The ETS-domain transcription factor Elk-1 regulates the expression ...

Kasza et al.

1

The ETS-domain transcription factor Elk-1 regulates the expression of its

partner protein, SRF.

Aneta Kasza, Amanda O’Donnell, Karen Gascoigne, Leo A.H. Zeef, Andy Hayes

and Andrew D. Sharrocks*

Faculty of Life Sciences, University of Manchester, Michael Smith building, Oxford Road,

Manchester, M13 9PT, UK.

*Corresponding author: A.D. Sharrocks

Tel: 0044-161 275 5979

Fax: 0044-161 275 5082

E-mail: [email protected]

Running title: Elk-1 regulates SRF expression.

Keywords: Elk-1, ETS-domain, MAP kinase, SRF, Transcription factor.

JBC Papers in Press. Published on November 4, 2004 as Manuscript M411161200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on February 11, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

2

Abstract

The ternary complex factors (TCF) are a subfamily of ETS-domain transcription factors that

bind and activate serum response elements (SREs) in the promoters of target genes in a

ternary complex with a second transcription factor, serum response factor (SRF). Here, we

have identified the SRF gene as a target for the TCFs, thereby providing a positive feedback

loop whereby TCF activation leads to the enhancement of the expression of its partner protein

SRF. The binding of the TCF Elk-1 to the SRF promoter and subsequent regulation of SRF

expression occurs in a ternary complex-dependent manner. Our data therefore reveal that SRF

is an important target for the Erk and Rho signaling pathways that converge on a ternary

TCF-SRF complex at the SRE on the SRF promoter.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

3

Introduction

Elk-1, SAP-1 and SAP-2/ERP/Net comprise the ternary complex factor (TCF)

subfamily of ETS-domain transcription factors (reviewed in 1, 2). These proteins form ternary

complexes on target promoters together with the MADS-box protein, serum response factor

(SRF). Both protein-DNA and protein-protein interactions with SRF are required to form

ternary complexes at the promoters of target genes like c-fos. The conserved B-box region of

the TCFs plays a pivotal role in mediating these protein-protein interactions (3, 4, 5, 6, 7, 8).

The TCFs can be phosphorylated within their transcription activation domains (TADs) by

members of all three of the major MAPK pathways present in mammals; ERK, JNK and p38

(reviewed in 1, 2, 9). In the case of Elk-1, this phosphorylation leads to the enhancement of its

transactivation properties both by the recruitment and activation of the coactivator proteins

Sur-2 and p300/CBP (10, 11) and also the loss of corepressor complexes containing HDAC-2

(12). Thus, Elk-1 provides an adaptor protein for SRF that can link it to the MAP kinase

signalling pathways.

In addition to binding to the TCFs, SRF has recently been shown to be able to bind to

members of the MAL/myocardin family of coactivator proteins (13, 14, 15, 16, 17, 18). In the

case of MAL, this interaction permits linkage of the MAL-SRF complex to the Rho signaling

pathway and subsequent activation of SRF-dependent gene expression (13, 16). The SRF

gene itself is thought to be one target gene for the MAL/myocardin-SRF complex. The

interaction of the TCFs and MAL/myocardin proteins with SRF is mutually exclusive, where

the Elk-1 B-box inhibits MAL/myocardin recruitment by SRF (19, 20). This suggests either

the existence of two different classes of SRF target genes (21) or the possibility of sequential

(13) or mutually exclusive interactions of different coregulatory proteins with the same SRF

target genes (20).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

4

To date the number of TCF target genes identified is limited and comprises well

studied immediate-early genes such as c-fos and egr-1 (reviewed in 1, 2, 9). On these latter

targets, SRF appears to aid TCF recruitment, but the reciprocal situation appears to operate on

other genes such as nur77 where the TCFs recruit SRF to the promoter (22, 23). It is currently

unclear if the TCFs act in an SRF-independent manner although evidence has been gathered

to suggest such a role on genes such as TNF-α (24) and 9E3/cCAF (25).

Due to the possibility of functional redundancy amongst the TCFs, suggested by the

minimal phenotypes obtained in mouse knockout studies (23, 26, 27), we developed a cell

line encoding an inducible repressive form of Elk-1 (Elk-1 fused to the engrailed repression

domain; Elk-En) to probe the potential role of TCFs in regulating gene expression (28). The

induction of Elk-En caused apoptosis and one key target gene identified was the anti-

apoptotic gene Mcl-1. Importantly, the activity of Elk-En was B-box dependent demonstrating

that it functions in a SRF-dependent manner. Here, we have extended these studies and show

that the gene encoding the TCF partner protein SRF is also a target for the TCF Elk-1. Elk-1

works through a ternary complex with SRF on the SRF promoter, thereby providing a link to

the ERK signaling pathway in addition to the well characterized link to the Rho pathway that

acts through SRF on its own promoter.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

5

Materials and Methods

Plasmid Constructs

pSRF-Luc(WT) (pAS2159) and pSRF-Luc(mETS-103) (pAS2160) contain a 322 bp

fragment of the mouse SRF promoter (-322- +1) upstream from the firefly luciferase gene,

with the wild-type promoter or containing a mutated ets site at position -103 respectively (29;

kindly provided by Ravi Misra), pCH110 (Pharmacia) contains an SV40 driven β-

galactosidase (LacZ) gene and is used to monitor transfection efficiency. pRSV-Elk-1-VP16

(pAS348) is an RSV promoter-driven vector encoding full-length wild-type Elk-1 fused to

residues 410-490 of VP16 C-terminal sequence (30). pAS1408 and pAS1411, encoding

respectively wild-type(WT) and L158P mutant derivatives of Elk-En (full-length Elk-1 fused

to the engrailed repression domain) have been described previously (28). pAS383 encodes

full-length wild-type Flag-tagged Elk-1 (31). pAS1801 encodes full-length mouse PEA3, and

was constructed by ligating a HindIII/SalI cleaved PCR product, (primers, A36/37) into

