The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment...

66
The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de Producto Genomica

Transcript of The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment...

Page 1: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

The Agilent Technologies

SureSelect™ Platform for Target Enrichment

Focus your next-gen sequencing on DNA that matters

Amparo Dávila.

Especialista de Producto – Genomica

Page 2: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 2

Page 3: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 3

Page 4: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 4

Enriquecimiento dirigido

¿Qué es?

• También conocido como particionamiento genómico, re-secuenciación dirigida, captura del ADN…

• Captura de material genómico de interés para ultra secuenciadores de nueva generación (i.e. Illumina, SOLiD, 454 etc…)

¿Por qué?

• ¡Secuencia solo las regiones de interés!

• Permite la focalización en una parte del genoma

• Ahorro de dinero y tiempo en secuenciación y posterior análisis

• Identifica variantes homocigóticas y heterocigóticas en la

diana relativos a una secuencia genómica de referencia

gDNA

Enriched library

Page 5: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

0.5µg

<3µg

Preparación de la librería• Ilumina SE/PE• SOLiD•Roche

Hibridación/ Captura24 hours

Baits, Anzuelos:

- oligos cRNA

- Longitud (120bp)

- Marcados con Biotin

- Customizado (eArray)

- Síntesis SurePrint

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 5

Separación con beads

Lavado/ Elución / Amplificación

Page 6: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

• Oligos largos que permiten la hibridación con mistmatches

- La mejor representación del balance alélico

- Captura de indels largos

- Capacidad de detectar CNVs

• Híbrido RNA-DNA es más estable que DNA-DNA

• Oligos largos de RNA se unen con mayor afinidad que oligos cortos de DNA

- 24h de hibridación

- Poco input de DNA (< 3 ug)

• Oligos de RNA permiten:

- Exceso molar de la sonda,

- La diana es limitada: mejora la uniformidad de la reacción

• Automatización sencilla: Todos los pasos en manipulación en líquido

• Trabajando en Solución desde el 2006. licencia de Broad

Ventajas del enriquecimiento dirgido de Agilent

Page 7: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Captura dentro del flujo de trabajo de

ultrasecuenciación

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 8: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 8

La plataforma SureSelect™ de Agilent: Opciones diversas

SureSelect Target

Enrichment System*Desarrollado en colaboración

con el Broad Institute

Dr. Chad Nusbaum et al.

SureSelect

DNA Capture ArrayDesarrollado en colaboración

con el Cold Spring Harbor

Dr. Greg Hannon et al.

*Flagship Method

Agilent 60mer Array

1-3 µg gDNA

1-5 µg gDNA

(con WGA)

20 µg gDNA

(sin amplificar)

Page 9: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 9

Productos diferentes para necesidades de projectos

diferentes

SureSelect Target

Enrichment System

SureSelect DNA

Capture Array

Capacidad/Throughput Alta Baja

Tamaño del estudio 10-1,000s muestras 1-10 muestras

DNA de inicio 1-3 µg* 1-20 µg**

Tamaño de la captura del

DNA3.3+ Mb Custom 1+ Mb

*minimum of 500 ng of prepped sample required

**Depends upon use of whole genome amplification.

or

Page 10: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 10

SureSelect™ Target Enrichment System

Flujo de trabajo

Illumina GAIIx

HiSeq 2000

24 hours

0.5µg

<3µg

SOLiD 3

SOLiD 4

5500

454

GS Junior

Page 11: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 11

SureSelect™ Target Enrichment Kit

Con todos los reactivos necesrarios

para la captura con SureSelect

(excepto las beads y Herculase II)

Alta calidad

y producción controlada.

