The defence response of Arabidopsis thaliana roots against ...347091/S... · 2 Abstract Fusarium...
121
1 The defence response of Arabidopsis thaliana roots against the fungal pathogen Fusarium oxysporum YI-CHUNG (Max) CHEN A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2014 School of Agriculture & Food Sciences
Transcript of The defence response of Arabidopsis thaliana roots against ...347091/S... · 2 Abstract Fusarium...
1
The defence response of Arabidopsis thaliana roots against the fungal pathogen
Fusarium oxysporum
YI-CHUNG (Max) CHEN
A thesis submitted for the degree of Doctor of Philosophy at
The University of Queensland in 2014
School of Agriculture & Food Sciences
2
Abstract
Fusarium oxysporum is a root-infecting fungal pathogen that causes wilt disease on a broad range
of plant species, including Arabidopsis thaliana. Investigation of the defence response against this
pathogen has primarily been conducted using leaf tissue and little is known about the root defence
response. In this study, we analysed the expression of root genes after infection with F. oxysporum
by microarray analysis. In contrast to the leaf response, the root tissue did not show a strong
induction of defence associated gene expression and instead showed a greater proportion of
repressed genes. Screening insertion mutants from differentially expressed genes in the microarray
uncovered a role for the transcription factor ETHYLENE RESPONSE FACTOR72 (ERF72) in
providing susceptibility to F. oxysporum. Due to the role of ERF72 in suppressing programmed cell
death and detoxifying reactive oxygen species, we examined other mutants known to possess higher
and lower ROS production in response to pathogen challenge. We found that the
pub22/pub23/pub24 U-box type E3 ubiquitin ligase triple mutant which possesses an enhanced
oxidative burst as well as the peroxidase33 mutant which possesses a reduced oxidative burst to
have increased resistance and increased susceptibility, respectively, to F. oxysporum infection. We
therefore identify a role for the oxidative burst in F. oxysporum resistance and identify new genes
involved in the root response to F. oxysporum.
3
Declaration by author
This thesis is composed of my original work, and contains no material previously published or
written by another person except where due reference has been made in the text. I have clearly
stated the contribution by others to jointly-authored works that I have included in my thesis.
I have clearly stated the contribution of others to my thesis as a whole, including statistical
assistance, survey design, data analysis, significant technical procedures, professional editorial
advice, and any other original research work used or reported in my thesis. The content of my thesis
is the result of work I have carried out since the commencement of my research higher degree
candidature and does not include a substantial part of work that has been submitted to qualify for
the award of any other degree or diploma in any university or other tertiary institution. I have
clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.
I acknowledge that an electronic copy of my thesis must be lodged with the University Library and,
subject to the General Award Rules of The University of Queensland, immediately made available
for research and study in accordance with the Copyright Act 1968.
I acknowledge that copyright of all material contained in my thesis resides with the copyright
holder(s) of that material. Where appropriate I have obtained copyright permission from the
copyright holder to reproduce material in this thesis.
4
Publications during candidature
Chen YC., Wong CL., Muzzi F., Vlaardingerbroek I., Kidd BN., Schenk PM. (2014)
Root defence analyses against Fusarium oxysporum reveals new regulators to confer resistance.
Scientific Reports. 4: 5584
Chen YC., Wong, CL., Muzzi, F., Vlaardingerbroek, I., Aitken, E.A.B., Kidd, B.N., and Schenk,
P.M., ERF72 regulates Fusarium oxysporum resistance in Arabidopsis. 24th
International
Conference on Arabidopsis Research (ICAR2013), Sydney, Australia (24th
-28th
June, 2013)
Schenk, P.M., Rincon-Florez, V., Rosli, A., Chen, YC., Liu, HW., Pretorius, L.S., Fallath, T.,
Mirzaee, H., Shuey, L., Al-Amery, A., Dennis, P., Iram, S., Kidd B.N., and Carvalhais, L.C.
Metagenomics and transcriptomics to elucidate new plant-microbe interactions at the rhizosphere.
15th
International symposium on Microbial Ecology, Seoul, South Korea. (24th
-28th
August) (Oral
presentation)
Publications included in this thesis
Chen, YC., Wong, CL., Muzzi, F., Vlaardingerbroek, I., Kidd, BN., and Schenk, PM. (2014)
Root defence analyses against Fusarium oxysporum reveals new regulators to confer resistance.
Scientific Reports 4: 5584
Chen, YC., Kidd, BN., Carvalhais, LC., and Schenk, PM. (2014) Molecular defense responses in
roots and the rhizosphere against Fusarium oxysporum. Plant Signaling & Behavior: DOI:
10.4161/15592324.2014.977710
Contributions by others to the thesis
The root tissue sample for microarray experiments was provided by Chin Lin Wong and Ido
Vlaardingerbroek. The initial analysis of microarray data was assisted by Frederico Muzzi. The
conception and design of this project was guided by Prof. Peer Schenk, A/Prof Elizabeth Aitken and
Dr. Brendan Kidd.
5
Statement of parts of the thesis submitted to qualify for the award of another degree
Chapter one was submitted for MPhil, The University of Queensland, 2012; the thesis was
withdrawn from assessment and the project was converted to PhD.
6
Acknowledgements
I never thought I would do a PhD in my life, through this journey I would like to thank all the
people who helped me. I don’t think I could have finished my PhD degree without them.
Firstly, I wish to express my deep appreciation to my supervisors Prof. Peer Schenk and A/Prof.
Elizabeth Aitken. I thank Prof. Peer Schenk for his support and initial recognition from the first day.
I really appreciate Prof. Peer Schenk giving me an opportunity to do a PhD project. Without Prof.
Peer Schenk, I might not have had a chance to achieve this dream in my life. I thank A/Prof.
Elizabeth Aitken for her supervision and guidance during every step of work in this PhD project.
My thanks to Dr. Brendan Kidd who gave me a hand from the very beginning with every detail of
laboratory work. I really appreciate Dr. Brendan Kidd for his supervision in the laboratory work. I
would have stumbled in this PhD project without his support and advice.
I would also like to thank all people in Prof. Peer Schenk’s lab. In particular, I would like to thank
Ms. Regina Sintrajaya and Dr. Lilia Carvalhais for their very valuable advice during my early
initiation of my PhD project. I would also like to thank other colleagues for their advice and
encouragements.
My thanks extend to Mr. Bob Simpson and Dr. Michael Nefedov for technical assistance for RT-
qPCR. I wish to thank Dr. Marco Trujillo for kind provision of pub 22/23/24 seeds.
In the end, I would like to thank my family’s support for these years, so I can focus on my academic
career without suffering from financial shortage.
7
Keywords
Arabidopsis, Fusarium oxysporum, defence signalling, root, disease resistance, ethylene, jasmonate,
PAMP, ROS
Australian and New Zealand Standard Research Classifications (ANZSRC)
ANZSRC code: 060704, Plant Pathology, 100%
Fields of Research (FoR) Classification
FoR code: 0607, Plant Biology, 100%
8
Table of Contents
1 Chapter I: Introduction & Literature Review: Plant molecular defence response against root pathogens ..................................................................................................................................... 13
1.1 General introduction ............................................................................................ 14 1.2 Soil-borne fungal pathogens ................................................................................ 15 1.3 The plant immune system .................................................................................... 16
1.3.1 Salicylic acid (SA) .................................................................................................... 17 1.3.2 Jasmonic acid (JA) .................................................................................................. 17 1.3.3 Ethylene (ET) ........................................................................................................... 18 1.3.4 Crosstalk between pathways ................................................................................... 19 1.3.5 Reactive oxygen species (ROS) for plant defence against pathogens ..................... 20
1.4 Defence against the root pathogen Fusarium oxysporum .................................... 22 1.4.1 F. oxysporum colonisation strategies ....................................................................... 22 1.4.2 Defence against F. oxysporum in Arabidopsis ......................................................... 23 1.4.3 Regulating defence: transcription factors ................................................................. 23
1.5 Conclusion........................................................................................................... 26 1.6 The research questions ....................................................................................... 26 1.7 The research objectives ....................................................................................... 27
2 Chapter II: Genome-wide microarray analysis of F. oxysporum infected Arabidopsis roots .... 29 2.1 Introduction: ......................................................................................................... 30 2.2 Methodology: ....................................................................................................... 31
2.2.1 Plant growth and growth conditions ......................................................................... 31 2.2.2 F. oxysporum inoculation ......................................................................................... 31 2.2.3 Microarray analysis .................................................................................................. 31 2.2.4 Primer design for Real time RT-qPCR ..................................................................... 32 2.2.5 RNA isolation and cDNA synthesis .......................................................................... 33 2.2.6 Real-time quantitative reverse transcriptase PCR (RT-qPCR) analyses .................. 33 2.2.7 Genevestigator analysis ........................................................................................... 34 2.2.8 T-DNA insertion lines ............................................................................................... 34 2.2.9 Disease resistance assays with F. oxysporum inoculation ....................................... 35
2.3 Results: ............................................................................................................... 35 2.3.1 Microarray analysis .................................................................................................. 35 2.3.2 RT-qPCR analysis ................................................................................................... 38 2.3.3 Comparison with leaf microarray .............................................................................. 39 2.3.4 Genevestigator analysis ........................................................................................... 42 2.3.5 Modulation of F. oxysporum repressed genes leads to increased resistance ........... 45
2.4 Discussion: .......................................................................................................... 46 3 Chapter III: Investigation into the role of ERF72 in F. oxysporum susceptibility ...................... 49
3.1 Introduction of the AP2/ERF family and ERF72: .................................................. 50 3.2 Methods: ............................................................................................................. 51
3.2.1 RT- qPCR conditions ............................................................................................... 51 3.2.2 RT-qPCR experiment for methyl jasmonate and salicylic acid treatment ................. 52 3.2.3 F. oxysporum inoculation and plate assay for gene expression ............................... 52 3.2.4 Quantification of bacterial growth (P. syringae) in Arabidopsis ................................. 53 3.2.5 Jasmonate root inhibition ......................................................................................... 53 3.2.6 Phytophthora cinnamomi inoculation ....................................................................... 54 3.2.7 Quantification of F. oxysporum levels in erf72 .......................................................... 54 3.2.8 H2O2 quantification ................................................................................................... 55 3.2.9 F. oxysporum GUS histochemical assay .................................................................. 56
3.3 Results: ............................................................................................................... 56 3.3.1 erf72 treated with defence hormones ....................................................................... 56 3.3.2 The erf72 mutant is not affected in resistance against other plant pathogens .......... 58 3.3.3 The root JA inhibtion assay ...................................................................................... 60
9
3.3.4 erf72 gene expression at different time points .......................................................... 61 3.3.5 Quantification of F. oxysporum levels in erf72 ......................................................... 63 3.3.6 Comparison between wild-type and erf72 using F. oxysporum expressing GUS ...... 63 3.3.7 Role of erf72 in ROS production .............................................................................. 65
3.4 Discussion: .......................................................................................................... 66 4 Chapter IV: PAMP response to F. oxysporum infection ......................................................... 69
4.1 Introduction: ......................................................................................................... 70 4.2 Methods: ............................................................................................................. 71
4.2.1 Plant growth and growth conditions ......................................................................... 71 4.2.2 T-DNA insertion lines ............................................................................................... 71 4.2.3 Callose staining ....................................................................................................... 73 4.2.4 DAB staining ............................................................................................................ 73
Results: ........................................................................................................................... 74 4.2.5 The pub22/23/24 triple mutant has increased resistance to F. oxysporum ............... 74 4.2.6 Callose deposition is deteced at an early stage of F. oxysporum infection ............... 75 4.2.7 ROS production in the roots ..................................................................................... 76 4.2.8 PAMP mutants investigation on F. oxysporum inoculation ....................................... 77
4.3 Discussion: .......................................................................................................... 78 5 Conclusion: ............................................................................................................................ 82 6 Future Prospects ................................................................................................................... 84 7 References: ........................................................................................................................... 85 8 Appendix: ............................................................................................................................. 102
10
List of Figures & Tables:
Table 1.1: A list of Arabidopsis mutants showing resistance to F. oxysporum .................................... 25 Table 2.1: Primer list for RT-qPCR ................................................................................................... 32 Table 2.2: T-DNA insertion lines .................................................................................................... 34 Table 2.3. Genes that were significantly down-regulated by greater than two-fold following F. oxysporum
inoculation in Arabidopsis root tissue. ................................................................................................ 36 Table 2.4 Genes that were significantly up-regulated greater than 1.5-fold following F. oxysporum
inoculation in Arabidopsis roots. ....................................................................................................... 37 Table 2.5: Common genes that were differentially expressed in root and shoot samples by comparison with
the study of Kidd et al. 2009; 2011. ................................................................................................... 40 Table 3.1:Primer list for quantification of F. oxysporum level .......................................................... 55 Table 4.1: SALK mutant list ........................................................................................................... 72
Figure 1.1:The zigzag model illustrates the plant immune system (Jones & Dangl, 2006) ......................... 17 Figure 1.2: A model of the ethylene downstream signalling pathway leading to a defence response
(Broekaert et al., 2006). Arrows and end-blocked lines indicate positive and negative regulation. White
arrows indicate signal direction. Genes and proteins are presented in light blue boxes. ............................. 19 Figure 2.1(A-D): Different relative transcript abundance in Arabidopsis wild-type roots under F. oxysporum
treatment at 48 h. ............................................................................................................................. 38 Figure 2.2. : Co-regulation of F. oxysporum-induced Arabidopsis root genes. ......................................... 43 Figure 2.3. : Co-regulation of F. oxysporum-repressed Arabidopsis root genes. ....................................... 44 Figure 2.4. : Co-regulation of F. oxysporum-repressed Arabidopsis root genes. ....................................... 45 Figure 2.5: Disease score for erf72 mutants and wild-type Arabidopsis plants. ........................................ 46 Figure 3.1A-F: Different relative abundance for WT/erf72 JA and SA treatment ..................................... 57 Figure 3.2: P. cinnamomi treatment of erf72 and WT Arabidopsis plants................................................ 58 Figure 3.3 (A-B): erf72 mutant disease score under P. cinnamomi treatment ........................................... 59 Figure 3.4(A-B): erf72 inoculated with P. syringae and disease score .................................................... 60 Figure 3.5: erf72 mutants showed no difference on JA root inhibition .................................................... 60 Figure 3.6(A-E): Gene expression in the WT and erf72 at 1 h post inoculation with F. oxysporum. ........... 62 Figure 3.7: Expression of a universal fungal gene (GPD) analysed by real time PCR ............................... 63 Figure 3.8(A-F): GUS expression of F. oxysporum colonizing wild-type and erf72 Arabidopsis roots ........ 64 Figure 3.9: H2DCFDA staining of erf72 and wild type Arabidopsis with and without F. oxysporum treatment
..................................................................................................................................................... 65 Figure 3.10. A model showing ERF72’s regulation of ROS and the JA pathway ..................................... 67 Figure 4.1: Arabidopsis pub22/23/24 triple mutant plants showed increased resistance against F. oxysporum.
..................................................................................................................................................... 75 Figure 4.2(A-D): Detection of callose in F. oxysporum infected root tissue ............................................. 76 Figure 4.3(A-B): DAB staining of Arabidopsis thaliana roots ............................................................... 77 Figure 4.5: PAMP T-DNA insertion mutants and wild type Arabidopsis plants challenged by F. oxysporum
..................................................................................................................................................... 78
11
List of Abbreviations used in the thesis: AGRF Australian Genome Research Facility
ABA Abscisic Acid
AP2 APETALA 2
B. cinerea Botrytis cinerea
Bax Bcl-2-assocaited X Protein
CTAB Cetyl-Trimethyl Ammonium Bromide
cDNA Complementary Deoxyribonucleic Acid
DNA Deoxyribonucleic Acid
dNTP Deoxyribonucleotide Triphosphate
ETI Effector-Triggered Immunity
ETS Effector-Triggered Susceptibility
ERF Ethylene Response Factor
E. cichoracearum Erysiphe cichoracearum
E. orontii Erysiphe orontii
ET Ethylene
F. oxysporum Fusarium oxysporum
h Hour
HR Hypersensitive Response
H2DCFDA 2’,7’-Dichlorofluorescein Diacetate
JA Jasmonic Acid
LB Luria-Bertani
MeJA Methyl Jasmonate
MS Murashige and Skoog
ND-1000 Nanodrop 1000 UV Spectrophotometer
PAMP Pathogen Associated Molecular Patterns
PDA Potato Dextrose Agar
PDB Potato Dextrose Broth
PDF1.2 Plant Defensin 1.2
PR Pathogenesis-related
PRRs Pattern Recognition Receptors
PTI PAMP-Triggered Immunity
P.syringae Pseudomonas syringae
O. lycopersicum Oidium lycopersicum
RNA Ribonucleic Acid
12
RT-qPCR Real-Time Reverse-Transcriptase quantitativePCR
ROS Reactive Oxygen Species
SA Salicylic Acid
SAR Systemic Acquired Resistance
SDS Sequence Detection System
S. sclerotiorum Sclerotinia sclerotiorum
T-DNA Transfer DNA
TF Transcription Factor
WT Wild-Type
13
1 Chapter I: Introduction & Literature Review:
Plant molecular defence response against root
pathogens
14
1.1 General introduction
Fusarium oxysporum is one of the most devastating root pathogens, affecting a broad range of
vegetables, fruits and industrial crops (Armstrong and Armstrong, 1981). However, there are
currently no effective methods to control F. oxysporum. The use of fungicides, soil fumigants and
bio-control agents are largely ineffective, and in the case of fungicides and fumigants, can also be
harmful to the environment. The fungal pathogen may also have fungicide resistance due to the
thick-walled chlamydospores (Harrach et al., 2013).Hence, with the lack of control, once F.
oxysporum, is present, many fields remain infected and farmers suffer from crop yield losses. The
development of crops that are resistant to F. oxysporum is therefore essential for agriculture.
Pathogenic F. oxysporum occurs as host specific strains infecting many different plant species, such
as, banana, cotton and tomato. For instance, the strains that infect banana are known as F.
oxysporum f.sp. cubense (Foc) the causal pathogen of Panama disease, the disease that devastated
banana production in the 1950s and stopped production of the Gros Michel cultivar. A new threat
for banana production has arisen from the tropical race 4 isolate of Foc that has spread through
much of South East Asia and has recently been reported in Jordan and Mozambique (Garcia et al
2013). Therefore, there is an urgent need for a novel development in plant resistance to this
pathogen to protect crops such as banana, tomato and cotton.
The ecotype Columbia-0 (Col-0) of the model plant Arabidopsis thaliana is also a compatible host
for F. oxysporum and is considered moderately resistant compared to other ecotypes of A. thaliana.
However, Arabidopsis thaliana is not a host for all Fusarium species, but it is a good experimental
model to investigate the F. oxysporum pathosystem. Modulation of plant hormone pathways
through mutation or over-expression of defence signalling genes in the Col-0 background can alter
its resistance and has therefore provided insights into processes governing either increased
resistance or increased susceptibility to this pathogen. We define plants that have decreased
symptom expression as having increased “resistance” as often they survive longer than the wild-
type (WT) (. However they may also be defined as being more “tolerant” as the modified lines do
not generally show complete resistance. For instance, mutation of AtMYC2, encoding a basic helix-
loop-helix transcription factor which is a positive regulator of ABA signalling, results in an
enhanced level of transcription from JA- andET-responsive defence gene expression and the T-
DNA insertion mutant also showed an increased level of resistance or tolerance to F. oxysporum
(Anderson et al., 2004). Furthermore, Berrocal-Lobo and Molina (2004) showed that over-
expressing ETHYLENE RESPONSE FACTOR1 (ERF1) a transcription factor that activates JA- and
15
ET-responsive defence gene expression, also increases resistance/tolerance to F. oxysporum. While
these studies show that suppression of negative regulators of plant defence or over-expression of
positive regulators of plant defence might confer increased resistance to F. oxysporum, our
knowledge of the F. oxysporum interaction has become more complex with the finding of additional
mutants, such as the coi1 (coronatine insensitive1) and med25 (mediator25) mutants, that have
decreased defence gene expression, yet increased resistance (Kidd et al., 2009; Thatcher et al.,
2009). Therefore further research is needed to investigate what other processes may provide
resistance to F. oxysporum.
Microarrays present a useful tool for exploratory analyses of Arabidopsis gene expression during F.
oxysporum infection. The transcriptional profiling of Arabidopsis roots during infection was
performed using microarrays. Key genes that were differentially expressed during the plant-fungus
interaction were identified. We hypothesise that some of these genes play a major role on conferring
resistance against F. oxysporum and may provide future strategies for combating plant disease.
1.2 Soil-borne fungal pathogens
Plants face many different abiotic and biotic stresses during their lifetime. The abiotic stresses result
from environmental stresses, such as heat, salinity, lack of nutrients and drought stress. The biotic
stresses include plant disease caused by pathogens, such as viruses, bacterial and fungal pathogens,
as well as stress due to insects, herbivores and parasitic plant interactions. In this study, we will be
primarily focusing on fungal pathogen disease.
Fungal pathogens can be simply classified into two categories, biotrophic or necrotrophic,
depending on how they acquire nutrients from the host plant. Many biotrophs live in the
intercellular region between leaf mesophyl cells, and some produce haustoria as feeding structures
that allow them to absorb nutrients from host plants (Voegele et al, 2003; Ellis et al, 2006). In
contrast, necrotrophic pathogens produce toxins to kill host plants to absorb nutrients (Agrios,
2005). However, it is important to note that some pathogens may behave as both a necrotroph and a
biotroph depending on the different stages of the infection cycle. These pathogens are considered as
“hemi-biotroph” Many hemi-biotrophic pathogens act as biotrophs at an early stage, feeding on
living cells and establishing infection before shifting to a necrotrophic phase to complete their life
cycle (Brown and Ogle, 1997).
