymple et al. 2008). It should be noted that many of the current methodologies
used to investigate GPCR interactions are unable to differentiate between simple
dimers and higher order oligomers and consequently the term dimer and oligomer are
often used interchangeably. For the purposes of this review and thesis, we will use
the term dimer to describe any GPCR interactions, unless oligomerisation has been
directly demonstrated. GPCR dimers may be homodimeric, occurring between two
GPCR which are the same, or heterodimeric, occurring between two different
32
GPCRs. More closely related GPCRs are more likely to form functional
heterodimers than less closely related receptors (Ramsay et al. 2002). Importantly,
dimerisation between GPCRs may create novel pharmacological receptors and
diversify the function of these receptors (Park and Palczewski 2005). Newly
described GPCR complexes may represent novel drug candidates and exciting new
avenues for the development of specific therapeutic targets (George et al. 2002;
Milligan 2006; Dalrymple et al. 2008; Panetta and Greenwood 2008).
Early evidence for GPCR dimerisation was provided as early as the mid 1970s, when
complex receptor binding studies showed evidence of negative cooperativity that
could be explained by site-site interactions within GPCR multimeric complexes
(Limbird et al. 1975; Limbird and Lefkowitz 1976; Salahpour et al. 2000). Up until
the mid-1990s, additional findings from crosslinking experiments, radiation
inactivation and photo-affinity labelling studies also supported the concept that
GPCRs may form dimers (Salahpour et al. 2000; Bouvier 2001). The dimeric GPCR
model never gained general acceptance, however, and GPCRs were still largely
considered to function as monomeric units (Salahpour et al. 2000; Bouvier 2001).
Further compelling evidence for GPCR dimerisation was provided by the studies of
Maggio et al. (1993) using non-functional chimeric α2-adrenergic/M3 muscarinic
receptors (containing TM 1-5 of one receptor and TM 6-7 of the other). When
expressed alone, these receptors did not bind ligand and no signalling activity was
observed, however, when co-expressed, individual receptor function was restored
(Maggio et al. 1993). This suggested that interactions were occurring between the
two chimeric receptors (Maggio et al. 1993). The potential for GPCRs to form
dimers gained wider acceptance with the demonstration of the obligate GPCR
heterodimer, the γ-aminobutyric acid (GABA) receptor B, GABABR. The GABAB
receptor was shown to be a heterodimer between two GPCRs, GABABR1 and
GABABR2 (Jones et al. 1998; Kaupmann et al. 1998; White et al. 1998). GABABR1
binds ligand, but when expressed alone does not efficiently traffic to the cell surface
(Couve et al. 1998). GABABR2, does not bind ligand, but is capable of surface
expression. When co-expressed a functional receptor is formed which traffics to the
cell surface and binds ligand and this demonstrated that in the case of the GABABR,
heterodimerisation of two GPCRs is required for function (Figure 1.11) (Jones et al.
1998; Kaupmann et al. 1998; White et al. 1998). GABABR1 surface expression is
33
prevented by an endoplasmic reticulum (ER) retention motif in the C-terminal that,
when masked by a coiled-coil interaction with the C-terminal of GABABR2, allows
membrane expression of the heterodimeric complex (Margeta-Mitrovic et al. 2000).
Figure 1.11 Heterodimerisation of GABAB receptor. An obligate heterodimer, the
GABAB receptor requires an interaction between two GPCRs for function. When
expressed alone, GABABR1 fails to traffic to the cell surface and GABABR2 does
not bind ligand. When co-expressed in the same cell, the two receptors interact
through coiled-coil domains in their C-tails leading to the expression of active
receptor on the cell surface. This binds the ligand GABA and activates G proteins.
Adapted from Pierce et al. (2002).
Further evidence for the concept of GPCR dimerisation was provided with the first
direct visual evidence of GPCR dimerisation in 2003 (Fotiadis et al. 2003; Liang et
al. 2003). Using atomic force microscopy to analyse native retinal disc membranes,
the rhodopsin receptor was shown to exist in neat rows of receptor dimers in their
natural state (Fotiadis et al. 2003; Liang et al. 2003). The number of GPCRs that
have now been shown to dimerise is extensive and the concept of GPCR dimerisation
has been extensively reviewed (Overton and Blumer 2000; Salahpour et al. 2000;
Bouvier 2001; Devi 2001; Angers et al. 2002; George et al. 2002; Milligan et al.
2003; Hansen and Sheikh 2004; Kroeger et al. 2004; Milligan 2004; Paul et al. 2004;
Prinster et al. 2005; Milligan 2006; Kent et al. 2007; Dalrymple et al. 2008;
Gurevich and Gurevich 2008b; Milligan 2008; Panetta and Greenwood 2008; Satake
and Sakai 2008; Szidonya et al. 2008).
34
Many basic questions regarding the mechanics of GPCR dimerisation have been
raised and they are largely not fully resolved. It is critical that the mechanism of
these interactions are determined and the receptor-receptor interfaces defined with a
view to disrupting these interactions (Kroeger et al. 2004). GPCRs could potentially
interact within the extracellular, transmembrane or C-terminal regions and
interactions could be covalent or non-covalent (Devi 2001). Interestingly, all of these
mechanisms have been demonstrated for different GPCRs, including interactions
involving every individual transmembrane domain (Hansen and Sheikh 2004).
Growing evidence favours direct contact between residues within the transmembrane
domains and particularly, transmembrane domains 4 and 5 (Milligan 2008). The
wide diversity of results, however, may reflect that different interfaces are likely to
be involved in different receptor-receptor interactions and it will be difficult to
predict a general model for GPCR dimerisation (Milligan 2008). While some
examples have been described, the lack of identification of the key interfaces for
GPCR dimerisation has restricted studies investigating the effects of disrupting
GPCR dimerisation (Milligan 2008).
It is also unclear in which cellular compartment GPCR dimerisation occurs. Models
have been proposed predicting that dimerisation could occur early in the endoplasmic
reticulum and that GPCRs are transported to the cell surface as a dimeric unit (Devi
2001). Alternatively, GPCRs could traffic to the cell surface as monomers and
assemble as a dimer in response to agonist (Devi 2001). While evidence has been
provided for both models, for a number of different GPCRs, the clear demonstration
of ligand-induced dimer formation is limited by the current experimental methods
that are available. It currently remains unclear whether or not ligand binding alters
the dimerisation state of GPCRs (Milligan 2008). Growing evidence suggests that the
life cycle of a GPCR, from synthesis to destruction, occurs as a dimeric complex
(Milligan 2004; Milligan 2008).
Recently, the in vivo relevance of GPCR dimerisation was demonstrated using a
heterodimer-selective agonist and this was a significant development in the field of
GPCR dimerisation research. 6’-guanidinonaltrindole (6’GNTI) is an opioid agonist
that selectively activates heterodimers between the κ and μ opioid receptors and not
homodimers (Waldhoer et al. 2005). Significantly, 6’GNTI was shown to induce
35
analgesia only in the spinal cord and not in the brain, suggesting that GPCR
dimerisation may be tissue-specific (Waldhoer et al. 2005). This represents proof of
concept for targeting GPCR heterodimers that are unique to specific tissues
(Waldhoer et al. 2005).
1.5.1 Functional outcomes of GPCR dimerisation
There are a number of examples where GPCR heterodimerisation can result in
distinct functional outcomes that are different from those of their corresponding
GPCR monomers or homodimers. GPCR heterodimerisation has been shown to alter
signal transduction. Heterodimerisation enhances the signalling of two different
vasoactive hormone receptors, the type 1 angiotensin II receptors (AT1) and the
bradykinin (B2) receptor that form stable heterodimers, resulting in increased AT1-
receptor signalling in smooth muscle cells (AbdAlla et al. 2000). Dimerisation can
also result in novel signalling that is not activated by either receptor alone. This is the
case for the dopamine D1 and D2 receptors, where co-treatment was shown to
stimulate novel phospholipase C-mediated calcium signalling that was not observed
when either receptor was activated alone (Lee et al. 2004). Antagonists have also
been shown to function through GPCR heterodimers, and this is the case for the
orexin-1 and cannabinoid (CB1) receptor heterodimer, where treatment with a
specific receptor antagonist was shown to cross antagonise the agonist-induced
ERK1/2 phosphorylation of the other receptor (Ellis et al. 2006). An example of
altered signalling resulting from GPCR dimerisation has also been demonstrated in
the prostate, where proliferation of the PC-3 prostate cancer cell line was shown to
require cross-talk between two subtypes of the bradykinin receptors, B1R and B2R
(Barki-Harrington et al. 2003). Additionally, it was shown that specific antagonism
of each receptor was sufficient to block ERK1/2 activation and the cell growth
response which was mediated by the other receptor (Barki-Harrington et al. 2003).
GPCR dimerisation can also alter receptor ligand binding. The κ and δ opioid
receptors form a heterodimer that shows no significant affinity for either κ- or δ-
selective agonists or antagonist, however, they do have a strong affinity for partially
selective ligands (Jordan and Devi 1999). This suggests that this dimer may provide
a novel binding site for selected ligands (Jordan and Devi 1999). Heterodimerisation
was shown to alter ligand binding of the µ and δ opioid receptors, where treatment
36
with extremely low doses of µ- or δ- selective ligands leads to a significant increase
in the binding of the other receptor agonist (Gomes et al. 2000). Ligand binding can
also be altered by heterodimerisation with orphan GPCRs. For example, interaction
of the MT1 melatonin receptor with the orphan GPCR, GPR50, was shown to abolish
high-affinity melatonin binding (Levoye et al. 2006). Interestingly, it was suggested
that the alteration of the function of GPCRs by heterodimerisation with orphan
GPCRs may represent a potentially ligand-independent function of orphan GPCRs
(Levoye et al. 2006).
Heterodimerisation between GPCRs can alter receptor trafficking. A number of
studies have shown that heterodimerisation between GPCRs can result in efficient
cell surface expression of GPCRs, including the GABABR1 when interacting with
the GABABR2 (White et al. 1998) and the α1D-adrenergic receptor when interacting
with the α1B-adrenergic receptor (Uberti et al. 2003; Hague et al. 2004) or the β2-
adrenergic receptor (Uberti et al. 2005). Heterodimerisation between GPCRs can
also alter receptor endocytosis and desensitisation. This occurs with the somatostatin
receptor subtypes, sst2A and sst3 for example, where heterodimerisation results in the
formation of a new receptor with greater resistance to agonist-induced desensitisation
(Pfeiffer et al. 2001).
Altered G protein coupling is another potential outcome of GPCR dimerisation.
Homodimers of the µ or δ opioid receptors were shown to stimulate Gαi3 activation,
however, for µ-δ opioid receptor heterodimers, G protein activation was shown to be
mediated by Gαz (Fan et al. 2005). In addition to shifting the G protein specificity,
heterodimerisation can modulate receptor activation by steric interactions, altering G
protein coupling. This occurs with the β2-adrenergic receptor, where Gαs coupling is
altered by heterodimerisation with the prostaglandin-EP1 receptor in airway smooth
muscle cells (McGraw et al. 2006).
Additional functional outcomes of GPCR heterodimersation have also been
described. The T1R taste receptors function as obligate heterodimers, where T1R2
and T1R3 combine and function as a sweet receptor (Nelson et al. 2001) and T1R1
and T1R3 combine to function as a umami receptor (Nelson et al. 2002). Finally, in
addition to full length GPCR dimers, numerous studies have shown that some splice
37
variants or C-terminally truncated mutant receptors can act as dominant-negative
regulators of their corresponding full length, wild-type receptors (Dalrymple et al.
2008).
1.5.2 GPCR dimers in pathophysiological conditions
Limited studies have now described a role for GPCR dimerisation in the
pathogenesis of human disease, supporting the hypothesis that dimers are
physiologically significant. Heterodimerisation between the type I angiotensin-II
receptor (AT1R) and bradykinin-2 receptor (B2R) may have a role in pre-eclampsia
(AbdAlla et al. 2001). In pre-eclamptic, hypertensive women an increase in receptor
dimerisation is observed that correlates with a 4-5 fold increase in B2-receptor
protein levels (AbdAlla et al. 2001). This increased heterodimerisation correlates
with the increase in responsiveness to angiotensin II that is observed in pre-
eclampsia (AbdAlla et al. 2001). AT1R heterodimerisation with B2R has also been
shown to contribute to angiotensin II hyper-responsiveness in mesangial cells in
experimental hypertension (AbdAlla et al. 2005).
Heterodimerisation between serotonin and glutamate receptors has been implicated
in psychosis. The serotonin 5-HT2A receptor and the metabotropic glutamate receptor
(mGluR) can interact and demonstrate unique responses to hallucinogenic drugs
(González-Maeso et al. 2008). Interestingly, in brain from untreated schizophrenic
patients, the serotonin 5-HT2A receptor is upregulated and mGluR is downregulated
compared to control patients (González-Maeso et al. 2008). This altered pattern of
expression of these GPCRs that heterodimerise may predispose patients to psychosis
(González-Maeso et al. 2008).
Heterodimerisation of mutant GPCRs may also have a role in the development of
disease. The CXCR4 chemokine receptor can heterodimerise with a CCR2
chemokine receptor mutant, CCR2V64I, but not with the wild type CCR2 receptor
(Mellado et al. 1999). This interaction may reduce the amount of CXCR4 in
peripheral blood mononuclear cells (Mellado et al. 1999). The CXCR4 receptor is
used by the human immunodeficiency virus (HIV) to gain entry into cells and,
therefore, dimerisation with the CCR2 mutant may explain the delay in the
development of acquired immune deficiency syndrome (AIDS) in infected
38
individuals carrying the CCR2V4I mutation (Mellado et al. 1999).
1.5.3 Experimental methods to demonstrate GPCR dimerisation
A number of different experimental techniques have been used to provide direct
evidence of GPCR dimerisation. Classical co-immunoprecipitation of differentially
tagged receptors is an extensively used technique (Devi 2001). GPCRs are tagged
with different epitopes and are co-expressed in the cells of interest (Devi 2001).
Protein complexes are immuno-isolated using an antibody to one epitope and
receptor dimerisation is indicated when the alternatively tagged receptor is visualised
from immune-isolated samples (Devi 2001). (Forster 1948)
Dimeric GPCR complexes can be visualised in living cells using the resonance
energy transfer (RET) techniques, fluorescence resonance energy transfer (FRET)
and bioluminescence resonance energy transfer (BRET). Resonance energy transfer
methods provide information about distances ranging from 10 to 100 Å between
molecules (Wu and Brand 1994) and they are, therefore, applicable to the
observation of protein-protein interactions. RET results from the transfer of energy
from a donor fluorophore to an acceptor fluorophore when they are in close
proximity, and this was first described by Förster (1948). Significantly, however,
while the RET signal is influenced by the distance between the donor and acceptor,
due to the dipole-dipole nature of RET, the relative orientation of the donor and
acceptor molecules is another important factor influencing energy transfer (Clegg et
al. 1993; Bacart et al. 2008). Therefore, as there is a requirement for the correct
orientation of donor and acceptor molecules, the absence of a RET signal does not
necessarily indicate that the tagged proteins of interest do not interact (Bacart et al.
2008). For FRET, both the donor and acceptor fluorophores are fluorescent
molecules, whereas in BRET the energy transfer is from a bioluminescent donor
molecule to a fluorescent acceptor molecule. The method of excitation of the donor
molecule is different between FRET and BRET. For FRET, donor excitation is
performed by exposure to light of a characteristic wavelength, and for BRET the
energy is released by the oxidation of a coelenterazine substrate (Szidonya et al.
2008). Following excitation of the donor molecule, if emission from the acceptor
molecule is also observed the donor and acceptor and, therefore, the tagged receptor,
are in close proximity (Figure 1.12).
39
Figure 1.12 Basic model describing the use of RET methods to measure GPCR
dimerisation. Resonance energy transfer (RET) is the transfer of energy from a
donor molecule to an acceptor molecule when they are in close proximity (10 to 100
Å). Donor and acceptor tagged GPCRs can be used to determine if the receptors
interact through dimerisation. For FRET, both the donor and acceptor molecules are
fluorescent proteins and the donor is excited by exposure to light of a characteristic
wavelength. For BRET, the donor molecule is a bioluminescent protein and the
energy is released by the oxidation of a coelenterazine substrate. The identification of
light at the characteristic wavelength for emission from the acceptor molecule is
indicative of receptor dimerisation.
The requirement for the close proximity of the donor and acceptor molecule (~10 Å)
means that FRET can be used as a ‘spectroscopic ruler’ (Stryer and Haugland 1967;
Stryer 1978) and it provides a valuable tool to monitor GPCR dimerisation (Pfleger
and Eidne 2005; Harrison and Van der Graaf 2006; Gandiá et al. 2008). The use of
FRET to analyse protein-protein interactions has become increasingly popular in
recent years due to the development of spectral variants of the green fluorescent
protein (GFP) for protein tagging (Vogel et al. 2006; Piston and Kremers 2007). The
most widely used donor and acceptor pair used for FRET is the cyan fluorescent
protein (CFP)/yellow fluorescent protein (YFP) FRET pair and it is considered to be
40
the most effective fluorophore combination for general applications (Piston and
Kremers 2007). However, many different fluorescent proteins are now available that
span the visible spectrum, from deep blue to deep red (Day and Schaufele 2008), and
a number of different donor-acceptor pairs have been used to observe GPCR
dimerisation (Pfleger and Eidne 2005). Indeed, the variety of available fluorescent
proteins has allowed multiplexed FRET for the simultaneous monitoring of multiple
cellular events (Grant et al. 2008; Piljic and Schultz 2008).
There are a number of methods available for visualising and analysing FRET,
including acceptor photobleaching (ab), sensitised emission, fluorescence lifetime
imaging microscopy (FILM), spectral imaging, and polarization anisotropy imaging,
and each of these methods has advantages and disadvantages (Piston and Kremers
2007). A commonly used method to measure FRET is acceptor photobleaching.
Acceptor photobleaching FRET (abFRET; also referred to as donor fluorescence
recovery after acceptor photobleaching, DFRAP, or donor dequenching), indirectly
measures specific FRET by observing the dequenching of the energy donor after
specific photobleaching of the acceptor, so that it is no longer available to receive
FRET (Figure 1.13) (Bastiaens et al. 1996). abFRET has the advantage of being
quantitative and relatively simple to perform (Piston and Kremers 2007) and can be
used to analyse FRET in specific sub-cellular locations (Herrick-Davis et al. 2006).
abFRET methodology has the disadvantage of being relatively time consuming and,
as each measurement requires the destructive photobleaching of the acceptor, each
cell can be measured only once (Piston and Kremers 2007).
41
Figure 1.13 Acceptor photobleaching (ab) FRET. Measurements of donor (cyan)
and acceptor (yellow) emission are measured simultaneously prior to acceptor
photobleaching. Acceptor photobleaching is performed by exciting the acceptor at its
characteristic excitation wavelength at a high intensity. Following photobleaching,
measurements of donor and acceptor emission are obtained. An increase in donor
emission after acceptor photobleaching compared to before photobleaching (donor
dequenching) is indicative of FRET from the donor to the acceptor. The donor and
acceptor fluorophores can be tagged to GPCRs of interest to examine receptor
dimerisation.
Sensitised emission is the direct measurement of acceptor fluorescence after specific
excitation of the donor and can be measured from a pool of cells in a fluorometer or
from a number of individual cells using flow cytometry. The analysis of sensitised
emission by flow cytometry (fcFRET) has the significant advantage of allowing the
analysis of FRET in a large number of cells on a cell-by-cell basis and the
measurement of cells expressing a range of donor and acceptor levels (Chan et al.
2001). However, the non-specific excitation of the acceptor following donor
excitation, and the potential emission at the acceptor wavelength from the donor
fluorophore due to spectral overlap must be considered when measuring sensitised
42
emission (Szidonya et al. 2008). Measurements of cells expression donor or acceptor
alone are required to correct for these factors.
BRET is a variant of FRET, where the fluorescent donor protein has been replaced
with a bioluminescent protein. BRET methodology has been applied to the study of
interactions between GPCRs and other proteins, in real time, in living cells (Pfleger
and Eidne 2003; Pfleger and Eidne 2005; Harrison and Van der Graaf 2006; Gandiá
et al. 2008). The original BRET technology, (which is known as BRET1), took
advantage of the transfer of energy from the sea pansy Renilla reniformis luciferase
(Rluc) to the red shifted mutant of Aequorea victoria green fluorescent protein
(EYFP) following the addition of a coelenterazine substrate (Xu et al. 1999). BRET2
is a newer form of BRET commonly used to investigate GPCR interactions. BRET2
technology utilises Rluc as the donor protein and a modified GFP (GFP2) as the
acceptor protein (Bertrand et al. 2002). In addition to the modified GFP, this system
also utilises a modified, cell permeable substrate, coelenterazine 400a (also known as
DeepBlueC). The addition of this substrate stimulates the emission of blue light at
395nm from Rluc, which can be absorbed by GFP2 if it is in close proximity, leading
to an emission of light at 510nm (Bertrand et al. 2002). The main advantage of this
BRET2 system is the increased separation of the donor and acceptor emission spectra
(395nm/510nm) compared to the emission spectra of BRET1 (475nm/515nm). This
results in significantly improved signal to background ratio, increasing the sensitivity
of the assay (Ramsay et al. 2002). Recent studies comparing FRET, BRET1 and
BRET2 found that BRET2 is 50 times more sensitive that FRET (Dacres et al. 2009)
and 2.9 times more sensitive than BRET1 (Dacres et al. 2008) for detecting donor
and acceptor interactions. The BRET2 methodology, however, has the disadvantage
of low quantum yield and a short half life of the BRET2 Rluc substrate,
coelenterazine 400a (Hamdan et al. 2005). The low quantum yield and rapid signal
decay, therefore, necessitates the use of highly sensitive instrumentation and has
significant disadvantages for high throughput screening (Hamdan et al. 2005).
More recently, other BRET technologies have been developed including; extended
BRET (eBRET) which uses a protected form of coelenterazine for the measurement
of BRET over many hours (Pfleger et al. 2006a) and the BRET3 platform which
combines a mutant red fluorescent protein (mOrange) and a mutant Renilla
43
reniformis luciferase (RLuc8) for improved light intensity (De et al. 2009). It has
also been suggested that the use of novel forms of luciferase, Rluc2 and Rluc8, may
improve BRET1 and BRET2 sensitivity (Kocan et al. 2008).
Co-immunoprecipitation and RET experiments have been the most widely used
methods to demonstrate GPCR dimerisation, however, a number of other methods
have been used, including bimolecular fluorescence complementation (BiFC), atomic
force microscopy, covalent cross-linking, gel filtration, neutron scattering
experiments and functional complementation (Bouvier et al. 2007; Szidonya et al.
2008).
1.5.4 Important considerations regarding techniques used to identify GPCR
dimerisation and the requirement for control experiments
While the demonstration of GPCR dimerisation has generated a great deal of interest,
a number of questions have been raised regarding the reliability of the methods
which have been used to demonstrate this phenomenon and the physiological
significance of these findings. Classical co-immunoprecipitation is often used to
show GPCR dimerisation. Significantly, however, due to the highly hydrophobic
nature of GPCRs, there is the potential for the formation of non-specific aggregates
when they are removed from the lipid environment of the plasma membrane during
cell lysis and protein solubilisation (Devi 2001; Kroeger et al. 2004; Kent et al.
2007; Szidonya et al. 2008). The appearance of high molecular weight bands due to
non-specific protein aggregation could be mistaken for dimerisation (Bouvier 2001).
Indeed, it has been suggested that if GPCR expression levels are high enough, and
the sample solubilisation is inadequate, almost any combination of GPCR can be co-
immunoprecipitated (Hansen and Sheikh 2004). Potentially, co-immunoprecipitation
studies have the advantage of being able to demonstrate GPCR dimerisation in native
cells using antibodies specific to the receptors investigated. Increasingly, however,
questions are also being raised over the selectivity and reliability of antibodies raised
against GPCRs (Michel et al. 2009). Potentially, a number of findings that have
previously described GPCR dimerisation may in fact be artefactual, due to the use of
non-specific antibodies (Szidonya et al. 2008). While co-immunoprecipitation
provides a good starting point to investigate GPCR interactions, it has been
suggested that due to the potential methodological limitations, additional
44
experimental techniques should also be used to verify any proposed receptor-receptor
interactions (Szidonya et al. 2008).
Resonance energy transfer enables the analysis of GPCR dimerisation in real time, in
living cells, however, there are significant methodological limitations to consider
when analysing RET. In particular, it is important to consider the potential for the
occurrence of ‘bystander RET’, which is non-specific RET which occurs when non-
interacting proteins are over-expressed and are forced into close proximity, due to
increased protein concentrations (Marullo and Bouvier 2007). This is a significant
consideration, as RET experiments are often performed in cells artificially expressing
high levels of donor and acceptor tagged GPCRs. Indeed it has been suggested that
for both BRET and FRET, a certain degree of RET can be observed as a result of
random interactions when any combination of tagged GPCRs are overexpressed
(Babcock et al. 2003; Vogel et al. 2006). This has led to the recent recognition that
when measuring sensitised emission RET, extensive experimental controls, including
saturation, competitive inhibition and surface density experiments are required
(Figure 1.14) (James et al. 2006; Marullo and Bouvier 2007). Saturation control
experiments rely on the principle that if the donor concentration is maintained at a
constant level and the concentration of acceptor is increased, the RET ratio will
increase with increasing acceptor/donor ratio up to a point where all of the donor
molecules will be involved in dimerisation and the RET value will then remain
constant (Marullo and Bouvier 2007). Where non-specific interactions are occurring,
changes in the acceptor/donor ratio would result in a linear increase in the RET
value, however, this too may reach a plateau at sufficiently high values (Marullo and
Bouvier 2007). In competitive inhibition experiments, where a specific interaction is
occurring between donor and acceptor tagged GPCRs, an increase in non-tagged
native receptor would displace tagged receptors, decreasing the RET signal (Marullo
and Bouvier 2007). A non-tagged, non-interacting partner could also be used as a
control to demonstrate specificity. This control partner should not interfere with a
specific protein-protein interaction and, therefore, its expression would not result in a
decrease in RET signal (Marullo and Bouvier 2007). Surface density experiments
can be performed by increasing the concentration of both the acceptor and donor,
while maintaining a constant acceptor/donor ratio (Marullo and Bouvier 2007). If the
interaction is specific, the RET signal remains the same over a range of surface
45
densities. For non-specific interactions, however, the RET signal increases as a result
of an increase in random interactions at the increasingly crowded cell surface
(Kenworthy and Edidin 1998; Marullo and Bouvier 2007).
Figure 1.14 Principles underlying BRET experimental controls. a) Saturation
experiments are performed by maintaining the donor (Rluc) concentrations with an
increasing concentration of acceptor (GFP). Specifically interacting donor and
acceptor tagged proteins, (A-Rluc and B-GFP), produce a characteristic hyperbolic
curve. BRETmax indicates the maximal BRET signal, however, as it is affected by a
variety of parameters it is not directly informative. The GFP/Rluc value at half of
BRETmax, BRET50, indicates the association propensity of the interacting partners.
The non-interacting proteins, (A-Rluc and C-GFP), produce a pseudolinear curve
that may saturate at high GFP/Rluc levels, indicative of bystander BRET. b)
Competition controls. Increasing the concentration of a non-interacting partner (C)
will not affect the BRET signal. The BRET signal of a specific interaction will be
reduced with an increasing concentration of a native non-tagged receptor (B). c)
Surface density experiments are performed by maintaining a constant acceptor/donor
ratio at increasing concentrations. A specific interaction will maintain a BRET signal
over a range of surface densities. In the case of a non-specific interaction, the BRET
signal will increase as a result of more random interactions at the increasingly
crowded cell surface. Adapted from Marullo and Bouvier (2007).
46
Questions have also been raised about other experimental methods used to
demonstrate GPCR dimerisation. The visualisation of the rhodopsin receptors in neat
rows of dimers in their natural state in native retinal disc membranes using atomic
force microscopy has often been cited as compelling evidence of GPCR dimerisation
(Fotiadis et al. 2003; Liang et al. 2003). It has been questioned if this may be due to
an artefact, however, resulting from the conditions used during sample preparation
(Chabre et al. 2003). Complex ligand binding curves, where one ligand binding to its
receptor influences a second ligand binding to a different receptor, is often
interpreted as evidence for receptor dimerisation (Chabre et al. 2009). It has been
suggested, however, that such findings do not necessarily imply dimerisation, but
may in fact be observed when two monomeric GPCRs compete for the same
available pool of G proteins (Chabre et al. 2009). The many questions regarding the
methodologies used to demonstrate GPCR dimerisation highlight the need for a
critical understanding of the experimental methods and for the inclusion of
appropriate experimental controls so that inaccurate conclusions based on potentially
misleading data are avoided.
1.6 GHS-R DIMERSATION
It has previously been reported that the ghrelin receptor, GHS-R1a, and the truncated
isoform, GHS-R1b, form physiologically relevant dimers. GHS-R1a and GHS-R1b
have been proposed to interact. Potential interactions between GHS-R1a and GHS-
R1b were first described using GHS-R1a and GHS-R1b from the seabream
(Acanthopagrus schlegeli) which share ~60% amino acid identity with mammalian
GHS-Rs (Chan and Cheng 2004). GHS-R1a and GHS-R1b were co-expressed in
HEK293 cells, and GHS-R1b attenuated GHS-R1a-mediated intracellular Ca2+
mobilisation in response to a number of growth hormone secretagogues (Chan and
Cheng 2004). The authors proposed that this may result from GHS-R1a/GHS-R1b
heterodimerisation, although they did not directly demonstrate such an interaction
(Chan and Cheng 2004). Later studies, using human GHS-R1a and GHS-R1b
constructs in HEK293 cells, showed that GHS-R1b had no effect on GHS-R1a
ERK1/2 signalling in response to ghrelin treatment, but did attenuate the constitutive
activation of phosphatidylinositol-specific phospholipase C by GHS-R1a (Chu et al.
2007; Leung et al. 2007). This suggested that GHS-R1b may preferentially attenuate
GHS-R1a constitutive activation, while having no effect on ghrelin-mediated
47
signalling (Chu et al. 2007; Leung et al. 2007). GHS-R1a/GHS-R1b
heterodimerisation has been directly demonstrated using co-immunoprecipitation and
BRET2 (Leung et al. 2007). Interestingly, it was also shown that if the expression of
GHS-R1b exceeds that of GHS-R1a, there is a reduction in GHS-R1a cell surface
expression (Leung et al. 2007). The authors proposed, therefore, that GHS-R1b may
act as a dominant-negative regulator of GHS-R1a by reducing the cell surface
expression of GHS-R1a, causing a decrease in GHS-R1a constitutive signalling
(Leung et al. 2007).
GHS-R1a and the dopamine receptor subtype 1 (D1R) have been shown to form
heterodimers, using co-immunoprecipitation and BRET2 (Jiang et al. 2006). When
co-activated with ghrelin and dopamine this GHS-R1a/D1R heterodimer amplified
dopamine/D1R-induced cAMP accumulation (Jiang et al. 2006). Interestingly, the
formation of this dimer is proposed to be agonist-dependent and the mechanism of
the amplification of the dopamine signalling by ghrelin seems to involve a switch in
GHS-R1a-G protein coupling from Gα11/q to Gαi/o (Jiang et al. 2006). GHS-R1a and
D1R were shown to be co-expressed in a number of neurons in the mouse brain, and
this GHS-R1a/D1R dimer may represent a novel mechanism where ghrelin can
amplify dopamine signalling in those neurons that co-express GHS-R1a and D1R
(Jiang et al. 2006).
GHS-R1a has also been shown to heterodimerise with a number of prostanoid
receptors, the prostaglandin E2 receptor subtype EP3-1 and the thromboxane A2 (TPα)
receptors (Chow et al. 2008). These heterodimers, demonstrated using co-
immunoprecipitation and BRET2, resulted in decreased GHS-R1a cell surface
expression and decreased constitutive GHS-R1a phospholipase C activation (Chow
et al. 2008). While the functional outcomes of these interactions are unclear, the
authors suggest that heterodimers between GHS-R1a and these vasoactive receptors
may be relevant in vascular inflammation (Chow et al. 2008).
Finally, using co-immunoprecipitation, GHS-R1b has been shown to form a
heterodimer with a related receptor in the ghrelin receptor family, the neurotensin
receptor 1, in a non-small cell lung cancer cell (NSCLC) line (Takahashi et al. 2006).
Interestingly, heterodimerisation between GHS-R1b and neurotensin receptor 1 led
48
to the formation of a novel neuromedin U (NMU) receptor and NMU-25 treatment
resulted in a dose-dependent increase in cAMP production (Takahashi et al. 2006).
Significantly, both GHS-R1b and neurotensin receptor 1 are overexpressed in
NSCLC compared to normal lung, and short interfering RNA knockdown of GHS-
R1b and neurotensin receptor 1 successfully inhibited the growth of NSCLC cells
(Takahashi et al. 2006). This heterodimer may, therefore, play a significant role in
the development and progression of lung cancer and could provide a novel target for
the design of new anti-cancer drugs (Takahashi et al. 2006).
1.7 SUMMARY AND RELEVANCE TO THE PROJECT
Prostate cancer is the second most common cause of cancer-related deaths in
Western males. Current diagnostic, prognostic and treatment approaches are not ideal
and advanced metastatic prostate cancer is currently incurable. There is an urgent
need for improved adjunctive therapies and markers for this disease. Over the last
decade, it has emerged that GPCRs are likely to function as homodimers and
heterodimers. Heterodimerisation between GPCRs can result in the formation of
novel pharmacological receptors, with altered functional outcomes. A number of
GPCR heterodimers have been implicated in the pathogenesis of human disease. The
focus of this study is the ghrelin receptor isoforms, GHS-R1a and GHS-R1b, and the
closely related receptor GPR39, and the role of heterodimerisation in the progression
of prostate cancer.
Previous studies by our research group have shown that the truncated ghrelin
receptor isoform, GHS-R1b, is not expressed in normal prostate, however, could be
detected in prostate cancer and this may reflect a difference between a normal and
cancerous state. A number of mutant GPCRs have been shown to regulate the
function of their corresponding wild-type receptors. Our initial interest, therefore,
was the potential role of heterodimerisation between GHS-R1a and GHS-R1b, which
would be unique to prostate cancer, and any novel functional outcomes of this new
pharmacological receptor. During the course of this project, GHS-R1a and GHS-R1b
were shown to heterodimerise and GHS-R1b was proposed to have a dominant-
negative effect on GHS-R1a, however, a role in the prostate in response to this
interaction has not been described.
49
Our initial interest in GPR39 was due to its role as the obestatin receptor. Obestatin
is a peptide derived from preproghrelin that was proposed to have opposing effects to
ghrelin on appetite and food intake. Interactions between the ghrelin receptor, GHS-
R1a and the obestatin receptor, GPR39, could play a role in modulating the opposing
interactions of these peptides in obesity and potentially other cellular functions and
GHS-R1a/GPR39 heterodimers may provide a novel drug candidate. However, the
role of obestatin in opposing the effects of ghrelin on appetite and food intake has
been recently questioned and furthermore, it appears that GPR39 may not be the
obestatin receptor. Despite this, GPR39 is of interest in the prostate, as it has a role as
a zinc receptor. Zinc has a unique role in the biology of the prostate where it is
normally accumulated at high levels, and zinc accumulation is altered in the
development of prostate malignancy. Dimers involving the receptors for ghrelin and
zinc, which have important roles in prostate cancer, may have novel roles in
malignant prostate cells.
A number of different methods have been used to describe GPCR dimerisation.
Resonance energy transfer techniques have been used to describe a large number of
GPCR dimers in living cells. At the commencement of this study, the improved form
of BRET, BRET2, was described as the most sensitive technology available to
investigate GPCR interactions. Significantly, the experimental techniques used to
demonstrate receptor interactions have a number of limitations and a critical
understanding of the methods and the inclusion of appropriate controls is required to
draw accurate conclusions about GPCR dimerisation.
1.7.1 Hypotheses
The underlying hypotheses explored in my PhD studies were:
1. The ghrelin receptor, GHS-R1a, and the truncated ghrelin receptor isoform,
GHS-R1b, will heterodimerise and form a new pharmacological receptor with
novel functional outcomes.
2. The ghrelin receptor, GHS-R1a, and the closely related receptor, GPR39, will
heterodimerise and form a new pharmacological receptor with novel
functional outcomes.
3. GHS-R1a/GHS-R1b and GHS-R1a/GPR39 heterodimers will have functional
outcomes, with significance in the development of prostate cancer, and they
50
may provide new targets for the development of potential adjunctive
therapeutic approaches for prostate cancer.
1.7.2 Aims
The aims of this PhD study were to:
1. Provide initial evidence of GHS-R1a/GPR39 heterodimerisation by co-
immunoprecipitation.
2. Confirm and characterise GHS-R1a/GHS-R1b and GHS-R1a/GPR39
heterodimers in living cells using the resonance energy transfer techniques,
BRET2 and FRET.
3. Investigate the functional effects (signalling properties and regulation of
cellular apoptosis) of GHS-R1a/GHS-R1b and GHS-R1a/GPR39
heterodimerisation in prostate cancer cell lines.
51
CHAPTER 2
GENERAL MATERIALS AND METHODS
52
2.1 INTRODUCTION
This chapter contains general materials and methods that are used in a number of
chapters in this thesis. Where a method is specific to a chapter, it is included in the
materials and method section of that results chapter.
2.2 GENERAL REAGENTS AND CHEMICALS
All general reagents and chemicals of analytical grade were obtained from Ajax
Chemicals (Melbourne, Australia), BDH Chemicals (Kilsyth, Australia) or Sigma-
Aldrich Chemical Company (Castle Hill, Australia), unless otherwise stated.
2.3 CELL LINES
The HEK293 human embryonic kidney cell line and the prostate cancer cell lines,
PC-3 and CWR22RV1, were obtained from the American Type Culture Collection
(ATCC) (Manassas, USA).
2.4 CELL CULTURE
2.4.1 Cell maintenance
All cell lines were maintained at 37°C with 5% CO2 in Sanyo IR Sensor Incubator
(Quantum Scientific, Brisbane, Australia). The HEK293 human embryonic kidney
cell line was cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen,
Mount Waverley, Australia) with 10% New Zealand Cosmic Calf Serum (HyClone,
South Logan, UT, USA) supplemented with 50 U/mL penicillin G and 50 µg/mL of
streptomycin (Invitrogen). The PC-3 and CWR22RV1 prostate cancer cell lines were
maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (Invitrogen)
with 10% New Zealand Cosmic Calf Serum supplemented with 50 U/mL penicillin
G and 50 µg/mL streptomycin. All cell lines were passaged at two to three day
intervals at 70% confluency using 0.25% Trypsin/EDTA (Invitrogen). Cell
morphology and viability was monitored by microscopic observation and regular
Mycoplasma testing was performed using PCR. All general disposable cell culture
labware was from Nagle Nunc International (Roskilde, Denmark).
2.4.2 Cell counting
Cell suspensions of cells detached using trypsin were counted using a NucleoCounter
(ChemoMetic, Allerød, Denmark) as required. Briefly, cell suspensions were mixed
53
with lysis and stabilising buffers, according to the manufacturer’s instructions, before
being loaded into NucleoCassettes (ChemoMetic) containing propidium iodide to
stain cell nuclei and measure total cell concentration. Measurement of non-lysed
cells gives an indication of the total non-viable cell population.
2.4.3 Cell transfections
All transfections were performed using Lipofectamine 2000 (Invitrogen), as per the
manufacturer’s instructions. Adjustments to DNA and Lipofectamine 2000
concentrations were made for different experimental protocols and this information
is included in the relevant methods sections in the results chapters. In general, the
required concentration of DNA was incubated in Opti-MEM Reduced Serum Media
(Invitrogen) for 5 minutes at room temperature (RT). This solution was then
incubated with a Lipofectamine 2000/Opti-MEM solution to form DNA/
Lipofectamine complexes. After 20 minutes this solution was applied to the cells for
the time required for each experimental method.
2.5 CLONING
2.5.1 Polymerase chain reaction (PCR)
Standard PCRs were performed in a volume of 25 µL or 50 µL with a final
concentration of 1 X PCR buffer (Invitrogen), 0.2 nM dNTPs (Roche, Castle Hill,
Australia), 2 µM forward and reverse primers and either 1 unit (U) Platinum Taq
(Invitrogen) and 1.5 mM MgCl2 or 1U Platinum Pfx high fidelity polymerase
(Invitrogen) and 1mM MgSO4. Thermal cycling (PTC-200 Thermal Cycler, MJ
Research, Watertown, MA, USA) consisted of an initial 94°C denaturation for 2 min,
then 35 cycles of: 94°C for 10 sec (melting), 55°C for 30 sec (annealing) and 72°C
for 1 min/kb amplicon (extension), followed by a final extension of 72°C for 10 min.
Platinum Pfx required an extension temperature of 68°C. Annealing temperatures are
primer specific and modifications of this protocol are indicated in the results
chapters. Primers were designed using DNASTAR software (DNASTAR Inc.
Madison, WI, USA) and primers and oligonucleotides were sythesised by Proligo
(Lismore, Australia).
2.5.2 PCR amplicon gel excision and purification
All PCR amplicons were electrophoresed and separated by molecular size on 0.7-2%
54
(w/v) agarose gels. The agarose was dissolved in 1 X TAE (Tris Acetate Ethylene
diamine tetra-acetate, EDTA) containing ethidium bromide (0.1 µg/mL). The PCR
products were mixed with 6 X Loading buffer consisting of 1:1 food dye:80%
glycerol (Rose Pink food dye, Queen, Alderley, Brisbane). The electrophoresis was
carried out at 100V in a BioRad Minigel System (BioRad, Sydney, Australia) for
approximately 30 minutes and the image was captured using a G:Box gel
documentation system (Syngene, Cambridge, UK). PCR amplicons of interest were
visualised under UV light and excised from agarose gels using a sterile scalpel blade.
PCR amplicons were purified using a QIAquick Gel Extraction Kit (QIAGEN,
Melbourne, Australia), as per the manufacturer’s procedures.
