The Amateur Footballer rd15-16, 2014

Amateur Footballerthe

9 AUGUSTSEASON 2014 99999999999999999999 9999999999999999999999999999999 AUAUAAUAUAUAUAUAUAUUAUAUAUAUAAUAUAUAUAAUAUAUUAUAUAAUAUAAUAUUUUUUGUGUGUGUGGUGUGUUGUGUGUGGUGUGUGUUUGGUGUGUGUUGUUUGGUUGG STSSTSSSTSTSTTSTTSSSSSSSSSSTSTSSTSSSSSSSTT999999999999999999999999999999999999999999999999999 AUAUAAUAAUAUAUAUAUAAAUAUAAAAAAUAAUAUAAAAAAAAUAAAAA GGUGGGGGUGUGUGUGGGGGGUUUUGUGUGGGUGGUGUUGUGGGUGGUGUUG SSSTSSTSSTTSTSTSSSTSSSTTTSSSSTSSTSSSSSSSSSSSSESESESSESSSSESESESSESSSESESSESSSSSSESSSSSSSEEASASASASASASASASASASASASASSASASASASSASASASSASASASSASSASSASASONONONONONONONONONONONNNONONONONOONONONONOONONONOOOONONOONONOONOONNON 222222222222222222222222222222222201001010010010101000100100100001000110000001000000000100 4444444444444444444444444444SESSESSSESESSESESSESEESESSSSESSESSSSESSESSSSSSS ASASAASASASSSASASASASASASASASAASASASASASASASAASSASASASSASSSSAA ONONOONOONONONONONOONOONONOONONONOONNONONOONONOONOOONONNNNNN 222222222222222222222222222222222222010101010010101001001010101000100101010010001001010000110 4444444444444444444444444444444

VIEVIEVIEVIEVIEVIEIIVVV W MW MWWWW OREOREREROREORER PHPHPHPHHPHHPHOTOTOTOTOOTOOOO S OOOOOF LF LF LLFF ASTASTASASTTTTASTT WWEWEEWEEK’EK’EKK’S AS S AAAACTION ON ININ THEEEE VVVAVAFA FA F IPAPAAIPAPAPAPAAD AD AD ADD APPPPPPPPPPP.P.P.P.P.PPP.

Everybody needs LifeCare

Ashburton Sports Medicine ph. 9885 8961

Malvern Sports Medicine ph. 9509 8844

Prahran Sports Medicine ph. 9529 8899

Croydon Sports Medicine ph. 9725 2444

Latrobe Sports Medicine ph. 9473 8780

LEADERS IN PHYSIOTHERAPY & SPORTS MEDICINE

Official VAFA Partner

Dr Stuart Down is a Specialist Sport & Exercise Medicine (SEM) Physician based at both LifeCare Prahran and LifeCare Ashburton Sports Medicine Centres. Stuart was granted a Fellowship of the Australasian College of Sports Medicine in 2008, obtaining the coveted College Medal for most outstanding graduate in doing so.

Stuart has accrued extensive experience in the provision of medical care for elite athletes over the past decade. Stuart has worked as Medical Officer for Cricket Victoria over the past 7 years, whilst he has also provided local and overseas coverage for the Australian men’s and women’s cricket team, AIS hockey, soccer and waterpolo teams, and has provided full season AFL team medical care at both TAC and VFL levels. He has covered major events including the Melbourne Commonwealth Games, FINA World Championships and UCI World Track Cycling.

Stuart has particular interest in acute musculoskeletal injury management and

knows the importance of early diagnosis, expedited and appropriate management, and liaison with team staff - in particular when dealing with high level athletes. He lectures to allied health groups and emergency departments about ‘easily and not to be missed’ musculoskeletal injuries. Having covered such an array of sports and events over many years, Stuart has extensive experience with all types of injuries and optimal management.

Working closely with several of Melbourne’s more highly regarded musculoskeletal radiologists and orthopaedic surgeons allows Stuart to readily discuss injury diagnosis and management options, and arrange surgery rapidly if required.

DR STUART DOWNVAFA PROFILE

1THE AMATEUR FOOTBALLER 2014

Perhaps like many of you, recent events happening

around our world have made me refl ect upon

how fortunate we are in Australia. This in turn has

caused me to refl ect upon community sporting

clubs and why we at the VAFA believe they are so

important.

I have long had a fi rm belief that the contribution

that community sporting clubs make to Australia

is undervalued, or if not undervalued, then

perhaps not properly understood. In particular,

our VAFA clubs.

Take the concept of amateurism at community

sporting level. One might understand amateurism

as being about players not being paid and playing

for the love of the game. Which of course it is. But

going deeper, amateurism is also about helping

to ensure that we preserve a voluntary sector

in society. At its essence, players not competing

for money means in fact that they are acting as

volunteers every time they run out to play, doing

something necessarily without the expectation of

something in return. I would argue that this is a

signifi cant contribution to our society.

Take the simple concept of people coming

together on a Saturday to watch a game, in

particular attending Saturday club lunches, which

are such an important part of our VAFA club

community. One might understand this coming

together as a great opportunity to catch up

with people, watch a game of local football, and

support your local club. Which of course it is. But

going deeper, coming along to a club lunch on a

weekend is where people meet each other face

to face in a large group environment and where

everyone is equal. Unlike the workplace, many of

the usual hierarchies do not exist. I would argue

that this is a signifi cant contribution to our society.

Even the prospect of a sporting club struggling

at community level and achieving little success

I would argue creates signifi cant benefi t for

our community. Many would defi ne success as

having a large club, with strong numbers, where

there are many volunteers and where there are

little struggles. Which of course is a defi nition

of success. But going deeper, there is also a real

quality in being involved in a sporting club where

things do not quite work as well as they should,

where there are no complex titles and ranks, and

where it is possible to still know everyone’s name

and things are kept at a very personal level. I

would argue that this is a signifi cant contribution

to our society.

I am reminded of a very good question that

was asked of me at last year’s AGM, where some

suggestions were made about improving the

tribunal system at the VAFA. Some valid ideas were

put forward about perhaps we could resource it

more, make it more professional, even bring in a

formal video review process. These were all valid

ideas, but I could not help but wonder whether we

would be better off retaining what we currently

have, where things do not work as perfect as they

might. Perhaps by retaining some imperfection,

we continue to build tolerance, resilience and

acceptance.

Governments and elite sporting organisations

in Australia do a lot of good things to help out

community sporting clubs in Australia. However,

there is a lot more that could be done, as we

should never take for granted how lucky we are

in Australia. Hopefully a greater understanding of

some of the hidden benefi ts that sporting clubs

at community level provide to our society, some

examples of which are set out above, will aid in our

quest for more to be done.

Th e Amateur FootballerTHE JOURNAL OF THE VICTORIAN AMATEUR FOOTBALL ASSOCIATION

August 09, 2014 $3.00 Vol. 14 No. 16

UNDERVALUED ORMISUNDERSTOOD?

Michael Hazell - VAFA PresidentED

ITOR

IAL

2 THE AMATEUR FOOTBALLER 2014

Andrew Leonard @ Lennytalk

WATCH EVERY PREMIER GAME AT WWW.VAFATV.COM

It’s the most uncomfortable of subjects, talking about the teams that are struggling to win the requisite number of games. Old Trinity is on a slippery slope. At present a season that has promised so much, is unraveling just as quickly as their whirlwind re-entry to Premier commenced. Four losses in a row, has seen their three game break on fourth spot evaporate and they could now miss the fi nals. At the other end of the spectrum, De La Salle failed by just seven points to fi nd themselves a game behind eighth placed Old Brighton. The Tonners have a trip to the Dairy Bell (Rd 16) ahead of them that could likely determine who will drop. However, we cannot rule out Beaumaris either. The Sharks are on a seven game losing streak, although a strong percentage is their salvation. St Bedes/Mentone Tigers are a proud club, but their seven years in Premier is coming to a close. A premiership and two runners-up eff orts have highlighted a fantastic stay. There is not a club in the VAFA that has more fun whilst still maintaining a respect of all teams for their prowess on the fi eld. The Tigers have Blacks and Xavs away in the next fortnight, whilst their best is capable of winning these types of matches, the reality of their form in 2014 suggests otherwise.

Old Xaverians’ defeat of University Blacks has Xavs as the form team of the comp on a fi ve game win streak. Arguments can be mounted that Xavs had more to play for, and Blacks were missing key players, however every Blacks player and their coach Cameron Roberts were all disappointed to lose this match. An inaccurate 2.10 in the fi rst term from Blacks was exacerbated by at least half of those behinds being rushed by Xavs defenders. The return of Brendan Goss for his fi rst game in Xavs colours this year was a highlight for both the red and black faithful and the neutral observer. His impact was immediate when he took a contested mark to open the scoring for Xavs. Goss ended the day with fi ve goals never leaving the forward arcs. Blacks, despite their omissions, had their chances to win the game closing the gap to just a kick in the last. However the manic tackling of Xavs meant Uni were always under either real or

perceived pressure, resulting in uncharacteristic errors. Tom Napier was a solid contributor for four quarters but he was one of the few to stamp his card each term. Xavs ultimately had more contributors for longer, Murphy Ambrose, Ben Kennedy and the return of Andy Biddlecombe all-important across the duration of the match.

De La Salle have a fantastic record against Collegians, particularly so at Harry Trott. That of course is irrelevant when they couldn’t win the one game they desperately would have wanted to win. De La controlled large swathes of this game, led at every change except the critical fi nal siren. David Lowe was a much-valued inclusion for De La and his waxing with Matt Fieldsend and Jacob Gotch was paying dividends in the middle. Adrian Indovino has been one De La’s better players this year and his second goal sent De La to a 20 point lead in the middle of the third. Collegians stepped it up a notch and Taft continued his great form in the forward line this year to boot two goals in a short period – he would fi nish with six goals – and Collegians trailed by a point at the last change. From there Collegians looked like winners but De La again fl oundered chances where as the Lions kicked theirs. Lindsay Apted’s improvement this year has been stark and his consistency was rewarded with three goals for the Lions.

Old Brighton pinched memorable away win at Old Trinity that only three weeks ago they had no right to even pencil in. The Tonners can call Dan Anthony ‘the diff erence’ whenever they meet the T’s next, as his six goals were telling in the upset win. Conversely the T’s couldn’t fi nd a winning forward. Weatherson is too often forced to lead up the ground leaving no one to come out of the goal square. Furthermore, Harry Tinney’s stellar year has potentially saved Old Trinity from this kind of rut earlier than now. Old Trinity started the superior team but the Tonners responded to work their way back into the contest and after quarter time were the better side for longer periods.

ELEPHANT IN THE ROOM

PREMIER — TIPS IN BOLD (YEARS TOTAL 47/67%)

Beaumaris v Old Trinity

De La Salle v Old Xaverians

Old Brighton v Old Scotch

St Bernard’s v Collegians

University Blacks v St Bedes/Mentone Tigers

PREM

IER


This game could still have swung Old Trinity’s way. After a strong Anthony mark, an obscure umpiring decision allowed a defender standing a metre from Anthony, to tackle him as he began his approach, a decision which astonished everyone and very nearly swung the momentum of the game. Trinity raced the ball forward and goaled. Nevertheless Old Brighton responded, Marcel Bruin and Matt Gadsen were also prominent in a win that has them eyeing off a spot at this level in 2015.

For the second consecutive week Old Scotch made an opening term statement that left their opposition in a state of fl ux. This time it was St Bedes/Mentone Tigers who felt the wrath of the Cardinals as the deluge of goals didn’t stop until their relatively subdued fi nal quarter. Mark Passador kicked another bag of six goals, but it was the overall team performance of Old Scotch that was impressive. Quarters of 6, 7 and 9 goals showed a ruthlessness born out of a costly ANZAC Day loss to the Tigers earlier this year. Pat

Kean tried his best to inspire and Michael Barnes

kicked a great goal but overall the Tigers were

never really in this. Richard Eva again produced

a quality performance and Jack Bull despite

again receiving heavy treatment was able to be

infl uential through the middle.

Andrew Merrington must enjoy the seaside. A

fortnight earlier the St Bernard’s forward bagged

fi ve goals against St Bedes/Mentone and repeated

the dose at Beaumaris last week. Another great

Beauy start was reeled in to leave the Sharks clear

by a point at the main break, before St Bernard’s

broke clear with a six goal premiership quarter.

Sullivan was again wielding infl uence for the

Snowdogs but whilst Gower and Petering were

playing well for the Sharks they couldn’t prevent

their side falling for a seventh straight week, a run

that was incidentally started when the Sharks fell

at St Bernards.

PREMIER LAST ROUND PREMIER RESERVE

St Bernards 4.2, 6.4, 12.9, 14.13 (97)Beaumaris 5.2, 6.5, 10.5, 13.5 (83)GOALS, St Bernards: A. Merrington 5, T. Gleeson 2, B. Considine 2, J. Forder 1, M. Hannan 1, C. Jones 1, R. Schroder 1, S. Fleming 1 Beaumaris: W. Manson 3, R. Cathcart 2, J. Grange 2, M. Petering 2, A. Carroll 1, B. Haynes 1, S. Braithwaite 1, W. Murton 1BEST, St Bernards: T. Sullivan, M. Hannan, A. Merrington, A. Bentick, N. Kazuro, A. SingletonBeaumaris: S. Gower, M. Petering, J. Grange, B. Haynes, M. Ensor, A. Carroll

Collegians 3.3, 6.6, 11.8, 15.10 (100)De La Salle 4.4, 6.7, 11.11, 13.15 (93)GOALS, Collegians: S. Taft 6, L. Apted 3, N. Corp 2, G. Jones 2, D. Russo 1, W. Tardif 1 De La Salle: A. Indovino 3, J. Gotch 2, D. Close 2, M. Carney 2, B. Oakley 1, T. Curry 1, D. Lowe 1, C. Haley 1BEST, Collegians: L. Apted, H. Croft, S. Taft, C. Simmons, W. Tardif, J. KamenerDe La Salle: D. Close, T. Humphrey, A. Indovino, C. Haley, D. Lowe, J. Gotch

Old Brighton 5.0, 8.4, 12.4, 13.7 (85)Old Trinity 5.5, 7.6, 8.8, 10.11 (71)GOALS, Old Brighton: D. Anthony 6, H. Cannon 2, C. King 2, O. Cavallaro 1, B. Jakobi 1, T. Skewes 1 Old Trinity: M. Kilpin 2, S. Nicolosi 2, J. Walsh 1, J. Hunt 1, B. Iezzi 1, L. Juric 1, E. Weatherson 1, B. Howell 1BEST, Old Brighton: D. Anthony, M. Bruin, M. Gadsden, L. Healy, N. Marston, T. SkewesOld Trinity: E. Weatherson, H. Tinney, H. Winter, C. Pohl, D. Wildsmith, N. Howell

Old Xaverians 3.1, 8.1, 10.3, 13.3 (81)University Blacks 2.10, 3.10, 6.14, 8.18 (66)GOALS, Old Xaverians: B. Goss 5, L. Smith 3, J. Williams 3, M. Ambrose 1, J. Anderson 1University Blacks: L. Devine 2, C. Turner 1, B. Mahon 1, B. Sheahan 1, S. Flight 1, A. Locke 1, J. Laurie 1BEST, Old Xaverians: C. Waller, E. Prowse, B. Goss, N. Wynne, J. Williams, L. SmithUniversity Blacks: B. Mahon, P. O’Rourke, A. Drysdale, J. Blake, S. Thomas, B. Sheahan

Old Scotch 6.1, 13.3, 22.7, 24.10 (154)St Bedes/Mentone Tigers 2.6, 4.12, 5.13, 9.16 (70)GOALS, Old Scotch: M. Passador 6, N. Cox 5, M. Seed 4, L. Hill 3, N. Walmsley 2, R. Wills 2, C. McDonough 1, W. Strange 1St Bedes/Mentone Tigers: T. Doherty 2, M. Barnes 2, T. Tyquin 1, C. Richards 1, P. Kean 1, B. O’Toole 1, M. Coen 1BEST, Old Scotch: R. Eva, M. Passador, N. Cox, J. Bull, R. Wills, S. ThompsonSt Bedes/Mentone Tigers: P. Kean, P. Tyquin, M. Barnes, S. D’Andrea, M. Geschke, T. Doherty

St Bernards 2.2, 5.7, 9.8, 10.8 (68)

Beaumaris 3.0, 4.0, 5.3, 8.6 (54)

GOALS, St Bernards: J. Gay 2, D. Wall 2, T. Duyndham 2, T. Russell 1, A. Boyse 1, P. Gamwell 1,

J. Manunzio 1 Beaumaris: M. Howes 3, J. Thompson 2, B. McLean 2, M. Wilson 1

BEST, St Bernards: T. Russell, B. Garth, J. Saundry, L. Madden, B. Peart, J. Manunzio

Beaumaris: T. Perkin, T. Abbott, W. Mattingley, J. Evans, S. Moore, M. Howes

Collegians 2.1, 3.3, 6.7, 8.8 (56)

De La Salle 2.3, 3.5, 3.7, 4.8 (32)

GOALS, Collegians: B. Riddle 2, M. Dyer 2, J. Parsons 1, M. Singleton 1, S. Sabbatucci 1, T.

Varigos 1 De La Salle: R. McDonough 2, S. Hogan 1, S. Harrington 1

BEST, Collegians: H. Pool, S. Hall, C. Jesaveluk, H. Apted, T. McNamara, B. Riddle

De La Salle: H. Haley, J. Oakley, L. Bull, D. Millwood, T. McMahon, L. Jarvis

Old Brighton 4.2, 8.6, 14.8, 16.11 (107)

Old Trinity 1.0, 2.2, 4.4, 5.9 (39)

GOALS, Old Brighton: M. Pascoe 4, T. Cooney 3, M. Tregear 2, L. Otto 2, T. Clarke 2, J. Davis 1, R. Cummin

1, J. Pascoe 1 Old Trinity: C. McCasker 1, T. Mitchell 1, F. Stewart 1, O. Fairweather 1, A. Medland 1

BEST, Old Brighton: J. Dickerson, J. Davis, J. Edge, T. Cooney, M. Pascoe, J. Pascoe

Old Trinity: C. McCasker, E. Beasley, A. Medland, C. Riggs, R. Mason, J. Steinhart

Old Xaverians 1.2, 2.3, 8.7, 8.11 (59)

University Blacks 2.1, 2.1, 3.1, 3.4 (22)

GOALS, Old Xaverians: R. Ralph 2, C. Smith 2, L. Keith 1, F. Lane 1, C. Santalucia 1, J. Douglas 1

University Blacks: J. Wilson 1, I. Anderson 1, D. Cooper 1

BEST, Old Xaverians: J. Pintal, J. Douglas, J. Close, L. Keith, E. Lachal, F. Lane

University Blacks: J. Quaile, S. Dadswell, A. Robbins, I. Anderson, J. Champion De Crespign,

T. Storer

Old Scotch 2.1, 5.2, 9.3, 13.8 (86)

St Bedes/Mentone Tigers 4.4, 5.8, 7.13, 11.14 (80)

GOALS, Old Scotch: E. Furey 7, L. McDonough 1, A. Harlock 1, A. Murray 1, M. Wills 1, J.

Nikolovski 1, S. Leith 1

St Bedes/Mentone Tigers: C. Hansen 3, B. Denton 2, B. Hodges 2, L. Stutterd 2, J. Cayhan 2

BEST, Old Scotch: T. Holding, E. Furey, J. Sansom, N. Lindsay, M. Wills, A. King

St Bedes/Mentone Tigers: B. Denton, C. Hansen, L. Stutterd, A. Cross, T. Gogerly, T. Pastura


There weren’t too many surprises last Saturday, as even I managed to tip all fi ve results correctly for the fi rst time this year! It was a perfect day for football as the overnight rain subsided leaving spectators to bask in sunshine and certain players of fair complexion to reach for the sun cream.

Uni Blues accounted for Old Carey to prove themselves as the class team of the competition; Old Melburnians enjoyed a victory over Old Haileybury; while Mazenod and AJAX had wins against Caulfi eld Grammarians and Old Ivanhoe respectively. The Nodders rise continued, as they remain close behind the OMs’ heels with only percentage keeping them out of fourth spot. Meanwhile, St Kevins won comfortably over Fitzroy to sustain their buff er over the top four chase group and they hold on to third place.

Any questions regarding Uni Blues’ supremacy at the top of the table were put to bed last Saturday, with a strong win over second placed Old Carey at home. A typically slow start saw the Blues trail at quarter time, and an inability to convert goals saw them move in to the main break trailing the Panthers by three goals. However, a fi ve goal third quarter and three goal last eclipsed the away side’s two majors for the half, and saw that the Blues sailed away with a 22-point victory. Jack Watts, Hugh Vickers-Willis, and Sean Carr all stood out through the middle for the Blues, while Marshall Rippon’s three majors were pivotal in the win. The panthers are not to be condemned after this loss, with their half game ascendancy over the Blue’s indicating positive aspects within their brand of football. Although an inability to capitalise on good start will be disappointing for Carey. As for many this was considered a grand fi nal preview, Uni Blues still have to be considered fi rm favourites, but Carey have proved they are no easy-beats.

Old Melburnians comfortably defeated Old Haileybury at Princes Park. OM’s moved to the front of the three way race for fourth spot and all but sealed Old Haileybury’s relegation fate. A six goal to three opening term tipped the scales in the Dark Blue’s favour early, and they would

stay that way for the reminder of the game. Melburnians won every quarter of football, acquiring more contested footy and moving far more freely around the ground than their hosts. Cam Beck kicked a career best fi ve majors, and quality contributions from Sam Playfair, Nick Voyage and Jeremy Beaumont culminated in a 45 point win for Melburnians, one they were hardly challenged for. Unfortunately, sitting three games behind Caulfi eld with only three left to play, Old Haileybury look destined for demotion. Even if they win all of their remaining fi xtures, they must rely on Caulfi eld losing all their matches to avoid the bottom two.

Mazenod continued their winning streak with a hard fought win against a brave Caulfi eld Grammarians. The contest was even, with Caulfi eld leading by four points at the fi rst break and 1 at half time, before they were tied at 47 all at the completion of the premiership quarter. Mazenod barraged the ‘Fields defence thereafter; nearly doubling their goal count with six majors, while holding Caulfi eld goalless to prevail easily. Dean Kelly led the goal kicking, dobbing four for the victors. Performances from Liam Welsford, and Josh Cowan, who also managed three and two goals each, alongside Robert Mann who was ubiquitous around the ground, underscored the important away victory.

AJAX notched up an important win against an consistent and challenging Old Ivanhoe outfi t. An even three quarters saw Old Ivanhoe lead at the fi nal interval as they were perched for a potentially devastating upset win. However the Jackas had the legs in the fi nal stanza, adding six goals to one to come out 30-point victors. Josh Ludski and Warren Steinberg were outstanding in their eff orts to lift the side throughout the match, wining plenty of ball. Jarryd Ludski was a terrier deep in

FEW SURPRISES

PREMIER B — TIPS IN BOLD (YEARS TOTAL 45/60%)

Old Carey v AJAX

Old Ivanhoe v Fitzroy

Old Melburnians v Caulfi eld Grammarians

Old Haileybury v Mazenod

St Kevins v University Blues

PREM

IER

BBlair Morton @blairwmorton


defence, while veteran Ari Lewski was a pivotal

play-making link in many forward eff orts.

St Kevins outperformed Fitzroy at Brunswick

Street to stay in third place. At the same time

SKOBs dashed any hopes Fitzroy had of playing

fi nals footy. SKOBs dictated proceedings all day,

wining every quarter and were looking the better

side in every aspect. Steve Salopek starred with

lots of the football and a classy goal, as did Zach

Ginnies. Anthony Lynch contributed three majors

alongside Nick Wood and Matt Murphy who

provided valuable input for SKOB. Fitzroy now sit

two games behind the three sides locked in the

race for fourth, and need to re-learn calculus in

order to secure a supremely unlikely fi nals berth.

This week sees Old Carey take on AJAX in a game of

huge importanancet for both sides. The Panthers

need to win to remain clear of SKOB and get back

to winning touch, while a Jackas loss could see

them lose touch with the top four competitors.

Old Ivanhoe take on Fitzroy in a contest the Roys

need to win to keep any chance, however slim,

of fi nals footy alive. Old Melburnians can hone

in on fourth spot with a win over Caulfi eld, who

will ensure they avoid relegation with a win on

Saturday. Mazenod too can improve their top four

chances with a win over Old Haileybury, who will

see their chances of retaining a Premier B start in

2015 evaporate with a loss. Lastly, St Kevins take

on Uni Blues at home, a barometer of both sides

form going into fi nals, that has the potential to

go either way, especially if SKOB bring their best

game.

PREMIER B LAST ROUND PREMIER B RESERVE

University Blues 1.2, 2.6, 7.7, 10.12 (72)Old Carey 3.4, 5.7, 6.8, 7.8 (50)GOALS, University Blues: M. Rippon 3, T. Blakey 1, M. James 1, R. Eade 1, P. Hayes 1, P. Gardiner 1, S. Carr 1, C. Williams 1Old Carey: C. Jones 3, J. Reid 2, C. Howat 1, B. Smithwick 1BEST, University Blues: H. Vickers-Willis, J. Watts, S. Carr, P. Summers, M. Rippon, J. Van De PolOld Carey: J. Murrie, A. Reed, M. Evans, A. Sloan, C. Howat, J. Rice

Mazenod 2.1, 5.2, 7.5, 13.9 (87)Caulfi eld Grammarians 2.5, 4.9, 6.11, 6.15 (51)GOALS, Mazenod: D. Kelly 4, L. Welsford 3, J. Cowan 2, N. Gentile 1, J. Trounce 1, B. Bonner 1, F. Reed 1Caulfi eld Grammarians: T. Small 2, Z. Parsons 2, T. Silvestro 1, D. Daly 1BEST, Mazenod: L. Welsford, J. Cowan, R. Mann, C. Smith, D. Kelly, S. InglisCaulfi eld Grammarians: T. Silvestro, M. Slonim, A. McGuinness, T. Small, B. Price, S. Stewart

St Kevins 4.2, 6.4, 10.7, 14.9 (93)Fitzroy 1.0, 3.1, 4.5, 6.8 (44)GOALS, St Kevins: A. Lynch 3, C. Ring 2, P. Karageorgiou 2, H. Townsend 2, L. Nankervis 2, J. Salopek 1, S. Salopek 1, Z. Ginies 1Fitzroy: M. Cussen 2, D. Pound-Palmieri 1, J. Turner 1, D. Patcas 1, W. Fenton 1BEST, St Kevins: S. Salopek, A. Lynch, Z. Ginies, N. Wood, M. Murphy, B. DowdFitzroy: R. Angiolella, W. Fenton, D. Patcas, M. Kyroussis, S. Green, J. Meakin

Old Melburnians 6.1, 11.4, 16.8, 18.14 (122)Old Haileybury 3.4, 5.7, 8.8, 11.11 (77)GOALS, Old Melburnians: C. Beck 5, T. Hywood 4, T. Marshall 3, T. Paule 2, A. Armstrong 2, J. Hooper 1, E. Fanning 1Old Haileybury: M. Meehan 3, J. Backway 2, J. Nicolopoulos 2, T. Witherow 1, H. McLauchlan 1, A. Schofi eld 1, J. Dawson 1BEST, Old Melburnians: S. Playfair, C. Beck, N. Voyage, J. Beaumont, H. Macciolli, T. MarshallOld Haileybury: P. Gleadhill, R. Johnson, M. Taylor, C. Vincent, M. Meehan, J. Toy

AJAX 0.5, 6.8, 7.12, 13.14 (92)Old Ivanhoe 2.2, 5.6, 7.13, 8.17 (65)GOALS, AJAX: D. Fayman 5, A. Burstin 2, J. Lew 2, B. Caplan 2, S. Fayman 1, W. Steinberg 1Old Ivanhoe: A. Delmonte 3, Z. Keane 2, B. Lee 1, C. Johnson 1, N. Gieschen 1BEST, AJAX: J. Ludski, A. Lewski, J. Ludski, R. Winograd, B. Caplan, M. SelzerOld Ivanhoe: D. Heta, C. Groth, H. Heta, A. Delmonte, B. Harrison, C. Johnson

University Blues 1.1, 5.4, 12.5, 14.11 (95)Old Carey 1.2, 2.2, 2.2, 4.4 (28)GOALS, University Blues: J. Mugavin 3, T. Girdwood 3, A. Wettenhall 1, D. McFarlane 1, W. Hartnell 1, J. Wood 1, R. McMahon 1, M. Steinbach 1, H. Weddell 1, J. Brown 1Old Carey: S. Cambridge 1, J. Ymer 1, P. Cremean 1, L. Marriott 1BEST, University Blues: E. Ratcliff e, E. Long, T. Girdwood, G. Chisholm, H. Evans, J. WoodOld Carey: B. Simpson, L. Hall, L. Marriott, P. Cremean, M. Pallozzi, J. Ymer

Caulfi eld Grammarians 2.2, 4.4, 8.9, 11.16 (82)Mazenod 2.2, 5.4, 6.5, 6.5 (41)GOALS, Caulfi eld Grammarians: W. Osborn 4, D. Simic 3, K. Stewart 2, J. Small 1, M. Wood 1Mazenod: D. Maskill 2, S. Mann 2, B. Woods 1, D. McLean 1BEST, Caulfi eld Grammarians: A. Spittal, D. Simic, W. Osborn, A. Bednarek, D. Dickson, D. TobiasMazenod: D. MacLeod, B. Woods, P. Johnson, D. Izon, M. Rich, J. Hende

St Kevins 3.4, 8.8, 15.10, 23.12 (150)Fitzroy 1.0, 1.0, 1.0, 4.2 (26)GOALS, St Kevins: T. McPherson 6, A. White 4, B. Kanakis 2, R. Caldow 2, J. Gambaro 2, J. Staffi eri 2, P. Aughton 1, T. Hickey 1, P. McLennan 1, T. Johnston 1, H. McPherson 1Fitzroy: B. Farley 2, J. Beech 1, C. Evans 1BEST, St Kevins: T. McPherson, T. Hickey, J. Staffi eri, L. McDonell, D. Wissell, P. McLennanFitzroy: D. Olarenshaw, A. Franklin, J. Anderson, R. Willingham, J. Murray, B. Farley

Old Melburnians 6.3, 12.6, 15.12, 19.19 (133)Old Haileybury 5.0, 5.1, 9.2, 10.4 (64)GOALS, Old Melburnians: C. Tunbridge 4, A. Coleridge 3, D. Velakoulis 3, J. Rundell 2, M. McCoy 2, Z. O’Neil 1, W. Boyd 1, Z. Johnston 1, P. Nestel 1, J. McMullin 1Old Haileybury: R. James 5, C. Ferguson 2, C. Hill 1, R. Carroll 1, T. Tyrell 1BEST, Old Melburnians: N. McLardy, Z. Johnston, A. Coleridge, Z. O’Neil, W. Beasley, A. MurrayOld Haileybury: C. Smith, C. Hill, D. Mackenzie, R. Carroll, C. Barter, A. Thomson

Old Ivanhoe 1.4, 7.7, 11.9, 15.11 (101)AJAX 1.2, 1.4, 3.6, 5.8 (38)GOALS, Old Ivanhoe: R. Dennis 7, M. Brown 2, A. Solomidis 2, R. Glavas 2, S. Leon 2AJAX: R. White 3, A. Shenker 1, S. Roth 1BEST, Old Ivanhoe: L. Phillips, J. Dunnett, R. Dennis, C. Crowley, A. Solomidis, R. DavidsonAJAX: D. Steinberg, J. Mendies, J. Brick, J. Bade-Boon, A. Wollan, D. Janover-Rocha

Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]


The Banyule faithful have every reason to feel hard done by after their side led for the best part of two hours in its clash against third-placed Hampton Rovers, before going down in the fi nal minute by one point. The loss has all but sealed Banyule’s fate in 2014, whilst the win has given the Rovers hope of securing a double chance. A Banyule snap from the stoppage handed them a fi ve point lead with two minutes left on the clock. However the ensuing bounce saw the Rovers surge the ball forward, and through relentless forward pressure the Bears defence wilted, a Josh Verlin soccer off the ground was enough to see the Rovers home.

Confronting 9th place in round fi fteen always ensures you are in for a tough day at the offi ce. One team is hanging on for grim death, the other is in pursuit of playing fi nals football. Upsets do happen when teams are trying to fi ght their way out of relegation. For the fi rst 10 minutes of the clash between Ormond and Peninsula, an upset was on the cards. The Monders booted three unanswered goals leaving the Pirates scratching their heads. But this only ignited the Pirates. Their midfi eld brigade lifted their work rate and the back-six, led by Brett Brisbane began to provide drive from defence. The Pirates had created an eight goal lead by the fi nal change. As tempers fl ared in the fi nal term the Pirates took control of the game. Late goals to Grigg, Fletcher and Scarpella (4) extended the margin to 77 points. For Ormond, Simon and Upstill could hold their heads high.

The Vultures are another step closer to playing fi nals football, after seizing fourth spot with an imposing 55 point win over Old Camberwell. Going from the smaller confi nes of Gerry Green to a larger ground such as Gordon Barnard Oval can often be a diffi cult assignment. However the Vultures took to their task with relative ease. Precision passing and relentless tacking pressure paved way for a commanding 23 point half time lead. Fearing an onslaught, the Wellers lifted their intensity in the third term with Clarke and Bennett getting on top in the clearances, alongside Rogers (3) who was lively up forward. However their hopes

of a comeback were quelled as the Vultures put the game beyond doubt with fi ve fi nal quarter goals. In the fi nal term it was Dillon and Platt in the midfi eld who broke the Wellers resistance, each snaring three goals for the afternoon. The win was highlighted by three goals to debutant Dylan Glascott, and the Vultures’ eight multiple goal kickers.

PEGS’ inability to play four quarters of football has cost it dearly in their 29 point loss to Monash Blues. PEGS were able to match it with their rivals in the fi rst and third terms, but failed to fi re a shot in the last quarter when the game was in the balance. With scores level at 53 all PEGS would’ve been hoping for a fairytale fi nal quarter, which they have been known to produce this year. However Monash’s rock solid defence were unwavering, refusing to concede a single point. Forrest was the dominant key forward on the ground for the Bombers with three goals. But it was Monash’s even spread of goal kickers that again proved the diff erence as it has often done this year, sharing the load between ten diff erent players. Livori played his fi nest game of the year for PEGS. Meanwhile for the Blues Meade and Griffi ths were standouts. Having fallen to sixth place, the Bombers will need to produce an impressive fi nal three weeks if they are to secure a top four fi nish.

To say Banyule didn’t deserve to win is an understatement. You have to feel for the Bears after they led up until the dying minutes of Saturday’s clash with the Hampton Rovers. And you can bet that Marcellin and Monash would’ve been praying for a Bears victory. The Bears held their opponents at bay for three quarters, and almost pulled off one of the upsets of the season. Unfortunately for the Bears, as time ticked past the 25 minute mark, deep into the fi nal term, they conceded a goal. A Josh Verlin soccer handed the Rovers a one point win. Barclay and Hay were outstanding for Banyule coupled with the starring role of McDonald up

Ned Hunt @ nedhunt1

UN-BEAR-ABLE TO WATCH

PREMIER C — TIPS IN BOLD (YEARS TOTAL 51/68%)

Hampton Rovers v Monash Blues

Parkdale Vultures v Ormond

Marcellin v PEGS

Peninsula v Old Camberwell

Oakleigh v Banyule

WATCH EVERY PREMIER C GAME at www.vafatv.com

PREM

IER

C


forward who booted four. Each time the Rovers

looked dead and buried it was Lovig and McNeil

who they turned to. The Rovers three quarter time

defi cit of 12 points was reduced on the back of

increased output from Care and Turner who each

fi nished with three pivotal goals. A gallant eff ort

from Banyule but one that won’t be enough to see

them remain in Premier C next season.

Oakleigh’s recent goal kicking woes came back to

haunt them on Saturday as they fell 11 points short

of ladder leaders Marcellin. It was the Eagles who

made a fast start, capitalising on an Oakleigh lapse

in concentration, racing to a 29 point half time

lead. Inaccuracy was costing the Krushers, while

their opposition appeared to pierce the big sticks

with relative ease. Bolger added another three to

his tally of 41 majors for the year, while Carlson

and Bortolotto (2) amassed plenty of the ball in the

midfi eld. The Krushers were able to bridge the gap

to 22 points by the fi nal change, after Hogan and

Murray produced stellar third terms. Onlookers

were given a front row seat to the Austin Deneys

show in the last term, as he tried to singlehandedly

kick start an Oakleigh revival, with four fi nal quarter

goals. Unfortunately his fellow teammates failed to

have the same impact.

Back at the familiar surrounds of Boss James, The

Rovers assume 2nd spot if they account for the

Blues. The Vultures are taking fl ight at the right

time of year, win number three in three weeks will

see them tighten their grip on 4th spot. A poor

travelling side this year, PEGS will need to produce

one of their fi nest performances of the season if

they are any chance to defeat the Eagles. Similarly

Peninsula and Oakleigh both need to win to keep

their fi nals prospects alive, but can Old Camberwell

and Banyule bring their 2014 campaigns unstuck?

There is a lot at stake this weekend, four teams

have their eyes set on fourth position. Which teams

will buckle? And which teams will make a big play?

