The evolution of lactose tolerance

Sean MylesSean MylesMax Planck Institute for Evolutionary AnthropologyMax Planck Institute for Evolutionary Anthropology

Leipzig, GermanyLeipzig, Germany

09 December 200509 December 2005

Volvox Volvox meetingmeeting

Lactose = complex sugarLactose = complex sugar

Lactase = digestive enzymeLactase = digestive enzyme

Lactose Glucose + GalactoseLactase

• All mammals and most humans stop producing All mammals and most humans stop producing lactase after weaninglactase after weaning

• Lactose tolerance = lactase persistenceLactose tolerance = lactase persistence

• Simple dominant mode of inheritanceSimple dominant mode of inheritance

• Human genetic polymorphismHuman genetic polymorphism

• Where is the mutation?Where is the mutation?

Some humans are strange!Some humans are strange!

AGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCT

AGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCT

Lactose Lactose intolerantintolerant people people

Lactose Lactose toleranttolerant people people

Genetic association studyGenetic association study

Step 1: Identify a candidate geneStep 1: Identify a candidate geneStep 2: Find a mutation in the candidate geneStep 2: Find a mutation in the candidate gene

that associates with the trait of interestthat associates with the trait of interest

MCM6 LCT

The Lactase GeneThe Lactase Gene

C-13910TC-13910T• 100% association with lactose tolerance100% association with lactose tolerance• lies in a transcription factor binding sitelies in a transcription factor binding site

= exon= exon

GreeceGreece47%47%

SwedenSweden99%99%

GermanyGermany80%80%

TuaregTuareg87%87%

FulaniFulani78%78%

TussiTussi93%93%

South AfricaSouth Africa5%5%

BejaBeja87%87%

BedouinBedouin85%85% ChinaChina

~10%~10%

JapanJapan15%15%

Lactose tolerance frequencies in the Old WorldLactose tolerance frequencies in the Old World

Frequency of lactose Frequency of lactose tolerancetolerance

30%30%30-60%30-60% 60%60%

Natural Selection

“Variations, however slight and from whatever cause proceeding, if they be in any degree profitable to the individuals of a species […] will tend to the preservation of such individuals, and will generally be inherited by the offspring. The offspring, also, will thus have a better chance of surviving, for, of the many individuals of any species which are periodically born, but a small number can survive. I have called this principle, by which each slight variation, if useful, is preserved, by the term natural selection.”

(Charles Darwin in The Origin, 1859)

Traits that have been driven up in frequencyTraits that have been driven up in frequencyby natural selection are called by natural selection are called adaptations.adaptations.

The culture-historical hypothesisThe culture-historical hypothesis

Simoons (1965)Simoons (1965)• Cultures that relied on milk as a nutritional Cultures that relied on milk as a nutritional

source experienced natural selection for source experienced natural selection for lactose tolerancelactose tolerance

Gene-culture coevolutionGene-culture coevolution• Humans co-directed their own biologicalHumans co-directed their own biological

evolution by creating the selection pressureevolution by creating the selection pressurefor lactose tolerancefor lactose tolerance

Genepool

Genepool

Culture

Culture

t

t + 1Development

Development

Et+1

Gen

etic

inhe

rita

nce

Cul

tura

l inh

erita

nce

Tim

e

Et NaturalSelection

NaturalSelection

Gene-Culture CoevolutionCultural mediation of selection pressures

Cultural mediation of selection pressures

AGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGGTTAGCTAGCTTGCTATCGGTAAGCTTAGGTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTAAGCTTAGCTTAGCTAGCTTGCTATCGGTATGCTTAGCTTAGCTAGCTTGCTATCGGTATGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTATGCTTAGCTTAGCTAGCTTGCTATTGGTATGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCTAGCTTGCTATTGGTAAGCTTAGCTTAGCT

Detecting the signature of selection from genetic data

SNP = single nucleotide polymorphismsSNP = single nucleotide polymorphisms• Occurrence 1 in 1000 nucleotidesOccurrence 1 in 1000 nucleotides• Main source of human genetic variation Main source of human genetic variation

Genome-wide SNP data

• HapMap projectHapMap project• approx. 3 million SNPs in 4 human populationsapprox. 3 million SNPs in 4 human populations• project will be extendedproject will be extended

• Perlegen dataPerlegen data• approx. 1.5 million SNPs in 3 human populationsapprox. 1.5 million SNPs in 3 human populations• Populations include:Populations include:

African-AmericansAfrican-AmericansEuropean-AmericansEuropean-AmericansChinese-AmericansChinese-Americans

Fst – genetic differentiation• Fst:

– a measure of frequency difference between populations

Population A Population B

Pop A = 20%

Pop B = 30%

= T allele= C allele

Pop A = 20%

Pop B = 80%

Little population differentiationLow Fst

Lots of population differentiationHigh Fst

African-Americans vs. European AmericansFst distribution for 1.5 million SNPs

# of SNPs within and around the lactase gene = 100# of top 1% Fst SNPs within lactase gene = 15

top 1% Fst = 0.5top 1% Fst = 0.5

Evidence for selection?How unusual does the lactase gene look?

Sample 10,000 times from data at random blocks of 100 SNPs and count # of top 1% SNPs in each iteration

Observed = 15, p = 0.016

How often are 15 out of 100 SNPs within the top 1% of the Fst distribution in the whole data set?

Wolof (.51) Wolof (.51) (0)(0)

Ga’ali (.53) Ga’ali (.53) (0)(0)

Shaigi (.38) Shaigi (.38) (0)(0)

Dinka (.26) Dinka (.26) (0)(0)

Nuer (.22) Nuer (.22) (0)(0)

..

RedRedFrequency of lactose toleranceFrequency of lactose tolerance

BlueBlueExpected frequency of lactose tolerance Expected frequency of lactose tolerance

from frequency of -13910Tfrom frequency of -13910T

What about African dairying populations?What about African dairying populations?

Evidence for convergent evolution??Evidence for convergent evolution??

Lessons from Lactase• Lactose tolerance is rare worldwide and is found at Lactose tolerance is rare worldwide and is found at high frequencies only in dairying populationshigh frequencies only in dairying populations

• Genetic signature of selection: the lactase gene in Genetic signature of selection: the lactase gene in Europeans possesses one of the strongest Europeans possesses one of the strongest signatures of signatures of selection to be detected in the selection to be detected in the human genomehuman genome

• Gene-culture coevolution: culture can drive Gene-culture coevolution: culture can drive biological evolution in humansbiological evolution in humans

• Convergent evolution: lactose tolerance may be an Convergent evolution: lactose tolerance may be an example of recent convergent evolution in humansexample of recent convergent evolution in humans