Page 12: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Características y Beneficios de 454 con SureSelect

• Kits totalmente compatibles- con secuenciadores 454 FLX y GS

Junior

• Protocolo simplificado – Protocolo rápido de preparación de

la librería (<3hrs) y el protocolo más rápido de captura

• Escalable y automatizable

• Con requerimientos mínimos de material de partida – 500ng

• Toda la línea de productos SureSelect sondas personalizadas y

de catálogo

• Detección de mutaciones, SNPs, indel, CNVs y fusiones y

traslocaciones

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 12

Page 13: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Eficacia de Agilent SureSelect™ Target Enrichment

Ejemplo de Cobertura

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 14

This plot (generated in the UCSC Genome Browser) shows sequence coverage data for a representative portion of the Agilent SureSelect Target Enrichment demo kit, which covers the RefSeq exons on the non-pseudoautosomalportion of Chromosome X using 2x tiling. In red is the log of the sequence coverage. Bait coordinates are denoted in black and the exons that constitute the target region are in blue. Sequence coverage is higher for those exons that are covered by more than one overlapping bait

269

0

SureSelect Bait Coordinates: Black Bars

2x tiling design approach

Page 14: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas: Secuenciación de exomas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 15

Page 15: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

La captura del Exoma es un método poderoso para el

estudio de enfermedades Mendelianas

• Las enfermedades mendelianas son causadas por mutaciones en regiones

codificantes (con algunas excepciones)

• Los exomas son solo ~1-1.4 % del genoma humano (30-50Mb)

• Principalmente regiones que codifican proteínas

Ventajas:

• Mucho menos que secuenciar

• ~5% del genoma total, es decir 20x más de muestras

Desventajas:

• Perdemos las variaciones no codificantes

¿Para qué?

• Más interpretable

• Más fácil de estudiar

• Adaptado al estudio de enfermedades Mendelianas

• CCDS exons – v1

• CCDS + RefSeq – 44Mb v2 (Broad)

• GENCODE – 50Mb (Sanger)

• Incluye ncRNA

• All Exons on X chromosomes

• 7674 exons

• 3Mb

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 16

Page 16: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Page 17

Kits del Exoma Humano – La cobertura más completa

Diseño original Exome V2 50Mb design

CCDS Sept. 2008

CCDS Sept. 2008 + contenido RefSeq

adicional incluyendo CCDS Sept. 2009 exons

GENCODE and Sanger(incluye contenido de

CCDS y Broad v2)

CCDS (Sept. 2009) 93.76% 99.01% 99.86%

CNV (Mar. 2010) 23.98% 27.49% 30.62%

Ensembl (6/16/2010) 65.58% 71.37% 75.24%

miRNA (miRBase 14) 90.00% 90.00% 92.78%

GenBank (6/16/2010) 75.96% 89.07% 90.74%

RefSeq Genes (6/16/2010) 86.69% 93.29% 96.47%

RefSeq Transcripts (6/16/2010) 88.85% 95.07% 97.50%

Total 37Mb 44Mb 50Mb

Developped with Broad Broad Sanger

• Human All Exon son personalizables (PLUS) con hasta 6.8Mb de contenido adicional• Human All Exon kits son multiplex enSOLiD4 and HiSeq2000

New

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 17: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

All Exon Plus (Añada su contenido personalizado)

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 18

Librería All Exon

+

Su librería customizada

Introduzca sus regiones de interés en eArray

CCDS exons>1000 ncRNAs

38Mb

Sus regiones de interés

¿El kit del Exoma Humano no captura todas sus regiones de interés?

Page 18: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelect Human All Exon 50Mb

• More comprehensive exon capture kit available, approximately 50Mb!