PREMIER C LAST ROUND PREMIER C RESERVEHampton Rovers 1.2, 6.8, 8.10, 13.12 (90)Banyule 4.6, 7.9, 10.10, 13.11 (89)GOALS, Hampton Rovers: M. Care 3, E. Turner 3, J. Donald 2, C. Sharp 2, S. Burggraaff 1, J. Verlin 1, S. Clements 1 Banyule: D. McDonald 4, R. Hay 2, D. Gayfer 2, Z. Wenke 2, L. French 1, A. Barclay 1, R. Williams 1 BEST, Hampton Rovers: J. Lovig, A. McNeil, M. Care, S. Clements, J. Verlin Banyule: R. Hay, A. Barclay, M. Christian, O. Philp-Taylor, J. Clark, L. French

Marcellin 4.5, 9.7, 11.10, 14.12 (96)Oakleigh 2.2, 4.8, 7.12, 11.19 (85)GOALS, Marcellin: D. Bolger 3, X. Burns 2, M. Gasparini 2, J. Bortolotto 2, N. Crosbie 2, A. Beaini 1, J. Antypas 1, D. Redmond 1 Oakleigh: A. Deneys 4, J. Paola 3, S. Tolongs 2, L. Hard 1, T. Scott 1BEST, Marcellin: J. Carlson, J. Bortolotto, P. Hamblin, J. Blanch, P. Millsom, M. GaspariniOakleigh: A. Deneys, C. Hogan, A. Murray, J. Paola, A. Valentini, D. Cleary

Parkdale Vultures 5.1, 10.2, 15.6, 20.8 (128)Old Camberwell 4.2, 6.3, 10.6, 11.7 (73)GOALS, Parkdale Vultures: C. Dillon 3, L. Platt 3, D. Glascott 3, N. Papatsanis 2, S. Hendricks 2, T. Boland 2, J. Le Breton 2, N. Ng 2, C. Tobin 1Old Camberwell: A. Rogers 3, H. Crothers 2, T. Miriklis 1, N. Tsindos 1, D. Toma 1, S. Bennett 1, R. Campbell 1, R. Kapoor 1BEST, Parkdale Vultures: C. Dillon, S. Hendricks, M. Ryan, P. Sullivan, R. Swayn, S. ChittyOld Camberwell: A. Clarke, S. Bennett, R. Kapoor, P. Bennett, R. Campbell, A. Halabi

Peninsula 5.5, 11.7, 13.11, 19.15 (129)Ormond 3.2, 3.6, 5.9, 7.11 (53)GOALS, Peninsula: T. Scarpella 4, T. Stainforth 2, S. Grigg 2, S. Buchanan 2, S. Glenn 2, A. Wood 1, S. Payze 1, A. Marshall 1, G. Fletcher 1, H. Brodie 1, J. Pomeroy 1, J. Gleeson 1Ormond: S. Stait 2, I. Tahana 2, D. Frazier 1, D. Bailey 1, M. Saunders 1BEST, Peninsula: T. Scarpella, B. Brisbane, R. Powney, A. Wood, G. Fletcher, B. SouthamOrmond: B. Upstill, J. Simon, H. Jacobs, M. Saunders, L. Anrep, D. Bailey

Monash Blues 4.0, 8.1, 8.5, 14.7 (91)P E G S 4.3, 4.4, 8.5, 9.8 (62)GOALS, Monash Blues: A. Carr 2, D. Hatch 2, J. Cosgriff 2, J. Taylor 2, L. Buck 1, E. Flanagan 1, Z. Ledin 1, J. McKenzie 1, J. Griffi ths 1, A. Young 1P E G S: D. Forrest 3, D. Cantwell 1, N. Bartram 1, J. Young 1, D. Roscoe 1, C. Livori 1, S. McCann 1BEST, Monash Blues: J. Meade, J. Griffi ths, A. Hickey, J. Taylor, J. Ledin, B. AmbergP E G S: C. Livori, D. Flaherty, S. Ghasimzadeh, J. Pound, B. Jones, J. Young

Hampton Rovers 5.4, 5.9, 9.10, 18.11 (119)Banyule 2.0, 4.4, 5.7, 8.10 (58)GOALS, Hampton Rovers: C. Long 3, C. Malthouse 3, A. Long 2, N. Bloomfi eld 2, G. Ivanka 1, M. Powell 1, M. Broadley 1, L. Dynon 1, M. Rowse 1, J. Coverdale 1, M. Woltering 1, S. Dalton 1Banyule: S. Hills 2, M. Borg 2, J. Plant 1, S. McKenzie 1, J. Pentland 1, M. Stephenson 1BEST, Hampton Rovers: N. Bloomfi eld, L. DeLisle, T. Youl, A. Power, C. Long, C. MalthouseBanyule: S. Hills, H. Tippett, M. Borg, S. McKenzie, A. Valvo, J. Pentland

Marcellin 4.5, 9.6, 14.6, 15.8 (98)Oakleigh 2.2, 6.4, 9.6, 10.12 (72)GOALS, Marcellin: Oakleigh: D. Costigan 3, L. Moeller 2, R. Gonzalez 1, S. Way 1, E. Catalla 1, J. Paola 1, N. Miller 1BEST, Marcellin: Oakleigh: C. Mercuri, B. Hogan, D. Costigan, S. Taylor, R. Gonzalez, A. Matthieson

Parkdale Vultures 3.2, 6.4, 7.8, 11.10 (76)Old Camberwell 1.0, 2.2, 5.6, 7.6 (48)GOALS, Parkdale Vultures: R. Irvine 2, A. Thompson 2, T. McLENNAN 1, S. L’Huillier 1, P. Lee 1, Z. McCarthy 1, M. Ferguson 1, D. McCarthy 1, S. Rzek 1Old Camberwell: B. Hillier 1, B. Cottrell 1, S. Needham 1, M. Woodbridge 1, T. Schipper 1, C. Webster 1, M. Jeff ers 1BEST, Parkdale Vultures: S. Chapman, D. Graham, J. Lay, Z. McCarthy, R. Meade, D. AtkinsOld Camberwell: S. Needham, T. Stayner, C. Gorman, N. Russell, N. Searles, T. Schipper

Peninsula 7.4, 13.8, 19.9, 24.16 (160)Ormond 2.0, 4.2, 5.4, 6.4 (40)GOALS, Peninsula: J. Archdeacon 6, C. Macaulay 5, J. Coghlan 4, S. Cain 3, B. Mitchell 3, T. Shayler 1, L. Baker 1, R. White 1Ormond: S. Walker 2, B. Lydster 1, J. Cukierman 1, C. Carothers 1, J. Gates 1BEST, Peninsula: B. Mitchell, C. Macaulay, E. Coghlan, T. Coghlan, M. Tuckett, S. CainOrmond: W. Cove, B. Lydster, C. Harvey, B. Rockman, J. McDonald, M. Bannan

P E G S 5.1, 6.3, 7.7, 8.7 (55)Monash Blues 1.0, 3.2, 4.2, 7.4 (46)GOALS, P E G S: A. Khallouf 3, M. Miller 1, L. Fitzgerald 1, B. Anderson 1, C. Tzambazis 1, J. Marr 1Monash Blues: not suppliedBEST, P E G S: B. Briggs, D. Phelan, J. Rogers, C. Tzambazis, A. Khallouf, M. MillerMonash Blues: not supplied



VAFA Media Coverage

LATE SCORES, FINES AND TRIBUNAL

STREAMING LIVE AT

southernfm.com.auSUNDAYS at 9:00am

Tom Brain, Steve McCarthy & Stephen

(Chooka) Grey apply their post-mortems

Sundays at 6:00pmGlenn “Scatters” Scarborough

dissect the weekend’s round

Streaming at northwestfm.org

LIVE SCORES: Access the URL on your Smartphone& save to your home screen.

livescores.vafa.com.auLISTEN TO BUSH ‘N’ THE BURBS

WITH MARK FINE 9PM THURS

vafatv.com

facebook.com/vafa.

@VAFA_HQ

9:00 am VAFA Footy ShowHosted by Andrew Leonard and John Kanis. Plus a rotating panel

of VAFA experts discussing all the big issues of the week.

VAFA Match of the RoundSaturday: Old Brighton v Old Scotch from 1.45pm

Results of Tribunal – 5 August 2014

Joshua Watts, Peninsula (Under-19). Striking, 2 matches.

Andrew Khallouf, PEGS (Reserves). Striking, 5 matches.

*James Tyquin, St. Bedes Mentone Tigers. Striking, 2 matches.

*Michael Defontenay, Beaumaris. Striking, 2 matches.

*Lachlan McQueen-Miscamble, Old Carey. Striking, 2 matches.

*Dylan Patcas, Fitzroy. Unreasonably rough conduct, 3 matches.

*Adam Pearson, Whitefriars. Striking, 2 matches.

*Will Wright, Old Carey (Under-19). Striking, 2 matches.

*Accepted Prescribed penalty.

Results of Investigations

Fitzroy and St. Kevins, two major melees, senior match on 2 August.

Both clubs accepted prescribed penalty. Fitzroy $1250, St Kevins $800.

Late Scores - 26 JulyMonash Gryphons — Division 2 (2nd Off ence)

South Mornington — Division 3 (3rd Off ence)

South Mornington — Division 3 Reserve

Old Ivanhoe — Under 19 3

Incorrect Scores - 26 JulyOld Brighton — Premier

Old Mentonians — Division 1

South Mornington — Division 3 Reserve (2nd Off ence)


FOR

THE

LOVE

OF

THE

GAM

E

» Largest range of strapping tapes and medical supplies » Used by Clubs and Leagues for over 15 years » Rewards packages available

Club Warehouse is the leading Sports Medical Supplier, offering an extensive range of quality sports medical supplies. Discuss with us your budget options and we can provide product solutions suited to your needs.

Call us today to experience the Club Warehouse difference!

» Taping Supplies » Sports Nutrition & Hydration » Rehabilitation » Supports and Bracing » Sports Performance

» First Aid Supplies

‘Protect your players with the best’

P: +3 8413 3100 M: +61 413 576 677E: [email protected]

» EDFL, EFL, SFL, WRFL, VAFA, AFL VIC, 14 AFL CLUBS.Proudly chosen medical supplier for:

‘Official Suppliers’


FOR

THE

LOVE

OF

THE

GAM

E

BULLEEN TEMPLESTOWE CELEBRATE

Three weeks ago, Bulleen Templestowe AFC hosted

their 40th anniversary ball held at The Centre

Ivanhoe. More than 200 attended a gala evening

to celebrate the club’s amazing history. The Club’s

record in the VAFA in the 1970s & 80s in particular

is quite remarkable. The club was formed out of

the Bulleen Templestowe Youth Club who entered

teams in local under age football competitions

and was administered by that club until the senior

committee was formed in 1976. After entering a

senior team in 1975 the club made progress each

year to climb all the way to A Section for the 1984

season. Along the way the club claimed three

premierships before they lost the 1984 A Section

preliminary fi nal. They climbed six sections in 10

seasons! The Bullants spent four years in A Section

before a gradual descent over the years to Division

1 where they now sit. To celebrate the night the

club named a team of the decade for most recent

10 year period and the club also produced a quite

attractive booklet covering the fi rst forty years.

From everyone at the VAFA, congratulations on 40

great years, let’s hope there are another great 40

to come!

THOUGHTS GO OUT…

Our thoughts are with the Prahran Assumption Football Club and the Dean Family whose son Ash was involved in a car accident last Saturday. Ash is currently in the Royal Melbourne Hospital. We wish Ash all the best with his recovery.

BUILDING A ROOF FOR VAFA GROUNDS?

After last week’s debate at AFL level about leaving the roof open for the Melbourne v Brisbane Lions match at Etihad Stadium and how the poor players suff ered looking into the sun, we wondered when VAFA clubs will be looking to build a roof over their grounds. There are many VAFA grounds that run on the same North-South axis as Etihad Stadium does so we thought we would raise the possibility of any of them ever getting a roof installed overhead. Just some that we can think could do with a roof are:

Bennettswood Sports Ground(Emmaus St Leos)

Elsternwick Park Oval 1 and 2(Home of VAFA HQ/Elsternwick AFC)

Glenhuntly Oval (Caulfi eld Grammarians)

Harry Trott (Collegians)

Junction Oval (Old Melburnians)

Princes Park (Old Haileybury)

Toorak Park (Old Xaverians/Prahran Assumption)

Of course there are many more but of these, you would imagine Collegians are closest to installing a roof after their much hyped installation of lights at Harry Trott. Given it took Collegians six years to get their lights up, any takers on how long it will be before they get a roof over Harry Trott?


VAFA TIPPING UPDATE

Only a few more weeks remain in the seven

VAFA Tipping competitions. There are some

great fi nals to be won and there are still a

large number of tipsters that can claim top

honours in any of the seven sections. For

those that might have missed a week or two

the away teams have done you some favours

in recent weeks. There is better news for all

tipsters too, all VAFA staff are ineligible for

the top prizes in each section. But don’t think

that will stop them from trying to at least

win bragging rights.

Head to vafa.com.

au/tipping to see

the leader board in

each section.

BIG V CLUB LUNCH A SUCCESS

Last Friday saw more than 220 guests attend the eighth Annual Big V Club Lunch at the lavish RACV Club. This year saw three new Big V Champion inductees Duncan Anderson (University Blues), Michael Blood (Old Xaverians) and Andrew Ramsden (Old Trinity) who were supported by

their family and friends on the day. Duncan’s sister and daughter accepted the award on his behalf whilst both Andrew and Michael spoke of how honoured they were to be recognised by the Big V Club in this way.

(L-R: Ingrid Anderson (daughter of Duncan Anderson), Rosemary Warssam (sister of Duncan), Andrew Ramsden and Michael Blood.)

ghts.

om.

e

n


FOR

THE

LOVE

OF

THE

GAM

EFO

R TH

E LO

VE O

F TH

E GA

ME

2014 INTERNATIONAL CUP

The 2014 International Cup will be played in Melbourne from August 9 to 23. There will be 18 men’s and seven women’s teams competing.

Men’s teams: Canada, China, Fiji, Finland, France, Indonesia, Ireland, Great Britain, India, Japan, Nauru, New Zealand, Pakistan, Papua New Guinea, South Africa, Sweden, Tonga, USA. New teams for IC14: Finland, Indonesia and Pakistan.

Women’s teams: Canada – Northern Lights, Canada – Midnight Suns, Ireland, Fiji, Tonga, USA – Freedom, USA – Liberty.

The majority of matches will be played at Royal Park in Parkville and for the fi rst time a community round will be played on Saturday August 16 as curtain-raisers to suburban, amateur and country matches.

The women’s grand fi nal will be played at Punt Road Oval and the men’s grand fi nal will be the curtain-raiser to the Round 22 AFL match between Hawthorn and Geelong at the MCG on Saturday August 23.

Expatriate Australians are ineligible to play in the International Cup. Teams are comprised solely of

amateurs who must be nationals of the country they represent. All players must have lived the majority of the years aged between 10 and 16 as a citizen of their nation.

The International Cup is played every three years. Previous International Cup winners are; Ireland (2002 & 2011), New Zealand (2005) and Papua New Guinea (2008).

Other VAFA clubs are also hosting matches of the International Cup in the competition’s Community Round to take place on Saturday 16th August.

Box Hill North are hosting the match between Japa n and Tonga as a curtain raiser to their senior match against Hawthorn in Division 4.

Manningham Cobras are hosting Fiji and Great Britain as the curtain raiser for their Round 17 match against Dragons also in Division 4.

These two clubs were luckily selected from a large pool of applicants of community clubs wanting to host matches.

FURTHER DETAILS CAN BE FOUND

AT WWW.AFLIC14.COM.AU


MIL

ESTO

NES

All milestones to [email protected] by Monday noon.

Please supply a picture or Milestones reserves the right to fi nd one on the web.

GAMES VAFA CONGRATULATES YOU IN REACHING THE MILESTONE

250

Congratulations to Emmaus St Leos’ PAUL MCGLOIN – Paul arrived at the

club with his twin brother Rob in 2000 to form the ‘Twin Bobcats’, confusing

opposition coaches who thought they were seeing double as they roved all

over the ground, with their courageous team play. Paul is a great on fi eld leader

and a hard at the ball centre man, who likes kicking a few goals and is a popular

clubman at the Animal Cage

250

Congratulations to Kew’s NICK TINETTI – Nick joined Kew from the Old Xaverians in 1999

and quickly made an impact with his leadership and silky smooth skills. In addition to his

contribution to the Kew FC committee, Nick has gone on to be Kew’s longest serving Senior

captain, is a Reserves Best and Fairest winner and more recently, Life Member. Respected by all

and a class act on and off the fi eld, congratulations to Nick on this major milestone.

200

Congratulations to St Bernard’s BRENTON GARTH. A St Bernards Junior, ‘George’

played in two MEGT U19 Premiership sides (‘02/’03). In 2004, George won the

U19 B&F and made his Senior debut, before playing in the clubs last Premier

fi nals campaign. In 10 years of taking on the VAFA’s best, George’s fearless

approach has resulted in a few injuries, so it’s great to see him chalk up the 200.

All at ‘the snakepit’ salute a great clubman.

200

Congratulations to Ivanhoe’s JOE MAZOCCA – Joe has been an outstanding

contributor (on and off the fi eld) over the years and has gained a cult following

during that time. Well known for his on-fi eld banter, red boots and end of season

stories, Joe is admired and well respected by all at the IAFC. Joe has been a

resolute defender for much of his playing career and is aff ectionately known as

the ‘iron fi st’ in acknowledgement of his no nonsense approach to clearing the

ball from many an opponent over the years.

150

Congratulations to Old Geelong’s COLBY O’BRIEN – Arriving in 2004, Colby played in a Seniors

premiership within his fi rst two years and has since become one of the best players the club has

seen. Blessed with an uncanny knack to fi nd his way through traffi c, Colby has become a great

ball-winner and has won two club best-and-fairest awards.

150

Congratulations to Old Mentonians’ KYM REGAN – Since joining the Club in

2002, Kym has been a fantastic contributor to the Panther cause. Kym is one

of the few players to have represented the OMFC in the Seniors, Reserves,

Thirds and Under 19s, and has coached the Thirds. A long term member of the

committee, Kym was the Panthers’ Best Club Member in 2013. Well done Kym,

now that the knee has been repaired we look forward to your 200th.

150Congratulations to Old Ivanhoe’s BRANT HARRISON and BRETT NAGEL – Brant

and Brett have played nearly all games at Senior level, including a number of

fi nals and premierships. Both were part of the 2013 Premier C Premiership team.


MIL

ESTO

NES


100

Congratulations to Old Xaverian MATT BALL – Matt arrived at the club in 2009,

where he made an immediate impact as a leader, on and off the fi eld. Club

captain from 2010 to 2013, Bally is your old school ‘in and under’ on-baller and

alpha male of the Old Xavs. One of the clubs greatest and most inspiration

captains, Matt leads from the front and by example. Awarded the Best & Fairest

in 2012, Matt is a true great of the Old Xavs!

100

Congratulations to Oakleigh’s CHRIS HOGAN – Chris was recruited from

Oakleigh JFC and played his fi rst Senior game against Rupertswood in round 11,

2004. With three Premierships, Chris won the 2004 VB Zann Medal and several

other awards at the club.

100

Congratulations to St Kevins’ TOM MCPHERSON – Tom is brother to Reserves

stalwart Hamish, and son of the charismatic Duncan. While still at school, Tom

started at SKOB in 2007 in the U19’s, amassing 28 U19 games, including sharing

the U19 goal kicking Award in 2008. His career has continued with 11 Reserves

games and 60 games in the Seniors, being awarded the Best 1st Year player in

2010.

100

Congratulations to St Kevins’ NICK MARCHESANI – Nick is a journeyman,

reaching the 100 game milestone after 14 years at the club, having debuted with

the Under 19’s in 2000. A member of the Reserves Premiership side in 2004, Nick

didn’t play football between 2005 and 2009. He returned in 2010 where he has

mostly played Thirds football. A highlight of his career was playing with his three

brothers: Ben, Tom and James, earlier this year.

100

Congratulations to Old Haileybury’s RHYS JOHNSON – Rhys has recently

returned to the club after several years at Frankston YCW. Rhys is a fi t, strong,

hard at it mid-fi eld type, with long hair and tattoos that make him stand out

from the crowd. His wife Brooke and son Rye can always be found cheering him

on from the sidelines. Congratulations Rhys on reaching your 100th game.

100

Congratulations to Swinburne Uni’s NICK MAURAN – Nick has the unenviable

task of playing on the opposition’s best forward every week, a challenge he looks

forward to and handles with aplomb. His steely determination and physical

attributes allow Nick to play on the quick smalls or the big key forwards. He

thrives in the contest and always wants to be pitted and challenged by the best.

100

Congratulations to St Bernard’s DAMIAN HURLEY – It’s been a long time coming

for ‘Hurls’ who played in St Bernards’ back to back MEGT U19 Premiership sides

in 2003/04. After a season of Reserves footy, Hurls spent a few years travelling.

Returning to footy, Hurls has been a star with the Warriors and Thirds sides in

recent seasons. Well done Hurls.

100

Congratulations to Ormond’s ORRY LACK – Judgy played his junior footy for

Frankston YCW before joining Ormond’s U19s in 2006. He has played in two U19

Grand Finals in 2006 and 2007, two Reserve Grand Finals in 2010 and 2011 and a

Senior Grand Final in 2013. He won the U19 goal kicking for Ormond in 2007.



100

Congratulations to Old Ivanhoe’s HAYDEN HETA – Hayden has been Captain of

the club for the last 3 years. In 2007, in his fi rst year with Old Ivanhoe, Hayden

was awarded the Woodrow Medal. He is a Premiership captain, twice Club Best &

Fairest, and has been a Big V representative on a number of occasions. Hayden is

tireless ruckman, great leader and a truly nice bloke.

100

Congratulations to Old Geelong’s JOHN FORSTER – John arrived in 2008 after fi nishing school

at Geelong Grammar, and has since become one of the most consistent players at the club. With

a penchant for mud and a hard contest, John has made a name for himself by winning the hard

balls in the air and on the ground.

50

Congratulations to Old Haileybury’s JOHN NICOLOPULOS – Poppa is a young,

exciting, match winning forward who loves to celebrate a goal with a leap in the

air and a fi st pump, which always brings the crowd to their feet. He is a leader on

and off the fi eld, with a big future in front of him. Congratulations Poppa on 50

memorable games.

50Congratulations to Oakleigh’s MATHEW ARANHA – Mathew was recruited from

Waverley Blues JFC, and played his fi rst game against Rupertswood U19’s in

round 2, 2012.

50

Congratulations to Old Geelong’s WILL SHARP – Will started his career in 2011 with the Reserves

and Club XVIII, a team with which he won a premiership in 2012. In the years since, he has shown

what can be achieved through hard work and dedication, turning himself into one of the club’s

fi ttest and hardest midfi elders.

16 THE AMATEUR FOOTBALLER 2014SPORTS INJURY CASUALTY - OPEN 1-7 SATURDAY

Bulleen Templestowe’s rise from the almost clutches of relegation is no longer a false hope as they closed the gap between themselves and eighth placed Whitefriars to just two points. Following a memorable win over rival Prahran Assumption, Bulleen Temp will need to reproduce that tenacity as their run home consists of three fi nals aspirants in need of victory as dearly as themselves. Elsewhere, Old Mentonians defeated Old Geelong to square up the race for fourth place. The OG’s remain favourites to take the remaining fi nals spot with a slightly easier draw, however the Panthers form is currently far superior.

After a slow start in the fi rst quarter, Bulleen Templestowe returned with a vengeance in the second. Down by 15 at the fi rst change of ends, they piled on fi ve goals to earn a 12-point advantage at the major break. The Bullants kept the pressure on the visitors in the third and managed to hold on to a steely four point win in the last. Despite Tim Rogers’ bag of fi ve, Prahran Assumption were unable to turn the tide and whisk away the four points. Anthony Lucisano was best on ground in Bulleen Templestowe’s second victory on the trot. The Bullants have doubled their win tally for the year in the past fortnight.

In an eight-point game, Old Mentonians thrived in the must-win scenario, as they defeated fellow fourth spot hopeful Old Geelong. Throughout the day both sides gave away opportunities, and the Panthers capitalised on this more so than the OG’s. OMFC controlled the majority of the matchup but seemingly let it slip late in quarters. Their hardy tackling and intensity was there, despite this Old Geelong would kick their way back into the game and almost stole the four points because of it. The Panthers’ seven point lead at three quarter time soon blew out beyond four goals as they dominated the fi rst 20 minutes. But as it ticked into time-on, the OG’s mounted another comeback kicking three quick goals and were roaring home. Unfortunately for the home crowd the siren silenced the fi ght back

as Old Mentonians won by four points. Elliot Macquire was best on across half back for the visitors.

NOBS/St Pat’s survived a monumental scare as Whitefriars threw the book at the fi nals-destined NOBs, leaving it until the last 10 minutes to fl ick the switch and race home to victory. NOBSPC started poorly while the Friars played out of their skin, kicking fi ve majors to two in the fi rst term. Whitefriars embarrassed NOBs in the fi rst half, keeping them to just three goals mostly due to sublime pressure and better spread going forward. The NOBs’ experienced heads slowly awoke in the third, as the visitors closed the margin to 16-points, however NOBs were still lacking the game-winning fi repower. Whitefriars continued to fl ounder opportunities thus leaving the door ajar; NOBSPC returned to their best with a goal-spree that came from nowhere. At the blink of the eye NOB/St Pat’s drove fi ve goals past the Friars and secured a 25-point victory. Damon Byrne was one of the few four quarter contributors for the NOBs, and played a signifi cant part in the match-defi ning fourth term burst to earn best on ground honours.

In the game between Williamstown CYMs (2nd) and MHSOB (10th), both teams had secured their fate long ago and seemingly had little to play for. Nonetheless the CY’s still handled the lowly Unicorns convincingly. The end result was as comfortable as could be expected, Williamstown had lavishly notched up 10 goals by half time. It didn’t stop there as the CY’s doubled that and some by game’s end. MHSOB struggled as most have this season against Williamstown, the CY’s showed no mercy against a side that has tallied just one win for the year. Nicholas Ebinger and Jack Gray had a fi eld day with four goals apiece

BULLANTS’ RELEGATION ESCAPE?

Listen to VAFA FOOTBALL SHOW 9-11am Sat. on 96.5 FM

DIVISION 1 — TIPS IN BOLD (YEARS TOTAL 60/80%)

Yarra Valley v Williamstown CYMS

Whitefriars v Old Geelong

MHSOB v NOBS/St Pats

Prahran Assumption v Therry Penola

Old Mentonians v Bulleen Templestowe

DIVI

SION

1James Reid @JamesRied9


NOBS/St Pats 2.0, 3.4, 6.8, 14.11 (95)Whitefriars 5.3, 7.4, 9.6, 10.10 (70)GOALS, NOBS/St Pats: C. Horsley 4, J. Molony 2, M. Keown 2, D. Tonkin 2, M. Chapman 1, D. Byrne 1, M. O’Donoghue 1, J. Nettlefold 1Whitefriars: M. Mirabella 3, D. Di Staso 2, D. Leardi 2, M. Geilings 1, J. Hogan 1, A. Pearson 1BEST, NOBS/St Pats: D. Byrne, D. Clarkson, D. Tonkin, P. Kelly, T. Weaver, M. O’DonoghueWhitefriars: D. Kaldor, D. Leardi, A. O’Meara, A. Marcello, M. Geilings, S. Currie

Williamstown CYMS 4.2, 10.5, 16.10, 21.14 (140)MHSOB 1.2, 2.5, 3.6, 4.10 (34)GOALS, Williamstown CYMS: N. Ebinger 4, J. Gray 4, N. Holdsworth 3, M. John 3, R. Joy 3, B. Gray 1, J. Hatfi eld 1, S. Puhar 1, F. Adamson 1MHSOB: S. Villani 1, L. Hood 1, L. Meyer 1, B. Jellis 1BEST, Williamstown CYMS: J. Gray, N. Holdsworth, C. Richards, R. Chan, N. Ebinger, F. AdamsonMHSOB: S. Villani, D. Hamilton-Ho, J. Tran, J. Sherwin, L. Meyer, L. Hood

Old Mentonians 3.4, 6.7, 9.9, 13.10 (88)Old Geelong 3.2, 6.5, 8.8, 12.12 (84)GOALS, Old Mentonians: B. Parker 2, T. Banks 2, M. Gledhill 2, L. Hull 2, T. Wilton 1, J. Costello 1, J. Jansson 1, D. Brown 1, M. Myers-Snyders 1Old Geelong: T. Wigan 3, P. Tucker 2, J. Hoevenaars 2, C. O’Brien 2, C. Wood 2, W. Sharp 1BEST, Old Mentonians: E. Macquire, M. Myers-Snyders, K. Conlon, D. Brown, B. Norton, B. ParkerOld Geelong: A. Herd, N. Hardie-Grant, R. Kemp, C. Wood, J. Hoevenaars, T. Wigan

Therry Penola 2.2, 4.9, 6.13, 11.18 (84)Yarra Valley 1.0, 2.1, 2.2, 3.3 (21)GOALS, Therry Penola: J. Bannister 3, A. Marangon 1, M. Costello 1, H. Rowe 1, M. Sullivan 1, M. Valenti 1, C. Bannister 1, J. Crotty 1, J. Costello 1Yarra Valley: T. Hancock 1, J. Canham 1, R. Amos 1BEST, Therry Penola: J. Costello, M. Lyons, J. Egglestone, J. White, M. Sullivan, N. MilevskiYarra Valley: B. Trend, L. Evans, S. Savage, S. Yeo, T. Hancock, J. Amos

Bulleen Templestowe 1.1, 6.6, 8.8, 12.11 (83)Prahran Assumption 3.4, 4.6, 5.10, 11.13 (79)GOALS, Bulleen Templestowe: J. Cowell 2, R. Edsall 2, M. Rogers 2, G. Chivers 1, D. Tulloch 1, S. Lambropoulos 1, P. Florance 1, M. Cowell 1, M. Considine 1Prahran Assumption: T. Rogers 5, P. Harris 4, T. Keaney 1, A. Sleight 1BEST, Bulleen Templestowe: A. Lucisano, L. Bettiol, J. Cowell, H. Vogler, R. Edsall, D. TonelliPrahran Assumption: B. Kenny, D. Anglin, B. Dempsey, B. Field, B. Adams, T. Rogers

NOBS/St Pats 2.0, 3.4, 6.8, 14.11 (95)Whitefriars 2.2, 4.5, 5.7, 7.10 (52)GOALS, Whitefriars: T. Chivers 3, J. Urbano 1, M. Larosa 1, T. Urbano 1, C. Zarafa 1NOBS/St Pats: D. O’Donaghue 2, N. Hrovatin 1, S. Davidson 1, D. King 1, H. Bismire 1BEST, Whitefriars: B. Staff ord, C. McFadyen, C. McDonald, C. Zarafa, M. Scannell, G. ZerbiNOBS/St Pats: C. Fox, D. King, H. Bismire, T. Emmett, M. Rapa, J. Hunter

Williamstown CYMS 2.2, 8.5, 13.10, 14.14 (98)MHSOB 4.1, 6.1, 7.2, 9.3 (57)GOALS, Williamstown CYMS: S. Barlow 6, M. Sultana 2, J. Gill 2, B. Dobney 1, N. Knapman 1, T. Bowers 1, B. Hynes 1MHSOB: M. McKinnon 3, N. James 2, M. Ham 2, N. Taranto 1, K. McDonald 1BEST, Williamstown CYMS: S. Barlow, N. Bratby, M. Cavarra, B. Hynes, A. Thompson, T. BowersMHSOB: N. James, D. Burke, C. Hewish, K. McDonald, B. Pretty, S. Hayes

Old Geelong 9.5, 14.8, 22.12, 30.14 (194)Old Mentonians 0.0, 0.0, 0.0, 0.0 (0)GOALS, Old Geelong: T. Slattery 5, T. Claeys 4, A. Smibert 4, C. Gibbs 3, J. Johnston 3, N. Hobson 2, S. Griffi ths 2, T. Hunt 2, P. Lynch 1, H. Beaumont 1, C. Barham 1, C. Hammond 1, A. Bird 1Old Mentonians: BEST, Old Geelong: A. Bird, T. Slattery, T. Claeys, H. Beaumont, J. Johnston, S. MathesonOld Mentonians: B. Clurey, J. Paul, P. Merkus, T. Goodrich, J. Lee, C. Downie

Yarra Valley 4.2, 6.4, 8.7, 11.8 (74)Therry Penola 3.2, 6.6, 8.10, 8.13 (61)GOALS, Yarra Valley: S. Donald 5, R. Little 2, R. Yeo 2, D. Blewonski 1, A. Whetham 1Therry Penola: D. Leroy 2, R. Steer 2, J. Quinn 2, T. Robertson 1, E. Benson 1BEST, Yarra Valley: M. Neilly, K. Moody, P. Ferrier, R. Yeo, S. Donald, D. RickettsTherry Penola: J. Hanlon, B. Budiono, M. Pell, M. Reynolds, D. Angus, T. Robertson

Prahran Assumption 3.6, 11.9, 15.14, 18.20 (128)Bulleen Templestowe 0.0, 0.0, 1.1, 2.1 (13)GOALS, Prahran Assumption: R. Ellis 7, A. Hall 2, D. Cupples 2, M. Sampson 2, J. Rice 2, N. Giofre 2, T. Candy 1Bulleen Templestowe: A. Lauria 1, D. Gibney 1BEST, Prahran Assumption: R. Ellis, M. Laverty, J. Ancrum, A. Hall, E. Delahenty, D. CupplesBulleen Templestowe: A. Stavretis, M. Stella, A. Radatti, L. Shiel, C. Minkou, D. Russo

DIVISION 1 LAST ROUND DIVISION 1 RESERVE


goal fl attered Yarra Valley with the fi nal 63-point margin.

This week, Williamstown CYMS travel to Yarra Valley, predicting the CY’s to return home with the four points. Whitefriars host Old Geelong, if the OG’s are to make fi nals they must win this weekend. MHSOB plays NOBS/St Pats, expect the Nobs to win easily. Prahran Assumption faces Therry Penola who will make it 16 wins in a row. Old Mentonians verse Bulleen Templestowe, the Panthers to keep momentum and be victorious.

while Gray was named B.O.G for his all-round

performance.

Therry Penola had no trouble edging past their

Grand Final competitor of last year in Yarra Valley

to win their 15th game in a row in Division 1.

Yarra Valley’s defensive mindset to play a man or

two behind the ball was fruitless. Aside slowing

down the play, the Bushrangers were unable

to stem control the Lions exerted on the day.

It took Therry a quarter to adjust, but by the

second term they were able to slice through the

extra defenders and fi nd their targets. Jarrod

Bannister was the only multiple goal scorer for

the Lions with three, while Joel Costello was best

afi eld in a game where Therry’s inaccuracy at

18 THE AMATEUR FOOTBALLER 2014Follow the VAFA on Twitter @VAFA_HQ

DIVI

SION

2

It took 15 rounds but we fi nally had our fi rst draw.

Traditional rivals Kew and Ivanhoe were locked

in a dogfi ght all-day, until a fl ying shot at goal in

the dying seconds by the Bears missed and thus

evened the scores. It spelt heartbreak for Ivanhoe,

as they were the better side for most of the day

and victory would have kept their faint fi nals

hopes alive. For Kew, it was a “get out of jail free

card”, as their patchy late season form was nearly

their undoing once again. The overnight deluge

reduced most of Ivanhoe Park into a bog heap

and made goals hard to come by, with a total

of 16 kicked for the day. With goals a premium,

Lovell for Ivanhoe bagged four and earned best

afi eld honours, but unfortunately it was to no

avail. The Hoes had the running early, they were

lower and harder at the ball than the Bears and

held a valuable nine point lead at half-time. The

third however belonged to the Bears, as they

welcomed back CHF Tim Allman and he delivered,

bagging two majors for the quarter. The game

opened up in the last as the ball zipped from end

to end, but both sides lacked polish in front of

goal. Ivanhoe came seconds away from recording

a meritorious victory but had to settle on sharing

the points. Finals now seem a bridge too far, but

the year has by no means been a waste. They will

head to South Melbourne this week as favourites

and should record their eight win of the year.

For Kew, they host Glen Eira, in what should be

viewed as a chance to regain some much needed

consistency of performance.

After a heartbreaking loss to Old Eltham a week

prior, the Raiders went to Elsternwick Park keen

to rebound, and they did so in fi ne style. With

percentage all important this time of year, their 75

point win over the Wicks has all but sealed a fi nals

berth. They sit in fourth place, two games clear of

St Johns, and a victory over the JOCs this week will

set it in stone. The win is even more impressive

given the overnight conditions, and this week

Dave Boundy took a back seat up forward as

Kandilakis bagged fi ve. For Elsternwick, the loss

sees them a mere 5% clear of relegation and will

need a win in the last three weeks to avoid the

bottom two. Old Paradians face a stern test this

week as they host a St Johns side still clinging to

a slim fi nals hope. For Elsternwick, their fate is in

their own hands as they take on Monash in a do-

or-die encounter.

Old Eltham threw the theories about heavy

grounds reducing teams’ ability to score out the

window as they handed South Melbourne a 134

point hiding. It was a precession from the get-go,

as the Turtles did as they pleased in an eight goal

to two opening quarter. By half-time the match

was over, the Districts were 11 goals in arrears.