HindIII/XhoI cleaved pCDNA3. The plasmid pCGN (pAS2158) encodes full-length SRF

(kindly provided by Ravi Misra). pEFplink-MAL∆N encodes an N-terminally truncated,

constitutively active version of MAL (kindly provided by Richard Treisman; 16). pAS278

(encoding full-length His-Flag-tagged Elk-1) (31) and pAS58 (encoding GST fused to amino

acids 132-222 of SRF- coreSRF) (6) for expressing proteins in bacteria have been described

previously.

pAS197 and pAS489, encoding Elk-1(1-168)(WT) and Elk-1(1-168)(L158P) were

used in in vitro transcription/ translation of proteins and have been described previously (7).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

6

Tissue culture, cell transfection and reporter gene assays

The EcR293 cell derivatives EcR293(Elk-En{WT})#1.3 and EcR293(Elk-

En{L158P})#L8, Hela and 293 cells were grown as described previously (28). Elk-En fusions

were induced in EcR293 derivatives by stimulating with 5 µM ponasterone A (PA).

Where indicated, cells were stimulated with 20% foetal calf serum (FCS) 10 nM PMA

or 0.5 µM jasplakinolide and where, required the inhibitors latrunculin B (LB) (0.5 µM) or

U0126 (10 µM) were added 30 and 60 mins respectively, prior to stimulation.

Transient transfection experiments were carried out using Polyfect transfection

reagent in 12 well plates (Qiagen). Luciferase assays carried out using the dual light reporter

gene assay system (Tropix) as described previously, using pCH110 as an internal control

(28).

Western Blot analysis

Western blotting was carried out using Supersignal West Dura Extended Duration

Substrate (Pierce) and the following primary antibodies; Anti-Elk-1 (Santa Cruz), anti-SRF

(Santa Cruz), anti-M2 FLAG antibody (Sigma). Data was visualised using a Biorad Fluor-S

MultiImager. Quantification of proteins was carried out using Quantity One software (Bio-

Rad).

Gel retardation assays

Gel retardation assays were carried out with a 32P-labelled 116 base-pair fragments of the

mouse SRF promoter generated by PCR on the templates pSRF-Luc(WT) and pSRF-

Luc(mETS-103) (primers; ADS1251, GCAGCGAGTTCGGTATGTC and ADS1252,

CCGCTCCTTATATGGCGAGC) as described previously (32). coreSRF was produced as a

GST-tagged protein in bacteria (6) C-terminally truncated Elk-1 was produced by in vitro


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

7

transcription and translation using a TNTTM-coupled reticulocyte lysate system. 35S-labelled

proteins were analysed by electrophoresis through a 0.1% SDS-12% polyacrylamide gel,

before visualisation and quantification using a phosphorimager and Quantity One software

(Bio-Rad). Protein-DNA complexes were analyzed on nondenaturing 5% polyacrylamide gels

cast in 0.5x Tris-borate-EDTA and visualized by autoradiography and phosphorimaging.

Northern and Microarray Analysis.

Total RNA extracted using the RNeasy kit (Qiagen) and Northern analysis, carried out as

described previously (28). Probes were made by random priming (Roche) using templates

derived from a human SRF and Elk-1 full-length cDNAs.

Microarray experiments were performed using Affymetrix “Human Focus” and

“Human U133A” GeneChip oligonucleotide arrays (Affymetrix, Inc.) as described previously

(28). Normalization and further analyses were carried out using RMAExpress software

(http://stat-www.berkeley.edu/users/bolstad/RMAExpress/RMAExpress.html). Microarray

data were generated using 3 independent samples from ponasterone A stimulated and 2 from

unstimulated EcR293(Elk-En)#1.3 cells.

Chromatin immunoprecipitation

Chromatin immunoprecipitations were carried out as described previously (28) and using

anti-Elk-1 (Santa Cruz) or non specific IgG (Upstate) antibodies. Promoter-specific primers

were used to amplify the DNA by PCR: human egr-1 (described in 28), human SRF promoter

(ADS1249, TGACAGCAACGAGTTCGGTA and ADS1250,

CCCCCATATAAAGAGATACAATGTT) and SRF intronic sequence (intron 3; +4986 to


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

8

+5167) (ADS1273, GCCACAGGGCAGTAGATGTT and ADS1274,

TCAGGCCCAAGTATCCACTC).

Induction of apoptosis and Hoechst Staining.

Apoptosis was scored by counting disrupted nuclei revealed by Hoechst stain (Sigma) as

described previously (28). Etoposide (0.2 mM) was added to 293 cells for 48 hours to induce

apoptosis.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

9

Results

Repressive Elk-1 constructs downregulate the expression of SRF.

To study the effects of inhibiting TCF-mediated gene expression, and thereby uncover

novel TCF target genes, we created a 293-derived stable cell line that inducibly expresses a

fusion of Elk-1 with the powerful Engrailed (En) repression domain [EcR293(Elk-En)#1.3]

(28). Upon induction of its expression with ponasterone A (PA), this fusion protein is

expected to be recruited to all TCF-dependent promoters and hence ablate the expression of

genes normally controlled by TCFs. To identify potential target genes, we used Affymetrix

microarray analysis to compare the mRNA expression profiles of unstimulated EcR293(Elk-

En)#1.3 cells with the same cells stimulated with PA for 6 hours to induce the expression of

Elk-En. One of the downregulated genes identified was SRF (1.28 fold reduced). Northern

analysis confirmed the microarray data, demonstrating a clear reduction in SRF mRNA

following PA induction, which coincides with the induction of the expression of Elk-En (Fig.

