The DNA Structure-Specific Endonuclease MUS81 … · Immunity, Volume 44 Supplemental Information...

24
Immunity, Volume 44 Supplemental Information The DNA Structure-Specic Endonuclease MUS81 Mediates DNA Sensor STING-Dependent Host Rejection of Prostate Cancer Cells Samantha S.W. Ho, Wendy Y.L. Zhang, Nikki Yi Jie Tan, Muznah Khatoo, Manuel A. Suter, Shubhita Tripathi, Florence S.G. Cheung, Weng Khong Lim, Puay Hoon Tan, Joanne Ngeow, and Stephan Gasser

Transcript of The DNA Structure-Specific Endonuclease MUS81 … · Immunity, Volume 44 Supplemental Information...

Immunity, Volume 44

Supplemental Information

The DNA Structure-Specific Endonuclease

MUS81 Mediates DNA Sensor STING-Dependent

Host Rejection of Prostate Cancer Cells

Samantha S.W. Ho, Wendy Y.L. Zhang, Nikki Yi Jie Tan, Muznah Khatoo, Manuel A.Suter, Shubhita Tripathi, Florence S.G. Cheung, Weng Khong Lim, Puay HoonTan, Joanne Ngeow, and Stephan Gasser

1

Supplementary Materials for Ho et al.

EXPERIMENTAL PROCEDURES

Reagents and Constructs

Cytosine β-D-arabinofuranoside hydrochloride (Ara-C), hydroxyurea (HU),

ovalbumin and DMSO were purchased from Sigma Aldrich. The PARP inhibitor

NU1025, the ATR inhibitor VE-821 and aphidicolin (APH) were purchased from

Calbiochem (USA). All drugs were dissolved in DMSO and added for 16 h total

treatment duration. Final drug concentrations were; 10 μM for Ara-C and

NU1025, 2 μM for VE-821, 10 mM for HU, and 4 μM for aphidicolin.

Murine Mus81 cDNA (#BC026560) was purchased from Open Biosystems

(Thermo Scientific) and cloned into a retroviral MSCV 2.2 construct containing

IRES-GFP (MSCV-GFP) using NotI (3' site) and XhoI (5' site) restriction enzymes

(New England Biolabs). Murine Mus81-specific shRNA (Accession No.

NM_027877) and negative control GIPZ lentiviral constructs were purchased

from Open Biosystems. Retroviral supernatants were generated as previously

described (Diefenbach and Raulet, 2003). Two days post-transduction, GFP+ cell

within the top 10% of fluorescence intensity were sorted using a MoFlo apparatus

(Beckman Coulter) or the transduced cells were selected using 10 μg/ml

puromycin (Sigma). A total of 20 nM negative control (sic001-1nmol), or human

MUS81 (SASI_Hs_00146003 and SASI_Hs_00146004) siRNAs were used for

transfection. A total of 30 nM negative control (sic001-1nmol) or human STING

siRNA (SASI_Hs02_00371843 and SASI_Hs01_00031029) were used for

transfection.

2

Real-Time PCR

Total RNA was isolated using the nucleospin RNA II kit according to the

manufacturer's instructions (Macharey Nagel) and reverse transcribed using M-

MLV Reverse Transcriptase with random hexamers (Promega). The total

reaction volume was 25 μl and contained reverse transcribed RNA, 0.2 μM

forward primer, 0.2 μM reverse primer and 12.5 μl iTaq SYBR Green Supermix

with ROX (Bio-Rad). Triplicate PCR reactions were performed using an ABI

PRISM 7700 Sequence Detection System (Applied Biosystems). The

thermocycling parameters were 50°C (2 min), 95°C (3 min) followed by 40 cycles

of 95°C (15 s), 60°C (30 s) and 72°C (45 s). Samples were normalized to the

signal generated by the housekeeping gene Hprt. The primers used were: Hprt-

5’: tgggaggccatcacattgt; Hprt-3’: gcttttccagtttcactaatgaca; Mus81-5':

gaaaccctggcctgccctcc; Mus81-3': gccatcgtgccgagtgctca; Ifna4-5':

agtgaccagcatctacaagacc; Ifna4-3': gaggcaggtcacatcctagag; Ifnb-5':

aatttctccagcactgggtg; Ifnb-3': tctcccacgtcaatctttcc; Ccl2-5’ gtccctgtcatgcttctgg and

Ccl2-3’ gcgttaactgcatctggct. hMUS81-5’: caaagaccccgctctcgaat; hMUS81-3’:

gcagcgccttctgaaatacg; hGAPDH-5’: gagtcaacggatttggtcgt and hGAPDH-3’:

gacaagcttcccgttctcag. Samples prepared without RNA were used as negative

controls.

Western Blotting

Whole cell extracts were separated in sodium dodecyl sulfate polyacrylamide

electrophoresis gels (8, 10 or 12%) and then blotted onto nitrocellulose

membranes (Millipore). Antibodies specific for phospho-IRF3 (serine 396)

3

(4D4G), IRF3 (D83B9), STING, GAPDH (Cell Signalling Technology), MUS81

(Abcam) and horseradish peroxidase–coupled second-stage reagents (Thermo)

were used to develop the blots, which were then exposed on X-ray film (Fuji).