The Turtles had an astonishing 14 goal-kickers,

Zanter the hero with eight. After a slump in form

mid-year, Old Eltham has well and truly bounced

back, and is now a genuine premiership threat.

South Melbourne will be extremely disappointed

with their eff ort, but were just simply a class

below their top-four opponent. The Turtles face

their sternest test of the year, as they head to

Ferndale Park to face the form side of Division 2.

A win sees them take St Mary’s Salesian’s second

spot. South Melbourne is clear of relegation but

will want to bounce back this week against an in-

form Ivanhoe.

Monash Gryphons kept their hopes of narrowly

avoiding relegation for the second straight year

alive with a gutsy win over a luckless Glen Eira.

The Gryphons scraped home by 13 points and

now are a mere 5% off this week’s opponent

Elsternwick in what is a must win for both sides.

For Glen Eira, their eff ort in the past few weeks


Monash Gryphons v Elsternwick

St Mary’s Salesian v Old Eltham

Old Paradians v St Johns

South Melbourne v Ivanhoe

Kew v Glen Eira

Brenton Mann @BrentyMann

BEARS IN HIBERNATION


unfortunately for the JOCs, turnovers proved

very costly. Countless times throughout the

day, St Johns gave the ball back to St Mary’s via

basic skill errors...and in the end that proved the

diff erence. They were valiantly led by key-forward

Adam Jones in a fi ve goal last quarter, that saw

them hit the front briefl y, but they couldn’t hold

on. St Marys’ class and superior structures saw

them arrest back the lead and march on to a hard

fought 24 point win. The JOCs still hold hopes of

a fi nals berth and face an uphill battle against

Old Paradians. St Mary’s take on a rampaging

Old Eltham, who will be keen to enhance its

premiership credentials.


cannot be questioned but they simply lacked the

class when needed, and are still anchored to the

bottom of the ladder. Inaccuracy in front of goal in

the last quarter is to blame for their loss this week,

as they just couldn’t land that killer blow. Monash

had the better of the fi rst half and did enough in

the second to secure victory.

St Johns went into their clash with St Mary’s

Salesian knowing that nothing short of a win

would suffi ce if they were to keep their fi nals

dream alive. Their eff ort and intensity from the

opening bounce refl ected just that. St Mary’s

were made to earn every bit of their 24 point

win, in what was a perfect lead-up with fi nals on

the horizon. The intensity and pressure around

the ball from both sides was fi rst class, but

Old Paradians 0.0, 0.0, 0.0, 18.6 (114)Elsternwick 0.0, 0.0, 0.0, 5.9 (39)GOALS, Old Paradians: J. Kandilakis 5, S. Rehlicki 3, M. Simpson 2, M. Bellizia 2, D. Mahony 1, D. Boundy 1, J. Lidyard 1, R. Licciardi 1, A. Asdagi 1, B. Holden 1Elsternwick: A. Symon 1, S. Grace 1, D. Renton 1, A. Thornton 1, J. Biviano 1BEST, Old Paradians: J. Kandilakis, R. Bugeja, J. Lidyard, M. Bellizia, D. Huntley, M. BoundyElsternwick: S. Grace, D. Convery, I. Clark, N. Tadros, J. Biviano, L. Yeatman

Old Eltham Collegians 8.4, 14.6, 21.11, 26.14 (170)South Melbourne Districts 2.1, 4.3, 4.5, 5.6 (36)GOALS, Old Eltham Collegians: Z. Tranter 8, M. Crooks 3, A. Hargrave 2, B. Switkowski 2, B. O’Malley 2, C. Crooks 1, R. Foo 1, J. Laver 1, M. Hargrave 1, A. Lendaro 1, C. Mizzi 1, T. Wenborn 1, B. Strongman 1, N. Harper 1South Melbourne Districts: S. Mahoney 2, B. Natoli 1, A. Ray 1, K. Tutty 1BEST, Old Eltham Collegians: Z. Tranter, R. Foo, J. Hall, J. Laver, A. Lendaro, M. CrooksSouth Melbourne Districts: D. Blake, J. Cliff ord, K. Tutty, A. Bermingham, T. McNamara, A. Balestra

Monash Gryphons 5.3, 9.5, 10.7, 13.7 (85)Glen Eira 3.3, 5.7, 7.11, 10.12 (72)GOALS, Monash Gryphons: R. Fletcher 3, A. Carey 3, A. Erwin-Ross 2, T. Casha 2, M. Kearsley 1, L. Pound 1, A. Robilliard 1Glen Eira: K. Cevik 4, K. Harwood 1, C. Maddox 1, C. Higgins 1, S. Hollow 1, A. Bradley 1, B. Pascal 1BEST, Monash Gryphons: M. Ryan, R. Pollock-Williams, J. Nuguid, R. Fletcher, A. Carey, D. BaxterGlen Eira: M. Fletcher, C. Maddox, N. Dennis, L. Barda, K. Harwood, A. Spink

Ivanhoe 1.4, 4.6, 5.8, 8.10 (58)Kew 1.2, 3.3, 6.6, 8.10 (58)GOALS, Ivanhoe: M. Lovell 4, Z. Mowat 2, E. Robinson 2Kew: T. Allman 2, A. Brazzale 2, J. Fidanza 2, J. Fultheim 1, C. Quinlivan 1BEST, Ivanhoe: J. Harty, T. Williamson, A. Diorietes, Z. Mowat, J. Chazan, M. SkellyKew: T. Allman, D. Spencer, K. Margaritis, S. Bishop, P. Donaldson, B. Goodwin

St Mary’s Salesian 4.1, 5.5, 10.8, 14.10 (94)St Johns 1.1, 4.3, 6.3, 11.4 (70)GOALS, St Mary’s Salesian: L. Holmes 3, J. Strangward 3, J. Rogers 2, B. Andrews 2, T. Whittle 1, A. Dwyer 1, B. Mc Lean 1, T. Dudgeon 1St Johns: A. Jones 3, K. Arnold 2, A. Abela 2, B. Ayache 1, A. Brannan 1, A. Stevanovic 1, G. Costas 1BEST, St Mary’s Salesian: N. Baum, A. Dwyer, S. Jones, L. Kelly, J. Op’t Hoog, J. KenyonSt Johns: N. Chalk, A. Jones, D. Cattolico, B. Ayache, C. Christiansen, M. Sofoulis

Old Paradians 4.4, 8.6, 15.9, 19.11 (125)Elsternwick 1.3, 1.3, 3.3, 5.6 (36)GOALS, Old Paradians: J. Monro 5, J. Cusumano 3, K. Barry 2, B. Dines 2, A. Gafa 1, M. Christie 1, M. Elliott 1, A. Tak 1, K. Mascitti 1, A. Iacona 1, A. Serafi n 1Elsternwick: M. Cunningham 2, M. Spence 1, J. Martin 1, H. Talarico 1BEST, Old Paradians: A. Jolley, J. Cusumano, M. Christie, A. Iacona, K. Barry, A. GafaElsternwick: K. Kenny-Jones, A. Neill, M. Rosewarne, S. Buckley, H. Talarico, D. Cattigan

Old Eltham Collegians 8.3, 12.7, 17.10, 24.14 (158)South Melbourne Districts 2.2, 2.3, 5.3, 5.4 (34)GOALS, Old Eltham Collegians: A. Coath 8, P. Vidinopoulos 4, J. Bird 3, Z. Cole 3, T. Edgell 2, P. Zumbo 1, J. Howell 1, M. Makin 1, J. Bevilacqua 1South Melbourne Districts: D. Phillips 2, K. Phongthai 1, J. Duim 1, D. Mcbrearty 1BEST, Old Eltham Collegians: A. Coath, P. Zumbo, J. Bird, P. Vidinopoulos, Z. Cole, J. LoveSouth Melbourne Districts: D. Mcbrearty, L. Beanland, M. East, D. O’Dea, K. Phongthai

Monash Gryphons 2.7, 6.7, 7.10, 8.12 (60)Glen Eira 1.2, 1.5, 1.7, 3.10 (28)GOALS, Monash Gryphons: J. Zhivov 1, B. Prigg 1, J. Hickey 1, L. Kerr 1, L. Taylor 1, J. Ogden 1, L. Lewis 1, D. O’Connor 1Glen Eira: I. Delac 1, N. Rudich 1, C. Massis 1BEST, Monash Gryphons: A. Petsinis, J. Rose, T. Mosley, K. Johnsen, W. Dowd, C. BrumleyGlen Eira: J. Drummond, R. McGirr, J. Haddan, A. Heyward, R. Amro, C. Massis

Kew 3.1, 8.1, 8.2, 13.5 (83)Ivanhoe 1.2, 3.5, 5.7, 8.9 (57)GOALS, Kew: J. O’Keefe 4, B. Van Leeuwen 4, C. Watts 2, A. Hawking 2, M. Vlahos 1Ivanhoe: BEST, Kew: D. Boehm, A. Hawking, A. Michael, J. O’Keefe, B. Van Leeuwen, Z. BrabinIvanhoe:

St Mary’s Salesian 6.9, 12.15, 21.18, 33.24 (222)St Johns 0.2, 0.2, 0.2, 0.3 (3)GOALS, St Mary’s Salesian: S. Gatehouse 6, D. Gook 6, S. Gusts 5, N. Alexopoulos 5, K. Buchanan 2, J. Dickinson 2, H. Angley 2, C. McMahon 2, D. Rajkumar 1, M. Kruze 1, C. Rose 1St Johns: BEST, St Mary’s Salesian: K. Buchanan, J. Dickinson, S. Gatehouse, H. Angley, C. Rose, K. DuerdenSt Johns: G. Chuol, M. De Poilly, A. Hall, B. Moldrich, C. West, J. Ayama



There is only three rounds left and every team in Division 3 still has something left to play for. The battle for fi rst place on the ladder and an undisputed double chance fi red up last weekend when the Northern Blues defeated Emmaus St Leos, placing both sides on equal points with eleven wins. Aquinas and Swinburne are fi ghting for home ground advantage in their own mini-tiff on ten wins each. The well-documented middle of the ladder is as tight as ever, with four teams still vying for the fi nal two places in the fi nals. At the other end of the spectrum teams battle for a combination of hope, avoiding relegation and respect as the regular season draws to its inevitable close.

REVIEWIn a match-up that could be re-lived in the fi rst week of fi nals, Aquinas kept Swinburne University scoreless in the fi rst half to take a 33-point victory and third position on the ladder at Aquinas College. Poor conditions at the Blood’s home ground created a low scoring clash – only nine goals for the contest - as the turf struggles to cope with rigors of continuous football and rain. Michael Niezen was at his brilliant best yet again for Aquinas while Joldy Bradley was dominant in the air for Swinburne who now slide down into fourth position.

The Northern Blues offi cially proved their mettle by recovering from a 20-point half time defi cit to defeat the fi rst-placed Emmaus St Leos by 25-points at Bennettswood Sports Ground. The loss ends an eleven game winning streak spanning back to May 3rd for Emmaus. The Animals and the Blues are now on equal points in fi rst and second on the ladder respectively. Division 3 leading goal-kicker Chris Beluszar kicked seven in the clash while James King, Damon Marcon and Jay Phelan combined for 13 for Northern.

A nine goal to two second half from UHS-VU propelled them to a 51-point win over the Eley Park Sharks and kept them in touch with the top

six. The fi rst half was a scrappy aff air, with both sides managing just three goals apiece. Eley Park’s Grant Deacon looked most likely to break the stalemate with dominant play up forward, however it was the Vulture’s Rhys Kirk (fi ve goals) who put the score on the board at the other end. The Sharks now face a tough fi ght to jump ahead of La Trobe in the fi nal three rounds and remain in Division 3 in 2015.

In the fi ght between the yellow and black sashes, Richmond Central made use of a relentless fi rst half to easily account for South Mornington to the tune of 159-points at Citation Oval. Despite their comfortable defeat, the Tiger’s did show courage by kicking three goals to match the three from the Snakes in the fi nal term. Sam Demeo and Woody Bucci joined forces to kick 10 majors for the Snakes while Nathan Coy found himself in the best players for the eighth time this season for South Mornington. Richmond is now ahead of Albert Park in fi fth position following the win.

In the upset of the round, seven goals from La Trobe’s Jack McMeel were enough to give them a shock 26-point win over Albert Park at La Trobe University. The result ends a seven-game winning streak for the Falcons who struggled up forward without focal point Stuart Maunder in the clash. The win gives La Trobe a one game buff er over Eley Park in the relegation zone while the Falcons are now on equal points with three other sides all battling for the fi nal two places in the fi nals.

The fi nal match of Round 15 was crucial for both sides, as Power House moved a game clear of St Francis Xavier in a spirited 59-point win at Ross Gregory Oval. Power House burst from the blocks, fi red up in the contest, kicking ten goals to one in the fi rst half to put the result beyond doubt by the major break. Ant Voyage’s men spread their goal-kickers evenly with nine contributors for the day to help their cause. St Francis will now need to win all of their last three

STILL NO CAKEWALK


Northern Blues v South Mornington

St Francis Xavier v Swinburne University

Power House v Eley Park Sharks

Albert Park v Aquinas

Richmond Central v UHS-VU

La Trobe University v Emmaus St Leos

www.vafatv.com

DIVI

SION

3Kris Neil @KrisANeil


matches if they hope to play fi nals in 2014.

The Sharks conceded six goals in the second term that allowed Albert Park to take a 35-point lead at half time. Stuart Maunder continued his brilliant form in front of goal with fi ve majors, while James Brick was superb for the Falcons. For the home side, Noel Bahnsen enjoyed a return to form with four majors alongside David Viola and Kenneth Darby who toiled hard all afternoon. The Sharks are tied on La Trobe for points; however they remain inside the relegation zone with a lower percentage.

PREVIEWRichmond Central v UHS-VU: If the Snakes can register their third win in a row it will complete a month of good football and cast fear into the other Division 3 fi nalists. La Trobe University v Emmaus St Leos: The Animal’s fi rst loss in almost three

months should be enough to prompt a return to

their best football and La Trobe have proved they

are no easy-beats. Albert Park v Aquinas: Flip a

coin in this one. Albert Park need the win more to

retain their sixth position on the ladder.

Power House v Eley Park Sharks: Eley Park have

been competitive all year but struggle to put

a winning score on the board, Power House

by three goals. St Francis Xavier v Swinburne

University: A loss for the X-men will all but secure

an early football trip. They’ll need to be at their

best to defeat the Razorbacks. Northern Blues v

South Mornington: A percentage-boosting win

for the Blues can edge them closer to Emmaus

in percentage and a guaranteed double chance.

Aquinas 3.2, 4.6, 4.8, 7.9 (51)Swinburne University 0.0, 0.0, 1.4, 2.6 (18)GOALS, Aquinas: T. Niezen 2, M. Jess 1, M. Cull 1, M. Kershaw 1, J. Perrett 1, M. Prouse 1Swinburne University: R. Lugg 1, C. Wight 1BEST, Aquinas: L. Barnes, M. Niezen, P. Jurkovsky, R. Foster, L. McDonald, M. JessSwinburne University: J. Bradley, M. Lingham, M. Manning, D. Webb, Z. Scrase, N. Mauran

Northern Blues 7.3, 8.8, 13.11, 18.14 (122)Emmaus St Leos 4.5, 11.10, 12.11, 14.13 (97)GOALS, Northern Blues: J. King 5, D. Marcon 4, J. Phelan 4, M. Cigagna 2, N. De Andrade 1, J. Warwick 1, M. Holmes 1Emmaus St Leos: C. Beluszar 7, P. Baranello 2, M. Gartland 2, B. Ellis 1, E. Mitchell 1, A. Smith 1BEST, Northern Blues: J. Phelan, M. Holmes, J. King, N. Parkes, R. Jepson, D. MarconEmmaus St Leos: D. Hill, C. Beluszar, P. Baranello, M. Lalor, M. Davis, T. Thorn

La Trobe University 4.3, 5.5, 6.5, 11.6 (72)Albert Park 0.0, 3.1, 5.3, 7.4 (46)GOALS, La Trobe University: J. McMeel 7, D. Weiss 1, B. Dowler 1, S. Field 1, J. Hickey 1Albert Park: N. Sjostrom 2, B. Gellie 1, J. Harrison 1, A. Snowden 1, A. Mackay 1, M. Lanigan 1BEST, La Trobe University: G. Dowler, J. McMeel, A. Rae, S. Field, A. Long, G. LinghamAlbert Park: K. Murray, M. Lanigan, J. Brick, T. Smoker, J. Harrison, N. Cattle

Power House 6.2, 10.2, 15.6, 17.7 (109)St Francis Xavier 0.2, 1.4, 3.6, 7.8 (50)GOALS, Power House: G. Tubridy 3, S. Confait 3, N. Moresi 3, T. Collett 2, L. Johnston 2, D. Burnside 1, B. Kyne 1, A. Collett 1, R. Gregory 1St Francis Xavier: J. Day 2, B. O’Hara 2, D. Scott 1, A. Burns 1, J. Roberts 1BEST, Power House: S. O’Leary, N. Moresi, A. Collett, S. Confait, A. Reynolds, D. BakerSt Francis Xavier: B. O’Hara, J. Lenders, C. Hughes, J. Lafranchi, J. Day, L. Andrews

Richmond Central 12.5, 18.11, 25.15, 28.22 (190)South Mornington 0.0, 1.0, 2.0, 5.1 (31)GOALS, Richmond Central: S. Demeo 6, W. Bucci 4, J. Sharp 3, L. Carland 3, K. Schoenmaekers 3, B. McGoldrick 2, R. Costanzo 2, B. Herbert 1, D. Holland 1, T. Baker 1, S. Bugeja 1South Mornington: B. Hallas 1, J. Bishop 1, D. Droscher 1, S. Pope 1, N. Coy 1BEST, Richmond Central: S. Ward, S. Demeo, J. Sharp, J. Nicholson, N. Anstey, D. HollandSouth Mornington: I. Davies, N. Coy, W. Spencer, L. Kelly, B. Rolls, D. Droscher

UHS-VU 1.2, 4.4, 9.13, 13.13 (91)Eley Park Sharks 2.2, 3.4, 4.5, 5.10 (40)GOALS, UHS-VU: R. Kirk 5, R. Smith 2, D. Benstead 1, R. Matthews 1, K. Barnes 1, E. Ramsay 1, T. O’Halloran 1, E. Clarke 1Eley Park Sharks: A. Olson 2, D. Crawford 1, T. Hudson 1, N. Bahnsen 1BEST, UHS-VU: R. Smith, K. Benstead, A. Kirk, S. McSweeney, J. Healey, J. AhmedEley Park Sharks: G. Deacon, C. Olson, D. Viola, T. Hudson, K. Darby, A. Olson

Aquinas 1.2, 4.7, 5.11, 7.12 (54)Swinburne University 2.2, 2.3, 3.3, 4.3 (27)GOALS, Aquinas: N. Spencer 2, B. O’Loughlin 1, J. Hamilton 1, L. Fringuelli 1, D. Lord 1, K. Rosewarne 1Swinburne University: J. Perillo 3, O. Taylor 1BEST, Aquinas: B. O’Loughlin, J. Bott, C. West, P. Fringuelli, K. Rooney, S. PorterSwinburne University: J. Carson, D. Hadzic, J. Perillo, K. Finn, R. Moloney, A. Hyman

Emmaus St Leos 3.3, 8.5, 11.8, 15.11 (101)Northern Blues 1.1, 1.6, 2.8, 3.10 (28)GOALS, Emmaus St Leos: N. Hodder 6, P. McGloin 2, J. Webb 2, A. LaRiccia 2, T. Canny 2, P. Jones 1Northern Blues: B. Passey 1, P. David 1, J. Mastin 1BEST, Emmaus St Leos: J. Page, T. Canny, N. Hodder, P. McGloin, C. Hadjiantonakis, J. WebbNorthern Blues: C. Paterson, M. Thompson, J. Thompson, B. Passey, L. Spiller, B. Bliss

La Trobe University 2.5, 5.6, 9.8, 12.10 (82)Albert Park 2.0, 2.4, 2.6, 3.8 (26)GOALS, La Trobe University: S. Marchitto 4, M. Harney 2, D. Rodger 1, T. Quirk 1, D. Francis 1, F. Canobie 1, C. Ruwoldt 1, S. Woollard 1Albert Park: L. Main 2, R. Sloan 1BEST, La Trobe University: M. Steiner, C. Taylor, S. Marchitto, E. Buff on, M. Harney, B. TonkinAlbert Park: B. Murnane, J. Smith, A. Waycott, G. Mihelakos, L. Main, T. Wright

Power House 2.8, 6.10, 9.12, 16.19 (115)St Francis Xavier 2.0, 4.0, 5.0, 6.0 (36)GOALS, Power House: P. Arnold 4, P. Mackney 2, C. Reid 2, C. Devaney 2, H. Miller 1, B. Griffi n 1, S. Circosta 1, E. Edwards 1, C. Young 1, G. Murphy 1St Francis Xavier: J. Williams 2, S. Greely 2, D. Johnstone 1, D. Butcher 1BEST, Power House: J. O’Doherty, C. Devaney, D. Buckley, P. Mackney, M. Devine, P. O’GradySt Francis Xavier: D. Johnstone, B. Sheehan, D. Butcher, L. Hall, J. Williams, S. Darlison

Richmond Central 4.3, 5.4, 9.6, 12.9 (81)South Mornington 1.0, 6.2, 8.4, 10.5 (65)GOALS, Richmond Central: South Mornington: BEST, Richmond Central: South Mornington: J. Clarke, J. Millar, C. Joshua, D. Clarke, T. Wilson, N. Douglas

UHS-VU 4.1, 8.3, 11.9, 15.12 (102)Eley Park Sharks 1.2, 2.5, 3.7, 5.9 (39)GOALS, UHS-VU: M. Sweeney 7, R. Dickson 4, A. Bossie 1, W. Smith 1, J. Bullen 1, A. Thomasse 1Eley Park Sharks: T. Houlden 4, L. Booth 1BEST, UHS-VU: A. Bossie, A. Thomasse, S. Cracknell, C. Marchio, O. Malyon, M. SweeneyEley Park Sharks: T. Houlden, T. Scholtes, S. Pertz, A. Chandramouli, A. Stevenson, L. Paolini


Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected],au


Whilst the rest of the Commonwealth mulls

over the inspirational gold medal performance

of the Hockeyroos and Genevieve LaCaze’s

‘stage-bomb’ in Glasgow, the water-cooler talk

for Division 4 fans this week will no doubt have

centred around Manningham’s triumph over

their namesakes. Sustained eff ort and hard

work from North Brunswick in recent weeks

fi nally paid off as they enjoyed a rare 2014

win. Meanwhile at Rathmines, the Hawks left

Westbourne Grammarian’s season hanging by

a thread as they comfortably accounted for the

rebirthed club. These results opened up a gorge

between the top four sides and the followers,

whilst providing an exciting taste of things to

come when the fi nals roll around.

After several cases of ‘close but no cigar’, the Bulls

blitzed Box Hill North to register a well-deserved

third win for the season. Despite having to call

upon several reserves players, the home side put

in a dominant four-quarter display. The Bulls were

spearheaded by Robbie ‘Stalker’ Santacroce who

was involved in everything and fi nished with fi ve

majors. Across the ground Campbell Hynam-

Smith and Scott Rymer were productive as North

Brunswick increased their lead at every change.

Michael Tilley and Sean Donovan were gallant in

defeat, whilst Toby Manning collected four goals

for Box Hill North. The result has spirits high in

the North of Brunswick and all but ends Box Hill

North’s slim hopes of playing fi nals football.

The battle of the Cobras was a venomous

encounter that has virtually sewn up the top four

and the order in which they’ll fi nish. An explosive

fi rst half from Canterbury was countered by

one of the best quarters of the season from

any Division 4 side. Manningham produced an

incredible eight goals to one performance in the

third to steal the lead. Despite the win, inaccurate

kicking nearly cost Manningham in the last

quarter – something they will be looking to

address in the lead up to September. Thomas Bell

continued his stellar season for Manningham.

Solid form from him and Stuart Fisher was the

platform from which Michael Muller was able to

collect fi ve goals. Brett Johnson, Tom Eckersley

and Rohan Walmsley were the most eff ective for

Canterbury, all of them multiple goal kickers. The

result of this match lengthens the abyss between

the top four and the rest. Barring an absolute

meltdown, it would be fair to assume that the

current standings in the top four will sustain until

the fi nals begin.

The Dragons put the sword to the Synners at

Keeley Park. Despite off ering stiff competition for

the fi rst half, Chadstone were unable to match

the relentless intensity of their opponents.

The Dragons will be pleased with a dominant

performance that saw them share the workload.

Four targets up front collected three or more

goals – Pasquale Torcasio the best of them

with four. The Dragons will hope to ride the

momentum from this result as they hunt for

another 2014 win. Chadstone however, will have

their work cut out for them when they meet the

in-form North Brunswick later this afternoon.

The Hawks kept their immaculate season in

tact with an unremitting seventy-eight point

drubbing of Westbourne Grammarians. The

usual suspects Sam Gold, Jason Ince and Sean

Stormonth were uncontainable inside the

forward fi fty. They were well assisted with regular

quality service from Paul Nunan and Davids

Pritchard and Kennedy through the middle. Chris

Sneddon and Adam Imber were admirable in

defeat, however the diff erence in class between

MANNINGHAM SHUT TOP FOUR DOOR


Canterbury v Hawthorn

Box Hill North v West Brunswick

Chadstone v North Brunswick

Manningham Cobras v Point Cook

Westbourne Gr. v Dragons

www.vafa.com.au

DIVI

SION

4Ryan ‘Hammy’ Goodman @HandsomeHammyG


the two sides was apparent throughout the

afternoon. Grammarians will now need to win

all of their remaining games well, and hope that

Manningham hit the self-destruct button to

stand a chance of squeezing in to the four.

The Bulldogs produced a gallant eff ort at the

pristine Saltwater Reserve as they went down

to West Brunswick. The Pies set the game up for

themselves with a dominant second term. The

second half was a matter of going through the

motions, and given the state of aff airs towards

the top of the ladder, West Brunswick seemed

happy to oblige. Evan Lloyd was outstanding in

his ninety-ninth game for the Magpies, whilst

Anthony Gibson and Adam Ross enjoyed the

extra space on the wings. Dylan Walker was a

tower of strength with a fi ve-goal haul. Robbie

Milne and, as always, Mason Kip were the pick of

the litter for the Dogs who now fi nd themselves

out of fi nals contention.

Canterbury will be looking to bounce back

quickly after their narrow loss, but they face

the ultimate test when they host Hawthorn

this afternoon. West Brunswick will be looking

to stamp some authority on the competition

against a side who are now only playing for pride.

North Brunswick have a golden opportunity to

earn back to back wins. Manningham will be hard

to stop off the back of last week’s brilliant result

and Westbourne Grammarians will be desperate

to stay in the race. Whilst things appear settled

up the top towards the pointy end, as we all

know, things can change very quickly in footy…


Dragons 5.5, 9.10, 10.15, 15.20 (110)Chadstone 4.1, 6.4, 7.5, 7.6 (48)GOALS, Dragons: P. Torcasio 4, H. Vuong 3, T. Lowden 3, S. Suon 3, P. Rueda 1, M. Babar 1BEST, Dragons: H. Vuong, P. Torcasio, J. Tait, P. Rueda, V. Nguyen, C. Kuang

Manningham Cobras 3.3, 8.7, 16.11, 17.15 (117)Canterbury 7.1, 12.4, 13.5, 17.7 (109)GOALS, Manningham Cobras: M. Muller 5, S. Newton 3, B. Hawker 2, B. Helme 1, T. Bell 1, M. Davies 1, A. Pianto 1, C. Jolly 1, S. Fisher 1, D. Wolfgramm 1Canterbury: B. Johnson 4, R. Walmsley 3, T. Eckersley 3, A. Baker 2, J. Price 1, C. Woods 1, B. Peel 1, C. Skate 1, L. Giles 1BEST, Manningham Cobras: T. Bell, M. Muller, S. Fisher, S. Leonard, P. Wood, S. NewtonCanterbury: B. Johnson, M. Higgins, T. Eckersley, B. Peel, R. Walmsley, R. Gates

Hawthorn 5.2, 11.5, 13.10, 21.15 (141)Westbourne Grammarians 3.4, 4.5, 6.8, 7.11 (53)GOALS, Hawthorn: S. Gold 5, J. Ince 4, G. Edmond 3, S. Stormonth 3, N. Raiti 2, M. McNeill 2, D. Pritchard 1, J. Ridley 1 Westbourne Grammarians: N. Schiano 2, A. Imber 1, C. Sneddon 1, S. Wallace 1, M. Culliver 1, N. Arias 1BEST, Hawthorn: P. Nunan, D. Pritchard, D. Kennedy, D. Monohan, K. Davies, N. RaitiWestbourne Grammarians: C. Sneddon, A. Imber, J. Humphreys, T. Rogers, E. Karageorge, J. Johns

West Brunswick 5.2, 10.5, 12.7, 13.10 (88)Point Cook 4.3, 5.6, 6.12, 9.13 (67)GOALS, West Brunswick: D. Muscat 5, N. Mitchell 2, A. Gibson 1, A. Commins 1, M. Holmes 1, P. Carroll 1, Z. Tisdale 1, J. Turner 1Point Cook: H. Wilkinson 2, P. Hegarty 2, R. Milne 1, C. Cox 1, M. Herbertson 1, J. Mandahl 1, A. Robinson 1BEST, West Brunswick: E. Lloyd, C. Bull, A. Gibson, Z. Tisdale, M. Thompson, A. RossPoint Cook: R. Milne, M. Kip, B. Langley, P. Hegarty, S. Percival, J. Mandahl

North Brunswick 5.4, 7.7, 10.12, 16.16 (112)Box Hill North 4.2, 4.8, 5.10, 8.14 (62)GOALS, North Brunswick: R. Santacroce 5, C. Hynam-Smith 2, K. Zuidema 2, T. Blount 2, D. Manoukian 2, G. McMonigle 1, S. Rymer 1, R. Dowsett 1 Box Hill North: T. Manning 4, R. Ball 2, B. Pearce 1, J. Howarth 1BEST, North Brunswick: R. Santacroce, C. Hynam-Smith, S. Rymer, S. Mair, C. Temperley, T. Blount Box Hill North: S. Donovan, M. Tilley, K. Robinson, C. Lee, E. Charles, B. Watt

Chadstone 2.3, 6.4, 7.7, 8.8 (56)Dragons 3.0, 4.4, 5.9, 5.12 (42)

Manningham Cobras 3.5, 6.8, 10.11, 11.17 (83)Canterbury 2.1, 7.2, 9.2, 11.3 (69)GOALS, Manningham Cobras: D. Wills 3, A. Egan 2, B. Mc Hugh 2, P. Vaughan 1, A. McDill 1, A. Bullen 1, J. Jewson 1Canterbury: Z. Zainal 5, D. Porta 2, C. Mason 1, J. Doak 1, D. Perera 1, M. Small 1BEST, Manningham Cobras: R. Mundy, B. Mc Hugh, J. Sotto, K. Ng, A. Bullen, T. TwynhamCanterbury: Z. Zainal, J. Doak, A. Stals, D. Perera, D. Porta, M. Small

Hawthorn 5.4, 12.7, 19.9, 24.13 (157)Westbourne Grammarians 0.2, 0.4, 2.5, 2.5 (17)GOALS, Hawthorn: J. Jackomos 9, R. White 5, T. Bowler 2, J. Ward 2, D. Lauletta 2, C. Bilton-Gough 1, M. Jones 1, X. Hallam 1, M. Laing 1Westbourne Grammarians: S. King 1, M. Chodowski 1BEST, Hawthorn: L. Chapman, J. Jackomos, T. Bowler, C. Bilton-Gough, R. White, X. HallamWestbourne Grammarians: K. Miller, J. Richardson, R. Binney, H. Wyatt, J. Crumpton, R. Fuentes

West Brunswick 4.5, 7.10, 14.16, 24.18 (162)Point Cook 0.1, 1.6, 1.6, 2.6 (18)

Box Hill North 6.5, 9.6, 12.12, 19.14 (128)North Brunswick 1.2, 4.2, 5.3, 6.7 (43)GOALS, Box Hill North: D. Piccioli 5, G. Cavallo 3, G. Williams 2, A. Obialor 2, J. Cope 2, A. Nyhuis 1, S. Stephens 1, J. Phillips 1, J. Irish 1, U. Khan 1North Brunswick: S. Wernham 2, B. Cornish 1, S. Barrett 1, D. Ilardi 1, T. Geary 1BEST, Box Hill North: D. Piccioli, A. Nyhuis, U. Khan, A. Obialor, K. Axten, S. StephensNorth Brunswick: B. Dancer, B. Cornish, J. Hayes, T. Geary, L. Selkrig, L. Spano



NEXT WEEKS GAMESPREMIER

Collegians Beaumaris 14:00

De La Salle Old Brighton 14:00

Old Scotch St Bernards 14:00

Old Trinity University Blacks 14:00

Old Xaverians St Bedes/Mentone Tigers 14:00

PREMIER B

Old Carey Old Haileybury 14:00

Old Ivanhoe Caulfi eld Grammarians 14:00

University Blues AJAX 14:00

Mazenod St Kevins 14:00

Fitzroy Old Melburnians 14:00

PREMIER C

Hampton Rovers Oakleigh 14:00

Marcellin Banyule 14:00

Monash Blues Ormond 14:00

Parkdale Vultures Peninsula 14:00

P E G S Old Camberwell 14:00

DIVISION 1

NOBS/St Pats Old Mentonians 14:00

Yarra Valley MHSOB 14:00

Therry Penola Whitefriars 14:00

Old Geelong Bulleen Templestowe 14:00

Williamstown CYMS Prahran Assumption 14:00

DIVISION 2

Elsternwick Ivanhoe 14:00

Old Eltham Collegians Glen Eira 14:00

Kew St Johns 14:00

Monash Gryphons Old Paradians 14:00

Sth Melbourne Districts St Mary's Salesian 14:00

DIVISION 3

Albert Park Richmond Central 14:00

Eley Park Sharks La Trobe University 14:00

Emmaus St Leos Power House 14:00

Northern Blues Aquinas 14:00

Swinburne University South Mornington 14:00

UHS-VU St Francis Xavier 14:00

DIVISION 4

West Brunswick Chadstone 14:00

Manningham Cobras Dragons 14:00

North Brunswick Point Cook 14:00

Box Hill North Hawthorn 14:00

Westbourne Gr. Canterbury 14:00

MEGT UNDER 19 PREMIER

Beaumaris De La Salle 14:00

Old Melburnians Old Scotch 14:00

St Bedes / Mentone Tigers St Bernards 14:00

St Kevins Old Xaverians 14:00

UNDER 19 SECTION 2

Mazenod Parkdale Vultures 14:00

Old Brighton Caulfi eld Grammarians 14:00

Old Trinity University Blacks 14:00

University Blues Collegians 14:00

Whitefriars Fitzroy 11:40

UNDER 19 SECTION 3

Marcellin Williamstown CYMS 14:00

Old Carey AJAX 14:00

Old Ivanhoe Old Xaverians 9:20

St Mary's Salesian Old Camberwell 14:00

UNDER 19 NORTH

St Bernards Yarra Valley 14:00

Ivanhoe P E G S 14:00

Wyndham Suns La Trobe University 14:00

Whitefriars Therry Penola 14:00

Northern Blues Banyule 9:20

UNDER 19 SOUTH

Oakleigh Peninsula 11:40

Ormond De La Salle 14:00

Old Haileybury Hampton Rovers 14:00

Collegians Monash Blues 11:40

Beaumaris MHSOB 11:40

VAFA COLTS

Westbourne Gr. Williamstown CYMS 11:40

Mazenod UHS-VU / Flemington 9:20

St Bernards Point Cook AFC 11:40

University Blues Old Paradians 11:40

PREMIER THIRDS

University Blues Old Scotch 9:20

Collegians St Bernards 9:20

Old Xaverians University Blacks 11:40

Old Melburnians Bye

PREMIER B THIRDS

Beaumaris Old Carey 11:40

Old Trinity Mazenod 11:40

AJAX Old Xaverians 11:40

Caulfi eld Grammarians Fitzroy 11:40

Old Brighton St Kevins 11:40

PREMIER C THIRDS

Marcellin Ormond 11:40

St Kevins Hampton Rovers 11:40

St Mary's Salesian P E G S 11:40

Old Ivanhoe Parkdale Vultures 12:00

Monash Blues Bye

CLUB XVIII (1)

Sunday 17th Aug , Preliminary Final 2:00pm Sportscover Arena

CLUB XVIII (2)

Sunday 17th Aug, Preliminary Final 11:40am Sportscover Arena

CLUB XVIII (3)

Sunday 17th Aug, Preliminary Final 9:20am Sportscover Arena


PREMIERRADIO BROADCAST GAME LISTEN LIVE ON 96.5FM

1 Ben Jakobi2 Matthew Gadsden3 Tom Jakobi4 Josh Homann5 Andrew Edge (CC)6 Jimmy Davis7 Michael Dewar8 Jordan Pascoe9 Andrew Dewar10 Jon Edge11 Dylan Verney12 Ollie Cavallaro12 Michael Tragear13 Nick Coroneous14 Thomas Clarke15 Ben Gadsden16 Kieran Rawlinson17 Ben Jarick18 Brendan Blatt19 Tom Mentiplay21 Tim Fogarty 22 Niall Collins23 Michael Karayannis24 Jon Perrett (CC)25 Riley Cummin26 Ben Austen27 Lachie Nicholls28 Matthew Smith29 Josh Dickerson30 Tom Skewes30 Levi Otto31 Jack Davis32 Charlie King33 Nick Marston34 Tom Mariani35 Luke Forato36 Marshall Pascoe37 Harry Cannon38 Callum Nicholls39 Tom Gunning40 Zac Alcott41 Marcel Bruin