1A). Similarly, SRF is also downregulated at the protein level following loss of the SRF

message (Fig. 1B). We also tested whether the prior induction of Elk-En could block the

activation of SRF expression by serum (FCS) stimulation. In comparison to the uninduced

cells, pretreatment of cells with PA to induce Elk-En expression led to a reduction in SRF

induction by serum (Fig. 2A). Thus, Elk-1 appears to be able to regulate the transcription of

the gene encoding its partner protein SRF.

Elk-En represses SRF expression in a B-box-dependent manner.

Elk-1 is thought to act primarily through ternary complexes in conjunction with SRF

on SREs (reviewed in 1, 2). However, it is possible that overexpression of Elk-En fusions

could result in the repression of genes usually regulated by different ETS-domain


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

10

transcription factors in an SRF-independent manner by virtue of their overlapping DNA

binding specificities. We therefore created a control cell line [EcR293(Elk-En{L158P})#L8]

that contains an Elk-En derivative that has a point mutation in its B-box region that blocks its

ability to bind to SRF and hence be recruited to DNA in an SRF-dependent manner (28). This

fusion protein should still inhibit transcription through high affinity binding sites. Control

experiments demonstrated that this was the case in reporter assays and that the expression

levels of the wild-type and L158P version of Elk-En were similar (28).

The prior induction of Elk-En(L158P) expression had little effect on serum-stimulated

SRF expression (Fig. 2B). This contrasts with the induction of wild-type (WT) Elk-En which

caused a clear reduction in serum-inducible SRF expression (Fig. 2A). We also examined the

protein levels of SRF in EcR293(Elk-En{L158P})#L8 cells following induction of Elk-

En(L158P), in contrast to the reductions in SRF levels observed upon induction of wild-type

Elk-En (Fig. 1B), no change in SRF expression was observed, even after 63 hours of

induction with PA (Fig. 2C).

To demonstrate that Elk-En could act directly on the SRF promoter, we carried out

transient transfection assays with increasing amounts of Elk-En and a SRF promoter-driven

luciferase reporter construct (Fig. 3A). Wild-type Elk-En efficiently repressed the activity of

the SRF promoter. In contrast, the mutant derivative, Elk-En(L158P), was unable to repress

the activity of the SRF promoter. This differential effect was not due to differences in

expression of the Elk-En fusions (Fig. 3B). Although Elk-En(L158P) is unable to affect the

activity SRF promoter, it is possible that other ETS-domain proteins might regulate this

promoter. Indeed, overexpression of a different ETS-domain protein, PEA3, also caused

upregulation of this promoter (data not shown). To establish the specificity of ETS-domain

protein action, we determined whether PEA3 could compete with Elk-En fusions in regulating


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

11

the SRF promoter. However, PEA3 was unable to compete with Elk-En (Fig. 3C), suggesting

that Elk-1 is an important regulator of this promoter.

Collectively, these data therefore demonstrate that Elk-1-mediated regulation of the

SRF promoter takes place in a B-box-dependent manner, suggesting that it is recruited by

SRF into a ternary, promoter-bound complex.

Elk-1 recruitment to the SRF promoter is mediated by an ets binding site.

The SRF promoter contains two CArG boxes that are bound by SRF and are important

for signal-mediated activation of SRF expression (33, 34). In addition, there is a functionally

important ets binding motif located upstream from these binding sites (29)(Fig. 4A). We

therefore tested whether Elk-1 can bind to this module in vitro using a DNA fragment

encompassing the upstream CArG box and the ets site (Fig. 4A). In the absence of SRF, Elk-1

was unable to bind to the SRF promoter (Fig. 4B, lane 3). However, in the presence of SRF,

the binding of Elk-1 was strongly stimulated and a ternary complex was formed on the

promoter (Fig. 4B, lane 4). This binding was dependent on the integrity of the B-box region

of Elk-1 as Elk-1(L158P) was unable to bind to the promoter (Fig. 4B, lane 5), demonstrating

the importance of interactions with SRF for its recruitment. Next, we tested the requirement

for the ets motif for recruitment of Elk-1 to the SRF promoter. Mutation of the ets motif

reduced the ability of Elk-1 to bind to the SRF promoter in a complex with SRF (Fig. 4B, lane

9). Thus, both protein-DNA contacts and protein-protein interactions with SRF are essential

for the efficient recruitment of Elk-1 to the SRF promoter

To extend these observations in vivo, we investigated the ability of Elk-1 derivatives

to regulate an SRF promoter-reporter construct that contains a mutation in the ets motif (Fig.

5A). The wild-type SRF promoter was repressed by Elk-En and activated by a constitutively

active Elk-VP16 fusion protein (Fig. 5B). In contrast, the activity of the mutated promoter,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

12

SRF(ets-mut), was unaffected by either fusion protein (Fig. 5B). We also investigated the

ability of wild-type Elk-1 to activate the SRF promoter in the presence of PMA which

stimulates the MAP kinase pathway (Fig. 5C). Elk-1 activated the wild-type SRF promoter in

a dose-dependent manner. In contrast, its ability to activate the mutant SRF promoter was

severely reduced.

Collectively, these data demonstrate the importance of the ets motif within the SRF

promoter for the binding of Elk-1 and the subsequent ability of Elk-1 to regulate its

expression.

Elk-1 binds to the SRF promoter in vivo.

