The changing face of dairy starter culture research: From genomics to economics

REVIEWThe changing face of dairy starter culture research: Fromgenomics to economics

SUSAN MILLS,1* ORLA O’SULLIVAN,1 COLIN HILL,2 ,3

GERALD FITZGERALD2,3 and R PAUL ROSS1,2

1Teagasc, Moorepark Food Research Centre, Fermoy, Co. Cork, Ireland, 2Alimentary Pharmabiotic Centre, UniversityCollege Cork, Cork, Ireland, and 3Department of Microbiology, University College Cork, Cork, Ireland

*Author forcorrespondence. E-mail:[email protected]

� 2010 Society ofDairy Technology

Dairy starter culture research is currently moving through an exciting period which increasingly usesstate-of-the-art functional genomics overlaid on traditional microbiology. To date, 25 lactic acid bacteria

(LAB) genomes have been sequenced, most of which are genetically pliable using food-gradeapproaches. An in-depth knowledge of intricate metabolic networks of industrial strains will provide us

with a repertoire of genetic markers for ‘knowledge-based’ selection of desirable LAB and expansion ofmolecular tools for potential strain improvement. This review explores the significance of the genomics

era for dairy cultures and discusses future directions which will ultimately change how we interpretstarter performance.

Keywords Dairy starter cultures, Genomics, Genetic identification, Industrial traits.

INTRODUCT ION

The old adage ‘a little knowledge goes a long way’is certainly applicable when considering techniquesfor maximising the market potential of dairy startercultures. Indeed, generating desirable cultureswhich are industrially robust may be readilyachieved by simply knowing what phenotypictraits are required and how to select for these traitsat the genotypic level using high-throughputscreening approaches. Nowadays, this is an achiev-able feat as there is a wealth of information aboutthe biology and genomics of living microorgan-isms, enabling scientists to link phenotypedirectly with genotype through systems biologyapproaches. Applying this knowledge to starterculture research programmes is enabling scientiststo develop superior starters and novel products formarket expansion. However, in the manufacturingcommunity much of the time involved in theproduction of commercial starter cultures involvesadherence to stringent quality control measures toensure the highest quality and stability in the finalproduct. Indeed, starter culture manufacturerscontinually face the challenge of producing novelstrains which generate desirable fermented prod-ucts and also withstand the stresses of the manufac-turing environment. While genetic engineeringstrategies may provide some solutions, bringinggenetically modified organisms (GMOs) to marketis still an extremely difficult task owing to govern-ment regulations and pressure from consumergroups (Pedersen et al. 2005; van Hylckama Vlieg

et al. 2006). Searching amongst the natural diver-sity for strains with desirable industrial genotypesshould provide a feasible solution, alongside theuse of food-grade methods such as conjugation andprotoplast fusion to shuffle valuable informationbetween strains in a food-grade manner for starterculture improvement (Patnaik et al. 2002; Millset al. 2006; Wang et al. 2007). Thus a strong linkbetween both the scientific and manufacturingcommunities should ensure the production ofpremium starter cultures with the capacity toproduce highly desirable and innovative fermentedproducts, whether they are infused with functionalproperties, have new sensory characteristics, aremanufactured for personalised nutrition, or aresimply produced as high quality dairy products toform part of a balanced diet.The aim of this review is therefore to provide a

synopsis of the latest molecular tools and genomicfindings relating to starter culture research whichare playing a major role in the future direction ofthis area. As the lactic acid bacteria (LAB) repre-sent a majority group in terms of both volume pro-duced and value of commercial starters (Hansen2002) they are the main focus of the review.Indeed, in 2002 the global commercial dairy start-ers market was estimated to be worth US$ 250million, and it was suggested that it could be worthup to US$ 1 billion if cultures for direct inoculationwere used worldwide for the production of cheeseand fermented dairy products (Hansen 2002). TheLAB group is composed of a number of bacterialgenera including Lactococcus, Streptococcus,

Vol 63, No 2 May 2010 International Journal of Dairy Technology 149

doi: 10.1111/j.1471-0307.2010.00563.x

Lactobacillus, Pediococcus, Enterococcus, Oeno-coccus and Leuconostoc. Some of these micro-organisms can additionally exert beneficial effectson health, either directly via the live microbialcells, known as the probiotic effect (Fuller 1989),or indirectly through the production of secondarymetabolites with health-promoting properties(Stanton et al. 2005). Given that fermented dairyproducts are considered a major constituent of thedaily diet, it is not surprising that this versatilityhas enabled such products to seize a major sectorof the market. Remarkably, worldwide total turn-over for cheese alone in 2007 was estimated to beworth 74.4 billion US $ (O’ Brien 2004; Sieuwertset al. 2008), while fermented fresh dairy productsrepresent a total economic value of 54.2 billion US$ annually (O’ Brien 2004; Sieuwerts et al. 2008).

Dairy starter culturesThe process of fermentation was utilised longbefore microorganisms were discovered, withsome records of fermented foods and ⁄or drinksdating back as far as 6000 BC (Fox 1993). Theseearliest dairy fermentations were optimised throughback-slopping: inoculation of the raw material witha small quantity of the previously performedsuccessful fermentation (Leroy and De Vuyst2004). Thus fermentation processes had the poten-tial to be markedly improved with the discovery ofmicroorganisms (Hansen 2002). Nowadays, theavailability of whole genome sequences for thesemicroorganisms is opening up a whole new plat-form for the production of superior fermentedfoods which are tastier, healthier and more conve-nient to produce. Indeed, the availability of acomplete list of genes for an organism is a power-ful tool, ultimately enabling a thorough estimationof the metabolic pathways and how they may bemanipulated (Dellaglio et al. 2005). For example,genome sequence analysis has already beenexploited for LAB to predict flavour formationfrom amino acids (Van Kranenburg et al. 2002)and to assist in the reconstruction of genome-scalemetabolic pathways (Francke et al. 2005; Teusinkand Smid 2005; Teusink et al. 2005; Notebaartet al. 2006; Pastink et al. 2009). These pathwaysprovide an overview of all metabolic conversionsin an organism based on its genome sequence,making it feasible to visualise different metabolicpathways, such as amino acid metabolism (Pastinket al. 2009), and have been constructed for Lacto-coccus lactis subsp. lactis (Oliveira et al. 2005)Lactobacillus plantarum (Teusink et al. 2005) andStreptococcus thermophilus (Pastink et al. 2009).The reconstruction of the metabolic pathway of thestrain L. plantarum WCFS1 led to the generationof the publicly available pathway genome databaseLacplantCyc which is among the most extensi-vely curated pathway genome database for Gram-

positive bacteria (Teusink et al. 2005). Many ofthe databases and tools which aid metabolic recon-struction can be located in the January issue ofNucleic Acids Research (NAR) (Galperin andCochrane 2009) and the NAR online MolecularBiology Database collection (http://www.oxford-journals.org/nar/database/a/). Screening strategiescan be greatly enhanced through such genomicapproaches enabling the development of novel orimproved dairy products, through a ‘knowledge-based’ selection of LAB which exhibit the desiredproperties (Rademaker et al. 2007; Pastink et al.2009).In terms of the LAB, 25 genomes have been

sequenced and annotated (15 Lactobacillus, threeLactococcus, three Streptococcus, two Leucono-stoc, one Pediococcus and one Oenococcus), while67 projects (to our knowledge) are in progress (59Lactobacillus, three Lactococcus, three Leuconos-toc, one Streptococcus, one Oenococcus) (Zhuet al. 2009) (see also GOLD; genome online data-base, http://www.genomesonline.org/). The threeprincipal dairy starter cultures which form thefocus of this review include strains of Lac. lactissubsp. lactis and subsp. cremoris, S. thermophilusand Lactobacillus.

Lactococcus lactisLac. lactis strains form one of the main constitu-ents in both industrial and artisanal starter cultureswhere their most important role lies in their abilityto produce acid in milk and to convert milk proteininto flavour compounds (Wouters et al. 2002).Indeed, it has been suggested that humans con-sume close to 1018 lactococci annually (Bolotinet al. 2001). Plant material is also a second impor-tant niche of this microorganism where it generallyoccurs as an early coloniser, being replaced byspecies that are more resistant to low pH (vanHylckama Vlieg et al. 2006). Not surprisingly themetabolic diversity of strains adapted to theseenvironments exceeds that of dairy strains as theyneed to perform in a more nutritionally diverseenvironment (van Hylckama Vlieg et al. 2006).Lac. lactis cultures found in dairy fermentationsare classified as the subspecies cremoris, subspe-cies lactis and subspecies lactis biovar diacetylactis(van Hylckama Vlieg et al. 2006). Differentiationof cremoris and lactis is generally based on a fewphenotypic traits; Lac. lactis subsp. lactis producesammonia from arginine and is tolerant to 40�C and4% NaCl whereas Lac. lactis subsp. cremoris isunable to produce ammonia from arginine and haslow tolerance for elevated temperatures and saltconcentrations (Schleifer et al. 1985). Morerecently glutamate decarboxylase activity, whichhas been observed in Lac. lactis subsp. lactis butnot in subsp. cremoris, can also serve as a mecha-nism for differentiation (Nomura et al. 1999, 2000,

Vol 63, No 2 May 2010

150 � 2010 Society of Dairy Technology

2002, 2006). Lac. lactis subsp. lactis biovar diacet-ylactis strains are characterised by their ability toutilise citrate where they produce diacetyl. How-ever, it was found that some strains which werephenotypically Lac. lactis subsp. lactis appearedgenotypically as Lac. lactis subsp. cremoris andvice versa (Salama et al. 1991, 1993; Godon et al.1992; Klijn et al. 1995). In a recent study, threemolecular typing methods [partial SSU (small sub-unit) rRNA gene sequence analysis, (GTG)5-PCRgenomic fingerprinting analysis and multilocussequence analysis (MLSA) scheme] applied to acollection of lactococcal strains from various dairyand plant fermentations and a wide range ofgeographic locations revealed two major distinctgenomic lineages within the species that are dis-similar to groups defined on the basis of pheno-typic analysis (Rademaker et al. 2007). The twomajor lineages included the Lac. lactis subsp.cremoris type-strain-like genotype lineage whichincludes both Lac. lactis subsp. cremoris and Lac.lactis subsp. lactis isolates. The other major lineageincluded Lac. lactis subsp. lactis type-strain-likegenotype, which was composed of Lac. lactissubsp. lactis isolates only. A novel third genomiclineage was represented by two Lac. lactis subsp.lactis isolates of non-dairy origin. Indeed, theirSSU rRNA gene sequences and five locus MLSAsequences grouped separately from the otherlactococcal isolates, although phenotypic differ-ences were less distinct. The authors have sug-gested using the current phenotypic classificationamended with a ‘type-strain-like-genotype’ classifi-cation, providing a direct sub-specific phylogeneticreference (Rademaker et al. 2007).The complete genome sequences of three lacto-

coccal strains have been published to date (Mayoet al. 2008); Lac. lactis subsp. lactis IL1403 (plas-mid-cured derivative) (Bolotin et al. 2001), Lac.

lactis subsp. cremoris MG1363 (plasmid-curedderivative) (Wegmann et al. 2007) and the ‘true’cremoris strain, Lac. lactis subsp. cremoris SK11(Makarova et al. 2006). This has paved the wayfor both comparative and functional genomics ofthe lactococci (Kok et al. 2005) (Figure 1a). Thetwo cremoris strains were found to contain greatergenome sizes than Lac. lactis subsp. lactis IL1403(�2.37 Mbp), with Lac. lactis subsp. cremorisMG1363 containing the largest genome size of�2.53 Mbp, followed by Lac. lactis subsp.cremoris SK11 with a genome size of 2.44 Mbp.Approximately 85% DNA sequence identity wasobserved between the coding domains (CDs) ofLac. lactis subsp. lactis IL1403 and Lac. lactissubsp. cremoris MG1363, whereas 97.7% identitywas observed between the two subsp. cremorisstrains (Wegmann et al. 2007). Interestingly, acomplete set of competence genes was observedon the Lac. lactis subsp. lactis IL1403 genome,indicating that the strain may have the ability toundergo natural DNA transformation. The pres-ence of 17 unique genes belonging to the COG(clusters of orthologous groups) functionalcategory ‘carbohydrate metabolism and transport’in Lac. lactis subsp. cremoris MG1363 comparedto Lac. lactis subsp. cremoris SK11 suggests thatMG1363 has a greater capacity to grow on varioussugars, especially those found in plant material. Italso contains putative genes for the breakdown ofpolysaccharides with 1,4-glucosidic bonds such asmaltose and cyclodextrin. This among other factorswould suggest that the ancestor of Lac. lactissubsp. cremoris MG1363 occupied a plant-associ-ated niche (Wegmann et al. 2007). It has beensuggested that the ancestral strain adapted tosurvival in a milk environment by encompassingchanges in metabolic activity and also by acquiringDNA from other bacteria such as plasmids and

Lactococcus lactis IL1403 Streptococcus thermophilus CNRZ1066

Lactobacillus helveticusDPC4571

(c)(b)(a)

Figure 1 Circular genomes of Lactococcus lactis susbp. lactis IL1403 (a), Streptococcus thermophilus CNRZ1066 and Lactobacillus helveticus DPC4571

generated with DNA Plotter Software package (http://www.sanger.ac.uk/Software/Artemis/circular/). Outer blue lines represent 5¢-3¢ open reading frames,inner blue lines represent 3¢-5¢ open reading frames. Green ⁄ purple region represents GC content; green indicates GC content which is above average,

and purple indicates GC content which is below average. Inserts; scanning electron micrograph of Lac. lactis subsp. lactis (a), S. thermophilus (b) and

L. helveticus (c).

Vol 63, No 2 May 2010

� 2010 Society of Dairy Technology 151

mobile elements. The sex factor, a unique mobilegenetic element, was also observed on the genomeof Lac. lactis subsp. cremoris MG1363, which hasbeen shown to conjugate into Lac. lactis subsp.lactis IL1403 (Gasson et al. 1995; Wegmann et al.2007), supporting the ‘plastic’ genome nature ofthis strain. Overall, the three genomes show exten-sive gene synteny. The large genome inversionobserved in Lac. lactis subsp. cremoris MG1363when compared with Lac. lactis subsp. lactisIL1403 (Le Bourgeois et al. 1995) is representedby 48% of the MG1363 genome, whereas a 73-kbinversion was observed in the Lac. lactis subsp.cremoris SK11 genome when compared withIL1403. Reconstruction of the metabolic networkof Lac. lactis subsp. lactis IL1403 based on theannotated genome sequence established a total of621 reactions and 509 metabolites, representing theoverall metabolism of Lac. lactis subsp. lactis(Oliveira et al. 2005). Subsequently, enhancedmetabolic engineering strategies for improveddiacetyl-producing strains were identified.Many of the traits in lactococci which render

these microorganisms suitable for dairy fermenta-tions are in fact encoded on plasmids (Mills et al.2006). Indeed, traits such as lactose utilisation,casein breakdown, bacteriophage resistance, bacte-riocin production, antibiotic resistance, resistanceto and transport of metal ions, and exopolysaccha-ride (EPS) production have all been associatedwith extra-chromosomal plasmid DNA. In manycases, this plasmidosome ⁄plasmid complement canbe considered to be responsible for the individual-ity in terms of most commercial traits observedbetween different lactococcal strains. Plasmidsisolated from lactococci range in size from 3 to130 kb, have a G+C content of 30–40% and varyin function and distribution, with most strainscarrying between 4 and 7 per cell (Davidson et al.1996). The difference in G+C content betweenlactococcal plasmids and genomes (36–38%) sug-gests that many of these plasmids may be recentadditions to the genome enabling their host toperform efficiently in milk. Screening for lactococ-cal plasmids with valuable industrial traits andfood-grade selectable markers is still a very worth-while process, particularly if these plasmids areself-transmissible, as the encoded traits can bemobilised in a food-grade manner which does notrender them classified as GMO.