Flow Cytometry

Peritoneal exudates were stained on ice for 30 min with the following specific

antibodies; CD3-PE (145-2C11), CD8α-APC-eFluor 450/780 (53-6.7), CD8β-

APC-eFluor 780 (YTS156.7.7), CD11c-PerCP-Cy5.5 (N418), CD16/CD32 (93),

CD44-PE-Cy7 (IM7), CD45-APC (30-F11), CD49b-APC (DX5), NK1.1-PerCP-

Cy5.5 (PK136), F4/80-PE-Cy7 (BM8), GR1-eFluor 450 (RB6-8C5), γδTCR-PE

(GL3), MHC class II (I-A/I-E)-APC (M5/114.15.2) (eBioscience), CD11b-PE

(M1/70), IFNγ-FITC (XMG1.2; BD Biosciences), CD3-BV605 (17A2), and

CD107a-FITC (1D4B) (Biolegend). The H2-Db/SPAS-1-APC multimer (TCMetrix)

was used as instructed by the manufacturer. CountBright Absolute Counting

Beads (ThermoFisher Scientific) were used to determine cell numbers by flow

cytometry. All stained samples were analyzed using a BD LSR Fortessa

instrument and FlowJo 8.8.6 software (Treestar, USA).

Cell Cycle Analysis

TRAMP-C2 cells were labelled with 10 μM BrdU for 75 min. BrdU incorporation

and 7-AAD staining were assessed by flow cytometry according to the

manufacturer’s protocol (BD Pharmingen).

BrdU Experiments

Prostate cancer cells were incubated for 75 min with 10 μM BrdU (BD

Pharmingen). Staining was performed according to the manufacturer's

4

instructions (clone BU-1, Millipore). Slides were prepared using DAPI mounting

medium and then viewed using an Olympus FV1000 confocal microscope.

pAT25tetA

The pAT25tetA plasmid was a generous gift from Dr. E. Giraud-Panis (Institute for

Research on Cancer and Aging, Nice, France) (Giraud-Panis and Lilley, 1997).

Mus81-/- MEFs were co-transfected with 12 μg pAT25tetA plasmid or empty vector

control along with 12 μg of pBabe-puro plasmid (#1764 Addgene). After 48 h, the

cells were selected with 5 μg/ml puromycin. Integration of pAT25tetA into genomic

DNA was verified by PCR using the primers pAT25tetA-5’: cggctccagatttatcagca;

pAT25tetA-3’: tcccggcaacaattaataga. The thermo-cycling parameters were 94°C

(2 min) and 30 cycles of 94°C (30 s), 63°C (30 s), 72°C (1 min) and finally 72°C

(10 min). Stably-transfected cells were transduced 3 weeks later using retrovirus

encoding either Mus81 or empty vector.

The FISH protocol was modified from Bayani et al. (Bayani and Squire,

2004). Briefly, cells were grown on coverslips and fixed with 4% PFA followed by

permeabilization with 0.1% Triton-X for 10 min. The coverslips were then treated

with 0.1 mg/ml RNase at 37°C for 90 min, washed twice with PBS, equilibrated in

2× saline-sodium citrate (SSC) buffer, and incubated in 75°C formamide in a

water bath for 2.5 min. After further washing with 2× SSC, the coverslips were

blocked using the avidin/biotin blocking kit (SP-2001) according to the

manufacturer’s instructions (Vector Laboratories). pAT25tetA and GFP DNA

probes were prepared by nick translation according to the procedure described in

Bayani et al. (Bayani and Squire, 2004). Labelled DNA probes were denatured at

5

75°C for 5 min and annealed at 37°C for 1 h. Coverslips were incubated with 200

ng probe in PBS (or PBS-only control) at 37°C for 24 h and then washed with

50% formamide in 2× SSC at 45°C. The secondary antibody was labelled using

Alexa Fluor 546 tyramide signal amplification kit with streptavidin HRP conjugate

according to the manufacturer’s instructions (Life Technologies). Coverslips were

stained and mounted onto slides using DAPI mounting medium. Slide analysis

was conducted using an Olympus FV1000 confocal microscope.

ELISA

A total of 1.5 × 106 transduced cells were cultured for 24 h in a 24-well plate. IFN-

α and IFN-β levels in the supernatants were determined by duplicate ELISA

measurement according to the manufacturer's protocol (PBL interferon source).

Immunofluorescence and Immunohistochemistry

Frozen prostate cancer, breast cancer, colorectal cancer, astrocytoma,

melanoma, CLL and healthy tissue sections were obtained from Origene or

Singapore General Hospital (IRB # 2011/826/B; detailed information on the

tissue samples is presented in the supplementary Table S1). Paraffin-embedded

prostate, breast, colorectal, and endometrium cancer tissue sections were

obtained from the Singapore General Hospital (IRB # 2011/826/B). Sections

were rehydrated in PBS for 2 h and blocked using 5% goat serum and 0.5% BSA

in PBS for 1 h before staining. For MUS81 staining, slides were rehydrated and

fixed with PFA for 20 min. Slides were blocked in 1% BSA and 2% goat serum

for 1 h before incubation with mouse monoclonal anti-MUS81 antibodies (MTA30

6

2G10/3, Santa Cruz) for 16 h at 4°C followed by goat anti-mouse IgG coupled to

Cy3 (Jackson ImmunoResearch).

Bone Marrow-derived Macrophages (BMDMs)

Bone marrow was harvested from 7-8 week old male C57BL/6 mice and

monocytes were differentiated into macrophages by culture for 7 days in RPMI

medium containing 10% macrophage colony stimulating factor (M-CSF)

containing supernatant of L929 cells (ATCC).