42 Leigh Hendra43 David Fallon44 Daniel Anthony45 Lachie Anthony46 Tim Cooney47 Brett Felsenthal48 Sebastian Zaia49 Matt Browning50 Andrew Ogilvie51 Dale Anderson52 Stuart Hooy54 Will Bardoel55 Michael Fort-Williams56 Jack White57 Alex Dick58 Nick Materia59 Luke Healy60 Pat Kelly61 David Naughton62 Zack Price63 Zack Wilson

Coach: Simon WilliamsAssistant: David PatersonReserves: Ross Stewart

OLD BRIGHTON

1 Sam Thompson (VC)2 Ashley Lim3 Matthew Peric4 Nick Jamieson5 James Sansom6 Jack Bull7 Jordan Clarke8 Lachie Hill9 Scott Sherwen (CC)10 Mark Passador (CC)11 Charlie Long12 James Bowden13 Richard Wilkinson14 Adam Houlihan15 Andrew Jelbart16 Shane Neaves17 Gene van den Broek18 Caillin O’Shannessy19 Tom Harkness20 Sam Neil21 Ned Walmsley22 Hugo Perry23 Max van den Broek24 Jack Davis25 Max Davis26 Will Strange27 Robbie Ferraro28 Justin Nikolovski29 Chris Watts30 Mitch Bradley31 James Long (VC)32 Richard Eva33 Henry Dick34 Sam Barnett35 Callum Goldby36 Nick Clay37 Sean Leith (RC)38 Lachie Cooper39 Charles Dixon40 Angus Harlock41 Hayden Calway42 Tom McKinley43 Stephen Hodges44 Jack Furey45 Jack Hurley46 Max Wills47 Matthew Seed48 Fraser Macfarlane49 Ed Lower50 Alex O’Shannessy

51 John Daggian (3rds C)52 Josh Raines53 Conor O’Beirne54 Ed Furey55 Nich Cox56 Tim Mead57 Rupert Wills58 Andrew Hummerston59 James Parsell60 Scott Wilcox61 Tom Holding62 Kieran McShane63 Chris Docker64 Tristan Bowman65 Fergus McKenzie66 James Carrington67 Matthew Jane68 Will Hewson69 Alex van Ryn70 Blood Jumper71 Nich Reddish72 Nick Lindsay73 Tom Hamilton74 Robert Hays75 Lachie McDonough76 Pat Oughtred77 Jacob Clark78 Nic Poliakow79 Will Carroll80 Evgeni Routman81 Tim Melville82 Will Ponsford83 Alex King84 Will Mackintosh85 Angus Tummel86 Scott Sansom87 James Halbert88 Call McDonough89 Matthew Parisi90 Sam Muttdon91 Ben Summerfi eld92 Pete Hodges93 Blood Jumper94 Maurice Clayton95 Blood Jumper96 Blood Jumper97 Cohan McDermott98 Angus Greenaway99 Ed Barlow

Coach: Dean Anderson & Stuart PowellAssistants: Steve Crisp, Christian Neeson, Matthew Bott, Kemble Edelsten & Ian LeithReserves: Christian NeesonAssistant: George Dick, Tim Green, Nick Allen & Will LewisThirds: Tristan Foenander

OLD SCOTCH


PREMIER

1 Matt Duggan2 Robert Cathcart3 Matt Petering4 Sean Coote5 Tom Abbott6 Lachlan Howes7 Tom Dean (C)8 Josh Ward9 Doug Pritchard10 Nick Loucaides11 Scott Braithwaite12 Scott Gower13 Will Murton14 Luke Casey-Leigh15 Raphael Clarke16 Sam McBain17 Anthony Carroll18 Will Edmonds19 Joel Di Natale20 Cal Buckley21 Mitchell Howes22 Steven Scott23 Jonno Nash24 Mitchell LaFontaine25 Travis Woolnough26 Michael DeFontenay27 Brayden Haynes 28 Mick Millar29 Jordan Thompson30 Will Mattingley31 Tom Gandy33 Matt Stevens34 Michael Globan35 Sean McNicholas36 Ben McLean36 Scott Kendall37 Elliott Harris38 Michael Wilson39 Luke McNicholas40 James Bull41 James Lapa41 Dylan Gabron-Uhe

42 Tim Pritchard43 Luke Edmondson44 Pete Richter45 Greg Roberts46 Luke Sketchley47 Tom Perkin48 Frasier Cloney49 Luke Slater50 Bane Suboticki51 Tyson Rayner52 David Brearley53 Sean Brennan54 Scott Moore55 Will Gillespie56 Oliver Webber57 Jack Richter58 Ryan Bennett59 Germaine Ivanka60 Mitch Bourne61 Lucas Bourne64 Alex Edmondson66 Robert Wilson67 Brad Kilgore68 Byron Hughes72 Mark Ensor

Coach: Stephen LawrenceAssistants: Mick Lovejoy, Sam HeckerReserves: Alex Bennett

BEAUMARIS

http://altitudevolvocars.com.au

1 Jake Walsh 1 Dayne Coulsen-Hoffacker 2 Kristian Butler 3 Harry Tinney 4 Ned Hunt 5 Dan Chamberlain 6 Heath Banfi eld 7 Brendan Iezzi (C)8 Ben Howell 9 Matthew Kilpin 10 Jack Osborn 11 Kris Spassopoulos (RVC)12 Luke Pacconi (VC)13 David Wildsmith 14 Gabe Hamilton 15 Cam McCasker 16 Emerson Satur 17 Jack Hunt 18 Ed Weatherson 19 Nick Howell (VC)20 Chris Riggs 21 Tim Howell 22 Brett Barratt 24 Brett Robertson 25 Will Oldfi eld 26 Andrew Kyriacopoulos 27 Sebastian Nicolosi 28 Christos Manoussakis 29 Nick Chamberlain 30 Alex Hasiotis 31 Callum Pohl 32 Anthony Scott 33 Mark Yeoman 34 Jack Gale 35 Tom Bennett 36 Sean Hanrahan 37 Michael Cooper 38 Jake Steinhart 39 Simon Murphy (RVC)40 Peter Mescher 41 Fergus Stewart 42 Scott Meighan (RC)43 Alex Heuston

44 Matt Coutts 45 Angus Milham 46 Henry Winter 47 Ed Beasley 48 James Spassopoulos 49 Dan Ahearne 50 Nathan Merzvinskas 51 Luther Juric 52 Ted Mitchell 53 Hugh Tyson 54 Andrew Coughlin 55 Joe Campbell 56 Alex Prittie 57 Steve Lawrence 58 Thomas Moore 59 Reggie Smith 60 Nathan Valkanis 61 Alex Syme 63 Stuart Cade 64 Andrew Kinross 65 Nick Pearce 66 Andrew Medland 67 Alex Polidoros 68 Will Bowman 70 Callum Rae 74 Richard Mason

Coach: Adam AndrewsAssistant: Gerard Sholly, Lucien Dean-JohnsReserves: Peter Lawrence

OLD TRINITY


PREMIER

1 Jake Williams2 Chris Santalucia3 Sam Lees4 Matt Jenkinson5 Caydn Beetham6 Benjamin Kennedy7 Michael Darvell (C)8 Andy Biddlecombe9 Chris Smith10 Damien Ryan11 Luke Barry12 Brendan Goss13 Cauley Beetham14 Josh Douglas 15 Matt Skidmore16 Louis Tiernan17 Chris Larkins 18 John Shaw19 Tim Dynon20 Marcus Allan21 Chris Waller22 Louis Denton23 Lachlan Smith24 Cam Purss25 Tom Williams26 Nick Wynne27 Robbie Ralph28 Tom Crapp29 Matt Handley30 Murphy Ambrose31 Matt Ball 32 Denis Symeopoulos33 Matt Margin34 Pat Allan35 Ed Lachal 36 David Sapuppo37 Daniel Harangozo38 Matt Douglas39 Michael Hannan

40 Jarryd Skene41 Esmond Prowse42 Jonno Close43 Pat Tiernan44 Matt Walsh45 Lachlan Keith46 Josh Anderson47 Daniel Prowse48 Declan Pittonet49 Jonathan Pintal 50 Ben Plant51 Charlie Woodley52 Tristan Parker53 Chris Margin54 Dan Barry55 Julian Darrer56 Michael Henderson57 Nathan Drummond58 Anthony Ongarello59 Andrew Mathis60 Matt Sitch61 Nick Ielasi62 James Mcelhinney63 Harry Healey64 James Forrest

Co-Coaches: Simon Lethlean & Pat HawkinsSenior Assistant: Ted Woodruff Assistants: Matt O’Hanlon, Tim Clarke, Tim Ockleshaw, Andrew Brushfi eld & Luke Gladman

OLD XAVERIANS

1 Tom Curry 2 Jacob Williams3 Matthew Moore4 Charlie Haley5 Michael Stizza6 Tyson Hunt7 Tom Humphrey8 Tom McMahon9 Harry Haley10 David Lowe11 Edward Clinch12 Matthew Fieldsend (C)13 Jacob Gotch (C)14 Joshua Slade15 Tim Allan16 Oscar Persson17 Sam Williams18 Ben Humphrey19 Ryan McDonough20 David Hutchinson21 Daniel Close22 Aaron Kneebone23 Sebastian Gotch24 Antony Forato25 Lachlan Bull26 Stephen Wall27 Adrian Indovino29 Nick Fyfi eld30 Joel Phillips31 Joshua Fisher32 Joshua Oakley33 Mitch Carney34 Aaron Wheatley35 Justin Baxter36 Ben Oakley37 Ed Murphy38 Liam Wood39 Daniel Millwood40 Joel Mattiske41 Hamish Ramsey42 Nick Hyland43 Luke Williams44 Tim Kovess45 Steven Hogan46 Luke Jarvis

47 Sefton McGraw48 Ed Espinosa49 Luke Gogis50 Jason Terrell51 Charlie Athanassiou52 Tom Moloney53 Matt Hamilton54 Simon Lowe (RC)55 Jackson McKay56 Garrett McDonough57 Michael De Luca58 Mitch Carter59 Jack Jarvis60 Jordan Bull61 Chris Cavanagh62 Declan Freeman63 Chris Hyde64 Shane Griffi n65 Sam O’Donnell66 Tyson Parker67 Beau Hill68 Kieran Grant69 Nick Hogan70 James Meade 71 Simon Byers72 Matthew Allan73 Joe Mannix74 Luis Godhino75 Matthew Hogan

Coach: Paul SatterleyAssistants: Michael Brown, Tom Madigan, Ash LeverReserves: John McDonoughThirds: Phil Proy

DE LA SALLE

SPONSORS


PREMIER

1 Alexander Croft 2 Billy Burstin 3 Charlie Holst 4 Nick Ries 5 Andrew Scott 6 Gareth Jones 7 Shura Taft 8 Julian Eimutis 9 Michael Dyer 10 James Jorgensen 11 Dylan Chaplin Burch 11r Luke Casey 12 Simon Hall 13 Josh Cashman 14 Sebastian Evans 15 Matthew Yates 16 Matthew Barton 17 Courtney Hylton (VC)18 Trent Zimbachs (C)19 Stuart Inglis 20 Tim Phillips 21 Hunter Pool 22 Nathan Giles 23 Wil Tardif (VC)24 Toby Goodman 25 James Kondarovskis 26 Jesse Band Conrick (RC)27 Matthew Singleton 28 Tom Penberthy 29 James Dunn 30 Josh Kamener 31 Lindsay Apted 32 Sam Hibbins 33 Lachlan Ferguson 34 Harry Croft 35 Anthony Carydias 36 Nick Corp 37 Andrew Howison 38 Justin Clark

39 Chris Jesaueluk 41 Dominic Russo 42 Jack Parsons 43 Ed Malone 44 Alistair Fahie 45 Andrew Stone 46 Julian Hampton 47 Alex Barr 48 Sam Doupe-Watt 50 Sam Adams 52 James Patterson 53 Billy Riddle (RC)54 Cameron Bonnar 55 Nicholas Brown 56 Calvin Lyon 57 Charlie Simmons 58 Nick Bobeff 59 Sam Cutts 61 Ed Cordner 64 Bernie Morris 65 Ned Withers 66 Huw Forbes

Coach: Mark HibbinsCoach: Darren BaxterReserves: Matt James, Nick RoachThirds: Nathan Moon

COLLEGIANS

1 Daniel Riley 1R Damien Ryan 2 Ryan Schroder 3 Alex Mcleod 4 Tom Sullivan 5 Adam Bentick (VC)5R Owen McIntyre 6 Jacob Bevanda 7 Michael Angel 8 Nathan Kazuro 8R Justin Evans 9 Ben Considine 10 George Garth 11 Sam Fleming, 11R Liam Mcintyre 12 Chris Peart 13 Thomas Duyndam 14 Nick Cooke 14R Michael Hughes 15 Luke Madden 16 Mitch Hannan 17 Glen Chivers 17R Jake Van Meel 18 Alex Singleton 18R Jarrod Gill 19 Andrew Merrington 19R Sam Firth 20 Shaun Clarke 21 Tom Overman 22 Simon Caven 22R Lachlan Jowett 23 Jake Forder 24 Alex Boyse25 Tom Russell 26 Tom Gleeson 27 Chad Jones 28 Jack Gay 29 Jack Fraser 30 James Weir 31 Lachlan Mcleod32 Tom Caven (C)32R Jake Wright 33 David Wall 34 Nick Burgin 35 Ben Peart 36 Brad Cooper 37 Pat Macdonough 38 Isaac Madden 39 Jack Saundry 40 Josh Madden 41 Jake Calvert 42 Adrian Corsetti 43 Matt Borzillo 44 Zeeshan Awan 45 Steve Cannatelli

46 Michael Moloney 47 Caleb Forder 48 James Bennie 49 Luke Sullivan 50 Pat Gamwell 51 Matt Pear 52 Jesse Manunzio 53 Jonathan Rose 54 Jack Wheeler 55 Malseed Jayden56 Damien Hurley 57 Michael Sulzberger 58 Luke Scerri 59 Peter Le Noury 60 Adam Bevanda61 Mark Salvadori 62 Andrew Gurrisi63 Matt Boscolo 64 Josh Cunningham 65 Taylor Devers 66 Michael Dillon 67 Matthew Feehan 68 Matthew Gurrusi 69 Will Kingston 70 Ned McAllister 71 Matt McCann 72 Daniel Molony 73 Liam Neal 74 Jake Notaro 75 Kieran O’Connor 76 Tim O”Sullivan 77 Paul Rahill 78 Stefan Romeo 79 Danial Segrave 80 Will Sullivan 81 Liam Whelan 82 Seamus Whelan 83 Brendan Ryan 84 Luke Baird 85 Alex Buckley 86 Sasha Bugryn 87 Gerard Christie 88 Jarred Couch 89 Chris Godfrey 90 Aaron Helenius 91 Nick Hughes 92 Thomas Isaacs 93 Sam Jones 94 Clark Mitchell 95 Justin Monaghan 96 Tate Pearson 97 Matt Sargent 98 Nick Shultz 99 Nicholas Toy

Coach: Anthony RockAssistants: Tim Harvey, Matt O’ConnorReserves Coach: Chris DavisAssistant: Gary McIntyre3rds Coach: Kevin Jones, Brian Moon, Chris Cunningham

ST BERNARDS


PREMIER

1 Paul Wintle2 Luke Wintle3 Michael Curcio4 Pat Kean5 Dan Garside6 Tom Garside7 Steve Doherty8 Tim Doherty9 Chris Richards10 Michael Wintle11 Simon Richards (C)12 Tom Tyquin13 Pat Tyquin14 Hayden Jeans15 Hiwad Shaikaib16 Shaun Glennen17 Mitchell Kent18 Alex Kane19 James Murnane20 Pat Liston21 Sam D’Andrea22 Jamie Maddocks23 Charlie Kinsey24 James Tyquin25 Jack Beckwith26 Michael Barnes27 Cameron Hansen28 Daniel Foot-Connolly30 Chris Mangoni31 Dale Foley32 Trent Bond33 Lachlan Mirams34 Jack O’Kearney35 Brayden O’Toole35R Paul Groves36 Chris McCready37 Jaryd Robertson38 Michael Seeber39 Brett Denton41 Mark Geschke42 Mitchell Coen43 James Symons44 Alex Cross

46 Josh Heron47 Nathan Cerisara48 James Dalzotto49 Fin Neaves50 Alex Whalebone51 Nick Seeber52 Taylor Gogerly53 Jack Hellier55 Tom Foster56 Juy Capp57 Ben Hodges58 Tom McMahon59 John Patounas60 Tim Jeans61 Ben Nicill62 Jamie Popaz66 Damien Waters70 Luke Terrell73 Lewis Stutterd74 Matthew Pitt76 Mitchell Kent

Coach: Mick DwyerAssistants: Jamie Shanahan, Greg SiwesReserves: Steve D’Andrea

ST BEDES/MENTONE TIGERS

SPONSORS

Clear Cut Hairdressing Mentone

Bendigo Bank Parkdale Branch

Buxton Real Estate Mentone

1 Joshua Steadman2 Harrie Lahy3 Scott Myers4 Andrew Willingham (VC)5 Huw Lacey6 Simon Hogan7 Jandre Slabbert8 Tyson Kruse9 Scott Weekley (VC)10 Bede Mahon (C)11 Bart Mill12 Daniel Hunt13 Angus Drysdale14 Simon Thomas15 Lachlan Huntington16 Jesse Laurie17 Peter O’Rouke18 Jason Johnson19 Ben Saliba20 Justin Crameri21 Jason Blake22 Tom Howgate23 Robert Humann24 Isaac Anderson25 Brent Sheahan26 Adam Pattison27 Nick Batten28 Trent Storer29 Scott Dadswell30 Angus Locke31 Clive O’Sullivan32 Steven Flight33 Jordan Foster34 Tyson Roberts35 James Bismire36 Jake Gardiner37 Ben Kealy38 Tom Napier39 Adam Pitt (VC)40 Hugh Curnow41 Joel Ernest42 Charlie Richardson43 Alastair Robbins

44 Hamish Guthrie45 Mitchell Aitken46 Ben Vile47 Tom Brennan48 Alex Williamson49 Andrew Pilbrow50 Jack Heeley51 Michael Coffey52 Henry Robinson53 Tom Sharp54 Cameron Turner55 Sean Butler56 Stephen Judson57 Peter Markworth58 Wayne Curnow

59James Champion de Crespigny

60 Andrew Kraeft61 Damian Kelly62 Jonathon Bunge63 William Van De Fliet64 Sam Bell65 Callum Lawford66 Matthew Witokowski67 Andrew Moore68 Sam Pattison69 Sam Forrest70 Mark Rees71 Sam Aldous

Coach: Cameron RobertsAssistants: Paul Yeomans, Darren CollopyReserves Coach: Xavier Moloney

UNIVERSITY BLACKS


PREMIER B

1 Steven Freemantle2 Tim Smith3 Ben Smithwick4 Jacob Murphy5 Joel Rice (VC)6 James Rimington7 Ryan Bongetti8 Tom Roach9 James Gaff10 Mathew Laidlaw11 Brenton McKenry12 Glen Parker13 James Courtot14 Alistair Stewart-Holmes15 Jarrod Reid (VC)16 Sam Casey17 Col Crowther18 Nicholas Colbert19 Andrew Sloan20 James Murrie

21Lachlan McQueen-Miscamble

22 Sam Rimington23 Cameron Howat (C)24 Marcus Cushen25 James Evans26 Tom Newton27 Shane Zabiegala28 Simon Cust29 Jack Joslin30 Cameron Jones (VC)31 Brett De Leijer32 Bas Simpson33 Luke Marriott34 Freddie Cator34 Nicholas Thompson35 Lachlan Macleod36 Matthew Pallozzi37 Brodie Easton38 Travis Chiuchiarelli38 Luke Mckinnon39 Chris Allen40 Morgan Evans40 Sam Hassett41 Harry Moore

42 Scott Gordon43 Alistar Reed44 Nick Richardson45 Tim Rule46 Simon Bramwell47 Liam Cooney48 Chris Bell49 David Pocock50 Blake Fordham51 Christian Virgona 52 Sam Pentney53 Lochlan Hall54 Henry McQueen-

Miscamble55 Spencer Cambridge56 Lewis Fotheringham57 Harry Maxwell58 Pat Arundel59 Jack Ymer60 Jarret Barber61 William Guiney62 James Coull63 Alexander Moshovelis64 Alex Richardson65 Adrian Morris66 Matthew Roach67 Patrick Cremean68 Tim Wilkins70 Sam Landgren71 Zac Lisle72 Campbell Wallace73 Callum O’Brien74 Tom Macready-Bryan75 Tim Laidlaw76 Simon Lenders77 Andrew Bird78 Rhett Mitchelhill

Coach: Glenn CoxAssistants: Dave Wright, Justin Seabury, James Wagner, Nicholas Thompson

OLD CAREY

1 Nadav Harel2 Adam Caplan3 Asher Burstin4 Jarryd Ludski5 Jason Ritterman6 David Fayman7 Marcus Jankie8 Geoff Measey 9 Gary Blieden10 Daniel Cohen11 Warren Steinberg12 Ezra Poyas13 Michael Shafar14 Jarrod White15 Rubin Winograd16 Nick Marks17 Josh Ludski18 Richie Simon19 Ashley Kalb20 Josh Kalmus21 Noah Rischin22 Luke Peters23 Ari Lewski24 Josh Sacks25 Jake Lew 26 Ben Kalmus27 Josh Givoni28 Dean Steinberg29 Brad Caplan30 Josh Gottlieb31 Josh Dorevitch32 Josh Singer33 Jordan Bade-Boon34 Jason Samuel35 Corey Jankie

36 Danny Markov37 Roi Abraham38 Luke Jankie39 Stuart Fayman40 Joel Gocs41 Jamie Grigorianis42 Ryan White43 Jeremy Forbes44 Michael Selzer45 Zac Leiser-Moore46 Alex Wollan47 Daniel Roth48 Simon Roth49 Josh Mendies50 Alon Abraham51 Ari Wytwornik52 Ben Michowski53 Adam Lerner54 Tim Freed55 Daniel Goodman56 Brandon Joel57 Brett Joffe58 Matt Markoff59 Jordan Tonkin60 Anton Ritterman61 Jarrod Swire62 Dean Rotenberg63 David Glass65 Myles Miller67 Daniel Janover-Rocha68 Noah Keddie69 Daniel Smorgon70 Sam Friede73 Nitsan Miliekowski

Coach: Leigh McQuillenAssistants: Dale Carey, Brent McGrath, David Veale, Darren Seidl & Nick GoldReserves: Adam Slade-JacobsonThirds: Barry Simon

AJAX


PREMIER B

1 Keegan Stewart2 Ben Price (C)3 Max Slonim3 Matthew Gould4 Aiden Clarke5 Tom Silvestro6 Chris Hammond6 Michael Bowden7 Tim Nixon (VC)8 TJ Rothel9 Will Edwards9 Harrison Mills10 Tim Yelland11 Sean Meredith12 Andrew McGuinness13 Sam Wood14 Alex Ford15 Scott Dickson16 Jackson Leigh17 Declan Reilly18 Tom Small19 Luke Price20 Darcy Daly21 James Shanahan (VC)22 Zac Parsons23 Nick Tonkin23R Chris Fagan24 Chris Game24 John Nankervis25 James Gray26 Matthew Mcternan27 Louis O’Keefe28 Daniel Meddings29 Dominic O’Keefe30 Josh Rogers31 Will Osborn32 Clay Williams33 Damien Simic34 Sean Stewart35 Andrew Spittal36 Lloyd Everett37 Francis McArdle

38 Hugo Gates39 Adrian Bednarek40 Lachlan Kellock41 Jackson Small42 Tom Green43 Woody Eke

44Conor Mengler-Francis

45 Norbert Williams46 Tyler Haugh47 Nick Karoly48 Tom Stewart49 Luke Matias50 Dylan Tobias51 Jake Tobias52 Robert Handel53 Drew Dickson54 Sam O’Sullivan55 Matthew O’Connor56 James Cleeve57 Tom Quinn58 Fred Cooper59 Matthew Wood60 Liam Bourke61 Will Conly62 Peter Mayes63 Andrew Clark64 Simon Tamblyn65 James Easton66 William Berry67 Hugh Goodfellow68 George Berry70 Damien Hay71 Glenn Thomson72 Mitch Bain74 David Roberts75 Tyler Smith

Coach: Tim O’ShaughnessyAssistants: Wayne Oswald, David LandriganReserves: Andrew Strain

CAULFIELD GRAMM

1 Harry Macciolli2 James Beaumont3 Tom Paule (C)4 Tom Healey5 Josh Freezer6 Chris Righetti7 Ted De Fegely8 Al Armstrong9 Pete Kennon10 Lachie Borthwick11 Tom Bachet12 Chris Wischer13 John Cooper14 Sam Gibbons15 Timmy Oman16 Nick Voyage17 Tim McLardy18 Harry Jupp19 Will Thompson20 Guy Brayshaw21 Charlie Cumbrae-

Stewart22 Ed Fanning23 Nick De Steiger24 Tom Hywood25 Cameron Tunbridge26 Billy Hatfi eld27 Marty McCoy28 Jeremy Beaumont29 Lachie Bennett30 Sam Quennell31 Cameron Beck32 Sammy Peacock33 Nick Daish34 Zach O’Neil35 Nick McLardy36 Matt Demicoli37 Chris Barry38 Adrian Karatzas39 Nick Madders40 Oscar Hosking41 Al Ferguson42 Alex Crosby43 Zach Johnston44 Johnny Ross45 Patty Garschagen46 Lewis Haralambous47 Nick Churkovich48 Will Fuller

49 Stephen Land50 Angus Murray51 James Bate52 Jono Phillips53 Alex Thorley54 Mac Webster55 Paul Mishura56 Will Fuller57 James Land58 James Siebert59 Josh Rundell60 Damon Velakoulis61 Alex Coleridge62 Julian Draudins63 Tom De Fegely64 Oscar Dixon65 Toby Dickson66 Tim Spargo67 Sam Playfair68 Tom Watson69 Jim De Fegely70 Rupert Doyle71 Richie Armit72 Will Boyd73 Andy Cameron74 Will Marshall75 Tom Lackman76 Nick Burke77 Cal Williamson78 Chris Lam79 Justin De Steiger80 Ben Rogers81 Max Gibson82 Jack Brandwood83 Rupert Middleton84 Will Beasley85 Morgan Cottee86 Sam Dellios87 Nick Molony88 Stefan Stacey89 Josh McMullin90 Edward Robinson91 Jack Sanford92 Sam Daddo93 Guy Shearman94 Ed Fuller95 Jordan Hooper96 Nick Sloan97 Charles May

Coach: Nathan BrownAssistants: Daniel Hughes, Peter NunnReserves: Chris Hood

OLD MELBURNIANS


PREMIER B

1 Matthew Murphy2 Nick Wood3 Ben Dowd 4 Callum Matheson5 Patrick Dowd6 Steven Salopek7 Charles Ring8 Joshua Gabelich9 Julian Staffi eri10 Karl Wissell11 Elliot Waldron12 Nick McArdle13 Patrick Keely14 James Grinter15 Joshua Taylor16 Jason Salopek17 Patrick Aughton18 Billy Kanakis19 Anthony Kirwan20 Sean Kennedy21 Francis Keely22 Phil Edgar23 Tom Simpson24 Zachary Ginies24 Tom (R) Marchesani25 Lachlan Nankervis26 Matthew Lodge27 Gerard Gleeson28 Edward Ring29 Chris Gleeson30 Tom Cunningham31 Anthony Lynch (C) 32 William Coates33 Jack Weber34 Julian Gambarro35 Patrick McLennan

36 Michael Dolan37 Luke McDonell38 Pana Karageorgiou39 Hamish Townsend40 Anthony Giarrusso41 Tom McPherson42 Matthew Nolan43 Rick Caldow 44 Henry Parkes45 Tom Hickey46 Domenic Losciavo47 John Griffi ths49 Dylan Wissell50 Tim Sharpe59 Hamish McPherson60 Liam Dunne61 Nelson Pryor64 Ray Short66 James Marchesani72 Pat Rhodes74 Ben Marchesani75 Adam Fenech77 Tom Gleeson78 Tom Johnstone84 Jarrod Nash

Senior coach: Daniel HarfordSenior assistants: Jon Edgar, Michael Christian

ST KEVINS

1 Cam Williams2 Jack Townley3 Matt Hart3R Alex Schipp4 Marshall Rippon4R Andy Wettenhall5R Jared Edwards6 Marc James7 Jeremy Mugavin8 Henry Weddell9 Tim Blakey10 Pete Summers11 Hugh Vickers-Willis12 Jack Watts (C)13 Tom Girdwood14 Tom Fairbairn15 Sam Henry16 Paddy Hayes17 Rich Langham18 Dan Zambon19 Matt Torney20 Dom Nixon21 Al Evans22 Jordan Brown23 Sean Carr24 Will Cunningham25 Angus Nice26 Jack Maxwell27R Charlie Craig27 Hugo Steinfort28 George Curnow29 Patrick Gardiner30 Angus Ford31 James Van de Pol32 Riley McMahon33 Tom MacKenzie34 Will Hartnell

35 James Coumans36 David Withers37 Tom Foott38 Ryan Eade39 Dirk Heinz40 Henry Hanlon41 Jack Rutherford42 Jack Wood43 Bennett Merriman44 John Wood45 Damian Barton46 Mick Steinbach48 Hugh Evans50 George Chisholm51 Daniel McFarlane52 Josh Caldow53 Cam McDonald55 Llewyn Butler56 Jason Cowland57 Jack Heinz58 Ed Long59 Jamie Mugavin60 Darcy Del Rio61 Ed Sinnott62 Danial Van de Pol66 Dan Gumley67 Jack Kershaw69 Nick Macrae73 Jesse Pardo74 Ben Jongebloed76 Sam Caldow78 Ed Ratcliffe79 Bernie Chomley80 Tom Kerr

Coach: Quinton GleesonAssistants: James Walker, Andrew Lowcock, Huw FlanaganReserves: Bob Girdwood

UNIVERSITY BLUES


PREMIER B

1 James Backway2 James Paul3 Hamish Mclauchlan4 Alex Woltering5 Luke Pinot (VC)6 John Nicolopoulos7 Lachlan Nash8 Nic Gooda9 Peter Gleadhill (VC)10 Matt Taylor11 Mark Collins 12 Corey Rich 13 Tim Lockwood14 Jarrod Rafferty15 David Mackenzie (RC)16 Spencer Roberts 17 Mitch Rafferty

18Jackson Heagney-Steart

19 Daniel Newby20 Michael Meehan 21 Oliver Armstrong22 Tim Witherow 23 Chris Ferguson24 Corey Barter25 Scott Ellis (RVC)26 Nick Leonidas27 Tom Chisholm28 Chris Povey29 Rhys Johnson30 Hamish McWilliam31 Adam Weekes (C)32 Ed Limon33 Rory James 34 Sean Verway35 Josh Alkemade36 Chris Smith37 Adam Schofi eld38 Josh Dawson39 Tim Hunter40 Jason Leonidas41 Michael Stowe41 Rilyn Mosbey42 Luke Skelton

43 Adam Vitolins44 Tom Dalton45 Sean Corrigan46 Jake Lynch47 Jordan Toy48 Tristan Coles (RVC)49 Luke Pitcher50 Toby Gill51 Jack Steen52 Mark Seccull53 Tom Tyrell54 Sam Hall55 Damian Fletcher56 Joe Fisscher57 Tim Miller58 Johnathan Spanos59 Shane Walden60 Adam Floyd61 Cameron Hill62 Sam Sturrock63 Cameron Vincent64 Jason Kurta65 William McTaggert66 Jackson Coleman67 Daniel Farmer68 Lee Griffi ths69 Hector Simpson70 Luke Floyd

Coach: Stewart LoeweAssistants: Matt O’Sullivan, Sean Murphy, Kain Taylor, Brett O’Farrell, Matt Brewer, Sam Langford-JonesReserves: Craig BrockleyAssistants: Johnathan Spanos, Drew GilbyThirds: Adam Floyd

OLD HAILEYBURIANS

1 N. Lewton 2 M. Chamberlain 3 D. Kelly (DVC)4 T. Bourbon 5 L. Welsford 6 R. Mann 7 F. Reed 9 J. Cowan 10 D. Chamberlain 11 C. Smith 12 P. Iacovangelo (RC)13 H. Black 14 B. Phibbs 15 M. Johnson (VC)16 M. Pecora 16 N. Thomas 17 T. Chambers 18 B. Bonner 19 J.P. Van Rensberg 20 N. Gentile 21 S. Inglis 22 S. Veltman 23 S. Oldman 24 L. Riley 25 J. Kelly (C)26 A. Patti 27 T. Bailey 28 S. Welsford 29 C. Collins 29 A. Holmes 31 B. Woods 32 J. Cetraro 32 R. McCarthy 32 B. Kovac 33 S. Balloch 34 D. Regan 35 D. McLean 36 N. McLean 37 M. Rice 38 A. DiPetta 39 J. Trounce 40 A. Bortoli

41 T. Wilson 42 D. Izon 44 J. Campbell 45 D. Micallef 51 P. Flanagan 52 P. Johnson 53 J. Mather 54 M. Rich 56 S. Mann 57 D. MacLeod 58 D. Maskill 60 R. Woolley 61 A. Ciavarella 62 J. Verbyla 63 J. Hende 67 J. Bates 68 J. Egan 81 G. Lofthouse 82 S. Paolucci

Coach: Adrian ConnollyAssistants: Wayne Poulter, Kevin ChamberlainReserves: Ben Chamberlain

MAZENOD


PREMIER B

1 Matthew Murray2 Josh Doherty3 Nick Gieschen4 Sam Geilings5 Adrian DelMonte6 Victor Sicilano7 Jake McKeon8 Joel Macdonald9 Chris Sutherland10 Brett Nagel11 Nick Butler12 Alex Vella13 Ricky Jessop14 Chris Johnson15 Kobe Trajanovski16 Brad Flintoff17 Zac Keane18 Michael Mitris19 Carl Groth20 Jake Trajanovski21 Bernard McDowell22 James Moio23 Iza Dawkins24 Richard Butler25 Rob Davidson26 Brandt Harrison27 Hayden Heta (C)28 Dean Heta29 Andrew Paine30 Brandon Lee31 James Binney32 Joey Cua33 Stephen Ward34 Richard Skok35 Robert Hondromatidis36 Sam Wilcox37 Nick Kenyon-Smith38 Tom Earle39 Arthur Solomidis40 Michael Basckos41 Max Kirwan42 Jordan O’Neill

43 Robert Glavas44 Lochlan Phillips45 Callum Matheson46 Tyson Hill47 Simon MacKenzie48 Gareth Fowler49 Sam Armstrong50 Jordan Stanton51 Josh Dunnett52 Ryan Buckley53 Nathan Valkanis54 Josh Spoor55 Tom Falconer56 Richard Dennis57 Jacson Cecil58 Chris Sarthou59 Ashley Steer60 Alec Steinicke61 Simon Leon62 Heath Evans63 Michael Pierce64 Tom Eggleston65 Adam Veli66 Daniel Mancuso67 Vincent Mancuso68 Luke Pace69 Paul Spurling70 Jason Burns71 Brendon Michael72 John Apostolopoulos73 Danny Stone74 Andrew Sheehan75 Brendon Knox76 Sjouke Price77 Michael DelMonte78 Justin Beilin79 Adam Karim81 Michael Baxter83 Danny Stone85 Nathan Pratt

Coach: Travis RonaldsonAssistant: Daniel WellerReserves: Darren TollAssistant: John Hill

OLD IVANHOE

East Ivanhoe

1 Rory Angiolella (C)2 Matt Kyroussis3 Ross Borland4 Toby Hudson Bevege5 Michael Cussen6 Chris Polidoras7 Jack Beech8 James Meakin9 Maxim Allen10 Tom Cheshire11 Daniel Bisetto12 Alister Green13 Jesse Dimond14 Ben Roberts15 Richard Willingham16 Tom Biscaro17 Alex Ricco18 Ryan Floyd19 Antony Harbor20 Dimitri Kynigopoulos21 Michael Lee22 Mitch McWhinney23 Sam Baker24 Jack Parkinson25 Michael Racovalis26 Jack Dalton28 James McGee30 Jamie Mackay32 Dom Pound-Palmieri33 Tom Parkinson34 Will Johnson35 Cailean Moore36 Dylan Patcas37 Will Fenton ( C )38 Jan Leman

39 Drew Olarenshaw40 Josh Munro41 Matt Brown42 Greg Hesse43 Raphael Lloyd44 Stefan Green45 Nick Marshall46 Cameron Ball47 Julian Turner49 Adam Franklin51 Max Ellis52 Phillip Carydis54 Luke Baker55 Dylan Leech56 Joshua Murray58 Gary McCarthy

59Diaramuid O’Donoghue-Cooney

60 Jonathan Anderson62 Brad Farley63 Brendan Johnstone64 Luke McNally66 Sam Buckely85 Will Pickering88 Conor Smith

Coach: Michael PickeringAssistants: John LeGrand, Vince Silluzio, Steve HurlReserves: Ryan Aisbett