Streptococcus thermophilusS. thermophilus is considered the second mostimportant industrial starter after lactococci (Fox1993). Indeed, it has been estimated that over 1021

live S. thermophilus cells are consumed annuallyby the human population (Hols et al. 2005). It is amember of the thermophilic LAB and has beentraditionally used in combination with

Lactobacillus delbreuckii subsp. bulgaricus or Lac-tobacillus helveticus at a high process temperature(45�C) for the manufacture of yogurt and so-calledhard ‘cooked’ cheeses (e.g. Emmental, Gruyere,Grana) (Tamime and Deeth 1980; Fox 1993). Thisbacterium is also used alone or in combinationwith lactobacilli for the production of Mozzarellaand Cheddar cheeses (Fox 1993). In addition, thisstrain also has some reputation as a probiotic, alle-viating symptoms of lactose intolerance and othergastrointestinal (GI) disorders (Guarner et al.2005; Kligler and Cohrssen 2008). However, thisis rather controversial as S. thermophilus is notnormally associated with the GI tract but hasrecently been shown to survive GI transit inhealthy volunteers (Matar et al. 2005). In addition,the strain S. thermophilus TH-4 was recentlyshown to reduce the severity of intestinal mucositisby 13% in rats treated with the chemotherapeuticagent 5-Fluoracil, and both the TH-4 live cells andTH-4 supernatant exhibited an inhibitory effect oncrypt fission, suggesting therapeutic potential forthe prevention of disorders such as colorectal carci-noma (Whitford et al. 2009). To date, three com-plete genome sequences are publicly available forS. thermophilus (Mayo et al. 2008); S. thermophi-lus CNRZ1066, S. thermophilus LMD-9 and S.thermophilus LMG18311 (Figure 1b). While S.thermophilus is closely related to Lac. lactis it isactually more closely related to human pathogenicstrains of streptococci such as Streptococcus pneu-moniae, Streptococcus pyogenes and Streptococcusagalactiae (Hols et al. 2005). However, the mostimportant pathogenic determinants are eitherabsent or present as pseudogenes, unless theyencode basic cellular functions (Bolotin et al.2004). S. thermophilus has therefore diverged fromits pathogenic relatives to occupy the well-definedecological niche of milk. All three sequencedstrains harbour genomes of approximately 1.8 Mb.Strain CNRZ1066 was found to contain 1915 pro-tein coding regions while strain LMD-9 contains1710 and strain LMG18311 contains 1889. Com-parative analysis of the genomes of strainsCNRZ1066 and LMG18311 indicated that approx-imately 80% of the open reading frames (ORFs) ofboth strains are orthologous to other streptococcalgenes, indicating that S. thermophilus and its path-ogenic relatives share a substantial part of theiroverall physiology and metabolism (Hols et al.2005). Overall, approximately 3000 single nucleo-tide differences were observed between the twogenomes (0.15% polymorphism) (Hols et al.2005). It has been suggested that this level ofdivergence could have arisen in 107 generations,according to the estimated natural mutation rate(Ochman et al. 1999; Hols et al. 2005). Hols et al.(2005) have suggested that the common ancestorof the two strains may have lived 3000–

Vol 63, No 2 May 2010


30 000 years ago, roughly fitting with the durationof human dairy activity, which may have begunabout 7000 years ago (Fox 1993). Both strainswere found to share 90% similarity in the CDswhere the main differences concern genes associ-ated with extracellular polysaccharide biosynthesis,bacteriocin production and immunity, a remnantprophage and the presence or absence of theCRISPR (clustered regularly interspaced short pal-indromic repeats) locus, CRISPR2 (Bolotin et al.2004) (see Bacteriophage Resistance). Both strainswere found to contain CRISPR1. Interestingly,Horvath et al. (2008) recently characterised a novelCRISPR locus in the S. thermophilus genome,namely CRISPR3. A genome-scale metabolicmodel of S. thermophilus LMG18311 enabled itscomparison through direct projection on a meta-bolic map with those of Lac. lactis subsp. lactisand L. plantarum (Pastink et al. 2009). This exer-cise revealed the minimal amino acid auxotrophy(only histidine and methionine or cysteine) of S.thermophilus and the broad range of volatilesproduced by the strain compared to the other twobacteria. The unique pathway for acetaldehydeproduction, which is responsible for yogurt flavour,was also identified in S. thermophilus.Unlike Lactococcus, plasmids are thought to

play a relatively insignificant role in S. thermophi-lus, reported to be found in about 20–59% ofstrains examined (Madera et al. 2003; Turgeonet al. 2004; Renye and Somkuti 2008). Streptococ-cal plasmids are generally small, ranging in sizefrom 2.1 to 10 kb and encode few industriallyuseful phenotypic traits (Renye and Somkuti2008), which include low molecular weight, heat-stress proteins (Solow and Somkuti 2000; Petrovaet al. 2003; El Demerdash et al. 2006; Renye andSomkuti 2008), enolase and specificity subunits ofbacteriophage-resistant restriction modification(R ⁄M) systems (O’ Sullivan et al. 1999) (Solowand Somkuti 2001; El Demerdash et al. 2006).

LactobacillusLike S. thermophilus, the lactobacilli also belongto the thermophilic group of LAB starter cultures.Lactobacilli commonly used for dairy fermenta-tions include L. delbreuckii subsp. bulgaricus,Lactobacillus delbreuckii subsp. lactis, L. helveti-cus and Lactobacillus acidophilus (Thunell andSandine 1985) (Figure 1c). To date a number ofcomplete genome sequences are available for lacto-bacilli (Mayo et al. 2008), including the starterstrains L. delbreuckii subsp. bulgaricusATCC11842 (van de Guchte et al. 2006), L. del-breuckii subsp. bulgaricus ATCC BAA-365 withgenome sizes of �1.8 Mbp (Makarova et al.2006) and L. helveticus DPC4571 with a genomesize of �2.0 Mbp (Callanan et al. 2008). Interest-ingly, a general trend towards metabolic

simplification has been observed in this groupwhich appears to be related to the transition to anutritionally rich environment (Callanan et al.2008). Indeed, the genome sequence of L. del-breuckii subsp. bulgaricus ATCC11842 showssigns of ongoing reductive evolution with a sub-stantial number of pseudogenes and incompletemetabolic pathways and few regulatory functions(van de Guchte et al. 2006). Selective gene loss isalso a feature of the L. helveticus genome, particu-larly towards genes important for gut colonisation(Callanan et al. 2008).The use of L. delbreuckii subsp. bulgaricus with

S. thermophilus for yogurt manufacture has led tothe development of a complex symbiotic relation-ship between the two strains sharing the same eco-logical niche, called ‘protocooperation’ (Rasic andKurmann 1978; Tamime and Deeth 1980). Indeed,such is the close interaction between the twospecies that in-depth bioinformatic analysis hasindicated that various gene sets may have movedfrom one species to the other via horizontal genetransfer (Liu et al. 2009). Liu et al. (2009) havepredicted that genes involved in EPS productionhave transferred from S. thermophilus to L. del-breuckii subsp. bulgaricus, while genes involved inthe metabolism of sulphur-containing compoundshave transferred from L. delbreuckii subsp. bulgari-cus or L. helveticus to S. thermophilus. A particularratio of streptococci to lactobacilli in the starterinoculum is achieved through symbiosis and com-petition during growth (Oberg and Broadbent1993). The degradation of casein by lactobacillisupplies peptides and amino acids to the weaklyproteolytic streptococci, which in turn produceformic acid and CO2 to stimulate the growth oflactobacilli (Driessen et al. 1982; Thunell andSandine 1985). In a traditional thermophilic starterculture, streptococci predominate, but as the pHdrops below 5 they are succeeded by lactobacilli,resulting in an approximately 1:1 ratio (Oberg andBroadbent 1993). The ratio can be influencedthrough manipulation of the incubation temperatureand ⁄or pH (Oberg and Broadbent 1993). However,the balance between streptococci and lactobacilli iscritical for the quality of the final product. Interest-ingly, it has been reported that the rate of acidproduction in mixed lactobacilli and streptococcicultures is greater than the sum of the acid produc-tion of the two single cultures (Marshall 1987).Likewise, mixed thermophilic cultures are alsomore proteolytic than the sum of the individualcultures (Rajagopal and Sandine 1990).Members of the species Lactobacillus can be

found in a broad range of environmental nichesincluding fermented milk, meat and plant productsand they are routinely isolated from the vagina andGI tract (Callanan et al. 2008). Indeed, such is thewide niche-range of Lactobacillus, that O’Sullivan

Vol 63, No 2 May 2010


et al. (2009) identified a ‘barcode’ of nine niche-specific genes for use as an initial guide to indicatethe organisms’ ability to occupy a specific niche.Of the nine genes, six are dairy specific, encodingcomponents of the proteolytic system and restric-tion endonuclease genes, while the remaininggenes are identified as gut specific, encoding bilesalt hydrolase genes and a sugar metabolism gene.This 9-gene barcode could be particularly useful asan indication of strain suitability for dairy fermen-tations from new strains of Lactobacillus.While certain lactobacilli are used extensively in

the dairy industry as starters, other lactobacilliappear as natural contaminants in Cheddar cheese,presumably from the raw milk itself or from post-pasteurisation contamination. These microorgan-isms form the major component of the secondaryflora and are referred to as the nonstarter lactic acidbacteria (NSLAB) (Cogan et al. 2007). Duringcheese ripening, the starter bacteria and most otherorganisms in the curd die; they autolyse and releaseintracellular enzymes as ripening progresses(Khalid and Marth 1990). On the other hand, theNSLAB persist and can grow from levels of 102 to104 cfu ⁄g to � 108 cfu ⁄g after manufacture, wherethey can have a significant impact on flavour,either positively or negatively (Khalid and Marth1990; Cogan et al. 2007). In order to become anappropriate adjunct culture, it has been suggestedthat a Lactobacillus strain should reach and main-tain high levels of cell density during ripening,cause no defect in the product, and if possibleimpact positively on the overall quality of thecheese (Crow et al. 2001; Di Cagno et al. 2003). Ithas been suggested that addition of the adjunctcultures may be an indirect solution for controllingthe growth of non-desirable NSLAB in cheese(Crow et al. 2001; Di Cagno et al. 2003). Basedon this ethos, the technological properties of anumber of Lactobacillus strains isolated fromcheese were studied, including milk acidificationkinetics and proteolytic properties, as well as toler-ance to salts and phage resistance (Briggiler-Marcoet al. 2007). Interestingly, two strains, namelyLactobacillus casei I90 and Lactobacillus rhamno-sus I91 with low acidifying activity, were found tobe appropriate for use as adjunct cultures as theydid not alter the composition of the cheese productsand improved their sensory attributes.