• Developed in collaboration with the Wellcome Trust Sanger Institute

– Developed as part of their participation in the International Cancer Genome Consortium (ICGC)

– To become the standard product used for the ICGC project

• Novel content derived through deep sequencing

– coding exons annotated by the GENCODE project

– CCDS database ~ 99% (Sept 2009)

– RefSeq database ~96% RefSeq Genes, 97% RefSeq Transcripts

• incorporates exonic regions and non-coding RNAs

Page 19: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelect Human All Exon v.2

• New design developed by the Broad Institute based on hg19

• Produced in collaboration with Agilent using SureSelect technology

• Rebalanced blend of current catalog product for improved uniformity and moderately improved coverage

• Serves as base for 50Mb design

• Smaller design requires less sequencing space to achieve same depth as 50Mb design

• Covers 99% of CCDS db (Sept ’09), 93% of RefSeq genes, 95% RefSeq transcripts

Page 20: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Human All Exon 50Mb – 2x76bp, 50-60M HQ reads

Page 21

76.3%

85.1%

96.7%87.9%

77.5%

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

% on target +/-

100bp

Uniformity (3/4 mean with upper

tail):

% bases with 1x

coverage

% bases with 10x coverage

% bases with 20x coverage

Contenido del Exoma Humanomás amplio en el mercado

Diseño de 38Mb = una parte del diseño de 50Mb

Capacidad de secuenciación• 0.5-1 muestra/ lane GAIIx• 1-3 muestra/ lane HiSeq• 5-10 muestra/ slide completaSOLiD4

Química recomendada:• PE 2x76bp Illumina• PE 50+25 SOLiD

Multiplexing:• Illumina• SOLiD

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 21: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Camparación de SNP con HapMap

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 22

99.1% 99.2%98.4% 98.0%

95.7%94.9%

70%

75%

80%

85%

90%

95%

100%

Human All Exon v2 Human All Exon 50Mb

GT is REF GT is variant HOM

GT is variant HET

99.8% 99.7%98.2% 98.1%98.5% 98.3%

99.4% 99.3%

70%

75%

80%

85%

90%

95%

100%

Human All Exon v2 Human All Exon 50Mb

GT is REF GT is variant HOM

GT is variant HET OVERALL

Genotype Concordance vs. HapMapGenotype Sensitivity vs. HapMap

Page 22: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Human All Exon Plus (All Exon + custom content)

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 23

1 tube capture, 1 lane seq. at 2x76bp on GAIIx = ~2Gb

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

Exome +

0.87 Mb

Exome +

1.7 Mb

Exome +

3.4 Mb

Exome +

6.8 Mb

Exome

Control

SNP Analysis vs. HapMap

Sensitivity Concordance

0

5000

10000

15000

20000

25000

30000

35000

Exome +

0.87 Mb

Exome +

1.7 Mb

Exome +

3.4 Mb

Exome +

6.8 Mb

Exome

Control

22394

23224

24337

26352

21976

4480

5528

5816 6

182

5173

No. S

NP

s

SNP Analysis vs. dbSNP

Concordant Novel Mismatched

Page 23: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 24

Captura eficiend de una delección de 5bp deletion

en el Cromosoma X: Menke’s Syndrome

hg18_ChrX_77131408_77131467_+ : Wildtype Bait Design

CTATTGTTTATCAACCTCATCTTATCTCAGTAGAGGAAATGAAAAAGCAGATTGAAGCT

CTATTGTTTATCAACCTCATCTT-----AGTAGAGGAAATGAAAA

ATTGTTTATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAG

TTGTTTATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGC

GTTTATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAG

TATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAGATT

ATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAGATTG

ATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAGATTG

ATCAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAGATTG

CAACCTCATCTT-----AGTAGAGGAAATGAAAAAGCAGATTGAA

CCTCATCTT-----A-TAGAGGAAATGAAAAAGCAGATTGAAGCT

SureSelect™ Target Enrichment Kit Captura Eficiente de una mutación de5 bp

Readout on Illumina GA

Page 24: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Aplicaciones a enfermendaes Mendelianas

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 25

… y muchas más por llegar

Page 25: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

• The Problem: Linkage analysis confirmed family inheritance pattern to a 28 Mb region (build 36)

• >200 genes contained in 28 Mb region; daunting task to sequence and validate all the variants.