2.5.3 Ligation of PCR amplicons into pGEM-T Easy vectors
DNA products of interest were cloned into pGEM-T Easy vectors (Promega,
Madison, WI, USA) according to the manufacturer’s instructions. Briefly, purified
PCR amplicons (approx. 50 ng), 2 X rapid ligation buffer, 50 ng pGEM-T Easy
Vector and 3 units T4 DNA ligase were mixed and incubated overnight at 4°C to
allow the ligation reaction to occur.
2.5.4 Transformation of DH5α subcloning efficiency chemically competent E.
coli by heat-shock
The ligated pGEM-T Easy vectors (containing the PCR amplicon of interest) were
transformed into DH5α Chemically Competent E. coli (Invitrogen), as per the
manufacturer’s instructions. Briefly, 3 μL ligation mixture and 50 μL DH5α cells
were mixed and incubated on ice for 20 min. Following this, the transformation was
performed by heat shocking the DH5α bacterial cells at 37°C for 20 sec in a water
bath. The transformed cells were then incubated in 950 μl of Super Optimal broth
with Catabolite repression (SOC) medium (2.0% w/v bactotryptone, 0.5% w/v yeast
extract, 10mM NaCl, 10mM MgCl2, 20mM MgSO4 20mM glucose) and shaken at
225 rpm for 60 min at 37°C.
2.5.5 Plating of transformed cultures onto LB/Ampicillin/X-Gal plates
Following the 37°C incubation of the transformation culture, centrifugation of the
culture was performed at 3500 x g for 10 min and the resulting supernatant removed
and discarded. The bacterial pellet was then resuspended in 100 μl SOC medium and
55
spread out on LB/ampicillin/X-Gal petri dishes (1.5% w/v agar, 1.0% w/v
bactotryptone, 0.5% w/v yeast extract, 0.5% w/v NaCl, 100 μg/mL ampicillin, 80
μg/mL X-Gal) and incubated at 37°C overnight.
2.5.6 Identification of positive colonies
The pGEM-T Easy Vector contains a multiple cloning site within the lacZ gene that
is required for lactose metabolism which is disrupted when DNA is inserted. Using
this selection process, colonies that remain blue can still use the lacZ gene and,
therefore, have no insert, and the lacZ gene is disrupted in colonies that appear white.
White and control blue colonies (no insert) were picked and grown in LB media
containing 100 μg/mL ampicillin overnight at 37°C with shaking at 225 rpm.
Following this, the samples were centrifuged at 14,000 x g for 10 min to collect the
bacterial cell pellets and then prepared for plasmid extractions as outlined below.
2.5.7 Extraction of plasmid DNA
The extraction of plasmid DNA was performed using the QIAprep spin Miniprep
Kit, as outlined by the manufacturer (QIAGEN).
2.5.8 DNA sequencing
DNA sequencing was carried out using the sequencing service at the Australian
Genome Research Facility (AGRF, http://www.agrf.org.au). The purified DNA
service was used, according to the AGRF guidelines using Big Dye Terminator
technology.
2.5.9 Subcloning into target vectors
Where required, target DNA sequences were cloned in frame into the vectors (as
required for specific applications) using restriction enzyme sequences that had been
incorporated into the correct position. Briefly, 4 μg pGEM-T Easy vector containing
the insert sequence of interest and 4 μg of the target vector were doubly digested
with 30 units of each of the required restriction enzymes in 50 µL reaction volume
containing 10 X restriction enzyme buffer at 37°C for 4 hr. Digest reactions were
then electrophoresed and target fragments purified as described (Chapter 2.5.2).
Subcloning ligations were performed using 3 units T4 DNA ligase, doubly digested
target vector (~50 ng), 10 X ligation buffer and doubly digested target insert (~100
56
ng) or sterile water as a negative control. For subcloning, ligations were incubated
overnight at 4°C and then transformed and screened, as per pGEM-T Easy vectors,
using antibiotic selection specific to the target vector.
2.6 PROTEIN ANALYSIS
2.6.1 Protein extraction and membrane fraction preparation
Soluble protein was isolated from prepared cells for further experimentation by the
addition of 1 mL of lysis solution (20 mM Tris, 150 mM NaCl, 1% Triton-X 100, 1
mM EDTA, 1 mM EGTA, 50 mM beta-glycerophosphate) and the addition of one
protease tablet (Complete EDTA-free Protease Inhibitor Cocktail, Roche) per 25 mL
of lysis solution. Where samples were to be used to identify phosphorylated proteins,
phosphatase inhibitors (Phosphatase Inhibitor Cocktail 2, Sigma-Aldrich, Castle Hill,
Australia and 50 mM NaF) were added to the lysis solution. Lysates were then
centrifuged for 20 min at 14,000 x g (4°C) in a bench top centrifuge. The supernatant
was collected and the total protein concentration determined using the Bicinchoninic
Acid (BCA) protein assay, as described below (Chapter 2.6.2). Where cell membrane
fractions were required, cell lysates (as prepared above) were further centrifuged at
100,000 x g (4°C) for 30 min. The resultant pellet, corresponding to the cell
membrane fraction, was resuspended in lysis solution.
2.6.2 Protein quantification by Bicinchoninic Acid (BCA) assay
The BCA assay was performed essentially as described by the manufacturer (Pierce,
Rockford, IL, USA) in 96-well microplates. Using 2 mg/mL Bovine Serum Albumin
(BSA) stock, a set of protein standards were made (0.2-1mg/mL) by dilution in Tris-
EDTA (TE, 10mM Tris, 1mM EDTA, pH 8.0). Then, 200 µL working reagent
(supplied in the Pierce kit) was added to each well. Twenty-five µL of each BSA
standard, blank control (TE) and protein test samples were added to each well, mixed
and then incubated for 30 min at 37°C. Once cooled to RT, the samples were read at
560 nm in a microplate spectrophotometer (BioRad, Gladesville, Australia).
2.6.3 Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE)
SDS-PAGE was carried out using the Mini-PROTEAN 3 apparatus (BioRad),
according to the manufacturer’s instructions. Briefly, gels were prepared containing
10-12% v/v acrylamide resolving gels to separate total protein and a 4% stacking gel
57
layer to enhance band quality. Protein samples were added to gel loading buffer
(250mM Tris-HCl, 2% SDS, 10% glycerol, 20 mM β-mercaptoethanol, 0.01%
bromophenol blue), before being boiled for 10 min or incubated at RT. PAGE gels
were electrophoresed in 1X Tris-glycine running buffer (25mM Tris, 0.25 M glycine,
0.1% w/v SDS, pH 8.3). SDS-PAGE gels were run at 80 volts until the loading dye
had reached the end of the stacking gel, and then at 100 volts until the proteins were
sufficiently resolved. A pre-stained molecular weight protein marker (Precision Dual
Colour Marker, BioRad) was used to estimate the molecular sizes of the separated
proteins.
2.6.4 Western blotting analysis
The proteins separated by SDS-PAGE were transferred to a BioTrace NT
nitrocellulose membrane (Pall Life Sciences, Pensacola, FL, USA) using a transfer
blot apparatus (BioRad). Transfers were performed in either CAPS buffer (10 mM N-
cyclohexyl-3-aminopropanesulfonic acid, pH 11, 10% methanol, 0.001% SDS) or
carbonate transfer buffer (0.01 M NaHCO3, 3 mM Na2C03, pH 9.9, 20% methanol)
for 120 min at 4°C using a constant current of 200 milliamps. To monitor transfer
efficiency and equal protein loading, the membrane was stained with Ponceau S
(Sigma-Aldrich) for 5 min, rinsed in tap water and the resulting proteins visualised.
Following the Ponceau S staining, non-specific protein binding sites were blocked by
incubating the membrane in 5% w/v skim milk powder diluted in TBS-T (Tris-
buffered saline-Tween-20, 10 mM Tris-Cl, 0.5 M NaCl, 0.05% Tween-20, pH 7.4) at
RT for 1 hr. Primary antibodies were diluted in blocking buffer or 2.5% BSA
(Sigma-Aldrich)/TBS and incubated with the membrane with agitation at 4°C
overnight. Membranes were then washed 4 times for 10 minutes with TBST.
Secondary antibodies were diluted in blocking buffer and incubated with agitation at
RT for 2 hr with membranes. Membranes were then washed again 4 times for 10 min
in TBST before incubation in a chemiluminescent substrate (SuperSignal West
Femto, Pierce) for 5 min. Signal was detected by exposing membranes to X-ray film
(Agfa, Brisbane, Australia) for the appropriate time to produce the best image. X-ray
film was developed using an Agfa CP1000 automatic film processor.
58
2.6.5 Densitometry
Western immunoblots were quantitated by scanning the X-ray film and analysing
images using the Syngene Gene Tools Software program. The Syngene software
generates a histogram based on the intensity of the band of interest and quantitates
the area under the curve. These values were used for comparisons of band intensity.
2.7 STATISTICAL ANALYSIS
Where comparisons were made between a baseline control and a number of test
means, a one-way analysis of variance (ANOVA) followed by Dunnett's test was
performed. Where all group means were compared an ANOVA was performed with
a Tukey’s test post hoc. Statistical data was analysed using the inerSTAT-a v1.3
software. A p-value <0.05 was considered statistically significant. BRET2 saturation
curves were fitted by non-linear regression assuming one site binding (Graphpad
Prism 4).
59
CHAPTER 3
INITIAL CHARACTERISATION OF INTERACTIONS
BETWEEN THE GHRELIN RECEPTOR ISOFORMS
(GHS-R1a AND GHS-R1b) AND GPR39
60
3.1 INTRODUCTION
Ghrelin is a multifunctional peptide hormone, and is a major regulator of energy
metabolism. Recent studies in our laboratory have shown that the ghrelin/GHS-R1a
axis could play an important autocrine/paracrine role in prostate cancer (Jeffery et al.
2002; Jeffery et al. 2003). This study focuses on three closely related GPCRs in the
ghrelin receptor subfamily: GHS-R1a, the ghrelin receptor, GHS-R1b, a truncated
isoform of the ghrelin receptor, and GPR39. Our research group initially described
the formation of novel GHS-R1a and GHS-R1b heterodimers in the LNCaP prostate
cancer cell line through co-immunoprecipitation studies (Figure 3.1) (McNamara et
al. 2002, unpublished) and GHS-R1a/GHS-R1b heterodimerisation has since been
demonstrated in the HEK293 human embryonic kidney cell line (Leung et al. 2007).
Figure 3.1 Demonstration of GHS-R1a/GHS-R1b heterodimerisation in native
LNCaP prostate cancer cells by co-immunoprecipitation. LNCaP prostate cancer
cell were treated with 10 nM ghrelin and membrane lysates were immunoprecipitated
with an antibody raised against GHS-R1a. A) GHS-R1a and B) GHS-R1b Western
blots were performed on this immunoprecipitated fraction (IP), and GHS-R1a- or
GHS-R1b-specific peptides (to which the GHS-R antibodies were raised) were used
as an antibody control (3 kDa). The presence of a similar 73 kDa immunoreactive
band, the approximate size of a potential GHS-R1a/GHS-R1b heterodimer, in both
GHS-R1a and GHS-R1b Western immunoblots suggests that these receptors may be
dimerising in native prostate cancer cells. Adapted from (McNamara et al. 2002,
unpublished).
61
In 2005, GPR39, an orphan GPCR in the ghrelin receptor family, was reported to be
the obestatin receptor (Zhang et al. 2005). Obestatin is a 23 amino acid, C-terminally
amidated peptide that is derived from preproghrelin (Zhang et al. 2005). It was
originally proposed to have opposing effects to ghrelin, as treatment of rats with
obestatin suppressed food intake, inhibited jejunal contraction and decreased body
weight gain (Zhang et al. 2005). The finding that two peptides, ghrelin and obestatin,
derived from the same preprohormone and acting through two different receptors
was particularly interesting. We hypothesised that the closely related ghrelin receptor
and GPR39 could interact, and we aimed to investigate how these interactions may
mediate the function of these opposing peptides derived from the same precursor.
The initial report describing GPR39 as the obestatin receptor has been questioned,
however, with a number of studies being unable to replicate the binding of obestatin
to GPR39 (Lauwers et al. 2006; Chartrel et al. 2007; Holst et al. 2007). Indeed, a
study by the original authors reported that the initial batch of obestatin contained
impurities and that a new, iodinated obestatin preparation was unable to bind GPR39
(Zhang et al. 2007a). More recently, however, further reports by the original authors
suggest that specifically purified monoiodo-obestatin can bind GPR39 and that
previously inconsistent binding of iodinated obestatin to GPR39 was due to variable
loss of obestatin bioactivity after iodination (Zhang et al. 2008a). Further
investigations by independent sources are required to clarify the binding of obestatin
to GPR39.
Despite the controversy surrounding the role of GPR39 in obestatin binding and
signalling, GPR39 has been consistently shown to be functionally responsive to Zn2+
treatments (Holst and Schwartz 2004; Lauwers et al. 2006; Holst et al. 2007; Yasuda
et al. 2007; Storjohann et al. 2008b; Storjohann et al. 2008a). The potential role of
GPR39 as a zinc sensing receptor is of particular interest to this study, as zinc plays
an important role in prostate cancer metabolism. Normal prostate accumulates the
highest amount of zinc of any soft tissue, however, the level of zinc consistently
decreases with prostate malignancy resulting in altered metabolism (Costello et al.
2005). This altered metabolic activity is an early and very predictable event in
prostate cancer and offers a survival advantage to the malignant cells (Costello et al.
2005).
62
GPCRs are a versatile family of membrane receptors and are the largest family of
proteins in the mammalian genome (Lander et al. 2001; Venter et al. 2001). Until
recently, GPCRs were widely thought to function as monomers, however, this dogma
has been recently questioned. It is currently thought that many GPCRs may form
functional dimers and higher order oligomers. The ability of GPCRs to form
functional dimers, in effect creating new pharmacological receptors, may lead to an
increased range of GPCR function (Kroeger et al. 2001). GHS-R heterodimers which
result in altered functional outcomes have recently been reported (Jiang et al. 2006;
Takahashi et al. 2006; Leung et al. 2007; Chow et al. 2008), however, GPR39
homodimerisation or heterodimerisation has not yet been shown. Closely related
GPCRs are more likely to form functional heterodimers than less closely related
receptors (Ramsay et al. 2002). We, therefore, hypothesised that the closely related
receptors, GHS-R1a, GHS-R1b and GPR39, which are all expressed in the prostate,
could homo- and/or hetero-dimerise to form novel pharmacological receptors with
potential functions in prostate cancer. This chapter describes initial experiments to
identify GPR39 expression in prostate cancer cell lines and investigates the
formation of heterodimers between GHS-R1a, GHS-R1b and GPR39 using a
classical co-immunoprecipitation technique.
63
3.2 MATERIALS AND METHODS
General materials and methods are outlined in detail in Chapter 2. Experimental
procedures which are specific to this chapter are described below.
3.2.1 Cell Culture
Cells were maintained in culture medium, as described in Chapter 2.4.1. The
HEK293 human embryonic kidney cell line was used in order to optimise
recombinant protein expression as it has a high transfection efficiency. The PC-3
prostate cancer cell line was used for probing interactions between GPCRs in a
prostate cancer model.
3.2.2 Amplification of full length GPR39 by PCR
Sense (5’-gctcatgaaaagccagaagg-3’) and anti-sense (5’-catgatcctccgaatctggt-3’) PCR
primers that spanned intron 1 of the human GPR39 sequence were designed for
amplification of GPR39 transcript in test cDNAs. LNCaP prostate cancer cell line
cDNA was obtained from Dr. John Lai (IHBI, QUT). MCF10a transformed normal
breast cell line cDNA was obtained from Rachael Murray (IHBI, QUT). Human
stomach cDNA reverse transcribed from FirstChoice Human Stomach Total RNA
(Ambion, Austin, TX, USA), was obtained from Dr. Inge Seim (IHBI, QUT). PCR
was performed as described in Chapter 2.5.1, in a 20 µL reaction using 1 µL
template cDNA with 1 unit (U) Platinum Taq (Invitrogen). Thermal cycling
consisted of an initial denaturation of 2 min at 94°C, then 35 cycles of 94°C for 10
sec (melting), 55°C for 30 sec (annealing) and 72°C for 1 min/kb amplicon
(extension), followed by a final extension at 72°C for 10 min (PTC-200 Thermal
Cycler, MJ Research, Watertown, MA, USA). PCR products were electrophoresed
and images were captured (as described in Chapter 2.5.2). PCR products were
sequenced (as described in Chapter 2.5.8).
3.2.3 GPR39 Immunohistochemistry (IHC) of PC-3 prostate cancer cells
PC-3 prostate cancer cells were grown in 96 well culture plates to 70% confluence.
Growth medium was aspirated and cells were washed three times in phosphate
buffered saline (PBS, pH 7.3). Cells were fixed in 100% ice cold methanol and
frozen for 5 minutes before methanol was aspirated and cells were allowed to air dry.
Cells were incubated twice for 20 min in 1% hydrogen peroxide and washed in PBS
64
prior to blocking for 1 hr in 1% BSA/PBS. Cells were incubated with primary
antibody (1/100 dilution, GPR39 antibody, Novus Biologicals, Littleton, CO, USA)
or without primary antibody (negative control) in blocking buffer overnight at 4°C.
Immunoreactivity was visualised using the EnVision+ system (DAKO, Carpinteria,
CA, USA) using peroxidise-conjugated anti-rabbit secondary antibody and DAB
(3,3'-Diaminobenzidine) substrate, as per the manufacturer’s instructions. Finally,
cells were counterstained with Haematoxylin and photographed.
3.2.4 GHS-R1a and GPR39 co-immunoprecipitation from native PC-3 prostate
cancer cell lysate
The PC-3 prostate cancer cell line was grown to 80% confluence in T75 tissue
culture flasks and lysed in standard lysis buffer (as described in Chapter 2.6.1).
Washed Protein A agarose (Roche) and Protein G agarose (Roche) was prepared by
blocking in 1% BSA/PBS for 1 hr at room temperature with gentle mixing. Blocked
gel was washed once in PBS and then equilibrated in standard lysis buffer. Protein A
agarose (60 µl) was incubated with 2.5 µl rabbit anti-humanGPR39 antibody (Novus
Biologicals) in lysis buffer and Protein G agarose (60 µl) was incubated with 2.5 µl
goat anti-humanGHS-R1a (F-16) antibody (Santa Cruz Biotechnology, Santa Cruz,
CA, USA) in lysis buffer at room temperature for 1 hr to allow antibody to bind.
Excess unbound antibody was removed by three washes in lysis buffer before 450 µl
PC-3 cell lysate was added for immunoprecipitation at 4°C overnight. Following
incubation, the agarose was washed 3 times in lysis buffer to remove unbound
proteins. Bound protein was eluted by the addition of 30 µl SDS-PAGE gel loading
buffer (250mM Tris-HCl, 2% SDS, 10% glycerol, 20 mM β-mercaptoethanol, 0.01%
bromophenol blue) for 5 min at 37°C. Immunoprecipitated proteins were then
identified using standard SDS-PAGE and Western blotting techniques (as described
in Chapter 2.6.3 and 2.6.4) using either a rabbit anti-humanGPR39 antibody (1:3000,
anti-rabbit secondary 1:5000) or a goat anti-humanGHS-R1a (F-16) antibody
(1:6000, anti-goat secondary 1:10000).
3.2.5 FLAG and Myc tagged construct design
PCR primers were designed to amplify the full length receptor with the addition of a
C-terminal tag sequence. Where a FLAG tag (N-DYKDDDDK-C) was incorporated,
the sequence, (5’-gactacaaggacgatgacgacaag-3’), was included in the reverse primer
65
sequence. To add a Myc tag, (N-EQKLISEEDL-C), sequence (5’-
gagcaaaagcttataagcgaggaggacctc-3’) was included in the reverse primer sequence.
The reverse primer sequences are listed in Table 3.1. A common forward primer,
Rluc-Tags-S (5’-ggatatcaagcttgcggtacc-3’) was used for all PCRs in order to
introduce a Kpn I restriction enzyme site (indicated by the underline) to allow
orientation-specific cloning.
Table 3.1 Reverse Primer Sequences used for FLAG-tag and Myc-tag cloning
FLAG or Myc tag sequence is indicated in bold. The Xba I restriction enzyme
sequence used for directional cloning is underlined.
Reverse Primer 5' → 3'
GHS-R1a-FLAG actctagactacttgtcgtcatcgtccttgtagtcccatgtattaatactaga
GHS-R1a-Myc tctctagactagaggtcctcctcgcttataagcttttgctcccatgtattaatactaga
GHS-R1b-FLAG actctagactacttgtcgtcatcgtccttgtagtcccagagagaagggagaag
GHS-R1b-Myc tctctagactagaggtcctcctcgcttataagcttttgctcccagagagaagggagaag
GPR39-FLAG actctagactacttgtcgtcatcgtccttgtagtcccaaacttcatgctcctgc
GPR39-Myc tctctagactagaggtcctcctcgcttataagcttttgctcccaaacttcatgctcctg
3.2.6 PCR and cloning of FLAG and Myc tagged pcDNA3.1 constructs
The Rluc-N construct (Chapter 4.2.2-4.2.3) containing the receptor sequence of
interest was used as a template for this PCR. PCRs were performed, as described in
Chapter 2.5.1, in a 50 µL reaction volume with a final concentration of 1 X PCR
buffer (Invitrogen), 1 µL template DNA, 0.2 nM dNTPs (Roche), 2 µM each of
forward and reverse primers, with 1 U Platinum Pfx high fidelity polymerase and
1mM MgSO4. Thermal cycling consisted of an initial denaturation (2 min at 94°C),
then 35 cycles of 94°C for 10 sec (melting), 55°C for 30 sec (annealing), 68°C for 1
min/kb amplicon (extension) followed by a final extension of 68°C for 10 min (PTC-
200 Thermal Cycler, MJ Research, Watertown, MA, USA). PCR products were
purified, cloned into pGEM-T Easy vector (Promega) and sequenced, (as described
in Chapter 2.5.2 - 2.5.8). The tagged receptor sequence was subcloned into the
pcDNA3.1(+) vector (Invitrogen) for high-level transient expression in mammalian
systems using single Eco RI digests, (performed as per Chapter 2.5.9), using
ampicillin (100 µg/mL) resistance selection. A single Xba I enzyme digest was used
to screen for correct orientation of the insert sequence.
66
3.2.7 Cell Transfections for Co-Immunoprecipitation
HEK293 cells were transiently transfected with different combinations of FLAG-
tagged receptors, with or without Myc-tagged receptors, in T75 tissue culture flasks.
Transfections were performed (essentially as described in Chapter 2.4.3) using 4 µg
each tagged receptor construct with 20 µL Lipofectamine 2000.
3.2.8 Initial Protein A immunoprecipitation of FLAG and Myc tagged receptors
For immunoprecipitation, transfected cells were lysed 24 hr post-transfection in
standard lysis buffer (as described in Chapter 2.6.1). A 10% solution of Protein A
sepharose (GE Healthcare, Rydalmere, Australia) was prepared by swelling the
required amount in TBS (pH 7.4) at 4°C for 1 hr before being blocked in
1%BSA/PBS for 1 hr. Prepared resin was incubated with an anti-FLAG polyclonal
antibody raised in rabbit (2 µg per 250 µl 10% solution, Sigma-Aldrich) for 1 hr at
room temperature. Immunoprecipitation of FLAG-tagged proteins was performed by
incubating the prepared resin with 250 µg protein sample at 4°C overnight.
Following incubation, resin was washed 3 times in lysis buffer to remove non-bound
proteins. Bound protein was eluted by the addition of 30 µl SDS-PAGE gel loading
buffer (250mM Tris-HCl, 2% SDS, 10% glycerol, 20 mM β-mercaptoethanol, 0.01%
bromophenol blue), before being boiled for 10 min. Immunoprecipitated proteins
were then identified using standard SDS-PAGE and Western blotting techniques (as
described in Chapter 2.6.3 and 2.6.4) using either an anti-FLAG polyclonal antibody
(1:3000, anti-rabbit secondary 1:25000) or an anti-Myc-Tag (9B11) mouse
monoclonal antibody (mAb) (Cell Signaling Technology, 1:3000, anti-mouse
secondary 1:25000).
3.2.9 Modified SDS-PAGE method to investigate the effect of temperature on
GPCR aggregation during SDS-PAGE
SDS-PAGE was performed, (as previously described in Chapter 2.6.3), however, to
evaluate the effect of temperature on GPCR aggregation, 10 µg protein samples in
gel loading buffer (250mM Tris-HCl, 2% SDS, 10% glycerol, 20 mM β-
mercaptoethanol, 0.01% bromophenol blue) were incubated at temperatures ranging
from RT to 100°C for 10 minutes before loading the gel. Western blotting was
performed, (as described in Chapter 2.6.4), using an anti-Myc-Tag (9B11) mouse
mAb (Cell Signaling Technology, 1:3000) and anti-mouse secondary antibody
67
(1:10,000).
3.2.10 Anti-FLAG affinity gel immunoprecipitation using optimised SDS-PAGE
sample preparation
For subsequent immunoprecipitations, cells were lysed 24 hr post-transfection in a
modified lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1% sodium deoxycholate,
1% Ipegal C-630, 2 mM EDTA, 10 mM iodoacetamide containing protease inhibitor
cocktail (Roche)) at 4°C for 20 min. Following centrifugation, 1 mg of protein lysate
was immunoprecipitated with 40 µL anti-FLAG M2 affinity gel (purified murine IgG
monoclonal antibody covalently attached to agarose by hydrazide linkage, Sigma-
Aldrich) at 4°C overnight. After washing three times with lysis buffer, FLAG-tagged
proteins were eluted by addition of 100 µL (15 µg) 3X FLAG peptide. For SDS-
PAGE, whole cell lysate (7.5 µL) and immunoprecipitates (12.5 µL) were added to
gel loading buffer but not boiled before they were applied to the gel. Western
immunoblot analysis was performed (as described in Chapter 2.6.4) using either an
anti-FLAG polyclonal antibody (1:2000 with anti-rabbit secondary 1:5000) or an
anti-Myc-Tag (9B11) Mouse mAb (1:3000 with anti-mouse secondary 1:5000).
68
3.3 RESULTS
3.3.1 GPR39 is expressed in prostate cancer cell lines
Following the report that GPR39, a member of the ghrelin receptor family, was the
obestatin receptor (Zhang et al. 2005), we were interested in the potential role of
GPR39 in prostate cancer and particularly in potential interactions between GPR39
and the ghrelin receptor isoforms (GHS-R1a and GHS-R1b). Initially, we
demonstrated the expression of GPR39 mRNA in the LNCaP prostate cancer cell
line by RT-PCR (Figure 3.2A) and GPR39 mRNA expression has previously been
demonstrated in the PC-3 cell line in our laboratory (personal communication, Laura
Amorim). PCR using primers specific to GPR39 resulted in an amplicon at the
predicted size (174bp) in LNCaP, MCF10a and human stomach cDNA (Figure
3.2A). This amplicon was sequenced and was confirmed as GPR39. Using an anti-
GPR39 antibody, specific cytoplasmic staining was observed in the PC-3 prostate
cancer cell line (Figure 3.2B), while the negative control, performed with the
omission of primary antibody did not produce any specific staining (Figure 3.2C).
GPR39 immunoreactivity has also been observed in prostate cancer tissue sections
(Figure 1.7).
Figure 3.2 Expression of GPR39 transcript in LNCaP prostate cancer cells and
GPR39 protein in PC-3 prostate cancer cells. A) Ethidium bromide stained
agarose gel of RT-PCR products (174 bp) show GPR39 mRNA expression in the
LNCaP prostate cancer cells (L), the transformed normal breast cell line, MCF10a
(M) and human stomach (HS), but not in the no template control (-ve). The identity
of this PCR product was confirmed by DNA sequencing. B) Immunohistochemistry
performed with an anti-GPR39 antibody shows specific cytoplasmic immunostaining
(brown) in the PC-3 prostate cancer cell line, but not in a no primary antibody
negative control (C).
69
3.3.2 GHS-R1a and GPR39 co-immunoprecipitation in native PC-3 prostate
cancer cells
As GHS-R1a and GPR39 are co-expressed in prostate cancer and in prostate cancer
cell lines, co-immunoprecipitation experiments were performed to identify potential
interactions between GHS-R1a and GPR39 in the native PC-3 prostate cancer cell
line. Immunoprecipitation of PC-3 cell lysates was performed with GHS-R1a and
GPR39 antibodies. The immunoprecipitated fraction was analysed by SDS-PAGE
and GHS-R1a and GPR39 Western immunoblots were performed (Figure 3.3). A
large non-specific protein band is observed at 100-150 kDa which is likely to be a
result of binding to the antibody used during immunoprecipitation. Western blots
performed with GHS-R1a antibody showed a number of high molecular weight
bands when immunoprecipitations were performed with a GHS-R1a antibody. The
GPR39 Western blots showed similar high molecular weight bands in the
immunoprecipitated fractions for both GHS-R1a and GPR39 immunoprecipitations.
These high molecular weight bands (>250 kDa) do not appear at the predicted
molecular weight of a simple GHS-R1a/GPR39 heterodimer (93 kDa), however, they
could represent oligomeric structures potentially resulting from specific GHS-R1a
and GPR39 interactions. While the formation of GHS-R1a/GPR39 heterodimers was
not proven, these data indicated further investigation using additional techniques
were warranted. To further analyse GHS-R1a, GHS-R1b and GPR39 interactions,
additional co-immunoprecipitation experiments were performed in cells expressing
these receptors tagged with either FLAG or Myc tags.
70
Figure 3.3 Co-immunoprecipitation of GHS-R1a and GPR39 in the native PC-3
prostate cancer cell line. Immunoprecipitations were performed with antibodies to
GHS-R1a (1a) and GPR39 (39). The immunoprecipitated fraction was analysed by
SDS-PAGE and Western blotting. GHS-R1a Western blots identified
immunoreactive bands in the fractions immunoprecipitated with both GHS-R1a and
GPR39 antibodies. GPR39 Western blots showed similar high molecular weight
bands (indicated by the arrow) in the immunoprecipitated fraction of both GHS-R1a
and GPR39 immunoprecipitations. These high molecular weight bands may
represent oligomeric structures potentially resulting from specific GHS-R1a and
GPR39 interactions. The large protein observed at 100-150 kDa is likely to be due to
the elution of the antibody which was used for immunoprecipitation.
3.3.3 Cloning of FLAG and Myc tagged full length receptor sequence into
pcDNA3.1 (+)
PCR of FLAG and Myc tagged full length receptor sequence was successfully
performed and the PCR product was cloned into pGEM-T Easy for sequencing and
subcloning. All inserts; GHS-R1a-FLAG, GHS-R1a-Myc, GHS-R1b-FLAG, GHS-
R-1b-Myc, GPR39-FLAG and GPR39-Myc were sequenced and were free of PCR
artefacts. A single Eco RI digest was used to subclone each tagged receptor sequence
into similarly digested pcDNA3.1(+) vector. Screening of these clones was
performed by selecting for ampicillin resistance and by the use of a single Xba I
enzyme digest to confirm the correct orientation of the insert sequence. Single
71
clones, containing the correct sequence in the correct orientation, for each of the six
constructs were selected for use in further experiments.
3.3.4 Immunoprecipitation and Immunoblotting of tagged protein aggregates
To further examine homodimerisation and heterodimerisation between GHS-R1a,
GHS-R1b and GPR39, co-immunoprecipitation and Western immunoblotting using
FLAG and Myc tagged receptors was performed. Preliminary studies were
performed in HEK293 cells overexpressing both GHS-R1a-FLAG and GPR39-Myc.
These studies into GHS-R1a/GPR39 heterodimerisation were initially performed
using the HEK293 cell line to optimise the method as it has a high transfection
efficiency and this model has been used to study many GPCR interactions. Protein A
immunoprecipitation with bound anti-FLAG antibody was used for
immunoprecipitation of protein lysates from these cells. Non-transfected HEK293
cell lysate was used as a negative control. The immunoblots of the
immunoprecipitation fraction of these overexpressing cells is shown (Figure 3.4) and
both FLAG (Figure 3.4A) and Myc (Figure 3.4B) tagged proteins (>250 kDa) from
cells overexpressing GHS-R1a-FLAG and GPR39-Myc were immunoprecipitated
successfully. Interestingly, however, these proteins are not visible at the predicted
molecular weights (MWs predicted from the amino acid structure) for GHS-R1a (42
kDa) or GPR39 (51 kDa) and these bands appear at a relatively high molecular
weight. This indicates the formation of protein aggregates involving the tagged
proteins of interest. As these high molecular weight aggregates were specific to the
cell lysate co-overexpressing tagged GHS-R1a and GPR39, this indicates that these
proteins may interact and further experimentation was performed in order to isolate
the cause of this aggregation or interaction.
72
Figure 3.4 Initial FLAG Immunoprecipitation of HEK293 cell lysates to identify
interactions between GHS-R1a and GPR39. A) FLAG and B) Myc immunoblots
of the immunoprecipitated fraction from HEK293 cells either overexpressing both
GHS-R1a-FLAG and GPR39-Myc or untransfected (negative control). High
molecular weight (>250 kDa) FLAG and Myc immunoreactive bands are present in
those cells overexpressing GHS-R1a-FLAG and GPR39-Myc. The presence of a
specific Myc immunoreactive band (>250 kDa) in the transfected cells indicates that
GPR39-Myc can be retained when an immunoprecipitation is performed with a
FLAG antibody. Interestingly the immunoreactive bands do not appear at the
predicted molecular weights for GHS-R1a (42 kDa) and GPR39 (51 kDa),
suggesting that these tagged proteins are aggregating. The IgG heavy chain is seen as
a large band at ~50 kDa and is indicated by the arrow.
3.3.5 Heating of samples in SDS-PAGE sample buffer during sample
preparation leads to aggregation of ghrelin receptor family members
To attempt to isolate the cause of the protein aggregation, the methods used during
preparation of protein samples for SDS-PAGE were considered. An important step to
aid protein denaturation during SDS-PAGE is to boil the samples in SDS-PAGE gel
73
loading buffer containing a reducing agent prior to loading samples. Identical
HEK293 cell lysate samples from cells overexpressing GHS-R1a-Myc were prepared
for SDS-PAGE and then incubated at a range of temperatures from room temperature
(~23°C) to 100°C in SDS-PAGE gel loading buffer for 10 min prior to loading on
the gel. The anti-Myc immunoblot of these samples is shown in Figure 3.5.
Surprisingly, it was observed that an increase in the temperature in which samples
were prepared in SDS-PAGE gel loading buffer resulted in an increased aggregation
of GHS-R1a-Myc (increased appearance of high molecular weight bands). The
predicted size of GHS-R1a is 42kDa and a band at approximately this size can be
observed in all samples where the temperature was under 60°C. At higher
temperatures (70-100°C) a proportion of the tagged protein failed to migrate through
the stacking gel and into the separating gel, indicating a significant increase in
molecular weight of the membrane protein complexes. Interestingly, it was also
noted that even at the lower temperatures tested, including 4°C (data not shown) and
when using a variety of solubilisation techniques (data not shown), that a significant
proportion of the tagged proteins were maintained as high molecular weight
aggregates. Additional bands at mid-range molecular weights (~60-95 kDa)
potentially indicating GHS-R1a homodimers or heterodimers were also observed
(Figure 3.5). Similar protein aggregation following heating of samples for SDS-
PAGE was observed for cells overexpressing tagged GHS-R1b and GPR39 (data not
shown). The ability of these receptors to aggregate during preparation of protein
samples for SDS-PAGE explains the presence of high molecular weight proteins in
Chapter 3.3.4 (Figure 3.4). Further immunoprecipitation and Western blotting
experiments were, therefore, performed without boiling the samples during sample
preparation.
74
Figure 3.5 The formation of GHS-R1a aggregates during SDS-PAGE when
samples in gel loading buffer are heated prior to electrophoresis. Protein (10 µg)
from HEK293 cells overexpressing GHS-R1a-Myc was prepared and identical
aliquots in reducing SDS-PAGE gel loading buffer were then incubated at a range of
temperatures for 10 min prior to loading on an SDS-PAGE gel. An anti-Myc
Western blot of the transferred gel, including the stacking gel portion, is shown
above. An increase in protein aggregation (high molecular weight proteins) is
observed with an increase in the incubation temperature. The predicted molecular
weight of GHS-R1a is 42 kDa (indicated by the arrow) and a band at this size is
observed only at incubation temperatures below 60 °C.
3.3.6 Immunoprecipitation demonstrates protein-protein interactions of GHS-
R1a, GHS-R1b and GPR39
Following optimisation of the immunoprecipitation and electrophoresis methods,
experiments were performed to analyse potential interactions between GHS-R1a,
GHS-R1b and GPR39. A commercial anti-FLAG antibody conjugated gel (Sigma-
Aldrich) was used instead of using protein A incubated with an anti-FLAG antibody.
The final elution was performed by the addition of a 3X FLAG peptide in order to
increase the sensitivity of the assay. This avoids the elution of IgG and, therefore, the
potential interference of denatured antibody chains during Western blot analysis.
Immunoprecipitations were performed using protein lysates from cells
overexpressing FLAG-tagged receptor either alone (negative control) or with a Myc-
75
tagged receptor. The presence of a Myc-tagged receptor in the immunoprecipitation
elution fraction suggested that these receptors were forming dimers or higher order
oligomers with the FLAG-tagged receptors. FLAG immunoprecipitations, using
either GHS-R-1a-FLAG, GHS-R-1b-FLAG and GPR39-FLAG proteins, in
conjunction with Myc-tagged receptors, were performed (Figure 3.6). Using this
method it was shown that GHS-R1a-FLAG (42 kDa) co-immunoprecipitated with
both GHS-R1b-Myc (33 kDa) and GPR39-Myc (51 kDa) (Figure 3.6A). GHS-R1b-
FLAG (33 kDa) co-immunoprecipitated with GHS-R1a-Myc (42 kDa) and GPR39-
Myc (51 kDa) (Figure 3.6B). Finally, assays performed with GPR39-FLAG (51 kDa)
overexpressing cell lysates resulted in the successful immunoprecipitation of GHS-
R1a-Myc (42 kDa) (Figure 3.6C). These data indicate that all of the receptors tested,
GHS-R1a, GHS-R1b and GPR39, appear to co-immunoprecipitate and, therefore,
may interact.
Figure 3.6 Co-immunoprecipitation (IP) and Western immunobloting (WB) of
FLAG- and myc- tagged GHS-R1a, GHS-R1b and GPR39 receptors in HEK293
cells. A) GHS-R1a-FLAG, B) GHS-R1b-FLAG and C) GPR39-FLAG were
immunoprecipitated using an anti-FLAG antibody conjugated gel. The predicted
molecular weights of GHS-R1a, GHS-R1b and GPR39 are 42, 33 and 51 kDa. When
two receptors are overexpressed in the same cells, the presence of a corresponding
band in the anti-Myc Western blot, indicates that the two receptors were co-
immunoprecipitated as a result of interactions between these two receptors. All
receptor combinations tested resulted in the immunoprecipitation of a Myc-tagged
protein at the predicted molecular weight. Similar immunoprecipitations performed
using cells that only expressed a single FLAG-tagged receptor were used as a
negative control.
76
77
3.4 DISCUSSION
This study aimed to identify interactions between the ghrelin receptor isoforms,
GHS-R1 and GHS-R1b, and the closely related receptor, GPR39. These receptors are
co-expressed in prostate cancer and heterodimers of these receptors may function as
a novel pharmacological receptor with prostate specific functions. Closely related
GPCRs are more likely to form functional heterodimers than less closely related
receptors (Ramsay et al. 2002). Prior to commencement of this study our research
group described a novel interaction between GHS-R1a and GHS-R1b in prostate
cancer cell lines (McNamara et al. 2002, unpublished). More recent studies have
reported the co-immunoprecipitation of dimers involving the ghrelin receptor
isoforms including GHS-R1a homodimers (Leung et al. 2007), GHS-R1a/GHS-R1b
heterodimers (Leung et al. 2007), GHS-R1b/NTSR1 heterodimers (Takahashi et al.
2006), GHS-R1a/D1R heterodimers (Jiang et al. 2006) and GHS-R1a heterodimers
with the prostanoid receptors, the prostaglandin E2 receptor subtype EP3-1, the
prostacyclin (IP) receptor and the thromboxane A2 (TPα) receptor (Chow et al.
2008).
GPR39 has recently received a great deal of interest within the ghrelin field. GPR39
was originally described to bind obestatin, a peptide derived from preproghrelin
(Zhang et al. 2005), however, the role of GPR39 as the obestatin receptor has been
questioned (Lauwers et al. 2006; Chartrel et al. 2007; Holst et al. 2007; Zhang et al.
2007a). In addition, GPR39 signalling has been shown to be stimulated by zinc ions
(Holst and Schwartz 2004; Lauwers et al. 2006; Holst et al. 2007; Yasuda et al.
2007; Storjohann et al. 2008b; Storjohann et al. 2008a). This is particularly
interesting, as zinc plays a central role in prostate metabolism (Costello et al. 2005).
Normal prostate accumulates the highest amount of zinc of any soft tissue, however,
the level of zinc consistently decreases with prostate malignancy resulting in altered
metabolism (Costello et al. 2005). Preliminary results described in this chapter show
that GPR39 is expressed in prostate cancer cell lines and that GPR39 may interact
with GHS-R1a in native PC-3 prostate cancer cells. These interactions were also
examined using immunoprecipitation of tagged receptors in the HEK293 human
embryonic kidney cell line. Heterodimers of the ghrelin receptor isoforms and
GPR39, which bind ligands that are important in prostate cancer function, ghrelin
and zinc, may have significant functional outcomes in prostate cancer.
78
The finding that the ghrelin receptors and GPR39 form large protein aggregates
during standard SDS-PAGE was surprising. While SDS-resistant aggregation has not
been previously reported for this family of receptors, it has been demonstrated in
other GPCRs, including the opsin GPCRs (Borjigin and Nathans 1994) and the D6
chemokine receptor (Blackburn et al. 2004). The current study suggests that a critical
factor contributing to the formation of these SDS-resistant aggregates is the
application of heat to protein samples in reducing SDS-PAGE gel loading buffer.
