The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits

Taehyung Lim, MD1,2,4, Hyuk- Jin Choi MD1,2, Hyun Joo Lee1,2, Mee Kum Kim, MD1,2, Won Ryang Wee, MD1,2, Jin Hak Lee,2,3

Department of Ophthalmology, Seoul National University Hospital1, Seoul, KoreaSeoul Artificial Eye Center, Seoul National University Hospital Clinical Research Institute2, Seoul, KoreaDepartment of Ophthalmology, Bundang Seoul National University Hospital3, Seoul, KoreaHanGil Eye Hospital4, Incheon, Korea

Authors have not any financial support

Purpose

To compare the expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbit animal models.

Subject & Methods 40 eyes of 20 New Zealand White rabbits Bilateral study

Corneal epithelial flap(diameter of 5.0 mm) was made using the following ways: Group A ; 1. Application of 20% alcohol for 30 seconds, 2 or 3 times 2. Corneal epithelial flap was made using a micro hoe (Katena,

U.S.) 3. The flap was replaced Group B ; 1.The flap was made using epimicrokeratome(Amadeus, 나라

Hz) 2. The flap was replaced

All the eyes wore therapeutic contact lenses and received tarsorrhaphies

Eyes were enucleated at 3 days after the procedure

Tissue sections were stained with H&E and immunohistochemistry (MMP-9, TNF-alpha)

(hamster anti mouse TNF-alpha : Santa Cruz, sc-12744, mouse anti MMP-9, Chemicon, MAB3309)

IL-6, TNF-alpha were evaluated by RT-PCR and were compared between those two groups.

(Rabbit TNF-a ; Forward PRIMER : atggtcaccctcagatcagc Reverse PRIMER : ttgaccgctgaagagaacct, Rabbit IL-6 ; Forward PRIMER : tcctggagaccatcaaggagReverse PRIMER : gggtggcttcttcattcaaa )

Results

H&E stain showed more irregular arrangement of epithelial basal cells in Group A than in Group B

Normal Group A Group B

RT-PCR

- The expression level of mRNA of IL-6, MMP-9, TNF-alpha showed no significant difference between those two groups

Mean ± SD

Immunohistochemistry

MMP-9

Negative Control, x 200 Positive Control, x 200

MMP-9 (x 200)

Group A

Group B

Immunohistochemistry TNF-alpha

Negative Control, x 200 Positive Control, x 200

TNF-alpha (x400)

Group A

Group B

MMP-9 and TNF-alpha were expressed and were more prominent than negative control tissue in all groups

There was no significant difference between two groups

Conclusion

The expression of inflammatory cytokines in epimicrokeratome-assisted flap might be no different from alcohol-assisted flap, suggesting that the inflammatory response of the cornea might be similar between Epi-LASIK and LASEK.