• Solution: Identify a 2nd family that manifests the syndrome, determine linkage and perform targeted sequencing using the X-demo kit on heterozygote females of both families

Page 26

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 26: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

• Target : 2.7 Mb; 36 bp SE seq on Illumina GA

• Findings

• Family 1 heterozygote showed a frameshift due to an A insertion in RBM 10 (RNA binding motif 10)

• Family 2 heterozygote showed a G to A substitution in RBM 10 (RNA binding motif 10)

• Both mutations were confirmed by Sanger Sequencing

• Inhibition of the orthologous Rbm 10 expression in developing mouse embryo using anti-sense probes showed patterns that were consistent with observed human malformations

Page 27

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 27: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Publications Citing SureSelect Products

Page 28

• Ovarian Clear Cell Carcinoma (OCCC) is one of the most aggressive types of ovarian cancer and is refractory to standard chemotherapy

• It develops from a common disease progenitor state involving activating mutations in POK3CA and genomic amplification of chr20q13.2

• Solution: Explore the genetic basis of this tumor type by SureSelect exome resequencing of 8 patients

Beyond Mendelian Diseases: Complex diseases

Page 28: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

• Findings:

• 268 somatic mutations identified (13-125 per patient); 88% confirmed by Sanger seq

• Only 4 genes mutated in more than 1 patient: PIK3CA, KRAS, PPP2R1A, ARID1A

• Validation on 34 additional OCCC cases showed 57% with ARID1A mutations and 7.1% with PPP2R1A mutations, both of which may act as “restricted cancer genes” in this specific cancer subtype

• Mutational spectrum includes point mutations and indels, including a 26bp deletion

• ARID1A is likely a tumor suppressor that reg-ulates gene expression via chromatin remodeling

• PPP2R1A is a serine/threonine phosphatase that likely functions as an oncogene

Publications Citing SureSelect Products

Page 29

Jones, S et al., continued

• Tumor cells pre-enriched by immunoprecipitation

25bp deletion

7bp deletion

10bp deletion

11bp deletion

Page 29: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado : Librerías Personalizadas

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 30

Page 30: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Otras aplicaciones de la captura para NGS: Personalización

• Captura cualquier región genómica: intrones, exones, UTRs, elementos reguladores…

• Ideal para el descubrimento de biomarcadores y perfilado(ej. cancer)

• Ideal para seguimiento de SNPs

• Ideal para la caracterización de numerosas muestras de forma focalizada

Características principales:

• Personalización de su captura

• Alta capacidad 12 índices Illumina / hasta 96 muestras por secuenciación

16 SOLiD barcodes / hasta 128 muestras por secuenciación

• Paga solo por aquello que capture, escalabilidad de 0.2 a 6.8Mb

• <0.2 Mb

• 0.2 – 0.5Mb

• 0.5 – 1.5Mb

• Muy reproducible, excelente representación alélica para detección precisa de

heterocigosis

• Personalizado y de catálogo (kinome)

• Automatización (preparación de la librería y captura)

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 31

•1.5 – 3Mb

• 3 – 6Mb

Page 31: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Indexado/Barcoding con SureSelect

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 32

El protocolo es similar para SOLiD(x16 primers)

Illumina / SOLiD primer

SureSelect Pre-Capture

Primer

Prepared Library without Index Tag

2. Pre-Capture PCR

4. Post-Capture PCR

SureSelect Universal Primer

Illumina / SOLiD

Index Primer (Up to 12/16)

3. SureSelect Hibridación/Captura

IndexCaptured

Library with Index Tag

1. Preparación de la librería

• Para funcionamiento óptimo:

• Captura

• Indexado

• Pool

• Sequenciación

• Combina múltiples muestras por

“lane”/cuadrante

• Ahorro en costes con producción

en escala

• Paga solo por lo que capture:

• <0.2Mb 12-16 muestras

• 0.2 – 0.5Mb

• 0.5 – 1.5Mb

• 1.5 – 3Mb 3-4 muestras

• 3 – 6.8Mb

Page 32: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Nivel de Multiplexado posible en illumina GA y SOLiD