Phagocytosis Assay

Briefly, 2 × 104 PKH-26-labelled TRAMP-C2 cells (transduced with either control

or Mus81-specific shRNA) were co-cultured with 5 × 104 BMDMs for 2 h, then

washed three times with DMEM, and fixed in 4% PFA for 10 min. Coverslips

were blocked using 1% BSA in PBS and then stained with an anti-mouse CD68

antibody (FA-11, Biolegend) followed by Alexa Fluor 647-conjugated goat anti-rat

IgG antibodies (Jackson ImmunoResearch) in the presence of DAPI. The

coverslips were then mounted onto microscope slides and analyzed using an

Olympus FV1000 confocal microscope. The number of macrophages positive for

CD68 and PKH-26 was counted and quantified using ImageJ (n>200).

Alternatively, 2 × 104 PKH-26-labelled TRAMP-C2 cells (transduced with control

shRNA) and 2 × 104 CellTrace Violet (Thermo Fisher)-labelled TRAMP-C2 cells

(transduced with Mus81 shRNA) were combined in a 1:1 ratio and added to 1 x

105 macrophages and incubated for 2 h. Cells were then stained with anti-mouse

F4/80-APC (BM8, eBioscience) on ice for 30 min and washed three times with

media before analysis using a BD LSRFortessa apparatus (BD Biosciences).

7

Cross-priming Assay

Briefly, 3 x 104 control-transduced or Mus81 shRNA-transduced TRAMP-C2 cells

were cultured in 6-well plates and treated with 10 μg/ml ovalbumin (AnaSpec) for

16 h. After removal of excess ovalbumin, 6 x 104 BMDMs or FACS-purified

CD11c+MHC class II+ (>99% purity) dendritic cells (DCs) were added to TRAMP-

C2 cells. The following day, 1.5 x 105 FACS-sorted (>99% purity) CD3+CD8+

splenocytes of OT-I mice were labelled with 5 μM CellTrace Violet according to

the manufacturer’s instructions (Thermo Fisher) and added to the co-culture. Two

days later, viable cells were counted by trypan blue (Sigma) exclusion. The

CellTrace Violet labelling and CD62L expression of CD3+F4/80-CD11c-GFP- cells

was analyzed by flow cytometry (BD LSR Fortessa Analyzer).

TCGA Data

Gene-level RNA-seq expression data for prostate (PRAD), breast cancer (BRCA)

and lung adenocarcinoma (LUAD) were downloaded from the TCGA data portal

(https://tcga-data.nci.nih.gov/tcga/), together with corresponding clinical

information. Normalized RSEM (citation: http://www.biomedcentral.com/1471-

2105/12/323) counts were pre-processed by log2-transformation prior to further

analysis. For the PRAD dataset, a subset of samples with available Gleason

Score and pathologic T and N information was used for further analysis (n=497).

For the BRCA dataset, only cases that were ER+/PR+ were retained (n=622).

Gene Set Enrichment Analysis (GSEA)

Gene-level RNA-seq expression data from the provisional TCGA prostate cancer

dataset was obtained from the TCGA data portal (https://tcga-

8

data.nci.nih.gov/tcga/). Expression values were loaded into the R statistical

environment (http://www.r-project.org) and differential expression analysis was

performed using an empirical Bayes t-test from the Limma package

(Subramanian et al., 2005). A list of genes ranked by differential expression was

then loaded into the GSEA tool. Enrichment analysis for sets of genes positively

regulated by human IFN-β (>2-fold) in fibroblasts and endothelial cells (Rusinova

et al., 2013) was performed.

Survival Analysis

Genes that were positively regulated by human IFN-β and exhibited low variation

across samples (median absolute deviation <= 1) were excluded from further

analysis of the specific TCGA data set. The average expression of the remaining

genes was used as a signature of IFN-β activation, and samples were sorted

according to this signature. The overall survival times of the top and bottom 50

patients in this sorted list were then compared using the log-rank test in R.

Supplementary Figures

Figure S1, related to Figure 1. Inhibition of Replication Forks Induces the

Accumulation of Cytosolic DNA in Tumor Cells

(A) TRAMP-C2 (left panels), DU145 (middle panels) or PC-3 (right panels) cells

were labelled using BrdU-specific antibodies (green) in the presence of DAPI

(blue). (B) BC2 cells were treated for 16 h with DMSO only, 4 μM aphidicolin, 10

μM Ara-C, or 10 mM hydroxyurea. Cells were then stained for cytosolic dsDNA

(red) in the presence of DAPI (blue). (C) Primary OT-I naïve T cells were

9

stimulated with 0.01 nM SIINFEKL in the presence of 10 U/ml recombinant

interleukin-2. After 3 days, SIINFEKL-stimulated T cells were treated with 10 μM

Ara-C or DMSO for 16 h. Cells were stained for cytosolic dsDNA (red) in the

presence of DAPI (blue). Bar graph shows the quantification of the MFI of

cytosolic DNA staining per cell (n>300 cells). Data are presented as mean ± SD

of 3 independent transductions. Scale bar, 10 μm. **p<0.01.