This effect of heat on the aggregation of membrane proteins has been described
previously in a number of studies; for the vesicular monoamine transporter (Sagné et
al. 1996), the NHE1 Na+/H+ exchanger in mammalian cells (Bullis et al. 2002), the
cystic fibrosis transmembrane conductance regulator (CFTR) (Sharma et al. 2001),
the 27 kDa component of ammonia monooxygenase from Nitrosomonas europaea
(Hyman and Arp 1993), the hydrophobic TGBp3 protein of Poa semilatent virus
(Gorshkova et al. 2003) and the GPCR, the D6 chemokine receptor (Blackburn et al.
2004). Interestingly, work by Sagné and coworkers, analysing membrane
preparations using silver-stained SDS-PAGE gels, showed that the formation of
SDS-resistant aggregates after heat treatment is limited to a relatively small
percentage of membrane proteins (Sagné et al. 1996).
One potential mechanism for the formation of these SDS-resistant aggregates, which
appears to be unique to hydrophobic membrane proteins, has been previously
described (Sagné et al. 1996). It is suggested that proteins that are susceptible to
SDS-resistant aggregation are those which retain a significant level of structure in the
presence of SDS, such as the secondary structures within transmembrane regions.
Interestingly, it appears that it is the application of heat during sample preparation, a
step that usually aids in disrupting protein structure, that enables these residual
secondary structures to form inter-molecular interactions leading to large protein
aggregates (Sagné et al. 1996). A diagram illustrating the potential mechanism for
the formation of these large protein aggregates is shown in Figure 3.7. This
mechanism for the formation of large protein aggregates after heating would explain
the presence of high molecular weight bands described in this study for GHS-R1a,
GHS-R1b and GPR39.
79
Figure 3.7 Proposed mechanism for SDS-resistant aggregation of hydrophobic
membrane proteins. Residual secondary structures of membrane proteins, which are
resistant to SDS (indicated by the black boxes), are exposed upon heating in SDS-
PAGE gel loading buffer. Resultant intermolecular interactions lead to the formation
of large protein aggregates. Adapted from Sagné et al. (1996).
The observation that receptors from the ghrelin family form large protein aggregates
during standard SDS-PAGE suggests that the findings from co-immunoprecipitation
experiments must be interpreted cautiously. The immunoprecipitation experiments
described in this chapter suggest that GHS-R1a, GHS-R1b and GPR39 interact, but
these may be the result of artificial aggregation and represent false positive results.
Therefore, further techniques to investigate and validate receptor-receptor
interactions in live cells were pursued. Previous reports of dimerisation of a large
number of GPCRs, including GHS-R1a/GHS-R1b (Leung et al. 2007) and GHS-
R1a/D1R heterodimersation (Jiang et al. 2006) have also used resonance energy
transfer techniques, in addition to co-immunoprecipitation.
This study is the first to describe the co-immunoprecipitation of GHS-R1a and
GPR39, suggesting that these receptors may heterodimerise. However, given the
80
ability of these receptors to form aggregates after heating during preparation for
SDS-PAGE, this finding requires confirmation using complementary methods. To
confirm the interactions between GHS-R1a, GHS-R1b and GPR39, two resonance
energy transfer methods, bioluminescence resonance energy transfer (BRET) and
fluorescent resonance energy transfer (FRET), were used and are described in
Chapters 4 and 5 of this thesis.
81
CHAPTER 4
BIOLUMINESCENT RESONANCE ENERGY
TRANSFER (BRET) STUDIES OF INTERACTIONS
BETWEEN THE GHRELIN RECEPTOR ISOFORMS
(GHS-R1a AND GHS-R1b) AND GPR39
82
4.1 INTRODUCTION
As a result of our findings using co-immunoprecipitation experiments, we attempted
to confirm the formation of dimers between the ghrelin receptor, GHS-R1a, a
truncated isoform, GHS-R1b and the related receptor, GPR39 using an ‘improved’
bioluminescence resonance energy transfer technique, BRET2. GHS-R1a/GHS-R1b
or GHS-R1a/GPR39 heterodimers could represent a novel target for the treatment of
prostate cancer. BRET methodology has been applied to investigate interactions
between GPCRs and other proteins in real time and in living cells (Pfleger and Eidne
2003; Pfleger and Eidne 2005; Harrison and Van der Graaf 2006; Gandiá et al.
2008). Dimers between GHS-R1a and other GPCRs have been demonstrated using
BRET2 methodology, including GHS-R1a homodimers (Jiang et al. 2006; Leung et
al. 2007), constitutive GHS-R1a and GHS-R1b heterodimers (Leung et al. 2007),
agonist-dependent GHS-R1a/dopamine receptor subtype 1 (D1R) heterodimers
(Jiang et al. 2006) and GHS-R1a heterodimers with vasoactive prostanoid receptors
(Chow et al. 2008). GPR39 homo- or heterodimerisation has not previously been
reported.
The BRET technique is based on the energy transfer from a donor molecule to an
acceptor molecule when these molecules are in close proximity. BRET2 technology
uses a modified acceptor protein (GFP2) and an alternative coelenterazine substrate
to BRET1 (Bertrand et al. 2002), which increases the spectral separation of donor and
acceptor emission (Ramsay et al. 2002), resulting in increased sensitivity compared
with other resonance energy transfer methods (Dacres et al. 2008; Dacres et al.
2009). A disadvantage of the BRET2 methodology, however, is the low quantum
yield and the short half life of the BRET2 Rluc substrate, coelenterazine 400a
(Hamdan et al. 2005). The potential for ‘bystander BRET’, (non-specific BRET
resulting from the overexpression of non-interacting proteins that are forced into
close proximity due to increased concentrations), has led to the requirement for
extensive experimental controls to be performed. These include saturation, surface
density and competitive inhibition experiments (James et al. 2006; Marullo and
Bouvier 2007).
This chapter describes BRET2 experiments using GHS-R1a, GHS-R1b and GPR39
donor and acceptor fusion proteins in the CWR22RV1 prostate cancer cell line and
83
the HEK293 human embryonic kidney cell line. These data highlight significant
practical implications when performing BRET2 experiments and have confirmed the
requirement for thorough experimental controls when performing similar
experiments in overexpressing cell systems.
84
4.2 MATERIALS AND METHODS
General materials and methods are outlined in detail in Chapter 2. Experimental
procedures which are specific to this chapter are described below.
4.2.1 Cell Culture
Cells were maintained in culture medium, as described in Chapter 2.4.1. The
HEK293 human embryonic kidney cell line was used in order to optimise
recombinant protein expression methods, as it has a high transfection efficiency. The
CWR22RV1 prostate cancer cell line was used to investigate interactions between
GPCRs in a prostate cancer model.
4.2.2 BRET2 vector construct design, PCR and cloning of full length receptor
constructs
BRET2 vector constructs (N- and C-) were purchased from Perkin-Elmer (Waltham,
MA, USA). Full length receptor sequence was amplified using the PCR primers
outlined in Table 4.1. PCRs were performed (as described in Chapter 2.5.2) in 50 µL
reaction volume with a final concentration of 1 X PCR buffer (Invitrogen), 1 µL
template DNA, 0.2 nM dNTPs (Roche), 2 µM each of forward and reverse primers
with 1 U Platinum Pfx high fidelity polymerase and 1mM MgSO4. Thermal cycling
(PTC-200 Thermal Cycler, MJ Research) consisted of 2 min at 94°C initial
denaturation then 35 cycles of 94°C for 10 sec (melting), 53°C for 30 sec
(annealing), 68°C for 1 min/kb amplicon (extension) followed by a final extension of
68°C for 10 min. For cloning of GHS-R constructs a pcDNA3.1(+) construct
containing either full length GHS-R1a or GHS-R1b (UMR cDNA Resource Center,
Rolla, MO, USA) was used as the template DNA in the PCR. For cloning of the
GPR39 vectors, human stomach cDNA was used as the template DNA for the PCR,
outlined above, that included the addition of 2% DMSO to increase reaction
specificity. Resultant PCR products contained full length receptor sequence with 5’
Kpn I and 3’ Bam HI restriction enzyme sites for directional cloning into target
vectors. For N-vector cloning the reverse primer was designed to mutate the receptor
stop codon which results in a receptor-luciferase/GFP2 fusion construct. N-vector
cloning was performed using the pRluc-N1 and the pGFP2-N1 versions of the vectors
to allow the cloning to be performed in the correct frame. For C-vector cloning the
native receptor stop codon was included in the reverse primer sequence and this
85
cloning strategy results in a luciferase/GFP2-receptor fusion construct. For correct
frame cloning, the pRluc-C1 and pGFP2-C3 versions of the vectors were used for C-
vector cloning. PCR products were purified, cloned into pGEM-T Easy vector
(Promega) and sequenced, as described in Chapter 2.5.2 - 2.5.8. The full-length
receptor sequences were subcloned into the target BRET2 vector using a double Kpn
I and Bam HI restriction enzyme digest, (performed as per Chapter 2.5.9), using
either kanamycin (25 µg/mL, pRluc vectors) or zeocin (25 µg/mL, pGFP2 vectors)
resistance for selection of positive clones. As a negative control, an unrelated GPCR,
the protease-activated receptor-2 (PAR2) was cloned into the pGFP2-N1 vector. A
pEGFP-PAR2 construct (obtained from Dr. Andrew Ramsey) was doubly digested,
as described in Chapter 2.5.9, using Hind III and Age I restriction enzymes for
subcloning into similarly digested pGFP2-N1 vector.
Table 4.1 Primer sequences for BRET2 vector cloning
Kpn I (forward primer) and Bam HI (reverse primer) restriction enzyme sequences
were included for directional cloning and are indicated by the underline.
BRET2-N vector cloning
Forward Primer 5' → 3' Reverse Primer 5' → 3'
GHS-R1a gtgtggtaccattcaccatgtgg ccctctagactggatccatgtattaatac
GHS-R1b gtgtggtaccattcaccatgtgg gccctctagactggatccagagagaag
GPR39 cctggtaccctggtgctctttct cttgggatccaaacttcatgctc
BRET2-C vector cloning
Forward Primer 5' → 3' Reverse Primer 5' → 3'
GHS-R1a gtgtggtaccattcaccatgtgg aacggatcctctagactcgagtca
GHS-R1b gtgtggtaccattcaccatgtgg aacggatcctctagactcgagtca
GPR39 gcggggtaccggtgctctttctcatg ggctggatccggtgggattcaaac
4.2.3 Cell Transfections for BRET experiments
The HEK293 or CWR22RV1 cell lines were seeded in 24 well plates and
transfections were performed at 80-90% confluence. Standard BRET2 transfections
were performed, as described in Chapter 2.4.2, with different combinations of Rluc-
receptor and GFP2-receptor constructs, using 1 µg DNA/well and 2 µL
Lipofectamine 2000 per well. Alterations to DNA concentration were made for
different BRET2 controls and are indicated where appropriate.
86
4.2.4 Luminescence/Fluorescence Detection
Twenty-four hours post transfection, cells were lifted in 350 µL 0.5 mM EDTA/PBS.
Cells were centrifuged for 5 min at 3,500 x g at RT and resuspended in 63 µL BRET2
assay buffer (1 mM CaCl2, 0.5 mM MgCl2, 5.5 mM D-Glucose in PBS) in 96-well
white Optiplates (Perkin Elmer). Cells were treated with the injection of 7 µL
coelenterazine 400a substrate (Biotium, Hayward, CA, USA) to a final concentration
of 5 µM. Immediately following addition of the substrate, Renilla luciferase
bioluminescence (410 nm) and GFP2 fluorescence (515 nm) were measured
simultaneously on a POLARstar fluorometer/luminometer (BMG Labtech).
4.2.5 Standard BRET2 assays of receptor-receptor interactions
Initial attempts to identify receptor-receptor interactions were performed using a
standard BRET2 assay system whereby equal amounts of Rluc-tagged receptor
construct and GFP2-tagged receptor construct were transfected into HEK293 or
CWR22RV1 cells, (as described in Chapter 4.2.3). Luminescent and fluorescent
signals were detected (as described in Chapter 4.2.4). Initial BRET2 assays were
performed, as described in the product literature, using the automatic injector of the
POLARstar reader (BMG Labtech) to inject 7 µL of the coelenterazine 400a
substrate into each well in sequence prior to reading Renilla luciferase
bioluminescence (410 nm) and GFP2 fluorescence (515 nm). Following the
identification of technical difficulties involving the use of the coelenterazine 400a
substrate (discussed in Chapter 4.3.3 and 4.3.4), a new method of substrate injection
was used whereby concentrated stock solutions of the coelenterazine 400a substrate
in anhydrous ethanol were diluted in BRET2 assay buffer immediately before the
addition of 7 µL manually to each well to a final concentration of 5 µM. Immediately
following addition of substrate, Renilla luciferase bioluminescence and GFP2
fluorescence were measured for BRET2 analysis. The BRET2 ratio was calculated by
dividing the 515 nm GFP2 emission by the 410 nm Rluc emission, where the two are
co-transfected, minus the 515 nm to 410 nm ratio where the Rluc tagged receptor is
expressed alone. In all BRET2 assays, a pGFP2-MCS-Rluc(h) vector (Rluc(h), codon
humanised Renilla luciferase gene, Perkin Elmer) which produces a GFP2-luciferase
fusion protein was used as a positive control for the assay.
87
4.2.6 BRET2 receptor-luciferase saturation assays
As a control to show receptor-receptor interaction specificity, saturation assays were
performed. This method maintains a constant receptor-luciferase expression level
with transfection of an increasing concentration of GFP2-tagged receptors. When all
of the luciferase-tagged receptors are involved in dimers, the addition of further
GFP2-tagged receptors will no longer lead to an increase in BRET2 ratio and will
result in a specific saturation curve. Transfections and luciferase/fluorescence
readings were performed, (as described in Chapter 4.2.3), with increasing GFP2 DNA
concentrations. Assays were performed using 500 ng pRluc-N-receptor construct,
either alone or with the addition of 125 ng – 1 µg pGFP2-N-receptor construct.
Luciferase/fluorescence readings were performed as described in Chapter 4.2.4. Data
for saturations curves were analysed for each test transfection individually, where the
[GFP2]/[Luc] ratio was determined post-assay, as the concentration of tagged
molecules is proportional to fluorescent and luminescent signal detected (James et al.
2006). To determine this ratio we first determined a K value constant on triplicate
measurements of the pGPF2-MCS-Rluc positive control, where the acceptor/donor
ratio is fixed at one. The fluorescence/luminescence ratio calculated for this positive
control gives 1/K. The [GFP2]/[Luc] ratio of test transfections was calculated by
multiplying the fluorescent/luminescent ratio, adjusted for background fluorescence
and luminescence of the cells alone, by the constant K determined in each assay. The
BRET2 ratio was also determined for each well individually, as previously described
in Chapter 4.2.5.
4.2.7 BRET2 variation of surface density expression experiments
To rule out the possibility that observed BRET is as a result of over-expression of
receptor constructs, leading to bystander BRET, surface density BRET2 experiments
were performed. Assays were performed by transfecting an increasing concentration
of total DNA whilst maintaining the donor to acceptor ratio at 1:1. Experiments were
performed with 50 ng-1 ug of each Rluc- and GFP2- construct, (transfected as
described in Chapter 4.2.3), with alterations made in DNA concentrations
transfected. Where BRET is specific and not a result of the bystander effect, the
BRET2 ratio remains the same, regardless of the receptor density when donor and
acceptor receptors are kept at the same ratio. Bystander BRET is observed when an
increased expression level leads to an increased BRET2 ratio due to the crowding of
88
the cell surface forcing BRET between two receptors that may not dimerise at
physiological receptor levels (Marullo and Bouvier 2007).
4.2.8 BRET2 unlabeled competition assays
To test the specificity of receptor-receptor interactions, competition assays were
performed by using increasing amounts of unlabeled receptor constructs to compete
out receptor-luciferase/receptor-GFP2 dimers. A corresponding decrease in BRET2
ratio indicates successful competition. Transfections were performed, as described in
Chapter 4.2.3, with alterations made to input DNA concentrations. GHS-R1a-
Rluc/GHS-R1a-GFP2 competition assays were performed using 100 ng of each
BRET2 construct, either alone, or with the addition of 100 ng – 1 µg GHS-R1a-Myc
as the native competing receptor. For GPR39-Rluc/GHS-R1a-GFP2, competition
assays were performed using 500 ng of each BRET2 construct, either alone, or with
the addition of 250 ng – 2 µg GHS-R1a-Myc as the native competing receptor.
4.2.9 Statistical analysis
Where comparisons were to be made between a wild type (wt)-receptor control and
receptor-receptor interactions, a one-way analysis of variance (ANOVA) followed by
Dunnett's test was performed. Where all groups were to be compared, such as for
observations of BRET2 ratio with alterations in surface density, a one way ANOVA
was performed followed by a Tukey’s post hoc test. Saturation curves were fitted by
nonlinear regression assuming one site binding (Graphpad Prism 4). Statistical data
was analysed using the inerSTAT-a v1.3 software. A p-value <0.05 was considered
statistically significant.
89
4.3 RESULTS
4.3.1 Cloning of GHS-R1a, GHS-R1b, GPR39 and PAR2 BRET2 constructs
PCR for cloning of GHS-R1a, GHS-R1b and GPR39 was successfully performed
(using the PCR primers outlined in Table 4.2.1) and PCR products were cloned into
pGEM-T Easy for sequencing and subcloning. All products were sequenced and
found to be free from PCR artefacts. Receptor sequences containing a mutated stop
codon were double digested with Kpn I and Bam HI and subcloned into the BRET2
N- vectors (resulting in a receptor-luciferase/GFP2 fusion construct), pRluc-N1 and
pGFP2-N1. N-vectors containing receptor sequence are designated; GHS-R1a-Rluc,
GHS-R1a-GFP2, GHS-R1b-Rluc, GHS-R1b-GFP2, GPR39-Rluc and GPR39-GFP2.
Receptor sequences containing the native stop codon were double digested with Kpn
I and Bam HI and subcloned into the BRET2 C- vectors (resulting in a
luciferase/GFP2-receptor fusion construct), pRluc-C1 and pGFP2-C3. C-vectors
containing receptor sequence are designated; Rluc-GHS-R1a, GFP2-GHS-R1a, Rluc-
GHS-R1b, GFP2-GHS-R1b, Rluc-GPR39 and GFP2-GPR39. As a control for BRET2
experiments, a class A GPCR unrelated to the ghrelin receptor family was cloned
into the pGFP2-N1 vector. Full length PAR2 sequence with a mutated stop codon
(from Dr. Andrew Ramsey, IHBI, QUT) was successfully subcloned and was
designated PAR2-GFP2.
4.3.2 Comparison of BRET2 N- and C- vector constructs
To initially optimise the BRET2 experimental method, test transfections of BRET2
N- and C- vectors were performed in the CWR22RV1 prostate cancer cell line. A
critical requirement for BRET2 methodology is the ability to efficiently detect a
luminescent and fluorescent signal in transfected cells. Initial standard BRET2
experiments in CWR22RV1 prostate cancer cells were performed using the N- and
C- variants of GHS-R1a and GHS-R1b; GHS-R1a-Rluc, Rluc-GHS-R1a, GHS-R1b-
Rluc and Rluc-GHS-R1b. To compare the expression efficiency of N- and C- vectors
a simple comparison of the luminescence units measured, where equal amounts of
Rluc construct were transfected, is shown in Figure 4.1. It was observed that the
luminescent signal and, therefore, receptor level was approximately 2-4 fold higher
for transfected N-vectors compared to C-vectors when equal amounts of vector were
transfected. As higher luminescence units were observed in cells transfected with
BRET2 N- fusion proteins, these vectors were chosen for further optimisation of
90
BRET2 technique. Subsequent data were obtained using the BRET2 N- vectors, and
for simplicity these will now only be referred to as receptor-Rluc or receptor-GFP2.
Figure 4.1 Comparison of luminescence generated by BRET2 N- and C- vector
constructs after the injection of coelenterazine 400a substrate. Equal amounts (2
µg) of N- or C-BRET2 vectors were transfected in CWR22RV1 prostate cancer cells
and cells were analysed for presence of Renilla luciferase by treatment with the
coelenterazine 400a substrate. The N-vector constructs containing GHS-R1a and
GHS-R1b resulted in an approximately 2-4 fold greater expression than GHS-R1a
and GHS-R1b C-vector constructs. Results of a single representative experiment with
mean of triplicate measurements ± SD. RLU (relative luminescent units).
4.3.3 Identification of experimental variation during initial optimisation of
BRET2 method in the CWR22RV1 prostate cancer cell line
Initial BRET2 optimisation was performed in prostate cancer cells by following the
methods described by the manufacturer (Perkin Elmer) in a luminometer/fluorometer
fitted with an automatic injector for the injection of the coelenterazine substrate.
Results of a representative experiment for GHS-R1a-Rluc and GHS-R1b-Rluc co-
transfected with wtGFP2, GHS-R1a-GFP2 or GHS-R1b-GFP2 are shown in Figure
4.2. Initial experiments showed an increased BRET2 ratio when GHS-R1a-Rluc and
GHS-R1a-GFP2 were coexpressed, however, this ratio was not significantly different
91
from the GHS-R1a-Rluc/wtGFP2 control. Significantly these experiments and other
early BRET2 experiments (data not shown) indicated that there was considerable
experiment to experiment variation. Therefore, there was a large degree of
experimental error that could not be easily explained by variations in cell
transfections. Further detailed investigations into the BRET2 experimental technique
were, therefore, performed.
Figure 4.2 Initial BRET2 ratios in the CWR22RV1 prostate cancer cell line.
Standard BRET2 was performed for GHS-R1a-Rluc and GHS-R1b-Rluc. An
increased BRET2 ratio, such as that observed for the GHS-R1a-Rluc/GHS-R-1a-
GFP2 pair, is indicative of receptor-receptor interaction. However, this BRET2 ratio
is not statistically significantly different from the wtGFP2 control co-transfected with
GHS-R1a-Rluc. Significant experimental variation was observed in early BRET2
experiments and further examination of the method was carried out. Data represents
mean of two independent experiments performed in triplicate ± SEM. Statistical
analysis was performed by one way ANOVA with a post-hoc Dunnett’s test for
comparisons to the wtGFP2 control.
92
4.3.4 The BRET2 substrate, Coelenterazine 400a, shows rapid signal decay with
significant practical implications
Due to the significant experimental variation observed during initial BRET2
experiments, the cause of this variation was investigated. To evaluate the
luminescent signal decay, standard BRET2 experiments, using a GPR39-Rluc as a
donor, were performed in the HEK293 human embryonic kidney cell line. These
assays were modified so that substrate was injected manually and the whole test plate
measured immediately, instead of sequential well readings being taken after injection
by the automatic injector. The luminescence and fluorescence readings were then
repeated at intervals over 30 minutes without the further addition of substrate. An
example of the luminescent signal, fluorescent signal and resultant BRET2 ratio, over
a 30 min time course, is shown in Figure 4.3. Significantly, it can be observed that
luminescence (Figure 4.3A) and fluorescence (Figure 4.3B) rapidly decays towards
baseline levels, and after 2.5 min the signals appear to decrease to approximately
25% of their initial levels. Figure 4.3C shows the BRET2 ratio ± SD of triplicate
transfections of the same donor/acceptor pair. The considerable experimental error
noted after 2.5 minutes reflects that the luminescent/fluorescent signals are
approaching the limits of detection and are no longer reliable. The rapid signal decay
of the BRET2 substrate, coelenterazine 400a, will impact on experiments performed,
as using an automatic injector, variations in the time taken for preparation of a
diluted substrate working stock and injector loading significantly impact on the
luminescence/fluorescence signal levels. The variation in signal intensity and
resultant error in BRET2 ratio, as a function of the rapid signal decay of the BRET2
substrate, is likely to reflect the variation between experiments which were noted
during initial BRET2 experiments.
93
Figure 4.3 BRET2 time course following addition of coelenterazine 400a in
HEK293 cells. The A) luminescent and B) fluorescent signal show rapid decay after
treatment with the BRET2 substrate, coelenterazine 400a. Approximately 25% of the
maximum signal in lost after 2.5 minutes and the signal rapidly approaches the limit
of detection. C) The resultant BRET2 ratios at all time points are shown ± SD of
triplicate transfections of the same donor/acceptor pair. The large experimental error
observed after 2.5 minutes reflects the decay of signals towards the baseline of
detection where these results are no longer reliable.
94
95
4.3.5 Standard BRET2 assays illustrate potential GHS-R1a/GHS-R1a,
GPR39/GHS-R1a and GPR39/PAR2 interactions
Having optimised the BRET2 detection method, standard BRET2 assays in HEK293
cells were performed by manually adding the coelenterazine substrate to test wells
and by immediately acquiring the luminescence/fluorescence readings. Data obtained
with donor-tagged receptors GHS-R1a-Rluc (Figure 4.4) and GPR39-Rluc (Figure
4.5) are shown. All receptor-Rluc/receptor-GFP2 co-transfections are compared to
receptor-Rluc co-transfected with soluble wild-type GFP2, which indicates the
background BRET2, as a result of random donor/acceptor collisions in solution. A
significant increase in BRET2 ratio is observed for the GHS-R1a-Rluc/GHS-R1a-
GFP2 co-transfection (Figure 4.4), indicating the potential of GHS-R1a to form
receptor homodimers. GPR39-Rluc, when co-transfected with GHS-R1a-GFP2 and
PAR2-GFP2, had a significant increase in BRET2 ratio potentially indicating the
formation of GPR39/GHS-R1a heterodimers and GPR39/PAR2 heterodimers (Figure
4.5).
Figure 4.4 BRET2 ratios from GHS-R1a-Rluc standard BRET2 assays in
HEK293 cells. GHS-R1a-Rluc was co-transfected with wtGFP2 (control) or GFP2
tagged receptor constructs and treated with the coelenterazine 400a substrate. Co-
transfection with GHS-R1a-GFP2 shows a significant increase in BRET2 ratio
indicating interactions between the donor (Rluc) and acceptor (GFP2) molecules.
Data represents the mean ± SEM of three independent experiments performed in
triplicate. Statistical analysis was performed using a one way ANOVA with a post-
hoc Dunnett’s test for comparisons to the wtGFP2 control. ** p<0.01
96
Figure 4.5 GPR39-Rluc standard BRET2 assays in HEK293 cells. GPR39-Rluc
was co-transfected with wtGFP2 (control) or GFP2 tagged receptor constructs and
treated with the coelenterazine 400a substrate. Co-transfection with GHS-R1a-GFP2
and PAR2-GFP2 shows a significant increase in BRET2 ratio, indicating close
interactions between the donor (Rluc) and acceptor (GFP2) molecules. Data
represents the mean ± SEM of three independent experiments performed in triplicate.
Statistical analysis was performed using a one way ANOVA with a post-hoc
Dunnett’s test for comparisons to the wtGFP2 control. ** p<0.01
4.3.6 BRET2 saturation of receptor-receptor interactions
A number of BRET control experiments must be performed before it can be
concluded that a positive BRET2 result represents a specific interaction between
receptor pairs (Marullo and Bouvier 2007). One such control experiment is a BRET2
titration assay, where the donor Rluc concentration is maintained while the acceptor
GFP2 concentration is increased. If the interaction is specific, the BRET2 ratio will
increase hyperbolically, with a corresponding increase in GFP2/Rluc value. It will
saturate at higher GFP2 levels, at a point where all donor molecules are associated
with acceptors (Marullo and Bouvier 2007). A non-specific interaction will increase
pseudo-linearly, but will still saturate at higher GFP2/Rluc values (Marullo and
Bouvier 2007). Saturation experiments were performed for receptor pairs in this
study and representative saturation curves are shown in Figure 4.6. Saturation curves,
using GHS-R1a-Rluc as the donor (Figure 4.6A) show a hyperbolic curve for GHS-
R1a-Rluc/GSH-R1a-GFP2, with a maximal BRET2 value of 0.176 ± 0.015. As with
97
previous experiments in this study, GHS-R1a-Rluc interactions with wtGFP2 and
GHS-R1b-GFP2 demonstrated no significant BRET2 over a range of GFP2/Rluc
ratios. GPR39-Rluc saturation curves (Figure 4.6B) show a hyperbolic fit, with both
GHS-R1a-GFP2 and PAR2-GFP2, with maximal BRET2 values of 0.090 ± 0.012 and
0.054 ± 0.021 respectively. A saturation curve of the GPR39-Rluc/wtGFP2 pair
displayed a linear fit, which is consistent with a non-specific interaction.
Significantly, however, experimental variation, which is likely to result from the
rapid signal decay of the coelenterazine 400a substrate, introduced considerable error
into these curves, with goodness of fit R2 values of 0.803 for the GHS-R1a-
Rluc/GHS-R1a-GFP2 pair, 0.724 for the GPR39-Rluc/GHS-R1a-GFP2 pair and 0.625
for GPR39-Rluc/PAR2-GFP2 pair. While the saturation of these positive BRET2
pairs may indicate specific protein-protein interactions, similar curves can still be
observed as a result of bystander BRET at sufficiently high donor surface densities
(Mercier et al. 2002) and, therefore, this must be ruled out by the evaluation of
BRET2 at a variety of receptor concentrations.
98
Figure 4.6 BRET2 saturation curves in HEK293 cells. A) GHS-R1a-Rluc and B)
GPR39-Rluc saturation curves. BRET2 pairs which have been previously shown to
show a significant BRET2 ratio in this study; GHS-R1a-Rluc/GHS-R1a-GFP2,
GPR39-Rluc/GHS-R1a-GFP2 and GRP39-Rluc/PAR2-GFP2 show hyperbolic
saturation curves at increasing GFP2/Rluc ratios. The GHS-R1a-Rluc/GHS-R1b-
GFP2 pair and the wtGFP2 background controls do not indicate a specific interaction.
Results are from a representative experiment (GHS-R1a-Rluc/wtGFP2 (n=1), GHS-
R1a-Rluc/GHS-R1a-GFP2 (n=5), GHS-R1a-Rluc/GHS-R1b-GFP2 (n=3), GPR39-
Rluc/wtGFP2 (n=1), GPR39-Rluc/GHS-R1a-GFP2 (n=9), GPR39-Rluc/PAR2-GFP2
(n=1)) where each data point of a triplicate transfections is displayed with
[GFP2]/[Luc] and BRET2 ratio determined post assay. Saturation curves were fitted
by nonlinear regression assuming one site binding (Graphpad Prism 4).
99
4.3.7 Surface density BRET2 experiments indicate positive results as a function
of bystander BRET2
A further BRET2 control experiment is to monitor the BRET2 ratio over a range of
receptor levels, where a constant donor/acceptor ratio is maintained. It is predicted
that if the receptor-receptor interaction is specific, the BRET2 ratio will remain
constant over a range of total protein concentrations at the same donor/acceptor ratio
(Kenworthy and Edidin 1998). In a non-specific interaction, the BRET2 ratio will
increase with receptor concentration as a function of higher expression levels which
force donor and acceptor molecules into close proximity due to crowding of the
membrane surface (Kenworthy and Edidin 1998). This BRET2 results from the
bystander effect caused by excessive receptor over-expression and is not indicative
of a specific interaction. To test the effect of surface density with the BRET2
methodology used in this study, surface density BRET2 experiments were performed
with the receptor pair that gave the highest experimental BRET2, which was GHS-
R1a-Rluc/GHSR-1a-GFP2. HEK293 cells were transfected with a 1:1 donor
construct to receptor construct DNA ratio in the range of 50 ng each DNA to 1 µg
each DNA corresponding to a range of receptor densities (Figure 4.7). Interestingly,
it was observed that the BRET2 ratio increased as a function of total DNA
concentration up to a maximum at 500 ng of both GHS-R1a-Rluc and GHS-R1a-
GFP2. This maximum BRET2 ratio was statistically significantly different to when
only 50 ng of each construct was transfected (p<0.05). While no further increase was
observed when 1 µg of each DNA construct was transfected, this may represent a
level of total membrane saturation. This increase in BRET2 ratio as a function of
surface density does not fit the prediction for a specific receptor-receptor interaction
(where the BRET2 ratio would stay constant). This suggests that the BRET2 observed
in this study may result from bystander BRET2 due to overexpression of tagged
receptors. However, due to the rapid signal decay of the BRET2 substrate,
coelenterazine 400a, (as discussed in Chapter 4.3.4), performance of BRET2
experiments at lower receptor levels could not be performed, as this would be
beyond the limits of detection.
100
Figure 4.7 GHS-R1a-Rluc/GHS-R1a-GFP2 BRET2 in HEK293 cells at a range of
receptor levels at equal donor/acceptor ratios. Cells were transfected with
increasing amounts (50 ng, 100 ng, 250 ng, 500 ng and 1 µg) of each receptor
construct at a 1:1 ratio. The increase in BRET2 as a function of total receptor density
at a constant donor/acceptor ratio does not fit the predicted result for a specific
interaction. A significant difference in BRET2 ratio was observed between
transfections of 50 ng of each construct and 500 ng of each construct. Data represents
the mean ± SEM of three independent experiments performed in triplicate. Statistical
analysis was performed by one way ANOVA with a Tukey’s post-hoc test for
comparisons of all means. * p<0.05
101
4.3.8 BRET2 competition of GHS-R1a-Rluc/GHS-R1a-GFP2 and GPR39-
Rluc/GHS-R1a-GFP2 with excess native GHS-R1a
Results from the previous section suggest that the positive BRET2 observed in this
study may be an artefact of the experimental method. As a further control of BRET2
interactions, competitive inhibition experiments were performed. A specific
interaction between a donor and acceptor pair should be significantly reduced by the
addition of increasing amounts of an unlabelled receptor (which is not fused to donor
or acceptor BRET2 probes). The results of competition assays for GHS-R1a-
Rluc/GHS-R1a-GFP2 and GPR39-Rluc/GHS-R1a-GFP2 with excess native GHS-R1a
are shown in Figure 4.8. Experiments were performed using equal amounts of
receptor-Rluc and receptor-GFP2 either alone, or with the addition of increasing
concentrations of GHS-R1a-Myc as the native competing receptor. Competition of
GHS-R1a-Rluc/GHS-R1a-GFP2 (Figure 4.8A) or GPR39-Rluc/GHS-R1a-GFP2
(Figure 4.8B) with native GHS-R1a showed no significant decrease in BRET2 ratio,
as a function of increasing the native GHS-R1a concentration. The non-significant
reduction observed in BRET2 in some cases where excess native GHS-R1a was
included may represent minor changes observed in tagged receptor concentration on
a crowded cell membrane due to overexpression (as discussed in Chapter 4.3.7).
These data are in agreement with those previously discussed and suggest that in the
context of this BRET2 study and the limitations described in this chapter we must be
cautious in drawing any conclusions about the capacity of GHS-R1a, GHS-R1b and
GPR39 to form receptor dimers.
102
Figure 4.8 BRET2 competition assays in HEK293 cells. Competition with excess
native GHS-R1a was performed on the BRET2 pairs A) GHS-R1a-Rluc/GHS-R1a-
GFP2 and B) GPR39-Rluc/GHS-R1a-GFP2. The first data point in each graph
represents the baseline BRET2 ratio when receptor-Rluc and receptor-GFP2 are
expressed alone. No significant decrease in BRET2 was observed at any
concentration of native GHS-R1a. Data represents the mean ± SEM of three
independent experiments performed in triplicate. Statistical analysis was performed
by one way ANOVA with a Dunnett’s post-hoc test for comparisons to the baseline
BRET2 ratio (when receptor-Rluc and receptor-GFP2 are expressed alone).
103
4.4 DISCUSSION
This chapter describes the use of the ‘improved’ bioluminescence resonance energy
transfer technique, BRET2, to probe interactions between the ghrelin receptor, GHS-
R1a, a truncated isoform, GHS-R1b, and a related zinc receptor, GPR39. Resonance
energy transfer methods provide information about distances between proteins
ranging from 10 to 100 Å (Wu and Brand 1994) and is, therefore, applicable to the
observation of protein-protein interactions. BRET methodology has been applied to
the study of interactions of GPCRs with other proteins, in real time in living cells
(Pfleger and Eidne 2003; Pfleger and Eidne 2005; Harrison and Van der Graaf 2006;
Gandiá et al. 2008). Dimers between GHS-R1a and other GPCRs have been
described using the BRET2 methodology, including GHS-R1a homodimers (Jiang et
al. 2006; Leung et al. 2007), constitutive GHS-R1a and GHS-R1b heterodimers
(Leung et al. 2007), agonist dependent GHS-R1a/dopamine receptor subtype 1
(D1R) heterodimers (Jiang et al. 2006) and GHS-R1a heterodimers with the
prostanoid receptors, the prostaglandin E2 receptor subtype EP3-1 and the
thromboxane A2 (TPα) receptor (Chow et al. 2008). Homo- or heterodimerisation of
GPR39 has not previously been reported. Oligomeric GPCR complexes are of
interest as they represent novel drug candidates and new avenues for the
development of specific therapeutic targets (George et al. 2002; Milligan 2006;
Dalrymple et al. 2008; Panetta and Greenwood 2008) and BRET technology may
provide an important tool for the identification and screening of these targets (Bacart
et al. 2008).
The BRET technique is based on the transfer of energy from a donor molecule to an
acceptor molecule when these molecules are in close proximity, and it is a naturally
occurring phenomenon in some marine animals (Angers et al. 2002). BRET was first
used to observe protein-protein interactions in 1999 to study interactions between
circadian clock proteins (Xu et al. 1999). This system, which has come to be known
as BRET1, took advantage of the transfer of energy from the sea pansy Renilla
reniformis luciferase (Rluc) to the red shifted mutant of Aequorea victoria green
fluorescent protein (EYFP) following the addition of a coelenterazine substrate (Xu
et al. 1999). The BRET2 technology utilises Rluc as the donor protein and a modified
GFP (GFP2) as the acceptor protein (Bertrand et al. 2002). In addition to the
modified GFP, this system also utilises a modified, cell permeable substrate,
104
coelenterazine 400a (also known as DeepBlueC). The addition of this substrate
stimulates the emission of blue light at 395nm from Rluc, which can be absorbed by
GFP2, leading to an emission at 510nm (Bertrand et al. 2002). The main advantage of
this BRET2 system is the increased separation of the donor and acceptor emission
spectra compared to the emission spectra of BRET1 (475nm/515nm). This results in
significantly improved signal to background (Ramsay et al. 2002). Recent studies
compared FRET, BRET1 and BRET2 by observing the effects of thrombin cleavage
on proteins containing the protease-specific cleavage sequence inserted between the
donor and acceptor molecules. These studies found that BRET2 is 50 times more
sensitive that FRET (Dacres et al. 2009) and 2.9 times more sensitive than BRET1
(Dacres et al. 2008) for detecting donor and acceptor interactions. The BRET2
technology has been used to demonstrate the formation of homodimers and
heterodimers between a number of GPCRs other than those involving GHS-R1a as
previously described including; adenosine A1 receptor homodimers and adenosine A1
and P2Y1 receptor heterodimers (Yoshioka et al. 2002), α1A-adrenoceptor splice
variant homo- and heterodimers (Ramsay et al. 2004), β1- and β2-adrenoceptor
homo- and heterodimers (Lavoie et al. 2002; Mercier et al. 2002), β2- and β3-
adrenoceptor heterodimers (Breit et al. 2004), angiotensin II type 1 receptor
homodimers (Hansen et al. 2004), calcium-sensing receptor homodimers (Jensen et
al. 2002), CXCR1 and CXCR2 homo- and heterodimers (Wilson et al. 2005),
CXCR4 homodimers (Babcock et al. 2003), dopamine receptor (D1 and D3)
heterodimers (Fiorentini et al. 2008), adenosine A2A and dopamine D2 receptor
heterodimers (Kamiya et al. 2003), GPR54 and gonadotropin releasing hormone
receptor heterodimers (Quaynor et al. 2007), protease-activated receptor (PAR1 and
PAR3) homo- and heterodimers (McLaughlin et al. 2007), δ-opioid receptor
homodimers (Ramsay et al. 2002), μ-opioid receptor and NK1 (substance P receptor)
heterodimers (Pfeiffer et al. 2003), neuropeptide Y Y4 receptor homodimers
(Berglund et al. 2003), relaxin family peptide receptor 2 (RXFP2) homodimers and
RXFP2 and RXFP1 heterodimers (Svendsen et al. 2008), serotonin 5-HT2A receptor
and metabotropic glutamate receptor (mGluR) heterodimers (González-Maeso et al.
2008) and oligomerisation of the yeast α-factor receptor (Gehret et al. 2006). At the
commencement of this study, the BRET2 methodology represented the best technique
available for probing GPCR interactions and was therefore chosen for this study into
GHS-R1a, GHS-R1b and GPR39 dimerisation.
105
Despite the increase in specificity afforded by the BRET2 methodology, this study
has highlighted a major disadvantage of this method which has significant practical
implications. To achieve the greater spectral separation of the donor and acceptor
emission, the BRET2 technique uses a different Rluc substrate to BRET1,
coelenterazine 400a, which leads to a lower emission wavelength. Studies by
Hamdan et al. (2005) illustrated that the intensity of the luminescence emitted by
coelenterazine 400a was ~300 fold lower than that for the BRET1 substrate.
Additionally, they reported that the coelenterazine 400a substrate signal decayed
significantly faster, with a half life of approximately 1 min (Hamdan et al. 2005). It
has been suggested that the possible detection duration using the BRET2 method is
only a matter of a few seconds (Pfleger et al. 2006b). This rapid signal decay
following addition of the BRET2 substrate was also observed in our study and
resulted in the introduction of significant experimental error, as after a very short
period of time emission signals approached baseline levels. The low quantum yield
and rapid signal decay, therefore, necessitates the use of highly sensitive
instrumentation and has significant disadvantages for the application of the BRET2
methodology to high throughput screening (Hamdan et al. 2005). Additionally, the
low sensitivity of the assay due to the properties of coelenterazine 400a means that
high levels of protein expression are required so that a BRET2 signal can be detected
(Kocan et al. 2008). This requirement has significant implications for the
physiological relevance of BRET2 results, and important experimental controls are
required to confirm that the interactions are specific and not an artefact of very high
receptor expression levels. With the increasing evidence of the weaknesses of the
BRET2 methodology, it is pertinent to point out that the company that originally
supplied and promoted the BRET2 vectors and substrate (Perkin Elmer), removed it
from the market at the end of 2007 after the majority of experiments in this study had
been completed (personal communication, Perkin Elmer representatives).
The requirement for a range of control experiments to be performed to validate
BRET findings has recently been the subject of a great deal of discussion. James et
al. (2006) proposed a ‘rigorous experimental framework for detecting protein
oligomerisation using bioluminescence resonance energy transfer’ (James et al.