Techniques for the identification of dairystarter culturesA recent study highlighted the importance of reli-able methods for the identification of LAB (Huyset al. 2006). Indeed, an analysis of 213 culturesfrom manufacturers, culture collections and aresearch institute indicated that more than 28%of the commercial cultures intended for humanand ⁄or animal use were misidentified at the

genus or species level, presumably due to the useof methods with limited taxonomic resolution orthat are unsuitable for reliable identification tospecies level. The analysis of small ribosomalDNA (rDNA) gene sequences, such as the 16SrDNA gene, undoubtedly marks a major mile-stone in the study of living microorganisms,providing vital information on evolutionary rela-tionships, classification and identification. Inter-estingly, all ribosomal RNA (rrn) operonsexamined in LAB have been shown to divergefrom the origin of replication, being compatiblewith their efficient expression and show acommon organisation of 5¢-16S-23S-5S-3¢ struc-ture, but differ in number, location and specificityof the tRNA genes (de Vries et al. 2006). Priorto this, classification of microorganisms wasbased on similarities in their morphological,developmental and nutritional characteristics(Lane et al. 1985). It became clear, however, thatclassification based on these criteria did notcorrelate well with evolutionary relationships, asdefined by sequence comparisons (Stackebrandtand Woese 1981). In addition, the application ofmorphological and biochemical tests for the iden-tification of microbial isolates was time consum-ing and often not discriminatory enough todifferentiate between closely related strains, hencerapid methods to identify microbial isolates hadthe potential to revolutionise the search for novelstarters. The use of DNA-based methods forbacterial detection, identification and diversityhas been extensively reviewed recently by Albu-querque et al. (2008) and Pontes et al. (2007).Using such techniques various genes, especiallyribosomal genes, have been targeted for probingor PCR-based strategies for the rapid and reliableidentification of LAB isolates, which has beenoutlined in Table 1. However, it is worth notingthat classification of Lac. lactis subsp. lactis andLac. lactis subsp. cremoris has been amendedover the years and has most recently beenaddressed by Rademaker et al. (2007) (see Lac.lactis). Randomly amplified polymorphic DNA(RAPD) fingerprinting can also provide fasttechniques for genotypic identification based oncluster analysis as well as for assessing sub-specific diversity, although the reproducibility ofthe technique is sometimes questionable (Mosch-etti et al. 1998, 2001; Tailliez et al. 1998; Corrol-er et al. 1999; Samarzija et al. 2002; Prodelalovaet al. 2005). Rep-PCR takes advantage of repeti-tive DNA elements which are randomly distrib-uted over the genome (Baldy-Chudzik 2001).Rep-PCR fingerprinting with the (GTG)5 primerwas recently revealed as a reliable and fast meansof identifying Lac. lactis subsp. lactis (Svec andSedlacek 2008). Indeed, nine presumptive entero-cocci isolated from surface waters generated a

Vol 63, No 2 May 2010


Tab

le1Primersandprobes

fortheidentification

ofcommon

startercultures

ofLAB

Microorganism

(PCRproductb

p,

digested

productb

p)Primer

⁄Probe

(Pb)

Methodofdistinction

TargetDNA

References

Lactococci

212R

La:CTTTGAGTGATGCAATTGCATC(Pb)

Hybridisation

16SrRNA

(Salam

aet

al.1991)

Lac.cremoris

68RCa:TGCAAGCACCAATCTTCATC(Pb)

Lac.lactis

subsp.lactis

PL1 1:AGTCGGTACAAGTACCAAC(Pb)

Hybridisation

toPCRproduct

ofV1or

V3region

16SrRNA

(Klijnet

al.1991)

Lac.lactis

subsp.lactisand

Lac.lactis

subsp.hordniae

PL1 2:G

CTGAAGGTTGGTACTTGTA(Pb)

Lac.lactis

subsp.crem

oris

PLc:TTCAAATTGGTGCAAGCACC(Pb)

Lactococcus

plantarum

PLp:CTACGGTACAAGTACCAGT(Pb)

Lactococcus

garvieae

PLg:CATAAAAATAGCAAGCTATC(Pb)

Lactococcus

raffinolactis

PLr:CGGTGAAGCAAGCTTCGGT(Pb)

Leuconostoc

spp.

PLC:C

ACCTTTCGCTGTGGTT(Pb)

Leuconostoc

lactis

PLC1:ATGCTAGAATAGGGAATGAT(Pb)

Leuconostoc

mesenteroides

PLCm:C

AGCTAGAATAGGAAATCAT(Pb)

rRNAregion

V1

P1:GCGGCGTGCCTAATACATGC&

P2:TTCCCCACGCGTTACTCACC

PCRbeforehybridisation

rRNAregion

V3

P3:GGAATCTTCCACAATGGGCG&

P4:ATCTACGCATTTCACCGCTAC

Lac.garvieae(430);Lac.raffinolactis

(450);Lac.lactis

(380);S.thermophilus&

Streptococcussalivarius(360);E.faecalis,

Enterococcuscasseliflavus,E

nterococcus

durans

(2bands:300&

400);Enterococcus

faecium(2

bands:410&

510);L

.delbreuckii

(2bands:320&

520);L

eu.m

esenteroides

(470)

G1:

GAAGTCGTAACAAGG&

L1:

CAAGGCATCCACCGT

PCRbasedon

inter-specific

polymorphism

ofISRa

16S-23S

ISR

(Blaiottaet

al.2002)

Lac.lactis

(238)

IRL:T

TTGAGAGTTTGATCCTGG&

LacreR:G

GGATCATCTTTGAGTGAT

PCR

16SrRNA

(Puet

al.2002)

Lac.garvieae(482)

IRL:T

TTGAGAGTTTGATCCTGG&

LgR

:AAGTAATTTTCCACTCTACTT

PCR

16SrRNA

Lac.plantarum

(860),Lac.piscium

(863),

Lac.raffinolactis(867)

IRL:T

TTGAGAGTTTGATCCTGG&

PiplraR

:CGTCACTGAGGGCTGGAT

PCRfollow

edby

restriction

digestionwithMboII

Lac.lactis

subsp.lactis,L

ac.lactis,subsp.cremoris

HaeIIdigestsonly

Lac.lactis

subsp.lactisproduct

MobIIdigestsonly

Lac.lactis

subsp.crem

orisproduct

IRL:T

TTGAGAGTTTGATCCTGG&

LacreR:G

GGATCATCTTTGAGTGAT

PCRfollow

edby

restriction

digestionwithMboII&

HaeII

Lac.lactis,subsp.cremoris(163)

CreF:G

TGCTTGCACCGATTTGAA&

LacreR:G

GGATCATCTTTGAGTGAT

PCR

Lac.lactis

subsp.lactis(163)

LacF:G

TACTTGTACCGACTGGAT&

LacreR:G

GGATCATCTTTGAGTGAT

PCR

Lac.lactis

subsp.lactis(600,190,410),Lac.lactis

subsp.crem

oris(560,190,370)

gadB

21:C

GTTATGGATTTGATGGATATAAAGC&

GAD7:ACTCTTCTTAAGAACAAGTTTAACAGC

PCRfollow

edby

restriction

digestionwithAseI

GAD

(Nom

uraet

al.2002)

Lac.lactis

subsp.lactis

Lac.lactis

subsp.crem

oris

Arbitrary

prim

er:T

GCTCTGCCC

RAPD-PCRClusterAnalysis

Arbitrary

(Corroleret

al.1999)

Vol 63, No 2 May 2010


Tab

le1(Continued)

Microorganism

(PCRproductb

p,

digested

productbp)

Primer

⁄Probe

(Pb)

Methodof

distinction

TargetDNA

References

Lac.lactis

subsp.crem

oris

P2:GATCGGACGG


Arbitrary

(Sam

arzijaet

al.2002)

DifferentiateLac.lactis

subsp.crem

oris

from

Lac.lactis

subsp.lactis

P15:C

TGGGCACGA

P16:T

CGCCAGCCA

P17:C

AGACAAGCC

S.thermophilus(968

bp)

Upstream:C

ACTATGCTCAGAATACA&

Dow

nstream:C

GAACAGCATTGATGTTA

PCR

LacZ

(Licket

al.1996)

S.thermophilus

XD9:GAAGTCGTCC


Arbitrary

(Moschettiet

al.2001)

Lactobacilli(250bp)

LbL

MA1-rev:CTCAAAACTAAACAAAGTTTC&

R16-1:CTTGTACACACCGCCCGTCA

PCR

16S-23S

ISR

(Dubernetetal.2002)

Lacticacidbacteria

BOXAIR:C

TACGGCAAGGCGACGCTGACG

Rep-PCRClusterAnalysis

Repetitiveelem

ent

(Moham

med

etal.2009)

Lacticacidbacteria

M13:G

AGGGTGGCGGTTCT


Arbitrary

(Rossettiand

Giraffa2005)

Lactobacilli(1004,200,250,300,350,500,700)

Streptococci(1004,180,200,550)

Bifidobacteria(1004,150,200,400)

16S1a

:GATTACATGCAAGTCGAACGA&

16S1b:T

TAACCCAACATCTCACGAC

ARDRAb:P

CRfollow

edby

restrictiondigestionwithMwoI

16SrRNA

(Collado

andHernandez

2007)

L.delbreuckiisubp.bulgaricus(700)

S.thermophilus(700)

Cysmet2F

:GGAACCTGAAGGCTCAAT&

Cysmet2R

:GTCAACCACGGTAAAGGTC

PCR

Methionine

biosynthesisgenes

(Cebeciand

Gurakan

2008)

L.delbreuckiisubp.bulgaricus(�

1500,650,850)

S.thermophilus(�

1500,700,850)

9699:A

TCCGAGCTCAGAGTTTGATCCTGGC&

9700:T

CAGGTCGACGCTACCTTGTTACGAC

ARDRA:P

CRfollow

edby

restrictiondigestionwithEcoR1

16srRNA

L.helveticus

(1.4

kb)

9857:C

TAGACAATCAATTGCACCG&

9860:T

ACCAGTTCTTCTTGAAGCC

PCR

SLH1probe

(DelleyandGermond2002)

L.delbreuckiisubsp.bulgaricus

(0.6

kb)

1378:C

TCATCATGTCGACCCGG&

1379:G

AGCAAGAAGCGTGATTT

pY85

probe

L.helveticus

(1500,3fragments)


(1500,no.of

smallm

igratin

gfragments)

9699:A


9700:T


ARDRA:P

CRfollow

edby

restrictiondigestionwithCfo1

16srRNA

L.helveticus

(1500,680,820)


(1500,620,820)

L.delbreuckiisubsp.lactis(1500,1440)

L.delbreuckiisubsp.delbreuckii(1500,1440)

9699:A


9700:T


ARDRA:P

CRfollow

edby

restrictiondigestionwithEcoR1

L.acidophilu

s(397)

LAcF:G

GAAGCTCAAGACCAAATCATG&

LAcR

:CTTCTTCAAAACATAAACTTGTG

PCR

Elongationfactor

Tugene

(tuf)

(Sheuet

al.2009)

L.caseigroupc

(202)

LCgF

:ATCATGGAATTGATGGATACCA&

LCgR

:TAGACTTGATAACATCTGGCTT

L.delbreuckii(230)

LDeF:T

ACTGTTAAGGTTGGCGACAGC&

LDeR

:TGTAGACTTGGCCCTTGAAAGT

Bifidobacteriumlongum

(161)

BLoF

:GTATCCGTCCGACCCAGCAG&

BLoR

:GGTGACGGAGCCCGGCTTG

Lac.,Lactococcus;L

eu.,Leuconostoc;S

.,Streptococcus;E

.,Enterococcus;L.,Lactobacillu

s.Sizes

ofrestricted

productshave

been

provided

whereavailable;

a ISR,intergenicspacerregion;bARDRA,amplified

ribosomalDNArestrictionanalysis;cL.caseigroup=L.casei,L

actobacillu

sparacasei,L.rhamnosusandLactobacillu

szeae.

Vol 63, No 2 May 2010


homogeneous cluster that matched fingerprintsrevealed by Lac. lactis subsp. lactis. Rep-PCRwas also recently used to identify a selection ofLAB isolates from the Delta area of Egypt usingthe BOXAIR primer (Mohammed et al. 2009).The technique of pulsed field gel electrophoresis

(PFGE), which involves restriction digestion ofunsheared genomic DNA followed by separationon agarose gels using a constantly reorienting elec-tric field (Lai et al. 1989), has also been utilisedfor species and strain identification based on clusteranalysis. However, the genomic fingerprints gener-ated through PFGE provide a powerful tool fordirect comparison of strains for determininggenetic relatedness. MLSA uses unambiguouslycharacterised genomic relatedness at inter- andintraspecific levels through sequence analysis of 7–9 housekeeping genes or other protein-coding genesequences and is extremely useful for generatingbiologically meaningful and functional groupings(Maiden et al. 1998; Rademaker et al. 2007).MLSA has been successfully used in many studiesto analyse the relative contribution of recombina-tion and (point) mutation to clonal diversification,for the study of niche-specific phylogeny andmicrobial diversity (Maiden et al. 1998; Hommaiset al. 2005; Bougnoux et al. 2006). The portabilityof this technique makes it highly attractive, assequence data can be compared readily betweenlaboratories (Maiden et al. 1998). While MLSA isprimarily used in epidemiology, Rademaker et al.(2007) recently used the technique to study thediversity within dairy and non-dairy Lac. lactis iso-lates and generated significant data for the sub-spe-cific classification of Lac. lactis, as already seen.However, all of these techniques will probably

be overshadowed or superseded in the future bytotal genome sequencing of strains, which is nowalmost becoming a viable option for even screen-ing purposes as the cost of sequencing decreases.Indeed, first generation sequencers (based on theSanger method) have been superseded by secondgeneration sequencers, which are based on massiveparallel analysis (Kato 2009) and promise ultra-fastand inexpensive delivery of DNA sequence infor-mation. At the time of writing, three-second gener-ation sequencers are currently commerciallyavailable (Kato 2009): Roche (FLX) (Margulieset al. 2005), Illumina Genome Analyser (GA)(Bentley 2006) and Lifetechnologies SOLiD(Nutter 2008; Pandey et al. 2008). These technolo-gies use PCR products from single molecules astemplates. FLX produces the longest reads (�400base pairs) with approximately 1 000 000templates per run. GA and SOLiD produce shorterreads (50–75 base pairs) but the number oftemplates per run is much larger (100 000 000–85 000 000) (Kato 2009). Interestingly, PacificBioscience Inc. (Menlo Park, CA, USA) is

currently developing a new sequencer which,according to Kato (2009), should be categorised asthird generation. The sequencer uses single DNAmolecules as templates and enables real-time moni-toring of nucleotide incorporation with DNA poly-merase. Moreover, the reads are much longer thanthe reads produced by second generation sequence-rs, being several kilobases in length.

Industrially significant traits ⁄ functionalpropertiesIndustrially significant traits or functional proper-ties define those characteristics of starter cultureswhich can impact on both the production and finalquality of the product. The five major characteris-tics which have a bearing on almost all fermenta-tions at some point include lactose metabolism andflavour production, bacteriophage (phage) resis-tance, antimicrobial activity and EPS production.