Figure S2, related to Figure 2. Knockdown of Mus81 by Mus81-specific

shRNAs

(A) Relative levels of Mus81 transcripts as determined by real-time RT-PCR in

puromycin-selected TRAMP-C2 cells (left panel) transduced with retroviral

constructs encoding different Mus81-specific shRNAs. Mus81 levels were

normalized to levels of Hprt and Mus81 transcripts in control shRNA-transduced

cells (See Methods). Mean values ± SEM from 3 independent experiments are

shown. DU145 (middle panel) and PC-3 (right panel) cells were transfected with

20 nM of control or Mus81-specific siRNAs. 48 h after transfection, Mus81

transcript levels were determined as described above. (B) BC2 cells transduced

with a retroviral vector encoding control (left panels) or Mus81 shRNA (right

panels) and treated with DMSO or 4 μM Aph for 16 h were stained for dsDNA

(red) in presence of DAPI (blue). Bar graph shows the quantification of the MFI of

cytosolic DNA staining per cell (n>300 cells). Data are presented as mean ± SD

of 3 independent transductions. (C) Representative immunoblot analysis of

Mus81-/- and Mus81+/+ MEFs transduced with MSCV-IRES-Gfp or MSCV-Mus81-

10

IRES-Gfp and probed with antibodies against MUS81 and GAPDH. (D)

Representative confocal image of dsDNA staining in BC2 cells transduced with

MSCV-IRES-Gfp (upper panel) or MSCV-Mus81-IRES-Gfp (lower panel). Bar

graph shows the quantification of the MFI of cytosolic DNA staining per cell

(n>300 cells). Data are presented as mean ± SD of 3 independent transductions.

(E) Mus81-/- MEFs were stably transfected with control or synthetic pAT25tetA

plasmids. Stably transfected cells were subsequently transduced with MSCV-

IRES-Gfp (Ctrl) or MSCV-Mus81-IRES-Gfp (Mus81) before fluorescence in situ

hybridization using GFP-encoding DNA probes (red) in the presence of DAPI

(blue). Representative confocal images are shown. Scale bar, 10 μm.

***p<0.001; ****p<0.0001.

Figure S3, related to Figure 3. Presence of Cytosolic DNA in Astrocytoma,

CLL and Endometrial Cancer Samples

(A) Representative confocal images of consecutive sections of stage II prostate

adenocarcinoma, stage I breast cancer, stage II colorectal cancer, stage III/IV

melanoma, cancer-adjacent tissue within normal limits and healthy skin. Tissues

were stained with IgG2a isotype controls (red) for MUS81- and dsDNA-specific

antibodies in the presence of DAPI (blue). (B) Representative confocal images of

consecutive sections of stage IB endometrial cancer (En) and WHO Grade III

astrocytoma (Ast). Sections were stained for MUS81 (red; left column) or dsDNA

(red; right column) in the presence of DAPI (blue). Quantification of the number

of nuclear MUS81 foci and the MFI of cytosolic dsDNA staining detected per cell

11

(n≥1000 cells in different sections from two individual patients) is shown in the

lower graphs. (C) Labelling of bone marrow tissues from a healthy control and a

patient with chronic lymphocytic leukemia (CLL) showing cytosolic dsDNA (red)

and DAPI staining (blue). In the right-hand column, DAPI staining has been

removed to improve visualization of the dsDNA distribution. Quantification of the

MFI of cytosolic dsDNA staining in bone marrow cells (n≥400 cells in different

sections from two individual patients and two healthy controls) is shown in the

lower graph. (D) Graph depicting the average number of nuclear MUS81 foci and

the MFI of cytosolic dsDNA staining detected per cell in consecutive sections of

human prostate cancer samples. (E) Representative confocal images of

consecutive sections of breast cancer-adjacent normal tissue (N), stage II

hyperplastic tissue (H), and stage I-III breasts from different patients. Tissues

were stained for cytosolic dsDNA (left columns) in the presence of DAPI (blue).

DAPI staining was removed in some pictures to enable better visualization of

dsDNA staining (right columns). Bar graph shows quantification of the MFI ± SD

of cytosolic dsDNA (right graph) in cells (n≥1000) of different normal breast

tissue (n=4), stage II hyperplastic breast (n=4 each), stage I breast cancer (n=4),

stage II breast cancer (n=6) and stage III breast cancer sections (n=5). Scale

bar, 10 μm. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

Figure S4, related to Figure 5. STING-deficient Mus81-/- MEFs and TRAMP-

C2 Cells Fail to Induce IFN-β in Response to DNA

12

(A-B) Western blot analysis of expanded clones following transfection of Mus81-/-

MEFs (A) or TRAMP-C2 cells (B) with control gRNA (StingCTRL) or Sting-specific

gRNA (StingCRISPR) and labelling for STING. Tubulin levels are shown as a

loading control. (C-D) IFN-β levels were measured by ELISA in the culture

supernatant of clone 5 Mus81-/- MEFs (C) or clone 3 TRAMP-C2 cells (D) 24 h

after transfection with 2 μg/ml plasmid DNA (pDNA), 10 μg/ml poly(I:C) or

medium only. Data are presented as mean ± SEM of 3 independent

transfections. ****p<0.0001.

Figure S5, related to Figure 6. Mus81 deficiency Does Not Affect the Rate of

Apoptosis in TRAMP-C2 Cells

(A) Annexin V-PI staining of TRAMP-C2 cells were transduced with either control

(ctrl) or Mus81 (Mus81)-specific shRNA. Grouped data from 3 independent

experiments show mean percentage ± SEM of annexin V-PI- (white), annexin

V+PI+ (light grey) and annexin V+PI- (dark grey) TRAMP-C2 cells. (B) TRAMP-C2

cells transduced with control (white column) or Mus81 (grey column)-specific

shRNA were examined by flow cytometry to determine BrdU incorporation and

DNA content (7-AAD staining). Shown are the percentages of BrdU- cells with 2N

DNA content (G0/1), BrdU+ cells with 2N-4N DNA content (S), BrdU+ cells with

4N DNA content (G2/M) and apoptotic BrdU- cells with <2N DNA content (A).