2006). The authors suggested that potentially a number of conventional BRET
106
analyses had been performed at maximal expression levels and that some of the
reported interactions of class A GPCRs may have resulted from random interactions
of artificially overexpressed receptors (James et al. 2006). They proposed two
experimental controls to differentiate between specific dimers and random
interactions. These controls were described as ‘type 1’ controls where variations are
made to the acceptor/donor ratio and ‘type 2’ controls where variations are made to
receptor cell surface density (James et al. 2006). Using examples of GPCRs which
had been reported to interact previously, the authors demonstrated that the BRET
observed may be the result of random interactions and not specific receptor
interactions (James et al. 2006). These results were questioned (Bouvier et al. 2007;
Salahpour and Masri 2007), however, as there are examples where similar controls
had been performed and that BRET results had been confirmed with a variety of
other experimental approaches including co-immunoprecipitation, FRET, atomic
force microscopy, covalent cross-linking, gel filtration, neutron scattering
experiments, functional complementation, and other functional cell biology studies
(Bouvier et al. 2007). Despite this, it is clear that comprehensive BRET control
experiments are required to confirm a specific protein-protein interaction. More
recently a report from a RET workshop illustrated that there are three key control
experiments to differentiate specific protein interactions from ‘bystander BRET’,
which is non-specific BRET resulting from the overexpression of non-interacting
proteins that are forced into close proximity due to increased concentrations (Marullo
and Bouvier 2007). These key controls are titration or saturation experiments (type
1), surface density experiments (type 2) and competitive inhibition experiments
(Marullo and Bouvier 2007). These three experimental controls were performed in
the current study and each is discussed in detail below.
Saturation experiments rely on the principle that if the donor concentration is
maintained at a constant level and the concentration of acceptor is increased, the
BRET ratio will increase with increasing acceptor/donor ratio up to a point where all
donor molecules will be involved in dimers and then the BRET value will remain
constant. In non-specific interactions, changing the acceptor/donor ratio would result
in a linear increase in BRET value, however, this too may reach a plateau at
sufficiently high values (Marullo and Bouvier 2007). Interestingly, modelling studies
of non-specific bystander BRET saturation curves for receptor-Rluc levels of 30, 300
107
and 3000 receptors/µm2 showed that for the lower levels (30 and 300 receptors/µm2)
the relationship between BRET values and receptor levels is linear. At the highest
concentration, (3000 receptors/µm2), however, the saturation curve approached a
hyperbolic curve which was similar to the curve predicted for a specific dimeric
interaction (Mercier et al. 2002). This finding is interesting, because while the
saturation curves for GHS-R1a-Rluc/GHS-R1a-GFP2, GPR39-Rluc/GHS-R1a-GFP2
and GPR39-Rluc/PAR2-GFP2 seem to indicate a specific interaction, our results
could be indicative of bystander BRET at excessively high levels of receptor
expression.
Surface density experiments can be performed by increasing the concentration of
both the acceptor and donor concentration while maintaining a constant
acceptor/donor ratio. If the interaction is specific the BRET signal remains the same
over a range of surface densities, however, for non-specific interactions, the BRET
signal increases as a result of more random interactions at the increasingly crowded
cell surface (Kenworthy and Edidin 1998). A previous comprehensive BRET study
has shown that for β2-adrenergic receptor homodimers the BRET signal was constant
for total receptor levels from ~1.4 to ~26 pmol/mg when the donor/acceptor ratios
remained constant, however, at receptor levels of 47 pmol/mg and above there was
an increase in BRET level suggesting that BRET was occurring as a result of
excessively high receptor expression (Mercier et al. 2002). Interestingly, 47 pmol/mg
corresponded to a surface density which allowed an average distance of less than 100
Å between receptors, which is the BRET permissive distance (Mercier et al. 2002).
In this study of GHS-R1a-Rluc/GHS-R1a-GFP2, surface density experiments
illustrated that there was an increase in BRET2 as a function of total receptor density.
A significant difference in BRET2 ratio was observed between transfections of 50 ng
of each construct and 500 ng of each construct. This does not fit the predicted result
for a specific interaction and may indicate the occurrence of bystander BRET due to
high expression levels. However, due to the experimental limitations of the BRET2
methodology, it was not possible to analyse BRET at lower surface densities.
Competitive inhibition experiments were performed as an experimental control. If a
specific interaction occurs between donor and acceptor tagged GPCRs, an increase in
non-tagged native receptor would displace tagged receptors, decreasing the BRET
108
signal (Marullo and Bouvier 2007). A non-tagged, non-interacting partner could also
be used as a control to demonstrate specificity, which should not interfere with a
specific protein-protein interaction and, therefore, would not result in a decrease in
BRET signal (Marullo and Bouvier 2007). Competition assays performed in this
study with the addition of excess native GHS-R1a to the BRET2 pairs, GHS-R1a-
Rluc/GHS-R1a-GFP2 and GPR39-Rluc/GHS-R1a-GFP2, did not result in a
significant decrease in BRET2 ratio indicating that the BRET levels observed may
not result from a specific receptor-receptor interaction.
The outcomes of these BRET2 control experiments suggest that we are unable, using
this methodology, to conclude that GHS-R1a, GHS-R1b and GPR39 interact. It is
interesting that the BRET2 ratios observed for some BRET2 pairs in this study were
significantly different to the wild type control, whereas other receptor-Rluc/receptor-
GFP2 pairs did not give a significant BRET2 signal. This is surprising as they would
be predicted to exist in a similarly crowded cell membrane and, therefore, display
similar levels of bystander BRET. While BRET signal is influenced by relative
distance between tagged receptors, the relative orientation of the donor and acceptor
molecules due to the dipole-dipole nature of BRET is another important factor
influencing BRET (Clegg et al. 1993; Bacart et al. 2008). Therefore, while these
receptor pairings may be within the BRET permissive distance, the orientation of
donor and acceptor may not be optimal for energy transfer. As there is a requirement
for the correct orientation of donor and acceptor molecules, the absence of a RET
signal may not necessarily indicate that the proteins of interest do not interact (Bacart
et al. 2008).
The conclusions reached from our BRET2 studies do not support previous BRET2
reports demonstrating GHS-R1a interactions. GHS-R1a homodimersation (Jiang et
al. 2006; Leung et al. 2007) and GHS-R1a and GHS-R1b heterodimersation (Leung
et al. 2007) was not observed. Interestingly, the BRET maximum value for the GHS-
R1a homodimers reported in this study, (0.176 ± 0.015), is similar in magnitude to
those values previously reported, 0.237 (Leung et al. 2007) and ~0.11 (Jiang et al.
2006), for GHS-R1a homodimerisation. The minor difference in BRET values
between studies may represent different relative orientations of donor and acceptor as
different linker sequences were introduced between the receptor and BRET molecule
109
in the BRET vector constructs. Both previous reports of GHS-R1a homodimerisation
present saturation control experiments (Jiang et al. 2006; Leung et al. 2007). One
reports surface density experiments, stating that the BRET2 signal was independent
of transfected DNA concentration, however, this data was not shown (Leung et al.
2007). The reported BRET maximum values for the GHS-R1a/GHS-R1b
heterodimers are 0.039 for the GHS-R1a-Rluc/GHS-R1b-GPF2 pair and 0.035 for the
GHS-R1b-Rluc/GHS-R1a-GFP2 pair (Leung et al. 2007) which are low and may be
unreliable due to the limitations of the BRET2 methodology. It is noted, however,
that the study by Leung et al. (2007) presented co-immunoprecipitation data of the
GHS-R1a homodimers and the GHS-R1a/GHS-R1b heterodimers which supported
their BRET findings and also present functional data to indicate that GHS-R1b acts
as a dominant-negative mutant of GHS-R1a.
The identification of a potential interaction between GPR39-Rluc and PAR2-GFP2
was an unexpected observation, particularly given that PAR2 was selected as an
unrelated GPCR for use as a negative control. Interestingly, in a BRET2 study of
CXCR4 dimerisation with a related HIV-1 coreceptor, CCR5, a distantly related
GPCR, C5a, was selected as a negative control. This resulted in an increase over the
baseline in a standard BRET assay for potential CXCR4/C5a heterodimers, however,
the BRET level was considerably lower than that of the CXCR4 homodimer which
had a corrected BRET2 of ~0.37 (Babcock et al. 2003). The authors of this study
suggested that the low BRET2 signal observed for the CXCR4/C5a combination
(corrected BRET2 value <~0.12) may result from the membrane expression of any
tagged GPCR causing random associations in the cell membrane (Babcock et al.
2003). Similar experiments performed in the present study did not result in any
BRET2 signals above this value (0.12) and, therefore, this further supports our
interpretation that, using these experimental constructs in this BRET2 system, we
cannot conclude that GHS-R1a, GHS-R1b, GPR39 and PAR2 interact.
The results presented in this chapter support the need for the critical analysis of
BRET2 data and the application of a range of methods before conclusions of
receptor-receptor interactions can be made. Many BRET2 studies have reported
additional data using a range of methods to support receptor dimerisation and,
indeed, one study has used five different methods; co-immunoprecipitation, single
110
cell imaging of FRET, cell surface time-resolved FRET, endoplasmic reticulum
trapping and BRET2, to show receptor dimerisation (Wilson et al. 2005). In light of
the inconclusive outcomes of the co-immunoprecipitation studies presented in
Chapter 3 and the BRET2 studies presented in this chapter, two additional fluorescent
resonance energy transfer (FRET) based techniques were used to investigate
interactions between GHS-R1a, GHS-R1b and GPR39 and are described in the
following chapter.
111
CHAPTER 5
FLUORESCENCE RESONANCE ENERGY TRANSFER
(FRET) STUDIES OF INTERACTIONS BETWEEN THE
GHRELIN RECEPTOR ISOFORMS
(GHS-R1a AND GHS-R1b) AND GPR39
112
5.1 INTRODUCTION
While interactions between GHS-R1a, GHS-R1b and GPR39 were demonstrated
using co-immunoprecipitation, we were unable to confirm these findings using the
‘improved’ bioluminescence resonance energy transfer technique, BRET2. We
therefore chose to investigate further the potential of GHS-R1a, GHS-R1b and
GPR39 to dimerise using fluorescence resonance energy transfer (FRET). FRET
results from the transfer of energy from a donor fluorophore (a fluorescent molecule
for FRET), to an acceptor fluorophore when they are in close proximity and was first
described by Förster (1948). The use of FRET to analyse protein-protein interactions
has become increasingly popular in recent years due to the development of spectral
variants of the green fluorescent protein (GFP) for protein tagging (Vogel et al.
2006; Piston and Kremers 2007) and it provides a valuable tool to monitor GPCR
dimerisation (Pfleger and Eidne 2005; Harrison and Van der Graaf 2006; Gandiá et
al. 2008). FRET analysis of interactions between donor and acceptor tagged GHS-
R1a, GHS-R1b and GPR39 has not been previously reported.
A number of methods exist to analyse FRET and each of these methods have
advantages and disadvantages (Piston and Kremers 2007). In this study, we have
measured FRET by acceptor photobleaching and sensitised emission FRET, which is
the measurement of the acceptor fluorescence after specific excitation of the donor,
by flow cytometry. Acceptor photobleaching FRET (abFRET; also referred to as
donor fluorescence recovery after acceptor photobleaching (DFRAP) or donor
dequenching), indirectly measures specific FRET by observing the dequenching of
the energy donor after specific photobleaching of the acceptor, so that it is no longer
available to receive FRET (Bastiaens et al. 1996). The advantage of abFRET is that
it is quantitative and relatively simple to perform (Piston and Kremers 2007) and can
be used to analyse FRET in specific sub-cellular localisations (Herrick-Davis et al.
2006). The measurement of FRET by analysing sensitised emission by flow
cytometry (fcFRET) has the significant advantage of allowing the analysis of FRET
in a large number of cells on a cell-by-cell basis and on cells expressing a range of
donor and acceptor levels (Chan et al. 2001).
In this study we have used the cyan fluorescent protein (CFP)/yellow fluorescent
protein (YFP) donor/acceptor pair in acceptor photobleaching FRET and flow
113
cytometry FRET experiments. The CFP and YFP pair was first used as a calmodulin-
based calcium sensor (Miyawaki et al. 1997). It has long been recognised as the
preferred donor and acceptor pair for general applications and is the most widely
used (Tsien 1998; Piston and Kremers 2007). The CFP/YFP FRET pair has been
used to illustrate dimerisation between a large number of GPCRs (Overton and
Blumer 2000; Wurch et al. 2001; Overton and Blumer 2002; Dinger et al. 2003;
Floyd et al. 2003; Gregan et al. 2004; Toth et al. 2004; Ellis et al. 2006; Herrick-
Davis et al. 2006; Wang et al. 2006; Lopez-Gimenez et al. 2007; Lukasiewicz et al.
2007; Mikhailova et al. 2007; González-Maeso et al. 2008; Isik et al. 2008; Pello et
al. 2008; Vilardaga et al. 2008; Woehler et al. 2008; Canals et al. 2009; Harding et
al. 2009; Steinmeyer and Harms 2009) and was chosen for this study due to their
efficacy for probing GPCR dimerisation. The results obtained of abFRET and
fcFRET assays using CFP and YFP tagged GHS-R1a, GHS-R1b and GPR39 are
described in this chapter.
114
5.2 MATERIALS AND METHODS
General materials and methods are outlined in detail in Chapter 2. Experimental
procedures which are specific to this chapter are described below.
5.2.1 Cell culture
Cells were maintained in culture medium, as described in Chapter 2.4.1. The
HEK293 human embryonic kidney cell line was used in order to optimise
recombinant protein expression methodology, as it has a high transfection efficiency.
5.2.2 FRET vector construct design and cloning
CFPzeo and YFPzeo vector constructs were obtained from A/Prof. Fraser Ross,
(School of Life Sciences, Queensland University of Technology). These vectors
contained full-length CFP and YFP sequence with a mutated stop codon cloned into
the pcDNA3.1/Zeo(+) vector (Invitrogen) at the Nhe I and Hind III restriction
enzyme sites within the multiple cloning sequence. CFP-receptor and YFP-receptor
constructs were prepared by subcloning the receptor sequence, containing its native
stop codon, from Rluc-C BRET2 constructs (that have been previously described in
Chapter 4.2.2-3). CFPzeo and YFPzeo vectors (4 μg) and Rluc-C constructs
containing the receptor sequence (4 μg) of interest were doubly digested using Hind
III and Bam HI restriction enzymes, as described in Chapter 2.5.9. Digested
fragments were ligated (as described in Chapter 2.5.9) into the CFPzeo and YFPzeo
vector backbone. This cloning strategy results in a 7 amino acid linker sequence
between the mutated stop codon of the fluorescent protein and the ATG start codon
of the receptor sequence. Cells transformed with CFP and YFP constructs were
grown on LB Agar plates containing 25 μg/mL Zeocin (Invitrogen) and colonies
were screened for insert of interest by Nhe I/Hind III double digest. A positive
control CFP-linker-YFP construct, which contains the full-length sequence of both
CFP and YFP resulting in a FRET positive CFP-YFP fusion protein, was also
obtained from A/Prof. Fraser Ross. As a GPCR negative control, a construct
containing full length receptor sequence of an unrelated GPCR, the cannabinoid
receptor type 1 (CB1) that is cloned in frame into the YFPzeo construct (YFP-CB1)
was also obtained from A/Prof. Fraser Ross for use in FRET experiments.
115
5.2.3 Cell transfections for Acceptor Photobleaching Fluorescent Resonance
Energy Transfer (abFRET)
HEK293 cells were seeded on sterile coverslips in 24 well tissue culture plates. Cells
were transfected at 40-50% confluence with different combinations of CFP and YFP
tagged receptors and also with vectors coding for wild type (wt)CFP, wtYFP and
CFP-linker-YFP as experimental controls. Transfections were performed (as
described in Chapter 2.4.2), using 600 ng CFP vector and 200 ng YFP vector or 100
ng CFP-linker-YFP vector and 1 µL Lipofectamine 2000 per well.
5.2.4 Slide Preparation for abFRET
Twenty-four hr post transfection, cells were washed in PBS and then fixed in 4%
paraformaldehyde at 4°C for 30 min. The cells were then washed three times in PBS
and mounted in ProLong Gold antifade reagent (Invitrogen).
5.2.5 abFRET Confocal Microscopy
Images were obtained and acceptor photobleaching FRET was performed on a SP5
Confocal microscope (Leica, North Ryde, Australia) using the Acceptor
Photobleaching Wizard software. The donor CFP was excited at 458 nm and
emission was detected from 465-505 nm. Acceptor YFP was excited at 514 nm and
emission read between 520 nm and 580 nm. FRET was detected by acceptor
photobleaching, where the region of interest, representing half of the cytoplasmic
area, was bleached using the 514 nm laser, at maximum intensity, to <20% of pre-
bleached acceptor fluorescence. Post-bleach images and fluorescent data were
obtained immediately following bleach. FRET efficiency is calculated on a pixel-by-
pixel basis on changes in donor efficiency pre- and post-bleach using the equation
FRETeff = (Dpost - Dpre)/Dpost, where Dpre represents the donor fluorescence prior to
acceptor photobleaching and Dpost represents the donor fluorescence after acceptor
photobleaching.
5.2.6 Cell Transfections for Flow Cytometric Fluorescent Resonance Energy
Transfer (fcFRET)
HEK293 cells in T25 tissue culture flasks were transfected using methods described
in Chapter 2.4.2. Transfections were performed using either 2 µg receptor tagged
CFP or YFP vectors, 500 ng untagged CFP and YFP vectors or 1 µg CFP-linker-YFP
116
positive control alone, or in combination, together with 10 µL Lipofectamine 2000.
After 24 hr cells were washed and detached in 0.5 mM EDTA/PBS and resuspended
in 2% New Zealand Cosmic Calf Serum/PBS for analysis by flow cytometry.
5.2.7 Flow Cytometry for fcFRET
The fcFRET method involves taking two experimental readings of a population of
cells using different excitation methods and measuring the CFP and YFP
fluorescence. The first uses simultaneous dual excitation of CFP and YFP and is used
to determine the percentage of cells within a population that are expressing CFP,
YFP or both CFP and YFP. These are defined as ‘dual excitation’ experiments. The
second method uses only the lower wavelength of excitation that aims to specifically
excite the CFP proteins in a sample. Any YFP fluorescence should, therefore, be as a
result of FRET, however, as a result of the broad spectral overlap of CFP and YFP,
under ‘specific’ excitation of CFP, not all light in the FRET channel results from
sensitized emission of YFP and, therefore, analysis of controls is required (Dye
2005). These are defined as the ‘FRET’ experiments. Flow Cytometry was
performed on the Cell Lab Quanta SC Flow Cytometer (Beckman Coulter,
Gladesville, Australia). Briefly, 25,000 cells were analysed for CFP emission
(fluorescent light sensor 1 (FL1), 465 nm) and YFP emission (fluorescent light
sensor 2 (FL2), 575 nm) by dual excitation, using the mercury arc lamp fitted with a
425 nm Bandpass excitation filter (Chroma Technology, Rockingham, VT, US) and
a 488 nm laser. FRET was performed by measuring FL1 (CFP) and FL2 (FRET)
emission, following specific CFP excitation using the Mercury Arc Lamp with a 425
nm Bandpass excitation filter. FL1/FL2 scatter plots were analysed to determine dual
CFP/YFP positive and FRET positive cell populations using CXP software for flow
cytometry (Beckman Coulter).
5.2.8 Assessment of the effect of ligand treatment on receptor conformation,
assayed by FRET
Ligand treatments often result in a conformational change in GPCR structure and this
change can alter the relative distances between CFP and YFP when these
fluorophores are tagged to a receptor and thus, produce a change in FRET efficiency
(Dalrymple et al. 2008). To determine if receptor ligand treatments resulted in a
conformational change that could be experimentally determined by FRET, ligand
117
treatments were performed on overexpressing cells prior to both abFRET and
fcFRET. Where cells were to be used in abFRET, wells containing transfected cells
on coverslips were treated with either DMEM (vehicle control), 100 nM Ghrelin, 100
µM Zn2+ or 100 nM Ghrelin and 100 µM Zn2+ for 15 minutes prior to fixation in 4%
paraformaldehyde and abFRET was performed as described in Chapter 5.2.5. Where
cells were to be assayed by fcFRET cells were prepared as described above in
Chapter 5.2.6, however, immediately prior to flow cytometry transfected cells were
incubated with either 2% New Zealand Cosmic Calf Serum/PBS (vehicle control) or
10 nM Ghrelin, 10 µM Zn2+, 10 nM obestatin (Auspep, Parkville, Australia) or 10
nM Ghrelin and 10 µM Zn2+ for 15 minutes prior to measurement on the Cell Lab
Quanta SC Flow Cytometer.
5.2.9 Statistical analysis
Quantitative FRET efficiency data determined by abFRET was compared using a one
way ANOVA followed by a post-hoc Tukey’s test. Statistical data was analysed
using the inerSTAT-a v1.3 software. A p-value <0.05 was considered statistically
significant.
118
5.3 RESULTS
5.3.1 Cloning of GHS-R1a, GHS-R1b and GPR39 FRET constructs
CFP and YFP tagged receptor constructs were successfully created by direct
subcloning of full length GHS-R1a, GHS-R1b and GPR39 sequence containing its
native stop codon from Rluc-C BRET2 constructs using Hind III and Bam HI
restriction enzymes as described in Chapter 5.2.2. Receptor sequences were ligated
into similarly digested CFPzeo and YFPzeo constructs to create vector constructs
containing a 7 amino acid linker sequence between the mutated stop codon of the
fluorescent protein and the ATG start codon of the receptor sequence.
5.3.2 abFRET method to show resonance energy transfer from a CFP donor to
an YFP acceptor fluorophore
Initial optimisation of the abFRET methodology utilised the FRET positive control,
CFP-linker-YFP, that when expressed produces a fusion protein of donor and
acceptor fluorophores. A typical abFRET result is shown in Figure 5.1. The raw
images (Figure 5.1A) show the expected result during abFRET experiments. The
pre-bleach images illustrate the expected localisation of the CFP-linker-YFP protein,
which is soluble and exists ubiquitously throughout the cell including the nuclear
compartment. In receptor tagged experiments, which will be discussed in detail later
in this chapter, we observed specific cytoplasmic localisation of the CFP and YFP
proteins. It was decided, therefore, to select a region that represented half of the
cytoplasmic space for acceptor photobleaching. The post-bleach images (Figure
5.1A) show a typical example of cellular fluorescence following photobleaching.
Typically, the YFP fluorescence is greatly reduced in the photobleached region of
interest, however, any resultant increase in CFP fluorescence was not always obvious
when examining the raw images. The FRET efficiency image is shown in Figure
5.1B. FRET efficiency is calculated on a pixel-by-pixel basis and based on changes
in donor efficiency pre- and post-bleach, using the equation FRETeff = (Dpost -
Dpre)/Dpost. The pre- and post-bleach fluorescence of CFP and YFP are averaged over
the region of interest to give a single FRET efficiency. These quantitative FRET
efficiency values are used for comparing different CFP and YFP combinations. The
graph in Figure 5.1B demonstrates the expected outcome of an abFRET experiment
when FRET is occurring. A decrease in YFP fluorescence as a result of specific
acceptor photobleaching will correspond with an increase in CFP fluorescence, as it
119
is now dequenched by the absence of the acceptor fluorophore.
Figure 5.1 Representative example of acceptor photobleaching FRET using the
positive control, CFP-linker-YFP construct, which produces a fusion protein of
acceptor and donor proteins with significant FRET, in HEK293 cells. A) The
raw pre-bleach images and post-bleach images are shown. The acceptor, YFP, is
bleached in the region of interest (dashed white line) indicated by the reduction in
fluorescence. B) The FRET efficiency image is displayed and an increased FRET is
observed in the photobleached region of interest. The donor and acceptor
fluorescence in the region of interest is quantified both pre- and post-bleach and the
data from this example is displayed. The graph indicates the decrease in acceptor
fluorescence following bleaching and the corresponding increase in donor, CFP,
fluorescence indicative of FRET. White scale bar represents 10 µm.
120
5.3.3 CFP and YFP tagged GHS-R1a, GHS-R1b and GPR39 are co-localised in
the cytoplasm.
Figure 5.2 shows representative abFRET experiments involving GHS-R1a, GHS-
R1b and GPR39. In this example CFP-GHS-R1a co-localises with YFP-GHS-R1a,
YFP-GHS-R1b and YFP-GPR39. This localisation is specific to the receptors as
similar transfections of CFP-GHS-R1a with wtYFP illustrate that the cytoplasmic
localisation of each receptor is maintained, while the wtYFP exists throughout the
cell. Notably, expression of these GPCRs did not produce a specific membrane
population of receptors. Similar results were observed for all combinations of CFP
and YFP tagged receptors when co-expressed. In all cases some degree of FRET was
observed in the photobleached region of interest, including experiments where the
wild type controls were transfected.
121
Figure 5.2 Representative examples of receptor and control wild type cellular
localisation in HEK293 cells. CFP and YFP tagged receptor constructs showed
specific cytoplasmic localisation. A similar pattern of expression was observed for
GHS-R1a, GHS-R1b and GPR39. The control, soluble wild type YFP, showed
ubiquitous expression across the cell. In all cases an increased FRET efficiency was
observed in the photobleached region of interest.
122
5.3.4 CFP and YFP tagged GHS-R1a, GHS-R1b and GPR39 when co-expressed
do not produce significant FRET
Acceptor photobleaching FRET was performed in HEK293 cells by co-transfection
of CFP and YFP tagged receptors with the appropriate controls. The results of YFP-
GHS-R1a (Figure 5.3), YFP-GHS-R1b (Figure 5.4) and YFP-GPR39 (Figure 5.5)
co-transfections with the wtCFP control, CFP-GHS-R1a, CFP-GHS-R1b and CFP-
GPR39 are shown. In each figure, the wtCFP/wtYFP control is indicated to show the
potential level of background FRET that may result from random interactions of the
donor and acceptor fluorophores. Also shown is the positive control, CFP-linker-
YFP, which illustrates specific FRET. Notably, in all cases some degree of FRET
was observed, indicating an interaction between the donor, CFP and the acceptor,
YFP. No significant increase in FRET was observed, however, for any YFP tagged
receptor when it was co-expressed with a CFP tagged receptor when compared with
the wtCFP control. wtCFP may not necessarily represent an optimal negative control
as this protein has a different cellular distribution (as indicated in Figure 5.2),
however some degree of co-localisation does exist with the tagged receptors.
Therefore, an additional negative control was performed using a construct containing
a GPCR which is unrelated to GHS-R1a, GHS-R1b and GPR39, CB1, tagged to
YFP. YFP-CB1 was similarly co-expressed with wtCFP and CFP tagged receptors.
The FRET observed when CFP-GHS-R1a, CFP-GHS-R1b and CFP-GPR39 were co-
transfected with YFP-CB1 (Figure 5.6) was at a similar level to when these CFP
constructs were co-expressed with the related YFP tagged receptors, YFP-GHS-R1a
(Figure 5.3), YFP-GHS-R1b (Figure 5.4) and YFP-GPR39 (Figure 5.5). The positive
control, CFP-linker-YFP, resulted in a significantly increased FRET efficiency when
compared with all other CFP/YFP combinations tested (p<0.01 in all cases except
YFP-GPR39/CFP-GHS-R1b (p<0.05)), including when wtCFP and wtYFP are co-
expressed separately. The FRET observed when CFP and YFP tagged GHS-R1a,
GHS-R1b and GPR39 were co-transfected is unlikely to result from specific
receptor-receptor interactions, as similar FRET efficiencies were observed with both
wild type fluorophore and the fluorophore tagged unrelated GPCR controls.
123
Figure 5.3 Quantitative abFRET data for HEK293 cells expressing YFP-GHS-
R1a. No significant increase in FRET was observed when YFP-GHS-R1a was co-
expressed with receptor tagged CFP constructs compared with the wtCFP control.
The positive control, CFP-linker-YFP, resulted in a significantly increased FRET
efficiency when compared with all other CFP/YFP combinations tested, including
when wtCFP and wtYFP are co-expressed on separate vectors. Data represents the
mean ± SEM of six independent experiments. Statistical analysis was performed by
one way ANOVA with a Tukey’s post-hoc test for comparisons of all means. **
p<0.01
124
Figure 5.4 Quantitative abFRET data for HEK293 cells expressing YFP-GHS-
R1b. No significant increase in FRET was observed when YFP-GHS-R1b was co-
expressed with receptor tagged CFP constructs compared with the wtCFP control.
The positive control, CFP-linker-YFP, resulted in a significantly increased FRET
efficiency when compared with all other CFP/YFP combinations tested, including
when wtCFP and wtYFP are co-expressed on separate vectors. Data represents the
mean ± SEM of six independent experiments. Statistical analysis was performed by
one way ANOVA with a Tukey’s post-hoc test for comparisons of all means. **
p<0.01
125
Figure 5.5 Quantitative abFRET data for HEK293 cells expressing YFP-
GPR39. No significant increase in FRET was observed when YFP-GPR39 was co-
expressed with receptor tagged CFP constructs compared with the wtCFP control.
The positive control, CFP-linker-YFP, resulted in a significantly increased FRET
efficiency when compared with all other CFP/YFP combinations tested, including
when wtCFP and wtYFP are co-expressed on separate vectors. Data represents the
mean ± SEM of six independent experiments. Statistical analysis was performed by
one way ANOVA with a Tukey’s post-hoc test for comparisons of all means. *
p<0.05
126
Figure 5.6 Quantitative abFRET data for the negative control YFP-CB1
construct in HEK293 cells. No significant increase in FRET was observed when the
negative control GPCR, YFP-CB1 was co-expressed with receptor tagged CFP
constructs compared with the wtCFP control. The positive control, CFP-linker-YFP,
resulted in a significantly increased FRET efficiency when compared with all other
CFP/YFP combinations tested, including when wtCFP and wtYFP are co-expressed
on separate vectors. Data represents the mean ± SEM of six independent
experiments. Statistical analysis was performed by one way ANOVA with a Tukey’s
post-hoc test for comparisons of all means. ** p<0.01
127
5.3.5 Ghrelin and zinc treatments had no effect on abFRET efficiency in
transfected HEK293 cells
Ligand treatments often result in a conformational change in GPCR structure and this
change can alter the relative distances between CFP and YFP when these
fluorophores are tagged to a receptor and thus, produce a change in FRET efficiency
(Dalrymple et al. 2008). To assess the effect of ligand on potential GHS-R1a and
GPR39 homodimers or GHS-R1a/GPR39 heterodimers, cells expressing CFP-GHS-
R1a/YFP-GHS-R1a, CFP-GPR39/YFP-GPR39 or CFP-GPR39/YFP-GHS-R1a were
pre-treated with a vehicle control, 100 nM ghrelin, 100 μM Zn2+ or 100 nM ghrelin
and 100 μM Zn2+ for 15 minutes prior to abFRET (Figure 5.7). Ghrelin and zinc
treatment had no significant effect on the FRET efficiency when compared with
similarly transfected cells treated with a vehicle control. For the constructs tested in
these abFRET experiments, ligand treated CFP-receptor and YFP-receptor
transfected cells did not indicate ligand-induced dimerisation or a ligand induced
conformational change within a receptor pair.
128
Figure 5.7 Ghrelin and zinc treatments of GHS-R1a and GPR39 expressing cells
resulted in no change in abFRET. One potential method to indicate specificity of
receptor-receptor interactions by resonance energy transfer techniques is to indicate a
change in RET following ligand treatment. The observed RET may increase or
decrease following ligand treatment as a result of a conformational change in the
receptors following treatment, leading to an altered spatial arrangement of donor and
acceptor molecules. To observe if FRET could be induced as a result of ligand
treatment, transfected cells representing GHS-R1a and GPR39 homodimers or GHS-
R1a/GPR39 heterodimers were treated with a vehicle control or 100 nM ghrelin and
100 μM Zn2+ alone or in combination for 15 minutes prior to fixation and abFRET.
No significant change in FRET efficiency was observed as a result of ligand
treatment in any of the cells tested. The positive control, CFP-linker-YFP, results in a
significantly increased FRET efficiency when compared with all ligand treated
CFP/YFP combinations. Data represents the mean ± SEM of six independent
experiments. Statistical analysis was performed by one way ANOVA with a Tukey’s
post-hoc test for comparisons of all means. ** p<0.01
129
5.3.6 Flow cytometric FRET (fcFRET) experimental controls define the region
of FRET positive cells resulting from specific CFP and YFP interactions
The advantage of the fcFRET methodology is that is enables the analysis of a large
number of cells expressing various combinations of CFP and YFP proteins over a
range of expression levels. First, a region in the scatter plots of FRET experiments
had to be defined which represented those cells that resulted in significant YFP
fluorescence after specific excitation of CFP, indicating FRET as a result of specific
CFP/YFP interactions. The fcFRET method involves taking two experimental
readings of a population of cells using different excitation methods and measuring
the CFP and YFP fluorescence. The first uses simultaneous dual excitation of CFP
and YFP and is used to determine the percentage of cells within a population that are
expressing CFP, YFP or both CFP and YFP. These are defined as ‘dual excitation’
experiments. The second method uses only the lower wavelength of excitation that
aims to specifically excite the CFP proteins in a sample. Any YFP fluorescence
should, therefore, be a result of FRET. These are defined as the ‘FRET’ experiments.
During these FRET experiments there is, however, a degree of YFP fluorescence that
results from non-specific excitation of YFP using the lower wavelength light source
and also YFP fluorescence that results from random non-specific interactions
between the donor, CFP, and the acceptor, YFP. We must, therefore, use
experimental controls to define the region on the FRET experiment scatter plots that
represents those cells that have significant YFP fluorescence that results from FRET
from specific CFP and YFP interactions. An example of these controls is illustrated
in Figure 5.8. The dual excitation experiments are shown on the left where the x-axis
shows a log scale of fluorescent light sensor 1 (FL1) or CFP intensity (465 nm) and
the y-axis is a log scale of fluorescent light sensor 2 (FL2) or YFP intensity (575
nm). The FRET data is indicated on the right where the x-axis again represents the
CFP intensity, however in this case the y-axis represents a log scale of FRET
intensity. Scatter plots of untransfected HEK293 cells are used to determine the
baseline levels of fluorescence not resulting from CFP of YFP emission (Figure
5.8A). Cells that have been transfected with wtCFP only show the predicted
fluorescent for CFP positive cells, that is, fluorescence in the FL1 (CFP) channel
(Figure 5.8B). CFP is excited during both dual excitation and FRET methods and
accordingly the scatter plots in both cases appear the same. Cells transfected with
wtYFP only (Figure 5.8C) show significant FL2 (YFP) fluorescence following dual
130
excitation and minimal FL2 fluorescence during FRET measurements which is
accounted for when defining the FRET positive region. Figure 5.8D shows
measurements of cells that have been co-transfected with wtCFP and wtYFP. The
dual excitation plot shows significant FL1 and FL2 fluorescence, as would be
predicted for cells that are expressing both CFP and YFP. These wtCFP only, wtYFP
only and wtCFP/wtYFP controls allow us to define, for dual excitation measurement,
the regions that represent CFP positive cells, YFP positive cells and dual CFP and
YFP positive cells and these regions are indicated on all dual excitation scatter plots.
Using these regions we can gain quantitative data for the percentage of cells within a
population that are expressing CFP, YFP or both. The wtCFP/wtYFP FRET
measurement accounts for two factors that contribute to non-specific YFP
fluorescence during specific CFP excitation. This includes the FL2 fluorescence
contributed by direct excitation of YFP, (as discussed for the wtYFP only control),
and also the FRET contributed by non-specific donor and acceptor interactions, as
wtCFP and wtYFP do not specifically interact. The FRET reading when wtCFP and
wtYFP are co-expressed shows an increased FL2 fluorescence (FRET) when
compared to cells that have been transfected with wtCFP alone (Figure 5.8B). We
can, therefore, define cells displaying FL2 fluorescence above this population as
having FRET that results from specific CFP and YFP interactions. When defining
this region, however, non-specific FRET levels resulting from wtCFP/receptor-YFP
co-transfections must also be considered and this will be discussed further. Having
defined this FRET region it can be observed that when the CFP-linker-YFP, FRET
positive control, is expressed it fits the predicted region for specific FRET (Figure
5.8E). The dual excitation plot indicates a significant population of dual CFP and
YFP positive cells and the FRET plot indicates a significant FRET positive
population (Figure 5.8E). Quantitative data can be generated by calculating the
percentage of dual positive cells that are also FRET positive, and for the positive
control this averaged ~90%.
131
Figure 5.8 Demonstration of the fcFRET method to illustrate resonance energy
transfer from a CFP to YFP fluorophore. For ‘Dual Excitation’ (425 nm and 488
nm excitation) experiments the x-axis represents a log scale of fluorescent light
sensor 1 (FL1, 465 nm) or CFP intensity and the y-axis is a log scale of fluorescent
light sensor 2 (FL2, 575 nm) or YFP intensity. For ‘FRET’ (425 nm excitation)
experiments the x-axis again represents the CFP intensity, however in this case the y-
axis represents a log scale of FRET intensity. A) Untransfected cells represent the
background FL1 and FL2 fluorescence and are used as a baseline reading when
determining the population of CFP and YFP positive cells during dual excitation and
the transfected cells available for FRET measurement following single excitation of
CFP. B) The CFP-only transfected cells indicate the CFP positive population that
exists in the cell sample following dual excitation and provides a baseline for FL2
fluorescence following excitation for FRET measurements at 425 nm alone. C) The
YFP-only transfected cells show the predicted fluorescence in the FL2 channel
following dual excitation. The FRET measurement of YFP-only cells indicate a low
level of FL2 fluorescence, however, this is not as a result of FRET, as no donor is
present. This fluorescence is taken into account when determining the region that is
considered to be FRET positive during FRET measurements. D) When CFP and YFP
constructs are transfected separately and excited at 425 nm and 488 nm, a significant
population of dual CFP and YFP positive cells were observed. The FRET
measurement (excited at 425 nm only) indicated a slight increase in FL2
fluorescence compared to cells expressing CFP alone and reflects both non-specific
donor and acceptor interactions and also the low level of excitation of YFP at the
CFP excitation wavelength (as indicated in C, YFP-only transfected cells). This level
represents the background, non-specific FRET and was used to determine the region
representing FRET positive cells, as indicated in the scatter plots. E) The positive
control, CFP-linker-YFP, shows a dual CFP and YFP positive population following
dual excitation and also a significant FRET positive population, when excited at 425
nm alone, as predicted. This is indicated by an increase in FL2 fluorescence (FRET)
in E when compared with D.
132
133
Controls performed using YFP tagged GHS-R1a, GHS-R1b and GPR39 are
illustrated in Figure 5.9. Cells engineered to express YFP-GHS-R1a only (Figure
5.9A), YFP-GHS-R1b only (Figure 5.9B) and YFP-GPR39 only (Figure 5.9C)
resulted in a significant population of YFP positive cells (as expected) and limited
FRET fluorescence when specifically excited at the CFP excitation wavelength.
When these receptors were co-expressed with wtCFP, wtCFP/YFP-GHS-R1a (Figure
5.9D), wtCFP/YFP-GHS-R1b (Figure 5.9E) and wtCFP/YFP-GPR39 (Figure 5.9F) a
significant population of dual positive cells were observed following dual excitation.
As discussed previously, when expressed with wtCFP some degree of non-specific
donor and acceptor interaction will occur and this was observed for these
wtCFP/YFP-receptor co-transfections. The wtCFP/YFP-GHS-R1b co-transfection
indicated the highest level of non-specific FRET. This was used to define the
minimum level of FL2 fluorescence in FRET measurements that resulted from non-
specific interactions. Therefore, the FRET positive region was defined as those cells
that following single excitation of CFP had significant FL1 (CFP) fluorescence,
indicating the presence of CFP, and had FL2 (FRET) fluorescence above that
observed for the wtCFP/wtYFP and wtCFP/YFP-GHS-R1b controls. This region is
shown on all scatter plots of FRET measurements. As expected, the FRET positive
control, CFP-linker-YFP was identified as positive using these criteria.
134
Figure 5.9 fcFRET controls. When determining FRET resulting from a specific
interaction between two tagged receptors it is important to determine the contribution
to FL2 fluorescence (emission at 575 nm) during FRET experiments that is not as a
result of a specific receptor-receptor interaction. When YFP-tagged receptors are
transfected alone A) YFP-GHS-R1a, B) YFP-GHS-R1b and C) YFP-GPR39, dual
excitation (425/488 nm) results in the predicted scatter, representing YFP positive
cells. No significant excitation of YFP tagged receptors is observed during FRET
excitation (425 nm). Non-specific FRET controls for YFP tagged receptor with
wtCFP, D) wtCFP/YFP-GHS-R1a, E) wtCFP/YFP-GHS-R1b and F) wtCFP/YFP-
GPR39, show the level of FRET which resulted from non-specific donor and
acceptor interactions. The exclusion of this population of cells with non-specific
FRET was used to define the FRET-positive region that would indicate the cell
population displaying FRET resulting from specific receptor-receptor interactions.
135
136
5.3.7 GHS-R1a, GHS-R1b and GPR39 do not show significant FRET when
analysed by fcFRET
To assess the potential of GHS-R1a, GHS-R1b and GPR39 to form dimers with
themselves, or with each other, CFP-tagged receptors were co-transfected with YFP-
tagged receptors in HEK293 cells and analysed by fcFRET. CFP-GHS-R1a (Figure
5.10), CFP-GHS-R1b (Figure 5.11) and CFP-GPR39 (Figure 5.12) were transfected
either alone or co-transfected with the control wtYFP, YFP-GHS-R1a, YFP-GHS-
R1b, YFP-GPR39 or the unrelated GPCR negative control, YFP-CB1. In all cases
where a CFP-receptor was transfected alone (Figures 5.10A, 5.11A and 5.12A), a
significant population of CFP-positive cells were identified following dual
excitation. When CFP-receptors were co-transfected with a YFP construct (Figures
5.10B-F, 5.11B-F and 5.12B-F) a significant population of dual positive emitting
cells were observed following dual excitation. For all FRET measurements for these
CFP and YFP transfected cells, no significant FRET-positive population
(representative of cells expressing CFP and YFP involved in a specific interaction),
were observed. These fcFRET data correlate with those previously discussed in
Chapter 5.3.4 that assessed FRET by acceptor photobleaching confocal microscopy.