Sample Size illumina GA HiSeq 2000 AB SOLiD Octet AB SOLiD Quadrant AB SOLiD Full Flow Cell AB SOLiD Full Run

MP1, <200 Kb targets 12 12 16 16 16 16

MP2, 200 Kb - 499 Kb targets 12 12 16 16 16 16

MP3, 500 Kb - 1.49 Mb targets 12 12 5 10 16 16

MP4, 1.5 Mb - 2.99 Mb targets 12 12 3 7 16 16

MP0, 3.0 Mb - 6.0 Mb targets 8 12 2 3 16 16

Human All Exon 38 Mb 1 4 0 1 3 7

Human All Exon 50 Mb 1 3 0 0 3 5

As of 10/02/10

1. El coste de secuenciación se reduce aproximadamente al inverso del número de muestras que se pueden secuenciara la vez.

Por ejemplo, si una línea en Illumina GA cuesta unos2.000$, al usar una versión MP2 del kit, se pagará unos200$ por muestra, ya que puede secuenciar 10 muestras a la vez.

Page 33: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado : Librerías Personalizadas

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 34

Page 34: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

eArray: la herramienta gratuita para el diseño de las

librerías de SureSelect

Usuario A

Regiones genómicas #1Parámetros de diseño

Regiones genómicas #2Parámetros de diseño

Regiones genómicas #3Parámetros de diseño

Baits #1

Baits #2

Baits #3

Librería deBaits

virutal

Diseño de baits

Diseño de baits

Diseño de baits

Diseñode la librería

Tamañokit

Pedido

eArray Webportal

Usuario B

Libreríafísica de baits de

DNA

Librería de baits de RNA bait

Kit

Envío a StratageneInformación del tamañoKit, etc

Ensamblaje del kit

Envío del Kit al usuario

Pedidolibreria

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 35

Hasta 55,000 baits individuales

Page 35: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

eArray – Especies

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 37

H. sapiens, M. musculus, R. norvegicus, D. melanogaster, C. elegans, C. familiaris, S. cerviseae, S. pombe, G.

gallus, B. taurus, A. thaliana

Page 36: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

eArrayXD – Importa tus propios genomas

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 38

Page 37: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Diseño de librerías en eArray: Qué se quiere cubrir

• Qué regiones cromosómicas

–Es una región contigua–Lista de genes específcos /regiones a cubrir

• Solo los exones. Incluir las UTR

–Si es una región genómica única que incluye intrones, existe la función de Interval Finder en eArray

–Si son solo exones, se puede usar la función Exon Interval Finder en eArray – se incluyen todoslos exones anotados (incluyendo 5’ y 3’ UTRs)

• Se quiereinvestigar regiones de splice

• Se necesitan regiones intrónicas

-Se necesitan evitar regiones específicas

• Durante el tiling de los oligos, por defecto, eArray evita regiones reconocidas por

el RepeatMasker y Tandem Repeats Finder. Si hay otras regiones a evitar a parte de estas se debe utilizar el “Avoid Custom Interval”

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 39

Page 38: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Crear los oligos: usando el wizard

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 40

Page 39: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Crear los oligos: usando el wizard

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 41

Page 40: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Estrategias de diseño: Centrado o Justificado

Page 42

(b) La región de interés es el doble del tamaño del bait

baits

(a) Regiones grandes (ej: de 2x tiling)

(c) La región target region es menor que el anzuelo

Centrado

Región de interés

Justificado

El diseño es el mismo para centrado o justificado

Los baits centrados se extienden más allá de los límites del intervalo, pero cubren uniformemente por toda la regíonLos baits Justificados no pasan de los límites de la región, pero pueden cubrir de forma no uniforme (ej, en la región marcada con un círculo donde hay regiones con 2x y 3x tiling