Data are presented as mean ± SEM of 3 independent experiments. (C) TRAMP-

C2 cells were transduced with Mus81-specific shRNA (grey bars) or control

shRNA (white bars) and labelled with 10 μM CellTrace Violet. The labelled

13

shRNA-transduced TRAMP-C2 cells were then mixed with control shRNA-

transduced TRAMP-C2 cells labelled with 2 μM PKH-26 to obtain a 1:1 ratio. The

ratio of differentially labelled cells was analyzed prior to cell culture in vitro (0 h)

and 24 h after cell culture in vitro (24 h) by flow cytometry. (D) The differentially

labelled TRAMP-C2 cells described in (C) were mixed in a 1:1 ratio and injected

i.p. into C57BL/6 mice (n≥5). The ratio of differentially labelled TRAMP-C2 cells

was analyzed by flow cytometry prior to injection (0 h) and in the peritoneal

exudate 24 h after injection of the TRAMP-C2 cell mixture (24 h). *p<0.05.

Figure S6, related to Figure 6. Injection of TRAMP-C2 Cells Increases the

Percentage of Innate Immune Subsets in the Peritoneal Cavity

(A) Ifnb transcript levels in FACS-purified (>99% pure) CD11c+ (DC) and F4/80+

(Macrophage) cells were determined by real-time PCR 24 h after injection of

C57BL/6 mice with 6 × 106 with TRAMP-C2 (T) cells or PBS. Data represent

mean ± SD of n=5 mice (B) Graph representing fold change in lymphocyte

subset numbers in the mouse peritoneal exudates 24 h after i.p. injection of

TRAMP-C2 cells (grey symbols). Numbers were normalized to lymphocyte

subset counts in mice injected with PBS only (white symbols). Data represent

mean ± SEM of 3 independent experiments (n=5 mice each). (C-D) Graph

showing percentage of IFN-γ+ (C) or CD107a+ (D) lymphocytes in mouse

peritoneal exudates 24 h after injection with PBS only (white symbols) or

TRAMP-C2 cells (grey symbols). Data represent mean ± SD of n=5 mice. (E)

C57BL/6 mice were analyzed as described in (C) 48 hours after mice received

14

500 μg isotype control antibody (n=3; circles) or neutralizing anti-IFNAR antibody

(n=5; squares). (F) Natural killer (NK) cell depletion in C57BL/6 mice (n=5) was

confirmed by flow-cytometric analysis of blood CD3-CD49b+ cell numbers 24 h

after intraperitoneal administration of 500 μg isotype control antibodies (white

bar) or anti-NK1.1 (PK136) antibodies (grey bar). (G) Density plots on the left

show peritoneal exudate labelling for GR1 and F4/80 24 h after administration of

2 mg/ml clodronate liposomes (clodronate) or PBS-loaded control liposomes

(PBS). Boxes indicate the gating strategy used to identify GR1+ or F4/80+ cells.

Percentage of GR1+ (N) and F4/80+ (MP) cells in the peritoneal exudates are

indicated in the right panel. Data represents mean ± SEM of 3 independent

experiments (n=5 mice each). MP = macrophages; NKT = NK T cells. (H)

Macrophage depletion in C57BL/6 mice was confirmed by flow-cytometric

analysis of blood CD45+F4/80+CD11b+ cell numbers 60 h after intraperitoneal

administration of 600 μg isotype control antibodies (white bar) or anti-

CD115/CSF-1R (AFS98) antibodies (grey bar). Data represent mean ± SD of n=5

mice *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

Figure S7, related to Figure 7. Proposed Model of Mus81-dependent Host

Rejection of Prostate Cancer Cells

The occurrence of MUS81 substrates in the genome promotes accumulation of

dsDNA in the cytosol of prostate cancer cells. Sensing of cytosolic dsDNA

triggers STING-mediated expression of type I IFNs and pro-phagocytic signals

15

leading to IFN-γ-dependent lysis of prostate cancer cells by macrophages and

potentially CD8+ T cells.

Table S1, related to Figure 3. Description of Human Cancer Samples Detailed patient and sample information is shown.