No specific interaction between GHS-R1a, GHS-R1b and GPR39 could be observed
using the CFP and YFP receptor constructs prepared for this study.
137
Figure 5.10 fcFRET in HEK293 cells expressing CFP-GHS-R1a. A) Cells
transfected with CFP-GHS-R1a alone illustrate the predicted scatter of CFP-
expressing cells. Co-transfection of CFP-GHS-R1a with YFP constructs: B) wtYFP,
C) YFP-GHS-R1a, D) YFP-GHS-R1b, E) YFP-GPR39 and F) YFP-CB1
demonstrate significant dual CFP and YFP positive populations following dual
excitation. No significant FRET-positive populations were observed for any
combinations tested following specific excitation of CFP-GHS-R1a at 425 nm.
138
Figure 5.11 fcFRET in HEK293 cells expressing CFP-GHS-R1b. A) Cells
transfected with CFP-GHS-R1b alone illustrate the predicted scatter of CFP-
expressing cells. Co-transfection of CFP-GHS-R1b with YFP constructs: B) wtYFP,
C) YFP-GHS-R1a, D) YFP-GHS-R1b, E) YFP-GPR39 and F) YFP-CB1
demonstrate significant dual CFP and YFP positive populations following dual
excitation. No significant FRET-positive populations were observed for any
combinations tested following specific excitation of CFP-GHS-R1b at 425 nm.
139
Figure 5.12 fcFRET in HEK293 cells expressing CFP-GPR39. A) Cells
transfected with CFP-GPR39 alone illustrate the predicted scatter of CFP-expressing
cells. Co-transfection of CFP-GPR39 with YFP constructs: B) wtYFP, C) YFP-GHS-
R1a, D) YFP-GHS-R1b, E) YFP-GPR39 and F) YFP-CB1 demonstrate significant
dual CFP and YFP positive populations following dual excitation. No significant
FRET-positive populations were observed for any combinations tested following
specific excitation of CFP-GPR39 at 425 nm.
140
5.3.8 Ligand treatments had no effect on fcFRET in transfected HEK293 cells
The potential for ligand-induced FRET was assayed by fcFRET. An example of data
obtained when CFP-receptor/YFP-receptor transfected cells were pre-treated for 15
minutes with ligand prior to flow cytometric measurements is shown (Figure 5.13).
In this example CFP-GPR39/YFP-GHS-R1a expressing HEK293 cells were treated
with a vehicle control, 10 nM ghrelin, 10 μM Zn2+, 10 nM obestatin or 10 nM
ghrelin/10 μM Zn2+ prior to dual excitation and FRET measurements with excitation
at 425 nm. The ligand treated cells (Figure 5.13B-E) did not show a significant
change in FL2 (FRET) fluorescence from the vehicle control (Figure 5.13A) and no
FRET positive cells were observed. No change in FRET, was observed in cell co-
expressing CFP-GHS-R1a/YFP-GHS-R1a, CFP-GHS-R1a/YFP-GHS-R1b or CFP-
GHS-R1a/YFP-GPR39 treated with 10 nM ghrelin or 10 μM Zn2+ or cell co-
expressing CFP-GPR39/YFP-GPR39 treated with 10 nM ghrelin, 10 μM Zn2+ or 10
nM obestatin when compared with the vehicle control treatment (data not shown).
These fcFRET data of ligand treated cells correlate with the FRET results observed
for ligand treated transfected cells assayed by abFRET (Chapter 5.3.5).
141
Figure 5.13 Representative fcFRET experiment with ligand treated cells. CFP-
GPR39/YFP-GHS-R1a transfected HEK293 cells were treated with A) Vehicle
control, B) 10 nM ghrelin, C) 10 μM Zn2+, D) 10 nM obestatin or E) 10 nM
ghrelin/10 μM Zn2+ prior to fcFRET measurements. A significant population of dual
CFP-GPR39/YFP-GHS-R1a positive cells existed in all treated samples. No change
in FRET was observed in any ligand treated cells (B-E) when compared with the
vehicle control (A).
142
5.4 DISCUSSION
Using co-immunoprecipitation we demonstrated that GHS-R1a, GHS-R1b and
GPR39 may form receptor heterodimers. Our attempts to demonstrate interactions
between GHS-R1a, GHS-R1b and GPR39 using the improved bioluminescence
resonance energy transfer technique, BRET2, however, resulted in inconclusive data,
because of technical problems associated with the limitations of the methodology. In
this chapter we used two FRET methods, acceptor photobleaching and flow
cytometry, to investigate interactions between these receptors using the classical
FRET pair CFP and YFP. FRET, like BRET, results from the transfer of energy from
a donor fluorophore to an acceptor fluorophore when they are in close proximity. In
the case of FRET the energy donor is a fluorescent molecule. FRET was first
described by Förster (1948) and is sometimes referred to as Förster resonance energy
transfer. The requirement for the close proximity of the donor and acceptor molecule
(~10 Å) means that FRET can be used as a ‘spectroscopic ruler’ (Stryer and
Haugland 1967; Stryer 1978) and is a valuable tool to monitor GPCR dimerisation
(Pfleger and Eidne 2005; Harrison and Van der Graaf 2006; Gandiá et al. 2008).
FRET was used in this study, as abFRET confocal microscopy is able to monitor the
cellular localisation of receptor-receptor interactions and fcFRET allows analysis in a
large number of cells expressing a range of donor and acceptor levels. FRET analysis
of donor and acceptor tagged GHS-R1a, GHS-R1b and GPR39 has not been
previously reported. In this study, using CFP and YFP tagged GHS-R1a, GHS-R1b
and GPR39 we were unable to observe significant FRET, as measured by acceptor
photobleaching (ab) and flow cytometry (fc) FRET.
There are a number of methods for analysing FRET, including acceptor
photobleaching, sensitised emission, fluorescence lifetime imaging microscopy
(FILM), spectral imaging and polarization anisotropy imaging and each of these
methods have advantages and disadvantages (Piston and Kremers 2007). In this
study we have measured FRET by acceptor photobleaching and sensitised emission
FRET, which is the measurement of the acceptor fluorescence after specific
excitation of the donor, by flow cytometry. Acceptor photobleaching FRET was first
described by Bastiaens and colleagues (1996) and indirectly measures specific FRET
by observing the dequenching of the energy donor after specific photobleaching of
the acceptor so that it is no longer available to receive FRET. (Bastiaens et al. 1996).
143
The advantage of this method is that it is quantitative and relatively simple to
perform (Piston and Kremers 2007) and can additionally be used to analyse FRET in
specific sub-cellular localisations. A study of serotonin 5-HT2C receptor
homodimerisation has been performed, for example, where FRET was observed in
discrete regions of the ER, Golgi and plasma membrane, suggesting dimer formation
early during receptor biosynthesis (Herrick-Davis et al. 2006). A disadvantage of the
abFRET methodology is that it is relatively time consuming and also, as each
measurement requires the destructive photobleaching of the acceptor, each cell can
be measured only once (Piston and Kremers 2007). The measurement of CFP-YFP
FRET by analysing sensitised emission by flow cytometry has the significant
advantage of being able to analyse a large number of cells on a cell-by-cell basis
(Chan et al. 2001). Significantly, however, as a result of the broad spectral overlap of
CFP and YFP, under ‘specific’ excitation of CFP, not all light in the FRET channel
results from sensitized emission of YFP and, therefore, analysis of controls is
required (Dye 2005). Such spectral bleed-through was observed in this study
(Chapter 5.3.6) and, therefore, significant consideration of experimental controls is
required to identify those cells that have significant FRET fluorescence that results
from a specific CFP-YFP interaction during fcFRET experiments (Dye 2005).
However, by performing these controls, a rigorous test for interaction is established,
because rather than including all those cells that may display some FRET, a level of
FRET is determined that excludes those cells with fluorescent levels no greater than
the negative controls (Dye 2005).
FRET, to observe protein-protein interactions, has been increasingly used in recent
years due to development of spectral variants of the green fluorescent protein (GFP)
for protein tagging (Vogel et al. 2006; Piston and Kremers 2007). The CFP and YFP
pair was first used as a calmodulin based calcium sensor (Miyawaki et al. 1997) and
early after development CFP and YFP were recognised as the preferred donor and
acceptor pair (Tsien 1998). Today, many different fluorescent proteins are now
available that span the visible spectrum from deep blue to deep red (Day and
Schaufele 2008) and a number of different donor-acceptor pairs have been used to
observe GPCR dimerisation (Pfleger and Eidne 2005). Indeed, the variety of
available fluorescent proteins has provided some examples where multiplexed FRET
has been performed to simultaneously monitor multiple cellular events, such as those
144
using CFP/YFP together with mOrange/mCherry (Piljic and Schultz 2008) and
ECFP/Venus in tandem with TagRFP/mPlum (Grant et al. 2008). Currently, the
CFP/YFP FRET pair is still the most widely used and considered the most effective
for general applications (Piston and Kremers 2007) and was, therefore, used in this
study.
The CFP/YFP FRET pair has been used to illustrate dimerisation between a number
of GPCRs including; adenosine A2A receptor homodimers (Lukasiewicz et al. 2007),
α2A-adrenergic and µ-opioid receptor heterodimers (Vilardaga et al. 2008), α1b-
adrenoceptor oligomers (Lopez-Gimenez et al. 2007; Canals et al. 2009), C5a
receptor homodimers (Floyd et al. 2003), corticotrophin releasing hormone and
vasotocin VT2 receptor heterodimers (Mikhailova et al. 2007), CXCR4 receptor
homodimers (Toth et al. 2004; Wang et al. 2006), CXCR4 and CCR5 receptor
heterodimers (Isik et al. 2008), CXCR4 and δ-opioid receptor heterodimers (Pello et
al. 2008), dopamine D2 receptor homodimers (Wurch et al. 2001), endothelin A and
endothelin B receptor heterodimers (Gregan et al. 2004), neuropeptide Y receptor
homodimers (Dinger et al. 2003), neurotensin receptor 1 homodimers (Harding et al.
2009), orexin-1 and CB1 receptor heterodimers (Ellis et al. 2006), parathyroid
hormone receptor homodimers (Steinmeyer and Harms 2009), serotonin 5-HT1A
receptor homodimers (Lukasiewicz et al. 2007; Woehler et al. 2008), serotonin 5-
HT2A receptor and metabotropic glutamate receptor (mGluR) heterodimers
(González-Maeso et al. 2008), serotonin 5-HT2C receptor homodimers (Herrick-
Davis et al. 2006) and yeast α-factor receptor homodimers (Overton and Blumer
2000; Overton and Blumer 2002). The CFP/YFP FRET pair was chosen for this
study due to its wide efficacy in probing GPCR dimerisation.
Similar to BRET, the use of FRET is not without controversy and false positive
results can be observed due to the use of an overexpression system. A number of
studies have indicated that in cells artificially expressing high levels of receptor,
significant FRET can be observed which is not a result of specific receptor-receptor
interactions. In a study of somatostatin receptors (SSTR), in one cell line expressing
low levels of SSTR5 there was insignificant FRET, suggesting a predominance of
SSTR5 monomers, however, in a second cell line expressing 5-fold higher
concentrations of SSTR5, a significant basal FRET could be observed prior to
145
agonist treatment (Rocheville et al. 2000). The authors suggested that the FRET
observed in those cells expressing a high level of receptor was in fact an artefact of
receptor overexpression (Rocheville et al. 2000). Furthermore, in a study of
neurokinin-1 receptors (NK1R), it was determined that at levels of NK1R expression
which were close to physiological conditions no FRET signal could be detected,
however, FRET could be observed showing a strong dependence on receptor
concentration (Meyer et al. 2006). At supraphysiological receptor concentrations a
significant FRET could be observed, which the authors determined to be due to
random donor and acceptor interactions occurring within membrane microdomains
(Meyer et al. 2006). Studies such as these highlight the importance of a critical
understanding of the experimental method and the importance of performing
experimental controls prior to concluding a specific interaction in cells artificially
overexpressing donor and acceptor tagged GPCRs.
An additional finding presented in this chapter is the cellular localisation of GHS-
R1a, GHS-R1b and GPR39 when tagged to CFP and YFP. We observed co-
localisation of these receptors to the cytoplasm, however, no specific membrane
population could be observed. Interestingly, a number of studies have previously
reported different localisations of GHS-R1b. In HEK293 cells, GFP tagged GHS-
R1b showed a predominant nuclear localisation (Smith et al. 2005; Leung et al.
2007), while in GHS-R1b overexpressing COS-7 cells, visualised using an anti-
GHSR antibody with an Alexa Fluor 488-labeled secondary antibody, GHS-R1b
showed a predominant membrane localisation (Takahashi et al. 2006). The
differences in localisation in GHS-R1b may be attributed to differences in cell type
and methods of visualisation, however, nuclear localisation was not observed for
CFP-GHS-R1b or YFP-GHS-R1b in the current study in any healthy HEK293 cells
displaying fluorescence. Differences in criteria in selection of those cells that best
represent the typical transfected HEK293 population may also account for the
differences observed. In the study by Leung and colleagues (2007), they also
demonstrated in some cases that when GHS-R1b was co-expressed with GHS-R1a,
GHS-R1b lead to the retention of GHS-R1a in the nucleus. This was not observed in
all cells, however, and the authors proposed that there may be a critical ratio of GHS-
R1a to GHS-R1b required before this nuclear retention is observed (Leung et al.
2007). In our study, while we did not specifically view cellular localisation over a
146
range of expression ratios, we observed no changes in GHS-R1a, GHS-R1b and GPR
39 localisation in cells expressing any combinations of these tagged receptors when
compared to those expressing a tagged receptor and wild type fluorophore control.
This chapter presents results of FRET based experiments which probe the ability of
GHS-R1a, GHS-R1b and GPR39 to form receptor dimers. FRET studies of GHS-
R1a, GHS-R1b and GPR39 interactions have not previously been reported. Using
both acceptor photobleaching FRET and FRET sensitised emission measured by
flow cytometry we were unable to show a significant interaction between CFP or
YFP tagged GHS-R1a, GHS-R1b and GPR39. The positive control, CFP-linker-YFP,
used in these experiments displayed significant FRET as measured by abFRET and
fcFRET, highlighting the ability of these experimental techniques to observe energy
transfer from the CFP donor to the YFP acceptor fluorophore when they are in close
proximity. An understanding of the experimental method and performance of
adequate controls is critical when performing FRET based experiments, because of
the possibility of random donor and acceptor interactions that are not a result of
specific receptor-receptor interactions. It has previously been suggested that for
almost any pair of integral membrane proteins labelled with a donor and acceptor, a
FRET efficiency of approximately 5% will be observed due to random interactions
(Vogel et al. 2006). The FRET efficiencies, as determined by quantitative abFRET in
this study, were close to 0.05 (5%) and may, therefore, reflect a level obtained due to
random interactions. It must be noted, however, that like BRET, FRET relies not just
on the proximity of the donor and acceptor fluorophore, but also on the relative
orientation of the fluorophores. Therefore, the absence of a significant FRET signal
does not necessarily indicate that the tagged proteins do not interact (Kenworthy
2001; Pfleger and Eidne 2005; Vogel et al. 2006). Changing the location of the CFP
or YFP tag, either by moving the tag to the C-terminus or by introducing different
lengths of linker sequence between the receptor sequence and the fluorophore
sequence may alter the position of the fluorophore and, therefore, may result in a
more FRET favourable orientation. Using the CFP and YFP tagged GHS-R1a, GHS-
R1b and GPR39 constructs created in this study, we were unable to observe any
significant FRET or FRET values that were likely to result from specific receptor
dimerisation.
147
CHAPTER 6
INVESTIGATIONS INTO THE FUNCTIONAL EFFECTS
OF POTENTIAL INTERACTIONS BETWEEN THE
GHRELIN RECEPTOR ISOFORMS (GHS-R1a AND
GHS-R1b) AND GPR39
148
6.1 INTRODUCTION
In recent years a number of GPCRs have been shown to form dimers. The
observation that GPCRs often form homo- and heterodimers raises questions about
the specific functional outcomes due to the interaction between specific pairs of
GPCRs. This is a critical element to understanding the implications of GPCR
dimerisation. Results in this study between the closely related receptors, GHS-R1a,
GHS-R1b and GPR39 have been conflicting and have not confirmed or excluded
dimerisation. While co-immunoprecipitation and resonance energy transfer
techniques provide a platform for initially identifying and characterising GPCR
dimerisation, the identification of specific functional outcomes that are altered due to
receptor dimerisation would be more indicative of physiological relevance. A
number of GPCR dimers with altered functional outcomes, including altered binding
affinity, signal transduction and receptor internalisation have been identified (Satake
and Sakai 2008). Additionally, some functional GPCR dimers have been implicated
in disease states (Dalrymple et al. 2008).
Functionally relevant dimers involving GHS-R1a and GHS-R1b have been
previously described. The function of the ghrelin receptor, GHS-R1a, may be altered
by interactions with GHS-R1b in seabream (Acanthopagrus schlegeli) (Chan and
Cheng 2004). These receptors share ~60% amino acid identity with mammalian
GHS-Rs (Chan and Cheng 2004). While this study did not directly demonstrate
GHS-R1a/GHS-R1b heterodimerisation, in HEK293 cells co-expressing GHS-R1a
and GHS-R1b, the presence of GHS-R1b attenuated the GHS-R1a-mediated
intracellular Ca2+ mobilisation in response to a number of growth hormone
secretagogues. The authors proposed that this effect may be due to GHS-R1a/GHS-
R1b heterodimerisation (Chan and Cheng 2004). GHS-R1a/Dopamine receptor
subtype 1 (D1R) heterodimerisation has been shown to have a functional outcome, as
treatment with ghrelin amplified dopamine/D1R dependent cAMP accumulation
(Jiang et al. 2006). In a non-small cell lung cancer cell (NSCLC) line,
heterodimerisation between GHS-R1b and the related neurotensin receptor 1, led to
the formation of a novel neuromedin U (NMU) receptor and resulted in a dose-
dependent increase in cAMP production in response to NMU-25 (Takahashi et al.
2006). Studies using human GHS-R1a and GHS-R1b constructs in HEK293 cells
showed that GHS-R1b had no effect on GHS-R1a ERK1/2 signalling in response to
149
ghrelin, but did attenuate the constitutive activation of phosphatididylinositol-
specific phospholipase C by GHS-R1a (Chu et al. 2007). GHS-R1a/GHS-R1b
heterodimerisation was demonstrated using the BRET2 methodology, and indicated
that GHS-R1b functions as a dominant-negative receptor to GHS-R1a by reducing
the cell surface expression of GHS-R1a and decreasing GHS-R1a constitutive
activation of phosphatididylinositol-specific phospholipase C (Leung et al. 2007).
GHS-R1a also heterodimerises with the prostanoid receptors, the prostaglandin E2
receptor subtype EP3-1 and the thromboxane A2 (TPα) receptors. This leads to similar
functional outcomes, decreasing GHS-R1a cell surface expression and decreasing
constitutive GHS-R1a phospholipase C activation (Chow et al. 2008). No GPR39
dimers have been described and the function of this receptor, which is closely related
to GHS-R1a, is currently unclear.
GHS-R1a and GPR39 could function as monomers, homodimers or heterodimers in
the prostate and their functions in prostate cancer are poorly understood. One of the
hallmarks of cancer is the ability to evade apoptosis, resulting in an increase in
malignant cells (Hanahan and Weinberg 2000). The ERK1/2 and AKT signalling
pathways play critical roles in apoptosis regulation, where an increased
phosphorylation of ERK1/2 and AKT results in an increase in cell survival (Xia et al.
1995; Dudek et al. 1997). ERK1/2 and AKT signalling has been shown to be a key
pathway in ghrelin mediated cell survival in a variety of cell types in response to a
range of insults (Baldanzi et al. 2002; Kim et al. 2004; Mazzocchi et al. 2004; Chung
et al. 2007; Granata et al. 2007; Zhang et al. 2007b; Liu et al. 2009). Additionally
these signalling pathways also play a key role in cell proliferation and differentiation,
and aberrant regulation of these pathways is widely implicated in cancer progression
(Roberts and Der 2007; Tokunaga et al. 2008). Ghrelin stimulates cell proliferation
in prostate cancer cells, signalling through ERK1/2, presumably through GHS-R1a
(Yeh et al. 2005).
While it is still unclear if GPR39 is the specific receptor for obestatin (Zhang et al.
2005; Lauwers et al. 2006; Chartrel et al. 2007; Holst et al. 2007; Zhang et al.
2007a; Zhang et al. 2008a), treatment with obestatin has also been shown to regulate
apoptosis. In pancreatic β-cells and human pancreatic islets, obestatin treatments
reduce apoptosis, induced by either serum withdrawal or by cytokines, through the
150
ERK1/2 and AKT signalling pathways (Granata et al. 2008). Additionally, zinc plays
a role in prostate cancer apoptosis, has been implicated in the proliferation of
malignant cells and is also a GPR39 ligand. In prostate cells, zinc has been shown to
induce apoptosis (Liang et al. 1999) by the induction of mitochondrial apoptogenesis
(Feng et al. 2000). It has not previously been investigated whether obestatin or zinc
mediate apoptosis through GPR39 in prostate cancer.
GHS-R1a and GPR39 display a high level of constitutive activity (Holst et al. 2004).
The constitutive activity of GHS-R1a has been shown to have an important
physiological role. A natural mutation, Ala204Glu, which results in a loss of
constitutive activity while maintaining ghrelin affinity, segregated with the
development of short stature (Pantel et al. 2006), demonstrating that the constitutive
activity of GHS-R1a may by physiologically relevant (Holst and Schwartz 2006).
Constitutively active GHS-R1a and GPR39 can attenuate apoptosis when
overexpressed in some cell types (Dittmer et al. 2008; Lau et al. 2009). In HEK293
cells, the expression of GHS-R1a significantly attenuated cadmium-induced
apoptosis and this protective effect was not modulated by GHS-R1a ligands (Lau et
al. 2009). In a hippocampal cell line, overexpression of GPR39 protected against
apoptosis induced by a number of stimuli including glutamate toxicity, hydrogen
peroxide-induced oxidative stress, tunicamycin treatment and direct activation of the
caspase cascade by the overexpression of Bax (Dittmer et al. 2008). siRNA GPR39
silencing had the opposite effect (Dittmer et al. 2008). The role of this constitutive
signalling and how it may be altered in prostate cancer cells has not been
investigated. Previous studies performed by our research group have investigated the
role of ghrelin on apoptosis in the PC-3 prostate cancer cells. Ghrelin was shown to
have no protective effect against apoptosis induced by actinomycin D (Yeh et al.
2005). The primary focus of the current study was the potential role of ghrelin-
independent GHS-R1a signalling in prostate cancer and its modulation by receptor
heterodimerisation. GHS-R1a, GHS-R1b and GPR39 are co-expressed in prostate
cancer, however, the function of these receptors both alone and in combination in
cancer survival and progression is unknown. In this study we have investigated
ERK1/2 and AKT signalling and cell survival in prostate cancer and how these
functions may be regulated by GHS-R1a, GHS-R1b and GPR39 and potentially
modulated by receptor dimerisation. Levels of signalling and cell survival were
151
measured in PC-3 cells expressing GHS-R1a, GHS-R1b and GPR39, alone or in
combination, with and without induction of apoptosis using tunicamycin or U0126.
152
6.2 MATERIALS AND METHODS
General materials and methods are outlined in detail in Chapter 2. Experimental
procedures which are specific to this chapter are described below.
6.2.1 Cell culture
Cells were maintained in culture medium, as described in Chapter 2.4.1. The PC-3
prostate cancer cell line was used to investigate functional outcomes resulting from
GHS-R1a, GHS-R1b and GPR39 expression or co-expression in a prostate cancer
cell line model.
6.2.2 Cell Signalling
Cells were seeded at a density of 300,000 cells per well in 6 well plates in standard
culture medium (RPMI 1640 medium with 10% New Zealand Cosmic Calf Serum
supplemented with 50 U/mL Penicillin G and 50 µg/mL Streptomycin) for 24 hr.
Cells were transfected with either 2 µg pcDNA3.1 empty vector (negative control), 1
µg FLAG- or Myc-tagged receptor construct and 1 µg pcDNA3.1 empty vector, or 1
µg each of two different FLAG- or Myc-tagged receptor constructs, as described in
Chapter 2.4.3. Cells were serum starved overnight. Treatments were prepared in
serum-free medium or standard culture medium and added to each well. Media were
aspirated immediately (0 min) and at 5, 15 and 30 min after treatment. To test
constitutive signalling, cells were treated with standard culture medium for 15
minutes. Cells were lysed by the addition of 200 μL lysis solution containing
phosphatase inhibitors (described in Chapter 2.6.1). Protein levels in the cell lysates
were quantified by bicinchoninic acid assay (BCA, as per Chapter 2.6.2) and
polyacrylamide gels (10%) were prepared and electrophoresed (as described in
Chapter 2.6.3). Western immunoblots were performed (as outlined in Chapter 2.6.4)
with an anti-phosphorylated ERK1/2 antibody (Cell Signaling Technologies) diluted
1:1000 in 5% w/v skim milk powder diluted in TBST, followed by secondary
detection using an anti-mouse secondary antibody diluted 1:5000. Where membranes
were to be reprobed, membranes were stripped (30 min at RT, Restore stripping
buffer, Pierce) and blocked again, as described above. Total ERK1/2 was detected
using an anti-ERK1/2 antibody (Cell Signaling Technologies) diluted 1:2000 in a
2.5% BSA/TBST solution. Phosphorylated AKT was detected using an anti-phospho
AKT (Thr308) (Cell Signaling Technologies) diluted 1:1000 in 2.5% BSA/TBST.
153
Total ERK1/2 and phosphorylated AKT antibodies were detected using an anti-rabbit
secondary antibody diluted 1:5000 for 2 hr in 5% w/v skim milk powder/TBST.
Bands were visualised using chemiluminescence substrate (SuperSignal West Femto)
and exposure to X-ray film. Developed films were scanned and image densitometry
was performed, as outlined in Chapter 2.6.6. The band density of phosphorylated
ERK 1/2 or phosphorylated AKT was corrected for protein loading by measuring the
density of total ERK1/2 bands.
6.2.3 Cell apoptosis
Apoptosis was detected using a Cell Death Detection ELISAPLUS kit (Roche), as
described by the manufacturer. This ELISA measures histone-complexed DNA
fragments which are characteristically produced by cells undergoing apoptosis.
Briefly, overexpressing PC-3 prostate cancer cells were produced by transient
transfection in 24 well tissue culture plates at 40-50% cell confluence, as described
in Chapter 2.4.2. Transfections were performed using 100ng each FLAG-tagged or
Myc-tagged receptor construct, or empty vector and 0.75 µL Lipofectamine 2000 per
well. Six hr post transfection, cells were treated (10 nM ghrelin, 10 nM obestatin, 10
µM zinc or vehicle control) with or without apoptosis inducers, tunicamycin (2
µg/ml, Sigma-Aldrich), or U0126 (mitogen-activated protein kinase kinase inhibitor,
10 µM, Sigma-Aldrich) or with the vehicle control (DMSO) for 24 or 48 hr.
Following treatment, cells were lysed in 200 µL lysis buffer, (supplied in kit, Roche),
for 30 min at RT. The ELISA was performed in 96-well streptavidin-coated
microplates using 20 µL cell lysate and 80 µL Immunoreagent (1/20 volume Anti-
DNA-POD, 1/20 volume Anti-histone-biotin in incubation buffer, supplied in kit).
The plate was incubated with agitation for 2 hr before washing, and the amount of
nucleosomes was determined using ABTS (2,2'-azino-bis(3-ethylbenzthiazoline-6-
sulphonic acid) as a colourimetric substrate for spectrophotometric detection at 405
nm. The raw absorbance units were normalised to controls, (which were cells
transfected with the empty vector), to calculate the enrichment factor of DNA
fragments in test samples.
6.2.4 Statistical analysis
Calculated values of phosphorylated ERK/total ERK or phosphorylated AKT/total
ERK were compared using a one way ANOVA followed by a post-hoc Tukey’s test.
154
Cell apoptosis data (fragmented DNA) was compared using a one way ANOVA
followed by a post-hoc Tukey’s test. Statistical data was analysed using the
inerSTAT-a v1.3 software. A p-value <0.05 was considered statistically significant.
155
6.3 RESULTS
6.3.1 Overexpression of GHS-R1a, GHS-R1b or GPR39, alone, or in
combination does not increase constitutive ERK1/2 or AKT phosphorylation in
PC-3 prostate cancer cells
As GHS-R1a and GPR39 display a high level of constitutive activity (Holst et al.
2004) we aimed to determine if GHS-R1a/GPR39 heterodimers, or dimers of GHS-
R1a or GPR39 with GHS-R1b altered their constitutive signalling through the
ERK1/2 and AKT pro-survival signalling pathways in the PC-3 prostate cancer cell
line. PC-3 cells were transfected with an empty vector control, or with GHS-R1a,
GHS-R1b or GPR39 receptor constructs, either alone or in combination. As we were
primarily interested in the constitutive activity of these receptors, (either alone or in
combination), ERK1/2 and AKT phosphorylation was observed in cells treated with
standard growth medium alone. A representative Western blot of phosphorylated
ERK1/2, phosphorylated AKT and total ERK1/2 and the corresponding densitometry
data from three independent experiments is shown in Figure 6.1. Transfection of PC-
3 prostate cancer cells with GHS-R1a, GHS-R1b or GPR39 constructs, either alone
or in combination, did not result in any statistically significant increase in
constitutive ERK1/2 or AKT phosphorylation compared with PC-3 cells similarly
transfected with empty pcDNA3.1(+) vector. Small increases, (less than two fold), in
ERK1/2 phosphorylation were noted for combinations of GPR39 with GHS-R1a or
GHS-R1b, however, these were not statistically significant (Figure 6.1). There was
considerable variability in phosphorylated AKT between experiments contributing to
the error in this data (Figure 6.1). This experimental variation may represent the
relative insensitivity of such Western blot based assays and, therefore, detection of
minor changes in ERK1/2 or AKT signalling may be difficult to determine by this
approach.
156
Figure 6.1 Overexpression of GHS-R1a, GHS-R1b or GPR39 alone, or in
combination, does not lead to an increase in constitutive ERK1/2 or AKT
phosphorylation in PC-3 prostate cancer cells. A representative Western blot of
phosphorylated ERK1/2, phosphorylated AKT and total ERK1/2 and the mean
densitometry data derived from three independent experiments ±SEM. Densitometry
data was corrected for the total ERK1/2 loading control and normalised to the
phosphorylated EKR1/2 or AKT levels in PC-3 cells transfected with the ‘empty’
vector control. Statistical tests were performed by one way ANOVA, however, no
significant changes were observed. Thirty μg of protein lysate was loaded per well
and Western blots were performed using either an anti-phosphorylated ERK1/2
antibody (1:1000), an anti-ERK1/2 antibody (1:2000) or an anti-phospho AKT
antibody (1:1000).
157
6.3.2 Overexpression of the ghrelin receptor, GHS-R1a, alone or in combination
with GHS-R1b or GPR39 does not alter PC-3 cell apoptosis
Constitutively active GHS-R1a and GPR39 can attenuate apoptosis when
overexpressed in some cell types (Dittmer et al. 2008; Lau et al. 2009). This study
aimed to identify if GHS-R1a modulated apoptosis and if this was altered by co-
expression with GHS-R1b, or GPR39, in prostate cancer cells. To initially determine
if overexpression of GHS-R1a, alone or in combination with GHS-R1b or GPR39,
had a pro-survival or pro-apoptotic effect in PC-3 prostate cancer cells, basal
apoptosis was observed in cells overexpressing these receptor combinations
compared with control PC-3 cells transfected with an empty vector. Transfected cells
were also treated with vehicle control (standard growth medium), 10 nM ghrelin, 10
nM obestatin or 10 µM zinc for 48 hrs, (six hours after transfection), to see if these
ligands could alter cell survival. Fragmented DNA was used as a measure of cell
apoptosis (Figure 6.2). No significant change was observed in any cells
overexpressing GHS-R1a alone, or in combination with GHS-R1b or GPR39,
compared with the untransfected control. There was a modest reduction, (less than
35%), in basal apoptosis in the GHS-R1a transfected cells, however, this change was
not statistically significant. This reduction did not appear to be altered, either by co-
transfection with GHS-R1b or GPR39, or by treatment with ghrelin, obestatin or
zinc.
158
Figure 6.2 Basal apoptosis in PC-3 cells overexpressing GHS-R1a alone, or in
combination with GHS-R1b or GPR39, treated with ghrelin, obestatin or zinc.
PC-3 prostate cancer cells were transfected and treated with vehicle, 10 nM ghrelin,
10 nM obestatin or 10 μM zinc, and basal apoptosis was measured after 48 hrs. The
level of apoptosis in transfected and treated cells was normalised to the level of
apoptosis in the vehicle control treated sample (empty vector transfected cells) to
give the relative enrichment factor of DNA fragments. No significant change in basal
apoptosis was observed between any transfected and treated samples or between
transfected cells and untransfected controls. Data for the vehicle control and ghrelin
treated samples are from three independent experiments performed in duplicate. Data
for the obestatin and zinc treated samples are from two independent experiments
performed in duplicate. Bars represent mean ± SEM. Statistical analysis was
performed by one way ANOVA for comparison of all means.
159
To analyse further if expression of GHS-R1a or GPR39 alone, or in combination, in
PC-3 prostate cancer cells has a pro-survival effect, the PC-3 cell line was
transfected with combinations of receptors and apoptosis was induced using 2 µg/ml
tunicamycin. Tunicamycin is a potent inhibitor of N-linked glycosylation and
induces endoplasmic reticulum (ER) stress-related apoptosis (Elbein 1987; Chang
and Korolev 1996). Tunicamycin has previously been used to induce apoptosis and
to illustrate the protective effect of GPR39 in a mouse hippocampal cell line and in
HEK293 cells (Dittmer et al. 2008). Cells were transfected with an empty vector
control, or vectors containing GHS-R1a, GPR39 alone or GHS-R1a and GPR39 in
combination for 6 hr, followed by the measurement of apoptosis after 24 hr treatment
with 2 µg/ml tunicamycin (Figure 6.3). Treatment with tunicamycin significantly
increased cell apoptosis in all cell combinations (p<0.01). Transfection with GHS-
R1a and/or GPR39, however, did not produce a protective effect when compared to
cells similarly transfected with an empty vector control and treated with tunicamycin
(Figure 6.3).
160
Figure 6.3 Overexpression of GHS-R1a and GPR39 alone, or in combination,
did not attenuate apoptosis induced by tunicamycin in PC-3 prostate cancer
cells. Cells were transfected and after 6 hr were treated with 2 μg/ml tunicamycin for
24 hr to induce endoplasmic reticulum stress-related apoptosis. The level of
apoptosis in transfected and treated cells was normalised to the level of apoptosis in
the vehicle control treated sample (empty vector transfected cells) to give the relative
enrichment factor of DNA fragments. In all cases, apoptosis was significantly
increased when compared to the vehicle control in tunicamycin treated cells
(p<0.01). No significant change in tunicamycin-induced apoptosis was observed in
cells overexpressing GHS-R1a or GPR39 alone, or in combination, when compared
to cells transfected with an empty vector control. Data represent the mean ± SD of
duplicate measurements. Statistical analysis was performed by one way ANOVA
with Tukey’s post-hoc test for comparisons of all means.
161
The potential role of the ERK1/2 signalling pathway in PC-3 cell survival in cells
overexpressing GHS-R1a alone, or in combination with GHS-R1b or GPR39, was
also examined. Activation of the ERK1/2 pathway promotes cell survival and
treatment with the specific MEK (mitogen-activated protein kinase kinase, which
activates ERK1/2) inhibitor, U0126, induces cell apoptosis in normal and cancerous
cell lines (Shakibaei et al. 2001; Blank et al. 2002; Huynh et al. 2003; Rice et al.
2004; Rice et al. 2006). PC-3 prostate cancer cells were treated with U0126 to induce
apoptosis. Cells were additionally treated with ghrelin, obestatin and zinc to asses if
any cell survival effect on cells overexpressing the receptors could be affected by
ligand treatment. The ERK1/2 signalling pathway plays a role in the ghrelin
mediated cell survival (Baldanzi et al. 2002; Kim et al. 2004; Mazzocchi et al. 2004;
Chung et al. 2007; Granata et al. 2007; Zhang et al. 2007b).
PC-3 cells were transfected with an empty vector control, or vectors encoding GHS-
R1a, alone or in combination with GHS-R1b or GPR39 vector constructs.
Transfected cells were treated with a ligand (10 nM ghrelin, 10 nM obestatin, 10 µM
zinc or vehicle control) in addition to the specific inhibitor of MEK, U0126 (10 µM),
or a vehicle control for 48 hrs. Apoptosis was measured as previously described
(Figure 6.4). As phosphorylation of ERK1/2 promotes cell survival, it may be
expected that an ERK1/2 inhibitor would result in increased basal apoptosis,
independent of GPCR transfection, however, this was not observed. Unexpectedly,
treatment with U0126 did not result in any significant change in apoptosis in any
transfected and treated cells.
162
Figure 6.4 The MEK inhibitor, U0126, did not stimulate an increase in
apoptosis in PC-3 cells overexpressing GHS-R1a alone, or in combination with
GHS-R1b, or GPR39 and treated with ghrelin, obestatin or zinc. The level of
apoptosis in transfected and treated cells was normalised to the level of apoptosis in
the vehicle control treated sample (empty vector transfected cells) to give the relative
enrichment factor of DNA fragments. PC-3 cells were treated with 10 µM U0126 to
induce apoptosis, however, no significant change in basal apoptosis was observed.
Data for the vehicle control and ghrelin treated samples are from three independent
experiments performed in duplicate. Data for the obestatin and zinc treated samples
are from two independent experiments performed in duplicate. Mean ± SEM.
Statistical analysis was performed by one way ANOVA.
163
6.4 DISCUSSION
In this study we investigated the effects of GHS-R1a, GHS-R1b and GPR39, alone
and in combination on ERK1/2 and AKT signalling and apoptosis. Our studies have
provided conflicting results concerning the dimerisation of GHS-R1a, GHS-R1b and
GPR39, receptors within the ghrelin receptor family. Our co-immunoprecipitation
experiments demonstrated that heterodimers could form between GHS-R1a, GHS-
R1b and GPR39, however, using resonance energy transfer techniques, we were
unable to confirm or exclude the formation of specific dimers between these
receptors. The demonstration of specific functional outcomes from receptor
dimerisation is an important step in demonstrating the physiological significance of
receptor interactions. Interactions between a number of GPCRs have led to altered
functional outcomes, such as altered binding affinity, signal transduction and
receptor internalisation (Satake and Sakai 2008) and some functional GPCR dimers
have been implicated in disease states (Dalrymple et al. 2008). In this study we were
unable to identify any change in constitutive ERK1/2 or AKT signalling, or altered
apoptosis, in PC-3 cells overexpressing combinations of GHS-R1a, GHS-R1b or
GPR39.
In order to assess any protective effect of receptor expression, apoptosis was induced
using tunicamycin, an ER stress inducer, or U0126, an ERK1/2 inhibitor. Treatment
with tunicamycin induced significant apoptosis in the PC-3 cells tested compared to
untreated cells, however, U0126 treatment did not. PC-3 cells have previously been
described to have low levels of basal ERK1/2 phosphorylation, particularly when
compared to other prostate cancer cell lines (Guo et al. 2000; Shimada et al. 2002;
Stangelberger et al. 2005; Ruscica et al. 2006). As there are low levels of ERK1/2
phosphorylation in PC-3 cells, this signalling may not have a significant pro-survival
effect and, therefore, inhibition of this pathway may not lead to significant apoptosis,
as reflected in this study.
Ghrelin, the endogenous ligand of GHS-R1a, has been shown to play a role in cell
survival. Ghrelin had a protective effect when apoptosis was induced in a variety of
ways in a number of different cell types including; doxorubicin- and serum
deprivation-induced apoptosis in cardiomyocytes and endothelial cells (Baldanzi et
al. 2002), serum deprivation-induced apoptosis in adrenal zona glomerulosa cells
164
(Mazzocchi et al. 2004) and adipocytes (Kim et al. 2004), tumor necrosis factor
(TNF)-α-induced apoptosis in mouse osteoblastic MC3T3-E1 cells (Kim et al. 2005)
and vascular smooth muscle cells (Zhang et al. 2008b), doxorubicin-induced
apoptosis in pancreatic β cells (Zhang et al. 2007b), basal apoptosis in the
adrenocortical carcinoma cell line SW-13 (Delhanty et al. 2007), serum deprivation-
and interferon-γ/TNF-α-induced apoptosis in pancreatic β-cells and human
pancreatic islets (Granata et al. 2007), oxygen-glucose deprivation-induced apoptosis
in hypothalamic neuronal cells (Chung et al. 2007) and oxidative stress-induced
apoptosis in cardiomyocytes from adult rats (Liu et al. 2009). In some of these cases
this protective effect was determined to be mediated by the ERK1/2 (Mazzocchi et
al. 2004), AKT (Liu et al. 2009) or by both the ERK1/2 and AKT signalling
pathways (Baldanzi et al. 2002; Kim et al. 2004; Chung et al. 2007; Granata et al.
2007; Zhang et al. 2007b). In some cases, a similar protective effect was observed
for unacylated ghrelin (Baldanzi et al. 2002; Delhanty et al. 2007; Granata et al.
2007; Zhang et al. 2008b) and in cardiomyocytes and endothelial cells, ghrelin-
mediated protection against apoptosis was found to be independent of GHS-R1a
(Baldanzi et al. 2002).