Lactose metabolismThe phosphoenol pyruvate-dependent sugar phos-photransferase system (PEP-PTS) which catalysesthe transport and subsequent phosphorylation ofcarbohydrates is the main sugar uptake system inlactic acid and other bacteria (Postma et al. 1993;de Vos and Vaughan 1994; van den Bogaard et al.2004). In lactococci, lactose-phosphate accumu-lates intracellularly and is hydrolysed to glucoseand galactose-6-phosphate by the enzyme phos-pho-b-galactosidase as part of the tagatose pathway(Monnet et al. 1996). The genes encoding thePEP-PTS and the tagatose-6-phosphate pathwayhave been located to plasmids, arranged in anoperon which is induced up to 10-fold by growthon lactose (de Vos and Gasson 1989; de Vos et al.1990; van Rooijen et al. 1991; de Vos andVaughan 1994). The second mechanism in lacto-cocci is more common in prokaryotes and trans-ports lactose into the cell using integral membraneproteins called permeases. These enzymes translo-cate lactose into the cell cytoplasm without chemi-cal modification where lactose transport is coupledto proton symport. The lactose is then metabolisedto glucose and galactose by b-galactosidase as partof the Leloir pathway (Monnet et al. 1996). Itappears that intensive industrial use of lactococcihas probably selected for strains which utilise theplasmid-encoded enzyme phospho-b-galactosi-dase. On the other hand, S. thermophilus does nottransport lactose via the PEP-PTS system but bythe dedicated permease LacS (Foucaud andPoolman 1992). The internalised lactose is thenhydrolysed by b-galactosidase to glucose andgalactose, the latter of which is not utilised butexcreted into the growth medium. A comparison ofthe gal-lac gene cluster from 18 S. thermophilusstrains isolated from a variety of sources revealedthat the vast majority of strains were able to utilise

Vol 63, No 2 May 2010


only glucose, lactose and sucrose, while somecould utilise fructose (van den Bogaard et al.2004). However, two strains were able to grow ongalactose. Molecular characterisation revealedup-mutations in the galTKE (galactose utilisationgene cluster) promoter in these two strains. Thusthe loss of galactose-fermenting ability can beattributed to the low activity of the promoter, pre-sumably as a consequence of adaptation to growthin milk (van den Bogaard et al. 2004). WithinLAB the internalised glucose is converted to pyru-vate via the glycolytic pathway, with the resultantproduction of ATP mainly through substrate levelphosphorylation. The environment is graduallyacidified through the conversion of pyruvate to lac-tate by lactate dehydrogenase (LDH), an essentialprocess for the regeneration of NAD+ used duringglycolysis (Ramos et al. 2002; Neves et al. 2005;Fernandez et al. 2008).Interestingly, a number of studies surrounding

lactococci have reported the shift from homolactic(lactate production) to mixed acid fermentation(ethanol, acetate and formate production) (Neveset al. 2005) in glucose-limited chemostats (Tho-mas et al. 1979), and during the metabolism ofgalactose (Thomas et al. 1980) or maltose (Lohme-ier-Vogel et al. 1986). Thus homolactic metabo-lism operates when the glycolytic flux is highduring growth on rapidly fermenting carbonsources such as glucose (Kowalczyk and Bardow-ski 2007). However, despite the wealth of informa-tion which exists (allosteric modulation ofenzymes, metabolite levels, and transcript andprotein levels) the factors behind the metabolicswitch remain elusive (Neves et al. 2005). PartialDNA arrays using Lac. lactis subsp. lactis IL1403revealed that several glycolytic genes wereexpressed to higher levels on glucose, whereasgenes of mixed acid fermentation were expressedhigher on galactose (Even et al. 2001). The studyalso suggested that mRNA translation was regu-lated by a sugar-dependent mechanism, as compar-ison of enzyme synthesis with transcriptconcentration indicated that some translationalregulation occurs with threefold higher transla-tional efficiency in glucose-grown cells than ingalactose-grown cells. It is envisaged that experi-mentation and modelling using the various ‘omic’disciplines will help elucidate the complete meta-bolic and regulatory networks of the LAB. Thistype of approach has been applied to study theregulation of glycolysis in lactococci, providinginsight into the principles that govern its operation(Voit et al. 2006). Indeed, based on an uncom-pleted path it was shown that the feed-forwardactivation of pyruvate kinase by fructose 1,6-bisphosphate provides a crucial mechanism forpositioning the starving organism in a holdingpattern that allows immediate uptake of glucose as

soon as it becomes available. An integrative exper-imental and modelling approach was also used tostudy metabolic pH response in Lac. lactis subsp.cremoris MG1363, which predicts that the lowerpool of phosphoenol pyruvate (PEP) available tofuel glucose uptake via the PEP-dependent trans-port system is the major cause of the decrease inthe glycolytic rate, upon lowering the extra-cellularpH (Andersen et al. 2009). A proteomic approachwas used to study cellular changes associated withacid adaptation in L. delbreuckii subsp. bulgaricussupported by transcription data (Fernandez et al.2008). Indeed, it was found that three major effectsresult in a re-routing of pyruvate metabolism tofavour fatty acid biosynthesis: (i) induction of thechaperones GroES, GroEL, HrcA, GrpE, DnaK,DnaJ, ClpE, ClpP and ClpL, and the repression ofClpC, (ii) induction of genes involved in the bio-synthesis of fatty acids and (iii) repression of genesinvolved in the mevalonate pathway of isoprenoidsynthesis.

Flavour production and metabolic engineeringThree main pathways are associated with flavourproduction in fermented products: glycolysis(conversion of lactose); lipolysis (conversion offat) and proteolysis (conversion of caseins) (Smitet al. 2005). While lactate is the main productgenerated from lactose conversion, a fraction ofthe intermediate pyruvate can alternatively beconverted to diacetyl, acetoin, acetaldehyde oracetic acid (some of which can be important fortypical yogurt flavours). The contribution of LABto lipolysis is relatively little, but proteolysis is thekey biochemical pathway for flavour formation.Degradation of caseins by the activities of rennetenzymes and the cell-envelope proteinase andpeptidases yields small peptides and free aminoacids, the latter of which can be further convertedto various alcohols, aldehydes, acids, esters andsulphur compounds for specific flavour develop-ment (Smit et al. 2005).Metabolic engineering has been applied to LAB

to increase the production of various desirableflavour compounds. For example, while lactococcinormally convert sugar to lactic acid, it is knownthat the enzymatic machinery does exist for otherproducts (Kleerebezem and Hugenholtz 2003).The re-routing of pyruvate metabolism in Lacto-coccus has led to many successful metabolic engi-neering approaches. Indeed, diacetyl productionfrom glucose and lactose as opposed to citrate wasachieved by either disruption of LDH or NICE(nisin-inducible expression) overproduction ofNADH oxidase. High diacetyl production levelswere achieved by combining the above strategywith disruption of a-acetolactate decarboxylase(Hugenholtz et al. 2000). In terms of flavourproduction from amino acids, transaminases

Vol 63, No 2 May 2010


initially convert the amino acids to the correspond-ing a-keto acids while transferring the amino groupto a-ketoglutarate, a key step in flavour develop-ment, but availability of a-ketoglutarate can be arate-limiting step in cheese ripening (van Hylck-ama Vlieg et al. 2006). The enzyme glutamatedehydrogenase (GDH) converts glutamate to a-ketoglutarate. A gene encoding GDH was clonedfrom a non-dairy Lac. lactis strain where therecombinant strains exhibited elevated amino acidtransformation activities (Tanous et al. 2002,2005). This study highlights the metabolic potentialwhich exists amongst the natural diversity. Inanother example, the carbon flux of Lac. lactissubsp. cremoris was re-routed towards productionof alanine, an amino acid with a sweet flavour, byexpressing the Bacillus sphaericus alanine dehy-drogenase with the NICE system (Hols et al.1999). Moreover, expression of alanine dehydroge-nase in an LDH-deficient strain permitted produc-tion of alanine as the sole end product(homoalanine fermentation). Finally, stereospecificproduction (> 99%) of L-alanine was achieved bydisrupting the gene encoding alanine racemase(Hols et al. 1999).A complete understanding of the metabolic

potential of an organism, established throughknowledge of gene function, pathway reconstruc-tion and prediction of phenotype through metabolicmodels, is a powerful tool in developing metabolicengineering strategies (de Vos and Hugenholtz2004; Smid et al. 2005). The ‘omics’ technologiesare undoubtedly playing a significant role inadvancing metabolic engineering techniques byproviding insight into metabolic pathways and newopportunities for diverting metabolism towardsdesirable phenotypes.

Bacteriophage resistanceWhile total loss of final product as a result of phageinfection is infrequent nowadays, phage infectioncontinues to result in quality defects that affect theflavour, texture and even safety of dairy productsand so continues to receive attention in bothresearch and manufacturing communities. Phageresistance mechanisms are probably best character-ised in the lactococci. Indeed, within lactococcithere are four main cellular defences which inter-fere with different stages of the phage lytic cycle,namely, adsorption inhibition (Ads), injectionblocking, R ⁄M and abortive infection (Abi). TheAds phenotype prevents the attachment of thephage particle to the cell surface and can often beinduced through the generation of bacteriophage-insensitive mutants (BIMs) (Mills et al. 2007). InLactococcus, this has been attributed to non-specific point mutations in chromosomal genesencoding cell receptor sites by masking ofreceptors through, for example, polysaccharide

production (Forde and Fitzgerald 1999). Poten-tially, one of the most exciting breakthroughs inphage resistance research recently is the study of S.thermophilus BIMs. Interestingly, within strepto-cocci the CRISPR loci have recently been shownto play a role in BIM formation. These loci consistof highly conserved repeats of approximately 21–48 base pairs which are separated by variablesequences of constant and similar length, calledspacers of approximately 20–58 base pairs (Grissaet al. 2007; Horvath et al. 2008). It has beenshown that BIMs of S. thermophilus can integratenovel spacers (short sequences from foreign DNA)into their CRISPR loci in response to phage attack(Barrangou et al. 2007; Horvath et al. 2008; Millset al. 2009) and appear to promote cellular individ-uality within an otherwise homogeneous popula-tion (Mills et al. 2009). It has been proposed thatthese spacers function as small interfering RNAs,base-pairing with target mRNAs, promoting theirdegradation or translation shutdown (Brouns et al.2008; Sorek et al. 2008), thus resulting in termina-tion of the phage lytic cycle (Figure 2). A recentcomparative study of the CRISPR loci in LAB ge-nomes resulted in the identification of multipleCRISPR families within Bifidobacterium and Lac-tobacillus as well as Streptococcus, and similarCRISPR loci were found in distant organisms, sug-gesting that these loci have evolved independentlyin select lineages, partly due to selective pressurefrom phage predation (Horvath et al. 2009).Exploitation of the CRISPR system offers manyopportunities for strain improvement such as straintyping, engineered defence against phage, selectivesilencing of endogenous genes (Sorek et al. 2008),as well as development of intelligent starter rota-tion strategies through exploitation of the diversityintroduced into an otherwise homogeneous popula-tion (Mills et al. 2009).To date there has only been one report of a lacto-

coccal plasmid-encoded injection blocking mecha-nism, which prevents the injection of phage DNAinto the cell, and this has been associated withthe plasmid pNP40 (Garvey et al. 1996). However,although the complete nucleotide sequence ofpNP40 has been revealed, the genetic determinantsencoding injection blocking have not been identi-fied even after the plasmid was ‘scanned’ throughcreation of a deletion derivative and multiplesubclones (O’ Driscoll et al. 2006). It has beensuggested that the resistance may be attributable tosynergistic enhancement of the already character-ised resistance systems on pNP40, namely two Abisystems (AbiE and AbiF) and the temperaturesensitive R ⁄M system (LlaJ1).R ⁄M systems digest foreign DNA that has

entered the cytoplasm but the host DNA remainsintact. These enzymes have been classified intothree groups based on molecular structure,

Vol 63, No 2 May 2010


sequence recognition, cleavage position and theco-factors required (Bickle and Kruger 1993). TypeI R ⁄M systems consist of three subunits: HsdR,restriction endonuclease (digests foreign DNA);HsdM, methylase (protects the host DNA) andHsdS, specificity subunit of the endonuclease orthe methylase. Interestingly, many lactococcalplasmids encode an hsdS locus without having thecognate hsdR and hsdM subunits. HsdS subunitsby themselves serve a valuable role as they func-tion in trans; capable of interaction with hsdR andhsdM subunits encoded on other DNA elements(Schouler et al. 1998; O’ Sullivan et al. 1999,2000; Boucher et al. 2001). A typical type II R ⁄Msystem is composed of two distinct gene products,one of which encodes a sequence-specific endonu-clease and the other a cognate methyltransferase.Interestingly, the streptococcal R ⁄M systemSth368I is encoded on an integrative conjugativetransposon called ICESt1 carried by S. thermophi-lus CNRZ368 (Burrus et al. 2001). A recent studydemonstrated that ICESt1, along with anothertransposon, ICESt3, can be transferred by conjuga-tion to other S. thermophilus strains (Bellangeret al. 2009). Moreover, ICESt3 was also success-fully transferred to other Firmicutes includingEnterococcus faecalis, S. pyogenes and Lac. lactissubsp. cremoris. This study demonstrates thepotential for mobilisation of industrially relevanttraits to desirable streptococcal starters, a techniquewhich has proven to be extremely useful for

generating industrially robust strains of Lactococ-cus (Mills et al. 2006).Constant exposure to phage has resulted in the

evolution of a diverse range of defence mecha-nisms in lactococci, including a large range of dif-ferent Abi systems. This mechanism comes intoplay after injection of phage DNA and includes abroad range of defences which can interfere withgenome replication, transcription, translation andpackaging or assembly of phage particles. Thisinterruption of phage development leads to therelease of few or no phage and to the death of theinfected cell, thus further propagation of phage isprevented and the bacterial population survives(Chopin et al. 2005). Of the 21 Abi’s identified inLactococcus to date most are plasmid encoded andrange from AbiA to AbiV. The phenotype is mostoften conferred by a single gene, although there area few exceptions where the involvement of twogenes has been proposed (AbiE, G, L and T).Protein homology has rarely been observedbetween lactococcal Abis and no homology withknown proteins has been found, preventing anyprediction being made on their mode of action(Chopin et al. 2005).