The above results indicate that Elk-1 can bind to the SRF promoter in vitro and

regulate its activity in vivo. To demonstrate that endogenous Elk-1 can occupy the SRF

promoter in vivo, we carried out a chromatin immunoprecipitation (ChIP) experiment in HeLa

cells. In the presence of Elk-1 antibodies, the SRF promoter was precipitated from

formaldehyde cross-linked total cell lysates (Fig. 6B, top panel, lanes 5 and 6). In contrast,

control antibodies precipitated background levels of the SRF promoter (Fig. 6B, lanes 3 and

4) and the Elk-1 antibody was unable to precipitate an intronic fragment of the SRF gene

above background levels (Fig. 6B, lower panel). The association of Elk-1 with the SRF

promoter was enhanced irrespective of the presence of PMA stimulation (Fig. 6B, lanes 5 and

6). Similarly, Elk-1 could be detected at the promoter of the well characterized target gene,

egr-1, both in the presence and absence of PMA stimulation. Thus, on the SRF and egr-1

promoters, it appears that Erk-pathway dependent activation of Elk-1 does not enhance

promoter occupancy, unlike previous in vitro studies that demonstrate phosphorylation-

enhanced recruitment of Elk-1 to the c-fos SRE (35, 36).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

13

These data therefore demonstrate that endogenous Elk-1 binds to the SRF promoter in

vivo, thereby suggesting that the regulatory effects of Elk-1 on SRF expression are direct.

Regulation of SRF expression by the Erk and Rho pathways.

Previously, SRF has been identified as a target gene of the Rho signaling pathway

(21), and this regulation is mediated by coactivator proteins from the MAL family that act

through SRF bound to the promoter (Fig. 7A). The binding of MAL is mutually exclusive

with TCF binding to SRF (19), suggesting that regulation by TCFs and MAL might also be

mutually exclusive. However, it is also possible that the Erk pathway, through the TCFs, can

contribute to the activation of the SRF promoter. This would be important physiologically, as

under different conditions, signaling through either the Rho or Erk pathway alone or

simultaneous activation of several pathways might occur.

To investigate the convergence of these two pathways on the SRF promoter, we first

examined the expression of SRF in response to activating the Erk pathway with PMA or the

Erk and Rho pathways by serum (FCS). The Erk and Rho pathway inhibitors, U0126 and

Latrunculin B (LB) respectively, were used to identify the individual contributions of these

pathways to SRF induction. SRF expression was increased by PMA stimulation, and this

increase was selectively blocked with U0126, demonstrating that this activation was Erk

pathway dependent (Fig. 7B, lanes 2-4). Similarly, FCS stimulated SRF expression, and this

was inhibited by both LB and, to a lesser extent, U0126 (Fig. 7B, lanes 5-7). Similar

observations have been made in NIH3T3 cells (21). Thus, the Erk pathway can activate SRF

expression and contributes to its expression following serum induction.

We also tested whether the Erk and Rho pathways contributed directly to the

regulation of the SRF promoter using reporter gene assays. First, we overexpressed Elk-1 to

sensitise the SRF promoter to Erk-pathway mediated stimulation. Under these conditions,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

14

both PMA and FCS treatment led to an increase in the activity of a SRF promoter-driven

luciferase reporter (Fig. 7C). The inhibition of the Erk pathway reduced the activation of the

SRF promoter by both treatments. However, LB was less effective in reducing the activation

of the SRF promoter by FCS, presumably due to Elk-1 competing with MAL recruitment. To

probe this possibility further, we tested the response of the SRF promoter to activation of the

Rho pathway by jasplakinolide in the presence and absence of exogenous Elk-1 (Fig. 7D).

The addition of Elk-1 inhibited the activation of the SRF promoter by jasplakinolide. This was

not a general inhibitory effect as the promoter now became more responsive to activation by

PMA. Thus, the level of Elk-1 in the cell can determine whether the Erk or Rho pathway can

activate the SRF promoter.

Conversely, we asked whether the overexpression of a constitutively active form of

MAL, MAL∆N (16) could interfere with Elk-1-mediated SRF promoter regulation. We

transfected 293 cells with either the wild-type (WT) or mutant (ets-mut) versions of the SRF-

luciferase reporter construct in the presence of low amount of Elk-En to dampen down the

activity of the promoter. A dose-dependent increase in the activity of the WT promoter was

observed upon transfection of increasing amounts of MAL∆N expression plasmid (Fig. 7E).

However, in contrast, the ets-mut promoter was activated to maximal levels at the lowest

concentration of MAL∆N expressed, with no further increases seen at higher levels of

MAL∆N (Fig.7E). Thus, the absence of the ets motif within the SRF promoter makes it more

sensitive to activation by MAL∆N, thereby demonstrating that occupancy of this ets motif in

vivo can inhibit activation via MAL.

Finally, we compared the ability of wild-type Elk-1 and an alternative ETS-domain

transcription factor, PEA3, to affect the activity of MAL∆N on the SRF promoter in serum

starved cells. Experiments were carried out under serum starved conditions where the ERK

pathway and hence the ETS-domain protein targets are not activated. Elk-1 inhibited the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

15

action of MAL∆N in a dose-dependent manner, but PEA3 did not, and instead weakly

potentiated the activity of MAL∆N on the SRF promoter (Fig. 7F). This is consistent with a

model whereby Elk-1 binds through SRF interactions, thereby inhibiting MAL recruitment,

but that other ETS-domain proteins like PEA3 may in some circumstances function in an

SRF-independent manner to activate the SRF promoter.