Our research group has previously investigated the role of ghrelin in apoptosis in the
PC-3 prostate cancer cells. Ghrelin had no protective effect on apoptosis induced by
actinomycin D (Yeh et al. 2005). In this study we investigated the potential ghrelin-
independent, constitutive role of the receptor, GHS-R1a, in regulating apoptosis and
whether this effect is modulated by receptor heterodimerisation. In COS-7 or
HEK293 cells transiently transfected with GHS-R1a, a high degree (~50% of
maximal activity) of ligand independent inositol phosphate turnover (Gαq signalling
through the phospholipase C pathway) and activation of cAMP-responsive element
(CRE) gene transcription was observed (Holst et al. 2003) indicating a high degree
of GHS-R1a constitutive signalling. Additional studies by the same group also
determined that GHS-R1a displayed a degree of constitutive signalling through the
serum response element (SRE) pathway and that the receptor is constitutively
internalised in the absence of ligand (Holst et al. 2004). Interestingly, constitutive
phosphorylation of ERK1/2 was not observed in COS-7 cells transiently transfected
with GHS-R1a, however, a clear increase in ERK1/2 phosphorylation was seen after
treatment with ghrelin (Holst et al. 2004). The constitutive signalling of GHS-R1a
165
may play a role in cell survival (Lau et al. 2009). In HEK293 cells stably
overexpressing seabream GHS-R1a, the expression of GHS-R1a significantly
attenuated cadmium induced apoptosis and this protective effect was not modulated
by GHS-R1a ligands (Lau et al. 2009). The protective role of constitutive GHS-R1a
activity was mediated via a protein kinase C-dependent pathway (Lau et al. 2009).
Interestingly, co-expression of GHS-R1b did not alter the survival responses in GHS-
R1a expressing cells (Lau et al. 2009).
Zinc is the only proven ligand for GPR39. The modulation of apoptosis by zinc has
been implicated in the proliferation of malignant cells in prostate cancer. In prostate
cells, zinc has been shown to induce apoptosis (Liang et al. 1999) by inducing
mitochondrial apoptogenesis (Feng et al. 2000). This is interesting, as normal
prostate accumulates the highest amount of zinc of any soft tissue, but the level of
zinc consistently decreases with prostate malignancy (Costello et al. 2005).
Therefore, this decrease in zinc in malignant cells will result in loss of zinc-induced
apoptosis, thereby aiding in the proliferation of malignant cells (Costello et al. 2005).
In this study, we observed an increase in apoptosis when transfected PC-3 cells were
treated with zinc, however, these changes were not statistically significant and did
not appear to be altered by the expression of GPR39 alone, or in combination with
GHS-R1a.
Like GHS-R1a, GPR39 has a high degree of constitutive activity. GPR39 displays
constitutive inositol phosphate turnover (Gαq signalling through the phospholipase C
pathway) and activation of cAMP-responsive element (CRE) gene transcription,
however, the degree of constitutive signalling is lower than that of GHS-R1a (Holst
et al. 2004). GPR39, however, has a higher level of constitutive signalling through
the serum response element (SRE) pathway compared with GHS-R1a (Holst et al.
2004). Like GHS-R1a, constitutive phosphorylation of ERK1/2 was not observed in
COS-7 cells transiently transfected with GPR39, however, an increase in ERK1/2
phosphorylation could be seen after treatment with zinc (Holst et al. 2004). These
findings are in agreement with this study in PC-3 cells where we did not observe
constitutive phosphorylation of ERK1/2 in cells overexpressing GHS-R1a and
GPR39. Interestingly, in contrast to GHS-R1a, GPR39 is not constitutively
internalised and in the absence of agonist it remains at the cell surface (Holst et al.
166
2004). This difference in constitutive internalisation between GHS-R1a and GPR39
was determined to be due to differences in the C-terminal tails (Holliday et al. 2007).
GPR39 has been reported to have a role in the regulation of apoptosis due to this
constitutive activity (Dittmer et al. 2008).
Despite the fact that GHS-R1a and GPR39 are constitutively active and provide a
cell survival effect in some cell types, this was not observed in PC-3 cells in this
study where these receptors and GHS-R1b were overexpressed alone or in
combination. No effect was seen on the basal rate of apoptosis, or on the rate of
apoptosis induced by treatment with tunicamycin. This may indicate that these
receptors do not play a role in apoptosis in prostate cancer cells, at least when
induced by tunicamycin. These receptors could, however, inhibit apoptosis induced
by other methods and may act through signalling pathways other than ERK1/2 and
AKT. Preparation of prostate cancer cell lines stably overexpressing GHS-R1a,
GHS-R1b and GPR39 alone, or in combination, may provide a better experimental
model to investigate these potential effects.
This study focused on the co-expression of the ghrelin receptor isoforms, GHS-R1a
and GHS-R1b and the related receptor, GPR39, and any potential functional
outcomes in prostate cancer cells. Dimers involving GHS-R1a or GHS-R1b have
been shown to attenuate ligand-induced signalling (Chan and Cheng 2004),
constitutive GHS-R1a activity (Chu et al. 2007; Leung et al. 2007; Chow et al. 2008)
and GHS-R1a cell surface expression (Leung et al. 2007; Chow et al. 2008), and to
amplify the signalling of unrelated GPCRs, as is the case for the GHS-R1a/dopamine
receptor dimer (Jiang et al. 2006) and the GHS-R1b/neurotensin receptor 1 dimer,
which functions as a novel receptor type that can signal in response to unrelated
ligands (Takahashi et al. 2006). As GHS-R1a and GPR39 demonstrate high levels of
constitutive activity, the effects of this activity on ERK1/2 and AKT signalling and
apoptosis were investigated in the PC-3 prostate cancer cell line. Overexpression of
GHS-R1a, GHS-R1b and GPR39, alone or in combination, did not increase
constitutive signalling through the ERK1/2 or AKT pathways. In addition,
overexpression of these receptors in PC-3 cells did not significantly alter basal
apoptosis or tunicamycin-induced apoptosis. These results may indeed indicate that
these receptors may not play a role in cell survival in the prostate, when expressed
167
alone or in combination. These receptors could yet have other functions in prostate
cancer, however, the function of GPR39 itself still requires further investigation. The
potential role of GPR39 in the prostate is interesting given that GPR39 is expressed
in this tissue and zinc, a ligand of GPR39, is important in normal prostate biology
and in prostate cancer progression. Rather than targeting the known functions of
GPR39, it may be useful to perform a broader study into GPR39 function in the
prostate, using microarray or proteomic techniques.
168
CHAPTER 7
GENERAL DISCUSSION
169
When this project commenced, the hypothesis that G protein coupled receptors
formed and functioned as homo- and hetero- dimeric units was gaining growing
support in the literature (Hansen and Sheikh 2004; Milligan 2004). This challenged
the dogma that GPCRs generally acted as monomers. It is now believed that
interactions between distinct GPCRs can lead to the formation of novel
pharmacological receptors and can diversify the function of GPCRs (Park and
Palczewski 2005), and a number of novel GPCR dimers have been implicated in the
development of pathophysiological conditions (Dalrymple et al. 2008). Importantly,
novel GPCR dimers represent potential new targets for the development of more
specific, targeted therapeutics for a wide range of diseases.
In this study we investigated the potential for interactions between the ghrelin
receptor, GHS-R1a, with a truncated ghrelin receptor isoform, GHS-R1b, and the
closely related zinc receptor, GPR39, and the potential for functional outcomes in
prostate cancer. Ghrelin and zinc have roles in prostate cancer. Our research group
has shown that ghrelin stimulates proliferation of the PC-3 and LNCaP prostate
cancer cell lines at close to physiological levels (Jeffery et al. 2002; Yeh et al. 2005).
Significantly, ghrelin and the truncated ghrelin receptor isoform, GHS-R1b, are more
highly expressed in prostate cancer when compared with normal prostate tissues
(Jeffery et al. 2002; Yeh et al. 2005). Zinc has a unique role in the biology of the
prostate, where it is normally accumulated at high levels, and the level of zinc
accumulation is greatly decreased in prostate malignancy (Costello and Franklin
2006). This altered accumulation of zinc in prostate cancer provides malignant cells
with significant metabolic, growth and metastatic advantages (Costello and Franklin
2006).
Numerous studies have shown that some GPCR splice variants or C-terminally
truncated mutant GPCRs interact with their corresponding full length wild-type
receptor, (as reviewed in Dalrymple et al. 2008). Additionally, closely related
GPCRs are more likely to form functional heterodimers than less closely related
receptors (Ramsay et al. 2002). We hypothesised, therefore, that as GHS-R1a, GHS-
R1b and GPR39 are very closely related that they will interact. As their ligands are
significant in prostate cancer, we hypothesised that the formation of GHS-R1a/GHS-
R1b and GHS-R1a/GPR39 heterodimers would have significant functional outcomes
170
in prostate cancer development or progression. These novel dimers could, therefore,
provide new targets for the development of potential adjunctive therapeutic
approaches for prostate cancer.
Using a number of experimental techniques we were unable to definitively
demonstrate that GHS-R1a interacts with GHS-R1b or GPR39. Interestingly, the
difficulty in obtaining reliable data with the appropriately controlled methods in this
study reflects the growing controversy regarding the use of these methods which has
emerged in the literature. The formation of GPCR dimers has been largely described
in artificial experimental systems, and this appears to have lead to the over-
interpretation of data in some cases and the over reliance on methodologies that have
significant potential shortcomings (Panetta and Greenwood 2008).
The initial aim of this study was to demonstrate interactions between GHS-R1a,
GHS-R1b and GPR39 using classical co-immunoprecipitation experiments with
differentially tagged receptors (Chapter 3). Using cells co-overexpressing FLAG-
and Myc- tagged GHS-R1a, GHS-R1b and GPR39, we co-immunoprecipitated these
receptors. Although this could be indicative of dimerisation, we interpreted these
data with caution, as we also demonstrated the ability of these receptors to aggregate
during cell lysis and protein solubilisation. This is a commonly reported concern
regarding the co-immunoprecipitation of highly hydrophobic membrane proteins,
and this aggregation could be interpreted as receptor dimerisation (Bouvier 2001;
Devi 2001; Kroeger et al. 2004; Kent et al. 2007; Szidonya et al. 2008). It has been
suggested, therefore, that due to this experimental limitation, additional experimental
techniques should be used to verify receptor-receptor interactions (Szidonya et al.
2008).
At the commencement of this study, the BRET2 system, which offers greater
resolution of the donor and acceptor emission spectrum than first generation BRET,
was described as one of the best available methods to demonstrate GPCR
dimerisation (Mercier et al. 2002; Ramsay et al. 2002), and, therefore, we used this
technique to investigate the potential for GHS-R1a, GHS-R1b and GPR39 to
dimerise (Chapter 4). However, during our studies we encountered a number of
technical limitations. The substrate used during BRET2 studies, coelenterazine 400a,
171
was found to have a low quantum yield and rapid signal decay (Hamdan et al. 2005).
In our study, we observed this phenomenon, where the luminescent and fluorescent
signals rapidly approached the baseline of detection, significantly increasing the
experimental error. While the low quantum yield and rapid signal decay does not
prohibit the use of BRET2 per se, the properties of coelenterazine 400a mean that
high levels of protein expression are required so that a BRET2 signal can be detected
(Kocan et al. 2008). This has significant implications for the physiological relevance
of BRET2 results. The supraphysiological overexpression of donor and acceptor
tagged receptors can lead to ‘bystander BRET’, which is non-specific BRET
resulting from usually non-interacting proteins that are forced into close proximity
due to increased concentrations. To differentiate between specific receptor-receptor
interactions and non-specific interactions a number of BRET controls are required
(James et al. 2006; Pfleger et al. 2006b; Marullo and Bouvier 2007). The results of
these controls which were performed in this study, suggested that the levels of
BRET2 that we observed may in fact be a result of ‘bystander’ BRET. It would be
preferable, therefore, to measure BRET2 in cells expressing lower levels of donor
and acceptor tagged receptor, however, due to the limitations imposed by requiring
the coelenterazine 400a substrate, this would not produce a measurable luminescent
and fluorescent signal. Interestingly, the company that originally supplied and
promoted the BRET2 vectors and substrate (Perkin Elmer) removed it from the
market at the end of 2007 (personal communication, Perkin Elmer). Given the results
of this study, and the reported limitations of the BRET2 methodology, we would
suggest that GPCR dimerisation observed using this method alone may require
further validation.
We investigated the potential for GHS-R1a, GHS-R1b and GPR39 to dimerise using
two different FRET methodologies; acceptor photobleaching FRET (abFRET) and
sensitised emission FRET, (which is the measurement of the acceptor fluorescence
after specific excitation of the donor), by flow cytometry (Chapter 5). Using these
methods we were unable to observe any significant FRET or FRET values that were
likely to result from specific receptor dimerisation. Interestingly, for all receptor
combinations tested, we observed a degree of FRET when measured by acceptor
photobleaching confocal microscopy. The level of FRET observed was within the
reported range observed for almost any pair of integral membrane proteins labelled
172
with a donor and acceptor undergoing random interactions (Vogel et al. 2006).
Our studies were unable to directly and conclusively demonstrate interactions
between GHS-R1a, GHS-R1b and GPR39 (Chapters 3-5). During the course of these
studies, significant concerns regarding the methodologies used to demonstrate GPCR
dimerisation were also raised in the literature, suggesting that more extensive
analysis of these potential interactions was required. Indeed, initial studies using co-
immunoprecipitation and BRET2 could have been interpreted as supporting our
dimerisation hypothesis if these rigorous controls had not been performed. It is
becoming increasingly apparent that a number of the current experimental methods
used to demonstrate GPCR dimerisation are open to interpretation (Gurevich and
Gurevich 2008a) and the unambiguous interpretation of inherently ambiguous data
is currently a major concern in the study of GPCR dimerisation (Gurevich and
Gurevich 2008a). Particularly given the current knowledge of these methodologies, it
is apparent that an extensive understanding of the experimental techniques and also
their potential limitations is required.
Our attempts to directly demonstrate dimerisation between GHS-R1a, GHS-R1b and
GPR39, while inconclusive, do not exclude the possibility that these receptors do
interact, or indeed dimerise. We aimed to further investigate this potential by
demonstrating a functional outcome in prostate cancers cells co-expressing
combinations of these receptors (Chapter 6). The demonstration of specific
functional outcomes from receptor dimerisation is an important step in determining
the physiological significance of receptor interactions. The ERK1/2 and AKT
signalling pathways have been shown to be key pathways in ghrelin mediated cell
survival (Baldanzi et al. 2002; Kim et al. 2004; Mazzocchi et al. 2004; Chung et al.
2007; Granata et al. 2007; Zhang et al. 2007b; Liu et al. 2009) and constitutively
active GHS-R1a and GPR39 can attenuate apoptosis when overexpressed in some
cell types (Dittmer et al. 2008; Lau et al. 2009). We, therefore, investigated the
potential role for GHS-R1a and GPR39 mediated ERK1/2 and AKT constitutive
signalling and apoptosis regulation, and how this may be modulated by receptor
dimerisation in the PC-3 prostate cancer cell line. Overexpression of GHS-R1a,
GHS-R1b and GPR39, alone or in combination, did not increase constitutive
signalling through the ERK1/2 or AKT pathways. In addition, overexpression of
173
these receptors in PC-3 cells did not significantly alter basal apoptosis or
tunicamycin-induced apoptosis. These findings do not support our hypotheses that
GHS-R1a/GHS-R1b and GHS-R1a/GPR39 heterodimers have functional outcomes
that may be significant in the development of prostate cancer, although a limited
number of potential functional outcomes were investigated.
As this project progressed, the initial excitement regarding the discovery and early
investigation of GPCR dimerisation has been overshadowed by growing controversy
surrounding this concept. The demonstration that GPCR dimers are involved in the
genesis of disease, gave weight to the argument that GPCR dimerisation is
functionally significant. One of the first physiologically relevant examples was the
demonstration that the type I angiotensin-II receptor (AT1R) and the bradykinin-2
receptor (B2R) heterodimerised resulting in increased AT1R signalling in pre-
eclamptic, hypertensive women (AbdAlla et al. 2001). This was the first disorder
shown to be associated with altered GPCR heterodimerisation, and was published in
Nature Medicine (AbdAlla et al. 2001). This study has often been cited as important
evidence for the significance of GPCR heterodimerisation. Additional studies by the
same group also suggested that this dimer contributes to the angiotensin II hyper-
responsiveness of mesangial cells in experimental hypertension (AbdAlla et al.
2005). Recently, however, researchers from four independent research groups
attempted to reproduce these findings with a view to studying this important
interaction further (Hansen et al. 2009). Using a number of different experimental
methods in a variety of cell types, they found a lack of evidence for AT1R/B2R
heterodimerisation (Hansen et al. 2009). Specifically, they failed to demonstrate any
physical interaction between these receptors, or any functional modulation of AT1R
signalling by B2R in any of the systems tested (Hansen et al. 2009). There is a
striking contrast between the conclusions reached in these recent studies and the
original report and the differences in data have proven difficult to reconcile (Hansen
et al. 2009). This example highlights the need for caution in interpreting data and for
the independent verification of some of the more exciting and significant cases
describing GPCR dimerisation. This is of particular concern for those cases that have
provided fundamental support for the concept of the physiological significance of
GPCR dimerisation.
174
Recent studies have addressed whether or not GPCR dimerisation is required for G
protein activation. These elegant studies were performed by directly incorporating
either one or two GPCRs into a reconstituted phospholipid bilayer and examining G
protein activation (Bayburt et al. 2007; Whorton et al. 2007; Whorton et al. 2008). It
was found that monomeric rhodopsin (Bayburt et al. 2007; Whorton et al. 2008) and
β2-adrenergic receptor (Whorton et al. 2007) were the minimal functional units
required for efficient G protein activation. While these studies do not refute the
theory that GPCR dimers exist, it does suggest that dimerisation is not a requirement
for GPCR signalling and that dimerisation may only play a minor role in G protein
activation (Whorton et al. 2007).
While this study raises significant questions regarding some aspects of GPCR
dimerisation, suggesting that data gained in artificial systems must be interpreted
carefully, it has not been suggested that GPCR dimerisation does not occur. There is
a wealth of experimental evidence to support the concept of GPCR dimerisation
(Milligan 2009). It is becoming clear, however, that greater emphasis needs to be
placed on the demonstration of GPCR dimers in native cellular contexts rather than
in artificial systems that are open to interpretation. Recently the International Union
of Pharmacology Committee on Receptor Nomenclature and Drug Classification
(NU-IUPHAR) outlined a number of criteria that need to be met before a receptor
heterodimer can be accepted by the scientific community (Pin et al. 2007). They
suggest that at least two of the following three criteria need to be demonstrated: 1)
evidence for physical association in native tissue or primary cells; 2) a specific
functional property for the heterodimeric receptor and 3) the use of knockout animals
or RNAi technology demonstrating a significantly altered dimer-mediated response
in the absence of either subunit (Pin et al. 2007). As we were unable to fulfil the
criteria outlined by NC-IUPHAR when considering the findings of this study, we are
unable to conclude that GHS-R1a, GHS-R1b and GPR39 form physiologically
relevant dimers. Interestingly, although a large number of GPCR dimers have been
described in the literature, the only examples to currently meet all of these criteria are
the obligate heterodimer class C GPCRs, the GABAB receptor
(GABABR1/GABABR2), the sweet taste receptor (T1R2/T1R3) and the umami taste
receptor (T1R1/T1R3) (Milligan 2009). Unambiguous evidence regarding the largest
class of GPCRs, the class A receptors to which the ghrelin receptor family belongs,
175
is sparse (Gurevich and Gurevich 2008b).
A number of avenues are available to investigate further the ability of GHS-R1a,
GHS-R1b and GPR39 to form functionally relevant dimers. In this study we used the
BRET2 methodology, however, it is now apparent that there are major limitations to
this technique. During the course of this study, improvements to BRET2 have been
suggested, where a novel form of luciferase, Rluc2 or Rluc8, is used as the energy
donor, giving greater signal intensity and stability following the addition of the
coelenterazine 400a substrate (Kocan et al. 2008). Other BRET methods that may
represent significant improvements are also now available, including extended
bioluminescence resonance energy transfer (eBRET) (Pfleger et al. 2006a) and
BRET3 (De et al. 2009). Additionally, as RET is based not only on the proximity of
the donor and the acceptor, but also on their relative orientations, redesigning our
current BRET2 and FRET constructs with a range of combinations of different linker
sequences between the receptor and the tagged fluorophore, may also result in a
different RET signal (Szidonya et al. 2008). It is unclear, however, if these
approaches would lead to the identification of dimerisation and this may not be
functionally significant. Perhaps a more reasonable approach would be to investigate
further potential functional outcomes of GHS-R1a/GHS-R1b and GHS-R1a/GPR39
heterodimersation in cells co-overexpressing these receptors using a broader
microarray or proteomic approach, as it is difficult to predict the functional outcome
of dimerisation. These findings would need to be confirmed in a native context,
potentially using RNAi methods for targeted knockdown of the relevant receptor.
However, given the current controversy regarding the propensity of class A GPCRs
to form and function as heterodimers, additional studies may not be warranted.
It is possible that the action of both ghrelin and zinc may be independent of GHS-
R1a and GPR39 in the prostate. There is increasing evidence that, in addition to
GHS-R1a, there is an alternative receptor which binds both ghrelin and its des-acyl
form (Cassoni et al. 2001; Baldanzi et al. 2002; Bedendi et al. 2003; Cassoni et al.
2004; Cassoni et al. 2006; Delhanty et al. 2006; Martini et al. 2006; Sato et al. 2006;
Filigheddu et al. 2007; Granata et al. 2007). Ghrelin actions in the prostate could be
mediated by the putative alternative ghrelin receptor. Additionally, in the preliminary
studies presented in this thesis, we were unable to demonstrate a GPR39-mediated,
176
zinc function in prostate cancer (Chapter 6). We cannot rule out, therefore, that the
negative findings of this study of the functional outcomes of GHS-R1a and GPR39
expression in the prostate may simply reflect that these receptors do not play a role in
the ghrelin and zinc mediated functions in the prostate.
There is currently an urgent need for better prognostic and diagnostic markers and
better adjuvant therapies for prostate cancer. The role of ghrelin and zinc in the
prostate remains interesting and requires further investigation. The increased
expression of ghrelin in prostate cancer provides a potential therapeutic target (Yeh
et al. 2005; Lanfranco et al. 2008). The targeted inhibition of ghrelin, potentially by
inhibition of the newly discovered ghrelin-acylating enzyme, ghrelin O-acyl
transferase (GOAT), may provide a mechanism for modulating prostate cancer
growth. GOAT expression has been demonstrated in the prostate (personal
communication, Dr. Inge Siem). Zinc may also provide a novel biomarker for the
screening of prostate cancer (Costello and Franklin 2009). Interestingly, a europium
luminescence assay that can accurately determine the levels of citrate in microlitre
volumes of prostate fluid has recently been developed (Pal et al. 2009). The levels of
citrate in the prostate are directly linked with the levels of zinc, as zinc increases
citrate production. This test is an exciting development, as it may be used to indicate
the onset or progression of prostate cancer (Pal et al. 2009). Further research into the
role of zinc in prostate cancer may also provide novel directions for the development
of new therapeutic drugs (Costello and Franklin 2006).
In recent years the growing excitement regarding the potential of newly discovered
GPCR dimers has been tempered by concerns regarding the validity of a great deal of
data that has been generated in this field. GPCR dimerisation provides the potential
for an increasing diversity of GPCR functions that may provide avenues for the
development of novel heterodimer-specific drugs. Ultimately, this may provide new
medicines that are more selective and have reduced side effects (Kent et al. 2007).
Importantly, however, it will be necessary for basic researchers to unambiguously
identify these drug targets and definitively demonstrate their relevance in vivo with
significant physiological outcomes (Kent et al. 2007). It has become increasingly
clear, therefore, that the methods applied must yield conclusive answers and the
temptation to over-interpret experimental data must be avoided (Gurevich and
177
Gurevich 2008a). Currently, there is significant controversy regarding the ability of
class A GPCRs to form functional dimers. While some scientists now believe that
GPCR dimerisation may not occur at all, at the other extreme, some authors still
hypothesise that GPCRs may always function as dimers (Chabre and le Maires 2005;
Fotiadis et al. 2006; Gurevich and Gurevich 2008b). It is most likely that while
GPCR dimers may form in some specific cases, they are unlikely to occur as
ubiquitously as once imagined. It is becoming increasingly unlikely that a general
model to describe GPCR dimerisation and its mechanisms will be described and it is
more likely that individual GPCR dimers will need to be assessed on a case by case
basis. However, given the potential for alternative functional outcomes, the ability of
GPCRs to dimerise is likely to remain a focus for intense research for a number of
years to come. As our study has not demonstrated specific interactions between
GHS-R1a, GHS-R1b and GPR39, it is possible that these receptors do not form
physiologically significant dimers. In contrast to our study, human GHS-R1a and
GHS-R1b were recently directly demonstrated to heterodimerise (Leung et al. 2007).
This discrepancy with our findings could be due to differences in interpretation of the
co-immunoprecipitation and BRET2 data. While we cannot conclusively prove that
GHS-R1a/GHS-R1b and GHS-R1a/GPR39 heterodimers do not form, our findings
are supported by recent opinions being expressed in the literature casting doubt on
class A GPCR heterodimerisation. The development of new, more robust
technologies is required to resolve this issue in the future. Importantly, we believe,
that given the current knowledge of the potential limitations of the co-
immunoprecipitation and resonance energy transfer methodologies, cautious
interpretation of such data is required. This would avoid spurious additional research
being performed that may be based on weak fundamental data. Given the important
role of ghrelin and zinc in the progression of prostate cancer, the receptors, GHS-
R1a, GHS-R1b and GPR39, may yet provide novel targets for the development of
adjuvant prostate cancer therapeutics.
178
CHAPTER 8
REFERENCES
179
AbdAlla, S., Abdel-Baset, A., Lother, H., El Massiery, A. and Quitterer, U. (2005). Mesangial AT1/B2 receptor heterodimers contribute to angiotensin II hyperresponsiveness in experimental hypertension. Journal of Molecular Neuroscience 26(2-3): 185-192.
AbdAlla, S., Lother, H., el Massiery, A. and Quitterer, U. (2001). Increased AT1
receptor heterodimers in preeclampsia mediate enhanced angiotensin II responsiveness. Nature Medicine 7(9): 1003-1009.
AbdAlla, S., Lother, H. and Quitterer, U. (2000). AT1-receptor heterodimers show
enhanced G-protein activation and altered receptor sequestration. Nature 407(6800): 94-98.
Adeghate, E. and Ponery, A. (2002). Ghrelin stimulates insulin secretion from the
pancreas of normal and diabetic rats. Journal of Neuroendocrinology 14(7): 555-560.
Ahn, S., Shenoy, S., Wei, H. and Lefkowitz, R. (2004). Differential Kinetic and
Spatial Patterns of ß-Arrestin and G Protein-mediated ERK Activation by the Angiotensin II Receptor. Journal of Biological Chemistry 279(34): 35518-35525.
Andersson, U., Filipsson, K., Abbott, C., Woods, A., Smith, K., Bloom, S., Carling,
D. and Small, C. (2004). AMP-activated protein kinase plays a role in the control of food intake. Journal of Biological Chemistry 279(13): 12005-12008.
Andreis, P., Malendowicz, L., Trejter, M., Neri, G., Spinazzi, R., Rossi, G. and
Nussdorfer, G. (2003). Ghrelin and growth hormone secretagogue receptor are expressed in the rat adrenal cortex: evidence that ghrelin stimulates the growth, but not the secretory activity of adrenal cells. FEBS letters 536(1-3): 173-179.
Angers, S., Salahpour, A. and Bouvier, M. (2002). Dimerization: An emerging
concept for G protein-coupled receptor ontogeny and function. Annual Reviews in Pharmacology and Toxicology 42(1): 409-435.
Asakawa, A., Inui, A., Fujimiya, M., Sakamaki, R., Shinfuku, N., Ueta, Y., Meguid,
M. and Kasuga, M. (2005). Stomach regulates energy balance via acylated ghrelin and desacyl ghrelin. Gut 54(1): 18-24.
Asakawa, A., Inui, A., Kaga, T., Katsuura, G., Fujimiya, M., Fujino, M. and Kasuga,
M. (2003). Antagonism of ghrelin receptor reduces food intake and body weight gain in mice. Gut 52(7): 947-952.
Asakawa, A., Inui, A., Kaga, T., Yuzuriha, H., Nagata, T., Fujimiya, M., Katsuura,
G., Makino, S., Fujino, M. and Kasuga, M. (2001a). A role of ghrelin in neuroendocrine and behavioral responses to stress in mice. Neuroendocrinology 74: 143-147.
180
Asakawa, A., Inui, A., Kaga, T., Yuzuriha, H., Nagata, T., Ueno, N., Makino, S., Fujimiya, M., Niijima, A. and Fujino, M. (2001b). Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 120(2): 337-345.
Ataka, K., Inui, A., Asakawa, A., Kato, I. and Fujimiya, M. (2008). Obestatin
inhibits motor activity in the antrum and duodenum in the fed state of conscious rats. American Journal of Physiology- Gastrointestinal and Liver Physiology 294(5): G1210-1218.
Babcock, G., Farzan, M. and Sodroski, J. (2003). Ligand-independent dimerization
of CXCR4, a principal HIV-1 coreceptor. Journal of Biological Chemistry 278(5): 3378-3385.
Bacart, J., Corbel, C., Jockers, R., Bach, S. and Couturier, C. (2008). The BRET
technology and its application to screening assays. Biotechnology Journal 3(3): 311 - 324.
Baiguera, S., Conconi, M., Guidolin, D., Mazzocchi, G., Malendowicz, L.,
Parnigotto, P., Spinazzi, R. and Nussdorfer, G. (2004). Ghrelin inhibits in vitro angiogenic activity of rat brain microvascular endothelial cells. International Journal of Molecular Medicine 14(5): 849-854.
Baldanzi, G., Filigheddu, N., Cutrupi, S., Catapano, F., Bonissoni, S., Fubini, A.,
Malan, D., Baj, G., Granata, R. and Broglio, F. (2002). Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT. Journal of Cell Biology 159(6): 1029-1037.
Bang, A., Soule, S., Yandle, T., Richards, A. and Pemberton, C. (2006).
Characterisation of proghrelin peptides in mammalian tissue and plasma. Journal of Endocrinology 192(2): 313-323.
Barki-Harrington, L., Bookout, A., Wang, G., Lamb, M., Leeb-Lundberg, L. and
Daaka, Y. (2003). Requirement for direct cross-talk between B1 and B2 kinin receptors for the proliferation of androgen-insensitive prostate cancer PC3 cells. Biochemical Journal 371(2): 581-587.
Barreiro, M., Gaytan, F., Castellano, J., Suominen, J., Roa, J., Gaytan, M., Aguilar,
E., Dieguez, C., Toppari, J. and Tena-Sempere, M. (2004). Ghrelin inhibits the proliferative activity of immature Leydig cells in vivo and regulates stem cell factor messenger ribonucleic acid expression in rat testis. Endocrinology 145(11): 4825-4834.
Bassil, A., Häglund, Y., Brown, J., Rudholm, T., Hellström, P., Näslund, E., Lee, K.
and Sanger, G. (2006). Little or no ability of obestatin to interact with ghrelin or modify motility in the rat gastrointestinal tract. British Journal of Pharmacology 150(1): 58-64.
Bastiaens, P., Majoul, I., Verveer, P., Söling, H. and Jovin, T. (1996). Imaging the
intracellular trafficking and state of the AB5 quaternary structure of cholera
181
toxin. The EMBO Journal 15(16): 4246-4253. Bayburt, T., Leitz, A., Xie, G., Oprian, D. and Sligar, S. (2007). Transducin
activation by nanoscale lipid bilayers containing one and two rhodopsins. Journal of Biological Chemistry 282(20): 14875-14881.
Bedendi, I., Alloatti, G., Marcantoni, A., Malan, D., Catapano, F., Ghé, C.,
Deghenghi, R., Ghigo, E. and Muccioli, G. (2003). Cardiac effects of ghrelin and its endogenous derivatives des-octanoyl ghrelin and des-Gln14-ghrelin. European Journal of Pharmacology 476(1-2): 87-95.
Berglund, M., Schober, D., Esterman, M. and Gehlert, D. (2003). Neuropeptide Y Y4
receptor homodimers dissociate upon agonist stimulation. Journal of Pharmacology and Experimental Therapeutics 307(3): 1120-1126.
Bertaccini, A., Pernetti, R., Marchiori, D., Pagotto, U., Palladoro, F., Palmieri, F.,
Vitullo, G., Guidi, M. and Martorana, G. (2009). Variations in blood ghrelin levels in prostate cancer patients submitted to hormone suppressive treatment. Anticancer Research 29(4): 1345-1348.
Bertrand, G. and Vladesco, R. (1921). Intervention probable du zinc dans les
phenomenes de fecondation chez les animaux vertebres. Comptes Rendus de l'Académie des Sciences 173: 176–179.
Bertrand, L., Parent, S., Caron, M., Legault, M., Joly, E., Angers, S., Bouvier, M.,
Brown, M., Houle, B. and Ménard, L. (2002). The BRET2/arrestin assay in stable recombinant cells: A platform to screen for compounds that interact with G protein-coupled receptors (GPCRS). Journal of Receptors and Signal Transduction 22(1): 533-541.
Black, P. C., Mize, G. J., Karlin, P., Greenberg, D. L., Hawley, S. J., True, L. D.,
Vessella, R. L. and Takayama, T. K. (2007). Overexpression of protease-activated receptors-1,-2, and-4 (PAR-1, -2, and -4) in prostate cancer. Prostate 67(7): 743-56.
Blackburn, P., Simpson, C., Nibbs, R., O'Hara, M., Booth, R., Poulos, J., Isaacs, N.
and Graham, G. (2004). Purification and biochemical characterization of the D6 chemokine receptor. Biochemical Journal 379(2): 263-272.
Blank, N., Burger, R., Duerr, B., Bakker, F., Wohlfarth, A., Dumitriu, I., Kalden, J.
R. and Herrmann, M. (2002). MEK inhibitor U0126 interferes with immunofluorescence analysis of apoptotic cell death. Cytometry 48(4): 179-84.
Borjigin, J. and Nathans, J. (1994). Insertional mutagenesis as a probe of rhodopsin's
topography, stability, and activity. Journal of Biological Chemistry 269(20): 14715-14722.
Bouvier, M., Heveker, N., Jockers, R., Marullo, S. and Milligan, G. (2007). BRET
analysis of GPCR oligomerization: newer does not mean better. Nature
182
Methods 4(1): 3. Bouvier, M. (2001). Oligomerization of G-protein-coupled transmitter receptors.
Nature Reviews Neuroscience 2(4): 274-286. Bowers, C., Momany, F., Reynolds, G. and Hong, A. (1984). On the in vitro and in
vivo activity of a new synthetic hexapeptide that acts on the pituitary to specifically release growth hormone. Endocrinology 114(5): 1537-1545.
Breit, A., Lagace, M. and Bouvier, M. (2004). Hetero-oligomerization between ß2-
and ß3-adrenergic receptors generates a ß-adrenergic signalling unit with distinct functional properties. Journal of Biological Chemistry 279(27): 28756-28765.
Brescianu, E., Rapetti, D., Dona, F., Bulgarelli, I., Tamiazzo, L., Locatelli, V. and
Torsello, A. (2006). Obestatin inhibits feeding but does not modulate GH and corticosterone secretion in the rat. Journal of Endocrinological Investigation 29(8): RC16-18.
Bridges, T. M. and Lindsley, C. W. (2008). G-protein-coupled receptors: from
classical modes of modulation to allosteric mechanisms. ACS Chemical Biology 3(9): 530-41.
Broglio, F., Arvat, E., Benso, A., Gottero, C., Muccioli, G., Papotti, M., Lely, A.,
Deghenghi, R. and Ghigo, E. (2001). Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in humans. Journal of Clinical Endocrinology & Metabolism 86(10): 5083-5083.
Bullis, B., Li, X., Rieder, C., Singh, D., Berthiaume, L. and Fliegel, L. (2002).
Properties of the Na+/H+ exchanger protein detergent-resistant aggregation and membrane microdistribution. FEBS Letters 269(19): 4887-4895.
Camina, J., Campos, J., Caminos, J., Dieguez, C. and Casanueva, F. (2007a).
Obestatin-mediated proliferation of human retinal pigment epithelial cells: regulatory mechanisms. Journal of Cellular Physiology 211(1): 1-9.
Camina, J., Lodeiro, M., Ischenko, O., Martini, A. and Casanueva, F. (2007b).
Stimulation by ghrelin of p42/p44 mitogen-activated protein kinase through the GHS-R1a receptor: Role of G-proteins and ß-arrestins. Journal of Cellular Physiology 213(1): 187-200.
Camina, J. (2006). Cell biology of the ghrelin receptor. Journal of
Neuroendocrinology 18(1): 65-76. Canals, M., Lopez-Gimenez, J. and Milligan, G. (2009). Cell surface delivery and
structural re-organization by pharmacological chaperones of an oligomerization-defective α1b-adrenoceptor mutant demonstrates membrane targeting of GPCR oligomers. Biochemical Journal 417(1): 161-172.
183
Carlini, V., Schiöth, H. and debarioglio, S. (2007). Obestatin improves memory performance and causes anxiolytic effects in rats. Biochemical and Biophysical Research Communications 352(4): 907-912.
Carlini, V., Monzón, M., Varas, M., Cragnolini, A., Schiöth, H., Scimonelli, T. and
de Barioglio, S. (2002). Ghrelin increases anxiety-like behavior and memory retention in rats. Biochemical and Biophysical Research Communications 299(5): 739-743.
Cassoni, P., Allia, E., Marrocco, T., Ghe, C., Ghigo, E., Muccioli, G. and Papotti, M.
(2006). Ghrelin and cortistatin in lung cancer: expression of peptides and related receptors in human primary tumors and in vitro effect on the H345 small cell carcinoma cell line. Journal of Endocrinology Investigation 29(9): 781-90.
Cassoni, P., Ghe, C., Marrocco, T., Tarabra, E., Allia, E., Catapano, F., Deghenghi,
R., Ghigo, E., Papotti, M. and Muccioli, G. (2004). Expression of ghrelin and biological activity of specific receptors for ghrelin and des-acyl ghrelin in human prostate neoplasms and related cell lines. European Journal of Endocrinology 150(2): 173-184.
Cassoni, P., Papotti, M., Ghe, C., Catapano, F., Sapino, A., Graziani, A., Deghenghi,
R., Reissmann, T., Ghigo, E. and Muccioli, G. (2001). Identification, characterization, and biological activity of specific receptors for natural (ghrelin) and synthetic growth hormone secretagogues and analogs in human breast carcinomas and cell lines. Journal of Clinical Endocrinology & Metabolism 86(4): 1738-1745.
Chabre, M., Deterre, P. and Antonny, B. (2009). The apparent cooperativity of some
GPCRs does not necessarily imply dimerization. Trends in Pharmacological Sciences 30(4): 182-187.
Chabre, M. and le Maires, M. (2005). Monomeric G-protein-coupled receptor as a
functional unit. Biochemistry 44(27): 9395-9403. Chabre, M., Cone, R. and Saibil, H. (2003). Biophysics (communication arising): Is
rhodopsin dimeric in native retinal rods? Nature 426(6962): 30-31. Chan, C. and Cheng, C. (2004). Identification and functional characterization of two
alternatively spliced growth hormone secretagogue receptor transcripts from the pituitary of black seabream Acanthopagrus schlegeli. Molecular and Cellular Endocrinology 214(1-2): 81-95.
Chan, F., Siegel, R., Zacharias, D., Swofford, R., Holmes, K., Tsien, R. and Lenardo,
M. (2001). Fluorescence resonance energy transfer analysis of cell surface receptor interactions and signalling using spectral variants of the green fluorescent protein. Cytometry 44(4): 361-368.
Chang, J. and Korolev, V. (1996). Specific toxicity of tunicamycin in induction of
programmed cell death of sympathetic neurons. Experimental Neurology
184
137(2): 201-211. Chartrel, N., Alvear-Perez, R., Leprince, J., Iturrioz, X., Reaux-Le Goazigo, A.,
Audinot, V., Chomarat, P., Coge, F., Nosjean, O., Rodriguez, M., Galizzi, J. P., Boutin, J. A., Vaudry, H. and Llorens-Cortes, C. (2007). Comment on "Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake". Science 315(5813): 766; author reply 766.
Chen, C., Chien, E., Chang, F., Lu, C., Luo, J. and Lee, S. (2008). Impacts of
peripheral obestatin on colonic motility and secretion in conscious fed rats. Peptides 29(9): 1603-1608.
Chen, C., Inui, A., Asakawa, A., Fujino, K., Kato, I., Chen, C., Ueno, N. and
Fujimiya, M. (2005). Des-acyl ghrelin acts by CRF type 2 receptors to disrupt fasted stomach motility in conscious rats. Gastroenterology 129(1): 8-25.
Cherezov, V., Rosenbaum, D. M., Hanson, M. A., Rasmussen, S. G., Thian, F. S.,
Kobilka, T. S., Choi, H. J., Kuhn, P., Weis, W. I., Kobilka, B. K. and Stevens, R. C. (2007). High-resolution crystal structure of an engineered human ß2-adrenergic G protein-coupled receptor. Science 318(5854): 1258-65.
Choi, K., Roh, S., Hong, Y., Shrestha, Y., Hishikawa, D., Chen, C., Kojima, M.,
Kangawa, K. and Sasaki, S. (2003). The role of ghrelin and growth hormone secretagogues receptor on rat adipogenesis. Endocrinology 144(3): 754-759.
Chow, K., Leung, P., Cheng, C., Cheung, W. and Wise, H. (2008). The constitutive
activity of ghrelin receptors is decreased by co-expression with vasoactive prostanoid receptors when over-expressed in human embryonic kidney 293 cells. International Journal of Biochemistry and Cell Biology 40(11): 2627-2637.
Chu, K., Chow, K., Leung, P., Lau, P., Chan, C., Cheng, C. and Wise, H. (2007).
Over-expression of the truncated ghrelin receptor polypeptide attenuates the constitutive activation of phosphatidylinositol-specific phospholipase C by ghrelin receptors but has no effect on. International Journal of Biochemistry and Cell Biology 39(4): 752-764.
Chung, H., Kim, E., Lee, D., Seo, S., Ju, S., Lee, D., Kim, H. and Park, S. (2007).
Ghrelin inhibits apoptosis in hypothalamic neuronal cells during oxygen-glucose deprivation. Endocrinology 148(1): 148-159.