FITZROY

SPONSORSRoyal Derby HotelReds Foundation

Clifton Hill/North Fitzroy Community Bank - Bendigo Bank

Fitzroy Victoria Bowls Club


PREMIER C

1 Leigh Fletcher2 Mark Devereaux3 Rory Lynch4 Kyle Pinto5 Stuart Burggraaff6 Bryce Pewtress7 Jesse Lovig8 Stephen Anderson9 Matthew Care10 Guy Martyn11 Tom Youl12 Ben Traeger-Haig13 Nick Jewell14 Nick Pinto15 Josh Schmitz16 David Morton17 Daniel Corp18 Tim Jones19 Christopher Long20 Adam Power21 Jay Ting22 Charlie Miles23 Richard Atkins24 Adam McNeil25 Shem Curry26 Samuel Clements27 Josh Verlin28 Ben Kezilas29 Jesse Donald30 Cain Malthouse31 Ed Turner32 Joshua McPherson34 Jason McCoy35 Jay Dillon36 Stefan Constantinou37 James Short38 Ash Fisher40 Matt Powell41 Liam Woodland43 Jack Baxter44 Paul Adams45 Marlon Woltering46 Nigel Bloomfi eld47 Michael Dynon48 Lachlan Wheeler49 Liam Dynon50 Andrew Long51 Josh Pavlou52 Kyal McNeil

53 Brendan Culvenor54 Jack Wilson55 Zac Pirrie56 Mark Short57 Daniel Andersen58 James Benjamin59 Matthew Broadley60 Vincent Camera61 Ben Clarke62 Zachary Cochrane63 Adam Cockie64 Sam Cougan65 Thomas Cougan66 Jay Coverdale67 Travis Cowan68 Sam Dalton69 Lachlan DeLisle70 Lachlan Edgar71 Christopher Ellison72 Nathan Foster73 Steven Helliger74 Brenton Holt75 Patrick Hosking76 Reece Houston77 Kristian Johannsen78 Szczepan Kasinski79 Ben Lane80 Jason Laver81 Will Lingard82 Jack Lloyd83 David McCarthy84 Leon McCarthy85 Tobias Morrison86 William O’Haire87 Jesse Rees88 Thomas Rowse89 Matthew Ryan90 Simon Schultz91 Chris Smith92 Nick Taylor93 Stephen Tiernan94 Ned Tikner95 Kieron Turner96 Ryan Warren97 Jadyn Wilkinson98 Sebastian Wright

Coach: Guy MartynAssistants: Owen Lalor & Steve KennedyReserves: Steven Kidd Thirds: Sebastian Wright

HAMPTON ROVERS

1 Ewan Flanagan2 Nick Petering3 Ryan Smith4 Harry Stephenson5 Dylan Harris6 Michael Davidson7 Andrew Young8 Andrew Hickey9 Sam Baring (C)10 Pat Bryce11 James Taylor12 George Smyth14 Jye Ledin15 Ben Tilley16 Darcy Meehan17 Jake Meade18 Joe Cosgriff19 James McKenzie20 Zac Ledin21 Tim McKenzie22 Alex Carr23 Lachlan Inglis24 Gareth Taylor25 Damien Hatch26 Sam Whatley27 Ben Amberg28 Tom Lancaster29 Andrew Costley30 Joe Griffi ths31 Callum Dick32 Daniel Brogden33 Rami Shenouda34 Rowan Shields35 Chris Godsil36 Jonathon Rau37 Grant Chessari38 Matt Hunt39 Matt McCart40 Gerard Gillian41 Shane Chapman42 Michael Chapman43 Tom Duffy44 Luke Leviston45 Martin Phillips46 Justin Mazur47 Brett McCaughan48 Matt Mason

49 Luke Meeking50 Greg Pavlos51 Henry Drysdale52 Simon Chandler53 Jake Richardson54 Luke Richardson55 Jake Cockburn56 Jacob Meehan57 Pat Long58 Brenton Bourke59 David Meulendijks60 Paul Tweedly61 Nick Rhoden62 Chris Vizard63 Darcy Bourke64 Ryan McIvor65 Zac Wilson66 Will Lucas67 Tom Lakeland68 Tom O’Dwyer70 Tom Freeman71 Jared Samuels72 Matt White73 Jacob Meehan74 Ryan Phillips75 Nick Malcolm76 Hayden Devanny77 Ben Dempsey78 Matt Stewart79 Daniel Heap80 Michael Fenwick-Nevin81 Nick Armstrong82 Josh Anaf83 Rhys Waller84 Bill Geary85 Seb Poole86 Daniel Garabiles87 Nick Burri88 Chris Wilson89 Freek Faber90 Jenson Leung91 James Hertan92 Aaron Darnell93 Matt Davies94 Haydn Brouwer96 Avi Ehrenreich97 Alex Hutchesson

Coach: Hayden Stanton, Jye LedinAssistant: Nicholas SalvatoreReserves: Shane Paynter

MONASH BLUES


PREMIER C

2 Jarrod Carlson2 Liam Mc Cormack3 John Mc Intyre4 Patrick Chard 5 Simon Considine5 Paul Symes6 Nicholas Crosbie7 Matthew Gasparini8 Stuart Kemp9 Patrick Millson 10 Timothy Lincoln 10 Paul Symes11 Jonathan Blanch12 Jeremiah Antypas 13 Robert Galea 14 Michael Abrahams 15 Jonathan Bortolotto16 Simon Abrahams17 James Baxter 18 Derrin Gartner19 Steven Crapper20 Mathew Beayni20 Harrison Lee 21 David Tantsis Hall21 Domenic Bolger 22 Timothy Montagna23 Michael Mc Coll24 Trent Carlson25 Daniel Mc Mahon26 Laine Rice27 Robert Costanzo27 Brendon Pearce 28 Jacob Gasparini29 Matthew Molloy30 Daniel Redmond31 Anthony Beaini31 Anthony Mc Glin32 Adrian Coburn33 Jake Symes34 Dallas Jarred34 Liam Brockhus35 Ashley Viney36 Timothy Blanch37 Bradley Taylor 38 Anthony Manakis39 William Delahunty

40 Jordan Bettello41 Cameron Kemp42 Heath Jenkins43 Thomas Cullen 44 Tom Black45 Rowan Mc Kenzie 46 Stewart Callan47 Nicholas Watty 48 Ari Loucas49 Jacques Augustin 50 Dustin Cracknell51 Joseph Kardami52 Hayden Manassa53 Liam Ryan 54 Scott Mc Pherson 55 Tom Natoli56 Paul Laccarruba57 Michael Ryan 58 Julien Toohey 59 Daniel Coloe60 Robert Kemp61 Hamish Murray62 Vincent O’Flynn63 Stephen Gill 64 Anthony Pezzimenti 65 Nicholas Thompson 66 Luke Money67 Joshua Normoyle68 David Mc Donald70 Adam Ceccomancini71 Christopher Walsh72 Paul Symes73 Sam Ayob74 Alexander Montalto75 James Moloney76 Jonathon Wilkinson 77 David Montalti78 Richard Stansbury79 Nicholas James 80 Daniel Kofoed81 Dale Juchnevicius82 Michael Whittle83 James Vear85 Joel Donnellan87 Gerard Mc Mahon88 Gianluca Romanin

Coach: Greg FremantleAssistants: Cameron Crowley, Graham AndersonReserves: Stuart KempThirds: Liam McCormack

MARCELLIN

1 Andrew Frazer2 Chris Goullet3 David Forrest4 Daniel Ryan5 Chris Tzambazis6 James Lenhart7 Jordan Leask7 Cameron Livori8 Cal Glassford9 Josh Pound (C)10 Tom Black11 Daniel Roscoe12 Mark Wilson13 Ryan Jones14 Brett Hannah15 Jarad Rogers16 Sandon McCann17 Sean Towner (C)18 Daniel Flaherty19 Aaron Bell20 Rob Baddeley21 Jack Fenner21 Stuart Dale22 Jed Watson23 Trent Skurrie24 Chris Caminiti25 Bradley Jones26 Jarryd French27 Rowan Nolan28 Sahand Ghasimzadeh29 Michael Fahey30 Ben Briggs31 Daniel Cantwell32 Damien Cerantonio33 Jake Barrett34 Dean Podger35 Jesse Saunders36 Nick Karikakas37 Blake Anderson38 Stuart Tibbitts39 Jackson Marr40 James Taylor

41 Dylan Anderson42 Andrew Baddeley43 Dave Bianchi44 Hugh Braden45 Jack Clarke46 Josh Dazkiw47 Hayden Federico48 Liam Fitzgerald49 Matthew Flaherty50 Rob Frain51 Daniel Galea52 Adrian Gurry53 Andrew Khallouf54 Michael Lepa55 Mitch Miller56 Mark Mitchell57 Matthew Nola58 Dale Phelan59 Ryan Richardson60 Daniel Rowland61 Matt Semini62 Liam Sutawon63 Jordan Williams64 Jack Williams65 Anthony Atkinson66 Shane Azzapardi67 Manuell Gauding68 John Hughes69 Andrew Palmer70 Andrew Petersen 71 Basil Remboulis72 Luke Schultz

Coach: Mark Murray Assistants: M. Regan, C. Jayaweera

PEGS FC


PREMIER C

1 Jake Rice1 Zan Wenke2 Leighton O’Donnell3 Stefan Courtot4 Fraser Oliver5 Ash Brown6 Jeremy Brazzale (RVC)9 Michael Christian (C)10 Luke Giles11 Tore Valvo12 Ryan Byrne13 Ryan Hay15 Oscar Philp-Taylor16 Liam Austin19 Dale Equid21 Benjamin Smith22 Darcy Cumberland23 Angelo Russo24 Michael Italia (VC)25 David Higgins26 Craig Skicko27 Michael Stephenson31 Nicholas Biscontin (VC)32 Mark Smith33 Adam Barclay35 Anthony Valvo36 Devin McDonald36 James Pentland37 Nick Smith38 Michael Sacchetta39 Andrew Hopgood41 Luke French44 Marcus Borg (C)49 Paul Trovato51 Scott Hills52 Jake Grose53 Adam Layt54 Luke Delaney57 Mark Morgan (DVC)58 Harrison Tippett59 Christian Lendaro60 Brendan Danaher61 Matthew Crema

63 Lincoln Burns65 Jonathan Knape67 Jarrad Appleby68 Brandon Kelly

Coach: Craig HayesAssistant: Jason PlantReserves: Peter Judge

BANYULE

1 M Bennett 2 T Scott 3 D Cleary (C)4 C Hogan 5 K Hogan 6 A Cloke 7 C Lavery 8 W Manning 9 G Bennett 10 S Wines 11 A Deneys 12 B Hogan 13 J Revere 14 P Di Siervi 15 P Ioannidis 16 D Costigan 17 A Valentini 18 J Chapple 19 J Hunt 20 S Tolongs 21 J Pappon 22 L Andreatta 23 K Holden 24 T Golik 25 J Hind 26 J Paola 27 L Barrand 28 B Wass 29 R Holden 30 P Holden 31 T Bromley 32 A Murray 33 N Seel 34 Z Thiessens 35 L Gillard 36 A Mase 37 C Grant 38 M Wass 39 A Binns 40 A Shaw 41 S Way 42 J Olson

43 D Mercuri 44 G Valenzuela (RC)45 A Matthieson 46 J Lever 47 L Hard 48 A Paisley 49 L Kioussis 50 J Benoiton 51 K Paisley 52 B Grizzell 53 C Mercuri 54 M Klonaridis 55 J van der Ven 56 R Gonzalez 57 M Kohli 58 B Sleet 59 J Paola 60 N Shannahan 61 D Ashworth 62 N Miller 63 B Clayton 64 L Moeller 65 J Faranda 70 M Catalla

Coach: Jamie MolloAssistant: Nathan MillerReserves: Jamie Connellan

OAKLEIGH


PREMIER C

1 Tom Buckley2 Lucas Hemming3 Matt Saunders 4 Henry Jacobs4 Yannick Chani5 Matt Martinov (C)6 Daniel Brosnan8 Sean Meeking9 Joss Holdsworth10 Ryan Martin11 Craig Harvey12 Henry Simon13 Jeremy Simon14 Boyd Upstill15 Tim Blackburn16 Sam Stait17 Jordan Tabakman18 Wayne Cove19 Dwain Bailey20 Matt Oaten21 Orry Lack22 Luke Duthie23 Tim Naylor24 Alistair McCooke25 Lloyd Anrep26 Sam Mason27 Will Sayce28 Andrew Clinch29 Luke Saunders30 Chris Coghlan31 Sam Barnes31 Roger Breust32 Daniel Riazah-Kesheh33 Stewart McCooke34 Mark Pappas35 Nicholas Curwood36 Blair Atkins37 Damien Casey37 Chris Everett38 Scott Walker39 Nick Ryde40 Stuart Gay

41 Dan Frazier42 Greg Hammond43 Mitch Veal44 Sam Ashton45 Ben Lydster46 Jarred Harry47 Sam Blandford48 Tom McCrabb49 Leon Calvert50 Daniel Farthing51 Dan Haysom51 Jason Kille52 Tom Haysom53 David Machin54 Haydon Whitehead56 Jesse Plostins57 Nick Topakas58 Ben Rockman

59Andrew Hastings-Dodge

60 James Hastings-Dodge61 Damien Cleary62 Michael Bannan63 Lachlan Upstill65 Jerome Keast66 Tom Cameron66 Daniel Milosavljevic67 Matt Pardy68 Brad Cromack68 Josh Cukierman70 James Young71 Chris Hecker77 Tim Ashford78 Michael Jukes80 Paul Konstanty81 Jason McDonald82 Chris Cleary85 James Gates86 Cody Johnston88 Nick Manning89 James Johnson

Coach: Brett RoweAssistant: Rod StrahanReserves: Stephen KeleherAssistant: Andrew KahoferThird 18 Coach: Paul Konstanty

ORMOND

1 Tom McLennon2 Sam Chitty2 Patrick Lee3 Liam Platt4 Adam Knight4 Matthew Hayes5 Michael Graham6 Daniel Price7 Brett Hampton8 Charlie Dillon8 Kris Little9 Michael Meyer10 Tim Kight11 Robert Swayn11 Mac O’Donnell12 Claye Tobin13 Matthew Ryan 14 Jack Edwards14 Dan Atkins15 Shaun Hendricks16 Paul Sullivan17 Mark Kidner18 Stephen Sullivan19 Luke Morgan20 Shaun Chapman21 Sam Larkins21 Lucas Thomas22 Daniel McCarthy23 Tim Boland (C)24 Zeke McCarthy25 Jesse Waters26 Jackson Boland 26 Darren Rochford27 Mitch Todd28 Jesse Balic29 Max Nixon29 Guy Crilley30 Tom Redmond

31 Jack Edwards32 Lewy Emmerson33 Sam L’huillier33 Jack Dunston34 Chad Ryan35 Jarryd Capiron36 Reid Irvine36 Ryan O’Leary37 Nathan Papatsanis37 Michael O’Connor38 Robert Meade39 Chris Welch40 Jacob Crowley41 Andrew Thompson42 Mark Ferguson43 James Lay

44 Retired In Memory Of John Kenny

45 Dean Kelly46 Dylan Glasscott47 Darcy Ballard48 William McGowan49 Nathan Ng50 Jonathan Fitt52 Daniel Graham53 Tom Fenwick54 Rob Heaney55 Shane Jones56 Jesse Waters57 Dean Lonsdale58 Jackson Harris60 James Le Breton61 Tim Matthews62 Jarrod Pierce64 Jacob Crowley72 Ben Wapling73 Antony McNeil

Coach: Sam RadfordAssistants: Corey Stephens, Mark Haynes, Ben Hampton Reserves: Tony WhiteAssistant: Ken WoodThirds: Jason Austin

PARKDALE VULTURES


PREMIER C

1 S Bennett2 R Campbell3 S Romanin3 M Cottrell4 O Scheiber4 B Hillier4 C Young5 N Adamson5 A Rogers6 O Lloyd7 N Tsindos7 M Hook7 M Woodbridge8 J Heffernan8 P Kanz9 R Deev10 M Powell12 A Lloyd12 B Cottrell13 G Tolson13 J Wilson14 L Campbell15 R Kapoor16 S Killworth16 D Toma17 P Bennett18 J Eade19 T Kanz19 C Woodbridge21 A Clarke22 J Howells23 W Kanz24 D DeSanctis25 H Crothers26 T Schipper27 C Hillier28 C Webster29 S Needham30 T Allwright31 A Romanin32 N Searles35 J Le Cerf

36 W McDonald38 D McGuigan41 T Mirikilis42 J Duke 42 M Jenkin43 B Hart (C)47 S Warr48 N Ross49 J Hart50 N Russell51 TSheehan53 C McLaughlin57 R Shute58 J Louey67 B Dean76 T Stayner

Coach: Ben Robertson

OLD CAMBERWELL

1 Sam Glenn2 Harry Whitty3 Stuart Grigg (C)4 Stefan Barbour5 Michael Lambert5 Garth O’Connor-Price6 Vaughan Clarke7 Sam Murray 8 Robert Stainforth (VC)9 Tom Coghlan10 Ben Southam (DVC)11 Ben Mitchell12 George Fletcher13 Sam Buchanan14 Brett Brisbane15 Alex Wood (VC)16 Alex Marshall17 Eddie Coghlan18 Tom Stainforth19 Rob Bambery20 Jeremy Gleeson21 Paul Coldrey22 Nicholas Fisher23 Reed Powney24 Thomas Grigg25 Adam Granger25 Jeremy Gleeson26 Ash Law27 Shaun Payze28 Lachlan Heron29 Jordan Pomeroy30 Tom Feldgen30 Adam Crean31 Zac Kurts32 Ryan Trickey

33 Andrew Starkins34 Jordan Owens35 Tim Scarpella36 Jake Archdeacon37 Luke Keon38 Cam Mccauley39 Leith Baker40 Aaron Brockley42 Scott Cain43 Mathew Tuckett44 Mathew Beggs46 Laurens Van der Sluijs47 Tom Shayler48 John Wilkins

49Mitchell Sheldon Collins

50 Aaron Anson51 Sam Messinis52 Liam Nickels53 Daniel Bruce54 Chris Davis55 Demi Pinxt57 Callum Savio59 Hayden Brodie60 Jamie Rhodes61 Lachlan O’Grady62 Dan Laversha63 Anthony Kyriacou64 Ryan White65 David Kotsiakos68 Aaron Bouten70 Dave Dungan77 Tom Lardner

Coach: Nick ClaringboldAssistant Coaches: Damian Brice, Peter Williamson, Michael Lambert & Neil KentReserves Coach: Adam Crean

PENINSULA


CLUB WAREHOUSE RISING STAR 2014

Congratulations to Timothy Marshall who has been nominated as

this week’s Club Warehouse Rising Star.

Timothy joined his brother at Old Melburnians this year for his

fi rst year of football since leaving Melbourne Grammar. Timothy’s

promotion to the senior team is highlighted by the fact he arrived

half way through pre-season after returning from a gap year

travelling. After missing a complete season, Timothy set him self

the goal of returning to peak fi tness and utilising his pace to

impress the coaching staff . During the practice matches earlier

in the year, it was not only his blistering pace that stood out, but,

his ability to read the play and exceptional skills which caught the

eye of senior coaches. Since his fi rst senior game, he has been a

coaches dream; reliable, competitive, does not fear anyone, as

defensive as he is attacking, and eager to learn. Timothy also has

the attributes to excite the supporters, tucking the ball under his

arm and when he’s off like the Road Runner, no-one can catch him.

Timothy is rarely seen around the club without his cheeky smile

and cheeky attitude.

* to be eligible for the club Warehouse Rising

Star, a player must be born no earlier than

1991 and playing his fi rst full season of

senior football.

TIM MARSHALL – OLD MELBURNIANS


Geoff Reilley @GeoffreyReilley

5 YEARS AGO – 2009

In A Section, Uni Blues went down to SBMT in a crucial game for the Blues. They remained in fourth spot but

were now vying with Collegians and Old Scotch; the other three, Xavs, De La and The Tigers were pretty safe. The Blues led at half time 6.7 to 3.4 but the Tigers were fantastic in the third quarter kicking 8.3 to 1.1. The Tigers went on with it in the last to win easily 17.12 to 12.11. Best: Anstey, Collins, Curcio, Hellier, Phibbs, Bliesner (SBMT) and Nicholson, McConnell, Paterson, Lewis, Austin, Weddell (Blues).

Vinnie Vescovi offi ciated in his 400th game as an umpire. Now in the goals after starting as a boundary runner, Vinnie was a fi eld ump for 8 years before settling for the fl ags on Saturdays.


The two top teams in D1 Section met at Banyule and the home side was looking to take the 4 points and maintain their second place. The ladder leaders, Uni Blacks, were not about to upset their unbeaten record for the season and commenced in fi ne fashion to take the lead at quarter time by 3 goals. Banyule threw everything at the Blacks, however whilst the Blacks didn’t have it all their own way in the second half, they proved to be too strong, winning comfortably in the conditions, 10.6 to 6.10. Best: Moff att, M Kempton, Middleton, Savige (4) (UB) and Cantwell, Lorenzini (4), Wilmore, N Taylor (Ban).


The talented St Kevins Old Boys’ team in D Grade were outright favourites and although winning out at Williamstown, were made to earn it in their 16.12 to 9.20 win. Sheedy, Mulcahy and Terzini were best for SKOBS and Griffi ths, Featherston and Harry for Williamstown.

In E Grade the match of the day was St Mary’s v Glenhuntly but the ‘Hunters’ made light work of it (20.18 to 9.15) as Thomas, Halpin, Raff erty and Miller (5) stood out for the winners, Stewart, Stone and Ymer gave their all for the Saints.


There were a number of ‘double centurians’ in this round – Greg (Les) Horton for Old Camberwell, Peter Ferguson at Fawkner, Kelvin ‘Lizard’ Leiper

achieved the milestone at Thomastown and Fawkner produced a second player to play 200 in Jeff Stewart.


In Junior Section 2, Parkside (1st) and Geelong (4th) had a terrifi c battle. After Parkside opened up an early lead, the boys from Corio came right back to lead by 67 points at half time. The second half produced some thrilling football but in the end, the ‘Red Devils’ hung on by 5 points at the fi nal siren. Best: Skalitisis, Simpson (3), Tanner and Bourke (Park); Barrow, Friend, Silver and Leeds (3) (Geel).


It was becoming a habit in A Grade as once again, four of the top fi ve teams were defeated and as a result, Collegians replaced MHSOB in the top four. There was only one Junior section and the leading teams were MHSOB 56, Old Scotch 52, University 48, Ivanhoe 44, Alphington 44 and Hampton Scouts 40.


Parkside remained undefeated in C Section and showed their superiority with a resounding win over Elsternwick (3rd) 18.16 to 3.15. Balwyn made sure of 3rd spot with a good win over Malvern (5th) 9.14 to 8.9.

A Hawthorn player was reported for abusing and striking an umpire! Guilty of the fi rst charge, he was given 6 weeks for the abuse, fortunately for the player he was found not guilty of striking the ump! Imagine what he would have copped given the 6 weeks for abuse!


A former Old Scotch Collegian, Cr. Baron Marks, presented a gold medal, suitably inscribed, to the mercurial Bill Pearson, the Old Scotch champion, for kicking 30 goals in the previous round (yes, 30 majors) against Brunswick in A Section! Pearson was an outstanding all-round sportsman who also kicked 24 against Uni Blacks! His record in amateur football was remarkable. He won the A Section goal-kicking in fi ve of six seasons from 1932 to 1937 and in those fi ve seasons he kicked 126, 220, 138, 121 and 155. Needless to say, Old Scotch won four consecutive A Section fl ags in the early 1930s! Bill was also an outstanding District cricketer with State honours.

RETR

OSPE

CTIV

E


SUPPORTS

MUSCLE GROWTH& RECOVERY

AIDS FOCUS &CONCENTRATION

ELECTROLYTEREPLACEMENT

<1g OF SUGAR PER SERVE

1g OF CARBS PER SERVE


MEG

T UN

DER

19

MEGT U19 Premier with John Donohoe @jdonohoe12

St Bernards continued their

rich vein of form with a 17 goal

demolition of Old Scotch in

Essendon. Five Bernards goals

to the Cardinals none gave

the Snowdogs a decent buff er

and they were never headed from there. Vague

kicked 4, and O’Halloran 3 and he was named

best. Daggian kicked the only 2 goals for Old

Scotch. Old Xaverians took on Old Melburnians

for the fourth time this season and this large win

for Xavs was much the same as the previous ones.

Jeremey Hannan was the catalyst with 11 goals

in the 210 point rout. Silk got 4 of his own and

classy ball user Luke Barry was outstanding with

3 goals. St Kevin’s hosted Beaumaris and a 5.2 to

2.5 fi rst quarter to the home side was the start

they were after. Doggett (3) and Massey, Lewin

and Quinlan all with 2 were instrumental in the

103-55 win for the home side. Burke, Hudson

and Kelly kicked 2 each but it wasn’t enough

with Kelly and Ryan Beauy’s best. De La won

their second game in a row against the depleted

St Bedes/Mentone, with Howard kicking 3 and

Vawser, McGaw, Martinez and Gava all kicking

2. Dumbelton and Halliday were outstanding for

the home side. Hoy was a shining light for the

Tigers in the loss though booting 3 goals.

U19 Section 2 Report @LewisEmmerson

Parkdale’s 55-point win over Caulfi eld Grammarians means the Vultures are sitting in the four. Parkdale are fl ying home and should be considered a real premiership contender

as Kane Bode was a rock in defence for the Vultures. Whitefriars produced a commanding 72-point victory over Old Brighton, Ciaran Hickey instrumental in his side’s victory. Brighton’s Jack Rutter kicked two thirds of his side’s goal tally, unfortunately, that amounted to only 2 goals. In a low-scoring aff air, both sides were wayward in front of goal as Mazenod came away with a

21-point win over Collegians. Peter Rozanitis

kicked 3 for the Nodders. Collegians’ James Edward

Emmett among his side’s best. Uni Blues can

breathe a sigh of relief after their narrow 3-point

win over Uni Blacks. A loss for the Blues would have

compromised their standing within the four; in a

desperate last quarter they were able to hold off

a fast fi nishing Blacks. It was a shootout at either

end between Daniel Batarilo of Blues (4) and John

Vrodos of Blacks (5). Fitzroy’s slide continues with

their 76-point loss to top-placed Old Trinity. The

loss sees the Roys drop to fi fth position. Trinity’s

Alex Polidoros was prolifi c with 6 goals.

U19 Section 3 with Tom Connolly @tomconnolly15

The sun was shining on

Saturday afternoon and all

teams would have enjoyed

playing in the dry conditions

considering what had

transpired in the preceding 12

hours. Old Xaverians played Old Camberwell and

took the 4 points by two straight kicks in a tight

aff air. Old Xaverians led all day and were just too

strong, as Bosner kicked 4 goals for the day. In

what you could say was the game of the round,

Marcellin played Williamstown CYMS and it was

Marcellin away from home that won by 14 points

as Di Roberto for the Eagles kicked 4 goals and

was best on ground. There was a late charge by

the CY’s, but it was all left too late. In another tight

clash, Old Carey took on St Mary’s Salesian and

just won by 8 points, as Old Carey’s Nixon kicked

4 goals and Schipper kicked 3 and Curwood was

best on ground for the Saints. It wasn’t enough

for St Mary’s Salesian who were left agonisingly

short of just their second win of the season. Old

Ivanhoe ran over the top of the AJAX by 25 points.

AJAX led by 8 points at 3 quarter time but in the

last quarter, Old Ivanhoe were just too strong and

kicked 6 goals to 1 to win.

Read the full MEGT U19 Premier report on the VAFA iPad App – Available at the App store


U19 North Anna O’Donnell @annaod_

La Trobe Uni just got up over Whitefriars, in a low scoring match, it was the Uni’s inaccurate kicking that saw them with enough scoring shots to win by just two

points despite kicking less goals. It was another heartbreaker for Whitefriars, they still search for that elusive victory.

Ivanhoe beat Therry Penola by 19 points, the Hoes’ were in control of the game and on top the entire four terms. Aments, Cochrane and Ioannou worked well for Ivanhoe, allowing them to keep their reign at the top of the table. Banyule

had a 28 point win over PEGS, putting them just

inside the top four. Christou and Kerrison were

Banyule’s best for the day, helping contribute to

a handy win that keeps their fi nals hopes in tact.

Yarra Valley fought back valiantly after trailing St

Bernards by 23 points in the fi rst term, but were

unable to get the points. St Bernards got up by 5

points, placing them well inside the top four, on

equal points with Wyndham Suns. The loss all but

ended the Bushrangers fi nals hopes. Wyndham

Suns grabbed a comfortable victory over

Northern Blues, both Galley and Gallina kicked

four goals for the day, whilst teammates Bean and

Dineen were the best performers for the Suns.

U19 South with Anna O’Donnell @annaod_

Monash Blues grabbed an easy 81 point win over MHSOB, Blues did not allow MHSOB to kick a goal until the fi nal term. Hogan kicked fi ve of the 17 goals for Monash, and was one

of their best along with teammates Brimacombe and Thomas, who worked well. Benoiton slotted eight goals for Oakleigh, contributing to an 80 point win over Beaumaris. The loss sees the Sharks sit a game outside the four. Oakleigh’s win has them equal top with Ormond, though the Krushers lead the way on percentage. De La Salle had a convincing win over Old Haileybury,

winning by 104 points. Old Haileybury struggled as they only managed three goals for the day. It was Lee who kicked six goals for the De La, in a win that has placed them comfortably inside the four. Hampton Rovers managed a 21-point victory over Peninsula, despite a late charge in the fi nal quarter by the Pirates. Roberston and Daley were Hampton’s best for the day, as they made good contributions to help the team get the points. Rovers sit in fourth, with Beaumaris not far behind. Ormond had an enforced bye as Collegians forfeited their match. With three games to go, only Beauy can sneak in but they would require a slip up from Rovers.

MEGT UNDER 19 Premier (YEARS TOTAL 51/85%)

Old Melburnians v St Bernards

St Bedes/Mentone v St Kevins

Old Scotch v De La Salle

Old Xaverians v Beaumaris

UNDER 19 Section 2 (YEARS TOTAL 55/73%)

Parkdale Vultures v University Blues

Whitefriars v Old Trinity

Fitzroy v Mazenod

University Blacks v Caulfi eld Grammarians

Collegians v Old Brighton

UNDER 19 Section 3 (YEARS TOTAL 46/72%)

Old Xaverians v St Mary’s Salesian

Old Carey v Old Camberwell

Williamstown CYMS v Old Ivanhoe

Marcellin v AJAX

UNDER 19 South (YEARS TOTAL 50/67%)

Hampton Rovers v Collegians

Ormond v Old Haileyburians

Oakleigh v MHSOB

Monash Blues v De La Salle

Peninsula v Beaumaris

UNDER 19 North (YEARS TOTAL 48/67)

La Trobe Uni v Yarra Valley

Whitefriars v Wyndham

Ivanhoe v Banyule

Therry Penola v St Bernards

PEGS v Northern Blues


RESULTS UN

DER

19 MEGT U19 Premier

De La Salle 5.3, 10.5, 12.10, 17.17 (119)St Bedes / Mentone Tigers 0.1, 3.2, 4.2, 6.4 (40) GOALS, De La Salle: J. Howard 3, M. Martinez 2, J. Gava 2, S. Vawser 2, J. McGAW 2, J. Cooke 1, M. Dumbleton 1, J. O’Sullivan 1, A. Wheatley 1, S. McGraw 1, W. Mackie 1 St Bedes / Mentone Tigers: M. Hoy 3, A. Watterson 1, J. Green 1, C. Michaud 1BEST, De La Salle: M. Dumbleton, N. Halliday, H. Ramsay, S. McGraw, J. Gava, J. Howard St Bedes / Mentone Tigers: M. Hoy, J. Beddoe, A. Watterson, M. Millwood, J. Millwood, B. Hubeek

Old Xaverians 5.3, 14.7, 22.9, 33.18 (216)Old Melburnians 0.0, 0.0, 0.0, 1.0 (6)GOALS, Old Xaverians: J. Hannan 11, O. Silk 4, T. Vander Haar 3, L. Barry 3, C. Stratford 3, M. Hess 2, T. Harrison 2, L. Tobin 1, B. Polkinghorn 1, A. Cannon 1, T. Wynne 1, J. Buff on 1 Old Melburnians: T. Scott 1BEST, Old Xaverians: J. Hannan, T. Harrison, L. Barry, T. Anderson, H. Sleeman, C. Stratford Old Melburnians: S. Clarke, R. Alstergren, J. Baring, A. Hurley, S. Madsen, A. Kleiman

St Bernards 5.4, 10.8, 14.15, 19.23 (137)Old Scotch 0.0, 0.1, 1.3, 2.4 (16)GOALS, St Bernards: C. Vague 4, Z. O’Halloran 3, J. Riley 2, T. Delzoppo 2, E. Sibbald 2, J. Carey 1, G. Zoccali 1, C. Hughes 1, H. Wade 1, R. Woods 1, E. Connelly 1 Old Scotch: J. Daggian 2BEST, St Bernards: Z. O’Halloran, C. Hughes, W. Considine, J. Hedley, T. Riley, E. Connelly Old Scotch: H. Harms, W. Michael, C. Melville, J. Hunt, E. Dalton, H. McCallum

St Kevins 5.2, 9.7, 12.8, 15.13 (103)Beaumaris 2.5, 4.5, 8.6, 8.7 (55)GOALS, St Kevins: J. Doggett 3, T. Massey 2, T. Quinlan 2, S. Lewin 2, L. Sabato 1, T. Sullivan 1, T. Corboy 1, D. Lattanzio 1, J. Canterbury 1, J. Tighe 1 Beaumaris: S. Burke 2, B. Hudson 2, D. Kelly 2, R. Keating 1, S. Gibbins 1BEST, St Kevins: T. Sullivan, T. Massey, J. Tighe, R. Stagg, N. Meehan, L. Sabato Beaumaris: D. Kelly, R. Ryan, D. Johns, A. Nohel, B. Hudson, R. Keating

Under 19 Section 2

Parkdale Vultures 3.1, 7.2, 12.3, 16.8 (104)Caulfi eld Grammarians 1.5, 3.6, 5.6, 6.13 (49)GOALS, Parkdale Vultures: L. Ellis 4, J. Francis 3, M. Dickie 2, A. Sivell 1, W. McGowan 1, C. Peele 1, R. O’Leary 1, J. Andrews 1, J. Everest 1, L. Jenkins 1Caulfi eld Grammarians: J. Brand 3, Z. Amos 2, J. Stewart 1BEST, Parkdale Vultures: K. Bode, L. Ellis, C. Peele, J. Francis, K. Love-Linay, A. CaprionCaulfi eld Grammarians: J. Stewart, J. Brand, L. Topp, B. Green, L. Matte, J. Anderson

Mazenod 2.5, 2.10, 4.11, 6.11 (47)Collegians 0.0, 1.1, 2.5, 3.8 (26)GOALS, Mazenod: P. Rozanitis 3, M. Acciarito 1, D. Fowler 1, J. Walton 1 Collegians: L. Walsh 1, C. Richards 1, J. Kyroussis 1BEST, Mazenod: N. Peck, F. Palleschi, J. Walton, D. Smith, P. Rozanitis, T. Odrowaz Collegians: J. Emmett, F. Sullivan, C. Richards, J. Kyroussis, E. Rice, M. Irvine

Whitefriars 4.3, 7.5, 10.7, 14.13 (97)Old Brighton 2.3, 2.4, 2.4, 3.7 (25)GOALS, Whitefriars: R. Malt 3, T. Petts 2, L. Tuke 2, C. Hickey 2, N. Mercuri 2, H. Murray 1, N. Hee 1, J. Spencer 1Old Brighton: J. Rutter 2, G. Kimpton-Moss 1BEST, Whitefriars: C. Hickey, N. Hee, T. Nilsson, T. Petts, N. Mercuri, D. Mendes Old Brighton: A. Andrews, J. Bilu, P. Chantzos, A. Grant, G. Kimpton-Moss, H. Vulcan

Old Trinity 4.5, 8.7, 14.8, 16.14 (110)Fitzroy 0.1, 2.4, 2.6, 4.10 (34)GOALS, Old Trinity: A. Polidoros 6, D. Moore 3, C. Manoussakis 3, H. Aikman 2, J. Nitsopoulos 1, D. White 1Fitzroy: L. Edwards 2, J. Hill 1, B. McDonald 1BEST, Old Trinity: D. Moore, A. Polidoros, H. Aikman, N. Valkanis, S. Emerson, J. Cooper Fitzroy: N. Ligris, N. Gibbons, T. Robinson, B. McDonald, J. Hill, L. Grace

University Blues 6.2, 7.4, 8.6, 9.11 (65)University Blacks 1.2, 3.4, 5.11, 8.14 (62)GOALS, University Blues: D. Batarilo 4, A. Adams 2, T.