Collectively, these data corroborate previous observations that indicate that TCF and

MAL/myocardin recruitment by SRF is mutually exclusive (19, 20). However importantly,

they demonstrate a clear role for the Erk pathway in regulating SRF expression and suggest

how multiple signaling inputs might lead to upregulation of the SRF promoter (see

discussion).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

16

Discussion

The TCF transcription factors play an important role in transducing extracellular

signals into a nuclear response by acting as targets for the MAP kinase signaling pathways

(reviewed in 1, 2, 9). To fully understand the physiological role of the TCFs, it is important to

gain a fuller insight into the spectra of target genes that they regulate. To date, the focus has

been primarily on the immediate-early genes such as c-fos and egr-1 (reviewed in 1, 2, 9).

Here we have identified SRF as a direct TCF target gene. This provides an elegant positive

feedback loop whereby the TCFs can regulate the expression of the TCF partner protein SRF.

We initially identified SRF as a TCF target gene by demonstrating downregulation of

SRF expression in cell lines expressing the repressive Elk-En fusion protein (Fig. 1). By using

a combination of reporter gene and ChIP analyses, we have shown that the TCFs can directly

affect the SRF promoter and that endogenously expressed Elk-1 can be found on this

promoter in vivo (Figs. 3, 5 and 6). It is currently not known whether TCFs other than Elk-1

can participate in the regulation of SRF. Indeed, as overexpressed Elk-En can potentially

block regulation by all the TCFs due to their structural similarity, it will be important to probe

whether the other TCFs can work in the same way. It remains possible that other ETS-domain

proteins might act on the SRF promoter through the ets site. Indeed, overexpression of PEA3,

a target of the Erk pathway (37), can activate the SRF promoter in an ets site-dependent

manner (data not shown). However, PEA3 is unable to compete with Elk-1 for promoter

occupancy (Fig. 3C). Indeed, in we show that in cells containing Elk-1, the SRF promoter is

occupied by Elk-1 (Fig. 6). It remains possible that in other cell types, where low levels of

Elk-1 and high levels of ETS-domain proteins such as PEA3 exist, that different ETS-domain

proteins contribute to SRF regulation. However, the interplay with the Rho/MAL pathway

would likely differ, as interference with SRF-dependent MAL recruitment would not occur

(Fig. 7F).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

17

Elk-1 appears to act to couple signals generated by the Erk pathway to the activation

of the SRF promoter (Fig. 7) whereas the coactivator MAL has previously been shown to

couple Rho pathway signals to this promoter (21). Signaling through the Erk pathway is of

importance where signaling does not activate the Rho pathway, here induced using the

mitogen PMA, and as a potential contributing pathway to more complex signaling triggers

such as serum. Importantly, we show that the ability of Elk-1 to regulate SRF expression is

dependent on the formation of a ternary complex with DNA-bound SRF (Figs. 2, 4 and 5).

Previous studies have shown that signaling via the Rho pathway also functions through SRF

bound to its own promoter, although in this case, the MAL/myocardin family protein MAL

represents the coregulatory partner that links to this pathway (13, 16). We demonstrate that a

functional antagonism can occur depending on the relative levels of MAL and the TCFs

within the cell (Fig. 7), which is consistent with previous data demonstrating that Elk-1 can

inhibit MAL recruitment in a B-box-dependent manner to SRF-regulated promoters (19, 20).

Thus depending on the relative levels of the TCF and MAL/myocardin family proteins, the

relative contributions of these two classes of coregulators might differ. Alternatively, there

may be a role for both coregulators in permitting convergence of the Erk and Rho pathways

through SRF bound to promoters. Our data suggest that the latter scenario may well exist at

the SRF promoter as inhibitor studies demonstrate a contribution of the Erk pathway to

mitogenic stimulation of SRF expression (Fig. 7B) that is consistent with results from a

previous study (21). In addition, it has been proposed that the TCFs might contribute to the

early induction phase of other genes like c-fos in response to mitogens while the

MAL/myocardin family contributes to the later phases (13). Furthermore, recent studies

demonstrate that promoters in several smooth muscle genes can be regulated through SRF by

either the TCFs or MAL/myocardin family members depending on the signaling pathways

that are active (20). Thus our data add further weight to an emerging model that SRF can


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

18

form a platform that can differentially recruit coregulatory transcription factors and permit

selective or combinatorial responses to different signaling pathways depending on the target

promoter.

Finally, our data further suggest an important role for SRF expression in cell survival.

Previously, SRF has been shown to be a target for degradation in response to apoptotic

pathways (38, 39) and also to regulate the expression of anti-apoptotic proteins like Bcl-2

(40). Recently we showed that the induction of Elk-En causes apoptosis and that one key anti-

apoptotic target gene was the antiapoptotic gene Mcl-1 (28). As SRF expression is also

downregulated upon Elk-En induction, then this too might play a role in triggering apoptosis.

Indeed, the downregulation of SRF transcript levels is a natural process observed upon

apoptotic induction caused by etoposide treatment (our unpublished data). However, although

we could partially rescue apoptosis induced by Elk-En (data not shown), we have been unable

to differentiate whether this was due to replacement of the downregulated endogenous SRF,

or merely titration of the Elk-En away from the promoters of antiapoptotic genes. Thus, the

TCFs can potentially promote cell survival through the regulation of multiple genes and

provide an important link to the prosurvival effects of the Erk pathway.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

19

Acknowledgements

We would like to thank Anne Clancy for excellent technical support. We also would like to

thank Ravi Misra and Richard Treisman for reagents and Shen-Hsi Yang, and Alan

Whitmarsh for comments on the manuscript. This work was funded by grants from the

Wellcome Trust and the AICR. AK was supported by a Research Fellowship from the

Wellcome Trust and the Foundation for Polish Science.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

20

References

1. Sharrocks, A. D. (2002) Biochem Soc Trans. 30, 1-9.

2. Shaw, P. E., and Saxton, J. (2003) Int. J. Biochem. Cell. Biol. 35, 1210-1226.

3. Janknecht, R. and Nordheim, A. (1992) Nucleic Acids Res. 20, 3317-3324.

4. Dalton, S. and Treisman, R. (1992) Cell 68, 597-612.

5. Treisman, R., Marais, R. and Wynne, J. (1992) EMBO J. 11, 4631-4640.

6. Shore, P. and Sharrocks, A. D. (1994) Mol. Cell. Biol. 14, 3283-3291.

7. Ling, Y., Lakey, J. H., Roberts, E.C. and Sharrocks. A .D. (1997) EMBO J. 16, 2431-2440.

8. Hassler, M. and Richmond, T.J. (2001) EMBO J. 20, 3018-3028.

9. Wasylyk, B., Hagman, J. And Gutierrez-Hartmann, A. (1998) Trends Biochem Sci. 23,

213-216.