Chung, S., Hammarsten, P., Josefsson, A., Stattin, P., Granfors, T., Egevad, L.,
Mancini, G., Lutz, B., Bergh, A. and Fowler, C. (2009). A high cannabinoid CB1 receptor immunoreactivity is associated with disease severity and outcome in prostate cancer. European Journal of Cancer 45(1): 174-182.
Clegg, R., Murchie, A., Zechel, A. and Lilley, D. (1993). Observing the helical
geometry of double-stranded DNA in solution by fluorescence resonance energy transfer. Proceedings of the National Academy of Sciences 90(7): 2994-2998.
185
Conconi, M., Nico, B., Guidolin, D., Baiguera, S., Spinazzi, R., Rebuffat, P.,
Malendowicz, L., Vacca, A., Carraro, G. and Parnigotto, P. (2004). Ghrelin inhibits FGF-2-mediated angiogenesis in vitro and in vivo. Peptides 25(12): 2179-2185.
Costello, L. and Franklin, R. (2009). Prostatic fluid electrolyte composition for the
screening of prostate cancer: a potential solution to a major problem. Prostate Cancer and Prostatic Diseases 12: 17-24.
Costello, L. and Franklin, R. (2006). The clinical relevance of the metabolism of
prostate cancer; zinc and tumor suppression: connecting the dots. Molecular Cancer 5: 17.
Costello, L., Franklin, R., Feng, P., Tan, M. and Bagasra, O. (2005). Zinc and
prostate cancer: A critical scientific, medical, and public interest issue (United States). Cancer Causes and Control 16(8): 901-915.
Costello, L., Liu, Y., Franklin, R. and Kennedy, M. (1997). Zinc inhibition of
mitochondrial aconitase and its importance in citrate metabolism of prostate epithelial cells. Journal of Biological Chemistry 272(46): 28875-28881.
Couve, A., Filippov, A., Connolly, C., Bettler, B., Brown, D. and Moss, S. (1998).
Intracellular retention of recombinant GABAB receptors. Journal of Biological Chemistry 273(41): 26361-26367.
Cowley, M., Smith, R., Diano, S., Tschöp, M., Pronchuk, N., Grove, K., Strasburger,
C., Bidlingmaier, M., Esterman, M. and Heiman, M. (2003). The distribution and mechanism of action of ghrelin in the CNS demonstrates a novel hypothalamic circuit regulating energy homeostasis. Neuron 37(4): 649-661.
Cummings, D., Purnell, J., Frayo, R., Schmidova, K., Wisse, B. and Weigle, D.
(2001). A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 50(8): 1714-1719.
Czifra, G., Varga, A., Nyeste, K., Marincsák, R., Tóth, B., Kovács, I., Kovács, L. and
Bíró, T. (2009). Increased expressions of cannabinoid receptor-1 and transient receptor potential vanilloid-1 in human prostate carcinoma. Journal of Cancer Research and Clinical Oncology 135(4): 507-514.
Daaka, Y. (2004). G proteins in cancer: the prostate cancer paradigm. Science's
Signal Transduction Knowledge Environment 2004(216): re2. Dacres, H., Dumancic, M., Horne, I. and Trowell, S. (2009). Direct comparison of
fluorescence-and bioluminescence-based resonance energy transfer methods for real-time monitoring of thrombin-catalysed proteolytic cleavage. Biosensors and Bioelectronics 24(5): 1164-1170.
Dacres, H., Dumancic, M., Horne, I. and Trowell, S. (2008). Direct comparison of
bioluminescence-based resonance energy transfer methods for monitoring of
186
proteolytic cleavage. Analytical Biochemistry 385(2): 194-202. Dalrymple, M., Pfleger, K. and Eidne, K. (2008). G protein-coupled receptor dimers:
Functional consequences, disease states and drug targets. Pharmacology and Therapeutics 118(3): 359-371.
Date, Y., Nakazato, M., Hashiguchi, S., Dezaki, K., Mondal, M. S., Hosoda, H.,
Kojima, M., Kangawa, K., Arima, T., Matsuo, H., Yada, T. and Matsukura, S. (2002). Ghrelin is present in pancreatic alpha-cells of humans and rats and stimulates insulin secretion. Diabetes 51(1): 124-9.
Date, Y., Kojima, M., Hosoda, H., Sawaguchi, A., Mondal, M., Suganuma, T.,
Matsukura, S., Kangawa, K. and Nakazato, M. (2000). Ghrelin, a novel growth hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts of rats and humans. Endocrinology 141(11): 4255-4261.
Day, R. and Schaufele, F. (2008). Fluorescent protein tools for studying protein
dynamics in living cells: a review. Journal of Biomedical Optics 13(3): 031202.
De, A., Ray, P., Loening, A. and Gambhir, S. (2009). BRET3: a red-shifted
bioluminescence resonance energy transfer (BRET)-based integrated platform for imaging protein-protein interactions from single live cells and living animals. The FASEB Journal.
De Smet, B., Thijs, T., Peeters, T. and Depoortere, I. (2007). Effect of peripheral
obestatin on gastric emptying and intestinal contractility in rodents. Neurogastroenterology and Motility 19(3): 211-217.
De Vries, L., Zheng, B., Fischer, T., Elenko, E. and Farquhar, M. (2000). The
regulator of G protein signalling family. Annual Review of Pharmacology and Toxicology 40(1): 235-271.
De Vriese, C., Gregoire, F., De Neef, P., Robberecht, P. and Delporte, C. (2005).
Ghrelin is produced by the human erythroleukemic HEL cell line and involved in an autocrine pathway leading to cell proliferation. Endocrinology 146(3): 1514-1522.
DeBoer, M. (2008). Emergence of ghrelin as a treatment for cachexia syndromes.
Nutrition 24(9): 806-814. Delhanty, P., van Koetsveld, P., Gauna, C., van de Zande, B., Vitale, G., Hofland, L.
and van der Lely, A. (2007). Ghrelin and its unacylated isoform stimulate the growth of adrenocortical tumor cells via an anti-apoptotic pathway. American Journal of Physiology- Endocrinology And Metabolism 293(1): E302-E309.
Delhanty, P., van der Eerden, B., van der Velde, M., Gauna, C., Pols, H., Jahr, H.,
Chiba, H., Van der Lely, A. and van Leeuwen, J. (2006). Ghrelin and unacylated ghrelin stimulate human osteoblast growth via mitogen-activated
187
protein kinase (MAPK)/phosphoinositide 3-kinase (PI3K) pathways in the absence of GHS-R1a. Journal of Endocrinology 188(1): 37-47.
Desouki, M., Geradts, J., Milon, B., Franklin, R. and Costello, L. (2007). hZip 2 and
hZip 3 zinc transporters are down regulated in human prostate adenocarcinomatous glands. Molecular Cancer 6(1): 37.
Devi, L. (2001). Heterodimerization of G-protein-coupled receptors: pharmacology,
signalling and trafficking. Trends in Pharmacological Sciences 22(10): 532-537.
DeWire, S., Ahn, S., Lefkowitz, R. and Shenoy, S. (2007). ß-arrestins and cell
signalling. Dinger, M., Bader, J., Kobor, A., Kretzschmar, A. and Beck-Sickinger, A. (2003).
Homodimerization of neuropeptide Y receptors investigated by fluorescence resonance energy transfer in living cells. Journal of Biological Chemistry 278(12): 10562-10571.
Dittmer, S., Sahin, M., Pantlen, A., Saxena, A., Toutzaris, D., Pina, A., Geerts, A.,
Golz, S. and Methner, A. (2008). The constitutively active orphan G-protein-coupled receptor GPR39 protects from cell death by increasing secretion of pigment epithelium-derived growth factor. Journal of Biological Chemistry 283(11): 7074-7081.
Dixit, V., Schaffer, E., Pyle, R., Collins, G., Sakthivel, S., Palaniappan, R., Lillard, J.
and Taub, D. (2004). Ghrelin inhibits leptin-and activation-induced proinflammatory cytokine expression by human monocytes and T cells. Journal of Clinical Investigation 114(1): 57-66.
Drake, M., Shenoy, S. and Lefkowitz, R. (2006). Trafficking of G protein-coupled
receptors. Circulation Research 99(6): 570-582. Dudek, H., Datta, S., Franke, T., Birnbaum, M., Yao, R., Cooper, G., Segal, R.,
Kaplan, D. and Greenberg, M. (1997). Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 275(5300): 661-665.
Duxbury, M., Waseem, T., Ito, H., Robinson, M., Zinner, M., Ashley, S. and Whang,
E. (2003). Ghrelin promotes pancreatic adenocarcinoma cellular proliferation and invasiveness. Biochemical and Biophysical Research Communications 309(2): 464-468.
Dye, B. (2005). Flow cytometric analysis of CFP–YFP FRET as a marker for in vivo
protein–protein interaction. Clinical and Applied Immunology Reviews 5(5): 307-324.
Egerod, K. L., Holst, B., Petersen, P. S., Hansen, J. B., Mulder, J., Hokfelt, T. and
Schwartz, T. W. (2007). GPR39 splice variants versus antisense gene LYPD1: expression and regulation in gastrointestinal tract, endocrine pancreas, liver, and white adipose tissue. Molecular Endocrinology 21(7):
188
1685-1698. Elbein, A. (1987). Inhibitors of the biosynthesis and processing of N-linked
oligosaccharide chains. Annual Review of Biochemistry 56(1): 497-534. Ellis, J., Pediani, J., Canals, M., Milasta, S. and Milligan, G. (2006). Orexin-1
receptor-cannabinoid CB1 receptor heterodimerization results in both ligand-dependent and-independent coordinated alterations of receptor localization and function. Journal of Biological Chemistry 281(50): 38812-38824.
Esler, W. P., Rudolph, J., Claus, T. H., Tang, W., Barucci, N., Brown, S. E., Bullock,
W., Daly, M., Decarr, L., Li, Y., Milardo, L., Molstad, D., Zhu, J., Gardell, S. J., Livingston, J. N. and Sweet, L. J. (2007). Small-molecule ghrelin receptor antagonists improve glucose tolerance, suppress appetite, and promote weight loss. Endocrinology 148(11): 5175-5185.
Fan, T., Varghese, G., Nguyen, T., Tse, R., O'Dowd, B. and George, S. (2005). A
Role for the Distal Carboxyl Tails in Generating the Novel Pharmacology and G Protein Activation Profile of μ and δ Opioid Receptor Hetero-oligomers. Journal of Biological Chemistry 280(46): 38478-38488.
Feng, P., Liang, J., Li, T., Guan, Z., Zou, J., Franklin, R. and Costello, L. (2000).
Zinc induces mitochondria apoptogenesis in prostate cells. Molecular Urology 4: 31-36.
Filigheddu, N., Gnocchi, V., Coscia, M., Cappelli, M., Porporato, P., Taulli, R.,
Traini, S., Baldanzi, G., Chianale, F. and Cutrupi, S. (2007). Ghrelin and des-acyl ghrelin promote differentiation and fusion of C2C12 skeletal muscle cells. Molecular Biology of the Cell 18(3): 986-994.
Fiorentini, C., Busi, C., Gorruso, E., Gotti, C., Spano, P. and Missale, C. (2008).
Reciprocal regulation of dopamine D1 and D3 receptor function and trafficking by heterodimerization. Molecular Pharmacology 74(1): 59-69.
Fitzpatrick, J., Schulman, C., Zlotta, A. and Schroder, F. (2009). Prostate cancer: a
serious disease suitable for prevention. BJU international 103(7): 864-870. Floyd, D., Geva, A., Bruinsma, S., Overton, M., Blumer, K. and Baranski, T. (2003).
C5a Receptor Oligomerization II - Fluorescence resonance energy transfer studies of a human G protein-coupled receptor expressed in yeast. Journal of Biological Chemistry 278(37): 35354-35361.
Foord, S., Bonner, T., Neubig, R., Rosser, E., Pin, J., Davenport, A., Spedding, M.
and Harmar, A. (2005). International Union of Pharmacology. XLVI. G protein-coupled receptor list. Pharmacological Reviews 57(2): 279-288.
Forster, T. (1948). Zwischenmolekulare energiewanderung und fluoreszenz. Annalen
der Physik 437(1-2): 55-75. Fotiadis, D., Jastrzebska, B., Philippsen, A., Müller, D., Palczewski, K. and Engel,
189
A. (2006). Structure of the rhodopsin dimer: a working model for G-protein-coupled receptors. Current Opinion in Structural Biology 16(2): 252-259.
Fotiadis, D., Liang, Y., Filipek, S., Saperstein, D., Engel, A. and Palczewski, K.
(2003). Atomic-force microscopy: rhodopsin dimers in native disc membranes. Nature 421(6919): 127-128.
Franklin, R., Feng, P., Milon, B., Desouki, M., Singh, K., Kajdacsy-Balla, A.,
Bagasra, O. and Costello, L. (2005). hZIP 1 zinc uptake transporter down regulation and zinc depletion in prostate cancer. Molecular Cancer 4(1): 32.
Fredriksson, R., Lagerstrom, M., Lundin, L. and Schioth, H. (2003). The G-protein-
coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Molecular Pharmacology 63(6): 1256-1272.
Fukushima, N., Hanada, R., Teranishi, H., Fukue, Y., Tachibana, T., Ishikawa, H.,
Takeda, S., Takeuchi, Y., Fukumoto, S. and Kangawa, K. (2004). Ghrelin directly regulates bone formation. Journal of Bone and Mineral Research 20(5): 790-798.
Gandiá, J., Lluis, C., Ferre, S., Franco, R. and Ciruela, F. (2008). Light resonance
energy transfer-based methods in the study of G protein-coupled receptor oligomerization. BioEssays 30: 82-89.
Gaskin, F., Farr, S., Banks, W., Kumar, V. and Morley, J. (2003). Ghrelin-induced
feeding is dependent on nitric oxide. Peptides 24(6): 913-918. Gauna, C., Kiewiet, R., Janssen, J., van de Zande, B., Delhanty, P., Ghigo, E.,
Hofland, L., Themmen, A. and van der Lely, A. (2007). Unacylated ghrelin acts as a potent insulin secretagogue in glucose-stimulated conditions. American Journal of Physiology- Endocrinology And Metabolism 293(3): E697.
Gehret, A., Bajaj, A., Naider, F. and Dumont, M. (2006). Oligomerization of the
yeast α-factor receptor: implications for dominant negative effects of mutant receptors. Journal of Biological Chemistry 281(30): 20698-20714.
George, S., O'Dowd, B. and Lee, S. (2002). G-protein-coupled receptor
oligomerization and its potential for drug discovery. Nature Reviews Drug Discovery 1(10): 808-820.
Gloriam, D., Fredriksson, R. and Schiöth, H. (2007). The G protein-coupled receptor
subset of the rat genome. BMC genomics 8(1): 338. Gnanapavan, S., Kola, B., Bustin, S., Morris, D., McGee, P., Fairclough, P.,
Bhattacharya, S., Carpenter, R., Grossman, A. and Korbonits, M. (2002). The tissue distribution of the mRNA of ghrelin and subtypes of its receptor, GHS-R, in humans. Journal of Clinical Endocrinology & Metabolism 87(6): 2988-2988.
190
Golovine, K., Makhov, P., Uzzo, R., Shaw, T., Kunkle, D. and Kolenko, V. (2008).
Overexpression of the Zinc Uptake Transporter hZIP1 Inhibits Nuclear Factor-κ B and Reduces the Malignant Potential of Prostate Cancer Cells In vitro and In vivo. Clinical Cancer Research 14(17): 5376-5384.
Gomella, L. G., Johannes, J. and Trabulsi, E. J. (2009). Current prostate cancer
treatments: effect on quality of life. Urology 73(5 Suppl): S28-35. Gomes, I., Jordan, B., Gupta, A., Trapaidze, N., Nagy, V. and Devi, L. (2000).
Heterodimerization of μ and δ opioid receptors: a role in opiate synergy. Journal of Neuroscience 20(22): 110-110.
González-Maeso, J., Ang, R., Yuen, T., Chan, P., Weisstaub, N., López-Giménez, J.,
Zhou, M., Okawa, Y., Callado, L. and Milligan, G. (2008). Identification of a serotonin/glutamate receptor complex implicated in psychosis. Nature 452(7183): 93-97.
Gorshkova, E., Erokhina, T., Stroganova, T., Yelina, N., Zamyatnin, A., Kalinina,
N., Schiemann, J., Solovyev, A. and Morozov, S. (2003). Immunodetection and fluorescent microscopy of transgenically expressed hordeivirus TGBp3 movement protein reveals its association with endoplasmic reticulum elements in close proximity to plasmodesmata. Journal of General Virology 84(4): 985-994.
Gourcerol, G., St-Pierre, D. H. and Tache, Y. (2007). Lack of obestatin effects on
food intake: should obestatin be renamed ghrelin-associated peptide (GAP)? Regulatory Peptides 141(1-3): 1-7.
Gourcerol, G., Million, M., Adelson, D., Wang, Y., Wang, L., Rivier, J., St-Pierre, D.
and Tache, Y. (2006). Lack of interaction between peripheral injection of CCK and obestatin in the regulation of gastric satiety signalling in rodents. Peptides 27(11): 2811-2819.
Granata, R., Settanni, F., Gallo, D., Trovato, L., Biancone, L., Cantaluppi, V., Nano,
R., Annunziata, M., Campiglia, P., Arnoletti, E., Ghe, C., Volante, M., Papotti, M., Muccioli, G. and Ghigo, E. (2008). Obestatin promotes survival of pancreatic beta-cells and human islets and induces expression of genes involved in the regulation of beta-cell mass and function. Diabetes 57(4): 967-979.
Granata, R., Settanni, F., Biancone, L., Trovato, L., Nano, R., Bertuzzi, F.,
Destefanis, S., Annunziata, M., Martinetti, M., Catapano, F., Ghe, C., Isgaard, J., Papotti, M., Ghigo, E. and Muccioli, G. (2007). Acylated and unacylated ghrelin promote proliferation and inhibit apoptosis of pancreatic beta-cells and human islets: involvement of 3',5'-cyclic adenosine monophosphate/protein kinase A, extracellular signal-regulated kinase 1/2, and phosphatidyl inositol 3-Kinase/Akt signalling. Endocrinology 148(2): 512-529.
191
Grant, D., Zhang, W., McGhee, E., Bunney, T., Talbot, C., Kumar, S., Munro, I., Dunsby, C., Neil, M. and Katan, M. (2008). Multiplexed FRET to image multiple signalling events in live cells. Biophysical Journal 95(10): 69-71.
Green, B., Irwin, N. and Flatt, P. (2007). Direct and indirect effects of obestatin
peptides on food intake and the regulation of glucose homeostasis and insulin secretion in mice. Peptides 28(5): 981-987.
Gregan, B., Juergensen, J., Papsdorf, G., Furkert, J., Schaefer, M., Beyermann, M.,
Rosenthal, W. and Oksche, A. (2004). Ligand-dependent differences in the internalization of endothelin A and endothelin B receptor heterodimers. Journal of Biological Chemistry 279(26): 27679-27687.
Groschl, M., Topf, H., Bohlender, J., Zenk, J., Klussmann, S., Dotsch, J., Rascher,
W. and Rauh, M. (2005). Identification of ghrelin in human saliva: production by the salivary glands and potential role in proliferation of oral keratinocytes. Clinical Chemistry 51(6): 997-1006.
Gualillo, O., Lago, F. and Dieguez, C. (2008). Introducing GOAT: a target for
obesity and anti-diabetic drugs? Trends in Pharmacological Sciences 29(8): 398-401.
Guo, C., Luttrell, L. M. and Price, D. T. (2000). Mitogenic signalling in androgen
sensitive and insensitive prostate cancer cell lines. Journal of Urology 163(3): 1027-32.
Gurevich, V. and Gurevich, E. (2008a). GPCR monomers and oligomers: it takes all
kinds. Trends in Neurosciences 31(2): 74-81. Gurevich, V. and Gurevich, E. (2008b). How and why do GPCRs dimerize? Trends
in Pharmacological Sciences 29(5): 234-240. Gurevich, V. and Gurevich, E. (2008c). Rich tapestry of G protein-coupled receptor
signalling and regulatory mechanisms. Molecular Pharmacology 74(2): 312-316.
Gutierrez, J., Solenberg, P., Perkins, D., Willency, J., Knierman, M., Jin, Z., Witcher,
D., Luo, S., Onyia, J. and Hale, J. (2008). Ghrelin octanoylation mediated by an orphan lipid transferase. Proceedings of the National Academy of Sciences 105(17): 6320-6325.
Habib, F., Mason, M., Smith, P. and Stitch, S. (1979). Cancer of the prostate: early
diagnosis by zinc and hormone analysis? British Journal of Cancer 39(6): 700-704.
Hague, C., Uberti, M., Chen, Z., Hall, R. and Minneman, K. (2004). Cell surface
expression of α 1D-adrenergic receptors is controlled by heterodimerization with α 1B-adrenergic receptors. Journal of Biological Chemistry 279(15): 15541-15549.
192
Hamdan, F., Audet, M., Garneau, P., Pelletier, J. and Bouvier, M. (2005). High-throughput screening of G protein-coupled receptor antagonists using a bioluminescence resonance energy transfer 1-based {beta}-arrestin2 recruitment assay. Journal of Biomolecular Screening 10(5): 463-475.
Hanahan, D. and Weinberg, R. (2000). The hallmarks of cancer. Cell 100(1): 57-70. Hansen, J., Hansen, J., Speerschneider, T., Lyngso, C., Erikstrup, N., Burstein, E.,
Weiner, D., Walther, T., Makita, N. and Iiri, T. (2009). Lack of evidence for AT1R/B2R heterodimerization in COS-7, HEK293, and NIH3T3 cells: how common is the AT1R/B2R heterodimer? Journal of Biological Chemistry 284(3): 1831-1839.
Hansen, J., Theilade, J., Haunso, S. and Sheikh, S. (2004). Oligomerization of wild
type and nonfunctional mutant angiotensin II type I receptors inhibits Gαq Protein signalling but not ERK activation. Journal of Biological Chemistry 279(23): 24108-24115.
Hansen, J. L. and Sheikh, S. P. (2004). Functional consequences of 7TM receptor
dimerization. European Journal of Pharmaceutical Sciences 23(4-5): 301-317.
Hanson, M. A. and Stevens, R. C. (2009). Discovery of new GPCR biology: one
receptor structure at a time. Structure 17(1): 8-14. Hanson, M. A., Cherezov, V., Griffith, M. T., Roth, C. B., Jaakola, V. P., Chien, E.
Y., Velasquez, J., Kuhn, P. and Stevens, R. C. (2008). A specific cholesterol binding site is established by the 2.8 A structure of the human ß2-adrenergic receptor. Structure 16(6): 897-905.
Harding, P., Attrill, H., Boehringer, J., Ross, S., Wadhams, G., Smith, E., Armitage,
J. and Watts, A. (2009). Constitutive dimerization of the G-protein coupled receptor, neurotensin receptor 1, reconstituted into phospholipid bilayers. Biophysical Journal 96(3): 964-973.
Harrison, C. and Van der Graaf, P. (2006). Current methods used to investigate G
protein coupled receptor oligomerisation. Journal of Pharmacological and Toxicological Methods 54(1): 26-35.
Herrick-Davis, K., Weaver, B., Grinde, E. and Mazurkiewicz, J. (2006). Serotonin 5-
HT2C receptor homodimer biogenesis in the endoplasmic reticulum: real-time visualization with confocal fluorescence resonance energy transfer. Journal of Biological Chemistry 281(37): 27109-27116.
Higgins, S., Gueorguiev, M. and Korbonits, M. (2007). Ghrelin, the peripheral
hunger hormone. Annals of Medicine 39(2): 116-136. Holliday, N., Holst, B., Rodionova, E., Schwartz, T. and Cox, H. (2007). Importance
of constitutive activity and arrestin-independent mechanisms for intracellular trafficking of the ghrelin receptor. Molecular Endocrinology 21(12): 3100.
193
Holst, B., Egerod, K. L., Jin, C., Petersen, P. S., Ostergaard, M. V., Hald, J.,
Sprinkel, A. M., Storling, J., Mandrup-Poulsen, T., Holst, J. J., Thams, P., Orskov, C., Wierup, N., Sundler, F., Madsen, O. D. and Schwartz, T. W. (2009). G protein-coupled receptor 39 deficiency is associated with pancreatic islet dysfunction. Endocrinology 150(6): 2577-2585.
Holst, B., Egerod, K., Schild, E., Vickers, S., Cheetham, S., Gerlach, L., Storjohann,
L., Stidsen, C., Jones, R. and Beck-Sickinger, A. (2007). GPR39 signalling is stimulated by zinc ions but not by obestatin. Endocrinology 148(1): 13-20.
Holst, B. and Schwartz, T. (2006). Ghrelin receptor mutations-too little height and
too much hunger. Journal of Clinical Investigation 116(3): 637-641. Holst, B., Holliday, N., Bach, A., Elling, C., Cox, H. and Schwartz, T. (2004).
Common structural basis for constitutive activity of the ghrelin receptor family. Journal of Biological Chemistry 279(51): 53806-53817.
Holst, B. and Schwartz, T. (2004). Constitutive ghrelin receptor activity as a
signalling set-point in appetite regulation. Trends in Pharmacological Sciences 25(3): 113-117.
Holst, B., Cygankiewicz, A., Jensen, T., Ankersen, M. and Schwartz, T. (2003). High
constitutive signalling of the ghrelin receptor-identification of a potent inverse agonist. Molecular Endocrinology 17(11): 2201-2210.
Hosoda, H., Kojima, M. and Kangawa, K. (2006). Biological, physiological, and
pharmacological aspects of ghrelin. Journal of Pharmacological Sciences 100(5): 398-410.
Hosoda, H., Kojima, M., Matsuo, H. and Kangawa, K. (2000). Ghrelin and des-acyl
ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochemical and Biophysical Research Communications 279(3): 909-913.
Howard, A. D., Feighner, S. D., Cully, D. F., Arena, J. P., Liberator, P. A.,
Rosenblum, C. I., Hamelin, M., Hreniuk, D. L., Palyha, O. C., Anderson, J., Paress, P. S., Diaz, C., Chou, M., Liu, K. K., McKee, K. K., Pong, S. S., Chaung, L. Y., Elbrecht, A., Dashkevicz, M., Heavens, R., Rigby, M., Sirinathsinghji, D. J., Dean, D. C., Melillo, D. G., Patchett, A. A., Nargund, R., Griffin, P. R., DeMartino, J. A., Gupta, S. K., Schaeffer, J. M., Smith, R. G. and Van der Ploeg, L. H. (1996). A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273(5277): 974-977.
Huynh, H., Nguyen, T. T., Chow, K. H., Tan, P. H., Soo, K. C. and Tran, E. (2003).
Over-expression of the mitogen-activated protein kinase (MAPK) kinase (MEK)-MAPK in hepatocellular carcinoma: its role in tumor progression and apoptosis. BMC Gastroenterology 3: 19.
Hyman, M. and Arp, D. (1993). An electrophoretic study of the thermal-dependent
and reductant-dependent aggregation of the 27 kDa component of ammonia
194
monooxygenase from Nitrosomonas europaea. Electrophoresis 14: 619-627. Inhoff, T., Wiedenmann, B., Klapp, B., Mönnikes, H. and Kobelt, P. (2009). Is
desacyl ghrelin a modulator of food intake? Peptides 30: 991-994. Inui, A., Asakawa, A., Bowers, C., Mantovani, G., Laviano, A., Meguid, M. and
Fujimiya, M. (2004). Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ. The FASEB Journal 18(3): 439-456.
Ishii, K., Otsuka, T., Iguchi, K., Usui, S., Yamamoto, H., Sugimura, Y., Yoshikawa,
K., Hayward, S. and Hirano, K. (2004). Evidence that the prostate-specific antigen (PSA)/Zn2+ axis may play a role in human prostate cancer cell invasion. Cancer Letters 207(1): 79-87.
Isik, N., Hereld, D. and Jin, T. (2008). Fluorescence resonance energy transfer
imaging reveals that chemokine-binding modulates heterodimers of CXCR4 and CCR5 receptors. PLoS One 3(10): e3424.
Jaakola, V. P., Griffith, M. T., Hanson, M. A., Cherezov, V., Chien, E. Y., Lane, J.
R., Ijzerman, A. P. and Stevens, R. C. (2008). The 2.6 angstrom crystal structure of a human A2A adenosine receptor bound to an antagonist. Science 322(5905): 1211-7.
Jacoby, E., Bouhelal, R., Gerspacher, M. and Seuwen, K. (2006). The 7TM G-
protein-coupled receptor target family. ChemMedChem 1(8): 760-782. James, J., Oliveira, M., Carmo, A., Iaboni, A. and Davis, S. (2006). A rigorous
experimental framework for detecting protein oligomerization using bioluminescence resonance energy transfer. Nature Methods 3: 1001-1006.
Jeffery, P., Murray, R., Yeh, A., McNamara, J., Duncan, R., Francis, G., Herington,
A. and Chopin, L. (2005). Expression and function of the ghrelin axis, including a novel preproghrelin isoform, in human breast cancer tissues and cell lines. Endocrine-related cancer 12(4): 839-850.
Jeffery, P., Herington, A. and Chopin, L. (2003). The potential autocrine/paracrine
roles of ghrelin and its receptor in hormone-dependent cancer. Cytokine and Growth Factor Reviews 14(2): 113-122.
Jeffery, P., Herington, A. and Chopin, L. (2002). Expression and action of the growth
hormone releasing peptide ghrelin and its receptor in prostate cancer cell lines. Journal of Endocrinology 172(3): 7-11.
Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., Murray, T. and Thun, M. (2008).
Cancer statistics, 2008. CA: A Cancer Journal for Clinicians 58(2): 71-96. Jensen, A., Hansen, J., Sheikh, S. and Brauner-Osborne, H. (2002). Probing
intermolecular proteinprotein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET). FEBS Journal 269(20): 5076-5087.
195
Jiang, H., Betancourt, L. and Smith, R. (2006). Ghrelin amplifies dopamine
signalling by cross talk involving formation of growth hormone secretagogue receptor/dopamine receptor subtype 1 heterodimers. Molecular Endocrinology 20(8): 1772-1785.
Jones, K., Borowsky, B., Tamm, J., Craig, D., Durkin, M., Dai, M., Yao, W.,
Johnson, M., Gunwaldsen, C. and Huang, L. (1998). GABA B receptors function as a heteromeric assembly of the subunits GABA B R1 and GABA B R2. Nature 396: 674-679.
Jordan, B. A. and Devi, L. A. (1999). G-protein-coupled receptor heterodimerization
modulates receptor function. Nature 399(6737): 697-700. Kamiya, T., Saitoh, O., Yoshioka, K. and Nakata, H. (2003). Oligomerization of
adenosine A2A and dopamine D2 receptors in living cells. Biochemical and Biophysical Research Communications 306(2): 544-549.
Kanamoto, N., Akamizu, T., Tagami, T., Hataya, Y., Moriyama, K., Takaya, K.,
Hosoda, H., Kojima, M., Kangawa, K. and Nakao, K. (2004). Genomic structure and characterization of the 5'-flanking region of the human ghrelin gene. Endocrinology 145(9): 4144-4153.
Kapica, M., Zabielska, M., Puzio, I., Jankowska, A., Kato, I., Kuwahara, A. and
Zabielski, R. (2007). Obestatin stimulates the secretion of pancreatic juice enzymes through a vagal pathway in anaesthetized rats - preliminary results. Journal of Physiology and Pharmacology 58(Suppl 3): 123-30.
Katergari, S., Milousis, A., Pagonopoulou, O., Asimakopoulos, B. and Nikolettos, N.
(2008). Ghrelin in pathological conditions. Endocrine Journal 55(3): 439-453.
Kaupmann, K., Malitschek, B., Schuler, V., Heid, J., Froestl, W., Beck, P.,
Mosbacher, J., Bischoff, S., Kulik, A., Shigemoto, R., Karschin, A. and Bettler, B. (1998). GABA(B)-receptor subtypes assemble into functional heteromeric complexes. Nature 396(6712): 683-687.
Kent, T., McAlpine, C., Sabetnia, S. and Presland, J. (2007). G-protein-coupled
receptor heterodimerization: Assay technologies to clinical significance. Current Opinion in Drug Discovery and Development 10(5): 580-589.
Kenworthy, A. (2001). Imaging protein-protein interactions using fluorescence
resonance energy transfer microscopy. Methods 24(3): 289-296. Kenworthy, A. and Edidin, M. (1998). Distribution of a
glycosylphosphatidylinositol-anchored protein at the apical surface of MDCK cells examined at a resolution of< 100 A using imaging fluorescence resonance energy transfer. The Journal of Cell Biology 142(1): 69-84.
Kim, M., Yoon, C., Jang, P., Park, Y., Shin, C., Park, H., Ryu, J., Pak, Y., Park, J.
196
and Lee, K. (2004). The mitogenic and antiapoptotic actions of ghrelin in 3T3-L1 adipocytes. Molecular Endocrinology 18(9): 2291-2301.
Kim, S., Her, S., Park, S., Kim, D., Park, K., Lee, H., Han, B., Kim, M., Shin, C. and
Kim, S. (2005). Ghrelin stimulates proliferation and differentiation and inhibits apoptosis in osteoblastic MC3T3-E1 cells. Bone 37(3): 359-369.
Kirchner, H., Gutierrez, J., Solenberg, P., Pfluger, P., Czyzyk, T., Willency, J.,
Schürmann, A., Joost, H., Jandacek, R. and Hale, J. (2009). GOAT links dietary lipids with the endocrine control of energy balance. Nature Medicine 15(7): 741-745.
Kobelt, P., Wisser, A., Stengel, A., Goebel, M., Bannert, N., Gourcerol, G., Inhoff,
T., Noetzel, S., Wiedenmann, B. and Klapp, B. (2008). Peripheral obestatin has no effect on feeding behavior and brain Fos expression in rodents. Peptides 29(6): 1018-1027.
Kobilka, B. and Schertler, G. F. (2008). New G-protein-coupled receptor crystal
structures: insights and limitations. Trends in Pharmacological Sciences 29(2): 79-83.
Kocan, M., See, H., Seeber, R., Eidne, K. and Pfleger, K. (2008). Demonstration of
improvements to the bioluminescence resonance energy transfer (BRET) technology for the monitoring of G protein-coupled receptors in live cells. Journal of Biomolecular Screening 13(9): 888-898.
Kohno, D., Gao, H., Muroya, S., Kikuyama, S. and Yada, T. (2003). Ghrelin directly
interacts with neuropeptide-Y-containing neurons in the rat arcuate nucleus: Ca2+ signalling via protein kinase A and N-type channel-dependent mechanisms and cross-talk with leptin and orexin. Diabetes 52(4): 948-956.
Kojima, M. and Kangawa, K. (2008). Structure and function of ghrelin. Results and
Problems in Cell Differentiation 46: 89-115. Kojima, M. and Kangawa, K. (2005). Ghrelin: structure and function. Physiological
Reviews 85(2): 495-522. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H. and Kangawa, K.
(1999). Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402(6762): 656-660.
Kolakowski, L. (1994). GCRDb: a G-protein-coupled receptor database. Receptors &
Channels 2(1): 1-7. Kroeger, K., Pfleger, K. and Eidne, K. (2004). G-protein coupled receptor
oligomerization in neuroendocrine pathways. Frontiers in Neuroendocrinology 24(4): 254-278.
Kroeger, K., Hanyaloglu, A., Seeber, R., Miles, L. and Eidne, K. (2001). Constitutive
and agonist-dependent homo-oligomerization of the thyrotropin-releasing
197
hormone receptor - Detection in living cells using bioluminescence resonance energy transfer. Journal of Biological Chemistry 276(16): 12736-12743.
Krupnick, J. and Benovic, J. (1998). The role of receptor kinases and arrestins in G
protein-coupled receptor regulation. Annual Review of Pharmacology and Toxicology 38(1): 289-319.
Lagaud, G., Young, A., Acena, A., Morton, M., Barrett, T. and Shankley, N. (2007).
Obestatin reduces food intake and suppresses body weight gain in rodents. Biochemical and Biophysical Research Communications 357(1): 264-269.
Lagerström, M. and Schiöth, H. (2008). Structural diversity of G protein-coupled
receptors and significance for drug discovery. Nature Reviews Drug Discovery 7(4): 339-357.
Lander, E., Linton, L., Birren, B., Nusbaum, C., Zody, M., Baldwin, J., Devon, K.,
Dewar, K., Doyle, M. and FitzHugh, W. (2001). The International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature 409: 860-921.
Lanfranco, F., Baldi, M., Cassoni, P., Bosco, M., Ghé, C. and Muccioli, G. (2008).
Ghrelin and prostate cancer. Vitamins and Hormones 77: 301-324. Lau, P., Chow, K., Chan, C., Cheng, C. and Wise, H. (2009). The constitutive
activity of the ghrelin receptor attenuates apoptosis via a protein kinase C-dependent pathway. Molecular and Cellular Endocrinology 299: 232-239.
Lauwers, E., Landuyt, B., Arckens, L., Schoofs, L. and Luyten, W. (2006). Obestatin
does not activate orphan G protein-coupled receptor GPR39. Biochemical and Biophysical Research Communications 351(1): 21-25.
Lavoie, C., Mercier, J., Salahpour, A., Umapathy, D., Breit, A., Villeneuve, L., Zhu,
W., Xiao, R., Lakatta, E. and Bouvier, M. (2002). ß1/ß2-adrenergic receptor heterodimerization regulates ß2-adrenergic receptor internalization and ERK signalling efficacy. Journal of Biological Chemistry 277(38): 35402-35410.
Lee, H., Wang, G., Englander, E., Kojima, M. and Greeley Jr, G. (2002). Ghrelin, a
new gastrointestinal endocrine peptide that stimulates insulin secretion: enteric distribution, ontogeny, influence of endocrine, and dietary manipulations. Endocrinology 143(1): 185-190.
Lee, S., So, C., Rashid, A., Varghese, G., Cheng, R., Lanca, A., O'Dowd, B. and
George, S. (2004). Dopamine D1 and D2 receptor co-activation generates a novel phospholipase C-mediated calcium signal. Journal of Biological Chemistry 279(34): 35671-35678.
Lefkowitz, R. (2007). Seven transmembrane receptors: something old, something
new. Acta Physiologica 190(1): 9-19. Lefkowitz, R. and Shenoy, S. (2005). Transduction of receptor signals by ß-arrestins.
198
Science 308(5721): 512-517. Leite-Moreira, A. and Soares, J. (2007). Physiological, pathological and potential
therapeutic roles of ghrelin. Drug Discovery Today 12(7-8): 276-288. Leung, P., Chow, K., Lau, P., Chu, K., Chan, C., Cheng, C. and Wise, H. (2007). The
truncated ghrelin receptor polypeptide (GHS-R1b) acts as a dominant-negative mutant of the ghrelin receptor. Cellular Signalling 19(5): 1011-1022.
Levoye, A., Dam, J., Ayoub, M., Guillaume, J., Couturier, C., Delagrange, P. and
Jockers, R. (2006). The orphan GPR50 receptor specifically inhibits MT1 melatonin receptor function through heterodimerization. The EMBO journal 25(13): 3012-3023.
Li, A., Cheng, G., Zhu, G. and Tarnawski, A. (2007). Ghrelin stimulates
angiogenesis in human microvascular endothelial cells: Implications beyond GH release. Biochemical and Biophysical Research Communications 353(2): 238-243.
Li, W., Gavrila, D., Liu, X., Wang, L., Gunnlaugsson, S., Stoll, L., McCormick, M.,
Sigmund, C., Tang, C. and Weintraub, N. (2004). Ghrelin inhibits proinflammatory responses and nuclear factor-kappa B activation in human endothelial cells. Circulation 109(18): 2221-2226.
Liang, J., Liu, Y., Zou, J., Franklin, R., Costello, L. and Feng, P. (1999). Inhibitory
effect of zinc on human prostatic carcinoma cell growth. The Prostate 40(3): 200-207.
Liang, Y., Fotiadis, D., Filipek, S., Saperstein, D., Palczewski, K. and Engel, A.
(2003). Organization of the G Protein-coupled receptors rhodopsin and opsin in native membranes. Journal of Biological Chemistry 278(24): 21655-21662.
Limbird, L. and Lefkowitz, R. (1976). Negative cooperativity among beta-adrenergic
receptors in frog erythrocyte membranes. Journal of Biological Chemistry 251(16): 5007-5014.
Limbird, L., Meyts, P. and Lefkowitz, R. (1975). Beta-adrenergic receptors: evidence
for negative cooperativity. Biochemical and Biophysical Research Communications 64(4): 1160-1169.
Liu, K., Zhang, W., Liu, L., He, D., Zhou, G., Zhou, L. and Hu, R. (2009). Ghrelin
inhibits apoptosis induced by high glucose and sodium palmitate in adult rat cardiomyocytes through the PI3K-Akt signalling pathway. Regulatory Peptides 155(1-3): 62-69.
Lopez-Gimenez, J., Canals, M., Pediani, J. and Milligan, G. (2007). The α1b-
adrenoceptor exists as a higher-order oligomer: Effective oligomerization is required for receptor maturation, surface delivery, and function. Molecular
199
Pharmacology 71(4): 1015-1029. Lu, Y., Cai, Z., Xiao, G., Liu, Y., Keller, E. T., Yao, Z. and Zhang, J. (2007). CCR2
expression correlates with prostate cancer progression. Journal of Cellular Biochemistry 101(3): 676-85.
Lukasiewicz, S., Blasiak, E., Faron-Gorecka, A., Polit, A., Tworzydlo, M., Gorecki,
A., Wasylewski, Z. and Dziedzicka-Wasylewska, M. (2007). Fluorescence studies of homooligomerization of adenosine A2A and serotonin 5-HT1A receptors reveal the specificity of receptor interactions in the plasma membrane. Pharmacological Reports 59(4): 379-392.
Maccarinelli, G., Sibilia, V., Torsello, A., Raimondo, F., Pitto, M., Giustina, A.,
Netti, C. and Cocchi, D. (2005). Ghrelin regulates proliferation and differentiation of osteoblastic cells. Journal of Endocrinology 184(1): 249-256.
Maggio, R., Vogel, Z. and Wess, J. (1993). Coexpression studies with mutant
muscarinic/adrenergic receptors provide evidence for intermolecular" cross-talk" between G-protein-linked receptors. Proceedings of the National Academy of Sciences 90(7): 3103-3107.