Figure S1

B DMSO Ara-CAphidicolin Hydroxyurea

dsDNA DAPI dsDNA

dsDNA DAPI dsDNA

dsDNA DPI dsDNA

dsDNA DAPI dsDNA

1 h 16 hA TRAMP-C2

1 h 16 hDU145

1 h 16 hPC-3

BrdU DAPI

DMSO Ara-C

0

50

100

150**

dsDNA DAPI dsDNA

dsDNA DAPI dsDNA

C

dsD

NA

MFI

/cel

l

DMSO Ara-C

Figure S2

D

0

10

20

30

40

Ctrl Mus81

dsD

NA

MFI

/cel

l

dsDNADAPI

Ctrl

Mus81

****C

GAPDH

Mus81

CtrlMus81CtrlMus81Mus81+/+Mus81-/-

E

Em

pty

vect

orpA

T 25t

etA

Mus81Mus81

Ctrl

GFPDAPI

Mus81

A

Fold

cha

nge

over

ctrl

Mus81#2Ctrl Mus81#10

1.0

0.5

Mus81#2shRNA

1.5

**** ****

Ctrl Mus81#10

1.0

0.5

Mus81#2siRNA

Ctrl Mus81#1siRNA

1.5

0

1.0

0.5

1.5

*** *** **** ***

TRAMP-C2 DU145 PC-3

dsD

NA

MFI

/cel

l

DMSOAph DMSOAph

****** ***

BMus81 shRNACtrl shRNA

0

810

dsDNADAPI

DMSO DMSO AphAph

46

2

Ctrl Mus81shRNA

AP

rost

ate

ca

nce

rN

L p

rost

ate

ca

nce

rB

rea

st

can

cer

NL

Bre

ast

ca

nce

rM

ela

no

ma

Ski

nC

olo

rect

al

can

cer

NL

Co

lore

ctal

ca

nce

rIgG2aDAPI

IgG2aDAPI

B

En

do

me

tria

l ca

nce

rA

stro

cyto

ma

# n

ucl

ea

r MU

S8

1 fo

ci/c

ell

dsDNADAPI

MUS81DAPI

30

40

20

0

50

Ast

10

15

5

0AstEn

Cyt

o. d

sDN

A M

FI/c

ell

10

En

C

CL

LH

ea

lthy

dsDNADAPI

dsDNA

30

20

0CLLHealthy

Cyt

o. d

sDN

A M

FI/c

ell

10

**

Figure S3

D

0.1

1

10

100

0.1 1 10 100

Cyto dsDNA MFI/cell

r2=0.7323p<0.0001

# n

ucl

ea

r MU

S8

1fo

ci/c

ell

E

I II III

Stage

250

200

150

100

50

0

Cyt

od

sDN

AM

FI/c

ell

NL HP

********

***

*****

********

dsDNADAPI

dsDNA

NL

HP

I

II

III

STINGTubulin

StingCTRL StingCRISPR

1 2 1 2 3 4 5

Mus81-/- MEFsA

STINGTubulin

TRAMP-C2StingCTRL StingCRISPR

1 2 3

B

0

1000

2000

3000

IFN

-β e

xpre

ssio

n (p

g/m

l)

pDNAPoly I:C

StingCTRL StingCRISPR

+- +

- +- +

-

Mus81-/- MEFC

**** ****

0

200

800

1000

IFN

-β e

xpre

ssio

n (p

g/m

l)

600

400

TRAMP-C2D

Figure S4

--

--

pDNAPoly I:C

StingCTRL StingCRISPR

+- +

- +- +

---

--

**** ****

Figure S5

0

Rel

. cha

nge

in ra

tio

0 h 24 h

A

Ctrl Mus81shRNA

0

20

40

60

80

100

120

% c

ells

A <G0/1 S G2/M0

50

100

150B

% o

f cel

ls

1.5C

0.5

1.0

0

Rel

. cha

nge

in ra

tio0 h 24 h

3D

1

2

* *

Fold

cha

nge

of to

tal i

mm

une

cel

ls r

elat

ive

to m

ice

inje

cted

with

PB

SFo

ld c

hang

e ov

er P

BS

NK NKT γδT CD8α

% o

f IFN

-γ+

cells

NK NKT γδT CD8α

% o

f CD

107a

+ce

lls

NK NKT γδT CD8α

** ** **

B C D

0

20

40

60

80

0

10

20

30

40

0

10

20

30

40

MP

** * **

% o

f IFN

-γ+

cells

NK NKT γδT CD8α

E

0

10

20

30

40 ********

*** *******

% C

D3-

CD

49b+

cells

Isotype PK136

*

MP MP0

20

40

80

N NPBS

60

***

GR1

F4/80

ClodronateF PBS

% c

ells

in p

erito

neum

0

1

3

2

Clodronate

H

Isotype AFS98

*%

CD

45+ F

4/80

+ CD

11b+

cells

0

5

15

10

G

0

20

30

40

50

10

PBS PBST TDC Macrophage

Fold

cha

nge

over

PB

S

A** **

Figure S6

**

dsDNA

STING

Prostate Cancer Cell

CD8+ T cellsMacrophages/(Dendritic cells)

MUS81

Figure S7

Lysis?Phagocytosis

Type I IFNs

Type I IFNs

Type II IFN

Disease Area OriginCatalog Number Sample ID Case ID ASM Age Gender Sample Type Tissue of (Origin/Finding) Appearance