Bacteriocin productionBacteriocins are polypeptides produced ribosomal-ly by bacteria and can have a bacteriocidal orbacteriostatic effect on other bacteria (Ross et al.2002). In general bacteriocins lead to cell death by

938-BIM 5000.1aCSK938

938-BIM 5077.1a

938-BIM 5102.1a

+3

S. thermophilus CSK938

CRISPR1

938-BIM 5002.1a

CRISPR3

CSK938

938-BIM5077.1a

Spacer Acquisition: +1 +4 –2

Spacer Acquisition: +2

S. thermophilus CSK938

(a)

(b)

Figure 2 Diagrammatic representation of the clustered regularly interspaced short palindromic repeats (CRISPR) loci: the CRISPR associated (cas) genes are

represented as arrows, repeats and direct repeats are represented as grey and black boxes. The initial 6 spacer regions of the parent strain CSK938 (located at

the 5¢-region after the leader sequence) are indicated in the dark boxes (a) CRISPR 1, (b) CRISPR3. Following exposure to phage, the resulting bacterio-

phage-insensitive mutants (BIMs) are indicated on the right hand side of the parent strain. New spacer sequences are indicated in the coloured boxes. Numbers

below the boxes indicate the number of spacers acquired (+) or deleted ()) in the BIMs [adapted from Mills et al. (2009)].

Vol 63, No 2 May 2010


inhibiting cell wall biosynthesis or by disruptingthe membrane through pore formation (Twomeyet al. 2002). Bacteriocins are therefore importantin food fermentations where they can prevent foodspoilage or the inhibition of food pathogens. Thebacteriocins of LAB have been classified into asmany as five groups (Klaenhammer 1993; Neset al. 1996; Kemperman et al. 2003) but thisclassification scheme has been recently revised tocontain two distinct categories (Cotter et al. 2005).Within this system, bacteriocins are divided intoeither lanthionine-containing bacteriocins (class I)(lantibiotics) or the non-lanthionine-containingbacteriocins (class II). Lantibiotics contain post-translationally modified amino acids such as lanthi-onine, b-methyllanthionine and the dehydratedresidues dehydroalanine and dehydrobutyrine.Within the newly proposed classification system,the large, heat-labile murein hydrolases (formerlyclass III bacteriocins) have been moved from classIII and designated ‘bacteriolysins’ (Cotter et al.2005). The lantibiotic nisin has gained widespread

application in the food industry and is used as afood additive in at least 50 countries, particularlyin processed cheese, dairy products and cannedfoods (Delves-Broughton 1990). It has been addedto the positive list of food additives by the EU asadditive number E234 (European Economic Com-munity 1983; Twomey et al. 2002). The geneticmachinery for production of and immunity to nisinis encoded on a self-transmissable transposon andso can be transferred in a food-grade mannerbetween strains, offering an ‘in-built’ protection infermented foods against undesirable microbiota.Another useful bacteriocin in terms of starter

culture improvement is lacticin 3147, encoded onthe 60.2 kb plasmid, pMRC01. Interestingly, theproducing strain was isolated from an Irish butter-milk plant used domestically for bread making(Figure 3). To date this plasmid has been trans-ferred to over 30 different lactococcal hosts, manyof which are derivatives of commercial starterstrains (Ryan et al. 1996; Coakley et al. 1997).Lacticin 3147 has been shown to be effective in

traJtraK

traL

traI

orfU

repB IS6770

IS946

IS946

ltnEltnF

ltnIltnR

ltnA2ltnA1

ltnM1ltnM2

ltnT

ltnD

traAtraB

traCtraD

traEtraF

ltrC

binR

tetD

binR

rggorf18

orf12

LtnA1

LtnA2

5

4

3

Log 1

0 C

FU

ml–

1

2

1

00 30 60 90 120

Time (min)

Figure 3 Circular diagram of pMRC01. Open reading frames are represented as arrows, blue arrows represent the lacticin 3147

operon. LtnA1 and ltnA2 encode the structural peptides, for which the protein structure is provided (inset). Survival levels of

Listeria monocytogenes at 16�C when inoculated into a 16-h ( ) Lactococcus lactis subsp. lactis DPC4268 (bacteriocin

negative) and ( ) L. lactis subsp. lactis DPC4275 (lacticin 3147 producer) fermentate. Error bars represent the standard

deviation of triplicate experiments (O’Sullivan et al. 2006). Lacticin 3147 production from producing lactococcal strain (colony)

against indicator organism (insert).

Vol 63, No 2 May 2010


many food systems for the control of food spoilageor pathogenic bacteria (McAuliffe et al. 1999;Ross et al. 1999; Morgan et al. 2001; O’Sullivanet al. 2006).Bacteriocin-producing LAB have also been

applied to improve the flavour and quality of fer-mented foods through two strategies; by using bac-teriocin-producing LAB to control adventitiousmicrobial populations i.e. NSLAB (Ryan et al.1996) and secondly by using bacteriocin-producingLAB as cell lysis-inducing agents to increase therate of proteolysis in cheese (Morgan et al. 1997;O’ Sullivan et al. 2002).Many strategies have been developed for the

detection of antibacterial production by micro-organisms including phenotypic methods usingindicator strains (Morgan et al. 2000; Vesterlundet al. 2004; O’Shea et al. 2009) and liquid chro-matography ⁄mass spectrometry techniques (Zendoet al. 2008). The detection and identification ofbacteriocins in producing strains has also beengreatly aided by PCR amplification of putativebacteriocin genes using specific primers designedto known bacteriocins (Trmcic et al. 2008) and byin silico searching amongst bacterial DNAsequences (Draper et al. 2009).

Exopolysaccharide productionEPSs play a major role in the production ofyogurt, cheese, fermented cream and milk-baseddesserts (Jolly et al. 2002) where they contributeto texture, mouth-feel, taste perception andstability of the final products (Crescenzi 1995;Hassan 2008). Two forms of EPSs are producedby LAB, capsular and unattached (Hassan 2008).Capsular EPSs form capsules around the cell walland are not secreted into the medium. UnattachedEPSs are secreted outside the cell wall of the pro-ducer and are responsible for the ‘ropy’ pheno-type observed in fermented milks. Microbialpolysaccharides are divided into two groups basedon their sugar composition, the homopolysaccha-rides and the heteropolysaccharides. Homopoly-saccharides contain only one sugar type, either D-glucopyranose or D-fructofuranose (Monsan et al.2001). Heteropolysaccharides are composed of arepeating unit that contains two or more differentmonosaccharides (Laws et al. 2001). The geneticmachinery responsible for EPS production in lac-tococci is generally encoded on large operonscontaining more than 10 genes. Indeed, in thecase of the 42-kb mobilisable plasmid pNZ4000,the EPS gene cluster is composed of 14coordinately transcribed genes which express theglucosyltransferases involved in synthesis andassembly of the EPS-repeating unit (vanKranenburg et al. 1999). As the producing strainsare food-grade, the EPSs are also consideredfood-grade. In addition, it has been suggested that

these EPSs are active as prebiotics (Gibsonand Robertfroid 1995), cholesterol-lowering neu-traceuticals (Nakajima et al. 1992) and immuno-modulants (Kitazawa et al. 1993; Hosono et al.1997). EPS-producing strains of S. thermophilusare also highly desirable in the dairy industry asthey have been shown to improve the functionalproperties of low-fat or part-skim Mozzarellacheese (Petersen et al. 2000; Zisu and Shah2005). In addition, EPS-producing strains of S.thermophilus and L. delbreuckii subsp. bulgaricushave been shown to enhance the texture andviscosity of yogurt and to reduce syneresis (Has-san et al. 2003; Doleyres et al. 2005). Broadbentet al. (2003) extensively reviewed the topic ofEPS production in S. thermophilus, providing adetailed overview of its biochemistry, geneticsand applications. With regard to the geneticmachinery encoding EPS production in S. thermo-philus, it has been suggested that a dozen or moreunique eps gene clusters may occur (Rallu et al.2002). These clusters range in size from 15 to20 kb and are chromosomally encoded. The 5¢-region of each cluster has been suggested toencode proteins involved in regulation of EPSsynthesis, chain length determination and mem-brane translocation (Broadbent et al. 2003). The3¢-end encodes the proteins involved in mem-brane translocation of the polymer subunits andenzymes required for production of sugar nucleo-tide precursors, while the intervening region con-tains genes encoding the glycosyl-1-phosphatetransferase and glycosyltransferases required forassembly of the basic repeating unit and enzymesinvolved in repeat unit polymerisation (Broadbentet al. 2003). S. thermophilus eps gene clusters areflanked by conserved regions of DNA which arenot directly involved in EPS production. The 5¢-region is flanked by deoD, which encodes ahomolog to purine nucleoside phosphorylase,whereas the 3¢-end is flanked by orf14.9. How-ever, some eps gene clusters extend beyondorf14.9 (Broadbent et al. 2003). The EPS-produc-ing capacity in S. thermophilus is a relativelyunstable characteristic which may be explained bythe presence of IS elements directly flanking oreven within eps gene clusters. For example, theloss of EPS production in a spontaneous mutantof S. thermophilus Sfi39 was associated withIS905 transposition into the epsF gene (Germondet al. 2001). Studying the genetics of EPS produc-tion in LAB should increase our knowledge of therequirements for the phenotype and should alsoprovide genetic markers that can be targeted inscreening approaches, such as PCR, to enablerapid detection of strains producing the desiredEPS. However, a lot of non-producing strains canshow up positive in such screens and vice versa,indicating that screening for EPS at the molecular

Vol 63, No 2 May 2010


level is not absolutely reliable and should alwaysbe accompanied by another screening method.

Future of starter culture research: systemsbiologyGenome-scale metabolic models permit in silicopredictions of gene function and hence provideinsight into the metabolic potential of an organism.This technology has paved the way towards a newtype of science which aims to understand biolo-gical systems in their entirety through multi-disciplinary approaches, collectively falling underthe term systems biology. Indeed, systems biology,which has been called the 21st century science, is arelatively new area broadly defined as the inter-dis-ciplinary study of the integrated and interactingnetwork of genes, proteins and biochemical reac-tions in a living organism, being integrative ratherthan reductive (Figure 4). It combines all the‘omic’ technologies, beginning with genomics andincludes transcriptomics, describing the study ofthe complete set of transcripts in a cell under a par-ticular set of conditions; proteomics, whichinvolves the study of the protein complement pro-duced by an organism; metabolomics, describingthe metabolite profile; and interactomics, whichdescribes the complex studies of these interactions,alongside mathematical modelling techniques tobuild models for biological interpretation and pre-diction of behaviour (Teusink and Smid 2005),thus encompassing a broad range of disciplines.Therefore, the sequenced genome is merely the

starting point, providing the doorway to the amal-gamation of a great deal of information, via experi-mentation and modelling using the various ‘omic’disciplines. We have seen how this approach hasbeen used to study regulation of glycolysis (Voitet al. 2006) and metabolic pH response (Andersenet al. 2009) in Lac. lactis. Systems biology thusprovides a powerful tool for a holistic view of anorganism’s metabolic potential rather than focusingon single events and will undoubtedly have a hugeimpact on the future course of starter cultureresearch. Indeed, understanding the interplay andinfluences between a starter’s genome and thedairy environment will ultimately transform ourunderstanding of dairy fermentations as a whole,enabling scientists to discover new properties ofstarter cultures, and will probably change how wemake culture selections and what cultures we selectfor the future, and even how we use them.

CONCLUS IONS

Our understanding of living microorganisms hasincreased dramatically in the last few decades,particularly with the advent of numeroussequenced bacterial genomes, which has ultimatelyled to a rapid understanding of bacterial functional-ity. The ultimate goal is to link genome with prote-ome and metabolome so that each compound orsignificant trait can be directly linked to its geneticcounterpart on the genome. This will provide thekey to genetic markers which will form the basis

Annotated genome sequence

Identify complete set of transcripts (Transcriptomics)

Identify protein complement (Proteomics)

Identify flavour compounds (Metabolomics)

Construct metabolic pathways

(Interactomics)

Mathematical modelling for prediction of strain behaviour

Select cultures with desirable traits

Knowledge-based selection of cultures

In-silico search of genomes for desirable traits

Figure 4 Diagrammatic representation of the sequence of events involved in systems biology approaches for knowledge-driven research strategies for starter

cultures of the future.

Vol 63, No 2 May 2010


of screening approaches for rapid detection ofmore desirable strains and enable us to determine‘which strains perform particular tasks best’. Theapplication of this knowledge in starter cultureswill lead to new strains which endow dairy prod-ucts with more desirable properties such asimproved flavour and texture, with longer shelf lifeand stability and health-promoting properties andwhich are ‘tailor-made’ to suit customer needs.New tools are constantly emerging to gain betterinsight into this essential information, which aim tobe highly labour efficient and are becoming moreinexpensive as their popularity grows. And while itmay seem like a daunting task, this systems-levelapproach can be successfully achieved through theintegration of research from a number of scientificdisciplines, and is certainly the way forward in star-ter culture research.

ACKNOWLEDGEMENTS

The authors would like to thank Dr Lizhe Wang ofthe National Food Imaging Centre (NFIC) at theTeagasc Moorepark Food Research Centre,Fermoy, Co. Cork, Ireland for the electron micro-graphs.

R E F E R E N C E S

Albuquerque P, Mendes M V, Santos C L, Moradas-Ferreira P

and Tavares F (2008) DNA signature-based approaches

for bacterial detection and identification. Science of the

Total Environment 407 3641–3651.

Andersen A Z, Carvalho A L, Neves A R, Santos H, Kummer

U and Olsen L F (2009) The metabolic pH response in

Lactococcus lactis: an integrative experimental and mod-

elling approach. Computational Biology and Chemistry

33 71–83.

Baldy-Chudzik K (2001) Rep-PCR – a variant to RAPD or an

independent technique of bacteria genotyping? A compar-

ison of the typing properties of rep-PCR with other recog-

nised methods of genotyping of microorganisms. Acta

Microbiologica Polonica 50 189–204.

Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P,

Moineau S, Romero D A and Horvath P (2007) CRISPR

provides acquired resistance against viruses in prokary-

otes. Science 315 1709–1712.

Bellanger X, Roberts A P, Morel C, Choulet F, Pavlovic G,

Mullany P, Decaris B and Guedon G (2009) Conjugative

transfer of the integrative conjugative elements ICESt1

and ICESt3 from Streptococcus thermophilus. Journal of

Bacteriology 191 2764–2775.

Bentley D R (2006) Whole-genome re-sequencing. Current

Opinion in Genetics and Development 16 545–552.

Bickle T A and Kruger D H (1993) Biology of DNA restric-

tion.Microbiological Reviews 57 434–450.

Blaiotta G, Pepe O, Mauriello G, Villani F, Andolfi R and

Moschetti G (2002) 16S-23S rDNA intergenic spacer

region polymorphism of Lactococcus garvieae, Lactococ-

cus raffinolactis and Lactococcus lactis as revealed by

PCR and nucleotide sequence analysis. Systematic and

Applied Microbiology 25 520–527.

van den Bogaard P T C, Hols P, Kuipers O P, Kleereb-

ezem M and de Vos W M (2004) Sugar utilization and

conservation of the gal-lac gene cluster in Streptococ-

cus thermophilus. Systematic and Applied Microbiology

27 10–17.

Bolotin A, Wincker P, Mauger S, Jaillon O, Malarme K,

Weissenbach J, Ehrlich S D and Sorokin A (2001) The

complete genome sequence of the lactic acid bacterium

Lactococcus lactis ssp. lactis IL1403. Genome Research

11 731–753.

Bolotin A, Quinquis B, Renault P et al. (2004) Complete

sequence and comparative genome analysis of the dairy

bacterium Streptococcus thermophilus. Nature Biotech-

nology 22 1554–1558.

Boucher I, Emond E, Parrot M and Moineau S (2001) DNA

sequence analysis of three Lactococcus lactis plasmids

encoding phage resistance mechanisms. Journal of Dairy

Science 84 1610–1620.

Bougnoux M E, Diogo D, Francois N, Sendid B, Veirmeire S,

Colombel J F, Bouchier C, Van Kruiningen H, d’Enfert C

and Poulain D (2006) Multilocus sequence typing reveals

intrafamilial transmission and microevolutions of Candida

albicans isolates from the human digestive tract. Journal

of Clinical Microbiology 44 1810–1820.

Briggiler-Marco M, Capra M L, Quiberoni A, Vinderola G,

Reinheimer J A and Hynes E (2007) Nonstarter Lactoba-

cillus strains as adjunct cultures for cheese making: in vitro

characterization and performance in two model cheeses.

Journal of Dairy Science 90 4532–4542.

Broadbent J R, McMahon D J, Welker D L, Oberg C J and

Moineau S (2003) Biochemistry, genetics, and applica-

tions of exopolysaccharide production in Streptococcus

thermophilus: a review. Journal of Dairy Science 86

407–423.

Brouns S J, Jore M M, Lundgren M, Westra E R, Slijkhuis R

J, Snijders A P, Dickman M J, Makarova K S, Koonin E

V and van der Oost J (2008) Small CRISPR RNAs guide

antiviral defense in prokaryotes. Science 321 960–964.

Burrus V, Bontemps C, Decaris B and Guedon G (2001)

Characterization of a novel type II restriction-modification

system, Sth368I, encoded by the integrative element

ICESt1 of Streptococcus thermophilus CNRZ368.

Applied and Environmental Microbiology 67 1522–1528.

Callanan M, Kaleta P, O’Callaghan J et al. (2008) Genome

sequence of Lactobacillus helveticus, an organism distin-

guished by selective gene loss and insertion sequence

element expansion. Journal of Bacteriology 190 727–735.

Cebeci A and Gurakan G C (2008) Molecular methods for

identification of Lactobacillus delbrueckii subsp. bulgari-

cus and Streptococcus thermophilus using methionine

biosynthesis and 16S rRNA genes. Journal of Dairy

Research 75 392–398.

Chopin M C, Chopin A and Bidnenko E (2005) Phage abor-

tive infection in lactococci: variations on a theme. Current

Opinion in Microbiology 8 473–479.

Coakley M, Fitzgerald G and Ross R P (1997) Application

and evaluation of the phage resistance- and bacteriocin-

encoding plasmid pMRC01 for the improvement of dairy

starter cultures. Applied and Environmental Microbiology

63 1434–1440.

Vol 63, No 2 May 2010


Cogan T M, Beresford T P, Steele J, Broadbent J, Shah N P

and Ustunol Z (2007) Invited review: advances in starter

cultures and cultured foods. Journal of Dairy Science 90

4005–4021.

Collado M C and Hernandez M (2007) Identification and

differentiation of Lactobacillus, Streptococcus and Bifido-

bacterium species in fermented milk products with bifido-

bacteria.Microbiology Research 162 86–92.

Corroler D, Desmasures N and Gueguen M (1999) Correla-

tion between polymerase chain reaction analysis of the

histidine biosynthesis operon, randomly amplified poly-

morphic DNA analysis and phenotypic characterization of

dairy Lactococcus isolates. Applied Microbiology and

Biotechnology 51 91–99.

Cotter P D, Hill C and Ross R P (2005) Bacteriocins: devel-

oping innate immunity for food. Nature Reviews Microbi-

ology 3 777–788.

Crescenzi V (1995) Microbial polysaccharides of applied

interest: ongoing research activities in Europe. Biotechno-

logy Progress 11 251–259.

Crow V L, Curry B and Hayes M (2001) The ecology of

non-starter lactic acid bacteria (NSLAB) and their use as

adjuncts in New Zealand Cheddar. International Dairy

Journal 11 275–283.

Davidson B E, Kordias N, Dobos M and Hillier A J (1996)

Genomic organization of lactic acid bacteria. Antonie van

Leeuwenhoek 70 161–183.

Dellaglio F, Felis G E, Torriani S, Sorensen K and Johansen E

(2005) Genomic characterisation of starter cultures. In

Probiotic Dairy Products, pp 16–38. Tamine A Y, ed.

Oxford: Blackwell Publishing.

Delley M and Germond J E (2002) Differentiation of Lacto-

bacillus helveticus, Lactobacillus delbrueckii subsp

bulgaricus, subsp lactis and subsp delbrueckii using phys-

iological and genetic tools and reclassification of some

strains from the ATCC collection. Systematic and Applied

Microbiology 25 228–231.

Delves-Broughton J (1990) Nisin and its use as a food preser-

vative. Food Technology 40 100–117.

Di Cagno R, De Angelis M, Upadhyay V, McSweeney P L H,

Minervini F, Gallo G and Gobbetti M (2003) Effect of

proteinases of starter bacteria on the growth and proteo-

lytic activity of Lactobacillus plantarum DPC2741. Inter-

national Dairy Journal 13 145–157.

Doleyres Y, Schaub L and Lacroix C (2005) Comparison of

the functionality of exopolysaccharides produced in situ

or added as bioingredients on yogurt properties. Journal

of Dairy Science 88 4146–4156.

Draper L A, Grainger K, Deegan L H, Cotter P D, Hill C and

Ross R P (2009) Cross-immunity and immune mimicry as

mechanisms of resistance to the lantibiotic lacticin 3147.

Molecular Microbiology 71 1043–1054.

Driessen F M, Kingma F and Stadhouders J (1982) Evidence

that Lactobacillus bulgaricus in yoghurt is stimulated by

carbondioxide produced by Streptococcus thermophilus.

Netherlands Milk and Dairy Journal 36 135–144.

Dubernet S, Desmasures N and Gueguen M (2002) A

PCR-based method for identification of lactobacilli at

the genus level. FEMS Microbiology Letters 214

271–275.

El Demerdash H A, Oxmann J, Heller K J and Geis A (2006)

Yoghurt fermentation at elevated temperatures by strains

of Streptococcus thermophilus expressing a small heat-

shock protein: application of a two-plasmid system for

constructing food-grade strains of Streptococcus thermo-

philus. Biotechnology Journal 1 398–404.

European Economic Community (1983) EEC Commission

Directive 83/463/EEC.

Even S, Lindley N D and Cocaign-Bousquet M (2001)

Molecular physiology of sugar catabolism in Lactococ-

cus lactis IL1403. Journal of Bacteriology 183 3817–

3824.

Fernandez A, Ogawa J, Penaud S, Boudebbouze S, Ehrlich D,

van de Guchte M and Maguin E (2008) Rerouting of

pyruvate metabolism during acid adaptation in Lactobacil-

lus bulgaricus. Proteomics 8 3154–3163.

Forde A and Fitzgerald G F (1999) Bacteriophage defence

systems in lactic acid bacteria. Antonie van Leeuwenhoek

76 89–113.

Foucaud C and Poolman B (1992) Lactose transport system

of Streptococcus thermophilus. Functional reconstitution

of the protein and characterization of the kinetic mecha-

nism of transport. Journal of Biological Chemistry 267

22087–22094.

Fox P F (1993) Cheese: chemistry, physics and microbiology.

In Cheese: An Overview, pp 1–36. Fox P F, ed. London:

Chapman and Hall.

Francke C, Siezen R J and Teusink B (2005) Reconstructing

the metabolic network of a bacterium from its genome.

Trends in Microbiology 13 550–558.

Fuller R (1989) Probiotics in man and animals. Journal of

Applied Bacteriology 66 365–378.

Galperin M Y and Cochrane G R (2009) Nucleic acids

research annual database issue and the NAR online

molecular biology database collection in 2009. Nucleic

Acids Research 37 D1–D4.

Garvey P, Hill C and Fitzgerald G F (1996) The lactococcal

plasmid pNP40 encodes a third bacteriophage resistance

mechanism, one which affects phage DNA penetration.


Gasson M J, Godon J J, Pillidge C J, Eaton T J, Jury K and

Shearman C J (1995) Characterization and exploitation of

conjugation in Lactococcus lactis. International Dairy

Journal 5 757–762.

Germond J E, Delley M, D’Amico N and Vincent S J (2001)

Heterologous expression and characterization of the

exopolysaccharide from Streptococcus thermophilus

Sfi39. European Journal of Biochemistry 268 5149–

5156.

Gibson G R and Robertfroid M B (1995) Dietary modulation

of the human colonic microbiota: introducing the concept

of prebiotics. Journal of Nutrition 124 1401–1412.

Godon J J, Delorme C, Ehrlich S D and Renault P (1992)

Divergence of genomic sequences between Lactococcus

lactis subsp. lactis and Lactococcus lactis subsp.

cremoris. Applied and Environmental Microbiology 58

4045–4047.

Grissa I, Vergnaud G and Pourcel C (2007) CRISPRFinder: a

web tool to identify clustered regularly interspaced short

palindromic repeats. Nucleic Acids Research 35

W52–W57.

Guarner F, Perdigon G, Corthier G, Salminen S, Koletzko B

and Morelli L (2005) Should yoghurt cultures be consid-

ered probiotic? British Journal of Nutrition 93 783–786.

Vol 63, No 2 May 2010


van de Guchte M, Penaud S, Grimaldi C et al. (2006) The

complete genome sequence of Lactobacillus bulgaricus

reveals extensive and ongoing reductive evolution.

Proceedings of the National Academy of Sciences of the

United States of America 103 9274–9279.

Hansen E B (2002) Commercial bacterial starter cultures for

fermented foods of the future. International Journal of

Food Microbiology 78 119–131.

Hassan A N (2008) ADSA Foundation Scholar Award: possi-

bilities and challenges of exopolysaccharide-producing

lactic cultures in dairy foods. Journal of Dairy Science 91

1282–1298.

Hassan A N, Ipsen R, Janzen T and Qvist K B (2003) Micro-

structure and rheology of yogurt made with cultures dif-

fering only in their ability to produce exopolysaccharides.

Journal of Dairy Science 86 1632–1638.

Hols P, Kleerebezem M, Schanck A N, Ferain T, Hugenholtz

J, Delcour J and de Vos W M (1999) Conversion of

Lactococcus lactis from homolactic to homoalanine fer-

mentation through metabolic engineering. Nature Biotech-

nology 17 588–592.

Hols P, Hancy F, Fontaine L et al. (2005) New insights in the

molecular biology and physiology of Streptococcus ther-

mophilus revealed by comparative genomics. FEMS

Microbiology Reviews 29 435–463.

Hommais F, Pereira S, Acquaviva C, Escobar-Paramo P and

Denamur E (2005) Single-nucleotide polymorphism

phylotyping of Escherichia coli. Applied and Environ-

mental Microbiology 71 4784–4792.

Horvath P, Romero D A, Coute-Monvoisin A C, Richards M,

Deveau H, Moineau S, Boyaval P, Fremaux C and Barran-

gou R (2008) Diversity, activity, and evolution of CRISPR

loci in Streptococcus thermophilus. Journal of Bacterio-

logy 190 1401–1412.

Horvath P, Coute-Monvoisin A C, Romero D A, Boyaval P,

Fremaux C and Barrangou R (2009) Comparative analysis

of CRISPR loci in lactic acid bacteria genomes. Interna-

tional Journal of Food Microbiolology 131 62–70.

Hosono A, Lee J, Ametani A, Natsume M, Hirayama M, Ad-

achi T and Kaminogawa S (1997) Characterization of a

water-soluble polysaccharide fraction with immunopoten-

tiating activity from Bifidobacterium adolescentis

M101-4. Bioscience, Biotechnology and Biochemistry 61

312–316.

Hugenholtz J, Kleerebezem M, Starrenburg M, Delcour J, de

Vos W and Hols P (2000) Lactococcus lactis as a cell fac-

tory for high-level diacetyl production. Applied and Envi-

ronmental Microbiology 66 4112–4114.

Huys G, Vancanneyt M, D’Haene K, Vankerckhoven V, Goos-

sens H and Swings J (2006) Accuracy of species identity

of commercial bacterial cultures intended for probiotic or

nutritional use. Research in Microbiology 157 803–810.

van Hylckama Vlieg J E, Rademaker J L, Bachmann H,

Molenaar D, Kelly W J and Siezen R J (2006) Natural

diversity and adaptive responses of Lactococcus lactis.