El diseño es el mismo en centrado o justficado

target region

bait

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 41: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Diseño de los Bait se pueden optimizar

dependiendo de la longitud de lectura del NGS

• Actualmente eArray restringe el tiling a 2x to 5x tiling en secuenciación SE

• Permite End to end tiling (1x) para kit PE y la captura del exoma humano

– Kit de enriquecimento del exoma contiene baits con diseño end to end tiling

– Optimizado para secuenciación con Illumina GA de 75 bp paired-end

55k baits @120bp 6.6Mb

end-to-end para secuenciación de 76bp

55k baits @ 120bp 3.3Mb

2x-tile para secuenciación 36bp

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 42: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

0.2 Mb contenido customizado, Illumina GAII

Covertura

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 44

Page 43: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Comparación con la dbSNP:

Librería de 0.2 MB - 12 índices en una “lane de Illumina

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 45

0

50

100

150

200

250

300

350

Nu

mb

er

of

SN

P s

ite

s

Index Sequences

dbSNP mismatch

Novel sites

dbSNP concordant

Page 44: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Balance de Masas de las muestras indexadas post-captura

Resultados Uniformes en la Representación de las Lecturas

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 46

0.91

1.07

1.00

0.91

1.00

1.320.94

1.00

0.94

1.00

1.23

1.27

0.2 Mb Capture Library (with 12 indexes per lane)

ATCACG CGATGT

TTAGGC TGACCA

ACAGTG GCCAAT

CAGATC ACTTGA

GATCAG TAGCTT

GGCTAC CTTGTA

• Fold-representation of each index is expressed as the number of high quality reads the median across all indexes. • Shown is a typical result of a) 12 indexed samples captured with a 0.2 Mb SureSelect library• Performing individual SureSelect captures for each sample before addition of index tags results in uniform representation and minimizes potential sample competition during hybridization.

Page 45: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

• Mutaciones heredadas con pérdida de función en los genes supresores de tumores BRCA1,

BRCA2, y en otros múltiples genes predisponen a padecer altor riesgo de cáncer de mama y/o

ovario. Las mutaciones heredadas que predisponen a cáncer en estos genes son

colectivamente muy comunes, pero individualmente muy raras.

• Para determinar si la ultra-secuenciación masiva podría permitir la identificación específica,

reproducible y económica de mutaciones de cáncer de mama y de pecho, se desarrolló un

ensayo de captura de secuencia [con Agilent SureSelect] y se detectaron todas las

mutaciones en 21 genes, incluyendo BRCA1 and BRCA2, con mutaciones heredadas que

predisponen al cáncer de mama y de ovario.

• No hubo falsos positivos de mutaciones sin sentido, mutaciones de cambios de lecturas o

reordenamientos genómicos para ninguna de los genes en ninguna de las muestras.

• Esta técnica permite el uso de tests genéticos para analizar personalizadamente el riesgo

a padecer cáncer de mama y ovario

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 47

Page 46: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 48

Excellent allelic balance

Deletion up to 19bp

Page 47: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Fusiones de genes

Problem: Genomic rearrangement in tyrosine kinase genes

• Can lead to deregulation of cellular signaling and cancer

• Identification of novel TK fusions is laborious

• TKs are attractive therapeutic targets

Solution: SureSelect Custom Capture (908 Kb)

• based on known cancer-derived TK fusions

• Designed baits to a conserved GXGXXG motif in 90 TKs + ATK and BRAF

• Regions extended to include preceding exons/introns

• 454 long-read sequencing

11 April, 2011

Page 48: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado : Librerías Personalizadas

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 52

Page 49: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelect “kinome” – Descubrimiento y perfilado de

biomarcadores relacionados con enfermedades y/o

respuesta a fármacos

• 518 posibles kinases

• 12 PI3K genes que contienen el dominio

• 6 PI3K componentes reguladores

• 13 diglicerido kinasas

• 18 genes mutados frencuentemente en cáncer humano

• 19 genes conocidos que se conoce, están mutados en cáncer de mama

G. Manning et al

Science 298 1912

(2002)