Hodge 1, W. Blakey 1, S. Walsh 1University Blacks: J. Vrodos 5, Z. Harris 1, H. Clarkson 1, A. Horton 1BEST, University Blues: D. Cumming, D. Batarilo, S. Walsh, T. Hodge, J. Cross, A. AdamsUniversity Blacks: J. Vrodos, A. Horton, J. Hill, S. Goulding, J. Moff att, J. Grant

Under 19 Section 3

Old Xaverians 1.0, 3.3, 6.3, 9.3 (57)Old Camberwell 1.4, 2.7, 5.7, 6.9 (45)GOALS, Old Xaverians: L. Bosnar 4, D. Nash 3, H. Denton 1, P. Darrer 1Old Camberwell: J. Bruce 1, B. Frattin 1, M. Bromell 1, F. Wells 1, A. Parker 1BEST, Old Xaverians: P. Darrer, H. Denton, J. Norman, D. Nash, N. Sestan, G. SmartOld Camberwell: F. Wells, M. Bromell, J. Mascitelli, R. Vienet, J. Wilson

Old Ivanhoe 3.3, 6.5, 8.11, 14.15 (99)AJAX 2.2, 7.4, 10.7, 11.8 (74)GOALS, Old Ivanhoe: T. Crouch 5, N. Christo 2, D. Pierri 2, A. Meikle 2, F. Portella 1, A. Bacskos 1, N. Ligdopoulos 1AJAX: T. Rogers 2, B. Joel 2, B. Shapiro 1, J. Sackville 1, B. De Winter 1, J. Berkowitz 1, Y. Saltzman 1, J. Goldberg 1, B. Schwartz 1BEST, Old Ivanhoe: J. O’Kane, C. Jowett, J. Stanton, A. Bacskos, S. Tsanoudakis, A. MeikleAJAX: J. Berkowitz, B. De Winter, A. Fetter, S. Lustig, J. Sackville, M. Voinsky

Old Carey 3.1, 5.4, 8.8, 10.13 (73)St Mary’s Salesian 6.0, 6.2, 9.3, 10.5 (65)GOALS, Old Carey: M. Nixon 4, J. Harris 2, J. Gaff 2, C. Wallace 1, C. Cameron 1St Mary’s Salesian: D. Schipper 3, J. Dragonetti 2, N. Bussell 2, M. Kinsella 1, D. Ryan 1, W. Douglas 1BEST, Old Carey: C. Wallace, K. Rodenberg, J. Harris, P. Akec, J. Ryan, N. AndrewsSt Mary’s Salesian: J. Curwood, M. Baum, C. Angley, H. Morris, M. Howard, C. O’Bryan

Marcellin 2.4, 6.7, 8.8, 9.10 (64)Williamstown CYMS 1.2, 2.6, 4.10, 6.14 (50)GOALS, Marcellin: R. Di Roberto 4, J. Robertson 2, M. Mazzone 1, M. Jones 1, J. Bolzonello 1Williamstown CYMS: M. Parkinson 2, M. Barnes 1, M. Christakakis 1, J. Connolly 1, B. Deller 1BEST, Marcellin: R. Di Roberto, L. MacKie, J. Dimattina, J. Hesse, J. Robertson, P. LunnWilliamstown CYMS: T. Gill, J. Goetz, J. Eccles, S. Raunik, M. Morris, J. Dawson

Under 19 North

La Trobe University 0.2, 2.4, 4.9, 4.11 (35)Whitefriars 2.1, 2.1, 3.2, 5.3 (33)GOALS, La Trobe University: P. Carroll 1, J. Webb 1, C. Toomey 1, B. Hoff man 1Whitefriars: H. Murray 2, T. Baker 1, J. Hardiman 1, D. Jacotine 1BEST, La Trobe University: J. Salau, J. Millen, R. Nolan, S. Neville, B. Hoff man, J. KeillerWhitefriars: L. Morris, N. Adam, T. Battista, T. Condon, M. Coen, J. Morais

Ivanhoe 2.2, 5.2, 7.4, 8.6 (54)Therry Penola 1.2, 3.2, 4.2, 5.5 (35)GOALS, Ivanhoe: B. McGregor 3, J. Scardamaglia 1, J. Lagreca 1, W. Emerson 1, M. Rees 1, L. Jacob 1Therry Penola: A. McIntyre 1, S. Tatlock 1, S. Calafi ore 1, M. Jacobson 1, S. Rees 1BEST, Ivanhoe: M. Amenta, M. Cochrane, D. IoannouTherry Penola: S. Rees, S. Calafi ore, H. Donohoe, J. Keenan, A. Mudgway, C. Evans

Banyule 3.4, 7.8, 8.10, 11.14 (80)P E G S 1.1, 2.5, 6.8, 7.10 (52)GOALS, Banyule: M. MacDonald 3, J. Esposito 1, J. Clarke 1, J. Hart 1, J. Lowe 1, M. Barnes 1, L. James 1, D. Wells 1,

R. Brown 1P E G S: A. O’Raff erty 2, J. Condon 1, M. Barton 1, J. Vovos 1, G. Stubbs 1, H. Weerasooriya 1BEST, Banyule: N. Christou, M. Kerrison , J. Lowe, L. James, A. Fleskens, L. BalcombeP E G S: L. Zammit, M. Barton, S. Prasad, A. O’Raff erty, W. Odgers, T. Mules

St Bernards 6.4, 8.6, 11.7, 14.10 (94)Yarra Valley 2.5, 7.5, 11.7, 13.11 (89)GOALS, St Bernards: J. Sullivan 4, B. Ronke 2, J. Firth 2, J. Notaro 2, P. Comerford 2, M. Farrant 1, C. Denahy 1Yarra Valley: B. Lee 5, J. Gleeson 2, C. Kassabis 1, J. Gray 1, M. Hatton 1, D. Hawking 1, C. Mitchell 1, O. Bolt 1BEST, St Bernards: A. Crocitti, M. Farrant, D. Douge, J. Oruba, W. Isaacs, F. McNicolYarra Valley: B. Lee, R. Chipman, M. Hatton, N. MacLennan, W. Elsworth, N. Stedman

Wyndham Suns 5.1, 9.3, 13.8, 17.12 (114)Northern Blues 0.2, 1.2, 2.4, 4.7 (31)GOALS, Wyndham Suns: A. Gallina 4, T. Galley 4, A. Galati 2, B. Wilson 2, H. Iannacone 2, J. Stephens 1, S. Nahyna 1, D. Bean 1Northern Blues: N. Petkopoulos 1, C. Useinov 1, P. Steinicke 1, T. Evans 1BEST, Wyndham Suns: D. Bean, J. Dineen, H. Iannacone, A. Gallina, T. Galley, A. GalatiNorthern Blues: T. Evans, J. Hamilton, T. Smith, E. Mitchell, L. Natoli, A. Mohamed

Under 19 South

Monash Blues 6.2, 11.4, 14.5, 17.6 (108)MHSOB 0.2, 0.3, 0.6, 3.9 (27)GOALS, Monash Blues: W. Hogan 5, J. Lawson 3, P. Mulcahy 2, C. Oppy 2, S. Cresser 1, P. Brimacombe 1, T. Berenyi 1, G. Adlam-Hunt 1, A. Fitzgerald 1MHSOB: B. Cook 1, G. Crampton 1, J. Ah-kan 1BEST, Monash Blues: P. Brimacombe, L. Thomas, W. Hogan, S. Cresser, G. Adlam-Hunt, P. MulcahyMHSOB: S. Babb, G. Crampton, S. Shearer, J. Ah-kan , B. Cook, J. McDonagh

Oakleigh 5.6, 8.6, 13.10, 19.11 (125)Beaumaris 1.1, 5.3, 5.4, 6.9 (45)GOALS, Oakleigh: J. Benoiton 8, N. Di Cioccio 3, J. Lever 2, S. Bhanwal 2, J. Cook 1, L. Pappon 1, A. Malhotra 1, A. Malhotra 1Beaumaris: N. Griffi n 2, N. Lapa 1, T. Woods 1, L. Cox 1, S. Chamberlain 1BEST, Oakleigh: J. Benoiton, S. Bhanwal, N. Di Cioccio, M. Tate, L. Pappon, J. CookBeaumaris: K. Jensen, A. Tanzimat, C. Griffi ths, H. Goodman, N. Griffi n, T. RichardsOrmond won by foreit.

De La Salle 6.2, 10.5, 13.6, 20.9 (129)Old Haileybury 1.1, 1.2, 2.3, 3.7 (25)GOALS, De La Salle: M. Lee 6, D. Marchese 2, M. Howard 2, M. Mullaly 2, D. Kelly 1, J. Cox 1, T. Still 1, O. Milner 1, D. Cowan 1, C. Akritidis 1, W. Agar 1, J. Dennehy 1Old Haileybury: A. Toy 2, C. White 1BEST, De La Salle: D. Marchese, M. Lee, L. Carracher, T. Still, M. Mullaly, M. LaoumtzisOld Haileybury: S. MacPHERSON, J. Mantell, Z. Tsinanis, B. O’Leary, N. Tabe, W. Meehan

Hampton Rovers 2.2, 4.3, 6.7, 9.8 (62)Peninsula 0.1, 2.4, 3.4, 6.5 (41)GOALS, Hampton Rovers: M. Robertson 2, S. Care 2, C. Jones 2, C. Clarke 1, J. Bryant 1, R. Fogarty 1Peninsula: B. Worn 3, J. Anthony 1, S. Harrison 1, J. Johnson 1BEST, Hampton Rovers: M. Robertson, J. Daley, D. Broadstock, J. Benjamin, C. Cullis, J. CampionPeninsula: J. Moignard, S. Barbour, T. Malan, T. Taylor, B. Worn, M. Forsyth


Old XaveriansCoach: Peter Callinan

Assistants: Nick Ferrari

1 Chris Turner2 Tom Harrison3 Matthew Merlo4 Daniel Hachem (VC)5 Tom Anderson6 Charlie Stratford7 Michael Henderson (C)8 Oscar Silk9 Callil Peter9 Charlie Wilson10 Jonny Benson11 Rupert Condon12 Paddy Nunan13 Hugo Denton13 Michael Stanley14 Fletcher Nugent15 Jeremy Hannan16 Nick Prowse17 Todd Vander Haar18 Liam Tobin19 harry Bales20 Richard Wilton22 James Midgley23 David Nash26 Jack Buffon27 Lucas O’Sullivan28 Andy Cannon31 Harry Sleeman52 Lachie Wright

De La SalleCoach: Simon Brown

Assistants: Anthony Hale

1 James Howard2 Charlie Haley3 Harry Zaia6 Ollie Purton-Smith7 William Kanz8 Sefton McGraw9 Liam Feather10 Tim Shallue11 Luke Gogis12 Matthew Hogan13 Adrian Indovino15 Pat Hatch16 Liam Wood17 Matthew Harvey18 Xavier Leonard19 Jack Gava21 Darcy Craig22 Pat Arceri23 Jordan Bull24 Matthew Dumbleton25 Nicholas Halliday26 Joey Cox28 Sam Harrington29 Kobi Wallis32 Hamish Ramsey34 Joel Mattiske38 Jack Hanley42 Joel Stewart45 Dominic Spicer48 Ashley Munday49 Daniel Anastasio51 Hamish Curtis52 Aaron Hay54 Damon Grant

St Bernard’sCoach: Rocky Iannello

Assistants: Serge Ramano

1 Chris Hughes2 Mitch Hughes3 Pat Romano4 Sam Woods5 Jed Carey6 Charlie Vague7 Stefan Piantella8 Tim Rose9 Tom Delzoppo10 Marcus De Leur11 Giacomo Zoccali12 Jack Holland13 Will Considine14 James Riley15 Joshua Hedley16 Darren Colaco17 Anthony Dillon18 Claude Issa19 Michael Caven20 Harrison Wade21 Edyn Sibbald22 Zac O’ Halloran23 Tom Riley (Capt)24 Jeremy Sullivan25 Nicholas Larkin26 Daniel Parkes27 Edward Connelly28 Joshua Turville29 Sean O’Keefe30 Jayden Foster31 Benjamin Ronke35 Tom Saundry

St Bedes/Mentone TigersCoach: Rick Caratello

Assistants: Ray Clark, Brad Berry

1 Pat Hurst2 Jonathon Dawes3 Johnny Cayhun4 Cory Michaud5 Sam Upton6 Alec Shaw7 Maxwell Millwood8 Jack Eldred9 Jayden Clark10 Steven Lay11 Jack Vawdrey12 Kieran Arthur13 Jake Beddoe14 Matthew Caia (Capt)15 Mitchell Johnstone16 Reagan Maddaford17 Jackson Millwood18 William Dutt19 Adam Heatley20 Joshua Green21 Ben Hubeek22 Liam Smithers23 Dale McArthur24 Andrew Watterson25 Robert Iudica26 Samuel Barca27 Thomas Chesters28 Darcy James76 Jordan Pastura

SPONSORS

Clear Cut Hairdressing Mentone

Bendigo Bank Parkdale Branch

Buxton Real Estate Mentone

Old MelburniansCoach: James Ray

Assistants: Guss Murray

1 Max Gibson2 Jack Lidgett3 Ritesh Varma (VC)4 Louis Raymond5 Nick Churkovich (C)6 Charlie Nettlefold7 Chris Barry8 Will Leveni9 Nick McLardy10 Will Heggen11 Hamish Baillieu12 Harry Smith13 Robbie Hayward14 Jack Kelly15 Will Bate16 David Parkinson17 Chris Lam18 James Fink19 Alex Hamer20 Lachlan Prendergast (VC)21 Stuart Watson22 Oscar Hosking23 Ollie Madders24 Guy Shearman26 Nicholas Bennison27 Jordan Cutter28 Charles May29 Matt Panton30 Sam Brand31 Alex Quirk32 Adam Borensztajn33 Nick Benson34 Andy Spargo35 Charlie Paine36 Ruari Wood-Freeman38 Darcy Coombs40 Peter Feaver

MEGT U19 – PREMIER

Old ScotchCoach: Steve Reddish

1 Julian Beard2 Nick Balson3 Alex Brkic4 Dom McDermott (Co-Capt)5 Hamish Dennis6 Ed Gillies7 Brett Borland8 Nick Mursell9 Harry McCallum10 Lewis Parisi11 Jonathon Leggo12 Gus McDonough13 Jock McKinnon14 Will Michael (VC)15 Kris Paltoglou16 John McLellan17 Richard Meadows18 Ed Dalton19 Cameron Melville20 Mitchell Pert21 Henry Harms22 Jono Daggian24 Mitch Nikolovski25 Daley Mackenzie (Co-Capt)26 Tom Peers- Barlow28 Josh Gordon29 James Hunt30 James Voltscos31 Tom Streat33 Tom Beddison (VC)34 Sam Hatty36 Chris Rosengarten37 Blood jumper38 Blood jumper39 Blood jumper40 Patrick Hamilton41 Gordon Ryan42 Jack McIntosh44 Ed von Moger46 Will Hays47 Blood jumper48 Charlie Worrell-Smith

BeaumarisCoach: Carty Mick

1 Matthew Williams1 Gibbons Sam2 Johns Damien3 Zagni Matt5 Lovejoy Matt6 Pierce Rhys7 Smout Alex13 Douglass Todd16 Gabron-Uhe Jack17 Kelly Drew18 Watson Andrew19 Dickson Ben20 Beattie-Powell Cal22 Woodward Tom26 Williams Matt27 Smith Jordan28 Ryan Richard30 Cusack Cal31 Carcassi James33 Crowe Daniel34 Pace Cameron35 Keating Ryan40 Atkins Dylan43 Hudson Ben48 Aridas Athan

St Kevin’sCo-Coaches: Tom Purcell, Timothy Sim

1 Luke Sabato2 Mitchell Smart3 Noah Armato4 Harrison Snell5 Samuel Holland6 Mark Spence6 James Spencer7 Daniel Dicintio8 Matthew Roberts12 William Ostrowsky13 Nicholas Fletcher14 Luke Peric15 Thomas Corboy16 Samuel Doyle18 Nicholas Brown19 Jay Canterbury21 Roland De Biase22 James Tighe24 Roland Stagg26 Joff Mithen27 Jacob Edginton28 Joshua Doggett30 Sam Lewin31 Daniel Lattanzio32 Thomas Vanderslik33 Thomas Sullivan35 Xavier Siebel37 Thomas Quinlan40 Jay Haydon42 Thomas Massey49 Oliver Gabelich52 Joshua Dunne53 Max Mercuri55 Matthew Knight59 Michael Turnbull61 Vince Newton63 Harry Kerr64 Henry Shaw66 Daniel Giannini80 Thomas Corboy90 Nicholas Meehan Scott Kaiser Thomas Peyton Michael Smith Thomas Stephenson Conor Utri


FitzroyCoach: Bruce Edwards

1 Will Zaghis2 Sam Dalton3 Luke Edwards4 Stephano Calabro4 Tom Robinson5 James Bluer6 Angelo Garcia7 Mica Worthington8 George Bountris9 Zac Hancock10 Nathan Ligris11 Connor Breheny12 Ben Caplikas13 Isaac Wattis14 Max Davie15 Jacob Fraser16 Joe Hill18 Otto Ishak19 Pep Gascoigne20 Jules Meltzer21 Martin Deasey22 Dom Golding 23 Lachy Grace24 Nick Harding25 Sam Lynch26 Andrew Indian Manning27 Sam Gill28 Nick McMahon29 Finn Kinsella30 Aiden Tregillis31 Jacob McCormack32 Aiden Lambert33 Nathan Fillieri34 Harrison Leech35 Ben McDonald36 Dylan Vella Horne37 Daniel O’Brien38 Lewis Pavlich39 Charlie Phillips50 Harry Dorrat Thorpe

WhitefriarsCoach: Jeremy Freeman

Assistants: Dave Kelsey, Dick Baker

1 Mitchell Malt3 Sean Currie5 Tom Lewis6 Jonathan Deller7 Toby Mcgurgan8 Ciaran Hickey9 Ryan Malt10 Tim Nilsson11 Luke Galtieri12 Nicholas Adam13 Nicholas Hee14 Daniel Nilsson16 Declan Power17 Hewitt Murray18 Matthew Gasowski19 Jason Spencer20 Damian Jacotine21 Jack Hardy22 Bryan Dinh23 Lachlan Tuke24 Anthony Giuliano25 Timothy (Capt) Petts26 Daniel De Angelis27 Matthew Perrin28 Ben Kelsey29 Tom Gastin30 Taylor Battista31 Tomas Condon32 Glenn Ibbott33 Benjamin Tatterson34 Nic Mercuri35 Angus Hands36 Jackson Byrne37 Luke Sandy38 Matthew Ciardulli

Caulfield GrammariansCoach: Brett Sinclair

Assistants: Simon Widjaja, Mark Liddell

1 Charlie Logan2 James Small3 Matthew Gould4 Lachlan Topp5 Tom Silvestro6 Michael Bowden7 George Tselios8 Daniel Meddings9 Harrison Mills10 Ben Green11 Tim Mollard12 Chris Bold13 Lachlan Holmes14 Daniel Goldberg15 Kosmo Malignaggi16 Josh Steiger17 Khan Oxenham18 Kirren Ponniah19 Jack Scott20 Lewis Matte21 Lachlan Gallop23 Tom Jordan24 John Nankervis25 Liam De Nardis26 Max Judd27 Matthew Baer28 John Szetho29 Malcolm Mccurdy30 James Anderson32 Travis Mudra33 Jeremy Anderson34 Joshua Brand35 Jerome Stewart36 James Turner38 Thomas Campbell39 Lucas Grigg40 Zach Tomaino42 Jake Mcloughlin43 Lachlan Rayner44 Zach Amos47 Hugh Mcmahon51 Nic Gould54 Thomas Cameron58 Charlie Cohen60 Darcy Levin67 Jack Edwards

Uni BlacksCoach: TBA

Assistants: TBA

ParkdaleCoach: Luke Borella

Assistants: Ned Harding

1 Kurt Lopo2 Darcy Ballard3 Matthew Dickie4 Kane Bode5 James Everest6 Luke Ellis7 Nathan Papatsanis8 Bailey Dillon9 Jack Edwards10 Jake Stent-Powell12 Corey Peele13 Nathan Ng14 Ryan O’Leary15 Joshua Gray16 William McGowan17 Alexander Taylor-Hirst18 Lyndon Byrnes19 Kye Steegstra20 Craig Sterling21 Dylan Glascott22 Tom Congerton23 Mac O’Donnell46 Kobi Delaney47 Harley Balic50 Jesse Andrews51 James Baker52 Adam Capiron53 William Cross54 Sean De Amicis55 Mitchell Donald56 Corey Fall-Jabonka57 Nicholas Farnbach58 Jack Francis59 Leigh Jenkins60 Patrick Larkin61 Kai Love-Linay62 Matthew McCoy63 Matthew McDonald64 Thomas Rayner65 Kyle Ross66 Jordan Russell67 Ash Sivell68 James Salouris69 Harrison Spencer70 Luke Symons71 Joshua Whelan

University BluesCoach: Jeff Scotland

Assistants: Nathan Green

1 Josh Cross2 Sam Walsh3 Matt Nevett4 Zach Thompson5 Angus Adams6 Tom Hodge7 Will May (DVC)8 Tom Morrison9 Dan Bartarilo10 Matt Hart (Capt)11 Jacob Jess12 Will Blakey13 Fred Harrison14 David Cumming15 Will Langley16 George McFarlane17 Andrew Bartarilo18 Lachie Cameron19 Will Ford21 Jack Reynoldson23 Michael Peart (V-Capt)26 Harrison Sullivan27 Charlie Craig32 Lachie Chomley33 Jack Curnow35 Sam Briggs36 Jack Morgan37 Denis Mooney38 Sean Scotland42 Matt Roche44 Tom Coburn64 Tom Lanyon

Old BrightonCoach: Ryan Joseph

Assistants: Andrew Knight,

Andrew Rutter

1 Ollie Parsons3 Jesse McLean4 Tom Fisher5 Dane Robinson6 Ben Williams7 Ben Middendorp 9 Ciacho Ong10 Jack Knight11 Adam Andrews14 Jack Cowling15 Alex Hargrave16 Tom Boxtel17 James Baimbridge19 Cal Macleod21 Jackson Bilu22 Brandon Harris23 Fred Boxtel25 Marcus Grant26 Sam Campbell28 Michael Lees69 Peter Chantzos

CollegiansCoach: Rob Ferguson, Mark Louis

Assistants: Alan Solomon

1 Tom Danks2 Milo Abeyratne3 Josh Dickinson4 Michael Irvine (VC) 5 Jack Burmeister6s Mitch Newton6 Charlie Richards 7 Matt Singleton7s Rob Jesaveluk8 Linus Walsh9s Sid Marshall9 Nick Holmes10 Fergus Huntington11 Sam Porz12 Zac Burns13s Alex Waddington13 Levi Fernandez14s Dane Wilson14 Harrison Sinclair15 Harry Butterss16 Alex Porz17 Seamus Hobbs (C)18 Matt Mandile19 Alex Cullen20s Rob Jesaveluk20 Michael Gregory21s Chris Kipouridis21 Harry Cattell22 Jake Kyroussis23 Dave Ellinghaus24 Ross Katsambanis25 Jaison Simadri26 Tom Danks27 Jaison Simadri27s Harry Hawkins28s Darcy Regan28 Eden Di Sipio29 James Dunn30 Eddie Rice31 Callum Sinclair32 Calum Wilson33 Jacob Diplaris34 Lachie Cooke35 Todd Campigli36 Jamie Clarke37 Chris Mark38 Mitch Palmer39 Ash Walls41 Seb Mundy42 Alex Barr43 James Emmett44 Jack Harris45 Curtis Collins46 Lachie Borthwick47 Lewis Hentschke49 James Kenyon Smith 50 Max Goodwin 51 Josh Third52 Jaden Douglass53 Harry Wilson55 Griffi n Siassios56 Jai Fernandes- Kemp57 James Widdop58 James Barry60 Freddie Sullivan61 Lochie Peck71 Oscar Pearson91 Rhys Hildebrand-Wise

Old TrinityCoach: Speros Beasley

Assistants: Adam Joyce, Nick Polidoros

1 Danny Land4 Darcy White (VC)5 Jad Khallouf6 Simon Emerson8 Lachlan Aikman11 Hugh Tyson13 Corey Mangos14 Dane Fencaros15 Mac Brown (Co.C)16 Will Cooper17 Nick Roberts18 Andrew Bennett24 Duncan Moore (Co.C)25 Alex Contos26 Sam Joyce 27 Seb Nicolosi28 Christos Manoussakis (VC)29 Tom Kerkvliet30 Alex Gebert32 Anthony Scott33 Mark Yeoman34 James Rogers35 Tom Bennett38 Mitchell Bourke 41 Simon Tselios43 Matt Lasorko44 Nathan Valkanis47 Zac Aarons48 James Spassopoulos58 James Nitsopoulos62 Harry Aikman 66 Alex Polidoros67 Luke Brendish70 Joe Camppbell73 Hugh Boyle74 Nicholas Emery

MazenodCoach: Paul McDonald

Assistants: Guy Ritchie

2 T. Cincotta3 F. Palleschi4 D. Hayes5 J. DiNezza6 M. Acciarito7 P. Cincotta8 J. White9 S. Forster10 A. Carney11 J. Walton12 X. Patti13 D. Smith14 T. Corrie15 T. Odrowaz16 J. Paola17 N. Peck18 C. Grady19 N. Melenhorst20 L. Strudwick23 T. McDonald24 M. Harris25 P. Rozanitis27 D. Fowler29 M. Guiliano

U19 – SECTION 2

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt


Old IvanhoeCoach: Brad Shadbolt

Assistants: Chris Branigan

1 Josh Begeman2 Ross Eckersley3 Alex Bacskos4 AdamMeikle5 Anthony Stenta6 Dominic Inglese7 Tim Fidler8 Niko Ligdopoulos9 Liam Oliver11 Patrick Walsh13 Tyson Deane15 Richard Skok18 Ian Lobo20 Gianni Mancuso21 Jake Erman22 Damian Pierri23 Sam Wilcox24 James Mitchell25 Francesco Portella26 Henry Gibbs27 Nick Christo28 Josh Doherty29 William Gough30 Matthew Broughan31 Nick Marshall32 Nick Horsford3334 James Kandiliotis3536 Tom Kellock37 Chris Jowett38 James O’Kane39 Stephen Tsandoudakis40 Trent Crouch

East Ivanhoe

Old CareyCoach: Michael Tarrant

Assistants: Michael Mitchell

1 Mitchell Nixon2 Tom Bedford3 Jeremy Cator4 Charlie Pentney5 Karsten Rodenberg6 Harry Hill7 Cameron Wallace8 William Wright9 James Gaff10 James Davy11 Callan Ahmling12 Christopher Hill13 Robert Cumming14 Lee Andrianakis15 Nicholas Andrews16 Pier Akec17 Dan O’Connell18 Jack Ryan19 Edward Kerr20 Matt Reddish21 Alister Dickson22 Callum Cameron23 Jack Harris24 Matthew Prentice25 Toby Wooldridge26 Stephan Panagos27 Louis Triandos28 29 Athol Candlsih

Old CamberwellCoach: Michael Ericson

2 M Troy 4 X Troy (C )5 S Boyce 7 A Taverner 12 B Warburton 14 A Halabi 16 A Parker 17 S Powell 19 Z Douglas 22 H Donnellan 23 L Birch 24 B Frattin 26 M Hook 27 B Mann 28 A Bongiorno 29 T Owen 30 H Urwin 32 D Bancroft 33 B Hansford 34 C Lindsey 37 S Clark 38 L Bannister 42 J Drago 51 A Giovannucci (VC)52 P Dennis 59 J Bruce

Williamstown CYMSCoach: Con TerzoglouAssistants: Zac Read

2 John Dawson3 Yuma Hemphill 4 Jackson Pennington 5 Indi Ridout6 Sam McHugh7 Raunik Sam8 Brodie Meadows9 Ethan Tuck10 Jack Connolly11 Mitchell Knight 12 Jacob Martin13 Edward Bordas14 Nicholas Harkins15 Austin Slaney16 Jordan Tripodi17 James Goetz18 Mati Christakakis 19 Tim Ball20 Vincent DiLorenzo21 Brendan Dawson22 Caleb Taylor23 Michael McLaughlin24 Alex Georgiadis25 Matt Barnes26 Jake Slee27 Daniel Fontaine28 Hayden Barnett28 Dali Sulejmani-Blackwell29 Nicholas Ebinger30 Steve Miller30 Ben Deller31 Evan Galerakis32 Jake Muddle33 Jordan Davies34 Luke Micallef35 Tim Farrugia36 Nicholas Green37 Bryson Ford38 Darcy Schwarze40 Tom Gill41 Jack Temby42 Julian Franze43 Charles Bold45 Tim Purves46 Keegan Gilbert47 Matt Morris48 Jonathan Omrcen49 Aiden Miller50 Ali Hamad51 Oliver Becroft52 Luke Goetz54 Darcy Wall58 Liam Cavarra60 Jesse Johnstone

AJAXCoach: Adam Sacks

Assistants: Danny Van Aken

1 Misha Voinsky2 Dylan Dexter3 Aaron Fetter4 Joshua Silver5 Dylan Rothschild (C)6 Jesse Velleman7 Jordan Lipton8 Jarred Grek9 Yoni Saltzman10 Jacob Kingston11 Jarrod Nankin12 Nathan Zielinski13 Ben Michelson14 Jeremy Forbes15 Josh Baron16 Jess Broons17 Justin Berkowitz18 Stephen Lustig19 Orren Chabbat20 Josh Kalmus21 Tom Rogers22 Adam Shapiro23 Ben De Winter24 Joshua Singer25 Joshua Heine26 Jamie Sackville27 Anton Fitt28 Ben Schwarz30 Brent ShapiroSponsors:TeskaCarson

Old MarcellinCoach: TBA

Assistants: TBA

1 Oliver Grant 2 Joshua Edwards3 Mathew Gough4 Jonathan Sammut5 Patrick Hamblin6 James Marazita7 Harry Malos8 Jacob Bolzonello9 Nicholas Giovas10 Marcus Hopkins11 John Nicolaci12 Jeremiah Antypas14 Adam O’Sullivan15 Lachlan MacKie16 Mitchell Jones17 Robert Di Roberto18 Daniel Grosso19 Adrian Bonato 20 Brent De Highden21 Joel Cunningham22 Xavier Burns23 Michael Mazzone24 Michael Mascitti25 Liam Hehir26 Joe Licciardi27 Adrian Beaini29 Chris Lane30 John Dimattina31 Joshua Hesse32 Antony Di Censo33 Joshua James36 Kieran Mahoney38 Tim James41 Patrick Lunn52 James Robertson

U19 – SECTION 3

St Mary’s SalesianCoach: Manny De Bono

Assistants: Jason ReddickNeil Taylor

1 Denereaz Luke2 Dragonetti Jesse4 Monaco Brad5 Gibbs Cambell 7 Williams Rueben8 Ryan Daniel9 Zacharopoulos Danny10 Curwood James11 Grant Darcy12 Newton Jeremy13 Baum Max14 Bussell Nick15 Ife Angus17 Douglas Will 18 Drew Anthony19 Clery Connor21 Brooks Hugh 22 Byrnes Jack24 Howard Michael25 Schipper Dane26 Hutchinson Cory27 Heggie Andrew28 Hanson Tom29 Angley Charlie32 Morrell Ben33 Fly Tom36 Evans Nathan43 nmeiselbach Harry44 Duncan Harley

Old XaveriansCoach: Patrick Kennedy

1 James Agius2 Harry Bales3 Luke Bosnar4 Jack Bueno5 Peter Callil6 Ben Case7 Nicholas Chancellor8 James Cosgrave9 Patrick Darrer10 Hugo Denton11 Harvey Donoghue12 Angus Dunn13 Lachlan Fitzpatrick14 Alex Gazdowicz15 Liam Gostencnik16 William Heath17 Adam Hermans18 James Hicks19 Henry Higgins20 Harry Higgins21 Jack Kelliher22 Fotios Keramitsis23 James McCANN24 Will McClusky25 Thomas McNamara26 Hugh Moodie27 Ben Murphy28 James Norman29 Fletcher Nugent30 Matthew Ongarato31 Theodore Paikopoulos32 Thomas Pepperell33 Jack Pica34 Nicholas Pillon35 Ben Polkinghorn36 Christian Prowse37 Matthew Quinn38 Edward Resic39 Tom Rickard40 Matthew Sharkey41 George Smart42 Josh Smith43 Nathan Sorrenti44 Michael Stanley45 Michael Timlin46 Bart Vaughan47 Lachlan Wright48 Thomas Wynne


IvanhoeCoach: Bill Emerson

Assistants: Leighton Pearce

5 James Lagreca6 William Emerson8 Zac Mowat16 Sam Batterton19 Max Post25 Dylan Treloar28 Daniel Jones31 Nathan Zervides38 Keke Blackmore-Moore39 David Ioannou40 William Cuthbert43 Alex Griffi th47 Cameron Bath54 Mitchell Rees63 Ed Robinson83 Ben McGregor88 James Schaffert Fenian Orsag Liam Kennedy Jake Scardamaglia Michael Vassilou Will Martin Dylan Power

BanyuleCoach: Sam Italia

2 Jayden Esposito3 James Clark4 James Bonello (C)5 Patrick McKinlay7 Dale Rodda (VC)9 Mathew Corcoran10 Matthew Barnes11 Lachlan James12 Mitchell MacDonald13 Mitchell Kerrison14 Jack Hook15 Blake McEntee16 Dale Wells17 Riley Williams18 Marc Centofanti19 Dylan Lester20 Rian Brown23 Ryan Cleaver24 Ryan Lester26 Stephen Mathieson27 Benjamin Stevenson37 Lachlan Pirret40 Rudi Mukumba41 Anthony Domini43 Tom Cowey46 Connor Lennox59 Jonah Clarke60 Nick Christou61 James Lowe64 Thomas Clarke65 Daniel Langford66 Andrew Fleskens67 Sean Tanudtanud

La Trobe UniversityCoach: TBA

PEGSCoach: Frank Troost

1 Anthony Barresi2 Matt Barton3 Ben Caminiti4 Tim Cannan5 Jacob Capovilla6 Reece Centin7 Jack Condon8 Tom Ferris9 Matthew Bergin10 Sam Graf11 Alex Hannah12 Brian Hughes13 Callum Hutchesson14 Stephen Iiistro15 John Karikakas16 Jackson Lanting17 Andrew Lepa18 Lachlan Marr19 Tom Memery20 Jack Mighell21 Theo Miokovic22 Corey Moore23 Tom Mules24 David Mundy25 Toby O’Brien26 Will Odgers27 Aidan O’Rafferty28 Luke Pearce29 Michael Stergioponios30 Grant Stubbs31 Michael Troost32 Jimmy Vovos33 Hashan Weerasooriya34 Luke Zammit

Northern BluesCoach: TBA

Assistants: TBA

U19 – NORTH

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

St BernardsCoach: TBA

9 P. Moloney25 F. Mc Nicol30 A. Mulkearns34 D. Parkes35 M. Farrant36 M. Dillon38 L. Perryman42 T. Devers44 L. Sullivan45 P. Comerford46 J. Firth48 A. Crocitti49 D. Drouge51 J. Oruba52 J. Notaro53 P. O’Sullivan56 M. Satterley57 W. Paszynk58 T. Hanmer59 W. Isaacs55 W. Baird60 J. Gauci61 S. Whelan62 C. Denahy63 J. Jones64 S. Tamraz65 D. Gilbert

WhitefriarsCoach: Ben Bucello

Assistants: Scott McDonough

1 Jon Pisani5 Lachlan Imeneo6 James Battista7 Patrick Moseley9 Sean Maher10 Ashley Hickman11 Jordan Thompson12 Nicholas Adam13 Daniel Chen17 Jordan Morais18 Tom Battista19 Tom Walker20 Thomas Compassi21 Daniel Serrao22 Tom Lewis23 Lachlan Tuke26 Daniel De Angelis27 Adrian Cardamone28 Dean Mendes30 Taylor Battista (Capt)31 Thomas Condon32 Lachlan Morris33 Michael Coen34 Daniel Michael35 James Hardiman36 Callum Maynard

Wyndham SunsCoach: Brad Gilham

1 Habib Ali2 Cody Harkin3 Ash Gallina4 Adam Scarpino5 Blake George6 Hayden Iannaconne (CC)7 Jaiden Dineen (VC)8 Abdullah Mohammed9 Josh Stephens10 Trent Galley11 Brenden Wilson12 Daniel Bean13 Nathan Clarke14 Scott Ryan15 Simon Nahyna16 Andrew Moshoudis17 Aaron Zahra18 Michael Bresnan19 Alex Galati20 Tate Stiles21 Mitch Bourchier23 Angus Holmes24 Harley Tunnicliffe (CC)26 Ash Collins28 Matt Accetta29 Jackson Gathercole30 Jake Millsom

Yarra ValleyCoach: Bart Drew

Assistants: Nick Chipman

1 Nicky MacLennan2 Daniel Hawking3 Nathaniel Johnston4 Jedd Purbrick5 Josh Dobson6 Harry Parkes7 Nick Stedman8 Luke Bacolas9 Will Elsworth10 Cam Mitchell11 Liam Robb12 Mark McMillan14 Daniel Pascoe15 Matthew Killey16 Jake Maher17 Corey Kassabis18 Tyler Smith21 Jeremy Fensome23 Jesse Woolley24 Owen Bolt25 Tom Hancock26 Joel Gleeson29 Jordan Goldsmith30 Damian Rigo31 Rory Chipman32 Chris Fraser36 Mitchell Hatton41 Michael Gazeas37 Brendan Lee68 Josh Gray