10. Stevens, J. L., Cantin, G. T., Wang, G., Shevchenko, A., Shevchenko, A., and Berk, A. J.

(2002) Science 296, 755-758


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

21

11. Li, Q. J., Yang, S. H., Maeda, Y., Sladek, F. M., Sharrocks, A. D., and Martins-Green, M.

(2003) EMBO J. 22, 281-291

12. Yang, S. H. and Sharrocks, A. D. (2004) Mol.Cell 13, 611-617

13. Cen, B., Selvaraj, A., Burgess, R. C., Hitzler, J. K., Ma, Z., Morris, S. W., and Prywes, R.

(2003) Mol.Cell Biol. 23, 6597-6608

14. Wang, D., Chang, P. S., Wang, Z., Sutherland, L., Richardson, J. A., Small, E., Krieg, P.

A., and Olson, E. N. (2001) Cell 105, 851-862

15. Wang, D. Z., Li, S., Hockemeyer, D., Sutherland, L., Wang, Z., Schratt, G., Richardson, J.

A., Nordheim, A., and Olson, E. N. (2002) Proc.Natl.Acad.Sci.U.S.A 99, 14855-14860

16. Miralles, F., Posern, G., Zaromytidou, A. I., and Treisman, R. (2003) Cell 113, 329-342

17. Du, K. L., Ip, H. S., Li, J., Chen, M., Dandre, F., Yu, W., Lu, M. M., Owens, G. K., and

Parmacek, M. S. (2003) Mol.Cell Biol. 23, 2425-2437

18. Selvaraj, A. and Prywes, R. (2003) J.Biol.Chem. 278, 41977-41987

19. Murai, K. and Treisman, R. (2002) Mol.Cell Biol. 22, 7083-7092


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

22

20. Wang, Z., Wang, D. Z., Hockemeyer, D., McAnally, J., Nordheim, A., and Olson, E. N.

(2004) Nature 428, 185-189

21. Gineitis, D. and Treisman, R. (2001) J. Biol. Chem. 276, 24531-24539.

22. Latinkic, B. V., Zeremski, M. and Lau, L.F. (1996) Nucleic Acids Res. 24, 1345-1351.

23. Costello, P. S., Nicolas, R. H., Watanabe, Y., Rosewell, I. and Treisman, R. (2004) Nat.

Immunol. 5, 289-298.

24. Tsai, E., Falvo, J. V., Tsytsykova, A. V., Barczak, A. K., Reimold, A. M., Glimcher, L.

H., Fenton, M. J., Gordon, D. C., Dunn, I. F. and Goldfeld, A. E. (2000) Mol. Cell. Biol. 20,

6084-6094.

25. Li, Q. J., Vaingankar, S., Sladek, F.M. and Martins-Green, M. (2000) Blood 96, 3696-

3706.

26. Ayadi, A., Zheng, H., Sobieszczuk, P., Buchwalter, G., Moerman, P., Alitalo, K. and

Wasylyk, B. (2001) EMBO J. 20, 5139-5152.

27. Cesari, F., Brecht, S. Vintersten, K., Vuong, L. G., Hofmann, M., Klingel, K., Schnorr, J.

J., Arsenian, S., Schild, H., Herdegen, T., Wiebel, F. F. and Nordheim, A. (2004) Mol. Cell.

Biol. 24, 294-305.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

23

28. Vickers, E. R., Kasza, A., Aksan-Kurnaz, I., Seifert, A., Zeef, L., O’Donnell, A., Hayes,

A. and Sharrocks, A. D. (2004) Mol. Cell. Biol. In Press.

29. Spencer, J. A., Major, M. L., and Misra, R. P. (1999) Mol.Cell Biol. 19, 3977-3988

30. Price, M. A., Rogers, A. E and Treisman, R. (1995) EMBO J. 14, 2589-2601.

31. Yang, S. H., Yates, P. R., Whitmarsh, A. J., Davis, R. J. and Sharrocks, A. D. (1998) Mol.

Cell. Biol. 18, 710-720.

32. Sharrocks, A. D., Gille, H. and Shaw, P. E. (1993) Mol. Cell. Biol. 13, 123-132.

33. Spencer, J. A. and Misra, R. P. (1996) J.Biol.Chem. 271, 16535-16543

34. Belaguli, N. S., Schildmeyer L. A. And Schwartz R. J. (1997) J. Biol. Chem. 272, 18222-

18231.

35. Gille, H., Sharrocks, A. D. and Shaw, P.E. (1992) Nature 358, 414-417.

36. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H., and

Shaw, P. E. (1995) EMBO J. 14, 951-62.

37. O'Hagan, R.C., Tozer, R.G., Symons, M., McCormick, F., and Hassell, J.A. (1996)

Oncogene 13, 1323-33.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

24

38. Bertolotto, C., Ricci, J. E., Luciano, F., Mari, B. Chambard, J. C. and Auberger, P.

(2000) J.Biol.Chem. 275, 12941-12947.