Cortesía de Rene BernardsAgilent SureSelect™ Platform

Enabling Products for the Next-Generation Sequencing Workflow

Page 50: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Correlación clínica actual entre alteraciones del

kinoma y respuesta a fármacos

• Expresión de HER2 (mama) Herceptin

• Translocación de BCR-ABL (CML) Gleevec

• Mutación de KRAS (colon) (no respondedor) Cetuximab

• Mutación en EGFR mutation (pulmón) Erlotinib

Quizás más lejano, pero prometedor

• Mutación BRAF (melanoma) PLX4032

• Mutación/translocación de ALK (pulmón, neuroblastoma) PF02341066

• Mutación de PIK3CA (pulmón) (no respondedor) Herceptin

Slide courtesy of Rene BernardsAgilent SureSelect™ Platform

Enabling Products for the Next-Generation Sequencing Workflow

Page 51: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Kinome3-5 muestras en GAIIx lane / SOLID quad

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 57

Page 52: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado : Librerías Personalizadas

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 58

Page 53: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelectTM RNA Target Enrichment

Análisis de grupos de genes de interés, con mediante captura de ARN

- Estudio de rutas metabólicas o bioquímicas o familias de genes en un experimento

- Más económico y rápido: Análisis de másmuestras / carrera (multiplexado y automatización)

- Mayor profundidad de lectura por transcrito

- Menos análisis bioinformático

- Cuantificación de la expresión génica tan sensible como con qPCR

- Descubrimento de splice junctions, fusions, SNPs, expresión alélica

Page 54: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelectTM RNA enrichment: Protocolo

Start with 0.1-0.5ug RNA

Similar process to DNA Target enrichment,

except for the fact that you are working with

a cDNA NGS library

Whole Protocol takes ~ 3-4 days

Protocols available for Illumina and SOLiD,

for individual or multiplexed samples

Page 55: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

New! SureSelectTM RNA Capture

RNA Target Enrichment

FIRST IN CLASS

- Primer kit de captura de RNA del mercado

Kits personalizados y de Catálogo

- Diseño de kits de 200Kb a 3.4Mb utilizando el espacio de RNA Target

en eArray

- RNA Capture Kinome Kit (catálogo) con el mismo contenido que el kit

de captura dedicado a ADN SureSelect

Page 56: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Unenriched Library

Enri

ched L

ibra

ry

Performance of SureSelectTM RNA Target Enrichment

Target Enriched transcripts

Non-Target Unenriched transcripts

Page 57: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

% O

n-T

arg

et

>90% on-target reads, for different sizes of custom designs

Performance of SureSelectTM RNA Target Enrichment

Page 58: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Performance of SureSelectTM RNA Target Enrichment

Even index distribution – perfect for multiplexing

Page 59: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agenda:

• Introducción

• Aplicaciones a la investigación de enfermedades

mendelianas

• Descubrimiento de biomarcadores de manera personalizada y

perfilado : Librerías Personalizadas

• Diseño Customizado mediante eArray

• Aplicaciones para el descubrimiento y perfilado de

biomarcadores en cáncer

• Secuenciación de RNA con SureSelect

• SureSelectXT y Automatización

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 65

Page 60: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent’s SureSelectXT kits

Available Now

Producto paralelo a la oferta de kits SureSelect para multiplexado

– La gama de productos más completa

• Flujos de trabajo validados y optimizados

• De la muestra al secuenciador

– Capacidad de automatización

• Con protocolos optimizados por la unidad de Agilent de Automatización

– La mayor calidad de productos para el descubrimiento y publicaciones

• 17 publicaciones peer-reviewed en 2010

– Flujo continuo de productos innovadores

• Mayor oferta de productos en humano y otras especies

• Amplio avanico de productos de captura de <200Kb to 50Mb+

– Customización por medio de eArray

• Añade librerías personalizadas a cualquier kit

gDNA extraction kit

+ Library Prep kit

+ SureSelect

+ Protocols for automation

+ Sample and Library QC

and quantification

= SureSelectXT

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 61: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