Therry PenolaCoach: Mark Hudson

1 Raffaele Liano2 Hamish Donohue3 Anthony Tana4 Jack Twomey5 Lucas Di Vito 6 Sean Rees7 Sean O’Sullivan8 Tom White9 Joel Costello10 Ethan Daley11 Luke Rocca12 Mitchell Keogh13 Luke Marinelli14 Jonathon Tonna15 Brendan Ward16 Aiden McIntyre17 Louis Taylor18 John Humphrey19 Andrew Mudgway22 Phouc Nguyen25 Jared Keenan27 Connor Kilbane28 Brock Egglestone32 George Di Ciero35 Chris Skapetis36 Chris Fiorile70 Michael Jacobson

BIG

V CL

UB L

UNCH

Mark McLure entertains the crowd

Tony Wilson interviews Luke Beveridge Andrew Ramsden


OakleighCoach: Danny Hall

Assistants: Geoff Brereton, Chris

White

3 J Benoiton

4 M Tate

5 B Grizzell

8 A Seremalis

9 J Cook

11 J Lever VC

14 C Pearson

15 T Michael

17 A Weymouth

18 S Ciavarella DVC

20 S Murray C

21 Z Barrett

22 M Aranha

23 L Pappon

24 K Schmauder

25 C Pinney

26 B Weymouth DVC

27 T Nolan

28 J Davidson

30 K Bradley

33 T Perrett

34 R Henderson

36 D Paola

41 AN Malhotra

42 M Ansell

43 S Bhanwal

45 AK Malhotra

52 L Gillard

53 A Deneys

61 A Mezenstaff

70 L Lloyd

Old HaileyburyCoach: TBA

OrmondCoach: David Robbins

Assistants: Robert Putamorsi

1 Daniel Gregg-Mantle2 Cameron Muir3 Matthew Hirschman4 Sam Elliott5 Will Robertshaw6 Richard Main7 Jack McCambley8 Jack Cappichiano9 Tom Putamorsi10 Brodie Todd11 Benjamin Hardwick12 Matthew Jordan13 Adam Schwarz14 Edward Scanlan15 Zac Papacostas16 Jack Meeking17 Liam Adlington18 Myles Neville19 James Rumanovsky20 Nick Halsall22 Marcus LaGreca25 Nick Edwards31 Anthony Strahan33 Cal Carothers35 Nick Curwood37 Lucas Lampos38 Troy Kettle44 Nick Oaten53 Mitchell Price57 Nick Houghton64 Roland Johnson73 Rob Davis74 Josh Smithe75 Isaiah Tahana79 Marlon Kerstens87 Chris Harms

Peninsula Old BoysCoach: Barry Besanko

Assistants: Theo Messinis,

Mark Featherby, Anthony Thripp &

Brian Parton

Runner: Paul Gleeson

1 Jaycob Johnson2 Mitch Glenn3 James Moignard (C)4 Jack Miers5 Tom LaBrooy6 Cal Parton7 Harry Featherby8 Tory Taylor9 Dylan Wilson10 Tom Malan (VC)11 Leon Newton12 Mitch Skaife14 Bryce McLean15 Seb Barbour (VC)17 Josh Watts18 Nelson Felsinger19 Jimmy Sinclair20 Jordan Boak 21 Brandon Warn22 Jason Anthony23 Nick Messinis (C)25 Jeremy Gleeson26 Andrew Hockhegger27 Tom Feldgen (C )28 Alex Stock (VC)29 Ben Ivansevic30 Tom Paterson31 Alex Treherne33 Sam Harrison68 Rory Farrell

BeaumarisCoach: Darren Wadley

2 Mitchell Barber3 Frasier Johns4 Aaron Keating6 Daniel Ladds7 Alex Smout9 Kaine Beasley10 Neil McKenzie11 Adam Tanzimat12 Joshua Davis16 Nick Lapa23 Tom Gregory24 Kyle McDonagh26 Max Aldrich32 Keenan Jensen33 Pat Brooks36 Tyler Rix41 Sam Burke49 Matt Banham53 Brendan Ellul54 Anthony Zanca57 Tom Richards59 Tim Woods61 Jason Murray66 Ned Griffi n

CollegiansCoach: TBA

De La SalleCoach: TBA

Hampton RoversCoach: TBA

MHSOBCoach: Jamie Anderson

1 Sapphire Watkinson

2 Paul Niklas

3 Ben Kuang

4 Jerome Ah-Kan

5 Alex Gleeson

6 Ben Steiner

7 Guy Velik

8 Athan Sgardelis

9 Tony Tran

11 Tom Feeney-Connor

12 Osman Elsouki

13 Tom Scelsi

14 Lllewellyn Ryan

15 Aarish Alinizar

16 Conor Khan

17 Stephen Babb

18 James Ward

21 Sam Shearer

22 Brendan Cook

24 Max Stella

25 Nick Clampett

26 Gibson Crampton

28 Julian Avila

29 Bernie Chen

30 Phil Huynh

32 Jason Pollock

33 Will Penhalluriack

35 James McDonagh

36 James Ness

40 Jayme Lawson

41 Charlie Franklyn

42 Oliver Croad

43 Michael Manteit

44 James Ellison

45 Danny Douros

Monash BluesCoach: James Donnelly

Assistants: Joe Salvatore,

Nicho Salvatore

1 Tim Berenyi2 Lachlan Blackwood3 Mitchell Blair4 Pat Brimacombe5 Lachlan Buck6 Lucas Buncle7 James Chiefalo8 Charles Cosgriff9 Hugh Duffy10 Justin Field11 Andrew Fitzgerald12 Andrew Hawes13 Will Hogan14 Alex Hutcheson15 Thomas Jackson16 Tom Lancaster17 James Lawson18 Toby Leemon19 Harrison Long20 Jason Ly21 Conor Mackle22 Levi McDonald23 Patrick Mulcahy24 Calvin Oppy25 Daniel Quattro26 Jonathan Rutherford27 Nicholas Schade28 Conor Squires29 Fraser Tankel30 Llewellyn Thomas31 Jake Wilson

U19 – SOUTH

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Ian Cordner with Barry Richardson, David Yoff a and Quinton Gleeson

Ingrid Anderson and Rosemary Warssom accepting Duncan Anderson’s induction

Andrew Ramsden


50 SHADES OF MELBOURNE

Melbourne’s weather transitioned rapidly from Friday to game day. Some of the city’s coldest temperatures in a decade were almost forgotten, as icy, wet and windy conditions morphed into footy perfection. The sun was out and undershirts returned to optional status for umpires. Veteran goal umpire Clayton Evans was even overheard asking fellow fl ag-waver, Premier A debutant Guy Hexter, if he’d brought a short-sleeved uniform. The new kid on the block replied that he hadn’t and Clayton had to put his deckchair and thongs back in the boot. It was fi nals weather in Round 13/14 and nobody was complaining. You know you’re doing alright if the beach seems like a borderline realistic option in early August. Melbourne, don’t ever change.

BACK IN TOWN

Last Saturday we saw the comeback game of one of our absolute legends. After nearly two years on the sidelines with a debilitating foot injury, Leah Gallagher donned the greens (for the fi rst time) when she stepped out in an under 19 game at Old Trinity. The good news is that she pulled up well, (according to her match day coach, Daggles, however we’re not sure who’d be coaching who) so with a few more games under her belt followed by a big pre-season she’ll be ready to strut her stuff again in senior football in round 1 next year.

A BIG HONOUR FOR “DROPPY”

Congratulations to Grant Wardrop who last week became the 107th Life Member of the VAFAUA. This achievement will be offi cially recognised at the Pre Finals Dinner on 25 August 2014 in the Members Dining Room at the MCG.

AFL VISITOR

Last week our group was fortunate to have a visit from former VAFA and now AFL-listed umpire Rob O’Gorman. Rob (#33 for those playing at home) spoke to the group outlining his pathway and journey from Moorabbin Saints Juniors to the VAFA, the VFL and now AFL. He showed that these

pathways which are in place can and do succeed if you persist and listen to your coaches. After his debut at AFL level earlier this year he joins an ever growing list of umpires at the elite level who have passed through or gained their start in our ranks. Last weekend Rob umpired the Melbourne v Brisbane game and we had great representation on the day with three other ex-VAFA umpires being on the fi eld with Rob. 2011 AFL Grand Final umpire Chris Donlon was one of the other fi eld umpires whilst Damian Cusack and Matthew Jenkinson were two of the boundary umpires. It

can happen to you!!!

LAWS OF THE GAME QUIZ

LAST WEEK’S QUESTION:

Before the siren goes to start a match, the umpire notices the full forward from Team A being thrown to ground by Team B’s full back. What happens next?

The correct answer was OPTION C: the umpire blows their whistle, holds the ball up, waits for the siren and then awards a free kick to the Team A full forward, which is taken from where the incident occurred.

THIS WEEK’S QUESTION:

A player from Team A is having a shot at goal. A teammate goes through the mark, closely followed by a Team B player. What does the umpire do?

a) The umpire pays a 25-metre penalty against

Team B.

b) The umpire pays a free kick against the Team A

player for coming in to the protected area.

c) The umpire blows time on and tells both players

to clear the area and resets the mark .

UMPI

RES

Proudly supported by

East Malvern Community Bank®Branch

300 Waverley Road, East Malvern, phone 9563 6044

Steve McCarthy & Kit Harvey @VAFAUA


St BernardsCoach: TBA

Assistants: TBA

1 Jonathan Ayres1 T. Doody2 J. Comito3 T. Howard4 T. Mahony5 A. Cunsolo7 M. Jaggard8 C. Tormey9 D. Heenan10 T. Baker11 M. Diamandis12 C. Gavaghan13 R. Brettell14 L. Arrowsmith15 C. Brasher18 D. Kennedy19 B. Ward20 S. Merkel21 R. Woods22 T. Noonan23 E. Vahland24 J. Sullivan25 N. Kelly26 J. Hannah37 M. Zammit47 L. Grech

MazenodCoach: TBA

Assistants: TBA

Point Cook AFCCoach: TBA

Assistants: TBA

1 Jonathan Ayres2 Jed Carey3 Lachlan Clark4 Edward Connelly 5 Anthony Dillon6 Thomas Donohoe7 Jack Firth8 James Ford9 Frazer Gatens10 Chris Gavaghan11 Thomas Howard12 Jack Howard 13 Will Isaacs14 Bomani Jackson 15 Max Jaggard16 Jake Jones17 Nick Larkin18 Nick Larkin 19 Dan Mighell 20 Adam Mulkearns21 Ben Nathan 22 Zach O’Halloran23 Pat O’Sullivan 24 James Oruba 25 Daniel Parkes 26 James Riley27 Tom Saundry28 Michael Sauro29 Lachlan Sullivan30 Chris Tormey31 Josh Wallis32 Liam Whelan33 Seamus Whelan 34 Rhyen Woods35 Sam Woods

Williamstown CYMSCoach: TBA

Assistants: TBA

1 Kieren Delaney2 Mason Smith3 Nishan Coyne4 Dylan McLellan5 Matthew Burton7 Jack Harris8 Mitchell Thar9 Patrick O’Brien10 Luke Vella11 Daniel Delaney12 Jayme Lawson16 Luke Gibbs17 Aaron Knezevic18 Callum Lawerson19 Alex Shanks20 Daniel Stoios21 Jake Hibbert22 Alex Court23 Jack Elliott24 Liam D’Arcy25 Haydn Acciarito26 Dane Thomas27 Nicholas Christou28 Scott Stewart

UHS-VU / FlemingtonCoach: TBA

Assistants: TBA

1 Matthew Williams4 Miles LEGUDI5 Daniel AITON6 Conor WALSH8 Nick WALLACE11 Thomas CHEYNE12 Jack SUTTON13 Finn DEVLIN15 Vince McINTYRE17 Dylan VELLA HORNE18 Nick PERICA20 Ray HASSAN 21 Anthony AUSAGE24 Camron ARISTOTLE25 Michael HEALEY26 Harry ANDERSON27 James McMAHON28 Nick McMAHON30 James GOSLING31 James HEALEY ©32 Toby KRUISHEER33 Tom McALL35 Esub RAMSAY37 Nathan FILIERI38 Marcus WALSH69 Lloyd GRANT

South Melbourne DistrictsCoach: TBA

Assistants: TBA

16 Paul Cuttajar-Milosev20 Vincent Di Lorenzo28 Hayden Barnett34 Luke Micallef36 Nicholas Green37 John Dawson50 Matthew Morris51 Tim Ball Edward Bordas Tyron Boorman Liam Cavarra Jack Connelly Brendan Dawson Ben Deller Daniel Di Lorenzo Nicholas Ebinger Damon Falzon Tim Farrugia Bryson Ford Kai Harty James Hazeldine Jesse Johnstone Tom Johnstone Wade Mcewan Jake Muddle Luke Mullen Mitchell Parkinson Tim Purvis Sam Raunic Johnny Ross Darcy Schwarze Matthew Singleton Austin Slaney Jake Slee Caleb Taylor

UNDER 18

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Deta

ils

Unava

ilable

at

tim

e o

f pri

nt

Mantra Lorne is the perfect location for a mid-season alignment and recovery retreat. Located beachside on 12 acres

with onsite gymnasium, access to salt therapy and hydrotherapy, football oval, indoor heated lap pool, numerous outdoor

group training and recovery activities. A variety of conference spaces exist to suit team meetings, massage therapy,

motivational talks and team building sessions. Our experienced coordinator will work closely with your nutritionist to

personalise menus, alongside coaches to tailor fitness programs and provide a seamless retreat event program.

To book, contact Michael Canny on 0419 808 670 or email [email protected]

Let Mantra Lorne tailor a package to

rejuvenate your team mid season.

Alignment & recovery retreats

are only a trip down the

Great Ocean Road

Located beachfront for cold therapy sessions Access to salt therapy and hydrotherapy Personalised menu options


After last week’s disappointing loss to UHS-

VU (losing having led all day), University Blues

were keen to avoid another replay of that

performance against another quality side in

Williamstown CYMS. Unfortunately history

repeated for the Blues, after leading by 27 points

at half time, they switched off in the second

half as the CY’s showed dominance across all

parts of the ground. A great come from behind

victory for the CY’s with the fi nals door still ajar.

Old Paradians were simply no match for ladder

leaders Mazenod, the 97 point defeat crushing

to the Old Paradians. Kieran McKeogh was again

impressive with another 3 goals, taking his tally

to 55 for the year, whilst Andrew D’Souza was

named best afi eld for the Paradians. Finals now

out of the equation, Old Paradians must focus

on fi nishing off the season well, whilst Mazenod

must continue their good form to give it a

good shot at the premiership. Westbourne Gr.’s

impressive performance kept their opponents

Point Cook to scoring only two points in the

second half to claim a 46 point victory. The

Warriors’ six goal to one opening quarter set

them up nicely as Jay Amore kicked 3. The

Bulldogs were never really in the match, with

Cody Hobbins the standout in the defeat. Point

Cook must now play consistent football for the

remaining few games to keep hold on to fourth

position from Williamstown CYMS who are just

behind them on percentage. Top two side St

Bernard’s, made life diffi cult for UHS-VU who

managed only two goals to their name by half

time and a 40 point loss by game’s end. This

victory to the Snowdogs sees them hold second

spot on the ladder. Despite the loss, Matthew

Mallia kicked goal, whilst Tim Rocke was best for

UHS-VU. Michael Diamandis was impressive with

three goals for the Snowdogs.

VAFA COLTS — TIPS IN BOLD (YEARS TOTAL 42/72%)

UHS-VU Vs Point Cook

Williamstown CYMS Vs Old Paradians

Westbourne Gr Vs Mazenod

St Bernards Vs University Blues

VAFA COLTS LAST ROUNDSt Bernards 4.0, 6.6, 8.8, 11.11 (77)GOALS, St Bernards: M. Diamandis 3, M. Zammit 2, M. Jaggard 1, C. Tormey 1, E. Vahland 1, D. Kennedy 1, J. Gauci 1, J. Turville 1UHS-VU / Flemington: M. Mallia 2, N. Munari 1, M. Morise 1, A. Okud 1BEST, St Bernards: D. Kennedy, C. Tormey, T. Doody, T. Howard, T. Baker, M. DiamandisUHS-VU / Flemington: T. Rocke, E. Ramsay, M. Healey, M. Legudi, T. Cheyne, F. DevlinWestbourne Grammarians 6.0, 7.5, 8.6, 10.10 (70)

Point Cook AFC 1.2, 3.4, 3.4, 3.6 (24)GOALS, Westbourne Grammarians: J. Amore 3, T. Kitson 2, L. Hogarth 1Point Cook AFC: J. Hynes 1, B. Foley 1, J. Johnson-Boe 1BEST, Westbourne Grammarians: L. Vella, P. O’Brien, A. Briggs, K. Djordjevic, A. MolloyPoint Cook AFC: C. Hobbins, A. Gauci, N. Ezard, C. England, K. Harvey, P. KerrMazenod 2.5, 6.8, 9.10, 14.13 (97)

Old Paradians 0.0, 0.0, 0.0, 0.0 (0)GOALS, Mazenod: K. McKeogh 3, J. Winn 2, J. Swainston 2, D. Wiles 1, F. D’Alfonso 1, S. Deegan 1, M. McLellan 1, P. Mulligan 1, E. Van Rensburg 1, D. Mydaras 1Old Paradians: BEST, Mazenod: M. Sier, T. McKenna, M. McLellan, T. Patterson, P. Mulligan, S. McCullaghOld Paradians: A. D Souza, W. Gilmore, S. Money, M. Ouzas, R. Ursino, T. DimasiWilliamstown CYMS 2.2, 3.5, 8.6, 12.6 (78)

University Blues 2.5, 7.8, 7.10, 8.10 (58)GOALS, Williamstown CYMS: K. Gilbert 4, J. Kilpatrick 2, A. Zadel 2, J. Franze 1, E. Tuck 1, E. Galerakis 1, D. Schwarze 1University Blues: D. Challis 1, F. Mulder 1, T. Lanyon 1, L. Walder 1, G. McFarlane 1, J. Johnson 1, F. Harrison 1, R. Chapman 1BEST, Williamstown CYMS: E. Tuck, I. Ridout, A. Weaven-Cahill, T. Farrugia, E. Galerakis, J. DaviesUniversity Blues: D. Baird, D. Lou, D. Itsines, G. McFarlane, T. Coburn, L. Walder

Olivia Crowe @Liv_Crowe

CONSISTANCY THE KEY

VAFA

COL

TS

PERFORMANCE RECOVERY AGILITY


KewCoach: Ian Aitken

Assistants: Myles Ashton

1 Josh Weightman2 Kyle Margaritas3 Zac Jones4 Zan Simons5 Darcy Sketcher6 Corey Quinlivan7 Jake Chesson8 James Thompson9 Grant Filsell10 Jono Benson11 Sam Nicholson12 Ethan Murray13 Tim Laughlin14 Tyler Hayward15 Josh Fidanza16 Billy Shute17 Mitch Walch18 John O’Keefe19 Cal Spencer20 Mick Kinsella21 Tieren Barbera22 Blake Van Leeuwen23 Jai Lane24 Marshall Sadikin25 Matt Jeffrey26 Jett Guerin27 Jordy Henman29 Max Waters30 Jono Thornley31 Brandon Droessler32 Jayden Barker33 Rob Maibaum35 Liam Kinsella37 Chris Simons91 Blair Hudson93 Joel Dale

CollegiansCoach: Ben Mason

4 Michael Irvine8 Linus Walsh10 Fergus Huntington17 Seamus Hobbs19 Alex Cullen22 Sam Porz24 Ross Katsambanis26 Michael Gregory27 Harry Hawkins29 James Dunn30 Eddie Rice34 Lachie Cooke36 Jamie Clarke37 Chris Mark38 Mitch Palmer39 Ash Walls40 Harry Butterss41 Seb Mundy43 Jake Kyroussis44 Jack Harris46 Tom Danks47 Alex Porz49 James Kenyon Smith50 Toby Benjamin52 Jaden Douglass53 Harry Wilson54 Harrison Sinclair55 Nimai Gordon56 Jimmy Benjamin57 Jordan Rettke58 Zach Grabovic59 Josh Dickinson60 Freddie Sullivan61 Lachie Peck63 Tom Madden71 Oscar Pearson

Point CookCoach: Glenn McAlpine

Assistants: Wayne Gough,

Paul Reardon, David Kip

1 Josh Crofton2 Brandyn Foley3 Matthew Volk4 Cody Day5 Daniel Hird6 Nicholas Ezard7 Mason Kip8 Liam MacGibbon9 Andrew Gough10 Kurt Mayne11 Callum Morrison12 Alex Grigg13 Aaron Sagona14 Luke Rappazzo15 Zac Harrington16 James Aquilina17 Daniel Duskovic18 Matthew Barnes20 Robbie Milne21 Patrick Kerr22 Josh Evans23 Ashley Gauci24 Ashton Cook25 Dillon Van Der Putten30 Riley Matthews31 Mitchell Pruscino34 Liam Gilbee

St BernardsCoach: Craig Connelly

Assistants: Shane Denahy

1 Jonathan Ayres2 Jed Carey3 Lachlan Clark4 Edward Connelly 5 Anthony Dillon6 Thomas Donohoe7 Jack Firth8 James Ford9 Frazer Gatens10 Chris Gavaghan11 Thomas Howard12 Jack Howard 13 Will Isaacs14 Bomani Jackson 15 Max Jaggard16 Jake Jones17 Nick Larkin19 Dan Mighell 20 Adam Mulkearns21 Ben Nathan 22 Zach O’Halloran23 Pat O’Sullivan 24 James Oruba 25 Daniel Parkes 26 James Riley27 Tom Saundry28 Michael Sauro29 Lachlan Sullivan30 Chris Tormey31 Josh Wallis32 Liam Whelan33 Seamus Whelan 34 Rhyen Woods35 Sam Woods

St Mary’s SalesianCoach: Michael Learmonth

1 Lindsay Moreen4 Bradley Monaco7 Reuben Williams8 Daniel Ryan9 Danny Zacharopoulos10 James Curwood11 Darcy Grant12 Jeremy Newton13 Ben Johnston14 Nick Bussell15 Nick Curwood19 Luke Devereuz22 Jack Byrnes24 Matthew Howard26 Cory Hutchinson27 Angus Ife29 Charlie Angley30 Matt Mace31 Nat Edwards32 Ollie Baxter36 Nathan Evans38 Nathan Phillips39 Tom Keys41 Cambell Walsh43 Tim Pepperell44 Kurt Brauns45 Louie Holmes47 Will Douglas48 Jesse Dragonetti50 Harry Meiselbach52 Lorenzo Bukulatjpi53 Hugh Brooks54 Hugh McRae61 Shane Baykai

Werribee DistrictsCoach: Stephen Frenkel

1 Mason Frenkel2 Sarian Scarlett-Long3 Mitch Thar4 Dan Stois5 Tim Malia6 John Kaklikos7 James Borg8 Zac McMillan9 Aaron Gatty10 Kieran Delaney11 Nick Holdsworth12 Zane Goetz13 Hamish Keogh14 Brayden Monk15 Jordan Patty16 Anthony Limina17 Callum Lawson18 Jacob Russell19 Matthew Defi na20 Brandon Doyle21 Max Gundy22 Alex Court23 Brendan Parker24 Ethan Henley25 Connor Yeoull26 Patrick Esposito27 Aaron Pogerzelski28 Anthony Daw82 Jarrod Stewart

UHS-VUCoach: David Speedie

Assistants: Greg Sutton

3 Connor Walsh4 Cal Aristotle5 Tom McMahon8 Nick Wallace9 Jack Sutton10 Myles Legudi11 Daniel Aiton12 Marcus Walsh13 Anthony Ausage16 Tom McAll17 Nick Perica18 James Healey(C)20 Omar Boru21 Nick McMahon22 Toby Kruisheer24 Michael Healey25 Thomas Cheyne28 Lachie Mitchell31 Finn Devlin33 Ezza Ramsey35 Fred Cawte36 Ray Hassan37 James Gosling69 Lloyd Grant81 Matthew Malia

Williamstown CYMSCoach: Bredan Cocks

Assistants: Gregor Burgess

16 Paul Cuttajar-Milosev20 Vincent Di Lorenzo28 Hayden Barnett34 Luke Micallef36 Nicholas Green37 John Dawson50 Matthew Morris51 Tim Ball Edward Bordas Tyron Boorman Liam Cavarra Jack Connelly Brendan Dawson Ben Deller Daniel Di Lorenzo Nicholas Ebinger Damon Falzon Tim Farrugia Bryson Ford Kai Harty James Hazeldine Jesse Johnstone Tom Johnstone Wade Mcewan Jake Muddle Luke Mullen Mitchell Parkinson Tim Purvis Sam Raunic Johnny Ross Darcy Schwarze Matthew Singleton Austin Slaney Jake Slee Caleb Taylor

Richmond CentralCoach: Louie Binios

Assistants: Reg Hickey

1 Zach Munnery2 Rifki Ergul3 Kaylem Lambrecht4 Benson Adams5 Thomas Harvey6 Jack Hendrich7 Rory Benson8 Hayden Binios9 Danny Baglava10 Chris Waiting11 Jayden Tran12 Emannuel Majok13 Gavin Kennedy14 Andrew Kelly15 Caleb Hounihan16 Chris Theodoridis17 Liam Laffey18 Jack Harvey19 Brad Katon20 Simon Hall21 Lorent Chitkrapong22 Ben Johnson23 Brendan Gallagher24 Ryan Armstead25 Tyson Wicks26 Ned Brown27 Michael Walsh28 Paul Johnson29 Jackson Lee30 Joshua Green31 Lewis Grieves32 Chris Christofi 33 Nic Willis34 Dylan Curnow35 Nathan Coote

UNDER 18


RESU

LTS

PREMIER THIRDS LAST ROUNDUniversity Blacks 3.1, 7.3, 9.8, 10.9 (69)University Blues 2.4, 4.7, 6.7, 6.12 (48)GOALS, University Blacks: M. Witkowski 3, T. Brennan 1, M. Coff ey 1, A. Torney 1, B. Mikus 1, R. Cleary 1, B. Farrow 1, S. McKnight 1University Blues: J. Cowland 1, T. Nagle 1, D. DelRio 1, N. MacRae 1, D. Condon 1, H. Hanlon 1BEST, University Blacks: M. Nicolson, A. Torney, M. Witkowski, A. Spinks, S. McKnight, A. MackayUniversity Blues: D. DelRio, C. Craig, D. Van De Pol, D. Aukema, W. Girdwood, J. Cowland

St Bernards 2.4, 6.7, 9.8, 15.11 (101)Old Melburnians 2.0, 6.1, 10.3, 11.7 (73)GOALS, St Bernards: K. O’Connor 2, M. Sulzberger 2, M. Hughes 2, M. Boscolo 2, J. Madden 2, A. Helenius 1, S. Cannatelli 1, J. Gill 1, L. Whelan 1, J. Cunningham 1Old Melburnians: E. Hughes 7, B. Holland 2, A. Cameron 1, T. Oman 1BEST, St Bernards: M. Sulzberger, S. Whelan, M. Hughes, S. Cannatelli, D. Hurley, J. WheelerOld Melburnians: E. Hughes, W. Leveni, S. Land, T. Oman, R. Armit, N. Molony

Old Xaverians 5.2, 7.9, 15.9, 20.16 (136)Collegians 1.1, 3.2, 3.6, 3.8 (26)GOALS, Old Xaverians: C. Dipierdomenico 4, T. Daniher 3, D. Molan 3, T. Cannon 2, S. Ross 2, M. Adams 1, J. Davies 1, P. Armstrong 1, T. Agius 1, J. Hanger 1, N. Ielasi 1Collegians: N. Crema 1, T. Baxter 1, C. Collins 1BEST, Old Xaverians: M. Dipietro, N. Ielasi, L. Rogan, A. Torre, P. ArmstrongCollegians: N. Crema, N. Brown, A. Carydias, J. Slatyer, A. House, C. Collins

PREMIER B THIRDS LAST ROUNDFitzroy 2.1, 3.4, 5.9, 11.14 (80)Old Brighton 1.8, 4.9, 4.9, 4.9 (33)GOALS, Fitzroy: L. Sugrue 2, M. Willson 2, B. McAdam 2, R. Bartel 1, M. Gloster 1, B. Finn 1, S. Delai 1, J. Ford 1Old Brighton: R. Baines 1, B. Trivett 1, A. Betts 1, J. Withers 1BEST, Fitzroy: B. McAdam, B. Finn, C. Hart, M. Gloster, D. Ryan, S. DelaiOld Brighton: S. Henley, A. Betts, L. Buntz, C. Betts, P. Weakley, Z. Wilson

Mazenod 2.1, 5.5, 11.9, 13.14 (92)Caulfi eld Grammarians 3.4, 4.6, 7.6, 8.8 (56)GOALS, Mazenod: S. Bamblett-Furner 3, T. Ross-Edwards 3, G. Joachim 2, A. Weekes 2, N. Parry 1, J. Carroll 1, A. Bau 1Caulfi eld Grammarians: D. Hay 2, B. Scott 2, L. Bourke 2, J. Cleary 1, A. Alibrando 1BEST, Mazenod: S. Bamblett-Furner, N. Klavins, A. Weekes, G. Joachim, M. Hickleton, A. BauCaulfi eld Grammarians: D. Hay, M. Price, J. Schwarer, S. Ilgoutz, L. Bourke, M. Linklater

Old Trinity 4.5, 7.7, 12.9, 15.10 (100)Old Carey 4.2, 6.9, 7.11, 8.13 (61)GOALS, Old Trinity: C. Sparsi 5, T. Cohen 5, R. Gillies 1, T. Gale 1, T. Mead 1, I. Huynh 1, S. Kilgower 1Old Carey: S. Lenders 2, T. MacReady - Bryan 2, J. Arrowsmith 2, L. Cooney 2BEST, Old Trinity: C. Sparsi, T. Cohen, N. Bourke, T. Hunter, I. Huynh, A. SmithOld Carey: A. Richardson, P. Arundel, C. Macrow, A. Moshovelis, Z. Lisle, J. Arrowsmith

Old Xaverians 5.8, 9.17, 15.23, 23.31 (169)Beaumaris 0.2, 2.3, 5.3, 5.4 (34)GOALS, Old Xaverians: T. Fenton 3, A. Ongarello 2, N. Sitch 1, D. Cotchett 1, S. Grigg 1, B. Lyon 1, T. Dillon 1Beaumaris: J. Miller 1, J. Bull 1, S. Kendall 1, A. Davies 1, A. Edmondson 1BEST, Old Xaverians: T. Fenton , A. Dickinson, C. Denton, S. Grigg, J. Silk, H. TrueloveBeaumaris: B. Hughes, M. Hardeman, F. Cloney, J. Bull, D. Cockburn

St Kevins 0.0, 0.0, 0.0, 13.13 (91)AJAX 0.0, 0.0, 0.0, 7.6 (48)GOALS, St Kevins: C. Randles 4, L. Kenyon 2, J. Leggett 2, M. Coloe 2, M. Cape 1, C. McPherson 1, B. Marchesani 1AJAX: Z. Aron 2, B. Fogelgarn 2, Y. Gottlieb 1, R. White 1, D. Wein 1BEST, St Kevins: D. McFarlane, J. Mustey, C. Randles, J. Liston, B. Marchesani, B. OmizzoloAJAX: B. Jones, D. Wein, Z. Aron, B. Adelist, E. Adelist, J. Brick

Yarra Valley BushrangersIs looking for Senior, Reserve &

U19 Coaches in 2015.Join us on the journey as we take the next step Finalists, Premiers & Grand

Finalists 2011-13Take us to the top. Be an important part

of a club which is fi ercely proud of its culture and keen to continue the success

we have achieved over recent years.Now located at our brand new home in

Doncaster.

For further informationcontact Ron Garlepp

[email protected]

Mob 0408 907 774

PREMIER C THIRDS LAST ROUNDSt Kevins 2.1, 5.4, 11.5, 17.9 (111)Ormond 1.1, 2.2, 3.4, 4.6 (30)GOALS, St Kevins: T. McMaster 3, S. Kaiser 2, M. Austin 2, M. Nolan 2, D. Kerr 2, D. Bourke 2, N. Brown 1, N. Pryor 1, J. Montgomerie 1, J. Mason 1 Ormond: C. Hirschman 1, J. Holland 1, L. Adlington 1, M. Hirschman 1 BEST, St Kevins: M. Austin, D. Bourke, M. Moore, S. Reid, N. Pryor, T. McMasterOrmond: S. O’Sullivan, C. Hirschman, J. Holland, C. Cleary, N. Houghton

Parkdale Vultures 5.2, 6.3, 8.7, 9.8 (62)Monash Blues 1.0, 1.6, 2.9, 4.12 (36)GOALS, Parkdale Vultures: M. Todd 3, J. Dobler 2, P. Vernon 1, A. Wingrave 1, J. Austin 1, M. Donald 1Monash Blues: W. Geary 1, D. Heap 1, G. Pavlos 1, N. Armstrong 1BEST, Parkdale Vultures: M. Todd, M. Donald, L. Symons, S. De Amicis, P. Vernon, R. HeaneyMonash Blues: C. Godsil, C. Vizard, C. Wilson, S. Poole, S. Fazzolari, W. Lucas

Old Ivanhoe 4.2, 8.5, 10.8, 11.9 (75)Marcellin 4.2, 5.5, 5.11, 7.14 (56)GOALS, Old Ivanhoe: K. Ellis 6, B. Mantesso 1, T. Ikeda 1, J. Vinicombe 1, S. Beattie 1, D. Hawkes 1BEST, Old Ivanhoe: K. Ellis, B. Mantesso, A. Velli, J. Vinicombe, M. Gorden, J. Mathew

P E G S 6.7, 12.15, 21.19, 27.26 (188)Hampton Rovers 0.0, 0.0, 0.1, 1.2 (8)GOALS, P E G S: M. Flaherty 5, G. Wilson 4, J. Lanting 2, T. Di Blasi 2, T. Rumble 2, B. Remboulis 2, D. Ryan 2, J. French 1, S. Caruso 1, K. Ng 1, J. Maguire 1, A. DeMarco 1, C. Ridley 1, M. McDougall 1, J. Barr 1 Hampton Rovers: B. Woodland 1BEST, P E G S: J. French, T. Di Blasi, S. Caruso, M. Flaherty, G. Wilson, B. RemboulisHampton Rovers: V. Camera, W. Wright, B. Woodland, S. Cougan, B. Lane, Z. Cochrane

LIVE SCORES: Access the URL on your Smartphone& save to your home screen.

livescores.vafa.com.au


Norm Nugent

REVIEW ROUND 15SECTION 1

As predicted in this column, Old Xaverians infl icted Hawthorn’s fi rst loss on Sportscover Arena when the Crocodiles fi nished nine points ahead. Hawthorn started well and held a four point lead at half time before a six goal to one third quarter gave the Xaverians a 27 point advantage at the last change. Hawthorn fought back valiantly in the last, but were unable to bridge the gap. Best for the winners were: Andrew Jones, Tim O’Meara and Matt Omen (No 67). For Hawthorn, Stan Neohoritis, Anthony Marguccio and Anthony Demitriou were best. Prahran/Assumption had a day to forget when they journeyed to Mt Lilydale. The Two Blues goaled in the opening quarter, which proved to be their only major score of the match. Mt Lilydale, who had a confi dence building victory by 80 points, were well served by the consistent Neil Trigwell with fi ve goals. Old Geelong ended their disappointing season with a fi ve point win over Masala after a very even contest.

SECTION 2

In an early match, fourth placed Therry Penola had the better of leaders, Emmaus/St Leo’s in the fi rst quarter. However the Animals fought back and held a one point lead at the half way mark. With six goals to two in the third quarter, Emmaus/ St Leo’s took control to lead by 29 points at three quarter time. They maintained their ascendency in the last and led by 36 points at the fi nal siren. Williamstown CYMS were always in control of their early morning match against Eley Park. The Sharks, who were all at sea by the Bay, went down by 113 points as the CY’s clinched second place and the double chance in the fi nals. On Friday night at Victoria Park, Richmond Central kept Bulleen Templestowe scoreless for a half and confi ned the Bullants to a sole goal as the Snake’s cruised to victory by 96 points.

SECTION 3

With a winning margin of 92 points, NOBs/ St Patrick’s easily accounted for a disappointing MHSOB who struggled throughout on the big Gillon Oval. The best for the winners were;

CROCS ROLL SPARTANS DOUBLE CHANCE SEAGULLSDRAGONS SIGN OFF WITH WIN

Christopher Gatto, Hamish Christie and Thomas O’Halloran who kicked fi ve goals. The consistent Tom Doer-Tolhurst was best for the losing Unicorns. Fourth placed, Kew proved no match for leaders, La Trobe University, who were in control throughout the match and ran out winners by 123 points. Twelve players shared the 21 La Trobe goals, to demonstrate their multi pronged attack. Despite marked inaccuracy, Dragons were able to defeat UHS/ VU by eight points. The Dragons came home with newfound accuracy in the fi nal quarter to snatch their third victory of the season. William Cheesman kicked fi ve of the eight University High goals in a fi ne display.