Current Opinion in Biotechnology 17 183–190.

Jolly L, Vincent S J, Duboc P and Neeser J R (2002) Exploit-

ing expolysaccharides from lactic acid bacteria. Antonie

van Leeuwenhoek 82 367–374.

Kato K (2009) Impact of the next generation DNA sequence-

rs. International Journal of Clinical and Experimental

Medicine 2 193–202.

Kemperman R, Kuipers A, Karsens H, Nauta A, Kuipers O

and Kok J (2003) Identification and characterization of

two novel clostridial bacteriocins, circularin A and closti-

cin 574. Applied and Environmental Microbiology 69

1589–1597.

Khalid N M and Marth E M (1990) Lactobacilli –

their enzymes and role in ripening and spoilage of

cheese: a review. Journal of Dairy Science 73 2669–

2684.

Kitazawa H, Yamaguchi T, Miura M, Saito T and Itoh T

(1993) B-cell mitogen produced by slime-forming, encap-

sulated Lactococcus lactis ssp. cremoris isolated from

ropy sour milk, viili. Journal of Dairy Science 76 1514–

1519.

Klaenhammer T R (1993) Genetics of bacteriocins produced

by lactic acid bacteria. FEMS Microbiology Reviews 12

39–85.

Kleerebezem M and Hugenholtz J (2003) Metabolic pathway

engineering in lactic acid bacteria. Current Opinion in


Kligler B and Cohrssen A (2008) Probiotics. American

Family Physician 78 1073–1078.

Klijn N, Weerkamp A H and de Vos W M (1991) Identifica-

tion of mesophilic lactic acid bacteria by using polymer-

ase chain reaction-amplified variable regions of 16S

rRNA and specific DNA probes. Applied and Environ-

mental Microbiology 57 3390–3393.

Klijn N, Weerkamp A H and de Vos W M (1995) Detection

and characterization of lactose-utilizing Lactococcus spp.

in natural ecosystems. Applied and Environmental Micro-

biology 61 788–792.

Kok J, Buist G, Zomer A L, van Hijum S A and Kui-

pers O P (2005) Comparative and functional genomics

of lactococci. FEMS Microbiology Reviews 29 411–

433.

Kowalczyk M and Bardowski J (2007) Regulation of sugar

catabolism in Lactococcus lactis. Critical Reviews in


van Kranenburg R, van S II, Marugg J D, Kleerebezem M

and de Vos W M (1999) Exopolysaccharide biosynthesis

in Lactococcus lactis NIZO B40: functional analysis of

the glycosyltransferase genes involved in synthesis of the

polysaccharide backbone. Journal of Bacteriology 181

338–340.

Lai E, Birren B W, Clarke S M, Simon M I and Hood M

(1989) Pulsed field gel electrophoresis. BioTechniques 7

34–42.

Lane D J, Pace B, Olsen G J, Stahl D A, Sogin M L and Pace

N R (1985) Rapid determination of 16S ribosomal RNA

sequences for phylogenetic analyses. Proceedings of the

National Academy of Sciences of the United States of

America 82 6955–6959.

Laws A, Gu Y and Marshall V (2001) Biosynthesis, charac-

terisation, and design of bacterial exopolysaccharides

from lactic acid bacteria. Biotechnology Advances 19

597–625.

Le Bourgeois P, Lautier M, van den Berghe L, Gasson M J

and Ritzenthaler P (1995) Physical and genetic map of the

Lactococcus lactis subsp. cremoris MG1363 chromo-

some: comparison with that of Lactococcus lactis subsp.

lactis IL 1403 reveals a large genome inversion. Journal

of Bacteriology 177 2840–2850.

Vol 63, No 2 May 2010


Leroy F and De Vuyst L (2004) Lactic acid bacteria as func-

tional starter cultures for the food fermentation industry.

Trends in Food Science and Technology 15 67–78.

Lick S, Keller M, Bockelmann W and Heller K J (1996)

Rapid identification of Streptococcus thermophilus by

primer-specific PCR amplification based on its lacZ gene.

Systematic and Applied Microbiology 19 74–77.

Liu M, Siezen R J and Nauta A (2009) In silico prediction

of horizontal gene transfer events in Lactobacillus

delbrueckii ssp. bulgaricus and Streptococcus thermo-

philus reveals proto-cooperation in yoghurt manufactur-

ing. Applied and Environmental Microbiology 75 4120–

4129.

Lohmeier-Vogel E M, Hahn-Hagerdahl B and Vogel H J

(1986) Phosphorous-31 NMR studies of maltose and glu-

cose metabolism in Streptococcus lactis. Applied Microbi-

ology and Biotechnology 25 43–51.

Madera C, Garcia P, Janzen T, Rodriguez A and Suarez J E

(2003) Characterisation of technologically proficient

wild Lactococcus lactis strains resistant to phage infec-

tion. International Journal of Food Microbiology 86

213–222.

Maiden M C, Bygraves J A, Feil E et al. (1998) Multilocus

sequence typing: a portable approach to the identification

of clones within populations of pathogenic microorgan-

isms. Proceedings of the National Academy of Sciences of

the United States of America 95 3140–3145.

Makarova K, Slesarev A, Wolf Y et al. (2006) Comparative

genomics of the lactic acid bacteria. Proceedings of the

National Academy of Sciences of the United States of

America 103 15611–15616.

Margulies M, Egholm M, Altman W E et al. (2005) Genome

sequencing in microfabricated high-density picolitre reac-

tors. Nature 437 376–380.

Marshall V M (1987) Lactic acid bacteria: starters for flavour.

FEMS Microbiology Letters 46 327–336.

Matar D D G, Bretigny L, Firmesse O, Flores M-J, Mogenet

A, Bresson J-L and Corthier G (2005) Streptococcus

thermophilus and Lactobacillus delbreuckii subsp. bulgar-

icus survive gastrointestinal transit of healthy volunteers

consuming yogurt. FEMS Microbiology Letters 250

185–187.

Mayo B, van Sinderen D and Ventura M (2008) Genome

analysis of food grade lactic acid-producing bacteria:

from basics to applications. Current Genomics 9 169–

183.

McAuliffe O, Hill C and Ross R P (1999) Inhibition of Liste-

ria monocytogenes in cottage cheese manufactured with a

lacticin 3147-producing starter culture. Journal of Applied


Mills S, McAuliffe O E, Coffey A, Fitzgerald G F and Ross R

P (2006) Plasmids of lactococci – genetic accessories or

genetic necessities? FEMS Microbiology Reviews 30 243–

273.

Mills S, Coffey A, McAuliffe O E, Meijer W C, Hafkamp B

and Ross R P (2007) Efficient method for generation of

bacteriophage insensitive mutants of Streptococcus

thermophilus yoghurt and mozzarella strains. Journal of

Microbiological Methods 70 159–164.

Mills S, Griffin C, Coffey A, Meijer W C, Hafkamp B and

Ross R P (2009) CRISPR analysis of bacteriophage insen-

sitive mutants (BIMs) of industrial Streptococcus

thermophilus – implications for starter design. Journal of

Applied Microbiology 108 945–955.

Mohammed M, El-Aziz H A, Omran N, Anwar S, Awad S

and El-Soda M (2009) Rep-PCR characterization and bio-

chemical selection of lactic acid bacteria isolated from the

Delta area of Egypt. International Journal of Food Micro-

biology 128 417–423.

Monnet V, Condon S, Cogan T M and Gripon J C (1996)

Metabolism of starter cultures. In Dairy Starter Cultures,

pp 47–99. Cogan T M and Accolas J, eds. New York:

VCH Publishers Inc.

Monsan P, Bozonnet S, Albenne C, Joucla G, Willemot R and

Remaud-Simeon M (2001) Homopolysaccharides from

lactic acid bacteria. International Dairy Journal 11

675–685.

Morgan S, Ross R P and Hill C (1997) Increasing starter cell

lysis in Cheddar cheese using a bacteriocin-producing

adjunct. Journal of Dairy Science 80 1–10.

Morgan S M, Hickey R, Ross R P and Hill C (2000) Efficient

method for the detection of microbially-produced antibac-

terial substances from food systems. Journal of Applied


Morgan S M, Galvin M, Ross R P and Hill C (2001) Evalua-

tion of a spray-dried lacticin 3147 powder for the control

of Listeria monocytogenes and Bacillus cereus in a range

of food systems. Letters in Applied Microbiology 33 387–

391.

Moschetti G, Blaiotta G, Aponte M, Catzeddu P, Villani F,

Deiana P and Coppola S (1998) Random amplified poly-

morphic DNA and amplified ribosomal DNA spacer

polymorphism: powerful methods to differentiate Strepto-

coccus thermophilus strains. Journal of Applied Microbi-

ology 85 25–36.

Moschetti G, Blaiotta G, Villani F, Coppola S and Parente E

(2001) Comparison of statistical methods for identification

of Streptococcus thermophilus, Enterococcus faecalis, and

Enterococcus faecium from randomly amplified polymor-

phic DNA patterns. Applied and Environmental Microbi-

ology 67 2156–2166.

Nakajima H, Suzuki Y, Kaizu H and Hirota T (1992) Choles-

terol-lowering activity of ropy fermented milk. Journal of

Food Science 57 1327–1329.

Nes I F, Diep D B, Havarstein L S, Brurberg M B, Eij-

sink V and Holo H (1996) Biosynthesis of bacterioc-

ins in lactic acid bacteria. Antonie van Leeuwenhoek

70 113–128.

Neves A R, Pool W A, Kok J, Kuipers O P and Santos H

(2005) Overview on sugar metabolism and its control in

Lactococcus lactis – the input from in vivo NMR. FEMS

Microbiology Reviews 29 531–554.

Nomura M, Kimoto H, Someya Y and Suzuki I (1999) Novel

characteristic for distinguishing Lactococcus lactis subsp.

lactis from subsp. cremoris. International Journal of

Systematic Bacteriology 49 Pt 1 163–166.

Nomura M, Kobayashi M, Ohmomo S and Okamoto T

(2000) Inactivation of the glutamate decarboxylase gene

in Lactococcus lactis subsp. cremoris. Applied and Envi-


Nomura M, Kobayashi M and Okamoto T (2002) Rapid

PCR-based method which can determine both phenotype

and genotype of Lactococcus lactis subspecies. Applied

and Environmental Microbiology 68 2209–2213.

Vol 63, No 2 May 2010


Nomura M, Kobayashi M, Narita T, Kimoto-Nira H and

Okamoto T (2006) Phenotypic and molecular character-

ization of Lactococcus lactis from milk and plants.

Journal of Applied Microbiology 101 396–405.

Notebaart R A, van Enckevort F H, Francke C, Siezen R J

and Teusink B (2006) Accelerating the reconstruction of

genome-scale metabolic networks. BMC Bioinformatics 7

296.

Nutter R (2008) New frontiers in plant functional genomics

using next generation sequencing technologies. In The

Handbook of Plant Functional Genomics, Concepts and

Protocols, pp 431–444. Kahl G and Meksem K, eds. San

Francisco: Wiley.

O’ Brien J (2004) Global dairy demand – where do we go? In

European Dairy Magazine, pp 22–25.

O’ Driscoll J, Glynn F, Fitzgerald G F and van Sinderen D

(2006) Sequence analysis of the lactococcal plasmid

pNP40: a mobile replicon for coping with environmental

hazards. Journal of Bacteriology 188 6629–6639.

O’ Sullivan T, van Sinderen D and Fitzgerald G (1999) Struc-

tural and functional analysis of pCI65st, a 6.5 kb plasmid

from Streptococcus thermophilus NDI-6. Microbiology

145 127–134.

O’ Sullivan D, Twomey D P, Coffey A, Hill C, Fitzgerald G F

and Ross R P (2000) Novel type I restriction specificities

through domain shuffling of HsdS subunits in Lactococ-

cus lactis.Molecular Microbiology 36 866–875.

O’ Sullivan L, Morgan S M, Ross R P and Hill C (2002)

Elevated enzyme release from lactococcal starter cultures

on exposure to the lantibiotic lacticin 481, produced by

Lactococcus lactis DPC5552. Journal of Dairy Science

85 2130–2140.

Oberg C J and Broadbent J R (1993) Thermophilic starter

cultures: another set of problems. Journal of Dairy

Science 76 2392–2406.

Ochman H, Elwyn S and Moran N A (1999) Calibrating bac-

terial evolution. Proceedings of the National Academy of

Sciences of the United States of America 96 12638–

12643.

Oliveira A P, Nielsen J and Forster J (2005) Modeling Lacto-

coccus lactis using a genome-scale flux model. BMC

Microbiology 5 39.

O’Shea E F, Gardiner G E, O’Connor P M, Mills S, Ross R P

and Hill C (2009) Characterization of enterocin- and sali-

varicin-producing lactic acid bacteria from the mammalian

gastrointestinal tract. FEMS Microbiology Letters 291

24–34.

O’Sullivan L, O’Connor E B, Ross R P and Hill C (2006)

Evaluation of live-culture-producing lacticin 3147 as a

treatment for the control of Listeria monocytogenes on the

surface of smear-ripened cheese. Journal of Applied


O’Sullivan O, O’Callaghan J, Sangrador-Vegas A, McAuliffe

O, Slattery L, Kaleta P, Callanan M, Fitzgerald G F, Ross

R P and Beresford T (2009) Comparative genomics of

lactic acid bacteria reveals a niche-specific gene set. BMC

Microbiology 9 50.

Pandey V, Nutter R C and Prediger E (2008) Applied

Biosystems SolidTM System: Ligation-based sequencing.

In Next Generation Genome Sequencing: Towards

Personalized Medicine, pp 29–41. Janitz M, ed. San

Francisco: Wiley.

Pastink M I, Teusink B, Hols P, Visser S, de Vos W M and

Hugenholtz J (2009) Genome-scale model of Streptococ-

cus thermophilus LMG18311 for metabolic comparison

of lactic acid bacteria. Applied and Environmental Micro-

biology 75 3627–3633.