39. Drewett, V., Devitt, A., Saxton, J., Portman, N., Greaney, P., Cheong, N. E., Alnemri, T.

F., Alnemri, E. and Shaw, P.E. (2001) J. Biol. Chem. 276, 33444-33451.

40. Schratt, G., Weinhold, B., Lundberg, A. S., Schuck, S., Berger, J., Schwarz, H.,

Weinberg, R., Ruther, U. And Nordheim, A. (2001) Mol. Cell. Biol. 21, 2933-2943.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

25

Figure legends

Figure 1. SRF expression is downregulated by Elk-En. EcR293(Elk-En)#1.3 cells were

treated with 5µM ponasterone A (PA) for the indicated times. (A) The expression of SRF

mRNA was analysed by Northern blotting (A) and SRF protein by Western analysis (B). The

middle panels show the expression levels of Elk-En whereas the bottom panels show loading

controls (total RNA for Northern analysis and GAPDH for Western analysis).

Figure 2. SRF downregulation by Elk-En is B-box dependent. SRF expression was analysed

by Northern blotting in EcR293(Elk-En)#1.3 (A) and EcR293(Elk-En{L158P}) cells (B).

Cells were serum starved for 24 hrs, pretreated with 5µM ponasterone A (PA) for 19 hrs and

stimulated with 20% serum for 2 or 3 hrs. The middle panels show the expression levels of

Elk-En whereas the bottom panels show the total RNA loading control. (C) Western blot

analysis of SRF expression (top panel) in EcR293(Elk-En{L158P}) cells treated with 5µM

ponasterone A for the indicated times. The middle panel shows the expression levels of Elk-

En whereas the bottom panel shows GAPDH loading control.

Figure 3. Elk-En downregulates the SRF promoter. (A) 293 cells were transiently transfected

with a luciferase construct containing the SRF promoter and with increasing concentrations of

Elk-En(WT) and Elk-En(L158P) (0, 1, 5, 10, 25, 50 ng). Cells were starved for 48 hrs and

then stimulated with 20% serum. Luciferase activity was measured 6 hrs after stimulation.

The results were normalised to β-galactosidase activity. (B) Western blot analysis of Elk-

En(WT) and Elk-En(L158P) from samples derived from cells transfected with 10 ng (lanes 1

and 5), 25 ng (lanes 2 and 6), 50 ng (lanes 3 and 7) and 100 ng (lanes 4 and 8) of expression

vector. (C) Reporter gene analysis of the wild type (WT) SRF promoter (0.4 µg) in 293 cells


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

26

grown as in part (A), in the absence and presence of 20 ng of Elk-En and increasing amounts

of a construct encoding PEA3 (0, 2.5, 10, 25 ng).

Figure 4. Elk-1 binds the SRF promoter in a B-box-dependent manner. (A) Schematic

diagram showing the sequence of wild type and mutated ets binding site in the SRF promoter.

The region encompassed by the dashed box was used in the gel retardation assay. (B) Gel

retardation assay with a fragment of SRF promoter (-49 to -165) containing the wild type

(WT) or mutated ets binding site (ets-mut) and one CArG box. The DNA was incubated with

the indicated combination of coreSRF and C-terminally truncated Elk-1(1-168)(WT) or Elk-

1(1-168)(L158P). The ternary complex containing Elk-1 and SRF and binary complex

containing SRF alone are indicated by closed and open arrows respectively.

Figure 5. The ets motif in the SRF promoter plays an important role in its regulation by Elk-

1. (A) Schematic diagram showing the sequence of wild type and mutated ets binding site in

SRF promoter used in luciferase assay. (B, C) Reporter gene analysis of the Wild type (WT)

and ets mutated (ets-mut) SRF promoter. (B) 293 cells were transiently transfected with a

luciferase construct containing the WT or ets-mut SRF promoter and with 2.5 ng Elk-En or 5

ng Elk-VP16 fusion protein. Cells were starved for 48 hrs and then stimulated with 20%

serum. Luciferase activity was measured 6 hrs after stimulation. The results were normalised

to β-galactosidase activity. (C) 293 cells were transiently transfected with SRF-luc reporter

constructs as in (B) but with increasing concentration of Elk-1 (2.5, 5, 10 ng respectively).

Cells were starved for 48 hrs and then stimulated with 10 nM PMA. Relative luciferase

activity was determined as in (B).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

27

Figure 6. Elk-1 binds to the SRF promoter in vivo (A) Schematic diagram of the SRF gene

showing the location of oligonucleotides used in chromatin immunoprecipitation assay. (B)

Chromatin immunoprecipitation of Elk-1 bound to the SRF promoter. Hela cells were starved

in serum free DMEM for 48 hrs and then stimulated with 10 nM PMA for 5 min where

indicated. Sonicated chromatin was immunoprecipitated with either an anti-Elk-1 antibody or

non-specific IgG. PCR analysis of eluted DNA was performed using oligonucleotides specific

for the SRF promoter (top panel), SRF intronic sequence (middle panel) or egr-1 promoter

(bottom panel). 2% of input DNA is shown in lanes 1 and 2. The panels shown are inverted

images of ethidium bromide stained gels.

Figure 7. The Erk pathway contributes to mitogenic regulation of SRF expression. (A)

Schematic diagram of regulation of the SRF promoter by the Erk and Rho pathway through

SRF and the coregulators Elk-1 and MAL. Specific inhibitors U0126 and latrunculin B (LB)

inhibit activation by the Erk and Rho pathways respectively. (B) Northern blot analysis of

SRF expression in Hela cells. Bottom panel shows loading control. Cells were starved in

serum free DMEM for 24 hrs and then stimulated with 10 nM PMA or 20% serum for 2 hrs.