Margeta-Mitrovic, M., Jan, Y. and Jan, L. (2000). A trafficking checkpoint controls
GABAB receptor heterodimerization. Neuron 27(1): 97-106. Martini, A., Fernandez-Fernandez, R., Tovar, S., Navarro, V., Vigo, E., Vazquez, M.,
Davies, J., Thompson, N., Aguilar, E. and Pinilla, L. (2006). Comparative analysis of the effects of ghrelin and unacylated ghrelin on luteinizing hormone secretion in male rats. Endocrinology 147(5): 2374-2382.
Marullo, S. and Bouvier, M. (2007). Resonance energy transfer approaches in
molecular pharmacology and beyond. Trends in Pharmacological Sciences 28(8): 362-365.
Masuda, Y., Tanaka, T., Inomata, N., Ohnuma, N., Tanaka, S., Itoh, Z., Hosoda, H.,
Kojima, M. and Kangawa, K. (2000). Ghrelin stimulates gastric acid secretion and motility in rats. Biochemical and Biophysical Research Communications 276(3): 905-908.
Mawson, C. and Fischer, M. (1952). The occurrence of zinc in the human prostate
gland. Canadian Journal of Medical Sciences 30(4): 336-339. Mazzocchi, G., Neri, G., Rucinski, M., Rebuffat, P., Spinazzi, R., Malendowicz, L.
and Nussdorfer, G. (2004). Ghrelin enhances the growth of cultured human adrenal zona glomerulosa cells by exerting MAPK-mediated proliferogenic and antiapoptotic effects. Peptides 25(8): 1269-1277.
McGraw, D., Mihlbachler, K., Schwarb, M., Rahman, F., Small, K., Almoosa, K. and
Liggett, S. (2006). Airway smooth muscle prostaglandin-EP1 receptors directly modulate 2-adrenergic receptors within a unique heterodimeric
200
complex. Journal of Clinical Investigation 116(5): 1400-1409. McKee, K., Tan, C., Palyha, O., Liu, J., Feighner, S., Hreniuk, D., Smith, R.,
Howard, A. and Van der Ploeg, L. (1997a). Cloning and characterization of two human G protein-coupled receptor genes (GPR38 and GPR39) related to the growth hormone secretagogue and neurotensin receptors. Genomics 46(3): 426-434.
McKee, K. K., Palyha, O. C., Feighner, S. D., Hreniuk, D. L., Tan, C. P., Phillips, M.
S., Smith, R. G., Van der Ploeg, L. H. and Howard, A. D. (1997b). Molecular analysis of rat pituitary and hypothalamic growth hormone secretagogue receptors. Molecular Endocrinology 11(4): 415-423.
McLaughlin, J., Patterson, M. and Malik, A. (2007). Protease-activated receptor-3
(PAR3) regulates PAR1 signalling by receptor dimerization. Proceedings of the National Academy of Sciences 104(13): 5662-5667.
McNamara, J., Herington, A. and Chopin, L. (2002). Expression and function of the
growth hormone secretagogue receptor 1b isoform in prostate cancer. QUT Honours Paper.
Mellado, M., Rodríguez-Frade, J., Vila-Coro, A., de Ana, A. and Martínez-A, C.
(1999). Chemokine control of HIV-1 infection. Nature 400(6746): 723-724. Mercier, J., Salahpour, A., Angers, S., Breit, A. and Bouvier, M. (2002). Quantitative
assessment of ß1-and ß2-adrenergic receptor homo-and heterodimerization by bioluminescence resonance energy transfer. Journal of Biological Chemistry 277(47): 44925-44931.
Meyer, B., Segura, J., Martinez, K., Hovius, R., George, N., Johnsson, K. and Vogel,
H. (2006). FRET imaging reveals that functional neurokinin-1 receptors are monomeric and reside in membrane microdomains of live cells. Proceedings of the National Academy of Sciences 103(7): 2138-2143.
Michel, M., Wieland, T. and Tsujimoto, G. (2009). How reliable are G-protein-
coupled receptor antibodies? Naunyn-Schmiedeberg's Archives of Pharmacology 379(4): 385-388.
Mikhailova, M., Mayeux, P., Jurkevich, A., Kuenzel, W., Madison, F., Periasamy,
A., Chen, Y. and Cornett, L. (2007). Heterooligomerization between vasotocin and corticotropin-releasing hormone (CRH) receptors augments CRH-stimulated 3', 5'-cyclic adenosine monophosphate production. Molecular Endocrinology 21(9): 2178-2188.
Milligan, G. (2009). G protein-coupled receptor hetero-dimerization: contribution to
pharmacology and function. British Journal of Pharmacology(Published online ahead of print).
Milligan, G. (2008). A day in the life of a G protein-coupled receptor: the
contribution to function of G protein-coupled receptor dimerization. British
201
Journal of Pharmacology 153: S216-S229. Milligan, G. (2006). G-protein-coupled receptor heterodimers: pharmacology,
function and relevance to drug discovery. Drug Discovery Today 11(11-12): 541-549.
Milligan, G. (2004). G protein-coupled receptor dimerization: function and ligand
pharmacology. Molecular Pharmacology 66(1): 1-7. Milligan, G., Ramsay, D., Pascal, G. and Carrillo, J. (2003). GPCR dimerisation. Life
Sciences 74(2-3): 181-188. Miyawaki, A., Llopis, J., Heim, R., McCaffery, J., Adams, J., Ikura, M. and Tsien, R.
(1997). Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin. Nature 388: 882-887.
Moechars, D., Depoortere, I., Moreaux, B., De Smet, B., Goris, I., Hoskens, L.,
Daneels, G., Kass, S., Ver Donck, L. and Peeters, T. (2006). Altered gastrointestinal and metabolic function in the GPR39-obestatin receptor–knockout mouse. Gastroenterology 131(4): 1131-1141.
Mondal, M., Toshinai, K., Ueno, H., Koshinaka, K. and Nakazato, M. (2008).
Characterization of obestatin in rat and human stomach and plasma, and its lack of acute effect on feeding behavior in rodents. Journal of Endocrinology 198(2): 339-346.
Mungan, N., Eminferzane, S., Mungan, A., Yesilli, C., Seckiner, I., Can, M., Ayoglu,
F. and Akduman, B. (2008). Diagnostic value of serum ghrelin levels in prostate cancer. Urologia Internationalis 80(3): 245-248.
Murata, M., Okimura, Y., Iida, K., Matsumoto, M., Sowa, H., Kaji, H., Kojima, M.,
Kangawa, K. and Chihara, K. (2002). Ghrelin modulates the downstream molecules of insulin signalling in hepatoma cells. Journal of Biological Chemistry 277(7): 5667-5674.
Nagaya, N. and Kangawa, K. (2003). Ghrelin improves left ventricular dysfunction
and cardiac cachexia in heart failure. Current Opinion in Pharmacology 3(2): 146-151.
Nagaya, N., Miyatake, K., Uematsu, M., Oya, H., Shimizu, W., Hosoda, H., Kojima,
M., Nakanishi, N., Mori, H. and Kangawa, K. (2001a). Hemodynamic, renal, and hormonal effects of ghrelin infusion in patients with chronic heart failure. Journal of Clinical Endocrinology & Metabolism 86(12): 5854-5859.
Nagaya, N., Uematsu, M., Kojima, M., Ikeda, Y., Yoshihara, F., Shimizu, W.,
Hosoda, H., Hirota, Y., Ishida, H. and Mori, H. (2001b). Chronic administration of ghrelin improves left ventricular dysfunction and attenuates development of cardiac cachexia in rats with heart failure. Circulation 104(12): 1430-1435.
202
Nakazato, M., Murakami, N., Date, Y., Kojima, M., Matsuo, H., Kangawa, K. and Matsukura, S. (2001). A role for ghrelin in the central regulation of feeding. Nature 409: 194-198.
Nanzer, A., Khalaf, S., Mozid, A., Fowkes, R., Patel, M., Burrin, J., Grossman, A.
and Korbonits, M. (2004). Ghrelin exerts a proliferative effect on a rat pituitary somatotroph cell line via the mitogen-activated protein kinase pathway. European Journal of Endocrinology 151(2): 233-240.
Neary, N., Druce, M., Small, C. and Bloom, S. (2006). Acylated ghrelin stimulates
food intake in the fed and fasted states but desacylated ghrelin has no effect. Gut 55(1): 135-135.
Nelson, G., Chandrashekar, J., Hoon, M., Feng, L., Zhao, G., Ryba, N. and Zuker, C.
(2002). An amino-acid taste receptor. Nature 416(6877): 199-202. Nelson, G., Hoon, M., Chandrashekar, J., Zhang, Y., Ryba, N. and Zuker, C. (2001).
Mammalian sweet taste receptors. Cell 106(3): 381-390. Nogueiras, R., Pfluger, P., Tovar, S., Arnold, M., Mitchell, S., Morris, A., Perez-
Tilve, D., Vazquez, M., Wiedmer, P. and Castaneda, T. (2007). Effects of obestatin on energy balance and growth hormone secretion in rodents. Endocrinology 148(1): 21-26.
Oldham, W. and Hamm, H. (2006). Structural basis of function in heterotrimeric G
proteins. Quarterly Reviews of Biophysics 39(2): 117-166. Otto, B., Cuntz, U., Fruehauf, E., Wawarta, R., Folwaczny, C., Riepl, R., Heiman,
M., Lehnert, P., Fichter, M. and Tschop, M. (2001). Weight gain decreases elevated plasma ghrelin concentrations of patients with anorexia nervosa. European Journal of Endocrinology 145(5): 669-673.
Overington, J., Al-Lazikani, B. and Hopkins, A. (2006). How many drug targets are
there? Nature Reviews Drug discovery 5(12): 993-996. Overton, M. and Blumer, K. (2002). The extracellular N-terminal domain and
transmembrane domains 1 and 2 mediate oligomerization of a yeast G protein-coupled receptor. Journal of Biological Chemistry 277(44): 41463-41472.
Overton, M. and Blumer, K. (2000). G-protein-coupled receptors function as
oligomers in vivo. Current Biology 10(6): 341-344. Pal, R., Parker, D. and Costello, L. (2009). A europium luminescence assay of lactate
and citrate in biological fluids. Organic & Biomolecular Chemistry 7(8): 1525-1528.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M. and Miyano, M. (2000). Crystal structure of rhodopsin: A G protein-coupled
203
receptor. Science 289(5480): 739-45. Pan, W., Tu, H. and Kastin, A. (2006). Differential BBB interactions of three
ingestive peptides: obestatin, ghrelin, and adiponectin. Peptides 27(4): 911-916.
Panetta, R. and Greenwood, M. (2008). Physiological relevance of GPCR
oligomerization and its impact on drug discovery. Drug Discovery Today 13(23-24): 1059-1066.
Pantel, J., Legendre, M., Cabrol, S., Hilal, L., Hajaji, Y., Morisset, S., Nivot, S., Vie-
Luton, M., Grouselle, D. and de Kerdanet, M. (2006). Loss of constitutive activity of the growth hormone secretagogue receptor in familial short stature. Journal of Clinical Investigation 116(3): 760-768.
Park, J., Scheerer, P., Hofmann, K., Choe, H. and Ernst, O. (2008). Crystal structure
of the ligand-free G-protein-coupled receptor opsin. Nature 454(7201): 183-188.
Park, P. and Palczewski, K. (2005). Diversifying the repertoire of G protein-coupled
receptors through oligomerization. Proceedings of the National Academy of Sciences 102(25): 8793-8794.
Patchett, A., Nargund, R., Tata, J., Chen, M., Barakat, K., Johnston, D., Cheng, K.,
Chan, W., Butler, B. and Hickey, G. (1995). Design and biological activities of L-163,191 (MK-0677): a potent, orally active growth hormone secretagogue. Proceedings of the National Academy of Sciences 92(15): 7001-7005.
Paul, S., Palczewski, K., Filipek, S. and Wells, J. (2004). Oligomerization of G
protein-coupled receptors: past, present, and future. Biochemistry 43(50): 15643-15656.
Pazos, Y., Casanueva, F. and Camiña, J. (2008). Basic aspects of ghrelin action.
Vitamins and Hormones 77: 89-119. Pazos, Y., Alvarez, C. J., Camina, J. P. and Casanueva, F. F. (2007). Stimulation of
extracellular signal-regulated kinases and proliferation in the human gastric cancer cells KATO-III by obestatin. Growth Factors 25(6): 373-381.
Pello, O., Martinez-Munoz, L., Parrillas, V., Serrano, A., Rodriguez-Frade, J., Toro,
M., Lucas, P., Monterrubio, M., Martinez-A, C. and Mellado, M. (2008). Ligand stabilization of CXCR4/δ-opioid receptor heterodimers reveals a mechanism for immune response regulation. European Journal of Immunology 38(2): 537 - 549.
Pettersson, I., Muccioli, G., Granata, R., Deghenghi, R., Ghigo, E., Ohlsson, C. and
Isgaard, J. (2002). Natural (ghrelin) and synthetic (hexarelin) GH secretagogues stimulate H9c2 cardiomyocyte cell proliferation. Journal of Endocrinology 175(1): 201-209.
204
Pfeiffer, M., Kirscht, S., Stumm, R., Koch, T., Wu, D., Laugsch, M., Schroder, H.,
Hollt, V. and Schulz, S. (2003). Heterodimerization of substance P and µ-opioid receptors regulates receptor trafficking and resensitization. Journal of Biological Chemistry 278(51): 51630-51637.
Pfeiffer, M., Koch, T., Schroder, H., Klutzny, M., Kirscht, S., Kreienkamp, H., Hollt,
V. and Schulz, S. (2001). Homo-and Heterodimerization of Somatostatin Receptor Subtypes: Inactivation of sst3 receptor function by heterodimerization with sst2A. Journal of Biological Chemistry 276(17): 14027-14036.
Pfleger, K., Dromey, J., Dalrymple, M., Lim, E., Thomas, W. and Eidne, K. (2006a).
Extended bioluminescence resonance energy transfer (eBRET) for monitoring prolonged protein–protein interactions in live cells. Cellular Signalling 18(10): 1664-1670.
Pfleger, K., Seeber, R. and Eidne, K. (2006b). Bioluminescence resonance energy
transfer (BRET) for the real-time detection of protein-protein interactions. Nature Protocols 1(1): 337-345.
Pfleger, K. and Eidne, K. (2005). Monitoring the formation of dynamic G-protein-
coupled receptor-protein complexes in living cells. Biochemical Journal 385(3): 625–637.
Pfleger, K. and Eidne, K. (2003). New technologies: Bioluminescence resonance
energy transfer (BRET) for the detection of real time interactions involving G-protein coupled receptors. Pituitary 6(3): 141-151.
Pierce, K., Premont, R. and Lefkowitz, R. (2002). Seven-transmembrane receptors.
Nature Reviews Molecular Cell Biology 3(9): 639-650. Piljic, A. and Schultz, C. (2008). Simultaneous recording of multiple cellular events
by FRET. ACS Chemical Biology 3(3): 156-160. Pin, J., Neubig, R., Bouvier, M., Devi, L., Filizola, M., Javitch, J., Lohse, M.,
Milligan, G., Palczewski, K. and Parmentier, M. (2007). International Union of Basic and Clinical Pharmacology. LXVII. Recommendations for the recognition and nomenclature of G protein-coupled receptor heteromultimers. Pharmacological reviews 59(1): 5-13.
Piston, D. and Kremers, G. (2007). Fluorescent protein FRET: the good, the bad and
the ugly. Trends in Biochemical Sciences 32(9): 407-414. Pitcher, J., Freedman, N. and Lefkowitz, R. (1998). G protein-coupled receptor
kinases. Annual Review of Biochemistry 67(1): 653-692. Prinster, S., Hague, C. and Hall, R. (2005). Heterodimerization of g protein-coupled
receptors: specificity and functional significance. Pharmacological Reviews 57(3): 289-298.
205
Prostate_Cancer_Foundation_of_Australia (2009).
www.prostate.org.au/articleLive/pages/Prostate-Cancer-Statistics.html. Accessed 31/07/2009.
Quaynor, S., Hu, L., Leung, P., Feng, H., Mores, N., Krsmanovic, L. and Catt, K.
(2007). Expression of a functional g protein-coupled receptor 54-kisspeptin autoregulatory system in hypothalamic gonadotropin-releasing hormone neurons. Molecular Endocrinology 21(12): 3062-3070.
Raj, G. V., Barki-Harrington, L., Kue, P. F. and Daaka, Y. (2002). Guanosine
phosphate binding protein coupled receptors in prostate cancer: a review. The Journal of Urology 167(3): 1458-63.
Ramsay, D., Carr, I., Pediani, J., Lopez-Gimenez, J., Thurlow, R., Fidock, M. and
Milligan, G. (2004). High-affinity interactions between human α1A-adrenoceptor C-terminal splice variants produce homo-and heterodimers but do not generate the α1L-adrenoceptor. Molecular Pharmacology 66(2): 228-239.
Ramsay, D., Kellett, E., McVey, M., Rees, S. and Milligan, G. (2002). Homo- and
hetero-oligomeric interactions between G protein coupled receptors in living cells monitored by two variants of bioluminescence energy transfer (BRET): hetero-oligomers between receptor subtypes form more efficiently than between less closely related sequences. Biochemical Journal 365: 429-440.
Rasmussen, S. G., Choi, H. J., Rosenbaum, D. M., Kobilka, T. S., Thian, F. S.,
Edwards, P. C., Burghammer, M., Ratnala, V. R., Sanishvili, R., Fischetti, R. F., Schertler, G. F., Weis, W. I. and Kobilka, B. K. (2007). Crystal structure of the human ß2 adrenergic G-protein-coupled receptor. Nature 450(7168): 383-387.
Reimer, M., Pacini, G. and Ahren, B. (2003). Dose-dependent inhibition by ghrelin
of insulin secretion in the mouse. Endocrinology 144(3): 916-921. Rice, P. L., Peters, S. L., Beard, K. S. and Ahnen, D. J. (2006). Sulindac
independently modulates extracellular signal-regulated kinase 1/2 and cyclic GMP-dependent protein kinase signalling pathways. Molecular Cancer Therapeutics 5(3): 746-54.
Rice, P. L., Beard, K. S., Driggers, L. J. and Ahnen, D. J. (2004). Inhibition of
extracellular-signal regulated kinases 1/2 is required for apoptosis of human colon cancer cells in vitro by sulindac metabolites. Cancer Research 64(22): 8148-51.
Roberts, P. and Der, C. (2007). Targeting the Raf-MEK-ERK mitogen-activated
protein kinase cascade for the treatment of cancer. Oncogene 26(22): 3291-3310.
Rocha-Sousa, A., Saraiva, J., Henriques-Coelho, T., Falcao-Reis, F., Correia-Pinto, J.
206
and Leite-Moreira, A. (2006). Ghrelin as a novel locally produced relaxing peptide of the iris sphincter and dilator muscles. Experimental eye research 83(5): 1179-1187.
Rocheville, M., Lange, D., Kumar, U., Sasi, R., Patel, R. and Patel, Y. (2000).
Subtypes of the somatostatin receptor assemble as functional homo-and heterodimers. Journal of Biological Chemistry 275(11): 7862-7869.
Rossi, F., Castelli, A., Bianco, M., Bertone, C., Brama, M. and Santiemma, V.
(2008). Ghrelin induces proliferation in human aortic endothelial cells via ERK1/2 and PI3K/Akt activation. Peptides 29(11): 2046-2051.
Ruscica, M., Dozio, E., Boghossian, S., Bovo, G., Martos Riano, V., Motta, M. and
Magni, P. (2006). Activation of the Y1 receptor by neuropeptide Y regulates the growth of prostate cancer cells. Endocrinology 147(3): 1466-73.
Sagné, C., Isambert, M., Henry, J. and Gasnier, B. (1996). SDS-resistant aggregation
of membrane proteins: application to the purification of the vesicular monoamine transporter. Biochemical Journal 316(3): 825.
Salahpour, A. and Masri, B. (2007). Experimental challenge to a 'rigorous' BRET
analysis of GPCR oligomerization. Nature Methods 4(8): 599-600. Salahpour, A., Angers, S. and Bouvier, M. (2000). Functional significance of
oligomerization of G-protein-coupled receptors. Trends in Endocrinology & Metabolism 11(5): 163-168.
Salom, D., Lodowski, D., Stenkamp, R., Trong, I., Golczak, M., Jastrzebska, B.,
Harris, T., Ballesteros, J. and Palczewski, K. (2006). Crystal structure of a photoactivated deprotonated intermediate of rhodopsin. Proceedings of the National Academy of Sciences 103(44): 16123-16128.
Samson, W., Yosten, G., Chang, J., Ferguson, A. and White, M. (2008). Obestatin
inhibits vasopressin secretion: evidence for a physiological action in the control of fluid homeostasis. Journal of Endocrinology 196(3): 559-564.
Samson, W., White, M., Price, C. and Ferguson, A. (2007). Obestatin acts in brain to
inhibit thirst. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 292(1): R637-R643.
Satake, H. and Sakai, T. (2008). Recent advances and perceptions in studies of
heterodimerization between G protein-coupled receptors. Protein and Peptide Letters 15(3): 300-308.
Sato, M., Nakahara, K., Goto, S., Kaiya, H., Miyazato, M., Date, Y., Nakazato, M.,
Kangawa, K. and Murakami, N. (2006). Effects of ghrelin and des-acyl ghrelin on neurogenesis of the rat fetal spinal cord. Biochemical and Biophysical Research Communications 350(3): 598-603.
Scheerer, P., Park, J., Hildebrand, P., Kim, Y., Krauß, N., Choe, H., Hofmann, K.
207
and Ernst, O. (2008). Crystal structure of opsin in its G-protein-interacting conformation. Nature 455(7212): 497-502.
Seifert, R. and Wenzel-Seifert, K. (2002). Constitutive activity of G-protein-coupled
receptors: cause of disease and common property of wild-type receptors. Naunyn-Schmiedeberg's Archives of Pharmacology 366(5): 381-416.
Seim, I., Collet, C., Herington, A. and Chopin, L. (2007). Revised genomic structure
of the human ghrelin gene and identification of novel exons, alternative splice variants and natural antisense transcripts. BMC genomics 8(1): 298.
Seoane, L., Al-Massadi, O., Pazos, Y., Paeotto, U. and Casanueva, F. (2006). Central
obestatin administration does not modify either spontaneous or ghrelin-induced food intake in rats. Journal of Endocrinological Investigation 29(8): RC13-15.
Shakibaei, M., Schulze-Tanzil, G., de Souza, P., John, T., Rahmanzadeh, M.,
Rahmanzadeh, R. and Merker, H. J. (2001). Inhibition of mitogen-activated protein kinase kinase induces apoptosis of human chondrocytes. Journal of Biological Chemistry 276(16): 13289-13294.
Sharma, M., Benharouga, M., Hu, W. and Lukacs, G. (2001). Conformational and
temperature-sensitive stability defects of the ΔF508 cystic fibrosis transmembrane conductance regulator in post-endoplasmic reticulum compartments. Journal of Biological Chemistry 276(12): 8942-8950.
Shiiya, T., Nakazato, M., Mizuta, M., Date, Y., Mondal, M., Tanaka, M., Nozoe, S.,
Hosoda, H., Kangawa, K. and Matsukura, S. (2002). Plasma ghrelin levels in lean and obese humans and the effect of glucose on ghrelin secretion. Journal of Clinical Endocrinology & Metabolism 87(1): 240-244.
Shimada, K., Nakamura, M., Ishida, E., Kishi, M., Yonehara, S. and Konishi, N.
(2002). Contributions of mitogen-activated protein kinase and nuclear factor kappa B to N-(4-hydroxyphenyl)retinamide-induced apoptosis in prostate cancer cells. Molecular Carcinogenesis 35(3): 127-37.
Shintani, M., Ogawa, Y., Ebihara, K., Aizawa-Abe, M., Miyanaga, F., Takaya, K.,
Hayashi, T., Inoue, G., Hosoda, K. and Kojima, M. (2001). Ghrelin, an endogenous growth hormone secretagogue, is a novel orexigenic peptide that antagonizes leptin action through the activation of hypothalamic neuropeptide Y/Y1 receptor pathway. Diabetes 50(2): 227-232.
Sibilia, V., Bresciani, E., Lattuada, N., Rapetti, D., Locatelli, V., De Luca, V., Donà,
F., Netti, C., Torsello, A. and Guidobono, F. (2006). Intracerebroventricular acute and chronic administration of obestatin minimally affect food intake but not weight gain in the rat. Journal of Endocrinological Investigation 29(11): RC31-34.
Smit, M., Vischer, H., Bakker, R., Jongejan, A., Timmerman, H., Pardo, L. and
Leurs, R. (2007). Pharmacogenomic and structural analysis of constitutive G
208
protein–coupled receptor activity. Annual Review of Pharmacology and Toxicology 47: 53-87.
Smith, R., Jiang, H. and Sun, Y. (2005). Developments in ghrelin biology and
potential clinical relevance. Trends in Endocrinology & Metabolism 16(9): 436-442.
Smith, R., Cheng, K., Schoen, W., Pong, S., Hickey, G., Jacks, T., Butler, B., Chan,
W., Chaung, L. and Judith, F. (1993). A nonpeptidyl growth hormone secretagogue. Science 260(5114): 1640-1643.
Smrcka, A., Brown, K. and Sternweis, P. (1991). Regulation of
polyphosphoinositide-specific phospholipase C activity by purified Gq. Science 251(4995): 804-807.
Soares, J. and Leite-Moreira, A. (2008). Ghrelin, des-acyl ghrelin and obestatin:
Three pieces of the same puzzle. Peptides 29(7): 1255-1270. Stangelberger, A., Schally, A. V., Varga, J. L., Zarandi, M., Cai, R. Z., Baker, B.,
Hammann, B. D., Armatis, P. and Kanashiro, C. A. (2005). Inhibition of human androgen-independent PC-3 and DU-145 prostate cancers by antagonists of bombesin and growth hormone releasing hormone is linked to PKC, MAPK and c-jun intracellular signalling. European Journal of Cancer 41(17): 2735-44.
Steinmeyer, R. and Harms, G. (2009). Fluorescence resonance energy transfer and
anisotropy reveals both hetero-and homo-energy transfer in the pleckstrin homology-domain and the parathyroid hormone-receptor. Microscopy Research and Technique 72(1): 12-21.
Storjohann, L., Holst, B. and Schwartz, T. (2008a). Molecular mechanism of Zn2+
agonism in the extracellular domain of GPR39. FEBS Letters 582(17): 2583-2588.
Storjohann, L., Holst, B. and Schwartz, T. (2008b). A second disulfide bridge from
the N-terminal domain to extracellular loop 2 dampens receptor activity in GPR39. Biochemistry 47(35): 9198-9207.
Stryer, L. (1978). Fluorescence energy transfer as a spectroscopic ruler. Annual
Review of Biochemistry 47(1): 819-846. Stryer, L. and Haugland, R. (1967). Energy transfer: a spectroscopic ruler.
Proceedings of the National Academy of Sciences 58(2): 719-726. Sun, Y., Wang, P., Zheng, H. and Smith, R. (2004). Ghrelin stimulation of growth
hormone release and appetite is mediated through the growth hormone secretagogue receptor. Proceedings of the National Academy of Sciences 101(13): 4679-4684.
Sun, Y., Ahmed, S. and Smith, R. (2003). Deletion of ghrelin impairs neither growth
209
nor appetite. Molecular and Cellular Biology 23(22): 7973-7981. Svendsen, A., Vrecl, M., Ellis, T., Heding, A., Kristensen, J., Wade, J., Bathgate, R.,
De Meyts, P. and Nohr, J. (2008). Cooperative binding of insulin-like peptide 3 to a dimeric relaxin family peptide receptor 2. Endocrinology 149(3): 1113-1120.
Szentirmai, E. and Krueger, J. (2006). Obestatin alters sleep in rats. Neuroscience
Letters 404(1-2): 222-226. Szidonya, L., Cserzo, M. and Hunyady, L. (2008). Dimerization and oligomerization
of G-protein-coupled receptors: debated structures with established and emerging functions. Journal of Endocrinology 196(3): 435.
Takahashi, K., Furukawa, C., Takano, A., Ishikawa, N., Kato, T., Hayama, S.,
Suzuki, C., Yasui, W., Inai, K. and Sone, S. (2006). The neuromedin U-growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signalling pathway as a therapeutic target for lung cancer. Cancer Research 66(19): 9408-9419.
Takaya, K., Ariyasu, H., Kanamoto, N., Iwakura, H., Yoshimoto, A., Harada, M.,
Mori, K., Komatsu, Y., Usui, T. and Shimatsu, A. (2000). Ghrelin strongly stimulates growth hormone release in humans. Journal of Clinical Endocrinology & Metabolism 85(12): 4908-4911.
Tanaka, M., Naruo, T., Nagai, N., Kuroki, N., Shiiya, T., Nakazato, M., Matsukura,
S. and Nozoe, S. (2003). Habitual binge/purge behavior influences circulating ghrelin levels in eating disorders. Journal of Psychiatric Research 37(1): 17-22.
Taub, J. S., Guo, R., Leeb-Lundberg, L. M., Madden, J. F. and Daaka, Y. (2003).
Bradykinin receptor subtype 1 expression and function in prostate cancer. Cancer Research 63(9): 2037-41.
Thompson, N., Gill, D., Davies, R., Loveridge, N., Houston, P., Robinson, I. and
Wells, T. (2004). Ghrelin and des-octanoyl ghrelin promote adipogenesis directly in vivo by a mechanism independent of the type 1a growth hormone secretagogue receptor. Endocrinology 145(1): 234-242.
Tokunaga, E., Oki, E., Egashira, A., Sadanaga, N., Morita, M., Kakeji, Y. and
Maehara, Y. (2008). Deregulation of the Akt pathway in human cancer. Current Cancer Drug Targets 8(1): 27-36.
Toshinai, K., Yamaguchi, H., Sun, Y., Smith, R. G., Yamanaka, A., Sakurai, T.,
Date, Y., Mondal, M. S., Shimbara, T., Kawagoe, T., Murakami, N., Miyazato, M., Kangawa, K. and Nakazato, M. (2006). Des-acyl ghrelin induces food intake by a mechanism independent of the growth hormone secretagogue receptor. Endocrinology 147(5): 2306-2314.
Toth, P., Ren, D. and Miller, R. (2004). Regulation of CXCR4 receptor dimerization
210
by the chemokine SDF-1a and the HIV-1 coat protein gp120: a fluorescence resonance energy transfer (FRET) study. Journal of Pharmacology and Experimental Therapeutics 310(1): 8-17.
Tremblay, F., Richard, A. M., Will, S., Syed, J., Stedman, N., Perreault, M. and
Gimeno, R. E. (2009). Disruption of G protein-coupled receptor 39 impairs insulin secretion in vivo. Endocrinology 150(6): 2586-2595.
Tremblay, F., Perreault, M., Klaman, L., Tobin, J., Smith, E. and Gimeno, R. (2007).
Normal food intake and body weight in mice lacking the G protein-coupled receptor GPR39. Endocrinology 148(2): 501-506.
Tschöp, M., Wawarta, R., Riepl, R., Friedrich, S., Bidlingmaier, M., Landgraf, R.
and Folwaczny, C. (2001a). Post-prandial decrease of circulating human ghrelin levels. Journal of Endocrinological Investigation 24(6): RC19-21.
Tschöp, M., Weyer, C., Tataranni, P. A., Devanarayan, V., Ravussin, E. and Heiman,
M. L. (2001b). Circulating ghrelin levels are decreased in human obesity. Diabetes 50(4): 707-709.
Tschöp, M., Smiley, D. and Heiman, M. (2000). Ghrelin induces adiposity in
rodents. Nature 407: 908-913. Tsien, R. (1998). The green fluorescent protein. Annual Review of Biochemistry
67(1): 509-544. Uberti, M., Hague, C., Oller, H., Minneman, K. and Hall, R. (2005).
Heterodimerization with β2-adrenergic receptors promotes surface expression and functional activity of α1D-adrenergic receptors. Journal of Pharmacology and Experimental Therapeutics 313(1): 16-23.
Uberti, M., Hall, R. and Minneman, K. (2003). Subtype-specific dimerization of 1-
adrenoceptors: effects on receptor expression and pharmacological properties. Molecular Pharmacology 64(6): 1379-1390.
van der Lely, A., Tschop, M., Heiman, M. and Ghigo, E. (2004). Biological,
physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocrine Reviews 25(3): 426-457.
Venter, J., Adams, M., Myers, E., Li, P., Mural, R., Sutton, G., Smith, H., Yandell,
M., Evans, C. and Holt, R. (2001). The sequence of the human genome. Science 291(5507): 1304-1351.
Vilardaga, J., Nikolaev, V., Lorenz, K., Ferrandon, S., Zhuang, Z. and Lohse, M.
(2008). Conformational cross-talk between a2A-adrenergic and µ-opioid receptors controls cell signalling. Nature Chemical Biology 4(2): 126-131.
Vogel, S., Thaler, C. and Koushik, S. (2006). Fanciful FRET. Science's STKE
2006(331): re2.
211
Volante, M., Rosas, R., Ceppi, P., Rapa, I., Cassoni, P., Wiedenmann, B., Settanni, F., Granata, R. and Papotti, M. (2009). Obestatin in human neuroendocrine tissues and tumours: expression and effect on tumour growth. Journal of Pathology 218(4): 458-466.
Volante, M., Allia, E., Fulcheri, E., Cassoni, P., Ghigo, E., Muccioli, G. and Papotti,
M. (2003). Ghrelin in fetal thyroid and follicular tumors and cell lines expression and effects on tumor growth. American Journal of Pathology 162(2): 645-654.
Wajnrajch, M., Ten, I., Gertner, J. and Leibel, R. (2000). Genomic organization of
the human ghrelin gene. Journal of Endocrine Genetics 1(4): 231-234. Waldhoer, M., Fong, J., Jones, R., Lunzer, M., Sharma, S., Kostenis, E., Portoghese,
P. and Whistler, J. (2005). A heterodimer-selective agonist shows in vivo relevance of G protein-coupled receptor dimers. Proceedings of the National Academy of Sciences 102(25): 9050-9055.
Wang, D., Hu, Y., Du, J., Hu, Y., Zhong, W. and Qin, W. (2009). Ghrelin stimulates
proliferation of human osteoblastic TE85 cells via NO/cGMP signalling pathway. Endocrine 35(1): 112-117.
Wang, J., He, L., Combs, C., Roderiquez, G. and Norcross, M. (2006). Dimerization
of CXCR4 in living malignant cells: control of cell migration by a synthetic peptide that reduces homologous CXCR4 interactions. Molecular Cancer Therapeutics 5(10): 2474-2483.
Warne, T., Serrano-Vega, M. J., Baker, J. G., Moukhametzianov, R., Edwards, P. C.,
Henderson, R., Leslie, A. G., Tate, C. G. and Schertler, G. F. (2008). Structure of a ß1-adrenergic G-protein-coupled receptor. Nature 454(7203): 486-91.
Weigle, B., Fuessel, S., Ebner, R., Temme, A., Schmitz, M., Schwind, S., Kiessling,
A., Rieger, M. A., Meye, A., Bachmann, M., Wirth, M. P. and Rieber, E. P. (2004). D-GPCR: a novel putative G protein-coupled receptor overexpressed in prostate cancer and prostate. Biochemical and Biophysical Research Communications 322(1): 239-49.
Weikel, J., Wichniak, A., Ising, M., Brunner, H., Friess, E., Held, K., Mathias, S.,
Schmid, D., Uhr, M. and Steiger, A. (2003). Ghrelin promotes slow-wave sleep in humans. American Journal of Physiology- Endocrinology And Metabolism 284(2): 407-415.
White, J., Wise, A., Main, M., Green, A., Fraser, N., Disney, G., Barnes, A., Emson,
P., Foord, S. and Marshall, F. (1998). Heterodimerization is required for the formation of a functional GABAB receptor. Nature 396(6712): 679-682.
Whorton, M., Jastrzebska, B., Park, P., Fotiadis, D., Engel, A., Palczewski, K. and
Sunahara, R. (2008). Efficient coupling of transducin to monomeric rhodopsin in a phospholipid bilayer. Journal of Biological Chemistry 283(7):
212
4387-4394. Whorton, M., Bokoch, M., Rasmussen, S., Huang, B., Zare, R., Kobilka, B. and
Sunahara, R. (2007). A monomeric G protein-coupled receptor isolated in a high-density lipoprotein particle efficiently activates its G protein. Proceedings of the National Academy of Sciences 104(18): 7682-7687.
Wilson, S., Wilkinson, G. and Milligan, G. (2005). The CXCR1 and CXCR2
receptors form constitutive homo-and heterodimers selectively and with equal apparent affinities. Journal of Biological Chemistry 280(31): 28663-28674.
Wilt, T., MacDonald, R., Rutks, I., Shamliyan, T., Taylor, B. and Kane, R. (2008).
Systematic review: The comparative effectiveness and harms of treatments for clinically localized prostate cancer. Annals of Internal Medicine 148(6): 435-448.
Woehler, A., Wlodarczyk, J. and Ponimaskin, E. (2008). Specific oligomerization of
the 5-HT1A receptor in the plasma membrane. Glycoconjugate Journal Epub.
Wren, A., Seal, L., Cohen, M., Brynes, A., Frost, G., Murphy, K., Dhillo, W., Ghatei,
M. and Bloom, S. (2001). Ghrelin enhances appetite and increases food intake in humans. Journal of Clinical Endocrinology & Metabolism 86(12): 5992-5992.
Wu, P. and Brand, L. (1994). Resonance energy transfer: methods and applications.
Analytical Biochemistry 218(1): 1-13. Wurch, T., Matsumoto, A. and Pauwels, P. (2001). Agonist-independent and-
dependent oligomerization of dopamine D2 receptors by fusion to fluorescent proteins. FEBS Letters 507(1): 109-113.
Xia, Q., Pang, W., Pan, H., Zheng, Y., Kang, J. and Zhu, S. (2004). Effects of ghrelin
on the proliferation and secretion of splenic T lymphocytes in mice. Regulatory peptides 122(3): 173-178.
Xia, Z., Dickens, M., Raingeaud, J., Davis, R. and Greenberg, M. (1995). Opposing
effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270(5240): 1326-1331.
Xu, L. L., Stackhouse, B. G., Florence, K., Zhang, W., Shanmugam, N., Sesterhenn,
I. A., Zou, Z., Srikantan, V., Augustus, M., Roschke, V., Carter, K., McLeod, D. G., Moul, J. W., Soppett, D. and Srivastava, S. (2000). PSGR, a novel prostate-specific gene with homology to a G protein-coupled receptor, is overexpressed in prostate cancer. Cancer Research 60(23): 6568-72.
Xu, Y., Piston, D. and Johnson, C. (1999). A bioluminescence resonance energy
transfer (BRET) system: Application to interacting circadian clock proteins. Proceedings of the National Academy of Sciences 96(1): 151-156.
213
Yang, J., Zhao, T., Goldstein, J. and Brown, M. (2008). Inhibition of ghrelin O-acyltransferase (GOAT) by octanoylated pentapeptides. Proceedings of the National Academy of Sciences 105(31): 10750-10755.
Yasuda, S., Miyazaki, T., Munechika, K., Yamashita, M., Ikeda, Y. and Kamizono,
A. (2007). Isolation of Zn2+ as an endogenous agonist of GPR39 from fetal bovine serum. Journal of Receptors and Signal Transduction 27(4): 235-246.
Yeh, A., Jeffery, P., Duncan, R., Herington, A. and Chopin, L. (2005). Ghrelin and a
novel preproghrelin isoform are highly expressed in prostate cancer and ghrelin activates mitogen-activated protein kinase in prostate cancer. Clinical Cancer Research 11(23): 8295-8303.
Yoshioka, K., Saitoh, O. and Nakata, H. (2002). Agonist-promoted heteromeric
oligomerization between adenosine A1 and P2Y1 receptors in living cells. FEBS Letters 523(1-3): 147-151.
Zaichick, V., Sviridova, T. and Zaichick, S. (1997). Zinc in human prostate gland:
Normal, hyperplastic and cancerous. International Urology and Nephrology 29(5): 565-574.
Zhang, J., Jahr, H., Luo, C., Klein, C., Van Kolen, K., Ver Donck, L., De, A., Baart,
E., Li, J. and Moechars, D. (2008a). Obestatin induction of early-response gene expression in gastrointestinal and adipose tissues and the mediatory role of G protein-coupled receptor, GPR39. Molecular Endocrinology 22(6): 1464.
Zhang, J., Klein, C., Ren, P., Kass, S., Ver Donck, L., Moechars, D. and Hsueh, A.
(2007a). Response to Comment on "Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake". Science 315(5813): 766.
Zhang, J., Ren, P., Avsian-Kretchmer, O., Luo, C., Rauch, R., Klein, C. and Hsueh,
A. (2005). Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science 310(5750): 996-999.
Zhang, M., Yuan, F., Liu, H., Chen, H., Qiu, X. and Fang, W. (2008b). Inhibition of
proliferation and apoptosis of vascular smooth muscle cells by ghrelin. Acta Biochimica et Biophysica Sinica 40(9): 769-776.
Zhang, X., Wang, W., True, L. D., Vessella, R. L. and Takayama, T. K. (2009).
Protease-activated receptor-1 is upregulated in reactive stroma of primary prostate cancer and bone metastasis. Prostate 69(7): 727-36.
Zhang, Y., Ying, B., Shi, L., Fan, H., Yang, D., Xu, D., Wei, Y., Hu, X. and Zhang,
X. (2007b). Ghrelin inhibit cell apoptosis in pancreatic ß cell line HIT-T15 via mitogen-activated protein kinase/phosphoinositide 3-kinase pathways. Toxicology 237(1-3): 194-202.
Zizzari, P., Longchamps, R., Epelbaum, J. and Bluet-Pajot, M. (2007). Obestatin
214
partially affects ghrelin stimulation of food intake and growth hormone secretion in rodents. Endocrinology 148(4): 1648-1653.
Zorrilla, E., Iwasaki, S., Moss, J., Chang, J., Otsuji, J., Inoue, K., Meijler, M. and
Janda, K. (2006). Vaccination against weight gain. Proceedings of the National Academy of Sciences 103(35): 13226-13231.