Patnaik R, Louie S, Gavrilovic V, Perry K, Stemmer W P,

Ryan C M and del Cardayre S (2002) Genome shuffling

of Lactobacillus for improved acid tolerance. Nature Bio-

technology 20 707–712.

Pedersen M B, Iversen S L, Sorensen K I and Johansen

E (2005) The long and winding road from the

research laboratory to industrial applications of lactic

acid bacteria. FEMS Microbiology Reviews 29 611–

624.

Petersen B L, Dave R I, McMahon D J, Oberg C J and Broad-

bent J R (2000) Influence of capsular and ropy exopoly-

saccharide-producing Streptococcus thermophilus on

Mozzarella cheese and cheese whey. Journal of Dairy Sci-

ence 83 1952–1956.

Petrova P, Miteva V, Ruiz-Maso J A and del Solar G (2003)

Structural and functional analysis of pt38, a 2.9kb plasmid

of Streptococcus thermophilus yogurt strain. Plasmid 50

176–189.

Pontes D S, Lima-Bittencourt C I, Chartone-Souza E and

Nascimento A M A (2007) Molecular approaches: advan-

tages and artifacts in assessing bacterial diversity. Journal

of Industrial Microbiology and Biotechnology 34 463–

473.

Postma P W, Lengeler J W and Jacobson G R (1993) Phos-

phoenolpyruvate:carbohydrate phosphotransferase sys-

tems of bacteria.Microbiology Reviews 57 543–594.

Prodelalova J, Spanova A and Rittich B (2005) Application of

PCR, rep-PCR and RAPD techniques for typing of Lacto-

coccus lactis strains. Folia Microbiologica (Praha) 50

150–154.

Pu Z Y, Dobos M, Limsowtin G K and Powell I B (2002)

Integrated polymerase chain reaction-based procedures for

the detection and identification of species and subspecies

of the Gram-positive bacterial genus Lactococcus. Journal

of Applied Microbiology 93 353–361.

Rademaker J L, Herbet H, Starrenburg M J, Naser S M,

Gevers D, Kelly W J, Hugenholtz J, Swings J and van

Hylckama Vlieg J E (2007) Diversity analysis of dairy

and nondairy Lactococcus lactis isolates, using a novel

multilocus sequence analysis scheme and (GTG)5-PCR

fingerprinting. Applied and Environmental Microbiology

73 7128–7137.

Rajagopal S N and Sandine W E (1990) Associative growth

and proteolysis of Streptococcus thermophilus and Lacto-

bacillus bulgaricus in skim milk. Journal of Dairy

Science 73 894–899.

Rallu F, Taillez P, Ehrlich D and Renault P (2002) Common

scheme of evolution between eps clusters of the food

bacteria Streptococcus thermophilus and cps clusters of

the pathogenic streptococci. 6th American Society of

Microbiology Conference on Streptococcal Genetics, 112.

Asheville, NC, USA

Ramos A, Neves A R and Santos H (2002) Metabolism of

lactic acid bacteria studied by nuclear magnetic resonance.

Antonie van Leeuwenhoek 82 249–261.

Rasic J L and Kurmann J A (1978) Fermented Fresh Milk

Products. Yogurt: Scientific Grounds, Technology,

Vol 63, No 2 May 2010


Manufacture and Preparations. Copenhagen, Denmark:

Technical Dairy Publishing house.

Renye J A Jr and Somkuti G A (2008) Cloning of

milk-derived bioactive peptides in Streptococcus thermo-

philus. Biotechnology Letters 30 723–730.

van Rooijen R J, van Schalkwijk S and de Vos W M (1991)

Molecular cloning, characterization, and nucleotide

sequence of the tagatose 6-phosphate pathway gene clus-

ter of the lactose operon of Lactococcus lactis. Journal of

Biological Chemistry 266 7176–7181.

Ross R P, Galvin M, McAuliffe O, Morgan S M, Ryan M P,

Twomey D P, Meaney W J and Hill C (1999) Developing

applications for lactococcal bacteriocins. Antonie van

Leeuwenhoek 76 337–346.

Ross R P, Morgan S and Hill C (2002) Preservation and fer-

mentation: past, present and future. International Journal

of Food Microbiology 79 3–16.

Rossetti L and Giraffa G (2005) Rapid identification of dairy

lactic acid bacteria by M13-generated, RAPD-PCR finger-

print databases. Journal of Microbiological Methods 63

135–144.

Ryan M P, Rea M C, Hill C and Ross R P (1996) An applica-

tion in cheddar cheese manufacture for a strain of Lacto-

coccus lactis producing a novel broad-spectrum

bacteriocin, lacticin 3147. Applied and Environmental


Salama M, Sandine W and Giovannoni S (1991) Develop-

ment and application of oligonucleotide probes for identi-

fication of Lactococcus lactis subsp. cremoris. Applied

and Environmental Microbiology 57 1313–1318.

Salama M S, Sandine W E and Giovannoni S J (1993) Isola-

tion of Lactococcus lactis subsp. cremoris from nature by

colony hybridization with rRNA probes. Applied and

Environmental Microbiology 59 3941–3945.

Samarzija D, Sikora S, Redzepovic S, Antunac N and Havra-

nek J (2002) Application of RAPD analysis for identifica-

tion of Lactococcus lactis subsp. cremoris strains isolated

from artisanal cultures. Microbiology Research 157

13–17.

Schleifer K H, Kraus J, Dvorak C, Kilpper-Balz R, Collins M

D and Fisher W (1985) Transfer of Streptococcus lactis

and related streptococci to the genus Lactococcus gen.

nov. Systematic and Applied Microbiology 6 183–195.

Schouler C, Gautier S, Ehrlich A D and Chopin M C (1998)

Combinational variation of restriction modification speci-

ficities in Lactococcus lactis. Molecular Microbiology 28

169–178.

Sheu S J, Hwang W Z, Chen H C, Chiang Y C and Tsen H Y

(2009) Development and use of tuf gene-based primers

for the multiplex PCR detection of Lactobacillus acidoph-

ilus, Lactobacillus casei group, Lactobacillus delbrueckii,

and Bifidobacterium longum in commercial dairy prod-

ucts. Journal of Food Protection 72 93–100.

Sieuwerts S, de Bok F A, Hugenholtz J and van Hylckama

Vlieg J E (2008) Unraveling microbial interactions in food

fermentations: from classical to genomics approaches.


Smid E J, van Enckevort F J, Wegkamp A, Boekhorst J,

Molenaar D, Hugenholtz J, Siezen R J and Teusink B

(2005) Metabolic models for rational improvement of

lactic acid bacteria as cell factories. Journal of Applied


Smit G, Smit B A and Engels W J (2005) Flavour formation

by lactic acid bacteria and biochemical flavour profiling

of cheese products. FEMS Microbiology Reviews 29

591–610.

Solow B T and Somkuti G A (2000) Comparison of low-

molecular-weight heat stress proteins encoded on plas-

mids in different strains of Streptococcus thermophilus.

Current Microbiology 41 177–181.

Solow B T and Somkuti G A (2001) Molecular properties of

Streptococcus thermophilus plasmid pER35 encoding a

restriction modification system. Current Microbiology 42

122–128.

Sorek R, Kunin V and Hugenholtz P (2008) CRISPR – a

widespread system that provides acquired resistance

against phages in bacteria and archaea. Nature Reviews


Stackebrandt E and Woese C R (1981) The evolution of prok-

aryotes. In Molecular and Cellular Aspects of Microbial

Evolution, pp 1–31. Carlisle M J, Collins J R, Moseley B

E B, eds. Cambridge: Cambridge University Press.

Stanton C, Ross R P, Fitzgerald G F and Van Sindern D

(2005) Fermented functional foods based on probiotics

and their biogenic metabolites. Current Opinion in


Svec P and Sedlacek I (2008) Characterization of Lactococcus

lactis subsp. lactis isolated from surface waters. Folia

Microbiologica (Praha) 53 53–56.

Tailliez P, Tremblay J, Ehrlich S D and Chopin A (1998)

Molecular diversity and relationship within Lactococcus

lactis, as revealed by randomly amplified polymorphic

DNA (RAPD). Systematic and Applied Microbiology 21

530–538.

Tamime A Y and Deeth H C (1980) Yogurt: technology and

biochemistry. Journal of Food Protection 43 939–977.

Tanous C, Kieronczyk A, Helinck S, Chambellon E and

Yvon M (2002) Glutamate dehydrogenase activity: a

major criterion for the selection of flavour-producing

lactic acid bacteria strains. Antonie van Leeuwenhoek

82 271–278.

Tanous C, Chambellon E, Sepulchre A M and Yvon M (2005)

The gene encoding the glutamate dehydrogenase in Lacto-

coccus lactis is part of a remnant Tn3 transposon carried

by a large plasmid. Journal of Bacteriology 187

5019–5022.

Teusink B and Smid E J (2005) Modelling strategies for the

industrial exploitation of lactic acid bacteria. Food Micro-

biology 4 46–56.

Teusink B, van Enckevort F H, Francke C, Wiersma A,

Wegkamp A, Smid E J and Siezen R J (2005) In silico

reconstruction of the metabolic pathways of Lactobacillus

plantarum: comparing predictions of nutrient requirements

with those from growth experiments. Applied and Envi-


Thomas T D, Ellwood D C and Longyear V M (1979)

Change from homo- to heterolactic fermentation by Strep-

tococcus lactis resulting from glucose limitation in anaer-

obic chemostat cultures. Journal of Bacteriology 138

109–117.

Thomas T D, Turner K W and Crow V L (1980) Galactose

fermentation by Streptococcus lactis and Streptococcus

cremoris: pathways, products, and regulation. Journal of

Bacteriology 144 672–682.

Vol 63, No 2 May 2010


Thunell R K and SandineW E (1985) Types of starter cultures.

In Bacterial Starter Cultures for Foods, pp 127–144. Gilli-

land S E, ed. Boca Raton, FL: CRC Press Inc.

Trmcic A, Obermajer T, Rogelj I and Bogovic Matijasic B

(2008) Short communication: culture-independent detec-

tion of lactic acid bacteria bacteriocin genes in two tradi-

tional Slovenian raw milk cheeses and their microbial

consortia. Journal of Dairy Science 91 4535–4541.

Turgeon N, Frenette M and Moineau S (2004) Characteriza-

tion of a theta-replicating plasmid from Streptococcus

thermophilus. Plasmid 51 24–36.

Twomey D, Ross R P, Ryan M, Meaney B and Hill C (2002)

Lantibiotics produced by lactic acid bacteria: structure,

function and applications. Antonie van Leeuwenhoek 82

165–185.

Van Kranenburg R, Kleerebezem M, Van Hylckama Vlieg J

E, Ursing B M, Boekhorst J, Smit B A, Ayad E H E, Smit

G and Siezen R J (2002) Flavour formation from amino

acids by lactic acid bacteria: predictions from genome

sequence analysis. International Dairy Journal 12 111–

121.

Vesterlund S, Paltta J, Laukova A, Karp M and Ouwehand A

C (2004) Rapid screening method for the detection of

antimicrobial substances. Journal of Microbiological

Methods 57 23–31.

Voit E O, Almeida J, Marino S, Lall R, Goel G, Neves A R

and Santos H (2006) Regulation of glycolysis in Lacto-

coccus lactis: an unfinished systems biological case study.

Systems Biology (Stevenage) 153 286–298.

de Vos W M and Gasson M J (1989) Structure and expression

of the Lactococcus lactis gene for phospho-beta-galactosi-

dase (lacG) in Escherichia coli and L. lactis. Journal of

General Microbiology 135 1833–1846.

de Vos W M and Hugenholtz J (2004) Engineering metabolic

highways in Lactococci and other lactic acid bacteria.

Trends in Biotechnology 22 72–79.

de Vos W M and Vaughan E E (1994) Genetics of lactose uti-

lization in lactic acid bacteria. FEMS Microbiology

Reviews 15 217–237.

de Vos W M, Boerrigter I, van Rooyen R J, Reiche B and

Hengstenberg W (1990) Characterization of the lactose

specific enzymes of the phosphotransferase system in

Lactococcus lactis. Journal of Biological Chemistry 265

22554–22560.

de Vries M C, Siezen R J, Wijman J G, Zhao Y, Kleerebezem

M, de Vos W M and Vaughan E E (2006) Comparative

and functional analysis of the rRNA-operons and their

tRNA gene complement in different lactic acid bacteria.

Systematic and Applied Microbiology 29 358–367.

Wang Y, Li Y, Pei X, Yu L and Feng Y (2007) Genome-shuf-

fling improved acid tolerance and L-lactic acid volumetric

productivity in Lactobacillus rhamnosus. Journal of


Wegmann U, O’Connell-Motherway M, Zomer A et al.

(2007) Complete genome sequence of the prototype lactic

acid bacterium Lactococcus lactis subsp. cremoris

MG1363. Journal of Bacteriology 189 3256–3270.

Whitford E J, Cummins A G, Butler R N et al. (2009)

Effects of Streptococcus thermophilus TH-4 on intestinal

mucositis induced by the chemotherapeutic agent, 5-Flu-

orouracil (5-FU). Cancer Biology and Therapy PMID

19305160.

Wouters J T M, Ayad E H E, Hugenholtz J and Smit G (2002)

Microbes from raw milk for fermented dairy products.

International Dairy Journal 12 91–109.

Zendo T, Nakayama J, Fujita K and Sonomoto K (2008)

Bacteriocin detection by liquid chromatography ⁄mass

spectrometry for rapid identification. Journal of Applied


Zhu Y, Zhang Y and Li Y (2009) Understanding the industrial

application potential of lactic acid bacteria through

genomics. Applied Microbiology and Biotechnology 83

597–610.

Zisu B and Shah N P (2005) Low-fat mozzarella as influenced

by microbial exopolysaccharides, preacidification, and

whey protein concentrate. Journal of Dairy Science 88

1973–1985.

Vol 63, No 2 May 2010


The changing face of dairy starter culture research: From genomics to economics

Documents

Transcript of The changing face of dairy starter culture research: From genomics to economics