Lane 3 and 6: cells were pretreated with 0.5 µM LB for 1 hr before stimulation. Lane 4 and 7:

cells were pretreated with 10 µM U0126 for 30 min before stimulation. (C and D) SRF

promoter analysis. (C) 293 cells were transiently transfected with a luciferase construct (0.4

µg) containing the SRF promoter and with Elk-1 (0.2 µg). Cells were starved for 48 hrs and

then stimulated with 10 nM PMA or 20% FCS. Where indicated, before stimulation cells

were pretreated with 0.5 µM LB for 1 hr or with 10 µM U0126 for 30 min. Luciferase activity

was measured 6 hrs after stimulation. The results were normalised to β-galactosidase activity.

(D) 293 cells were transiently transfected with a SRF-luc reporter (0.4 µg) and where

indicated with Elk-1 (0.2 µg). Cells were starved for 48 hrs and then stimulated with 10 nM


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kasza et al.

28

PMA or 0.5 µM jasplakinolide. Relative luciferase activity was determined as in (C). (E)

Reporter gene analysis of the wild type (WT) or ets mutated (ets-mut) SRF promoter (0.4 µg),

in the presence of 20 ng of Elk-En and increasing amounts of a construct encoding MAL∆N

(0, 10, 20, 50, 100 ng). (E) Reporter gene analysis of the wild type (WT) SRF promoter (0.4

µg) in serum starved 293 cells, in the absence and presence of 20ng of MAL∆N and

increasing amounts (0, 10, 20, 50 ng) of constructs encoding Elk-1 and PEA3.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 1

A

1 2 3 4 5 6

0.5 1 2 4 6 ConHrs:

Total

SRF

Elk-En

+PA

BHrs:

GAPDH

SRF

Elk-En

0 15 24 39 48 63

+PA

1 2 3 4 5 6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 2

A

1 2 3 4 5 6B

FCS (Hrs):

Total

SRF

Elk-En

Total

SRF

Elk-En

0 2 3 0 2 3

-PA

1 2 3 4 5 6

+PA

EcR293(Elk-En{WT}):

FCS (Hrs): 0 2 3 0 2 3

-PA +PA

EcR293(Elk-En{L158P}):

C

Hrs:

GAPDH

SRF

Elk-En

0 15 24 39 48 63

+PA

1 2 3 4 5 6

EcR293(Elk-En{L158P}):


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 3

A

B

1 2 3 4 5 6

Elk-En:

0.2

0.4

0.6

0.8

1.0

1.2

1.4

Rel

ativ

e Lu

c. A

c tiv

ity

0

WT L158P-

7 8

L158PWT

Elk-En

LucSRF

0

2

4

6

8

10

C

Elk-En: - + + + +--PEA3:

SRF(WT)-luc

Rel

. Luc

ifera

seac

tivity


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 4

A

1 2 3 4 5 6 7 8 9 10

- - - +Elk-1(1-168)(L158P):+

-- -+Elk-1(1-168)(WT): -

+ SRF

- - - ++

-- -+-

+ SRF

WT ets-mut

B

2°

3°

SRF

TGCCGGAAGC

ets CArG CArG

TGCCTGCAGC

WT

ets-mut


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 5

ALucSRF

B

TGCCGGAAGC

ets CArG CArG

TGCCTGCAGC

WT

ets-mut

SRF(WT)-luc

Elk-1:0

2

4

6

8

10

- ---

Rel

ativ

e Lu

cife

rase

activ

ity

SRF(ets-mut)-luc

PMA PMA

C

0

1

2

3

4

Rel

ativ

e Lu

cife

rase

activ

ity

SRF(WT)-luc SRF(ets-mut)-luc

-

Elk-

VP16

Elk-

En -

Elk-

VP16

Elk-

En


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 6

A

SRF

ets CArG CArG

ADS1249 ADS1250 ADS1273 ADS1274

Exon 1 Intron 3

1 2 3 4 5 6

SRF (promoter)

input

SRF (intron)

- + - -+ +PMA:

IgG Elk-1IP:B

Egr-1 (promoter)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

B

1 2 3 4 5 6

C

Total

SRF

- LB U012

6

7

- LB U012

6

-

PMA FCS

0

1

2

3

4

Rel

ativ

e Lu

c. a

ctiv

ity

- LBU0

126- - LB

U012

6

PMA FCS

LucSRF

1

2

3

4

5

Rel

ativ

e lu

cife

rase

activ

ity

0Elk-1: - - -+ +

Jasp PMA

DLucSRF

E

SRFSRF SRF

Elk-1 MALRho pathwayErk Pathway

U0126 LB

A

ets CArG CArG

0

2

4

6

-MAL∆N

Rel

ativ

e Lu

c. a

ctiv

ity

-

LucSRF

ets CArG CArG

WT ets-mut

Fig. 7

0

20

40

60

80

-MAL∆N + + + + + + +-- -- -

-- -- -Elk-1PEA3

FLucSRF

Rel

ativ

e Lu

c. a

ctiv

ity


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Andrew D. SharrocksAneta Kasza, Amanda O'Donnell, Karen Gascoigne, Leo A. H. Zeef, Andy Hayes and

protein, SRFThe ETS-domain transcription factor Elk-1 regulates the expression of its partner

published online November 4, 2004J. Biol. Chem.

10.1074/jbc.M411161200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M411161200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M411161200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/11/04/jbc.M411161200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/11/04/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/11/04/jbc.M411161200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

The ETS-domain transcription factor Elk-1 regulates the expression ...

Documents

Transcript of The ETS-domain transcription factor Elk-1 regulates the expression ...