16
1.3 The plant immune system
Plant roots are surrounded by a diverse range of microorganisms in the rhizosphere. Root-microbe
interactions can be either beneficial or pathogenic (Whipps, 2001) and a fast and accurate
assessment of the surrounding organisms is essential for the plant’s survival. Due to the threat that
pathogens pose, plants have evolved an immune system to defend against potential invading
organisms. Unlike animals, plants do not have an adaptive immune system with a diverse repertoire
of B and T lymphocytes (Martinon et a.l, 2005; Vivier and Malissen 2005). Instead, they rely on the
innate immunity of each cell and systemic signals emanating from infection sites (Dangl and Jones
2001). Plants have evolved two layers of innate immunity to defend against pathogen attack:
pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered
immunity (ETI) (Jones and Dangl, 2006). PTI is activated in response to the detection of PAMPs,
such as bacterial flagellin. Plants possess pattern recognition receptors (PRRs) at the plasma
membrane which activate downstream defence responses such as callose deposition (Zipfel et al.,
2004).. In leaves, PAMP detection leads to a signal transduction and amplification kinase cascade
that triggers the activation of pathogenesis related (PR) proteins (Navarro et al., 2004), the
production of reactive oxygen species (Lamb and Dixon, 1997) and many secondary metabolites,
including the deposition of callose, that act as physical and chemical barriers to prevent pathogen
attack (Aist and Bushnell, 1991). Pathogens try to overcome PTI by delivering effectors into host
cells or the apoplastic space, which can interact directly with host proteins to suppress PTI (Li et al.,
2005; Thilmony et al., 2006; Truman et al., 2006), resulting in effector-triggered susceptibility
(ETS).
According to Jones & Dangl (2006), the plant immune system can be represented as a four phased
“zigzag” model (Figure 1.1). In phase I, PAMP are recognised by PRRs, resulting in PAMP-
triggered immunity (PTI) that can stop further colonisation. In phase 2, pathogens secrete effectors
to enhance pathogen virulence, resulting in effector-triggered susceptibility (ETS). In phase 3, the
pathogen effector is recognised either directly or indirectly by a resistance protein, for example a
NB-LRR protein, resulting in effector –triggered immunity (ETI). Recognition leads to an amplified
resistance response, and in the case of biotrophic pathogens, results in a hypersensitive cell death
response (HR) at the infection site. In phase 4, pathogens evade from ETI by diversifying effectors
or gaining additional effectors to suppress ETI through natural selection. The plant also evolves its
repertoire of R genes, so that ETI can be triggered again to protect the plant.
17
Figure 1.1:The zigzag model illustrates the plant immune system (Jones & Dangl, 2006)
1.3.1 Salicylic acid (SA)
Pathogen invasion may also lead to the activation of further hormone-controlled defence pathways
such as systemic acquired resistance (SAR) which protects against subsequent infections (Durrant
and Dong, 2004). SAR is mediated by salicylic acid (SA) signalling but has also been shown to
require jasmonic acid (JA) in the initial stages (Truman et al., 2007). SAR is the result of a defence
response signal that is activated from the initial site of pathogen interaction, resulting in the
systemic activation of defence mechanism such as PR gene expression, like PR1and PR5 (Uknes et
al,, 1993) or long lasting resistance to subsequent infection (Ryals et al,, 1996). Activation of the
SA defence pathway generally provides protection to biotrophic pathogens but not to necrotrophic
pathogens
1.3.2 Jasmonic acid (JA)
Jasmonate, including JA as well as the methylated form, methyl jasmonate (MeJA), and its various
conjugates, is produced from the membrane lipid, linolenic acid, through the octadecanoid
biosynthetic pathway. JA and MeJA can induce expression of defence related genes, such as
PLANT DEFENSIN1.2 (PDF1.2) and THIONIN2.1 (THI2.1) (Epple et al., 1995; Penninekx et al.,
1996). JA-dependent defence responses are considered to provide defence against necrotrophic
pathogens (McDowell and Dangl, 2000). For example, Seo et a.l (2001) found that over-expressing
a JA carboxyl methyl transferase showed increased endogenous levels of MeJA and resulted in
stronger resistance to B.cinerea.
18
However, there are exceptions to the rule as the activation of the JA signalling pathway in
Arabidopsis resulted also in enhanced resistance to biotrophic pathogens such as Erysiphe
cichoracerum, Erysiphe orontii and Oidium lycopersicum(Ellis et al., 2002).
1.3.3 Ethylene (ET)
The hormone Ethylene (ET) is involved in a range of plant growth and developmental processes,
such as seed germination, root hair development, root nodulation, flower senescence, abscission and
fruit ripening (Johnson and Ecker, 1998). ET is perceived by a family of membrane-associated
receptors, including ETR1, ERS1 and EIN4 in Arabidopsis (Sakai et al., 1998; Hua et al., 1995;
Chang et al., 1993).
There are also some key regulators in this ET pathway; CTR1 acts a negative regulator, and EIN2,
EIN3, EIN5, EIN6 are positive regulators of ethylene responses, acting downstream of CTR1
(Kieber et al., 1993). The positive regulator regulates downstream target genes such as ETHYLENE
RESPONSE FACTOR 1 (ERF1) (Solano et al., 1998). ERF1 can activate defence genes such as
PDF1.2 and CHI-B (Chao et al., 1997; Solano et al., 1998). ERF1 expression can be induced by
both ET and JA, however, intact signalling components from both pathways are simultaneously
required for expression since mutations that block either pathway prevent ERF1 expression in
response to JA or ET (Lorenzo et al., 2003).Therefore, ERF1 plays a role in downstream
intersection between the ET and JA signalling pathways.
Figure 1.2 illustrates ET perception and downstream signalling leading to the defence response
(Broekaert et al., 2006). Ethylene is perceived by the ET hormone receptors ETR1, ETR2, ERS1,
ERS2, and EIN4. CTR1 is a negative regulator of ET responses that phosphorylates the
transcription factor EIN2 keeping it in the cytosol (Kieber et al., 1993; Wen et al., 2012).
Perception of ET leads to the inactivation of CTR1 and therefore the release of the Ce-terminal
portion of EIN2 which travels into the nucleus to stabilise downstream transcription factors,
TFssuch as EIN3 and EIL1 (Wen et al., 2012). The Arabidopsis F-box proteins AtEBF1and
AtEBF2 were shown to physically interact with and inhibit EIN3 (Gagne et al., 2004 ; Guo &
Ecker., 2003). EIN3/EIL1 lead to the activation of a large number of genes such as ERF1, a
positive regulator of the defence gene PDF1.2 and other ET responses. On the other hand, the
activation of negative regulators such as ERF4 are also activated to help regulate the amplitude of
the ET response. ERF4 represses the activation of GCC-box containing genes promoters, such as
19
the PDF1.2. The overexpression of AtERF2 and AtERF4 result in increased disease resistance and
susceptibility to F. oxysporum respectively (McGarth et al., 2005). Interestingly, Anderson and
Singh (2011) showed that Medicago truncatula plants over-expressing MtERF1 showed no change
in resistance to F. oxysporum. This suggests that ethylene may play different roles in F. oxysporum
resistance within different plant hosts.
Figure 1.2: A model of the ethylene downstream signalling pathway leading to a defence
response (Broekaert et al., 2006). Arrows and end-blocked lines indicate positive and negative
regulation. White arrows indicate signal direction. Genes and proteins are presented in light blue
boxes.
1.3.4 Crosstalk between pathways
From the previous paragraph, the defence hormone pathways seem to act independently, in fact,
they interact with each other quite often. The crosstalk between pathways is more complex than
that. Schenk et al. (2000) suggested that each of the defence signalling pathways are partially
integrated with each other and can act both synergistically and antagonistically. In general, the SA
and JA pathways typically act antagonistically to each other and this was first discovered by Doares
et al. (1995). SA has been shown to inhibit JA-biosynthesis, as well as JA-responsive gene
20
expression (Penninckx et al., 1996). On the other hand, JA has been reported to repress the SA
signalling pathway. Although JA- and SA- pathways are generally antagonistic to one another,
Schenk et al. (2000) showed that approximately one in four genes induced by SA were also induced
by MeJA.
The JA and ET pathway are generally synergistic with one another. Schenk et al. (2000) showed
that more than half of the genes induced by ET in a microarray study were also induced by MeJA.
Therefore is more overlap between the JA– and ET- signalling pathways.
The SA- and JA/ethylene- signalling pathways are generally considered to be effective against
biotrophic and necrotrophic pathogens, respectively (Glazebrook, 2005; Beckers and Spoel, 2006).
Hemi-biotrophic pathogens, such as Phytophthora infestans, typically start out as a biotrophic
pathogen however, later on in the infection cycle the pathogen changes to a necrotrophic lifestyle
that is often accompanied by the production of cellulolytic enzymes and toxins to damage host cells
enabling further invasion and nutrient uptake. This change in lifestyle leads hemi-biotrophic
pathogens to be adept at hijacking host signalling pathways.
1.3.5 Reactive oxygen species (ROS) for plant defence against pathogens
Plants have developed surveillance systems triggered by PAMP, such as flagellin and fungal chitin,
which allow plants to recognise the presence of harmful microbes. Once the plant’s defence
response has been activated, reactive oxygen species (ROS) are produced (Jones and Dangl, 2006;
He et al., 2007). The ROS include superoxide, hydrogen peroxide, but nitric oxide should also be
listed in this group,, which function either directly in the establishment of defence mechanisms or
indirectly via synergistic interactions with other signalling molecules, such as SA (Bolwell and
Daudi, 2009). The production of ROS in response to pathogen attack is one of the first measurable
events in the plant defence response. There are many potential ROS generation systems; genetic
analysis and biochemical studies using inhibitors of ROS-generating enzymes have established that
two main categories of enzymes are involved in ROS production in response to pathogens. these
areNADPH oxidases, and class III cell wall peroxidases (O’Brien et al., 2012). NADPH oxidases,
also referred to as respiratory burst oxidases, have been implicated in biotic interactions, abiotic
stress responses and development in different plant species and have been studied well in
Arabidopsis (Torres and Dangl, 2005). In Arabidopsis, RBOHD and RBOHF were found to be
required for the production of a full oxidative burst in response to avirulent strains of the bacterial
and oomycete pathogens, P. syringae and Hyaloper-onospora arabidopsidis respectively (Torres et
21
al., 2002). Furthermore, Chaouch et al..(2012) showed that the rbohf mutant was shown to be more
susceptible to P. syringae. Torres et al. (2005) suggested that NADPH oxidases need to be activated
by an independent source of ROS to generate their oxidative burst. Thus, it is possible that ROS
activates RBOHD, and RBOHF is generated by peroxidases during the basal (PTI) defence
response, in which case NADPH oxidases may function mainly in the HR.
The peroxidase-dependent oxidative burst was first revealed by Bach et al. (1993), and they showed
that the cell wall is required for a full oxidative burst in carrot cultured cells. This mechanism has
been explored further, interestingly, Bindschedler et al. (2006) identified that an Arabidopsis
sodium azide-sensitive but diphenylene iodonium-insensitive apoplastic oxidative burst that
generated H2O2 in response to a F. oxysporum cell wall preparation. In additional, the transgenic
line as French bean class III peroxidase (FBP1.1) showed a reduced oxidative burst in response to a
F. oxysporum cell wall elicitor preparation, reduced expression of two cell wall peroxidase-
encoding genes PRX33 and PRX34, and enhanced susceptibility to infection by bacterial and fungal
pathogens (Bindschedler et al., 2006). PRX 33 and PRX34 play a major role in the generation of
ROS in response to many different MAMP elicitors (Daudi et al., 2012). Furthermore, Daudi et al.
(2012) pointed out that FPB1.1, PRX33 and PRX34 T-DNA knock out lines exhibited significantly
reduced levels of callose deposition in response to MAMPs. Hence, the apoplastic oxidative burst
peroxidase plays a major component in plant defence response to pathogen attack.
ROS also co-operates with plant defence pathways against pathogen attack. SA acts as a signalling
molecule in both local and systemic responses and has been shown to accumulate locally around
pathogen breach sites (Enyedi et al., 1992). H2O2 has been shown to accumulate after SA
application (Shirasu et al., 1997), which suggests that SA may require other down stream
components including ROS for a more robust defence response. Furthermore, Torres et al. (2006)
revealed that SA accumulation also leads to a reduction in ROS scavenging enzyme which in turn
leads to high levels of ROS in response to pathogen invasion. Not only SA, ET is also co-responded
with ROS. Desikan et al. (2001) suggested that large scale gene expression analysis revealing that
ethylene responsive elements and other genes involved in ET signalling were up-regulated by
exogenous application of H2O2. ET is known to induce programmed cell death and fruit or flower
senescence, and there is also evidence for the accumulation of H2O2 in response to ethylene in
tomato (De Jong et al., 2002). Both ET and ROS were implicated in a SAR response against the
virus but SA levels did not have a major role to play in this particular system (Love et al., 2005).
22
1.4 Defence against the root pathogen Fusarium oxysporum
In addition to the paragraphs below, please see also the short review manuscript at appendix: Chen
YC, Kidd BN, Carvalhais LC, Schenk PM (2014) Molecular defense responses in roots and the
rhizosphere against Fusarium oxysporum. Plant Signaling & Behavior (accepted 4 September
2014).
1.4.1 F. oxysporum colonisation strategies
F. oxysporum is a root infecting pathogen that infects a number of plants, including cotton, tomato,
banana and Arabidopsis. Despite infecting over 100 different plant species, there are only a limited
number of studies on the interaction between F. oxysporum and the host plant. This is mainly
because F. oxysporum is a root-infecting pathogen which makes it difficult to study the interaction
unobtrusively. Even so, there are still some studies on the root infection process and the plant
response (Beckman and Roberts, 1995 ; Czymmek et al., 2007). F. oxysporum is known to infect
through the roots where it subsequently moves towards the vascular tissue. When F. oxysporum
spores detect a suitable host, the fungal spores germinate and develop hyphae that grow towards the
host and surround the outside of the root.The pathogen then penetrates the root by fungal hyphae or
with assistance of a rudimentary apressorium-like structure ( Czymmek et al., 2007). Upon
penetrating the root, the infection hyphae move through the cortex to the vascular tissue and into
xylem. Penetration into the xylem allows the pathogen to spread systemically through the plant and
cause drought stress and disease.
According to Beckman et al. (1991), one hour after inoculation of resistant tomato plants, the
contact parenchyma cells show an enlarged cytoplasm opposite to the infection point. The
susceptible plants showed a weak response which did not occur till several hours after the infection.
It has also been reported that host plants are capable of depositing apposition layers made of callose
to fortify the cell wall (Beckman et al., 1989; Muller et al., 1994).
Upon recognition of pathogen invasion, a signal will be transmitted to activate the defence
response. If the signalling network of the host plant during F. oxysporum infection is understood, it
may be possible to enhance plant resistance against F. oxysporum. Arabidopsis is a suitable model
plant to study signalling processes since a lot of genetic information is available for this species.
23
1.4.2 Defence against F. oxysporum in Arabidopsis
F. oxysporum acts as a hemi-biotrophic pathogen in Arabidopsis and the application of SA on
Arabidopsis leaves resulted in a partial increase in resistance (Edgar et al., 2006). Mutants deficient
in SA-mediated defence were shown to be more susceptible to F. oxysporum. For instance, the sid2
mutant is impaired in SA biosynthesis and is susceptible to F. oxysporum f. sp. conglutinans
(Berrocal-Lobo and Molina, 2004; Diener and Ausubel, 2005). However, during infection, F.
oxysporum strongly induces JA-mediated defence responses in the leaves (Kidd et al., 2011).
In Arabidopsis, Diener et al. (2005, 2013,) revealed several resistance gene loci termed
RESISTANCE TO FUSARIUM (RFO1, RFO2, RFO3 etc), some of which have been successfully
cloned. RFO1 was found to encode a wall-associated kinase-like kinase 22 (WAKL22) and was
revealed using a cross between resistant WT (Col-0_ and the more susceptible ecotype Taynuilt-0
(Ty-0) (Diener and Ausubel, 2005). RFO1 provides a broad spectrum resistance to three different
formae speciales of F. oxysporum (F. oxysporum f.sp. matthioli; F. oxysporum f.sp. conglutinans
and F. oxysporum f.sp. raphani), and the mutant rfo1 allele confers susceptibility to F. oxysporum
f.sp. In addition, RFO2 and RFO3 also provide partial resistance.. However, RFO3 only confers
specific resistance to F. oxysporum f.sp. matthioli, and provides no resistance to the other two
formae speciales of F. oxysporum. Shen and Diener (2013) indicated that RFO2 provides strong
pathogen-specific resistance. The extracellular leucine-rich repeats (eLRRs) in RFO2 and the
related receptor like protein (RLP) 2 protein are interchangeable for resistance and remarkably
similar to eLRRs in the receptor-like kinase PSY1R, which perceives tyrosine-sulfated peptide
PSY1. The authors also found a reduced infection in psy1r. Therefore, Shen and Diener (2013)
suggested that F. oxysporum produces an effector that inhibits the normal negative feedback
regulation of PSY1R, which stabilises PSY1 signalling and induces susceptibility, however, RFO2 ,
acting as a decoy receptor of PSY1R, is also stabilised by the effector and instead induces host
immunity. The RFO resistance (R) genes are unique in that they provide protection to multiple
formae speciales of F. oxysporum and provide only partial resistance in some host-pathogen
combinations. Further work analysing these R genes and how they provide resistance is warranted.
1.4.3 Regulating defence: transcription factors
The Arabidopsis genome contains over 1500 potential transcription factors (TFs), making up about
6% of all protein-coding genes (Ratcliffe and Riechmann, 2002). These proteins are responsible for
controlling all aspects of development and adaptation, from germination and growth through biotic
24
and abiotic stresses to flowering and seed production. Many TFs are believed to play important
roles in disease resistance and pathogen defence. Chen et al. (2002) showed that many TFs showed
altered levels of transcription in response to exogenous application of disease signalling compounds
or pathogen stress. In addition, many TFs have been shown to have a role in defence gene
regulation and disease resistance.
MYC2, a basic helix-loop-helix transcription factor, represses JA-dependent plant defences PDF1.2
and CHI-B, (Dombrecht et al., 2006). The T-DNA insertion mutant of MYC2 (myc2) has increased
expression of JA-dependent defences and shows increased resistance to F. oxysporum (Anderson et
al., 2004). ERF1 is another well studied TF and regulates plant resistance to the necrotrophic fungi
Botrytis cinerea and Plectosphaerella cucumerina where the overexpression of ERF1 enhances
resistance to these fungi. In addition, ERF1 also confers resistance to F. oxysporum (Berrocal-Lobo
and Molina, 2004). AtMYC2 and ERF1 are both key TFs, which play a role in regulating plant
defence signalling pathways, such as JA and ET. Hence, it can be proposed that TFs play an
important role in F. oxysporum resistance by regulation and crosstalk between defence signalling
pathways.
Kidd et al. (2009) reported that PFT1 (PHYTOCHROME AND FLOWERING TIME1), which
encodes the MEDIATOR25 subunit of the plant Mediator complex, is required for jasmonate-
dependent defence gene expression and resistance to leaf-infecting necrotrophic fungal pathogens.
The pft1 mutant showed a significant increased resistance against F. oxysporum, while, a PFT1
over-expressing line showed to be highly susceptible to F. oxysporum. Clearly, PFT1 (or MED25)
plays a significant role in modulating plant susceptibility to F. oxysporum. In addition, Thatcher et
al. (2009) revealed that jasmonate signalling mediated through the JA receptor, COI1
(CORONATINE INSENSITIVE1) is responsible for susceptibility to wilt disease caused by F.
oxysporum. As both pft1 and coi1 mutants have reduced expression of defence genes, yet an
increased resistance to F. oxysporum, it indicates that F. oxysporum hijacks non-defensive aspects
of the JA-signalling pathway to cause wilt-disease symptoms that lead to plant death in
Arabidopsis. Grafting studies performed with the coi1 mutant showed that the root section is
required for resistance/susceptibility to F. oxysporum. A coi1 rootstock grafted to a WT scion
resulted in almost complete resistance, suggesting that roots play a significant role in plant defence
against F. oxysporum. In addition, Pantelides et al (2013) showed that etr1-1 mutant plants
exhibited statistically less Fusarium wilt symptoms compared to Col-0 plants. Quantitative PCR
analysis associated the decrease in symptom severity shown in etr1-1 plants with reduced vascular
growth of the pathogen, suggesting the activation of defence mechanisms in etr1-1 plants against F.
25
oxysporum in the roots. This study suggested that F. oxysporum hijacks ETR1 mediated ethylene
signalling to promote disease development in plants.
Table 1.1: A list of Arabidopsis mutants showing resistance to F. oxysporum
Mutant Name TAIR Locus ID Mutant type Function Resistance to F.
oxysporum
rfo1 AT1G79670 Resistance
QTL from Col-
0
Confers
resistance to
F. oxysporum
Yes
rfo2 AT1G17250 Insertion Confers
resistance to
F. oxysporum
Yes
rfo3 AT3G16030 Insertion Confers
resistance to
F. oxysporum
Yes
myc2 AT1G32640 Insertion Regulates
diverse JA-
dependent
functions
Yes
coi1 AT2G39940 Insertion Require for
wound and
JA-induced
transcriptional
regulation
Yes
erf1 AT3G23240 Overexpressing Involved in
ethylene
signalling
Yes
erf4 AT3G15210 Insertion A negative
regulator of
JA-responsive
defence gene
expression
Yes
etr1 AT1G66340 Insertion Ethylene
receptor and
respond to
ethylene
Yes
pft1 AT1G25540 Insertion Induces
flowering in
response to
suboptimal
light
conditions
Yes
(From TAIR: http://www.arabidopsis.org/)
26
1.5 Conclusion
The literature reviewed here discuses the genetic mechanisms behind recognition of the pathogen,
signal transduction and the response from the host defence mechanism, yet these are still not fully
understood. Thatcher et al. (2009) suggest that plant roots could be a novel and vital entry points to
study how plants respond to F. oxysporum invasion. In addition, Kidd et al. (2011) revealed gene
expression and response to F. oxysporum invasion in shoots, thus, this study provides good
comparison data for us to examine root defence responses to this pathogen. The discovery of root
defence response to F. oxysporum might provide interesting new defence concepts novel aspect to
study in this field.