SureSelectXT – Automatización. De la muestra al

secuenciador sin optimización

Genomic DNA

prep

Library prep

(GA, SOLiD)

Bioanalyzer,

qPCR quant

Manual Procedure for small number

of samples

Sequencer

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 62: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Next-Gen Sequencing and SureSelect Overview

Shear

Genomic DNA

Repair Ends

3’-dA Addition

Adapter

Ligation

PCR

Enrichment

Prepped

Library

SureSelect

Oligo Capture

LibraryLibrary

Hybridization

Magnetic

Bead Capture

PCR

QA

Illumina &

SOLiD

Sequence

Library Prep

SureSelect

Target Enrichment

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 69

Page 63: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Next-Gen Sequencing and SureSelect Automation

Shear

Genomic DNA

Repair Ends

3’-dA Addition

Adapter

Ligation

PCR

Enrichment

Prepped

Library

SureSelect

Oligo Capture

LibraryLibrary

Hybridization

Magnetic

Bead Capture

PCR

QA

Illumina &

SOLiD

Sequence

Library Prep

SureSelect

Target Enrichment

Agilent Automation

Bravo Liquid Handler

Automated

Bead Capture

Automated

Purification

Automated

Purification

Automated

Purification

Automated

Purification

Automated

Purification

Automated

Purification

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 70

Page 64: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Automated Library Prep Yields are More Consistent

and Generates Consistent Sequencing Performance

Page 71

0

200

400

600

800

1000

1200

1400

1600

1800

1 2 3 4 5 6 7 8 9 10 11 12

Nan

og

ram

s D

NA

Column Position

Automated Prepped Library Yields

Row H %CV = 11.12%

0

200

400

600

800

1000

1200

1400

1600

1800

Manual 1 Manual 2 Manual 3 Manual 4 Manual 5 Manual 6

Nan

og

ram

s D

NA

Sample Number

Manual Prepped Library Yields

Manual %CV = 18.93%

50%

55%

60%

65%

70%

75%

80%

85%

90%

95%

100%

202 Mb 164 Mb 195 Mb 139 Mb 129 Mb 208 Mbb 143 Mb 229 Mb 158 Mb 236 Mb 175 Mb 146 Mb 124 Mb

H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 Manual

% reads in regions +/- 200bp

% Regions Covered at 1x

% Bases Covered at 10x

% Bases Covered at 20x

Uniformity (1/2 mean with upper tail)

Performance Results of a 1.0 Mb Capture

Total Number of Mapped Bases (Mb)

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

Page 65: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Most Comprehensive, Ever Expanding SureSelectXT Menu

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 72

ProductTarget amount (catalog

number)Reactions/kit Product Definition

X-demo 3.4 Mb 5 Exons in the human X-chr

Human All Exonv2

38 Mb + RefSeq 5-10,000CCDS Sept. 2009

+ additional RefSeq

Human All Exon50Mb

50Mb 5-10,000GENCODE content – Most comprehensive coverage

Multiplexable

Human All ExonPlus

38 Mb + up to 6.8 Mb of custom content

5-10,000Add custom content to All Exon

catalog content

Kinome 3.2Mb 5-10,000 All kinases

Mouse All Exon +40Mb 5-10,000 Mouse Exome

Indexed custom content

<0.2 Mb, 0.2-0.49 Mb, 0.5-1.49 Mb, 1.5- 2.9 Mb 3 – 6.8 Mb

10 – 5,000Cost-saving custom offering –

Illumina (12 indexes) and SOLiD (16 barcodes)

New

New

New

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing Workflow

New

Page 66: The Agilent Technologies · The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Amparo Dávila. Especialista de

Agilent SureSelect™ Platform

Enabling Products for the Next-Generation

Sequencing WorkflowPage 74

Muchas gracias por su atención

¿Preguntas?

[email protected][email protected]