SEMI FINALS PREVIEWSECTION 1

Hawthorn, the minor Premiers have defeated perennial Premiers Old Xaverians twice this season albeit twice on the small Rathmines Road, Reserve. Last week on Sportscover Arena, Old Xaverians infl icted Hawthorn’s only loss for the season. So many factors will be in “play” in this game. The weather often gives teams kicking south an initial advantage. Will potential match winners, Nick Bye, Matthew Green and James McDonnell play this week? Xavs won without them last Saturday! The ground had not proven favourable to Hawthorn over the years until their Premiership victory in 2013 and certainly the Xaverians have enjoyed unparalled success there over a generation. The Xaverians justifi ed my faith in them last week and I tip them to win again today. Mt Lilydale will start favourites to defeat Prahran/Assumption because of their two home victories during the season including the confi dence building one last week. In Round 12, The “Two Blues” won on the Righetti Oval and I suspect the Mt Lilydale players will be able to out run their opponents on Sportscover where the fi tness of so many Two Blues players has been tested over the years. Many of those who have struggled will be playing today. Even though my observation of Mt Lilydale was of a big defeat, I am selecting them to win today.

SECTION 1 TIPS IN BOLD (YEARS TOTAL 41/91%)

Hawthorn v Old Xaverians

Mt Lilydale v Prahran Assumption

SECTION 2

Richmond Central has defeated Therry Penola twice this season as well as playing the only tie of 2014 against them in Round 13. On form this year, Richmond Central must be favoured to win again.

CLUB

XVI

II


Their defence has been the more impressive although over the 15 rounds there has not been a marked diff erence in points scored by each team. Based on the form to date, I select Richmond Central. Surely the success story of 2014 (so far) has been that of Williamstown CYMS, a team considered unlikely to compete this season after early setbacks. They have fi nished second and will approach today’s major semi fi nal knowing they hold a two to one winning advantage over the Animals including that in round 4 when the CY’s powered home to win by two points. Emmaus/St Leo’s won in Round 8 when their stars, Ben Walters, Mark Petryk and Robert Hughes were all on form. In Round 13, Willy won by eight points to set the stage for today. I have memories of Emmaus/St Leo’s fading out of the 2013 fi nals with consecutive defeats. Could it happen again despite their galaxy of much travelled stars? I am taking the risk on the Animal’s fi tness and select them to win.

SECTION 2 TIPS IN BOLD (YEARS TOTAL 30/67%)

Richmond Central v Therry Penola

Emmaus St Leos v Williamstown CYMS

SECTION 3

On Friday night MHSOB and Kew meet under lights on the wide wings of a fi tness testing Sportscover Arena. The Unicorns have twice defeated Kew whose sole win was by seven points in Round 8. From the times I have watched each team, it has been apparent that neither can sustain pressure for the whole game. At their best, I favour Melbourne High to win narrowly although Kew could surprise. Two weeks ago, La Trobe University would have been highly favoured to win this game against NOBs/St Patrick’s. However in Round 14, the “Combined Colleges” scored a 63 point victory under the La Trobe Lights. Unlike many other fi nal four teams, the wide expanses of headquarters will hold no fear for either side as they are both accustomed to playing on a big ground. La Trobe do not rely on individual goal kickers, rather they have shown versatility in attack, with their many goals spread between several players. NOBs/St Pat’s have relied fi rstly on Todd MacLeod and latterly on Tom and Ben O’Halloran for their goals. The result on Sunday morning could well depend on which back line holds up the better against unusual pressure. After a closely fought encounter, I select La Trobe to triumph.

TIPS IN BOLD (YEARS TOTAL 38/84%)

La Trobe Uni v NOB/St Pat’s

Kew v MHSOB

CLUB XVIII (1) LAST ROUNDOld Geelong 1.0, 2.3, 6.6, 8.8 (56)

Masala 2.5, 3.5, 4.5, 7.9 (51)

GOALS, Old Geelong: R. Buckley 3, B. Ferguson 2, A. Smith 1, M. Leslie 1, J. Graham 1

Masala: P. Kailasanathan 2, S. Freeman 2, J. Coghill 2, M. Decarne 1

BEST, Old Geelong: R. Buckley, A. Smith, B. Ferguson, S. Jenner, O. Davies, P. Menciassi

Masala: W. McMahon, S. Giritharan, M. Decarne, T. O’Brien, D. Nugent, D. Inge III

Old Xaverians 1.3, 3.5, 9.7, 10.8 (68)

Hawthorn 4.3, 4.3, 5.4, 9.5 (59)

GOALS, Old Xaverians: H. Lyons 3, T. Lee 3, N. Corcoran 2, M. Owen 1, N. Larkins 1

Hawthorn: A. Marguccio 2, S. Neohoritis 2, C. Katsanevakis 1, A. Brizzi 1, A. Mitropoulos 1, M. Dabab

1, M. Elijah 1 BEST, Old Xaverians: N. Corcoran, N. Larkins, T. Lee, D. Quinn, A. Barrett, H. Lyons

Hawthorn: A. Karim, M. Dabab, B. Wignell, S. Neohoritis, A. Marguccio, A. Demetriou

Mt Lilydale 2.5, 6.8, 10.12, 13.13 (91)

Prahran Assumption 0.1, 0.1, 0.2, 1.5 (11)

GOALS, Mt Lilydale: N. Trigwell 5, A. Thorne 2, J. Oakes 2, D. Cerra 1, N. Hooke 1, M. Fernando

1, M. Hollingsworth 1

Prahran Assumption: J. Corrigan 1

BEST, Mt Lilydale: B. Hughes, N. Trigwell, S. Hickey, H. Moyes, A. Stockley, B. Boomsma

Prahran Assumption: N. Keohler, N. Gouin, J. Corrigan, M. Slaven, L. Godeassi, P. O’Connor

CLUB XVIII (2) LAST ROUNDRichmond Central 2.7, 6.10, 11.14, 15.15 (105)

Bulleen Templestowe 1.1, 1.1, 1.1, 1.3 (9)

GOALS, Richmond Central: S. Hartmann 3, J. Stevenson 3, N. Rice 3, M. Sandilands 2, T. Nolan

1, R. Nolan 1, S. D’Arcy 1, M. Baron 1 Bulleen Templestowe: J. Gigliotti 1

BEST, Richmond Central: J. Stevenson, S. Hartmann, R. Nolan, M. Sandilands, P. Iser, L. McKenzie

Bulleen Templestowe: M. Vergamalis, R. Brancatisano, R. Rametta, M. Silvaggio, C. Smith, C. Broom

Williamstown CYMS 5.4, 11.8, 18.10, 23.15 (153)

Eley Park Sharks 0.4, 2.6, 5.7, 5.10 (40)

GOALS, Williamstown CYMS: C. Fennell 4, J. Buttigieg 3, M. Ferrie 3, D. Elias 3, M. Keating 2,

J. Streets 1, T. Humberstone 1, J. Street 1, C. Wiltshire 1, L. McKenzie 1, F. Henry 1, J. Micallef 1, J.

MacKenzie 1 Eley Park Sharks: J. Brown 2, P. Salvatico 1, A. Rock 1, P. Arouinthan 1

BEST, Williamstown CYMS: F. Henry, B. Gatt, L. McKenzie, J. Trethowan, D. O’Keeff e, M. Busuttil

Eley Park Sharks: I. Gridchin, J. Sheahan, T. Silvers, C. Cresswell, W. Knight, A. Quantrell

Emmaus St Leos 0.4, 2.8, 8.8, 11.9 (75)

Therry Penola 2.1, 3.1, 4.3, 6.3 (39)

GOALS, Emmaus St Leos: R. Hughes 4, M. Pietryk 2, J. Greensides 2, T. Walters 1, J. Vince 1,

A. Athorne 1

Therry Penola: D. McKibbin 1, D. Casey 1, N. Robinson 1, M. Helm 1, A. Rosso 1, A. Maynard 1

BEST, Emmaus St Leos: J. Vince, M. Pietryk, B. Walters, J. Greensides, O. Scott, T. Walters

Therry Penola: S. Matthews, S. Bye, A. Maynard, D. Casey, L. Vassallo, R. McKerrow

CLUB XVIII (3) LAST ROUNDDragons 1.4, 2.7, 3.17, 7.18 (60)

UHS-VU 2.2, 4.3, 6.3, 8.4 (52)

UHS-VU: W. Cheesman 5, S. Seeger-Snowden 1, A. Ausage 1, L. Grant 1

UHS-VU: A. Ausage, M. Reinhard, W. Cheesman, H. Waterman, L. Grant, E. Coombe

NOBS / St Pats 0.0, 0.0, 0.0, 19.5 (119)

MHSOB 0.0, 0.0, 0.0, 3.9 (27)

GOALS, NOBS / St Pats: T. O’Halloran 5, B. O’Halloran 3, T. Macleod 3, H. Christie 3, M. Piazza 3,

C. Roberts 1, T. Pick 1 MHSOB: T. Doer-Tolhurst 1, L. Albiston 1, M. Griffi n 1

BEST, NOBS / St Pats: M. Karunaratne, B. O’Halloran, L. Fogarty, C. Gatto, C. Ives, P. Moore

MHSOB: T. Doer-Tolhurst, A. Ahsan, M. Chowdhury, D. Grantham, D. Ndenzako, D. Nuttall

LA TROBE UNI 6.3, 10.8, 17.11, 21.17 (143)

Kew 2.0, 2.1, 3.2, 3.2 (20)

GOALS, La Trobe Uni: J. Eltringham 4, N. Doyle 3, Z. Curwen-Walker 3, S. Johnstone 2, R.

Clifton 2, J. Mildren 1, M. Beaumont 1, B. Cameron 1, A. Hughes 1, B. Jordan 1, M. Sturges 1, K.

Jeff rey 1 Kew: S. Healey 1, R. Harmeston 1, S. Coles 1

BEST, La Trobe Uni: P. Russell, A. Hughes, Z. Curwen-Walker, J. Eltringham, B. Jordan, R.

Garland Kew: T. Hunter, J. Galbraith, A. Quinn, R. Shute, A. Cross, M. Plain


SHARPSHOOTERS

SHAR

PSHO

OTER

S

Premier LR TOTAL

Matthew Handley Old Xaverians 0 40

Shura Taft Collegians 6 37

Chad Jones St Bernards 1 33

Andrew Merrington St Bernards 5 32

Premier Reserve LR TOTAL

Billy Riddle Collegians 2 22

Benjamin Considine St Bernards 0 22

Ned Walmsley Old Scotch 0 21

Thomas Duyndham St Bernards 2 19

Premier Thirds LR TOTAL

Damien Ryan St Bernards 0 28

Todd Daniher Old Xaverians 3 20

Andrew Walsh University Blues 0 18

Joshua Hanger Old Xaverians 1 16

Premier B LR TOTAL

David Fayman AJAX Afc 5 55

Michael Meehan Old Haileyburians 3 43

Jake Lew AJAX Afc 2 37

Cameron Beck Old Melburnians 5 34

Premier B Reserve LR TOTAL

Jamie Mugavin University Blues 3 50

Julian Gambaro St Kevins OB 2 41

Will Osborn Caulfi eld Grammarians 4 31

Cameron Tunbridge Old Melburnians 4 30

Premier B Thirds LR TOTAL

Charles Randles St Kevins OB 4 34

Zev Aron AJAX Afc 2 26

Alexander Edmondson Beaumaris FC 1 24

Israel Gutnick AJAX Afc 0 24

Premier C Reserve LR TOTAL

Nicholas Manning Ormond AFC 0 28

Tim Naylor Ormond AFC 0 27

Jake Archdeacon Peninsula OB 6 27

Jack Fenner PEGS Football Club 0 23

Premier C LR TOTAL

Ed Turner Hampton Rovers AFC 3 42

Dominic Bolger Marcellin OC 3 41

David Forrest PEGS Football Club 3 39

Joseph Cosgriff Monash Blues 2 39

Premier C Thirds LR TOTAL

Dylan Gook St Mary’s Salesian 0 50

Troy McMaster St Kevins OB 3 42

Matthew Flaherty PEGS Football Club 5 28

James Barrie St Mary’s Salesian 0 21

Division 1 LR TOTAL

Jarrod Bannister Therry Penola OB 3 83

Corey Bannister Therry Penola OB 1 68

Matthew Keown NOBS/St Pats 2 41

Callum Wood Old Geelong 2 37

Division 1 Reserve LR TOTAL

Matthew Sultana Williamstown CYMS 2 45

Steven Barlow Williamstown CYMS 6 41

Joel Quinn Therry Penola OB 2 35

Jon Rice Prahran Assumption AFC 2 29

Division 2 LR TOTAL

David Boundy Old Paradians 1 60

Sabastian Ciavola Eltham Collegians AFC 0 52

Andrew Brazzale Kew AFC 2 48

Louis Holmes St Mary’s Salesian 3 39


Stefan Gusts St Mary’s Salesian 5 66

Andrew Coath Eltham Collegians AFC 8 45

Joshua Monro Old Paradians 5 42

Zach Tranter Eltham Collegians AFC 0 37

Division 3 LR TOTAL

Christopher Beluszar Emmaus St Leos OC AFC 7 57

Rhys Kirk UHS-VU AFC 5 52

Damon Marcon Northern Blues 4 49

Jack McMeel La Trobe University AFC 7 48



Mitchell Sweeney UHS-VU AFC 7 59

Travis Houlden Eley Park Sharks 4 34

Leigh Booth Eley Park Sharks 1 30

Jake Munro Richmond Central AFC 0 28

Division 4 LR TOTAL

Jason Ince Hawthorn AFC 4 73

Sam Gold Hawthorn AFC 5 53

Andrew Baker Canterbury Football Club 2 44

Daniel Penny Box Hill North AFC 0 36


Jason Jackomos Hawthorn AFC 9 70

Shane Devers West Brunswick AFC 0 33

Glenn Williams Box Hill North AFC 2 27

Daniel Lauletta Hawthorn AFC 2 27

MEGT U19 Premier LR TOTAL

Jeremy Hannan Old Xaverians 11 66

James Canterbury St Kevins OB 1 52

Jonathan Daggian Old Scotch 2 46

Sam Lewin St Kevins OB 2 39

Under 19 Section 2 LR TOTAL

Joseph Campbell Old Trinity Grammarians 0 42

William Blakey University Blues 1 39

Daniel Batarilo University Blues 4 38

Jack Francis Parkdale Vultures 3 33

Under 19 Section 3 LR TOTAL

Mitchell Nixon Old Carey Grammarians 4 70

Nicholas Ebinger Williamstown CYMS 0 63

Xavier Burns Marcellin OC 0 53

Daniel Ryan St Mary’s Salesian 1 42

Under 19 North LR TOTAL

Josh Stephens Wyndam Suns Football Club 1 48

Thomas Hancock Yarra Valley OB 0 36

Jack Firth St Bernards 2 32

Reuben Blackmore-Moore Ivanhoe AFC 0 25

Under 19 South LR TOTAL

Campbell Jones Hampton Rovers AFC 2 50

Jack Meeking Ormond AFC 0 42

Jake Benoiton Oakleigh AFC 8 36

Jaycob Johnson Peninsula OB 1 34

VAFA Colts LR TOTAL

Kieren McKeogh Mazenod OC 3 55

Josh Swainston Mazenod OC 2 33

Brandyn Foley Point Cook AFC 1 27

Nicholas Munari UHS-VU AFC 1 26

Club XVIII (1) LR TOTAL

Ari Mitropoulos Hawthorn AFC 1 67

Antonio Brizzi Hawthorn AFC 1 47

Anthony Marguccio Hawthorn AFC 2 44

Sam Chester Old Xaverians 0 36


Robert Hughes Emmaus St Leos OC AFC 4 46

Joshua Brown Eley Park Sharks 2 43

Joe Vernali Therry Penola OB 0 30

Mark Pietryk Emmaus St Leos OC AFC 2 30


Todd Macleod NOBS/St Pats 3 37

Louis Meyer MHSOB 0 36

Thomas O’Halloran NOBS/St Pats 5 24

Benjamin O’Halloran NOBS/St Pats 3 23


1116 SEN VAFA PREMIERSHIP LADDERS 2014

PREMIER C RESERVESP W L D FF F A % Pts

P E G S 15 14 1 0 0 1312 532 246.62 56

Parkdale Vultures 14 12 2 0 1 1251 741 168.83 52

Old Camberwell 15 9 6 0 0 1274 827 154.05 36

Monash Blues 15 9 6 0 0 919 925 99.35 36

Peninsula 15 7 8 0 0 1161 956 121.44 28

Oakleigh 15 7 8 0 0 915 1125 81.33 28

Ormond 15 6 8 1 0 1176 1182 99.49 26

Marcellin 15 5 10 0 0 857 1087 78.84 20

Hampton Rovers 15 4 10 1 0 952 908 104.85 18

Banyule 14 0 14 0 0 466 2050 22.73 0

DIVISION TWO RESERVESP W L D F A % Pts

Old Eltham Collegians 15 14 1 0 1792 639 280.44 56

St Mary's Salesian 15 13 2 0 1962 517 379.5 52

Kew 15 12 3 0 1573 734 214.31 48

Ivanhoe 15 11 4 0 1628 638 255.17 44

Old Paradians 15 7 8 0 949 1072 88.53 28

Monash Gryphons 15 5 9 1 896 1305 68.66 22

St Johns 15 4 10 1 795 1275 62.35 18

Glen Eira 15 4 11 0 605 1282 47.19 16

South Melbourne Districts 15 3 12 0 701 1435 48.85 12

Elsternwick 15 1 14 0 300 2318 12.94 4

DIVISION THREE RESERVESP W L D For Agst % PTS

Richmond Central 15 13 2 0 1626 620 262.26 52

UHS-VU 15 13 2 0 1406 850 165.41 52

La Trobe University 15 10 5 0 1282 696 184.2 40

Aquinas 15 10 5 0 984 853 115.36 40

Power House 15 9 6 0 1228 772 159.07 36

Swinburne University 15 9 6 0 960 1061 90.48 36

Albert Park 15 8 7 0 1276 827 154.29 32

Eley Park Sharks 15 7 8 0 1269 948 133.86 28

St Francis Xavier 15 5 10 0 808 1280 63.12 20

Emmaus St Leos 15 4 11 0 876 1304 67.18 16

Northern Blues 15 2 13 0 823 1418 58.04 8

South Mornington 15 0 15 0 486 2441 19.91 0

PREMIER CP W L D F A % Pts

Marcellin 15 12 3 0 1425 1038 137.28 48

Monash Blues 15 11 4 0 1337 843 158.6 44

Hampton Rovers 15 11 4 0 1408 1125 125.16 44

Parkdale Vultures 15 8 7 0 1204 1217 98.93 32

Peninsula 15 8 7 0 1249 1277 97.81 32

P E G S 15 8 7 0 1225 1318 92.94 32

Oakleigh 15 7 8 0 1210 1113 108.72 28

Old Camberwell 15 5 9 1 1272 1317 96.58 22

Ormond 15 2 12 1 1084 1517 71.46 10

Banyule 15 2 13 0 1149 1798 63.9 8

DIVISION ONEP W L D F A % Pts

Therry Penola 15 15 0 0 1831 842 217.46 60

Williamstown CYMS 15 11 4 0 1315 1047 125.6 44

NOBS/St Pats 15 10 5 0 1407 1176 119.64 40

Old Geelong 15 8 7 0 1287 1257 102.39 32

Old Mentonians 15 8 7 0 1325 1357 97.64 32

Prahran Assumption 15 7 8 0 1465 1223 119.79 28

Yarra Valley 15 5 9 1 1138 1520 74.87 22

Whitefriars 15 5 10 0 1081 1299 83.22 20

Bulleen Templestowe 15 4 10 1 1041 1331 78.21 18

MHSOB 15 1 14 0 910 1748 52.06 4

DIVISION ONE RESERVESP W L D F A % Pts



Therry Penola 15 10 5 0 1192 642 185.67 40

Old Geelong 15 10 5 0 1363 885 154.01 40

Whitefriars 15 9 6 0 1102 874 126.09 36

Yarra Valley 15 9 6 0 1099 944 116.42 36

Bulleen Templestowe 15 6 9 0 858 1043 82.26 24

NOBS/St Pats 15 5 10 0 972 1102 88.2 20

MHSOB 15 2 13 0 695 1488 46.71 8

Old Mentonians 15 0 15 0 391 2046 19.11 0

DIVISION TWOP W L D F A % Pts

Kew 15 12 2 1 1450 928 156.25 50


Old Eltham Collegians 15 12 3 0 1483 972 152.57 48

Old Paradians 15 10 5 0 1325 982 134.93 40

St Johns 15 8 7 0 1432 1157 123.77 32

Ivanhoe 15 7 7 1 1265 1112 113.76 30

South Melbourne Districts 15 6 9 0 1157 1468 78.81 24

Elsternwick 15 3 12 0 991 1700 58.29 12

Monash Gryphons 15 3 12 0 856 1600 53.5 12

Glen Eira 15 1 14 0 749 1635 45.81 4

DIVISION THREEP W L D F A % Pts

Emmaus St Leos 15 11 4 0 1775 952 186.45 44

Northern Blues 15 11 4 0 1709 1126 151.78 44

Aquinas 15 10 5 0 1416 974 145.38 40

Swinburne University 15 10 5 0 1274 1047 121.68 40

Richmond Central 15 8 7 0 1544 1151 134.14 32

Albert Park 15 8 7 0 1307 1097 119.14 32

Power House 15 8 7 0 1139 1009 112.88 32

UHS-VU 15 8 7 0 1154 1211 95.29 32

St Francis Xavier 15 7 8 0 1119 1193 93.8 28


Eley Park Sharks 15 4 11 0 1049 1340 78.28 16

South Mornington 15 0 15 0 380 2703 14.06 0

PREMIER C THIRDSP W L D FF F A % Pts

St Kevins 13 13 0 0 2 1830 322 568.32 60

St Mary's Salesian 13 11 2 2 0 1387 496 279.64 52

P E G S 12 7 5 1 2 1117 681 164.02 40

Old Ivanhoe 12 7 5 1 0 728 685 106.28 32

Parkdale Vultures 12 6 6 2 0 612 944 64.83 32

Marcellin 10 4 6 1 2 896 942 95.12 28

Monash Blues 14 5 9 0 1 778 1057 73.6 24

Ormond 12 2 10 2 0 453 1301 34.82 16

Hampton Rovers 14 2 12 1 0 412 1365 30.18 12

VAFA COLTSP W L D FF F A % Pts

Mazenod 14 13 1 0 1 1246 322 386.96 56

St Bernards 15 11 4 0 0 1164 544 213.97 44

Westbourne Gr 13 11 2 0 0 927 453 204.64 44

Point Cook AFC 15 7 8 0 0 818 853 95.9 28

Williamstown CYMS 15 7 8 0 0 732 1043 70.18 28

Old Paradians 13 4 9 0 0 552 901 61.27 16

UHS-VU / Flemington 15 3 12 0 0 587 1003 58.52 12

University Blues 13 1 12 0 0 464 1219 38.06 4


DIVISION FOURP W L D F A % Pts

Hawthorn 15 15 0 0 2055 684 300.44 60

West Brunswick 15 13 2 0 1571 957 164.16 52

Canterbury 15 11 4 0 1567 1247 125.66 44

Manningham Cobras 15 9 6 0 1379 1088 126.75 36

Westbourne Gr 15 7 8 0 1448 1309 110.62 28

Box Hill North 15 6 9 0 1328 1489 89.19 24

Point Cook 15 6 9 0 1130 1306 86.52 24

Dragons 15 5 10 0 973 1436 67.76 20

North Brunswick 15 3 12 0 1079 1386 77.85 12

Chadstone 15 0 15 0 618 2246 27.52 0


CLUB XVIII (3)P W L D FF F A % Pts

La Trobe Uni 13 12 1 0 2 1712 416 411.54 56

NOBS / St Pats 14 12 2 0 1 1486 653 227.57 52

MHSOB 14 6 8 0 1 918 1096 83.76 28

Kew 15 6 9 0 0 879 1185 74.18 24

Dragons 11 3 8 0 0 483 1650 29.27 12

UHS-VU 15 2 13 0 0 772 1431 53.95 8

MEGT UNDER 19 PREMIERP W L D FF F A % Pts

St Bernards 15 14 1 0 0 1944 676 287.57 56

St Kevins 14 11 3 0 1 1640 796 206.03 48

Old Xaverians 14 10 3 1 1 1697 814 208.48 46

Beaumaris 15 8 6 1 0 1298 1128 115.07 34

Old Scotch 15 6 9 0 0 1056 1272 83.02 24

De La Salle 15 4 11 0 0 1115 1455 76.63 16

St Bedes / Mentone Tigers 14 2 12 0 0 765 1647 46.45 8

Old Melburnians 14 2 12 0 0 443 2253 19.66 8

UNDER 19 SECTION 2P W L D F A % Pts

Old Trinity 15 12 3 0 1278 833 153.42 48

Whitefriars 15 11 4 0 1330 756 175.93 44

University Blues 15 11 4 0 1361 996 136.65 44

Parkdale Vultures 15 10 5 0 1305 907 143.88 40

Fitzroy 15 10 5 0 1240 966 128.36 40

Mazenod 15 7 8 0 973 974 99.9 28

Old Brighton 15 5 10 0 826 1204 68.6 20

Collegians 15 5 10 0 597 1028 58.07 20

University Blacks 15 4 11 0 699 1253 55.79 16

Caulfi eld Grammarians 15 0 15 0 732 1424 51.4 0

UNDER 19 SECTION 3P W L D F A % Pts

Old Ivanhoe 15 12 3 0 1509 906 166.56 48


Old Carey 15 11 4 0 1481 985 150.36 44

Marcellin 15 11 4 0 1259 921 136.7 44

AJAX 15 8 7 0 1186 1038 114.26 32

Old Xaverians 15 5 10 0 968 1242 77.94 20

Old Camberwell 15 5 10 0 853 1182 72.17 20


UNDER 19 NORTHP W L D F A % Pts

Ivanhoe 15 14 1 0 1339 713 187.8 56

Wyndham Suns 15 10 5 0 1220 913 133.63 40

St Bernards 15 9 4 2 1269 1030 123.2 40

Banyule 15 8 6 1 1134 868 130.65 34

Therry Penola 10 7 3 0 940 561 167.56 32


P E G S 15 7 8 0 1067 1122 95.1 28

Yarra Valley 15 6 9 0 1163 1191 97.65 24

Northern Blues 10 2 8 0 621 1010 61.49 8

Whitefriars 15 0 14 1 539 1504 35.84 2

UNDER 19 SOUTHP W L D D FF F A % Pts

Oakleigh 13 11 2 0 1 1 1318 593 222.26 52

Ormond 14 12 2 0 0 1 1489 690 215.8 52

De La Salle 14 10 4 0 1 0 1265 833 151.86 44

Hampton Rovers 15 9 6 0 0 0 1204 968 124.38 36

Beaumaris 14 7 7 0 0 1 1386 1032 134.3 32

Peninsula 15 7 8 0 0 0 1211 1124 107.74 28

Monash Blues 15 6 9 0 0 0 970 1220 79.51 24

Old Haileybury 15 5 10 0 0 0 830 1298 63.94 20

Collegians 12 4 8 0 0 0 601 1364 44.06 16

MHSOB 15 1 14 0 0 0 560 1671 33.51 4

DIVISION FOUR RESERVESP W L D B F A % Pts

West Brunswick 15 15 0 0 2371 276 859.06 60 4

Hawthorn 15 13 2 0 2003 454 441.19 52 4

Manningham Cobras 15 8 6 1 833 976 85.35 34 4

Westbourne Gr. 15 8 7 0 1030 909 113.31 32 4

Box Hill North 15 8 7 0 988 1190 83.03 32 4

Canterbury 15 8 7 0 1054 1292 81.58 32 4

North Brunswick 15 4 10 1 832 1468 56.68 18 0

Chadstone 15 4 11 0 715 1644 43.49 16 0

Point Cook 15 3 12 0 762 1514 50.33 12 0

Dragons 15 3 12 0 541 1406 38.48 12 0

Club XVIII (1)P W L D F A % Pts

Hawthorn 15 14 1 0 2075 711 291.84 56

Old Xaverians 14 12 2 1 1804 866 208.31 52

Mt Lilydale 15 8 7 0 1292 1155 111.86 32


Old Geelong 14 2 12 0 709 1565 45.3 8

Masala 15 1 14 0 663 1924 34.46 4

Club XVIII (2)P W L D FF F A % Pts

Emmaus St Leos 15 12 3 0 0 1431 714 200.42 48

Williamstown CYMS 14 10 4 0 1 1202 1046 114.91 44

Richmond Central 15 10 4 1 0 1069 762 140.29 42

Therry Penola 15 6 8 1 0 1039 1075 96.65 26

Eley Park Sharks 15 5 10 0 0 903 1137 79.42 20

Bulleen Templestowe 14 0 14 0 0 597 1562 38.22 0


WINNING EDGE CLUB CHAMPIONSHIP

Club Seniors Reserves 19/18Thirds/

C18Total

St Bernards 44 26 42 11 123

University Blues 52 28 33 5.5 118.5

Williamstown CYMS 44 24 33 10.5 111.5

Therry Penola OB 60 20 24 6.5 110.5

St Kevins OB 36 26 34.5 10.5 107

Hawthorn AFC 60 26 0 14 100

Marcellin OC 48 10 33 6 97

Parkdale Vultures 32 25 30 8 95

Ivanhoe AFC 30 22 42 0 94

Old Xaverians 28 18 33 10.5 89.5

PREMIER RESERVESP W L D F A % Pts

St Bernards 14 13 1 0 1220 620 196.77 52

Old Xaverians 14 9 5 0 982 741 132.52 36

Old Scotch 14 8 6 0 998 867 115.11 32

Collegians 14 8 6 0 891 845 105.44 32

Beaumaris 14 7 6 1 995 851 116.92 30

Old Brighton 14 7 7 0 973 847 114.88 28


St Bedes/Mentone Tigers 14 5 9 0 821 1048 78.34 20

Old Trinity 14 4 10 0 786 1292 60.84 16

De La Salle 14 2 12 0 718 1236 58.09 8

PREMIERP W L D F A % Pts


St Bernards 14 11 3 0 1264 931 135.77 44

Old Scotch 14 8 6 0 1254 1090 115.05 32

Old Trinity 14 8 6 0 1103 1004 109.86 32

Collegians 14 8 6 0 1078 1115 96.68 32

Old Xaverians 14 7 7 0 970 1052 92.21 28

Beaumaris 14 5 9 0 1124 1201 93.59 20

Old Brighton 14 5 9 0 906 1253 72.31 20

De La Salle 14 4 10 0 840 1201 69.94 16

St Bedes/Mentone Tigers 14 3 11 0 985 1292 76.24 12

PREMIER THIRDSP W L D B FF F A % Pts

University Blacks 12 11 1 0 1 1 1044 646 161.61 52

Old Xaverians 11 9 2 0 0 3 1107 619 178.84 48

St Bernards 13 10 3 0 1 0 1080 692 156.07 44

University Blues 13 5 8 0 0 1 892 839 106.32 24

Collegians 13 5 8 0 1 0 707 891 79.35 24

Old Melburnians 11 4 7 0 1 0 621 993 62.54 20

Old Scotch 12 1 11 0 2 0 572 972 58.85 12

PREMIER BP W L D F A % Pts


Old Carey 15 10 5 0 1477 1174 125.81 40

St Kevins 15 9 6 0 1484 1253 118.44 36

Old Melburnians 15 8 7 0 1245 1131 110.08 32

Mazenod 15 8 7 0 1210 1217 99.42 32

AJAX 15 8 7 0 1183 1212 97.61 32

Fitzroy 15 6 8 1 1049 1327 79.05 26


Old Haileybury 15 3 11 1 1068 1448 73.76 14

Old Ivanhoe 15 3 12 0 935 1470 63.61 12

PREMIER B RESERVESP W L D F A % Pts


St Kevins 15 13 2 0 1690 607 278.42 52


Old Melburnians 15 8 7 0 1224 1056 115.91 32

Old Ivanhoe 15 7 8 0 902 1175 76.77 28

Old Carey 15 6 9 0 967 1098 88.07 24

Fitzroy 15 6 9 0 936 1158 80.83 24

AJAX 15 5 10 0 720 1067 67.48 20

Old Haileybury 15 3 12 0 676 1635 41.35 12

Mazenod 15 3 12 0 603 1504 40.09 12

PREMIER B THIRDSP W L D F FF A % Pts

Old Xaverians 12 10 1 1 3 1591 641 248.21 54

St Kevins 13 9 3 1 2 1385 794 174.43 46

Fitzroy 14 10 4 0 1 1192 728 163.74 44

Old Brighton 14 8 6 0 1 1208 981 123.14 36

AJAX 15 7 8 0 0 1006 1019 98.72 28

Beaumaris 13 7 6 0 0 1137 1193 95.31 28

Caulfi eld Grammarians 12 5 7 0 1 929 1132 82.07 24

Old Carey 15 5 10 0 0 912 1319 69.14 20

Old Trinity 13 4 9 0 0 704 1229 57.28 16

Mazenod 13 1 12 0 0 467 1775 26.31 4


PROUD SPONSOR OF VICTORIAN AMATEUR FOOTBALL ASSOCIATION

www.bayford.com.au

BAYFORD FORDCOBURG PHONE: 9297 5000EPPING PHONE: 9401 8888

BUNDOORA PHONE: 9467 5533

BAYFORD CITROENSOUTH YARRA PHONE: 8290 2877

BAYFORD PEUGEOTCITY PHONE: 9341 4444

SOUTH YARRA PHONE: 8290 2888

CHRYSLER JEEP DODGEHAWTHORN EAST PHONE: 9811 1800

BAYFORD VOLKSWAGENCAMBERWELL PHONE: 9811 1888

EPPING PHONE: 9409 9000 FAIRFIELD PHONE: 9471 5500

BMWSOUTH YARRA PHONE: 9521 2121

OAKLEIGH PHONE: 9252 5000

• New, Used and Demonstrator vehicles• 12 convenient locations • Multiple brands

Bayford would like to thank you for the opportunity to be involved with the V.A.F.A. We look forward to fostering a supportive relationship with all those involved

with the association well into the future.

To demonstrate our proud sponsorship of the VAFA, we’d like to extend the following offer to your club.

We’ll gladly pledge $500 to your club for any successful introduction at any of our

dealerships, resulting in a new or used vehicle sale, from any member, player or supporter.

Simply spread the word to help raise funds for your club! We thank you again for choosing Bayford as your sponsor.

Bendigo and Adelaide Bank Limited, The Bendigo Centre, Bendigo, VIC 3550. ABN 11 068 049 178. AFSL 237879. (S45195) (6/13)

www.bendigobank.com.au

East Malvern Community Bank® Branch are proud sponsors of Amateur Football

With every product or service we offer, money goes back into the community to support local clubs, organisations and initiatives like Amateur Football.

As a Bendigo Bank customer you benefit from competitive products and great service and get the satisfaction of knowing your banking is contributing to your community.

So make a difference – to your own banking and to your community. Drop into East Malvern Community Bank® Branch at 300 Waverley Road, East Malvern or phone Branch Manager, Peter Wolff on 9563 6044.

East Malvern Community Bank® Branch

TTTTTTTTTTTTTTTTThe

he

he

he

he

he

he

he

he

he

he

he

hee

he

he

hhhhhhhwwwwwwwwwwwwww

ooooooooorrrrrrrrrrd

Sd

Sd

Sd

SSSd

Sd

SSd

SSSd

Sd

SSSd

Sd

Sddd

OPOPOPOPOPOPOOPOPOPPPRRRRRRRRRR

TTTTTTTTTTSSSSSSSSSSSSCCCCCCCC

OV

EEV

EEV

EEEV

EV

EEV

EO

VEE

OV

EV

EO

VEEEEEE

VEEEEEEE

VEE

VE

OV

EV

EO

VE

VVO

VVO

VVO

R aa

R a

R a

Ra

R a

Ra

Ra

RRRRRRRRRRRRRRRRRRRRRRR

dd

d

d

d

dn

ddn

ddn

ddn

dn

dn

dnnnnn

the

the

the

the

the

the

the

the

SSSSSSSSSSSSSpppppppppppppooooooooooooo

rrrrrrrrrrrrrrtststststststststtststccccccccoooooooo

vvvvvvver er

er

er

erreLLLLLLLLLLLLo

go

og

oo

go

og

oo

go

og

oo

go

og

oo

goo

go

og

oo

go

go

og

og

aaaaaaaaaaarrrrrrrrrrre

tte

te

te e

te

te

te

te

te

te

te

rrrrrrrrrrrrdad

ead

ed

ead

ead

ead

ead

edad

ed

ead

edadad

ma

ma

ma

ma

ma

maa

marrrrr

kskskskskskkf

of

of

of

off

of

offf

offf

oooooooooooSSSSSpppppppp

oooooooooorrrrrt

ststststststtccccccooooooooooo

vvvvvvvvvver er

err r reeeeeeeAAAAAAAAAAAAAA

ust

ustt

ust

ust

ust

us

uss

uurrrrra

liali

ali

aliilialiii

alaaaa a aaaaa

PPPPPPPPttttttty

Ly

Ly

Ly

Ly

Ly

Lyy

Lyy

ttttttttttttddddddddddd

Supporting Amateur Football Since 1991

www.sportscover.comVAFA MAJOR SPONSOR

worldwide sports insurance pty ltd

BROKER FOR THE VAFA

Web: www.wwsi.com.au

SPO

RTS

CO

VER

TM

The Amateur Footballer rd15-16, 2014

Documents

Transcript of The Amateur Footballer rd15-16, 2014