Sample Pathology from Pathology Verification

Case Diagnosis from Donor Institution Pathology Report Tumor Grade TNM

Minimum Stage

Grouping % Normal % Lesion % Tumor

% Tumor Hypercellular

Stroma

% Tumor Hypo/Acellular

Stroma%

Necrosis Pathology Verification Notes from H&E reviewProstate

Origene CS634963 FR0002C100 CU0000009443 BF6 42 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 pT2cpNXpMX II 0 90 10 0 0 0 Lesion: prostatic intraepithelial neoplasia; 30% glandular epithelium, 70% fibromuscular stromaOrigene CS634327 FR00028A54 CU0000009344 AF2 47 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 pT3apNXpMX III 0 95 5 0 0 0 lesion: hyperplasia of prostate; 60% epithelium, 40% fibromuscular stromaOrigene CS535985 FR0003992B CI0000014201 AF1 51 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 pT2bpN0pMX II 0 90 10 0 0 0 Lesion (90%): Hyperplasia of prostate 100%; Non Tumor Structures: 30% Epithelium, 70% Fibromuscular stromaOrigene CS523326 FR0002262B CI0000009014 BF5 75 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+2=5/10 pT1apNXpMX I 95 0 5 0 0 0 Non Tumor Structures: 30% Epithelium, 70% Fibromuscular stromaOrigene CS614627 FR00016CCF CU0000005026 Not reported 51 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 pT3apNXpMX III 0 95 5 0 0 0 Lesion: 100% hyperplasia of prostate containing 55% epithelium, 45% fibromuscular stromaOrigene CS530175 FR0003153A CI0000011643 Not reported 53 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 pT3apNXpMX III 0 90 10 0 0 0 45% epithelium, 55% fibromuscular stroma; lesion: 60% high grade prostatic intraepithelial neoplasia, 40% benign hyperplasia of prostateOrigene CS527465 FR0002DD13 CI0000010221 Not reported 62 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 pT2apNXpMX II 70 15 10 0 5 0 Lesion (15%): Prostatitis 100%; Non Tumor Structures: 25% Epithelium, 75% Fibromuscular stromaOrigene CS500048 FR0000178B CI0000000007 BF3 71 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 pT2cpNXpMX II 80 0 15 5 0 0 normal: 60% epithelium, 40% stromaOrigene CS502386 FR000063A4 CI0000000297 BF6 67 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 5+4=9/10 pT3bpNXpMX III 95 0 5 0 0 0 Not reportedOrigene CS500120 FR00001C2C CI0000000021 BF6 68 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Normal Within normal limits Adenocarcinoma of prostate n/a n/a n/a 100 0 0 0 0 0 30% Glandular epithelium, 70% StromaOrigene CS505199 FR00019502 CI0000005252 Not reported 48 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumour Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 pT2bpN0pMX II 0 90 10 0 0 0 70% epithelium, 30% fibromuscular stroma; lesion: benign prostatic hyperplasiaOrigene CS530165 FR00031450 CI0000011639 Not reported 50 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumour Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 pT3apN0pMX III 0 90 10 0 0 0 lesion: hyperplasia of prostate with prostatitis; 60% epithelium, 40% fibromuscular stromaOrigene CS503440 FR00007656 CI0000000421 Not reported 53 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Normal Within normal limits Adenocarcinoma of prostate Gleason Score: 4+3=7/10 pT2bpN0pMX II 100 0 0 0 0 0Origene CS514443 FR5B3391BF CI0000007160 Not reported 82 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Tumour Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 2+2=4/10 pT1apNXpMX I 70 0 10 10 10 0 Non Tumor Structures: 50% Epithelium, 50% Fibromuscular stromaOrigene CS505191 FR000188C5 CI0000005249 AF1 55 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Lesion Hyperplasia of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 pT2cpN0pMX II 0 100 0 0 0 0 60% epithelium, 40% fibromuscular stromaOrigene CS503715 FR00007DAD CI0000000470 FF1 51 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Lesion Hyperplasia of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 pT2bpN0pMX II 0 100 0 0 0 0 Non Tumor Structures: 55% Epithelium, 45% Fibromuscular stromaOrigene CS501085 FR000051A4 CI0000000128 AF3 60 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Lesion Hyperplasia of prostate Adenocarcinoma of prostate n/a n/a n/a 0 100 0 0 0 0 45% glandular epithelium, 55% stroma; benign prostate hyperplasiaOrigene CS634653 FR0002BCE4 CU0000009395 70 Male Frozen OCT-embedded Tissue Sections 5um Prostate / Prostate Lesion Hyperplasia of prostate Adenocarcinoma of prostate n/a n/a n/a 0 100 0 0 0 0 Non Tumor Structures: 40% Epithelium, 60% Fibromuscular stroma

SGH NA NA 07:PB25212 Not reported 76 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB12160 Not reported 80 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB15738 Not reported 54 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB24384 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB27762 Not reported 60 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05: PB01145 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB07213A Not reported 70 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB25270 Not reported 71 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+4=8/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB12434 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB15933 Not reported 60 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB27813 Not reported 55 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB07553 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB26984 Not reported 68 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+4=8/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB30743 Not reported 72 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB03421 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB02342 Not reported 64 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB07782 Not reported 58 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB30791 Not reported 49 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB16056 Not reported 74 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB21198 Not reported 71 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB02827 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB08314 Not reported 77 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB27516 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB30861 Not reported 42 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB4030 Not reported 57 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB21300 Not reported 57 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB25380 Not reported 64 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB28418 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB10537 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Tonsil / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB10537 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB27564 Not reported 67 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB04638 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB14417 Not reported 64 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB16378 Not reported 56 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB21817 Not reported 57 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB25441 Not reported 72 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB28923 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB03633 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+5=8/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB27755 Not reported 61 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB14485 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB23037 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB25646 Not reported 65 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB28979 Not reported 59 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 2+3=5/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB10579 Not reported 65 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB764 Not reported 61 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 5+3=8/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB05329 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB10068 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB15063 Not reported 46 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB17025 Not reported 57 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB23648 Not reported 61 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported II Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB30648 Not reported 53 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB04848 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB11407 Not reported 69 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB28091 Not reported 53 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB1434 Not reported 61 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+3=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB10683 Not reported 70 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB15114 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB17630 Not reported 74 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB24275 Not reported 55 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB00577 Not reported 67 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB05461 Not reported 71 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB11637 Not reported 65 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB28598 Not reported 53 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB1475 Not reported 59 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB05896 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB15661 Not reported 63 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB18257 Not reported 57 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB24321 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB06124 Not reported 61 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIC Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB10708 Not reported 67 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+3=6/10 Not reported IIIA Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB01054 Not reported 58 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 4+4=8/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB04686 Not reported 66 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB9117 Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 06:PB03990 Not reported 56 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 05:PB01779 Not reported 60 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA 07:PB27444A Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Tumor Adenocarcinoma of prostate Adenocarcinoma of prostate Gleason Score: 3+4=7/10 Not reported IIIB Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH NA NA Not reported Not reported 62 Male Formalin Fixed Paraffin Embedded Tissue Prostate / Prostate Normal Within normal limits Adenocarcinoma of prostate n/a n/a n/a Not reported 0 0 0 0 0 30% Glandular epithelium, 70% Stroma

