The Genetic Code! Theme: Organization Cell as a Protein Factory The Central Dogma Nucleic Acids: DNA vs. RNA Let s First Watch these two processes While you watch the animation, take notes on transcription and translation: Where are they happening? What is involved? What is the product? Transcription Wiley Animation: Where does it happen? What enzyme is involved? What happens? What is the product? Transcription Where does it happen? Nucleus What enzyme is involved? RNA polymerase What happens? RNA polymerase uses DNA as a template to make RNA by base pairing What is the product? mRNA that can leave nucleus Can you work like RNA polymerase and transcribe this DNA? TACTAGACGGTAGCACATATG Control of transcription Transcription factors bind to promoter regions in DNA and tell RNA polymerase where to begin Ex. P53 What type of genes Might p53 regulate? Transcription factors Transcription factors--bind to the DNA and tell RNA polymerase to transcribe. Ex. P53--What type of genes might p53 regulate? One gene, many proteins Alternative splicing Intron Exon Getting out of the nucleus Poly A tail Find way out of nucleus GTP cap Attach to ribosome Check! Imagine you are an mRNA who just encountered a ribosome. Tell the ribosome how you made it to your destination (pair-share) Partner will identify all vocab words that you use in your description! What happens here? Translation mRNA-->protein Where does this happen? What are the three steps? How is the code read? 3 Steps Termination Initiation Elongation Terminology mRNA: codon: tRNA: Anticodon: Amino acid: Polypeptide: Terminology mRNA: single stranded RNA takes message from nucleus to cytoplasm Codon: 3 letter base code that codes for an amino acid tRNA: transfers amino acid to the ribosome to make the protein Anticodon: 3 letter code on the tRNA that allows it to match up with the corresponding mRNA codon Amino acid: monomer of a protein Polypeptide: chain of amino acids that makes up a protein How to read the codon table! Practice Using your Codon Table Start codon Amino acid ACG How many stop codons? Anticodon for AUG Codon for leucine Codon for phenylalanine Anticodon for isoleucine Amino acid for AAC Total number of amino acids Total number of codons Be tRNA and rRNA and put together a polypeptide! Use your mRNA sequence and determine the amino acid sequence: mRNA: AUG AUC CGC CAU CGU GUA UAC * A little trick, you must always read left to right and start translating at the first AUG start codon and stop at the stop codon! Controlling Translation RNAi System in which RNA triggers the destruction of mRNA and therefore no protein production Used for Turning on and off genes in embryos Defense from viruses in PLANTS! RNAi Nova Video See how RNAi was discovered and use an analogy to understand how it worksgbh/nova/sciencenow/ video/3210/i02.html How are eukaryotes different than prokaryotes? Prokaryotes have no nucleus so transcription and translation are coupled (together) Eukaryotes make pre-mRNA that is processsed before leaving the nucleus. This allows one section of the DNA to make multiple genes. WaitI don t get it! This is a complicated area of biology. It takes more than one go around. We will have a lab on transcription and translation. You need to go home and read in your book about these two processes to clarify your class notes :) You can also look for other online demos, put remember you may find ones with more detail that you will not be responsible for.