1.6 The research questions
There are only a limited number of studies describing the interaction between F. oxysporum and the
host plant, although this pathogen can infect various plant species. A possible reason for this is that
F. oxysporum is a root-infecting pathogen; therefore it is much more difficult to study than other
types of pathogens. Despite F. oxysporumbeing a root fungal pathogen, most of the studies
regarding this pathogen are based of Arabidopsis leaves. As F. oxysporum starts to infect plants, the
root is the first tissue that F. oxysporum interacts with. The root tissue should signal the rest of the
plant to switch on its immune system once the fungal pathogen invades the root tissue.
Interestingly, the Arabidopsis roots are relatively unstudied compared to leaves. The resistance
mutant coi1 provides resistance through the root tissue, so the root might play some role in
pathogen resistance against F. oxysporum. Further research of the root response to F. oxysporum is
needed to understand the whole picture of resistance against this pathogen.
As previously discussed, there is a critical gap in our understanding of how host plants develop
resistance against F. oxysporum. The current approaches used against F. oxysporum infection are
not sufficient to enhance resistance in plants. The discovery of resistance or susceptible mutants is
providing new insights for possible mechanisms of disease resistance. Plants with mutations in key
regulatory genes display altered defence signalling, and therefore change the plant’s response to
pathogen invasion.
In order to fulfil the critical gap, the following questions could be raised:
27
How do the roots play a role in resistance against F. oxysporum? Is signalling of roots similar to the
signalling of shoots? What is the gene expression in roots when F. oxysporum infects the plant?
Does the early PAMP response assist in F. oxysporum resistance and how does it help in resistance?
In this PhD study, the root section was mainly focused on and a microarray analysis was conducted
2 days after infection with F. oxysporum. The Ethylene Response Factor 72 (ERF72) TF was
selected to be investigated because its gene was significantly down-regulated in the analysed
microarray data and an insertion mutant of ERF72 showed increased resistance against F.
oxysporum. Moreover, a literature search indicated that ERF72 has not been functionally
characterised fully in hormonal signalling and pathogen resistance. In addition, we explored the role
of early PAMP responses against F. oxysporum. To do this we explored the role of ROS and
investigated PAMP signalling using mutants involved in PAMP triggered immunity. Through the
investigation of these areas we hope to provide the starting point for new technologies to protect
against F. oxysporum in crop plants.
1.7 The research objectives
The present PhD study aims at understanding mechanisms of plant resistance against F. oxysporum,
a wide-spread destructive pathogen that infects roots of a broad range of crops and vegetables.
Using Arabidopsis as a model, this objective will be pursued by performing gene expression
profiling in infected and mock-infected Arabidopsis roots. Strategies to enhance plant defence and
combat this devastating fungal disease could then be proposed in the future, such as the
development of resistant crop varieties.
The following three objectives have been chosen to be investigated in the present PhD study:
1. To explore root microarray and identified possible candidate genes for their roles in
resistance against F. oxysporum infection.
2. To examine the function of candidate genes in resistance against F. oxysporum. ERF72 was
chosen as a candidate transcriptional factor from the root microarray.
3. To explore the PAMP triggered immune response, particularly ROS responses, against F.
oxysporum.
28
In the research chapters following the literature review, detailed information will be presented on
the areas briefly introduced here.
29
2 Chapter II: Genome-wide microarray analysis of
F. oxysporum infected Arabidopsis roots
30
2.1 Introduction
As a pathogen infects the host plant, the host plant will adjust its gene expression to mount a
defence response. In order to understand the transcriptional response to pathogens, technology such
as microarrays can be used. Microarray experiments allow us to measure gene expression on a
genome wide scale and help us to understand the transcriptional response to pathogens better.
In the literature, there are a couple of microarray studies of F. oxysporum. Kidd et al. (2011)
performed a microarray analysis of Arabidopsis shoot tissues which were infected with F.
oxysporum. Kidd et al. (2011) discovered that defence genes, such as PDF1.2, were induced during
F. oxysporum infection and therefore the JA pathway was active against this pathogen. Zhu et al.
(2013) also performed a microarray with two different time points (1 DPI and 6 DPI) on 2 week-
old-seedlings. In doing so, Zhu et al. (2013) observed that more genes were up-regulated rather than
repressed, and these genes were continually expressed at 6 DPI. Those two studies reveal that
numerous gene expressions are induced in the shoots section during F. oxysporum infection.
However, what about the gene expression in the root? Dowd et al. (2004) performed a subtractive
cDNA microarray using F. oxysporum infected cotton roots. In this latter study the researchers
discovered that more genes were suppressed by F. oxysporum in the root section than were
upregulated. This observation leads to an intriguing proposition that gene expression is
fundamentally different in the root and leaves of F. oxysporum infected Arabidopsis plants.
In a review of the literature, it is clear that knowledge of root gene expression to pathogen infection
is really very limited. There is a critical gap in that most studies focus on leaf tissue, even when
investigating root pathogens. The plant roots may provide new insights to help us to understand root
fungal pathogens better. Therefore, in this study we have performed a plant root microarray analysis
to understand gene expression in the roots with the aim of providing insight in gene expression
responses with possibilities of leading to new approaches in the development of resistance to F.
oxysporum.
31
2.2 Methodology
2.2.1 Plant growth and growth conditions
Arabidopsis thaliana (Col-0) seeds were sown onto sterilized moist soil (UC mix) and incubated at
4oC in the dark for 3 days, to synchronize the germination of seeds. The resultant Arabidopsis
seedlings were then grown in growth cabinets at 25oC, with an 8 h photoperiod (160 µE m
-2s
-1).
After 2 weeks, seedlings were transferred to 30-well trays, and grown until the six to eight leaf
stage. Hormone treatments and timepoints for analysis by RT-qPCR were performed according to
previously published research (Schenk et al., 2000; Anderson et al., 2004; Kidd et al., 2009).
2.2.2 F. oxysporum inoculation
Plants were inoculated with F. oxysporum as described previously (Edgar et al., 2006). Briefly, at 1
h after the start of the photoperiod (t = 0 h) the plants were gently uprooted and dipped for 15 s in
fungal spore suspension with a concentration of 106 spores/mL in water and then replanted. Mock
plants were dipped in water and replanted. Root tissues were harvested at 48 h after inoculation
(three independent biological replicates with pools of 40 plants each). Once the root samples were
harvested, the root tissue was snap-frozen in liquid nitrogen.
2.2.3 Microarray analysis
RNA from Arabidopsis roots was extracted using the SV Total RNA Isolation System (Promega,
USA). The RNA from mock- and F. oxysporum-inoculated samples was reverse-transcribed and
labelled with Cy3 and Cy5 fluorescent dyes, respectively. The labelled cDNA samples were then
hybridized onto 4x44K Agilent Arabidopsis Gene Chip arrays (Agilent Technologies, USA). The
labelling and hybridization steps were performed by the Australian Genome Research Facility
(AGRF, Victoria, Australia). Signal intensities were extracted from scanned microarray images
using Agilent Feature Extraction version 10.5.11 software (Agilent Technologies). The extracted
data were analysed using Integromics Biomarker Discovery (Integromics Granada, Spain), and
normalized within-arrays using the Loess algorithm, and between arrays using the Quantile
normalization method.
32
Differentially expressed and statistically significant genes were selected based on the following cut-
off criteria. The first criterion was that genes had to present fluorescence signals that were greater
than background signal (gisPosAndSignif = 1 and risPosAndSignif = 1) by the Agilent Feature
Extraction in both Cy3 and Cy5 channels. Secondly, the above genes with p-values < 0.05 using a
parametric-based test (Welch T-test) were considered statistically significant. Finally, those genes
that met the above listed criteria and presented a ratio (normalized red / normalized green) > 1.5 and
< 0.68 were considered as up- and down- regulated genes, respectively.
2.2.4 Primer design for Real time RT-qPCR
Primers were designed using Primer Express® software v2.0 (Applied Biosystem). The software
finds PCR primers for RT-qPCR by searching potential primer pairs against fixed parameters (Min
Tm = 59, Max Tm = 61, optimum Tm = 60, Max primer length = 26, amplicon length =100-150, the
remaining parameters are as per default).
Table 2.1: Primer list for RT-qPCR
ATG
Number
Forward Primer Reverse Primer
Forward
Universal
Actin
AGTGGTCGTACAACCGGTATTGT
AT3G18780 GATGGCATGGAGGAAGAGAGAAAC
AT5G09810 GAGGAAGAACATTCCCCTCGTA
AT1G49240 GAGGATAGCATGTGGAACTGAGAA
AT3G55970 CAGCGTCCAAACATAACCCCT GGTCGTCCGTGTATAGGCGA
AT4G22610 GTCCAAGGGACATCGAAGCTT TCCACGAGAGTGCAACATGG
AT1G90135 TGTTACCCATCTTCAGGCAAGA ACTTGTTTGGAGGATCCGACC
AT3G62760 AACGGATTTGACAAGACACGAA GATCGCAGGGTTGAAGTGGT
AT5G17220 CTTCGTCAGCCATTTGGTCAAG TGGTAGCGTAGTATCTCGCGATG
AT3G22120 TTGATTCACATCGGACTTGGAA GACAAACGGCTGCGTCTAGGT
AT1G29930 CAGAGGCATTCGCTGAGTTGA ACGATGGCTTGAACGAAGAATC
AT5G48485 CCATCACAGCCTTGCTGCA CACCGAAAGAACCGAGCCAT
AT1G60590 GCTGCAGCCAGTTGAGGACT TTCAAACGCCTGAGTGTCATCA
AT5G25980 GCACTGGATCACCATCAACCA CACCCATTGGGAACATCGAC
AT3G16770 AGCCAAGCTCAACTTCCCAGA CGGAGGCTGATCGGTTGAT
AT3G50440 TCACTTCGTCTTTGTCCACGG TGTCACACGGTGACCATCGA
AT5G26000 TTCGGACGTACACACTGCCTT TGCATTGAACGGTGGACCA
AT5G13930 TTCCGCATCACCAACAGTGA GCATGTGACGTTTCCGAATTGT
AT5G46110 AAACGTGTGTTCGTGATCGGTT CAGCAATGGCTATTCCTGTTCC
AT1G29490 CAGAAGGACCAATCACGTTGC TGTATCTCCATCCATTCGTCTTTTG
AT1G61190 GTGATGCATGACGTGGTTCG CGACTCTTGCTCGCACAACATA
AT3G26650 GGATCGCTCTCCGTGTACCA GCGTTGACTTCCTCAGCAAATG
AT5G62360 AACTTCAGCAATGATGGTGCG GTGTCACCTAACTCCTCGACGC
33
The selected primer pairs were checked by using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
for specificity. For RT-qPCR normalization, we used a primer mix of three ACTIN genes (β-actin-2
AT3G18780, β-actin-7 AT5G09810, and β-actin-8 AT1G49240) according to prior research
(Anderson et al., 2004). The use of multiplexed primers to three ACTIN genes (one universal
forward and three specific reverse primers) was found to provide greater stability over different
treatments and more accurate normalization as compared to a single ACTIN gene (Bob Simpson,
verbal communication).
2.2.5 RNA isolation and cDNA synthesis
For RNA extraction, plant samples were collected and then frozen immediately in liquid nitrogen
for processing. Total RNA from roots for RT-qPCR analyses were isolated using the SV Total RNA
Isolation Kit (Promega). RNA integrity was tested by gel electrophoresis and the quantity measured
by NanoDrop spectrophotometer (NanoDrop ® ND-1000). The cDNA synthesis was performed
with 0.2 µg root RNA in 13.25 µL, using the SuperScript™ III RT kit (Invitrogen) as follows. A
total of 0.2 µL of 100 µM oligo-dT, 0.05 µL of 3 µg/µL random hexamers (Invitrogen) and 1 µL of
10 mM dNTPs were added to a final volume of 20 µL. The mixture was denatured at 65°C for 5
min followed by 2 min of chilling on ice. A total of 4 µL of 5x first strand buffer, 1 µL of 0.1 mM
DTT (Invitrogen) and 0.5 µL (200 U/µL) SuperScriptTM
III Reverse Transcriptase were added,
followed by incubation at 52°C for 50 min and 70°C for 15 min. The resulting cDNA was
subsequently diluted to a final concentration of 20 ng/µL of input RNA for RT-qPCR.
2.2.6 Real-time quantitative reverse transcriptase PCR (RT-qPCR) analyses
Gene expression analysis by RT-qPCR was carried out in 384-well plates using an ePMotion
automatic pipetting (Eppendorf epMotion 5075, Eppendorf) and an ABI PRISM 7900HT Sequence
Detection System (Applied Biosystems). Each reaction contained 5 µL of SYBR green and 1 µL of
200 nM of each gene-specific primer pair and 20 ng/ µL of cDNA template to a final volume of 10
µL. The PCR primer efficiency (E) of each primer pair in each individual reaction was calculated
from the changes in fluorescence values (∆Rn) of each amplification plot, using LinReg PCR
software (Ramakers et al., 2003). E values for each gene were averaged across all samples, except
in cases where linear regression of amplification plots yielded a R2 value of less than 0.99, in which
case the derived E value for that sample was omitted from the calculation of mean E value.
Amplification plots were analysed using a threshold of 0.20 to give a cycle threshold (Ct) value for
34
each gene and cDNA combination. Gene expression levels relative to the Arabidopsis housekeeping
genes β-ACTIN 2 (AT3G18780), β-ACTIN 7 (AT5G09810) and β-ACTIN 8 (AT1G49240) were
calculated for each cDNA sample using the following equation: The gene transcript levels relative
to actin = (E gene^(-Ct gene)) / (E Actin ^(-Ct Actin)).
2.2.7 Genevestigator analysis
Microarray analysis of Arabidopsis genes performed using Affymertix 22K ATH1 oligonucleotide
expression data were obtained from Genevestigator (https://www.genevestigator.com). The
expression profiles of Arabidopsis genes were selected for cluster analysis. Hierarchical clustering
tool from Genevestigator was used to rearrange candidate genes in a heat map.
2.2.8 T-DNA insertion lines
All mutant lines used in this chapter are SALK T-DNA insertion lines and were obtained from the
Arabidopsis Biological Resource Center (ABRC; http://www.Arabidopsis.org).
Table 2.2: T-DNA insertion lines
TAIR locus ID Salk_number Insertion Homozygous Function
AT3G55970 Salk_024417C Intron Yes Oxidoreductase activity
AT3G62760 Salk_093696C Exon Yes Encodes glutathione
transferase belonging to the
phi class of GSTs
AT4G22610 Salk_099386C Exon Yes Lipid binding
AT5G17220 Salk_113805C Promoter Yes Encodes glutathione
transferase belonging to the
phi class of GSTs
AT1G62500 Salk_022164 Exon No Lipid binding
AT1G60590 Salk_068596 Exon No Polygalacturonase activity
AT3G16770 Salk_030459C Promoter Yes
Encodes a member of the
ERF (ethylene response
factor) subfamily B-2 of the
plant specific ERF/AP2
transcription factor family
(RAP2.3)
AT5G26000 Salk_069615C Intron Yes Encodes myrosinase enzymes
AT1G29490 Salk_018291 Exon No SAUR-like auxin-responsive
protein family
AT1G61190 Salk_016572 Exon No Putative CC-NB-LRR
resistance gene
AT2G47400 Salk_008459C Exon Yes Encodes a small peptide
found in the chloroplast
stroma
The source is from TAIR (http://www.arabidopsis.org/)
35
The mutants used include Salk_024417C(AT3G55970), Salk_093696C(AT3G62760),
Salk_099386C(AT4G22610), Salk_113805CAT5G17220), Salk_022164(AT1G62500),
Salk_068596(AT1G60590), Salk_030459C(AT3G16770), Salk_069615C(AT5G26000),
Salk_018291(AT1G29490), Salk_016572(AT1G61190).
2.2.9 Disease resistance assays with F. oxysporum inoculation
F. oxysporum spores isolate #5176, obtained from Dr. Roger Shivas, Queensland Plant Pathology
Herbarium, Queensland Department of Agriculture, Fisheries and Forestry (DAFF), Brisbane,
Australia, were grown and prepared for inoculation. Inoculation with F. oxysporum was carried out
as outlined in Edgar et al. (2006). The plants were gently uprooted and dipped for 15 s in fungal
spore suspension with a final concentration of 106 spores/ mL in distilled water and then replanted.
The control plants were water dipped and replanted back to soil. Trays were then placed back onto
16 h photoperiod cabinet. The disease score was done by counting symptomatic leaves from each
whole plant, then took average for each biological replicates. The student statistics method was
applied for analysing this data.
2.3 Results:
2.3.1 Microarray analysis
To identify root genes that play a role in the interaction of F. oxysporum with Arabidopsis we
performed a microarray experiment using F. oxysporum-infected root tissue harvested at 48 h after
infection. We chose to analyse gene expression at 48 hours after infection to compare with a
previously published microarray conducted on the leaf tissue of F. oxysporum infected Arabidopsis
(Kidd et al., 2009; 2011). Overall, we found 89 genes that were significantly differentially regulated
greater than 1.5-fold (p <0.05). Of these genes, the majority (72 genes) were found to be repressed
by more than 1.5-fold in the infected tissue relative to the mock-infected tissue, whereas only 17
genes were found to be induced more than 1.5-fold by F. oxysporum infection (Table 2.3;Table
2.4). Of the significantly induced genes, only two were induced greater than two-fold, compared to
15 genes that were repressed greater than two-fold (Table 2.3;Table 2.4). Therefore, at the 48 hour-
time point tested, this microarray experiment suggests that F. oxysporum primarily repressed genes
in the roots of Arabidopsis.
36
Table 2.3. Genes that were significantly down-regulated by greater than two-fold following F.
oxysporum inoculation in Arabidopsis root tissue.
TAIR ID Gene Description Fold Change T-test
AT5G17220
GLUTATHIONE S-TRANSFERASE
12 (GST12)
0.24 0.02
AT3G22120
Cell wall-plasma membrane linker
protein homolog
0.25 0.021
AT1G29930
CHLOROPHYLL A/B BINDING
PROTEIN 1 (CAB1)
0.28 0.048
AT5G48485
DEFECTIVE IN INDUCED
RESISTANCE 1 (DIR1)
0.30 0.029
AT1G60590 Pectin lyase-like protein 0.31 0.015
AT5G25980
THIOGLUCOSIDE
GLUCOHYDROLASE 2 (TGG2)
0.36 0.004
AT3G16770
ETHYLENE RESPONSE FACTOR 72
(ERF72)
0.40 0.017
AT3G50440
METHYL ESTERASE 10 (MES10) 0.40 0.003
AT5G26000
THIOGLUCOSIDE
GLUCOHYDROLASE 1 (TGG1)
0.40 0.042
AT5G13930
CHALCONE SYNTHASE (CHS) 0.40 0.020
AT5G46110
ACCLIMATION OF
PHOTOSYNTHESIS TO
ENVIRONMENT 2(APE2)
0.42 0.030
AT1G61190 Response to auxin stimulus 0.44 0.013
AT3G26650
GLYCERALDEHYDE 3-
PHOSPHATE DEHYDROGENASE A
SUBUNIT (GAPA)
0.48 0.045
AT1G29490 SAUR-like auxin-responsive protein 0.48 0.034
AT5G62630 HIPL2 protein precursor 0.49 0.020
37
Table 2.4 Genes that were significantly up-regulated greater than 1.5-fold following F.
oxysporum inoculation in Arabidopsis roots.
TAIR ID Gene Description Fold Change
(infected/mock)
T-test
AT3G55970 JASMONATE-REGULATED GENE 21
(JRG21)
2.66 0.005
AT4G22610 Lipid transport protein 2.14 0.024
AT1G30135
JASMONATE ZIM DOMAIN
PROTEIN 8 (JAZ8)
1.58 0.030
AT3G62760
GLUTATHIONE S–TRANSFERASE
13 (GST13)
1.55 0.007
AT2G38240
Oxidoreductase 1.79
0.009
AT5G19110
Eukaryotic aspartyl protease protein 1.73
0.018
AT2G26370
ML domain-containing protein
1.70
0.027
AT1G61080
Proline-rich family protein
1.66
0.009
AT3G44870
S-adenosyl-L-methionine-dependent
methyltransferase
1.66
0.005
AT3G30740
Ribosomal Protein
1.59
0.032
AT1G04270
CYTOSOLIC RIBOSOMAL PROTEIN
S15 (RPS15 )
1.58
0.019
AT1G21528
unknown protein
1.56
0.005
AT1G13510
unknown protein 1.55
0.001
AT2G36080
DNA-binding protein 1.55
0.010
AT5G26070
Hydroxyproline-rich glycoprotein 1.54
0.009
AT2G27710
60S acidic ribosomal protein P2 1.54
0.006
AT2G39460
RNA binding / structural constituent of
ribosome
1.50
0.024
38
2.3.2 RT-qPCR analysis
To independently confirm the results of microarray analyses, we performed quantitative real-time
reverse transcriptase PCR (RT-qPCR) on F. oxysporum-inoculated plants in three independent
biological experiments at 48 h post inoculation of genes that had shown significant differences in
expression levels following inoculation.
Figure 2.1(A-D): Different relative transcript abundance in Arabidopsis wild-type roots under
F. oxysporum treatment at 48 h.
Shown are RT-qPCR data from three independent biological replicates, each containing expression
levels from pool of 30 plants. Asterisk (*) indicates p-value < 0.05 according to Student’s T test;
bars represent mean ±SE of three independent replicates of 10 plants each.
A B
C D
39
Results from RT-qPCR confirmed the differential expression from the microarray data for most of
the genes that had been shown to be unregulated in the microarray assay. Only one gene (JAZ8)
from the microarray data was not confirmed as having a significant difference in expression when
assessed using in the RT-qPCR assay. Hence, a total of 18 genes were confirmed in terms of being
up or down-regulated and 11 of these genes showed statically significant differences compared to
the control (P ≤0.05) (Figure 2.1).
2.3.2 Comparison with leaf microarray
We then compared our root microarray results with the microarray analyses previously performed
on the leaves of F. oxysporum-infected Arabidopsis plants (Kidd et al., 2009; 2011). Interestingly,
out of the significantly induced or repressed genes in both studies only three genes were common to
both microarray experiments. These genes were At1g60590 which is a pectin lyase-like protein,
At2g47400 which encodes a CP12 protein that forms a complex with glyceraldehyde 3-phosphate
dehydrogenase and At5g25980 which encodes the myrosinase TGG2 involved in glucosinolate
metabolism. All three genes were suppressed in both microarray experiments (Table 2.5; Kidd et
al., 2011). The low number of genes that were common between the root microarray and the leaf
microarray suggests that perhaps different transcriptional programs are activated in the roots as
opposed to the leaves during F. oxysporum infection. However the leaf and root microarrays were
conducted on different microarray platforms (Affymetrix ATH1 Gene Chip and Agilent
Arabidopsis Gene Chip for the leaf and root experiment, respectively), and therefore we cannot rule
out differences in microarray technology perhaps affecting the number of common genes between
array experiments. Furthermore, we compared our microarray of the root tissue challenged with F.
oxypsorum with that of the microarray produced by Iven et al (2012) using Aarbidopsis rosettes at 1
or 3 days post inoculation, with Verticillium longisporum The CP12 gene was found to be
differentially expressed on both microarrays. As V. longisporum is reported to also be
hemibiotrophic there may be comonality here and CP12 might play an important role against
hemibiotrophic pathogens. Singh et al. (2008) suggested that CP12-1 protein has a role in the
metabolism of plastids in non-green tissues, such as root tissue. Furthermore, the expression profile
of the CP12-1 genes indicates that, this protein may play a role in metabolism during early seedling
growth and in roots. Therefore, hemibiotrophic fungi might affect the Calvin cycle and metabolism
in roots, as the result of this, it might assist fungi to infect plants better. Overall however, we found
the majority of the differentially expressed genes in the root microarray to be reduced in response to
F. oxysporum infection whereas in the leaf microarray the majority of differently expressed genes
40
were induced upon F. oxysporum infection and therefore this suggests a difference in the
transcriptional profile that is activated between roots and shoots upon F. oxysporum infection.
Table 2.5: Common genes that were differentially expressed in root and shoot samples by
comparison with the study of Kidd et al. 2009; 2011.
Universal
ID
Gene Name Function Expression
Value in
root
microarray
Expression
Value in
shoots
microarray
AT1G60590 Pectin lyase-
like
superfamily
protein
Polygalacturonase
activity
0.63 0.90
AT2G47400 CP12-1 Involved in the
formation of a
supramolecular
complex with
GAPDH and PRK
embedded in the
Calvin cycle
0.52 0.89
AT5G25980 TGG2 Myrosinase gene
involved in
glucosinoloate
metabolism
0.36 0.85
Shown are gene names, functions and their induction ratios in both roots and shoots microarray.
In the leaf microarray by Kidd et al. (2009; 2011) , the highest differentially expressed genes were
the related PLANT DEFENSIN1.2 genes, PDF1.2a and PDF1.2b, along with PATHOGENESIS
RELATED4 (PR4) which encodes a hevein-like protein (Kidd et al., 2011). These defence genes
were induced quite strongly in the leaves (up to 40-fold for PDF1.2a) and are considered marker
genes for the jasmonate-associated defence response. In assessment of the root tissue we looked at
the expression of PDF1.2, PR1 and PR4, however we could not find strong induction of
pathogenesis- or defence-related genes in the root microarray. Accordingly, a large number of JA-
associated genes were also up-regulated in the leaf microarray experiment along with other JA
inducible pathways such as the tryptophan pathway (Kidd et al., 2011). The metabolism of
41
tryptophan leads to the production the hormone auxin and glucosinolates. Auxin signalling has
been shown to have a role in F. oxysporum resistance (Kidd et al., 2011), but a role for
glucosinolates has not been conclusively shown. In our root microarray experiment, the highest
expressing gene encoded an oxidoreductase known as JASMONATE REGULATED GENE 21 which
was induced approximately 2-fold (Table 2.4). We also found the JAZ8 gene, encoding the
JASMONATE ZIM DOMAIN8 protein which acts as a repressor of JA-associated transcription
factors, to be induced in the microarray. However, we could not confirm this result using RT-qPCR.
When we looked at the significantly expressed genes that were below the 1.5-fold cut-off we also
found the JAZ1 repressor (At1g19180) as well as a plant defensin family member (At4g22214).
Therefore, while some JA-related genes and a defensin appear to be expressed in the roots,
pathogenesis-related proteins were not highly induced in the root microarray in response to F.
oxysporum infection.
We also compared our root microarray with the results published from the microarray produced by
Zhu et al. (2013) . In the study by Zhu et al. (2013), they found more induced genes than down-
regulated genes in the first day-post inoculation (1 DPI) and also 6 DPI. This finding is similar to
the Kidd et al. (2011) study, in which the number of induced genes was greater than the repressed
genes. In the Zhu et al. (2013) study, they found that defence related genes were induced at 1 DPI
and continued to be induced at 6 DPI. They also showed that a U-box gene (PUB23) was
significantly upregulated in their microarray. PUB23 is negative regulator of the PAMP response,
and this result suggests that F. oxysporum might induce negative regulators of the plant immune
system to manipulate plant immune responses. A comparison between the differentially expressed
genes in the Zhu et al. (2013) microarray experiment and our microarray revealed no genes in
common. There are three possible explantions. Firstly, the plant tissue samples were obtained in a
different manner; our microarray only contained root samples, whereas the microarray produced in
the study by Zhu et al. (2013) was produced using whole seedlings. The use of whole seedlings
may be dominated by the gene expression in the shoot and therefore would possibly mask the root
gene expression. This may explain why Zhu et al. (2013) also found predominantly induced genes
similar to the study by Kidd et al. (2011) where only shoot tissue was used. Secondly, our plants
grew on soil until we obtained tissue samples. In the study by Zhu et al. (2013), the plants were
grown on MS agar, hence growth conditions were quite different. The difference in growth
conditions may potentially alter plant gene expression against F. oxysporum invasion. Lastly, we
used different time points which would also influence gene expression. Therefore it may not be
surprising that there was little in common between these two microarray experiments.
42
To gain insight into function of the differentially expressed genes from our microarray, we then
performed gene ontology (GO) term enrichment analysis (http://bioinfo.cau.edu.cn/agriGO) for the
induced and repressed genes. Indeed, “response to stimulus” and “response to stress” were
significantly enriched. This result indicated that Arabidopsis roots were able to detect F. oxysporum
infection and make a transcriptional response at the root region. In addition, we found that some GO
terms, which relate to secondary metabolism, were enriched at repressed gene clusters. Fungal
infection might influence and alter plant secondary metabolism, however, these genes which
involve secondary metabolism were related to different light spectrum responses, such as red light.
They were not significantly related to any defence mechanism, thus the results will not be shown in
this thesis.
2.3.3 Genevestigator analysis
In our microarray study, the relative absence of defence gene activation in the root array was
surprising and we wished to investigate further the types of genes that were induced by comparing
our microarray gene lists with publically available microarray data such as that published by
Zimmermann et al. (2005) to determine what other stimuli might affect the genes that appeared to
be induced in our study; Figures 3-4). The Genevestigator dataset is included with both roots and
shoots. We analysed 14 of the up-regulated genes from our root array and found the genes could be
clustered into two different groups based on their expression pattern: the first cluster of genes
(AT3G44860, AT5G19110, AT2G38240, AT3G55970, AT1G30135) had been reported to be
induced by methyl jasmonate, Pseudomonas syringae inoculation and/or other abiotic treatments
such as salt and heat treatment (Figure 2.2). Whereas the second cluster of genes (AT3G30740,
AT5G26070, AT1G61080, AT1G04270, AT2G39460, AT3G62760, AT2G27710, AT2G36080 and
AT4G22610)) had been reported to have responded highly to any treatment most likely because
they were all reported to be ribosome related genes (Figure 2.2). These results suggest that F.
oxysporum activates the expression of JA and P. syringae-inducible genes in the roots as well as a
second cluster which is not overly responsive to other stimuli in the Genevestigator treatment set.
We next investigated the genes down-regulated by F. oxysporum with publically available
microarray data. Although the down-regulated genes were affected by a number of treatments, we
found the majority of the F. oxysporum down-regulated genes to be repressed in response to
flagellin as well as treatment with P. syringae and syringolin (Figure 2.3). Similarly to F.
oxysporum, P. syringae is considered a hemi-biotroph and both pathogens hijack the JA pathway to
promote disease susceptibility in the plant (Feys et al., 1994; Block et al., 2005; Laurie-Berry et al.,
43
2006; Thatcher et al., 2009). Therefore it is interesting that the genes that were repressed in the F.
oxysporum-infected root microarray were also repressed in response to P. syringae infection (Figure
2.4). This suggests that both F. oxysporum and P. syringae are able to evoke similar patterns of
gene expression. In addition, as the genes that were repressed by F. oxysporum were also
suppressed in response to FLG22 treatment (Figure 2.4) this suggests that genes that are switched
off during the response to FLG22 may also be suppressed in the roots during F. oxysporum
infection. However we did not find co-expression of FLG22-induced genes when comparing the F.
oxysporum-induced genes in Genevestigator (Zimmermann et al., 2005).
Figure 2.2. : Co-regulation of F. oxysporum-induced Arabidopsis root genes.
Shown is a heat map with different intensity Arabidopsis gene expression of various other
treatments for the genes that were identified in this study to be induced in F. oxysporum-infected
roots. Red = induced, green = repressed gene expression; data were extracted from Genevestigator
(Zimmermann et al., 2005).
44
Figure 2.3. : Co-regulation of F. oxysporum-repressed Arabidopsis root genes.
Shown is a heat map with different intensity gene expression of FLG22-treated Arabidopsis plants
for the genes that were identified in this study to be repressed in F. oxysporum-infected roots. Red
= induced, green = repressed gene expression; data were extracted from Genevestigator
(Zimmermann et al., 2005).
45
Figure 2.4. : Co-regulation of F. oxysporum-repressed Arabidopsis root genes.
Shown is a heat map with different intensity gene expression of P. syringae-treated Arabidopsis
plants for the genes that were identified in this study to be repressed in F. oxysporum-infected roots.
Red = induced, green = repressed gene expression; data were extracted from Genevestigator
(Zimmermann et al., 2005).
2.3.4 Modulation of F. oxysporum repressed genes leads to increased resistance
To test whether the genes identified from our microarray study play a role in defence against F.
oxysporum, we obtained T-DNA insertion mutants from TAIR for ten differentially expressed genes
and performed disease resistance assays with F. oxysporum. The majority of the insertion lines
showed no difference in F. oxysporum resistance (data not shown). However, one of the mutants
tested, erf72, which contains a T-DNA insertion in the AP2/ETHYLENE RESPONSE FACTOR72
gene, showed increased resistance to F. oxysporum (Figure 2.5).
46
Figure 2.5: Disease score for erf72 mutants and wild-type Arabidopsis plants.
The disease score represent the average proportion of symptomatic leaves per total leaves per plant.
Asterisk (*) indicates p-value < 0.05 according to Student’s T test; bars represent mean ±SE of
three independent replicates of 10 plants each.
2.4 Discussion:
In comparison to leaf-infecting pathogens there are relatively few studies of root pathogens due to
the difficulty in observing the infection process in an unobtrusive manner. The exploration of the
defence response in the leaves has provided vast insights into the main plant defence pathways that
are activated in response to a pathogen attack and more research is needed to fully understand plant
defence signalling in response to root-infecting pathogens.
F. oxysporum is a systemic pathogen that infects root tissue and travels through the root vasculature
to cause disease in the stem and leaf tissue. Microarray analyses (Kidd et al., 2009; 2011; Zhu et al.,
2013) as well as a number of functional genomic-type analyses (Anderson et al., 2004; Berrocal-
Lobo and Molina, 2004; Diener and Ausubel, 2005; Thatcher et al., 2009) have been performed to
identify the signalling processes that are required for resistance against F. oxysporum in
Arabidopsis. However these studies have primarily focussed on the leaf tissue and it is possible that
the leaf may not be the ideal location for identifying resistance mechanisms against a root-infecting
pathogen. It has been shown that the JA co-receptor, COI1 is required for susceptibility to F.
oxysporum and the coi1 mutant shows almost complete resistance (Thatcher et al., 2009; Trusov et
47
al., 2009). In addition, other mutants deficient in JA-associated gene expression pathways such as
the myc2 and pft1 mutants are resistant to F. oxysporum (Anderson et al., 2004; Kidd et al., 2009).
These findings suggest that manipulation of the plant’s JA signalling pathway is required for
disease progression. Interestingly, grafting studies revealed that the resistance of coi1 depended
primarily on a coi1 mutant rootstock suggesting that coi1-dependent resistance occurs in the roots
(Thatcher et al., 2009). Furthermore, Bardi et al. (2008) found out that significant differences
occurred in the signalling compound-elicited expression profile of genes in roots vs those in leaves.
Both studies (Carvalhais et al., 2013; Bardi et al., 2008) show root exudate patterns upon JA and
SA treatment on the leaves, respectively. To examine the resistance response in the roots in more
detail, we undertook a microarray experiment of F. oxysporum-infected root samples collected at 48
hours after infection. This time point was chosen to be comparable with a previously conducted
microarray performed on the leaf tissue.
In contrast to the leaf microarray, the root array showed more down-regulated genes as opposed to
up-regulated genes. Also in contrast to the leaf array was the relative absence of defensin or
pathogenesis-related (PR) protein gene expression in the infected root tissue. In the root array, one
relatively uncharacterized defensin gene was expressed in infected roots but the expression was
below the 1.5 fold cut-off used for selecting differentially expressed genes. Dowd et al. (2004)
performed a microarray experiment on cotton infected with F. oxysporum. Interestingly, the authors
found similar results with gene repression also being more predominant than induction in F.
oxysporum-infected cotton roots. Dowd et al. (2004) also found little change in defence-related
genes in the roots, however observed induced expression in the leaves, which is similar to the
findings of our Arabidopsis leaf and root microarrays (Table 2.3;Table 2.4; Kidd et al., 2011).
These observations possibly suggest that gene repression in the root tissue by F. oxysporum
infection may contribute to the susceptibility of the infected plant. The comparison of differentially
expressed genes between our root microarray and the F. oxysporum leaf microarray showed only
three genes in common between these two microarrays. While we cannot rule out differences in the
types of arrays that were used affecting the results, our results indicate that gene expression changes
that occur in response to F. oxysporum infection are different in the root and leaf tissue. In support
of our results, Attard et al. (2010) reported that the pattern of early defence mechanisms against
Phytophthora parasitica differs between roots and leaves in Arabidopsis. This is perhaps not
surprising for hemi-biotrophic pathogens such as F. oxysporum and P. parasitica, as the gene
expression changes that occur in the roots, may be prioritized to perception of the pathogen and
preventing penetration of the root tissue during the biotrophic stage, whereas the leaves may instead
be acting to limit symptom development as a result of the switch to the necrotrophic stage. In
48
support of this, Schlink (2010) also found that gene expression in the early biotrophic stages of
Phytophthora citricola infection were different compared to the later necrotic stages of infection in
Fagus sylvatica. Intriguingly, Balmer et al. (2013) pointed out that the fungal pathogen
Colletotrichum graminicola infecting roots provoked systemic resistance in the foliage more
efficiently than leaf infections, suggesting that roots have an enhanced capability to trigger a
systemic defence response in maize. However, Balmer et al. (2013) showed only a minor
transcriptional response in the roots using RT-qPCR and the antifungal defence response between
roots and shoots still needs to be explored in the future to gain a better view of plant defence
responses above and below ground.
From our microarray result, we found that ERF72 was down-regulated under F. oxysporum
infection at 48 h. The down-regulation of ERF72 by F. oxysporum might suggest that ERF72 is a
resistance associated gene and that down-regulation of this gene is a strategy employed by F.
oxsporum to reduce resistance in the host. However an erf72 mutant showed an increased
resistance response against F. oxysporum and therefore suggesting that the down-regulation of
ERF72 during infection is instead evidence of the host trying to mount a resistance response.
Ultimately the plant fails though as the down-regulation of ERF72 is either too late or insufficient to
ward off the pathogen in time to suppress disease spread. Ogawa et al. (2005) suggest that ERF72
potentially induces the JA pathway as JA pathway marker gene PDF1.2 was induced in ERF72-
over-expressing plants. Over-expression of ERF72 also down-regulates ROS production and
programmed cell death. Therefore, we hypothesised that erf72 plants will down regulate aspects of
the JA pathway and induce ROS and programmed cell death. These three elements might assist the
plant to increase resistance against F. oxysporum. These hypotheses are explored in more detail in
the following chapter.
49
3 Chapter III: Investigation into the role of ERF72
in F. oxysporum susceptibility
50
3.1 Introduction of the AP2/ERF family and ERF72:
ERF72 (encoding Ethylene Response Factor 72, At3g13770) showed a significant reduction in
expression in the microarray experiment when plants were challenged with F. oxysporum and also
the mutant erf72 showed a significant resistant phenotype against F. oxysporum compared with the
wild-type (see Figure 2.5). ERF72 is one of several AP2/ERF (APETALA2/Ethylene Responsive
Element Binding Protein) TFs in Arabidopsis. The AP2/ERF proteinfamily is a group of TFs that
possesses a DNA-binding domain that consists of about 60-70 conserved amino acids (Ito et al.,
2006). Irish and Sussex (1990) were first to identify the AP2 domain through characterizing
mutants in Arabidopsis. The ERF domain was first identified in tobacco (Nicotiana tabacum) and it
was reported to bind to a specific GCC box, which is a DNA sequence involved in the promoters of
ethylene responsive genes (Ohme-Takagi and Shinshi, 1995).
Sakuma et al. (2002) have reported that the Arabidopsis genome has 145 genes coding for
AP2/ERF-related proteins. This gene family can be divided into subfamilies. These are the ERF
subfamily consists of a single AP2/ERF domain and another one is the AP2 subfamily which has
two AP2 domains (Shigyo et al., 2006). Most genes in the ERF subfamily are involved in signal
transduction pathways responding to abiotic and biotic stress (Riechmann and Meyeroitz, 1998).
ERF TFs can mediate the response to pathogen infection (Schenk et al., 2000), ethylene (Fujimoto
et al., 2000), ABA (Finkelstein et al., 1998) and abiotic stress such as cold, dry and salt (Stockinger
et al., 1997; Finkelstein et al., 1998; Park et al., 2001). It is also known that ERFs can act as either
an activator or repressor of transcription.
Nakano et al. (2006) have classified all the ERF TFs in Arabidopsis and clustered them into
different groups. ERF72 has been classified in group VII. A characteristic feature of this group is a
MCGGAI(I/L) motif referred to as CMVII-1. Two additional motifs, CMVII-2 and CMVII-3, were
also identified. All the TFs in this group have a single intron in the 5’-flanking region of the
AP2/ERF domain. ERF72 was the first TF identified in this group.
ERF72 expression is inducible by exogenous ethylene in wild-type plants and ERF72 transcript
abundance is greater in the ctr1-1 mutant, in which ethylene-regulated signal pathways are
constitutively activated (Buttner et al., 1997). Pan et al. (2001) suggested that ERF72 can function
51
as a dominant suppressor of Bcl-2-associated X protein (Bax)-induced cell death in yeast. Bax
forms channels in the outer membrane of the mitochondrion and triggers the release of cytochrome
C, which activates a series of caspases, initiating a cascade of protease activation. In addition,
Ogawa et al. (2005) found out that ERF72 confers resistance to Bax-induced cell death in tobacco
plants and resistance treatments such as H2O2 and heat in plant cells. It is also suggested that ERF72
causes the up-regulation of defence genes and the up-regulation of GST6, which is related to ROS
metabolism. GST6 is a H2O2- and salicylic acid-inducible glutathione S-transferase . Chen and
Singh (1999) showed that the GST6 promoter had a high induction in roots following H2O2
treatment. Therefore, ERF72 is considered to antagonize cell death. Ogawa et al. (2005) suggested
that ERF72 may be located downstream of EIN2 and CTR1, and most likely under EIN3.
Other ERF genes which belong to group VII have been studied in the literature. Park et al. (2011)
investigated ERF71 and suggested that this TF mediates osmotic stress such as hypoxia response in
Arabidopsis. Hess et al. (2011) have pointed out that ERF73 gene expression positively regulates
alcohol dehydrogenase (ADH) activity, which was analysed as a marker enzyme for metabolic
adaptation to hypoxic stress. ERF73 was also found to increase the response to ethylene signalling
in Arabidopsis roots. ERF74 and ERF75, also known as RAP2.2 (related to AP2 2), were found to
have dual roles in Botrytis cinerea resistance and as a positive regulator of hypoxia tolerance (Zhao
et al., 2012). Therefore, it is intriguing to investigate how an erf72 mutant shows resistance against
F. oxysporum.
3.2 Methods:
3.2.1 RT- qPCR conditions
All RT-qPCR experiments have been done on 384 well plates using epMotion automated pipetting
(Eppendorf epMotion 5075, Eppendorf). The 10 µL reactions consisted of 5 µL SYBR Green
master mix reagent (Applied Biosystems), 2 µL primer mixture (forward and reverse, 3 µM) and 3
µL cDNA (1 µg/uL) were used. Real-time quantitative PCR was performed with ABI PRISM 7900
sequence Detection System (SDS) (Applied Biosystems) using SYBR Green to monitor real-time
synthesis of double-stranded DNA. The following thermal cycles were applied; Stage 1: 50°C 2 min,
Stage 2: 95°C 10 min, Stage 3: 45 cycles of 95°C 15 sec and 60°C 1 min, Stage 4: one cycle of
95°C 2 min, 60°C 15 sec, 95°C 15 sec.
52
3.2.2 RT-qPCR experiment for methyl jasmonate and salicylic acid treatment
Methyl jasmonate (MeJA) was applied to a sample of cotton wool (approximately a thumb size) to
reach a final concentration of 4 µM/L of air when the cotton wool was placed inside a 20 L sealed
dome, and MeJA was volatilised in the air. The growth condition of Arabidopsis mutants remained
the same as detailed in the previous chapter. Leaf tissues were collected after 6 hours for gene
expression studies.
RT-qPCR analysis for salicylic acid treated plants were performed by spraying the plants with
salicylic acid (SA) with a concentration of 100 µM. The growth condition remained the same as in
the previous chapter. Leaf tissues were collected at 24 hours after spraying. The time points were
chosen based on their optimal induction of marker genes based on previous studies within the
laboratory and have been previously published (Schenk et al., 2000).
3.2.3 F. oxysporum inoculation and plate assay for gene expression
Arabidopsis thaliana (wild type, Col-0) was used for F. oxysporum inoculation assays. Arabidopsis
seeds were sterilized in 70% (v/v) ethanol for 2 min and then 2% (v/v) of bleach for 10 min,
followed by rinsing five times in sterilized water. Surface-sterilized seeds were planted on Petri
dishes containing 100 mL of Murashige-Skoog (MS) agar supplemented with 1% (w/v) of sucrose
and kept for 2 days at 4oC. The Petri dishes were then transferred to a growth cabinet with a
constant temperature of 22oC and a 16 hour light/ 8 hour dark time regime. Two-week-old seedlings
were used for F. oxysporum inoculations. Plants were inoculated with F. oxysporum as described by
Edgar et al., (2006). Briefly, at 1 h after the start of the photoperiod (t = 0 h) the plants were gently
uprooted and dipped for 15 s in fungal spore suspension with a concentration of 106 spores/mL in
water and then replanted. Mock plants were dipped in water and replanted. Root tissues were
harvested at specific hours after inoculation (three independent biological replicates with pools of
40 plants each). Once the root samples were harvested, the root tissue was snap-frozen in liquid
nitrogen. Additional experiments (three independent biological replicates with pools of 40 plants
each) were carried out for the F. oxysporum RT-qPCR analyses.
53
3.2.4 Quantification of bacterial growth (P. syringae) in Arabidopsis
The bacteria were prepared 3 days before the inoculation procedure. Pseudomonas syringae
DC3000 was incubated for 2 days at 28°C. In the morning of the day before inoculation, a spreader
was used to distribute a generous sample of growing bacteria over a fresh plate to obtain a lawn for
the following day. On the day of inoculation, 10 mL of 10 mM MgCl2 was added to the plate, after
waiting for 10 min and then pipetting the suspension out of the plate. After measuring the
concentration at OD600, it was adjusted to OD600 of 0.05 (~1-2.5x107 bacteria) by using the blank 10
mM MgCl2 solution. Four to five–week-old plants were inoculated in the morning when stomata
were open. The petioles of the leaves that were inoculated were labelled with a permanent marker,
this included a mock treated plant as a control (10 mM MgCl2). At the point of inoculation on the
abaxial leaf surface a 1 mL syringe (no needle) was used to infiltrate with 10 µL of the bacterial
suspension into each leaf. This was accomplished while pressing with a finger against the syringe
tip on the adaxial side. Four leaves were inoculated on each plant. After inoculation, the plants were
moved to the growth chamber and covered with a transparent lid. Samples for day 0 were taken 1 h
after inoculation. This was followed by collecting three replicates/time point and four
leaves/replicate, and for each replicate, four leaves were transferred to an Eppendorf tube. Once in
the Eppendorf tube, 1 mL of 10 mM MgCl2 solution was added and tissues were ground by hand
using a plastic pestle. Ten-fold serial dilutions were prepared (180 µL MgCl2 + 20 µL sample) by
adding sterile water then plated (20 µL of each) onto KB plates with the appropriate antibiotics,
rifampcin 50. The composition of KB medium (per litre) consisted of: 10 g of Bacto-tryptone, 10 g
of Bacto-peptone, 1.5 g of K2HPO4, 3.08 g of MgSO4.7H2O, and 15 g of agar, then the pH was
adjusted to 7.2. The dilution rate at which the number of colonies in the range of 1-20 colonies per
plate after 40 h of incubation at 28°C, was used to calculate the colony forming units (cfu) as a
disease score.
3.2.5 Jasmonate root inhibition
Four different types of MS media plates (4.43 g of MS salt from PhytoTechnology Laboratories ®,
1% of sucrose in 1 litre of distilled water and with the pH adjusted to 5.8, followed by adding 15 g
of agar from SIGMA) were made (plain, ethanol control, 5 µM and 10 µM). A concentrated stock
of MeJA was prepared by adding 11.8 µL of MeJA in 500 µL ethanol (100%). Each type of MS
medium was used for 8 plates. For the ethanol control plate, 20 µL of 100% ethanol was added into
200 mL of MS agar. For the 10 µM MeJA MS plate, 20 µL of MeJA (100 mM) was added to 200
mL of agar. The 5 µM MeJA MS plate should have 10 µL of MeJA (100 mM) and 10 µL of ethanol
54
was added into 200 mL of agar. For each plate, the wild-type and mutant seeds were sterilized and
planted on MS agar and stored at 4oC for two days for stratification. After stratification, the MS
plates were placed vertically into the growth chamber and the root lengths were measured after 10
days.
3.2.6 Phytophthora cinnamomi inoculation
P. cinnamomi was obtained from Dr. Christopher O’Brien from the Department of Employment,
Economic Development and Innovation (DEEDI) - and maintained on 20% V8 juice agar as
described by Miller (1995) with the isolate subcultured every two weeks. Wheat seeds were
sterilized and cultured with P. cinnamomi until the wheat seeds were completely infected. The three
weeks-old Arabidopsis plants were transferred to a new tray containing 30 wells. P. cinnamomi
infected wheat seeds were added to each well by making two holes in it and three infected seed
were added to each hole before the Arabidopsis plant was planted. After two weeks post
inoculation, the plants were collected to measure the rosette diameter and compared with mock
infected plants.
3.2.7 Quantification of F. oxysporum levels in erf72
erf72 DNA extraction was performed by using the CTAB buffer. 500 µL of CTAB buffer was
added into leaf ground powder. The CTAB/plant extract mixture was incubated about 15 min at
55°C in a heat block. After incubation, the extraction mixture was spun at 12,000xg for 5 min to
spin down cell debris and the supernatant was transferred to clean microfuge tubes. Approximately
½ volume of chloroform:isoamyl alcohol (24:1) was added. After mixing, tubes were spun at
12000xg for 1 min and the upper aqueous phase was carefully transferred to clean tubes. To each
tube, 1/10 volume of 7.5 M ammonium acetate was added followed by 1 volume of ice cold
absolute ethanol. The tube was mixed and placed at -20°C overnight. Following precipitation, DNA
was washed twice by two changes of ice cold 70% ethanol. The pellet was resuspended in 50 µl
water. The quantification of F. oxysporum level PCR was used the same condition as RT-qPCR
condition. The sequences of primers used in this experiment were detailed in table below.
55
Composition of CTAB buffer (100 mL):
2 g CTAB (hexadecyl trimethyl ammonium bromide)
10 mL 1 M Tris pH 8.0
4 mL 0.5 M EDTA pH 8.0
28 mL 5 M NaCl
2 mL β-Mercaptoethanol (optional)
56 mL H2O
1 g PVP40 adjusted all to pH5.0 with HCl
Table 3.1:Primer list for quantification of F. oxysporum level
Primer
Name
Forward sequence Reverse sequence
iASK CTTATCGGATTTCTCTATGTTTGC GAGCTCCTGTTTATTTAACTTGTACATACC
GPD AAGGGTGCTTCTTACGACCA ATCGGAGGAGACAACATCGT
3.2.8 H2O2 quantification
Hydrogen peroxide quantity was measured according to the method of Joo et al. (2005). A total of
30 mg of liquid nitrogen-ground plant sample was extracted in 1 mL Tris-HCl buffer (10 mM,
pH7.3). The homogenate was centrifuged at 13,000 rpm for 5 min at 4°C. The supernatant was
taken and centrifuged again under the same conditions. H2O2 was detected using the dye 2’,7’-
dichlorofluorescein diacetate (H2DCFDA). This indicator is a cell permeable non-fluorescent probe,
but it switches to high fluorescence during oxidation. The H2DCFDA stain is taken up by cells
where non-specific cellular esterases act upon it to cleave off the lipophilic groups, resulting in a
charged compound believed to be trapped inside the cell. Oxidation of H2DCFDA by H2O2 converts
the molecule to 2’,7’ dichlorodihydrofluorescein (DCF), which is highly fluorescent. (Eruslanov &
Kusmartsev, 2010). The assay mixture contained 20 µM H2DCFDA final concentration (a stock of
100 mM in DMSO was prepared) and 100 µL extract. The volume was prepared to 250 µL with 10
mM Tris-HCl buffer (pH7.3). In parallel with each sample, catalase (300 unit/mL, Sigma) was
added to subtract, which accelerate the ROS reaction. The fluorescence was measured at 40 min
after H2DCFDA addition using a fluorometer (Fluoroskan Ascent).
56
3.2.9 F. oxysporum GUS histochemical assay
The GUS-expressing F. oxysporum, which is F. oxysporum transformed with a constitutive β-
glucuronidase over-expressing construct, was obtained from Dr. Ming Bo Wang’s laboratory at
CSIRO (Schumann et al., 2013). The plants were inoculated with F. oxysporum GUS spores at a
concentration of 1 million spores/mL. The plant root tissue was cleared with 100% ethanol after 14
days post inoculation. The roots were incubated at 37°C in staining solution overnight. The staining
solution included 2 mM X-Gluc (5-Bromo-4-chloro-3-inoyl β-D-glucuronide cyclohexylammonium
salt in dimethyl formamide), 0.1% Triton, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6.3H2O, 10 mM
EDTA and 50 mM K or (Na) PO4 buffer pH7.0. Following X-Gluc incubation, the root tissue was
de-stained with 100% ethanol for 5 minutes and cleaned with fresh desterilized water. The tissue
slide was observed under a compound microscope (Olympus).
3.3 Results:
3.3.1 erf72 treated with defence hormones
To examine how the erf72 mutant may be providing resistance to F. oxysporum, relative to the WT
Col-0, we looked at how defence genes may be altered in the erf72 mutant. The expression of a
number of JA- and SA-associated marker genes after treatment with either JA or SA, respectively,
was examined. Both experiments used leaf tissues examine gene expression, as previous results
have found that leaves respond better to hormone treatment and allow for the potential detection of
small differences between the mutant and the WT (unpublished results). RT-qPCR experiments
showed no significant change in the expression of SA-associated PATHOGENESIS RELATED
genes; PR1, PR2 and PR5, or the JA-associated defence genes PDF1.2 and PR4 in the erf72 mutant
(Figure 3.1). Interestingly however, the expression of the BASIC CHITINASE (CHI-B) gene,
otherwise known as PR3, showed increased expression in the erf72 mutant under both mock and JA
treated conditions (Figure 3.1) The heightened expression of CHI-B could potentially contribute to
the increased resistance of the erf72 mutant to F. oxysporum.
57
Figure 3.1A-F: Different relative abundance for WT/erf72 JA and SA treatment
Shown are RT-qPCR data from three independent biological replicates, each containing a pool of
30 plants. Asterisk (*) indicates p-value < 0.05 according to Student’s T test; bars represent mean
±SE.
A B
C D
E F
58
3.3.2 The erf72 mutant is not affected in resistance against other plant pathogens
As the erf72 mutant showed increased resistance against F. oxysporum relative to the WT, we
decided to examine its role in plant defence against other pathogens. We inoculated erf72 with two
leaf pathogens and another root pathogen to determine whether the defensive function of erf72 has a
role against other plant pathogens. Firstly, erf72 leaves and wild-type leaves were treated with A.
brassicicola spores and lesions were examined 3 days after treatment (Campbell et al., 2003).
Unfortunately, the infection of A. brassicicola failed and symptoms were not produced for either the
erf72 mutant or the wild-type. We also examined erf72 with P. cinnamomi comparing to wild-type
plants (Figure 3.2).
Figure 3.2: P. cinnamomi treatment of erf72 and WT Arabidopsis plants
The first two rows were WT plants and were inoculated with P. cinnamomi. The 3rd
and 4th
rows
were erf72 inoculated with P. cinnamomi. The last row was separated into 2 parts- left was the
mock control with WT, and on the right was the mock-treated control with erf72.
We measured the diameter of infected erf72 and wild-type plants, the result is shown below:
59
Figure 3.3 (A-B): erf72 mutant disease score under P. cinnamomi treatment
(A) The disease assay of P. cinnamomi with wild-type and erf72. The y-axis indicates rosette
diameters. The result shown is from three independent biological replicates, each containing a pool
of 30 plants (B). The figure shows the percentage of reduced growth in WT and erf72.
Figure 3.3(A) shows that erf72 has a larger rosette diameter compared to WT. Figure 3.3 (A) shows
that there is 85% growth in WT and 88% in erf72. However, the result is hard to compare between
WT and erf72. Figure 3.3 (B) shows that there is no significant difference between WT and erf72.
Therefore, erf72 has no change in resistance to P. cinnamomi relative to the WT (Col-0).
We also tested erf72 with the bacterial pathogen, Pseudomonas syringae. We infected Arabidopsis
leaves and then extracted the bacteria from the leaves and plated the leaf solution in serial dilutions
to count the bacterial titre within the leaf (Figure 3.4).
According to Figure 3.4, the P. syringae colonies showed obvious growth day by day on both wild
type and erf72 leaves. Unfortunately a significant difference between wild-type and erf72 mutant
could not be found. Therefore altering erf72 might not have a role in defending against these
pathogens. Further repetition is necessary to determine whether there is a real difference by day
three of growth of P. syringae in the erf72 mutant.
A B
60
Figure 3.4(A-B): erf72 inoculated with P. syringae and disease score
(A) 4 weeks-old erf72 plants inoculated with P. syringae. The leaves showing lesions by P.
syringae were obtained for analysis. (B) 3 biological replicate samples were obtained post
inoculation on day 1, 2 and 3. Each replicate had 10 leaves.
3.3.3 The root JA inhibtion assay
Previously, its been found that Arabidopsis mutants that have a reduced sensitivity to JA, are
resistant to F. oxysporum (Kidd et al., 2009; Thatcher et al., 2009). Therefore we treated erf72
plants with MeJA (5 µM) to investigate whether the root length will be suppressed by MeJA. Our
result indicates that there was no significant difference between the root lengths of wild-type and
erf72 after MeJA treatment. Therefore it is unlikely that the erf72 mutant is insensitive to JA
(Figure 3.5).
Figure 3.5: erf72 mutants showed no difference on JA root inhibition
Bars represent mean root lengths ±SE of three independent replicates of 10 plants each.
A B
61
3.3.4 erf72 gene expression at different time points
We treated erf72 with F. oxysporum at different time points, and we expected to investigate certain
marker gene expression changes through various time points. We set the time points for 1 h to
measure very early responses and 24 h to capture intermediate responses compared to the
microarray which was at 48 h. We selected genes which were related to ROS and the JA-pathway.
Ogawa et al. (2005) indicated that ERF72 has role in ROS and the JA pathway; therefore we
selected 20 candidate genes that relate to both, ROS and the JA pathway.
Glutathione S-transferase (GST) 6 was up-regulated in ERF72-over-expressing plants according to
the literature (Ogawa et al., 2005). It is obvious to see that GST6 was down-regulated when ERF72
was knocked down. However, it did not show much difference in the F. oxysporum treatment.
Interestingly, OXI1 and MAPK6 showed a significant lack of induction in the erf72 plants relative to
the WT in response to F. oxysporum treatment (Figure 3.6). OXI1 is a positive regulator for ROS
production and it is required for full activation from both MAPK3 and MAPK6 after strong
induction by H2O2. According to the real time PCR result (Figure 3.6), it might suggest that F.
oxysporum induces some H2O2 production in wild-type roots, but erf72 blocked OXI1 induction and
potentially blocked H2O2 production. The suppression of OXI1 might lead to less ROS production
and potentially less stress from F. oxysporum infection and therefore leads to greater resistance
through enhanced stress tolerance. This hypotheses is investigated in section 3.3.7. It was
interesting to find that MAPK6 was also down-regulated in the erf72 line after F. oxysporum
treatment. MAPK6 is involved in the PAMP response, so it might suggest that PAMP signalling
and ROS responses are altered in the erf72 mutant.
We also looked at the expression of other genes relating to the JA and ET pathways such as VSP2
and WRKY70, however we could not find much difference between these key marker genes.
However, AOS (Allene Oxide Synthase) showed a significant difference in expression in erf72
during F. oxysporum infection. At the 1 h time point, AOS showed a lack of induction in erf72 roots
in response to F. oxysporum infection (Figure 3.6), as a result of this, JA levels might be lower in
erf72. The JA pathway is known to be induced by F. oxysporum and is required for disease
progression. The failure of AOS to be induced by F. oxysporum by erf72 may be evidence of a
failure to up-regulate this pathway in the resistant erf72 mutant. Further work is needed to
determine how this result may be occurring.
62
We also did RT-qPCR for erf72 leaves at the 24 h time point; however, we did not find any gene
expression that had a significant difference at this time point with the genes we looked at in the
roots. This might suggest that roots and shoots act differently during fungal invasion.
Figure 3.6(A-E): Gene expression in the WT and erf72 at 1 h post inoculation with F.
oxysporum.
Shown are RT-qPCR data from three independent biological replicates, each containing a pool of
30 plants. Asterisk (*) indicates p-value < 0.05 according to Student’s T test; bars represent mean
±SE.
A B
C D
E
63
3.3.5 Quantification of F. oxysporum levels in erf72
It is possible that the resistance of erf72 to F. oxysporum infection is due to a reduction of growth in
planta. To determine whether erf72 can suppress F. oxysporum growth, we infected both wild-type
and erf72 and obtained the leaf tissues at two different time points and performed real-time PCR to
quantify pathogen biomass. We compared the relative abundance of F. oxysporum DNA to
Arabidopsis DNA using the F. oxysporum GPD gene against the Arabidopsis iAsk gene (Gachon &
Sainderan, 2004). GPD is a fungal specific gene, and these specific primers are able to amplify
fungal DNA inside of the plant. iAsk provides specific primers for Arabidopsis. Comparing these
two genes allows us to determine the quantity of fungus relative to Arabidopsis DNA.
The gene expression showed no difference between wild-type plant and erf72 plants in both time
points (Figure 3.7). Therefore erf72 contained the same amount of fungal DNA compared to wild-
type plants.
Figure 3.7: Expression of a universal fungal gene (GPD) analysed by real time PCR
Soil grown 4 weeks-old Arabidopsis seedlings (WT and erf72) were inoculated with F. oxysporum.
The samples were obtained at the 8th
day and the 12th
day after infection. Three biological replicates
were collected and each replicate had 30 seedlings.
3.3.6 Comparison between wild-type and erf72 using F. oxysporum expressing GUS
We used GPD to quantify F. oxysporum in wild-type and erf72. We wanted to use other methods to
confirm the result of GPD quantification, thus we used a F. oxysporum GUS-expressing line to
visualize fungus inside of plants. We obtained the F. oxysporum GUS line from CSIRO Canberra.
64
GUS is a reporter gene system and after x-Gluc staining the GUS enzyme activity can be visualized
as a blue colour.
Figure 3.8(A-F): GUS expression of F. oxysporum colonizing wild-type and erf72 Arabidopsis
roots
(A) Mock control of wild-type (Col-0) plant roots, (B) Mock control of erf72 roots, (C, E) F.
oxysporum expression in wild-type (Col-0) plant roots. (D,F) F. oxysporum expression in erf72
roots. The plants were examined at 24 h after inoculation with F. oxysporum GUS.
Figure 3.8 illustrates the comparison between wild-type and erf72 plant roots. Figure 3.8 (A) and
(B) are the mock controls for both wild-type and erf72, which showed no expression of the GUS
reporter gene. Figure 3.8 (C- F) shows the images of GUS expression in both, as a result, we could
see that GUS expression is relatively similar between wild-type and erf72. We did an expression
A
C D
E F
B
80um
m 200um
200um 200um
200um 200um
65
score by approximately calculating the percentage of expression from the overview of the whole
plant roots: there were around 7.75% infected tissue in wild-type and 7.2% in erf72. We observed
the whole roots, and then calculated the percentage of expression of whole roots. The result
suggests that erf72 consists of relatively the same amount of fungus inside of roots compared to
wild-type. Therefore, even though erf72 confers resistance against F. oxysporum, erf72 does not
reduce the quantity of fungus either internal or external by preventing fungus entering the roots.
3.3.7 Role of erf72 in ROS production
Ogawa et al. (2005) pointed out that ERF72 plays a role in regulating programmed cell death and
ROS production. However, the study did not investigate the role in ROS production further.
Therefore, we wish to investigate the role of ERF72 in ROS production and programmed cell death,
and whether ROS production plays a role in F. oxysporum infection. In order to measure ROS, we
tried several staining methods to measure hydrogen peroxide. We tried H2DCFDA to measure the
ROS production in both wild-type and erf72. In our result, we found that F. oxysporum suppressed
ROS production in both wild-type and erf72 (Figure 3.9). The production of ROS is much lower
than in the mock treatment. It might suggest that F. oxypsorum suppresses ROS production and this
may aid in successful infection of the plant.
Figure 3.9: H2DCFDA staining of erf72 and wild type Arabidopsis with and without F.
oxysporum treatment
Three biological replicates of 4 weeks old seedlings were collected, and each biological replicate
had 10 seedlings. The plant tissue was collected 1h after inoculation with F. oxsyporym. The Y-axis
indicates the fluorescence reading under a plate reader.
66
3.4 Discussion:
Through screening of T-DNA insertion mutants of genes differentially expressed in the microarray,
we were able to identify a role for ERF72 in susceptibility to F. oxysporum. ERF72 encodes an
AP2/ERF transcription factor that has been shown to suppress programmed cell death (Ogawa et
al., 2005). Expression of ERF72 could suppress cell death in both plants and yeast when induced by
the Bax protein, a pro-apoptotic protein from mammals (Pan et al., 2001; Ogawa et al., 2005).
Over-expression of ERF72 in plants leads to up-regulation of the PLANT DEFENSIN1.2 (PDF1.2)
gene and GLUTATHIONE S-TRANSFERASE6 (GST6) gene involved in plant defence and ROS
signalling (Ogawa et al., 2005). Our examination of the T-DNA insertion mutant showed no change
in PDF1.2 expression or in the expression of other JA- and SA-related defence genes. However it is
possible that these phenotypes could not be uncovered due to redundancy of the other ERF
transcription factors maintaining their expression. Interestingly, we found an increase in the
expression of the CHI-B gene under both mock and F. oxysprorum-treated conditions. This result is
intriguing, considering that over-expression of ERF72 was shown to activate transcription at
promoters containing the conserved GCC box (Ogawa et al., 2005). Therefore it is possible that the
constitutively increased expression of CHI-B in the erf72 mutant may be due to de-repression of a
repressor that represses CHI-B expression. While further investigation is required into the gene
expression network controlled by ERF72, the increased expression of genes such as CHI-B could
provide enhanced resistance to F. oxysporum. In addition, the expression of the AOS gene was
significantly repressed at 1 h and 6 h time points. The function of AOS lies in the biosynthesis of
jasmonic acid. According to Thatcher et al. (2009), F. oxysporum hijacks the JA pathway to
manipulate plant defence. A repression of AOS in erf72 might prevent the plant from producing
jasmonic acid; as a result of this the plant may have better resistance with less JA production.
Conflicting with these results is the finding that plants with reduced JA biosynthesis have no change
in disease symptom development (Thatcher et al., 2009). Therefore it may be unlikely that reducing
AOS expression would provide enhanced resistance in the erf72 line. Instead it may be an example
of F. oxysporum being less able to produce disease symptoms in the erf72 mutant. Furthermore, our
real-time PCR results showed genes encoding oxidative signal inducible 1 (OXI1) and MAP Kinase
6 (MAPK6) being significantly repressed at the 1 h time point during F. oxysporum infection. OXI1
is a positively regulator for ROS production, and activation of OXI1 is required for dual activation
of MAPK3 and MAPK6 (Rentel et al., 2004). Both, OXI1 and MAPK6, genes were significantly
repressed by F. oxysporum colonisation in erf72, but showed similar levels in the WT. Therefore
67
the role of ERF72 in ROS needs further study.. In our H2O2 measurement assay, we also showed
the result that F. oxysporum suppressed ROS production but could not find a difference between
erf72 and the WT. How does a suppression of ROS assist plants to protect against F. oxysporum?
What is the major role of ERF72 in ROS production? The major sign of symptom development in
F. oxysporum infected Arabidopsis plants is a chlorosis that starts in the vasculature of leaves and
spreads to the entire leaf. It is possible that ROS or perhaps redox changes could affect chloroplast
stability leading to chloroplast breakdown. Suppression of ROS production in the erf72 line may be
a reason for decreased symptoms despite similar colonisation levels of the mutant and WT. Ogawa
et al., (2005) suggested a role in suppressing programmed cell death and ROS in Arabidopsis. In
our study we found reduced expression of OXI1 in the mutant line. Therefore the role of erf72 in
maintaining ROS homeostasis needs to be explored further. Further experiments to investigate the
role of ERF72 in ROS production may also lead to a mechanism in suppressing symptom
development in response to F. oxysporum infection.
ETR1
CTR1
EIN2
EIN3
ERF1 ERF72
AOS
PDF1.2 GST6 MAPK6
OXI1
Figure 3.10. A model showing ERF72’s regulation of ROS and the JA pathway
Figure 3.10 illustrates a proposed ERF72 pathway based on our findings. ERF1 showed an
induction in the erf72 mutant, so ERF72 might suppress ERF1 in the ethylene pathway. A
significant suppression of AOS was found in the erf72 mutant after infection and AOS has been
68
referred to occupy an early position in the JA pathway. Hence ERF72 may induce AOS and
jasmonic acid production which may switch on JA defence genes such as PDF1.2 potentially in the
leaves (Kidd et al., 2011) and also defence related genes, such as GST6. ERF72 also plays a role in
ROS production. Based on our real-time PCR results, we found that ERF72 also induced MAPK6
and the activation of MAPK6 will switch on OXI1. OXI1 plays a central role in ROS; hence once
we knock down ERF72, the suppression of OXI1 might help plants to encounter less damage of
excess ROS production.
Further examination of the resistance phenotype in the erf72 mutant and other mutants from the
microarray experiment is therefore justified. Investigation of the F. oxysporum responsive genes
and their roles in pathogenesis may help uncover the strategies used by root microbes to suppress
host resistance and could provide useful tools to reduce losses in crop species to root associated
plant pathogens.
69
4 Chapter IV: PAMP response to F. oxysporum
infection
70
4.1 Introduction:
In Chapter I, PTI and the innate immune system have been reviewed, however, the majority of
studies focus on resistance against bacterial pathogens (Wang et al., 2009; Kim et a.,l 2005; Li et
al,. 2005; Thilmony et al., 2006; Truman et al., 2006). PTI plays an important role in bacterial and
fungal pathogen defence, so what is known about the role of PTIin fungal resistance?
There are some studies describing the role of PAMP triggered immune responses to fungal
pathogens. Zhang et al. (2013) identified a novel proteinaceous elicitor, called Sclerotinia Culture
Filtrate Elicitor 1 (SCFE1) from the necrotrophic fungus, Sclerotinia sclerotiorum that induces
typical PTI responses in Arabidopsis thaliana. Zhang et al.(2013) showed that SCFE1-triggered
immune responses engage a signalling pathway dependent on SUPPRESSOR OF BIR1-
1/EVERSHED (SOBIR1/EVR). The presence of an elicitor in S. sclerotiorum evoking PAMP-
triggered immune responses and sensed by RLP30/SOBIR1/BAK1 demonstrates the relevance of
PAMP-triggered immunity in resistance to necrotrophic fungi. Bouwmeester et al. (2011) reveal
that lectin receptor kinase, LecRK-1.9 is a novel Phytophthora resistance component. Miya et al.
(2007) also suggests that, CERK 1, plays a critical role in fungal PAMP perception in plants.
CERK1, a receptor-like kinase, is essential for chitin elicitor signalling in Arabidopsis. Petutschnig
et al. (2014) also recently suggested that CERK1 might have a chitin-independent role in cell death
control and acts as an ectodomain shedding in plants. The KO mutant shows disease resistance
against Alternaria brassicicola. CERK1 also interacts with other LysM receptor-like kinase to
enhance immune system (Le et al., 2014; Narusaka et al., 2013 ; Wan et al., 2012). Le et al. (2014)
have revealed that the interaction between CERK1 and LysM RLK-1 interacting kinase 1(LIK1)
was confirmed by co-immunopreciptation using protoplasts and transgenic plants. lik1 mutant
plants showed an enhanced response to both chitin and flagellin elicitors. lik1 compared with wild-
type plants was more resistant to the hemibiotrophic pathogen, P. syringae, but more susceptible to
the necrotrophic pathogen, S. sclerotiorum. Le et al.(2014) also suggested that lik1 mutants showed
reduced expression of genes involved in the JA and ET signalling pathways. These studies suggest
that PAMP triggered immunity can play an essential role in fungal resistance, however, there are
limited studies investigating the role of PTI responses in F. oxypsorum resistance and therefore this
is an intriguing field to explore.
71
4.2 Methods:
4.2.1 Plant growth and growth conditions
Arabidopsis thaliana was used for all experiments. Arabidopsis seed was sterilised in 70% (v/v) of
ethanol for 2 min and then 2% (v/v) of bleach for 10 min, followed by rinsing five times in
sterilised water. Surface-sterilised seeds were planted on Petri dishes containing 100 mL of
Murashige-Skoog (MS) agar supplemented with 1% of sucrose and were kept for 2 days at 4oC. The
Petri dishes were then transferred to a growth cabinet with a constant temperature of 22oC and a 16
hours light/ 8 hours dark time.
4.2.2 T-DNA insertion lines
The pub22/23/24 triple mutant was obtained from Dr. Marco Trujillo. cerk1 (AT3G21630) was
obtained from Dr. Rebecca Lyons. The remaining mutants are SALK-T-DNA insertion lines and
were obtained from the Arabidopsis Biological Resource Center (ABRC;
http://www.Arabidopsis.org). These mutants include (). Salk_023199C (AT5G26920),
Salk_127158C (AT1G08720), Salk_093905C (AT5G46330), Salk_025399C (AT2G23770),
Salk_062314C (AT3G49110), Salk_152132C (AT3G49110), Salk_094655C (AT1G56570),
Salk_060002C (AT1G73080), Salk_125413C (AT2G27050), Salk_017221C (AT5G40350),
Salk_088968C (AT5G42223), Salk_002122C( AT1G29030), Salk_058127C (AT3G23150),
Salk_070738C (AT4G29080), Salk_140393C (AT2G43010), Salk_096892 (AT4G03550), pub22-
1/pub23-2/pub24-1 (AT3G52450/AT2G35930/AT3G11840), cerk1-1 (AT3G21630)
72
Table 4.1: SALK mutant list
TAIR locus ID Salk_number Insertion Homozygous Function
AT5G26920 Salk_023199C Exon YES Encodes a
calmodulin-binding
protein CBP60g
AT1G08720 Salk_127158C Exon YES Enhance disease
resistance 1 (EDR1)
confers resistance to
powdery mildew
disease
AT5G46330 Salk_093905C Exon YES Encodes a leucine-
rich repeat
serine/threonine
protein kinase that is
expressed
ubiquitously
AT2G23770 Salk_025399C Promoter YES Protein kinase
family
protein/peptidoglyca
n-binding LysM
domain-containing
protein
AT3G49110 Salk_062314C Intron YES Play a role in
generating H2O2
during defence
response
AT3G48090 Salk_152132C Exon YES Component of R
gene-mediated
disease resistance in
Arabidopsis
thaliana with
homology to
eukaryotic lipases
AT1G56570 Salk_094655C Promoter YES Defence against
necrotrophic fungi
and abiotic stress
tolerance
AT1G73080 Salk_060002C Promoter YES Functions as a
receptor for AtPep1
to amplify innate
immunity response
to pathogen attacks
AT2G27050 Salk_125413C Exon YES Ethylence-
insensitive3-like 1
AT5G40350 Salk_017221C Intron YES MYB24
transcription factor
AT5G42223 Salk_088968C Exon YES Encodes a defensin-
like family protein
AT1G29030 Salk_002122C Promoter YES Apoptosis inhibitory
protein 5
73
AT3G23150 Salk_058127C Exon YES Involved in ethylene
perception in
Arabidopsis
AT4G29080 Salk_070738C Promoter YES Phytochrome-
associated protein 2
AT2G43010 Salk_140393C Intron YES Isolated as a
semidominant
mutation defective
in red light response
AT4G03550 Salk_096892 Exon NO Encodes a callose
synthase that is
required for wound
and papillary callose
formation in
response to fungal
pathogens Erysiphe
and Blumeria
AT3G52450/AT2G35930/
AT3G11840
pub22-1/pub23-
2/pub24-1
Exon
Exon
Exon
YES Involved in the
response to water
stress and acts as a
negative regulator of
PAMP-triggered
immunity
AT3G21630 cerk1-1 Intron YES Involved in chitin-
mediated plant
innate immunity
The source is from TAIR (http://www.arabidopsis.org/)
4.2.3 Callose staining
Following treatment with F. oxysporum spores (106 spores/mL) for 24 h, 10 d-old seedlings grown
on MS media were fixed in a 3:1 ethanol:acetic acid (v:v) solution for 2 hours. The fixative was
changed 3 times to ensure both thorough fixing and clearing of the tissues, which is essential for
good callose detection in the roots. Seedlings were rehydrated in 70% ethanol for 2 h, 50% ethanol
for an additional 2 h, and water overnight. After two or three water washes, seedlings were treated
with 10% NaOH and placed at 37°C for 1 to 2 h to make the tissues transparent. After three or four
water washes, seedlings were incubated in 150 mM K2HPO4, pH 9.5, and 0.01% Aniline blue
(Sigma-Aldrich) for several hours. The roots were mounted on slides and callose was observed
immediately using a fluorescent microscope (Olympus BX60F5) under UV light (excitation, 390
nm; emission, 460 nm).
4.2.4 DAB staining
Detection of hydrogen peroxide was conducted using 3,3’-Diaminobenzidine (DAB) from Sigma-
Aldrich (Daudi et al., 2012). Briefly, plants were inoculated with F. oxysproum suspension and the
74
root tissues were collected and mixed with 1 mg/mL of the DAB liquid buffer solution with 30 µL
of DAB liquid chromogen. After staining, the plant tissues were rinsed with distilled water for 5
times and then observed under a microscope (Olympus BX60F5).
Results:
4.2.5 The pub22/23/24 triple mutant has increased resistance to F. oxysporum
While predominantly studied in the leaves, the PAMP response has recently been shown to be
active in the roots of Arabidopsis (Millet et al., 2010). Millet et al. (2010) used callose staining and
GUS-promoter constructs to show that the PAMP response is inducible in roots by a range of
elicitors. Similarly to the leaves, the root PAMP response can be effectively suppressed by the
application of P. syringae or the jasmonoyl-isoleucine analog, coronatine, suggesting a possible role
for JA in suppressing the root PAMP response (Millet et al., 2010). In addition, the root colonising
non-pathogenic fungus Piriformospora indica has recently been found to use JA signalling to
suppress the PAMP response to support greater colonisation (Jacobs et al., 2011). As F. oxysporum
is known to require JA signalling components to promote susceptibility and has been shown to
induce JA-associated gene expression in the roots and shoots (Kidd et al., 2009; Thatcher et al.,
2009; Table 2.3), we hypothesised that F. oxysporum may also suppress PAMP responses via the
JA pathway to allow greater infection.
To explore whether an enhanced PAMP response could provide increased resistance to F.
oxysporum¸ we inoculated the pub22/pub23/pub24 triple mutant which lacks the PUB22, PUB23
and PUB24 U-box type E3 ubiquitin ligases and has enhanced PAMP responses. The
pub22/pub23/pub24 triple mutant has been shown to display increased resistance to P. syringae and
the biotroph Hyaloperonospora arabidopsidis and also shows reduced colonisation by P. indica due
to a heightened PAMP response (Trujillo et al., 2008; Jacobs et al., 2011). We inoculated the
pub22/pub23/pub24 mutant with F. oxysporum and found that the triple mutant also possessed
increased resistance to F. oxysporum (Figure 4.1). This suggests that a heightened PAMP response
may provide increased protection against F. oxysporum infection.
75
Figure 4.1: Arabidopsis pub22/23/24 triple mutant plants showed increased resistance against
F. oxysporum.
The disease score represents the average proportion of symptomatic leaves per total leaves per
plant. Asterisk (*) indicates p-value < 0.05 according to Student’s T test; bars represent mean ±SE
of three independent replicates of 10 plants each.
4.2.6 Callose deposition is deteced at an early stage of F. oxysporum infection
To investigate the involvement of the PAMP response in F. oxysporum infection, we undertook
callose staining experiments to see whether F. oxysporum is detected by the plant and whether
callose is produced in response to infection. After inoculation with F. oxysporum, Arabidopsis
seedlings showed strong accumulation of fungal growth around the root tip regions as previously
identified (Czymmek et al., 2007; Kidd et al., 2011). However, despite large amounts of F.
oxysporum hyphae surrounding the root tissue, staining with aniline blue did not detect callose in
these regions (Figure 4.2A). However, in a limited number of instances we could see callose
formation in the root regions surrounding possible infection events (Figure 4.2B). This suggests that
callose may be induced in limited occurrences once infection has already taken place and that the
PAMP response is activated in the root during F. oxysporum infection. F. oxysporum has been
shown to effectively colonise the vascular tissue of Arabidopsis roots (Czymmek et al., 2007) and
therefore the PAMP response might be ineffective in preventing the penetration of F. oxysporum,
leading to extensive colonisation of the root vasculature and eventual collapse of the above ground
tissue. The activation of the PAMP response typically needs to be fast in order to successfully
contain pathogens. It is possible that F. oxysporum may have an immunosuppressive effect at an
76
early stage of infection or alternatively the infection is simply too fast for the plant to block
infection.
Figure 4.2(A-D): Detection of callose in F. oxysporum infected root tissue
(A) Fungus surrounding the outside of root tissue. (B) Infected root tip and lateral root, (C-D)
Uninfected roots. The white arrows pointed out callose formation during F. oxysporum infection.
4.2.7 ROS production in the roots
To analyse PAMP responses in the roots further, we performed DAB staining to detect local ROS
production in the root. However, the results did not show any significant difference under the
microscope. There are several reasons that may cause these results, firstly, the seedlings were
A B
C D
80um
m 80um
m
80um
m 80um
m
77
uprooted from the MS agar for inoculation and this might cause a strong ROS production due to
wounding, thus we cannot see any difference between the infected and uninfected tissue.
Figure 4.3(A-B): DAB staining of Arabidopsis thaliana roots
(A) Mock control root, (B) Root colonised by F. oxysporum, and it can be seen that the fungus
surrounds the outside of the root.
4.2.8 PAMP mutants investigation on F. oxysporum inoculation
In order to understand more about the role of the PAMP mechanism against F. oxysporum, we
ordered 17 mutants, which are related to PAMP triggered immunity, to see whether they are
resistant or susceptible to F. oxysporum. Our results showed that edr1-3, etr2, api5, and prx33
showed increased susceptibility to F. oxysporum (Figure 4.4). In addition, lyk4 showed increased
resistance to F. oxysporum relative to the WT Col-0. Peroxidase 33 (PRX33) is known to play a
role in generating H2O2 during the defence response. ETR2 is involved in ethylene perception in
Arabidopsis. Enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease
caused by the fungus Erysiphe cichoracearum. API5 is an apoptosis inhibitory protein 5 while
LYK4 is a lysine motif receptor-like kinase and is important for chitin signalling and plant innate
immunity in Arabidopsis.
A B
200um 200um
78
Figure 4.4: PAMP T-DNA insertion mutants and wild type Arabidopsis plants challenged by
F. oxysporum
The disease score represents the average proportion of symptomatic leaves per total leaves per
plant. Asterisk (*) indicates p-value < 0.05 according to Student’s T test; bars represent mean ±SE
of three independent replicates of 10 plants each.
4.3 Discussion:
Although there was little overlap between the leaf and root gene expression after F. oxysporum
infection, there was similarity in the types of genes being expressed between roots and shoots.
Comparisons with publically available microarray data showed that a subset of our induced genes
A B
C
79
were JA-responsive which is similar to what was found for the leaf microarray where a significant
proportion of the induced genes were JA-related (Kidd et al., 2011). Interestingly, the majority of
the genes that were suppressed by F. oxysporum infection in Arabidopsis roots were also
suppressed by FLG22 treatment, a peptide often used as an elicitor to analyse the plant PAMP
response. This result suggests that Arabidopsis is able to recognise F. oxysporum and may switch
off similar non-defensive pathways that are suppressed during a FLG22 response to co-ordinate a
successful defence response. However, we could not find co-activation of FLG22-induced genes in
our array experiment using Genevestigator comparisons and it is possible that F. oxysporum may be
suppressing genes associated with the root PAMP response as has been previously shown for P.
syringae strain DC3000 and P. indica on Arabidopsis roots (Millet et al., 2010; Jacobs et al., 2011).
To test whether we could increase resistance by boosting the host’s PAMP response, we inoculated
the pub22/23/24 triple mutant with F. oxysporum and found the triple mutant to be more resistant
compared to the WT. The PUB22/23/24 genes encode U-box type E3 ubiquitin ligases and act as
negative regulators of PAMP-triggered immune responses (Trujillo et al., 2008). Immune
responses activated in the pub22/23/24 mutant included the oxidative burst, MAP-kinase activity,
and transcriptional activation of ROS and PAMP associated marker genes. The pub triple mutant
has previously been shown to possess increased resistance to the hemi-biotroph P. syringae, the
obligate biotrophic oomycete, H. arabidopsidis, and also reduced colonisation of the symbiotic
fungus P. indica. Therefore, enhancing the PAMP response can increase resistance to a variety of
organisms including F. oxysporum.
According to our PAMP disease assay, prx33 showed an interesting result to F. oxysporum
inoculation. Bindschedler (2006) found that silencing peroxidases 33 and 34 blocks the oxidative
burst in response to F. oxysproum cell walls, and causes enhanced susceptibility to Botrytis cinerea
powdery mildew and two P. syringae strains, PtoDC3000 and P. syringae pv. maculicola strains
ES4326. Besides, prx33 was found to be more susceptible to P. syringae than wild-type plants
(O’Brien et al., 2012). The T-DNA insertion mutant prx33 showed a reduced ROS and callose
deposition in response to PAMPs, including the synthetic peptide FLG22 and ELF26. prx33 and
prx34 knockdown lines also showed a diminished activation of FLG22-activated genes after
flagellin treatment. These PAMP-activated genes were also down-regulated in unchallenged leaves
of peroxidise knockdown lines, suggesting that a low level of apoplastic ROS production may be
required to pre-prime basal resistance. These findings showed that PRX33 plays an important role
in the PAMP pathway, especially in ROS and callose deposition. When PRX33 and PRX34 are
mutated, the PAMP genes cannot activate effectively, so the F. oxysporum might invade easily with
a low level of basal resistance, such as low levels of ROS production and callose disposition. For
80
prx33, blocking ROS production might make plants more resistant to F. oxysporum. A knock down
of EDR1 might increase stress levels and then leads to susceptibility to F. oxysporum. api5-caused
susceptibility to F. oxysporum might be due to more apoptosis occurring during fungal infection.
For lyk4 and etr2 it is still unclear why they showed these results against F. oxysporum. However,
erf72 mutants show an increased resistance with repression of ROS against F. oxysporum. It might
be an unknown feature of ERF72 in the role of ROS production.
EDR1 is also another interesting gene to investigate. Hiruma et al. (2011) revealed that EDR1
functions in pre-invasive non-host resistance. When plants lacking EDR1 exhibit impaired entry
resistance to hemibiotrophic Colletortrichum gloeosporiodies, in contrast to the enhanced resistance
of edr1 against biotrophic infection of a host-adapted powdery mildew fungus. F. oxysporum is also
considered as a hemibiotrophic, edr1 also exhibits more susceptibility to F. oxysporum. Thus,
EDR1 might play a role in resistance to hemibiotrophic and necrotrophic fungi. Hiruma et al.
(2011) also indicated that EDR1 is required for the induced expression of antifungal protein. Hence,
EDR1 exerts a positive and critical role in resistance responses to hemibiotrophic fungi, in part by
inducing antifungal protein expression through de-repression of MYC2 function.
Millet et al. (2010) used callose staining and GUS-promoter constructs to show that the PAMP
response is inducible in roots by a range of elicitors, and can be suppressed by the JA-Ile analog,
coronatine. The suppression of the root PAMP response by coronatine required the JA co-receptor
COI1 and the JA-associated transcription factor MYC2, but did not require suppression of the SA
pathway (Millet et al., 2010). Similarly our laboratories have previously shown that the coi1 and
myc2 mutants are resistant to F. oxysporum and that the resistance observed in the coi1 mutant does
not require activation of the SA pathway (Anderson et al., 2004; Thatcher et al., 2009). Therefore
these JA signalling components are required both for susceptibility to F. oxysporum as well as
suppression of the PAMP response and it is possible that the resistance phenotypes of coi1 and
myc2 to F. oxysporum may be due to the reduced ability of the fungus to suppress the PAMP
response in these mutants. In addition, different strains of F. oxysporum have previously been
shown to produce a variety of JA compounds including JA-Ile (Miersch et al., 1999). This could
suggest that F. oxysporum may use JA-Ile and other JA compounds to suppress the PAMP response
in order to gain entry to the plant root. Further investigation of the role of fungus-derived jasmonate
in the root interaction with F. oxysporum is required to confirm these hypotheses.
Interestingly, Jacobs et al. (2011) indicated that the ability of P. indica to suppress host immunity is
compromised in the jasmonate mutants myc2 and jasmonate resistant1-1 (jar1-1). Thus, JA
81
signalling is also utilised by P. indica to suppress early root responses. In addition, in response to
arbuscular mycorrhizae (AM), plants react with an increase in SA levels. However in compatible
interactions, SA levels are reduced as the fungus colonises the cortex, and then induction of JA
biosynthesis occurs in arbuscule-containing cells (Pozo and Azcón-Aguilar, 2007). Therefore it is
possible that F. oxysporum might hijack an ancestral pathway for microbial communication to
evade the host defence response.
82
5 Conclusion:
In conclusion, the work presented gene expression profiles in Arabidopsis roots through microarray
analyses. Our results showed that we have more repressed genes than induced genes in the root
microarray. It suggested that F. oxysporum mainly repressed genes in the roots of Arabidopsis.
Then we compared our expression data with other studies (Kidd et al., 2009; Zhu et al., 2013), we
only found very little overlap between shoots microarray and roots microarray data. This suggests
that roots and shoots act differently when F. oxysporum infects the plants. F. oxysporum down-
regulated more genes in the roots and induced more genes in the shoots. Other studies (Attard et al.,
2010; Schlink, 2010) also support this hypothesis using Phytophthora, another root infecting
pathogen. As we compared F. oxysporum microarray data with Iven et al. (2012)’s Verticillium
microarray, SA and JA-induced responses appeared not to be crucial during the root infection
phase. Verticillium-induced gene expression in the roots is not correlated with induction of plant
hormones. Hence, Verticillium might have similar infection phases as F. oxysporum.
We performed Genevestigator searches to understand this expression data much further. We found
that some of the induced genes are also induced by JA. This finding matches other studies (Thatcher
et al., 2009), suggesting that F, oxysporum hijacks the JA pathway to infect plants. Pantelides et al.
(2013) revealed that F. oxysporum also hijacks the ET pathway via ETR1 to infect plants.
Interestingly, Pantelides et al. (2010) suggest that Verticillium dahliae requires ETR1 to enhance
pathogenicity during Arabidopsis infection. Once again, those two pathogens showed a very similar
feature of infection phase in Arabidopsis. Studying those two pathogens together might provide
new insights how to enhance resistance against soil-borne pathogens. On the other hand, we found
that many repressed genes were also repressed by FLG22 and P. syringae in roots. It suggests that
F. oxsyproum might suppress the innate immune system to infect the plants.
According to our microarray data, ERF72 showed significant down-regulation. We confirmed this
by performing real-time RT-qPCR and the mutant showed a phenotype resistance against F.
oxysporum. Ogawa et al. (2005) suggested that ERF72 plays a role in the JA pathway, ROS
production and programmed cell death. We investigated how these three different factors assist
erf72 to act against F. oxysporum. There was not much difference between wild-type and erf72 in
jasmonate marker genes such as PDF1.2. However, CHI-B showed a significant increase in the
erf72 mutant. An increase of CHI-B expression might help plants to defend against F. oxysporum
infection. On the other hand, ERF1 and AOS also showed some significant expression between
83
erf72 and wild-type. ERF1 showed an induced expression at both, basal levels and after F.
oxysporum treatment, in roots at the 1 h time point and expression remained induced at the 24 h
time point. ERF1 also plays a role in the JA pathway and defence response. AOS showed significant
reduction after F. oxysproum treatment at both 1 h and 24h time points. A reduction of AOS
transcripts might help plants to fight against F. oxysporum by failing to hijack the JA pathway to
manipulate the plant defence system. The role of ROS in relation to ERF72 is still unclear, but our
results showed that erf72 might suppress ROS production. The reduced ROS production might help
plants to suffer from less damage from ROS and save more energy to defend pathogen invasion.
According to our result, PAMP plays a role of initial defence against F. oxysporum. When PAMP-
related defence genes have been silenced, the mutants exhibited more susceptibility to F.
oxysporum invasion. Like prx33 that showed a significant susceptibility to F. oxysporum, it
suggests that a basic level of ROS production is required for fungus resistance. The flg22 assay
showed that F. oxysporum is an aggressive fungus which is able to suppress the ROS production
and enhance its toxicity. Besides, when we enhanced the PAMP response, such as in the
pub22/23/24 mutant, this showed resistance to F. oxysporum. Therefore, a strong PAMP response
would help plants to defend against F. oxysporum better.
84
6 Future prospects
More experiments, including comparing other ERF group VII mutants with F. oxysporum
treatments can be carried out. This may reveal a perfect picture of the ERF group VII
against F. oxysporum.
F. oxysporum shows a very similar infecting feature with Verticillium. It will be quite
intriguing to know whether erf72 shows less susceptibility to Verticillium or not.
In this project, we investigated various aspects about ERF72. However, we did not
investigate the role of programmed cell death yet. In the future, we might focus on this
aspect and get a better picture of ERF72 in resistance against F. oxysporum. The
experiments proposed include measuring the level of damage to chloroplast, photosynthetic
parameters, chlorophyll levels, and cell death staining, such as NBT staining.
To understand more about oxidative burst, the FLG22 assay might need to be investigated a
bit further. We would like to know whether oxidative burst can occur for a second time after
F. oxysporum spore inoculation.
85
7 References
Aist, J.R. and Bushnell, W.R. (1991) Invasion of plants by powdery mildew fungi, and cellular
mechanisms of resistance. In: The Fungal Spore and Disease Initiation in Plants and Animals, G.T.
Cole, and H.C. Mock, eds (New York; Plenum), pp. 321-345.
Agrios, G.N. (2005) Plant Pathology. Fifth edition, Elsevier Academic Press, Amsterdam.
Anderson, J.P., Badruzsaufari, E., Schenk, P.M., Manners, J.M., Desmond, O.J., Ehlert, C.,
Maclean, D.J., Ebert, P.R. and Kazan, K. (2004) Antagonistic interaction between abscisic acid
and jasmonate-ethylene signaling pathways modulates defense gene expression and disease
resistance in Arabidopsis. Plant Cell 16: 3460-3479.
Anderson, J.P. and Singh, K. (2011) Interactions of Arabidopsis and M.trucatula with same
pathogens differ in dependence on ethylene and ethylene response factors. Plant signaling and
behaviour 6: 551-552.
Attard, A., Gourgues, M., Callemeyn-Torre, N. and Keller, H. (2010) The immediate activation
of defense responses in Arabidopsis roots is not sufficient to prevent Phytophthora parasitica
infection. New Phytologist 187: 449-460.
Armstrong, G.M. and Armstrong, J.K. (1981) Formae speciales and races of Fusarium
oxysporum causing wilt disease. In Fusarium: Diseases, Biology and Taxonomy, R.Cook, ed
(University Park: Penn State University Press), pp. 391-399.
Badri, D.V., Loyola-Vargas, V.M., Du, J., Stermitz, F.R., Broeckling, C.D., Iglesias-Andreu,
L. and Vivanco, J.M. (2008) Transcriptome analysis of Arabidopsis roots treated with signaling
compounds: a focus on signal transduction, metabolic regulation and secretion. The New
Phytologist 179: 209-223.
Balmer, D. and Mauch-Mani, B. (2013) More beneath the surface? Root versus shoot antifungal
plant defences. Frontiers in plant science 4: 256
86
Bao, J.R., Velema, J., Dobinson, K.F., and Lazarovits, G. (2000) Using GUS expression in a
nonpathogenic Fusarium oxysporum strain to measure fungal biomass. Canadian Journal of plant
pathology 22: 70-78.
Beckers, G.J.M. and Spoel, S.H. (2006) Fine-tuning plant defense signaling:salicylate versus
jasmonate. Plant Biol. 8: 1-10.
Beckman, C.H., Verdier, P.A., and Muller, W.C. (1989) A system of defense in depth provided
by vascular parenchyma cells of tomato in response in response to vascular infection with Fusarium
oxysporum f sp. lycopersici, Race-1. Physiol. Mol. Plant Pathol. 334: 227-239.
Beckman, C.H., Morgham, A.T., and Muller, W.C. (1991) Enlargement and vaucolization of the
cytoplasm in contact cells of resistant and susceptible tomato plants following inoculation with
Fusarium oxysporum f sp. lycopersici, Race 1. Physiol. Mol. Plant Pathol. 38: 433-442.
Beckman, C.H., and Roberts, E.M. (1995). On the nature and genetic basis for resistance and
tolerance to fungal wilt diseases of plants. Advances in Botanical Research, 21: 35-77.
Berrocal-Lobo, M., and Molina, A. (2004) Ethylene Response Factor1 mediates Arabidopsis
resistance to the soilborne fungus Fusarium oxysporum. Mol. Plant-Microbe Interact.17: 763-770.
Bindschedler, L., Dewdney, J., Blee, K., Stone, J., Asai, T., Plotnikov, J., Denoux, C., Hayes,
T., Gerrish, C., and Davies, D. (2006) Peroxidase-dependent apoplastic oxidative burst in
Arabidopsis required for pathogen resistance. Plant J 47: 851-863.
Boller, T. and Felix, G. (2009) A renaissance of elicitors perception of microbe-associated
molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60:
379-406.
Bolwell, GP. And Daudi, A. (2009) Reactive oxygen species in plant-pathogen interaction. In: del
Rio LA, Puppo A (eds) Reactive oxygen species in plant signalling. Springer, Berlin, pp 113-133.
Block, A., Schmelz, E., Jones, J.B. and Klee, H.J. (2005) Coronatine and salicylic acid: the battle
between Arabidopsis and Pseudomonas for phytohormone control. Mol. Plant Pathol. 6: 79-83.
87
Broekaert, W.F., Delaure, S.L., De Bolle, M.F.C. and Cammue, B.P.A. (2006) The Role of
Ethylene in Host-Pathogen Interactions. Annu. Rev Phytopathol. 44:393-416
Brown, JF. and Ogle, HJ. (1997) Plant pathogens and plant diseases. Rockvale Publications,
Amidale
Bouwmeester, K., de Sain, M., Weide, R., Gouget, A., Klamer, S., Canut, H., and Govers, F.
(2011) The Lectin Receptor Kinase LecRK-1.9 Is a Novel Phytophthora Resistance Component and
a Potential Host Target for a RXLR Effector. PLos Pathog 7(3):
e1001327.doi:10.1371/journal.ppat.1001327
Buttner M., and Singh, K.B. (1997) Arabidopsis thaliana ethylene-responsive element binding
protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an OCS
element binding protein. Proc. Natl. Acad. Sci. USA 94: 5961-5966.
Campbell, E.J., Schenk, P.M., Kazan, K., Penninckx, I.A.M.A., Anderson, J.P., Maclean, D.J.,
Cammue, B.P.A., Ebert, P.R., and Manners, J.M. (2003) Pathogen-responsive expression of a
putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is
regulated by multiple defense signaling pathways in Arabidopsis. Plant Physiol. 133: 1272-1284.
Cao, H., Bowling, SA., Gordon, AS., and Dong, XN. (1994) Characterization of an Arabidopsis
mutant that is nonresponsive to inducers of Systemic Acquired-Resistance. Plant Cell 6:1583-1592.
Cao, H., Li, X., Dong, XN. (1998) Generation of broad-spectrum disease resistance by
overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl. Acad.
Sci. USA 95: 6531-6536.
Chao Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., Ecker, JR. (1997) Activation
of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-
INSENSITIVE 3 and related proteins. Cell 89:1133-1144.
Chaouch, S., Queval, G. and Noctor G. (2012) AtRbohF is a crucial modulator of defence-
associated metabolism and a key actor in the interplay between intracellular oxidative stress and
pathogenesis responses in Arabidopsis. Plant J 69:613-627.
88
Chang, C., Kwok, S.F., Bleecker, A.B., Meyerowitz, E.M. (1993) Arabidopsis ethylene-response
gene ETR1: similarity of product to two component regulators. Science 262:539-544.
Chen, CH., Chen, ZX. (2002) Potentiation of developmentally regulated plant defense response by
AtWRKY18, a pathogen-induced Arabidopsis transcription factor. Plant Physiol. 129: 706-716.
Chen, W. and Singh, K.B. (1999) The auxin, hydrogen peroxide and salicylic acid induced
expression of the Arabidopsis GST6 promoter is mediated in part by an ocs element. The Plant
Journal 19(6): 667-677.
Cole, S.J., and Diener, A.C. (2013) Diversity in receptor-like kinase genes is a major determinant
of quantitative resistance to Fusarium oxysporum f.sp. matthioli. New Phytologist 200: 172-184.
Couteaudier, Y., Daboussi, MJ., Eparvier, A., Langin, T., and Orcival, J. (1993) The GUS
Gene Fusion System (Escherichia coli-β-D-Glucuronidase Gene), a Useful Tool in Studies of Root
Colonization by Fusarium oxysporum. Applied and environmental microbiology 59: 1767
-1773.
Czymmek, K.J., Fogg, M., Powell, D.H., Sweigard, J., Park, S.Y., and Kang, S. (2007) In vivo
time-lapse documentation using confocal and multi-photon microscopy reveals the mechanisms of
invasion into the Arabidopsis root vascular system by Fusarium oxysporum. Fungal Genet. Biol.
44: 1011-1023.
Dang, J. L, and Jones, J.D.G. (2001) Plant pathogens and integrated defense responses to
infection. Nature. 411: 826-833.
Daudi, A., Cheng, Z., O’Brien, J.A., Mammarella, N., Khan, S., Ausubel, F.M. and Bolwell,
G.P. (2012) The Apoplastic Oxidative Burst Peroxidase in Arabidopsis Is a Major Component of
Pattern-Triggered Immunity. The Plant Cell, Vol 24: 275-287.
Desikan, R., A-H-Mackerness, S., Hancock, JT., and Neill, SJ. (2001) Regulation of the
Arabidopsis transcriptome by oxidative stress. Plant Physiol 127: 159-172.
89
De Jong, D., Yakimova, ET., Kapchina, VM., and Woltering, EJ. (2002) A critical role for
ethylene in hydrogen peroxide release during programmed cell death in tomato suspension cells.
Planta 214: 537-545.
Diener, A. (2012) Visualizing and quantifying Fusarium oxysporum in the plant host. Mol. Plant-
Microb Interact. 25: 1531-154.
Diener, A.C. and Ausubel, F.M. (2005) RESISTANCE TO FUSARIUM OXYSPORUM 1, a
dominant Arabidopsis disease-resistance gene, is not race specific. Genetics 171: 305-321.
Dowd, C., Wilson, L.W. and McFadden H. (2004) Gene expression profile changes in cotton root
and hypocotyl tissues in response to infection with Fusarium oxysporum f. sp. vasinfectum. Mol.
Plant-Microbe Interact. 17: 654-667.
Doares, SH., Narvaez-Vasquez, J., Conconi A., Ryan, CA. (1995) Salicylic acid inhibits
synthesis of proteinase inhibitors in tomato leaves induced by system and jasmonic acid. Plant
Physiol. 108: 1741-1746.
Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytpathol. 42:
185-209.
Ellis, C., Karafyllidis, L., Turner, JG. (2002) Constitutive activation of jasmonate signaling in
Arabidopsis mutant correlates with enhanced resistance to Erysiphe cichoracearum, Pseudomonas
syringae and Myzus persicae. Mol. Plant-Microbe Interact. 15:1025-1030.
Ellis, J., Catanzariti, A.M. and Dodds, P. (2006) The problem of how fungal and oomycete
avirulence proteins enter plant cells. Trends Plant Sci. 11: 61-63.
Edgar, C.I., McGrath, K.C., Dombrecht, B., Manners, J.M., Maclean, D.C., Schenk, P.M. and
Kazan, K. (2006) Salicylic acid mediates resistance to the vascular wilt pathogen Fusarium
oxysporum in the model host Arabidopsis thaliana. Australasian Plant Pathol. 35: 581-591.
Enyedi, AJ., Yalpani, N., Silverman, P., and Raskin, I. (1992) Signal molecules in systemic plant
resistance to pathogens and pests. Cell 70:879-886
90
Eruslanov, E. & Kusmartsev S. (2010) Identification of ROS Using Oxidized DCFDA and Flow-
Cytometry. In: Advanced Protocols in Oxidative Stress II, Methods in Molecular Biology: 594,
pp57-72.
Felix, G., Duran, J.D., Volko, S. and Boller, T. (1999) Plants have a sensitive perception system
for the most conserved domain of bacterial flagellin. Plant J. 18:265-276.
Feys, B., Benedetti, CE., Penfold, CN. and Turner, JG. (1994) Arabidposis mutants selected for
resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and
resistant to a bacterial pathogen. Plant Cell 5, 751-759.
Finkelstein RR., Wang ML., Lynch TJ., Rao S., Goodman HM. (1998) The Arabidopsis
abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 10: 1043-
1054
Fujimoto SY., Ohta M., Usui A., Shinshi H., Ohme-Takagi M. (2000) Arabidopsis ethylene-
responsive element binding factors act as transcriptional activators or repressors of GCC box-
mediated gene expression. Plant Cell 12: 393-404.
Gachon, C. and Saindrenan, P. (2004) Real-time PCR monitoring of fungal development in
Arabidopsis thaliana infected by Alternaria and Botrytis cinerea. Plant Physiol. Biochem. 42: 367-
371.
Gagne JM., Smalle, J., Gingerich, DJ., Walker, JM., Yoo, DD., Yanagisawa, S. and Vierstra,
RD. (2004) Arabidopsis EIN3-binding F-box 1and 2 form ubiquitin-protein ligases that repress
ethylene action and promote growth by directing EIN3 degradation. Proc. Natl. Acad. Sci. USA
101: 6803-6808
Garcia, FA., Ordonez, N., AlQasem, M., Naser, Z., Abdelwali, M., Salem, NM., Waalwijk, C.,
Ploetz, R., Kema, G. (2013) First report Fusarium oxysporum f.sp. cubense Tropical Race 4
associated with Panama disease of banana outside Southeast Asia. Plant Disease: doi:
http://dx.doi.org/10.1094/PDIS-09-13-0954-PDN
Glazebrook, J. (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic
pathogens. Annu. Rev. Phytopathol. 43: 205-227.
91
Guo, H. and Ecker, J.R. (2003) Plant responses to ethylene gas are mediated by
SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. Cell 115: 667-677
Guo, H. and Ecker, J.R. (2004) The ethylene signaling pathway: new insights. Current Opinion in
Plant Biology, 7:40-49
Harrach, B.D., Baltruschat, H., Barna, B., Fodor, J. and Kogel, K.H. (2013) The mutualistic
fungus Piriformospora indica protects barley roots from a loss of antioxidant capacity caused by the
necrotrophic pathogen Fusarium culmorum. MPMI. 26(5): 599-605
He, P., Chintamanani, S., Chen, ZY., Zhu, L., Kunkel, BN., Alfano, JR., Tang, X., Zhou, JM.
(2004) Activation of a COI1-dependent pathway in Arabidopsis by Pseudomonas syringae type III
effectors and coronatine. Plant J. 37: 589-602.
He, P., Shan, L., and Sheen, J. (2007) Elicitation and suppression of microbe associated molecular
pattern-triggered immunity in plant-microbe interactions. Cell Microbial 9:1385-1396.
Hess, N., Klode, M., Anders, M., and Sauter M. (2011) The hypoxia responsive transcription
factor genes ERF71/HRE2 and ERF73/HRE1 of Arabidopsis are differentially regulated by
ethylene. Physiologia Plantarum 143: 41-49.
Hiruma, K., Nishiuchi, T., Kato, T., Bednarek, P., Okuno, T., Schulze-Lefert, P. and Takano,
Y. (2011) Arabidopsis ENHANCED DISEASE RESISTANCE 1 is required for pathogen-induced
expression of plant defensins in nonhost resistance, and acts through interference of MYC2-
mediated repressor function. Plant J. 67: 980-992.
Hogenhout , SA., Van der Hoom, RA., Terauchi, R. and Kamoun, S. (2009) Emerging concepts
in effector biology of plant-associated organisms. Mol. Plant Microbe Interact. 2: 115-122.
Hua, J., Chang, C., Sun, Q., Meyerowitz, E.M., (1995). Ethylene insensitivity conferred by
Arabidopsis ERS gene. Science 269: 1712-1714.
92
Irish VF and Sussex IM. (1990) Function of the APETALA-1 gene during Arabidopsis floral
development. Plant Cell 2: 741-753.
Ito Y, Nakanomyo I, Motose H, Iwamoto K, Sawa S, Dohmae N, Fukuda H (2006) Dodeca-
CLE peptides as suppressors of plant stem cell differentiation. Science 313: 842-845,
Jacobs, S., Zechmann, B., Molitor, A., Trujilo, M., Petutschnig, E., Likpa, V., Kogel, K. and
Schafer, P. (2011) Broad-spectrum suppression of innate immunity is required for colonization of
Arabidopsis roots by the fungus Pirformospora indica. Plant Physiol. 156, 726-740.
Jones J.D.G. and Dangl, J.L. (2006) The plant immune system. Nature 444: 323-329.
Johnson, PR., and Ecker, JR. (1998) The ethylene gas signal transduction pathway: a molecular
perspective. Ann. Rev. Genetics 32: 227-254
Joo, JH., Wang, S., Chen, JG., Jones, AM., Fedoroff, NV. (2005) Different signaling and cell
death roles of heterotrimeric G protein α and β subunits in the Arabidopsis oxidative stress response
to ozone. Plant Cell 17: 957-970.
Kidd, B.N, Edgar, C., Kumar, K., Aitken, E.A., Schenk, P.M., Manners, J.M. and Kazan, K.
(2009) The mediator complex subunit PFT1 is a key regulator of jasmonate-dependent defense in
Arabidopsis. Plant Cell 21: 2237-2252.
Kidd, B.N, Kadoo, N., Dombrecht, B., Tekeoglu, M., Gardiner, D., Thatcher, L., Aitken, E.A.,
Schenk, P.M., Manners, J.M. and Kazan, K. (2011) Auxin signaling and transport promote
susceptibility to the root-infecting fungal pathogen Fusarium oxysporum in Arabidopsis. Mol.
Plant-Microbe Interact. 24: 733-748.
Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R. (1993) CTR1, a
negative regulator of the ethylene response pathway in Arabidopsis , encodes a member of the raf
family of protein kinases. Cell 72: 427-441.
Kim, M., da Cunha, L., McFall, A., Beljhadir, Y., DebRoy, S., Dangl, J., and Mackey, D.
(2005) Two Pseudomonas stringae type III effectos inhibit RIN4-regulated basal defense in
Arabidopsis. Cell 121:749-759.
93
Lamb C. and Dixon RA. (1997) The oxidative burst in plant disease resistance. Annu. Rev. Plant
Physiol Mol. Biol. 48: 251-275.
Laurie-Berry, N., Joardar, V., Street, IH. and Kunkel, BN. (2006) The Arabidposis thaliana
JASMONATE INSENSITIVE 1 gene is required for suppression of salicylic acid-dependent defenses
during infection by Pseudomonas syringae. Mol. Plant-Microbe Interact. 7: 789-800.
Le, MH., Cao, Y., Zhang, XC., and Stacey G. (2014) LIK1, a CERK1-interacting kinase,
regulates plant immune responses in Arabidopsis. PloS one 9: e102245
Li, X., Lin, H., Zhang, W., Zou, Y., Zhang, J., Tang, X., and Zhou, J-M. (2005) Flagellin
induces innate immunity in nonhost interactions that is suppressed by Pseudommonas syringae
effectors. Proc. Natl Acad. Sci U.S.A 102: 12990-12995.
Liu , Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-shinozaki, K., Shinozaki K.
(1998) Two transcription factors, DREB 1 and DREB2, with an EREBP/AP2 DNA binding domain
separate two cellualr signal transduction pathways in drought- and low-temperature-responsive gene
expression, respectively, in Arabidpsis. Plant Cell 10: 1391-1406.
Lorenzo, O., Piqueras, R., Sanchez-Serrano, JJ., Solano, R. (2003) ETHYLENE RESPONSE
FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15:
165-178
Love, AJ., Yun, BW., Laval, V., Loake, GJ., and Milner, JJ. (2005) Cauliflower moasic virus, a
compatible pathogen of Arabidopsis, engages three distinct defense-signaling pathways and
activates rapid systemic generation of reactive oxygen species. Plant Physiol 139: 935-948.
Lyons, R., Iwase, A., Gansewig, T., Sherstnev, A., Duc, C., Barton, G.J., Hanada, K., Higuchi-
Takeuchi, M., Matsui, M., Sugimoto, K., Kazan, K., Simpson, G.G. and Shirasu, K. (2013) The
RNA-binding protein FPA regulates flg22-triggered defense responses and transcription factor
activity by alternative polyadenylation. Scientific Reports 3: 2866
Martinon, F. and Tschopp, J. (2005) NLRs join TLRs as innate sensors of pathogens. Trends
Immunol. 26: 447-454.
94
McDowell, JM., Cuzick, RA., Bell, E., Mullet, JE., and Browse, J. (1997) Downy mildew
(Peronospora parasitica) resistance genes in Arabidopsis vary in functional requirements for
NDR1, EDS1, NPR1 and salicylic acid accumulation. Plant J. 22: 523-529.
McDowell, JM., Dangl, JL. (2000) Signal transduction in the plant immune response. Trends
Biochem. Sci. 25: 79-82.
McGrath, K.C., Dombrecht, B., Manners, J.M., Schenk, P.M., Edgar, C.I., Maclean, D.J.,
ScheibleW.R., Udvardi, M.K., and Kazan, K. (2005) Repressor-and activator-type ethylene
response factors functioning in jasmonate signalling and resistance identified via a genome-wide
screen of Arabidopsis transcription factor gene expression. Plant Physiology 139: 949-959
Miersch, O., Bohlmann, H. and Wasternack, C. (1999) Jasmonates and related compounds from
Fusarium oxysporum. Phytochemistry 50: 517-523.
Miller, PM. (1955) V-8 juice agar as general purpose medium for fungi and
bacteria.Phytopathology 45: 461-462.
Millet, Y., Danna, C., Clay, N., Songnuan, W., Simon,M., Werck-Reichhar, D. and Ausubel, F.
(2010) Innate immune responses activated in Arabidopsis roots by microbe-associated molecular
patterns. Plant Cell 22: 973-990.
Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y.,
Kawakami, N., Kaku, H. and Shibuya, N. (2007) CERK1, a LysM receptor kinase, is essential
for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sc.i U.S.A. 104: 19613-19618.
Muller, W.C., Morgham, A.T., and Roberts, E.M. (1994). Immunocytochemical localization of
callose in the vascular tissue of tomato and cotton plants infected with Fusarium oxysporum.
Canadian Journal of Botany-Revue Canadienne De Botanique 72: 505-509.
Nakano, T., Suzuki, K., Fujimura, T., and Sinshi, H. (2006) Genome-Wide Analysis of the ERF
Gene Family in Arabidopsis and Rice. Plant Physiology 140: 411-432.
Narusaka, Y., Shinya, T., Narusaka, M., Motoyama, N., Shimada, H., Murakami, K., and
Shibuya, N. (2013) Presence of LYM 2 dependent but CERK1 independent disease resistance in
Arabidopsis. Plant signaling & Behavior 8: 9, e25315
95
Navarro, L., Zipfel, C., Rowland, O., Keller, I., Robatzek, S., Boller, T. and Jones, J.D. (2004)
The transcriptional innate immune response to flg22 interplay and overlap with avr gene-dependent
defense responses and bacterial pathogenesis. Plant Physiol. 135: 1113-1128.
Novikova, G.V., Moshkov, I.E., Smith, A.R. and Hall, M.A. (2000) The effect of ethylene on
MAPKinase-like activity in Arabidopsis thaliana. FEBS Lett. 474:29-32
Ogawa,T., Pan, LH., Kawai-Yamada, M., Yu, L., Yamamura, S., Koyama, T., Kitajima, S.,
Ohme-Takagi, M., Sato, F., and Uchimiya, H. (2005) Functional analysis of Arabidposis
ethylene-responsive elemen binding protein conferring resistance to Bax and abiotic stress-induced
plant cell death. Plant Physiol. 138: 1436-1445.
Ohme-Takagi M, Shinshi, H. (1995) Ethylene-inducible DNA binding proteins that interact with
an ethylene-responsive element. Plant Cell 7: 173-182.
Ouaked, F., Rozhon, W., Lecourieux, D. and Hirt, H. (2003) A MAPK pathway mediates
ethylene signalling in plants. EMBO F. 22:1282-1288
O’Brien, J., Daudi, A., Finch, P., Butt, V.S., Whitelegge, J.P., Souda, P., Ausubel, F.M., and
Bolwell, G.P. (2012) A peroxidase-dependent apoplastic oxidative burst in cultured Arabidopsis
cells functions in PAMP-elicited defense. Plant Physiol. 158: 2013-2027.
O’ Brien, J., Daudi, A., Butt, V.S., and Bolwell, G.P. (2012) Reactive oxygen species and their
role in plant defence and cell wall metabolism. Planta 236: 765-779
Pan, L., Kawai, M., Yu, LH., Kim, KM., Hirata, A., Umeda, M., and Uchimiya, H. (2001) The
Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP) can function as a
dominant suppressor of Bax-induced cell death of yeast. FEBS Lett. 508:375-378.
Pantelides, I.S., Tjamos, S.E. and Paplomatas, E.J. (2010) Ethylene perception via ETR1 is
required in Arabidopsis infection by Verticillim dahilae. Molecular plant pathology 11:191-202
96
Pantelides, I.S., Tjamos, S. E., Pappa, S., Kargakis, M., and Paplomatas, E.J. (2013) The
ethylene receptor ETR1 is required for Fusarium oxysporum pathogenicity. Plant Pathol.
Doi:10.1111/ppa.12042.
Park JM., Park, C-J., Lee, S-B., Ham, BK, Shin R., and Paek, K-H. (2001) Overexpression of
the tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factors enhances resistance
against pathogen attack and osmotic stress in tobacco. Plant Cell 13: 1055-1046.
Petutschnig, E.K., Stolze, M., Lipka, U., Kopischke, M., Horlacher, J., Valerius, O., Rozhon,
W., Gust, A.A., Kemmerling, B., Poppenberger, B., Braus, G.H., Nurnberger, T., and Lipka
V. (2014) A novel Arabidopsis CHITIN ELICITOR RECEPTOR KINASE 1 (CERK1) mutant with
enhanced pathogen-induced cell death and altered receptor processing. The New Phytologist
doi:10.1111/nph.12920.
Penninckx, I., Thomma, B., Buchala, A., Metraux, JP., Broekaert, WF. (1998) Concomitant
activation of jasmonate and ethylene response pathways is required for induction of a plant defensin
gene in Arabidopsis. Plant Cell 10: 2103-2113.
Pozo, M. and Azcon-Aguilar, C. (2007) Unraveling mycorrhiza-induced resistance. Curr. Opin.
Plant Biol. 10: 393-398.
Sakai, H., Hua, J., Chen, Q.G., Chang, C., Medrano, L.J., Bleecker, A.B., Meyerowitz, E.M.,
(1998) ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad.
Sci. USA 95: 5812-5817.
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-
binding specifity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in
dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 290: 998-1009.
Schenk PM., Kazan K., Wilson I., Anderson JP., Richmond T., Somerville SC., Manners JM.
(2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc.
Natl. Acad. Sci. USA 97: 11655-11660.
97
Schlink, K. (2010) Down-regulation of defense genes and resource allocation into infected roots as
factors for compatibility between Fagus sylvatica and Phytophthora citricola. Funct. Integr.
Genomics 10: 253-264.
Schumann, U., Smith, NA., Kazan, K., Ayliffe, M., and Wang, MB. (2013) Analysis of hairpin
RNA transgene-induced gene silencing in Fusarium oxysporum. Science 4:3 doi:10.1186/1758-
907X-4-3
Seo, HS., Song, JT., Cheong, J-J., Lee, YH., Lee, YW., Hwang, I., Lee, JS, Chol, YD. (2001)
Jasmonic acid carboxyl methyltransferase: A key enzyme for jasmonate-regulated plant responses.
Proc. Natl. Acad. Sci. USA 98: 4788-4793.
Shen, Y., and Diener, AC. (2013) Arabidopsis thaliana RESISTANCE TO FUSARIUM
OXYSPORUM 2 implicates tyrosine-sulfated peptide signaling in susceptibility and resistance to
root infection. PLoS Genet. 9:e1003525.
Shigyo M., Hasebe, M., and Ito, M. (2006) Molecular evolution of the AP2 subfamily. Gene 366:
256-265.
Shirasu K., Nakajima, H., Rajasekhar, VK., Dixon, RA., and Lamb, C. (1997) Salicylic acid
potentiates an agonist-dependent gain control that amplifies pathogen signals in the activation of
defense mechanisms. Plant Cell 9:261-270
Stawick, PE., Yuen, GY., Lehman, CC. (1998) Jasmonate signaling mutants of Arabidopsis are
susceptible to the soil fungus Pythium irregulare. Plant J. 15: 747-754.
Stepanova, A.N. and Alonso, J.M. (2005) Ethylene signaling pathway. Sci. STKEI:cm3
Stockinger EJ., Gilmour SJ., Thomashow MF., (1997) Arabidopsis thaliana CBF1 encodes an
AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA
regulatory element that stimulates transcription in response to low temperature and water deficit.
Proc. Natl. Acad. Sci. USA 94: 1035-1040.
98
Solano, R., Stepanova, A., Chao, Q., Ecker, JR. (1998) Nuclear events in ethylene signaling: a
transcriptional cascade mediated by ETHYLENE-INSENSITIVE 3 and ETHYLENE-RESPONSE
FACTOR 1. Genes .Developm. 12: 3703-3714.
Spoel, SH., Koornneef A., Claessens, SMC., Korzelius, JP., Van Pelt, JA., Mueller, MJ.,
Buchala, AJ., Metraux, JP., Brown, R., Kazan, K., Van Loon, L.C., Dong, X., and Pieterse,
C.M.J (2003) NPR1 modulates cross-talk between salicylate- and jasmonate-dependt defense
pathways through a novel function in the cytosol. Proc. Natl. Acad. Sci. USA 89: 6837-6840.
Park, JM., Park C-J., Lee S-B., Ham B-K, Shin R, Paek K-H (2001) Overexpression of the
tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resistance against
pathogen attack and osmotic stress in tobacco. Plant Cell 13: 1035-1046.
Park, HY., Seok, HY., Woo, DH., Lee, SY., Tarte, VN., Lee, CH., and Moon, YH. (2011)
AtERF71/HRE2 transcription factor mediates osmotic stress response as well as hypoxia response
in Arabidopsis. Biochem. Biophys. Commun. 414: 135-141.
Thatcher, L., Manners, J.M. and Kazan, K. (2009) Fusarium oxysporum hijacks COl1-mediated
jasmonate signaling to promote disease development in Arabidopsis. Plant J. 58: 927-939.
Thilmony, R., Underwood, W., and He, S.Y. (2006) Genome-wide transcriptional analysis of the
Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. Tomato
DC3000 and the human pathogen Escherichia coli OI57:H7. Plant J. 46: 34-53.
Thomma, B., Eggermont, K., Pennickx, I., Mauch-Mani, B., Vogelsang, R., Cammue, BPA.,
Broekaert, WF. (1998) Separate jasmonate-dependent and salicylate-depedent defense-response
pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl.
Acad. Sci. USA 95: 15107-15111.
Torres , MA., Dangl JL., and Jones, JDG. (2002) Arabidopsis gp91phox homologues AtrbohD
and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense
response. Proc. Natl. Acad. Sci. USA 99:517-522.
Torres, MA. And Dangl, JL. (2005) Functions of the respiratory burst oxidase in biotic
interactions, abiotic stress and development. Curr Opin Plant Biol 8:397-403.
99
Torres, MA., Jones, JD., and Dangl, JL. (2006) Reactive oxygen species signalling in response to
pathogens. Plant Physiol 141:373-378.
Truman, W., Zabala, M. T., and Grant, M. (2006) Type III effectors orchestrate a complex
interplay between transcriptional networks to modify basal defense responses during pathogensis
and resistance. Plant J. 46: 14-33.
Truman, W., Bennett, MH., Kubigsteltig, I., Turnbull, C. and Grant, M. (2007) Arabidopsis
systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates.
Proc. Natl. Acad. Sci. U.S.A. 104: 1075-1080.
Trujillo, M., Ichimura, K., Casais, C. and Shirasu, K. (2008) Negative Regulation of PAMP-
triggered immunity by an E3 ubiquitin ligase Triplet in Arabidopsis. Curr. Biol. 18: 1396-1401.
Trusov Y., Sewelam, N., Rookes, JE., Kunkel M., Nowak, E., Schenk PM. and Botella, JR.
(2009) Heterotrimeric G proteins- mediated resistance to necrotrophic pathogens includes
mechanisms independent of salicylic acid-, jasmonic acid/ethylene- and abscisic acid-mediated
defense signaling. Plant J. 58: 646-649.
Rentel, M.C., Lecourieux, D., Ouaked, F., Usher, S.L., Petersen, L., Okamoto, H., Knight, H.,
Peck, S.C., Grierson, C.S., Hirt, H., and Knight, M.C. (2004) OXI1 kinase is necessary for
oxidative burst-mediated signaling in Arabidopsis. Nature 427: 858-861.
Riechmann JL., Meyerowitz EM. (1998) The AP2/EREBP family of plant transcription factors.
Biol Chem 379: 633-646.
Riechmann, JL., Ractliffe, OJ. (2000) A genomic perspective on plant transcription factors. Curr.
Opin. Plant Biol. 3:4 23-434.
Ryals, JA., Neuenschwander UH., Willits, MG., Molina, A., Steiner, HY., and Hunt MD.
(1996) Systemic acquired resistance. Plant Cell 8: 1809-1819.
Uknes, S., Winter, AM., Delaney T., Vernooij, B., Morse A., Friedrich, L., Nye, G., Potter, S.,
Ward, E., and Ryals, J. (1993) Biological induction of systemic acquired resistance in
Arabidopsis. Mol. Plant-Microbe Interact. 6: 692-698.
100
Wan J., Tanaka, K., Zhang, XC., Son, GH., Brechenmacher, L., Nguyen TH., Stacey G. (2012)
LYK4, a lysin motif receptor-like kinase, is important for chitin signaling and plant innate
immunity in Arabidopsis. Plant Physiology 10: 2204/pp.112.201699
Wang, L., Tsuda, K., Sato, M., Cohen, J.D., Katagiri, F. and Glazebrook, J. (2009) Arabidopsis
CaM binding protein CBP60g contributes to PAMP-induced SA accumulation and is involved in
disease resistance against Pseudomonas syringae. PLoS Pathogens 5: e1000301.
Wen, X., Zhang, C., Ji, Y., Zhao, Q., He, W., An, F., Jiang, L., and Guo, HW. (2012)
Activation of ethylene signaling is mediated by nuclear translocation of the cleaved EIN2 carboxyl
terminus. Cell research 22: 1613-1616
Whipps, J.M. (2001) Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 52: 487-
511.
Vivier, E. and Malissen, B. (2005) Innate and adaptive immunity: specificities and signaling
hierarchies revisited. Nat. Immunol. 6: 17-21.
Vogele, T. T. and Mendgen, K. (2003) Rust haustoria: nutrient uptake and beyond. New Phytol.
159, 93-100.
Zimmermann, P., Hirsch-Hoffman, M., and Gruissem. W., (2005) Gene expression analysis and
network discovery using Genevestigator. Trends in Plant Science 9 10:407-409
Zipfel, C., Robtzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G.,and Boller, T.
(2004) Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428: 764-
767.
Zipfel C. (2008). Pattern-recognition receptors in plant innate immunity. Curr. Opin. Immunol. 1,
10-16.
Zhang, W.G., Fraiture, M., Kolb, D., Loffelhardt, B., Desaki, Y., Boutrot, F.F.G., Tor, M.,
Zipfel, C., Gust, A.A. and Brunner, F. (2013) Arabidopsis RECEPTOR-LIKE PROTEIN30 and
101
Receptor- Like Kinase SUPPRESSOR OF BIR1-1/EVERSHED Mediate Innate Immunity to
Necrotrophic Fungi. The Plant Cell 25:4227-4241
Zhao, Y., Wei, T., Yin, KQ., Chen, Z., Gu, H., Qu, LJ., and Qin, G. (2012) Arabidopsis RAP2.2
plays an important role in plant resistance to Botrytis cinerea and ethylene responses. New
Phytologist 195: 450-460.
Zhu, QH., Stephen, S., Kazan, K., Jin, G., Fan, LJ., Taylor, J., Dennis, E.S., Helliwell,C.A.,
and Wang, M.B. (2013) Characterization of the defense transcription responsive to Fusarium
oxysporum – infection in Arabidopsis using RNA-seq. Gene 512: 259-266.
102
8 Appendix
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