BreastOrigene CS517616 FR00025F07 CI0000007799 Not reported 44 Female Frozen OCT-embedded Tissue Sections 5um Breast/Breast Tumour Carcinoma in situ of breast, lobular Adenocarcinoma of breast, lobular Not reported pTXpN0pMX I 55 0 25 20 0 0 normal: 10% epithelium, 70% fibrotic stroma, 20% fatOrigene CS517615 FR00025F05 CI0000007799 Not reported 44 Female Frozen OCT-embedded Tissue Sections 5um Breast/Breast Normal Within normal limits Adenocarcinoma of breast, lobular Not reported pTXpN0pMX I 100 0 0 0 0 0 20% epithelium, 50% fibrotic stroma, 30% fat

SGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Breast/Breast Tumour Not reported Adenocarcinoma Not reported Not reported I Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Breast/Breast Tumour Not reported Adenocarcinoma Not reported Not reported I Not reported Not reported Not reported Not reported Not reported Not reported Not reported

MelanomaOrigene CS500090 FR00001A8D CI0000000017 Not reported 42 Female Frozen OCT-embedded Tissue Sections 5um Skin/Lymph Node Tumour Malignant melanoma, metastatic Malignant melanoma, metastatic Not reported pTXpN1pMX III 0 0 55 5 0 40 Not reportedOrigene CS558957 FR00043D4F CI7000000826 Not reported 49 Male Frozen OCT-embedded Tissue Sections 5um Lung Tumour Malignant melanoma, metastatic Malignant melanoma, metastatic Not reported pTXpNXpM1b IV 0 0 30 5 5 60 Not reportedOrigene CS520299 FR00026E16 CI0000008256 Not reported 49 Male Frozen OCT-embedded Tissue Sections 5um Lung Tumour Malignant melanoma, metastatic Malignant melanoma, metastatic Not reported pTXpNXpM1b IV 0 0 30 5 5 60 Not reportedOrigene CS610514 FR00006061 CU0000001603 Not reported 36 Female Frozen OCT-embedded Tissue Sections 5um Skin/Skin Normal Within normal limits No pathologic disease Not reported NA NA Not reported Not reported Not reported Not reported Not reported Not reported Not reported

ColorectalOrigene CS519420 FR00020B41 CI0000008078 Not reported 66 Male Frozen OCT-embedded Tissue Sections 5um Right colon/ Right colon Tumour Adenocarcinoma of colon Adenocarcinoma of colon Not reported pT3pN0pMX IIA 60 0 30 0 10 0 Not reportedOrigene CS535170 FR00038582 CI0000013783 Not reported 61 Male Frozen OCT-embedded Tissue Sections 5um Right colon/ Right colon Normal Within normal limits Adenocarcinoma of colon Not reported pT3pN0pMX IIA 100 0 0 0 0 0 Not reported

SGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Right colon/ Right colon Tumour Adenocarcinoma of colon Adenocarcinoma of colon Not reported Not reported II Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Right colon/ Right colon Tumour Adenocarcinoma of colon Adenocarcinoma of colon Not reported Not reported II Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Right colon/ Right colon Tumour Adenocarcinoma of colon Adenocarcinoma of colon Not reported Not reported II Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Right colon/ Right colon Tumour Adenocarcinoma of colon Adenocarcinoma of colon Not reported Not reported II Not reported Not reported Not reported Not reported Not reported Not reported Not reported

EndometriumSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Not reported Tumour Endometrial Cancer Not reported Not reported Not reported 1B Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Formalin Fixed Paraffin Embedded Tissue Not reported Tumour Endometrial Cancer Not reported Not reported Not reported 1B Not reported Not reported Not reported Not reported Not reported Not reported Not reported

AstrocytomaOrigene CS511324 FR0001E199 CI0000006721 Not reported 34 Female Frozen OCT-embedded Tissue Sections 5um Brain/Brain Tumour Astrocytoma, anaplastic Astrocytoma, anaplastic WHO Grade III Not reported Not reported 0 70 10 0 10 10 lesion: 100% gliosisOrigene CS515704 FR00024763 CI0000007383 Not reported 39 Male Frozen OCT-embedded Tissue Sections 5um Brain/Brain Tumour Astrocytoma, anaplastic Astrocytoma, anaplastic WHO Grade III Not reported Not reported 0 0 60 0 20 20 Not reported

CLLSGH Not reported Not reported Not reported Not reported Not reported Not reported Frozen samples Bone marrow Tumour Not reported Not reported Not reported Not reported III Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Frozen samples Bone marrow Tumour Not reported Not reported Not reported Not reported III Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Frozen samples Bone marrow Normal Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reportedSGH Not reported Not reported Not reported Not reported Not reported Not reported Frozen samples Bone marrow Normal Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported